Datasets:

danieladeeko
/

proccessed_ccdv

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 120k rows

article stringlengths 0 682k	abstract stringlengths 146 3.69k
acute myocardial infarction (ami) is a common manifestation of coronary heart disease that affected > 800 000 adults in the united states in 2010.1 concomitant with advances in prehospital and hospital treatment, inhospital survival after ami has dramatically improved.2 many patients are being discharged from the hospital into the community who are at risk for being readmitted to the hospital due to a variety of contributory factors and reasons.3, 4 although not all hospital readmissions can be prevented, excess readmissions within a short time frame can be a marker of poor quality of care and efficiency. since the centers for medicare and medicaid services (cms) began publicly reporting 30day riskstandardized readmission rates for heart failure, ami, and pneumonia as performance measures,5 30day hospital readmission rates have become a quality performance measure for patients hospitalized with ami.5, 6 there has been considerable interest from hospitals and clinicians to better understand and improve modifiable factors associated with 30day hospital readmissions, which are increasingly being linked to hospital reimbursement.7 although several studies have reported 30day rehospitalization rates among patients surviving hospitalization for ami,4, 8, 9 few have examined risk factors for being readmitted to the hospital during the following month by using multivariable regression analyses. moreover, there are little contemporary data that describe longterm trends in 30day rehospitalization rates, the reasons for rehospitalization, as well as sociodemographic, clinical, and treatmentrelated factors that may affect 30day rehospitalization rates among patients surviving an ami. our primary study objective was to describe relatively contemporary decade long (20012011) trends in the frequency of 30day rehospitalizations among patients surviving hospitalization for an ami. our secondary study objective was to describe patient characteristics, clinical factors, and treatment practices associated with an increased risk of 30day rehospitalizations among residents of central massachusetts discharged from the 3 principal medical centers in central massachusetts after an ami. data from the worcester heart attack study were used in this study.10, 11, 12, 13 described elsewhere in detail,10, 11, 12, 13 the worcester heart attack study is an ongoing populationbased investigation examining longterm trends in the descriptive epidemiology of ami in residents of the worcester, ma, metropolitan area (2010 census 518 000) hospitalized at all 16 medical centers in central massachusetts on an approximate biennial basis between 1975 and 2011.10, 11, 12, 13 due to hospital closures, mergers, or conversion to longterm care or rehabilitation facilities, fewer hospitals (n=11) have been providing care to greater worcester residents during recent years. computerized printouts of patients discharged from all greater worcester hospitals with possible ami (international classification of disease, ninth revision [icd ] codes : 410 to 414, 786.5) were identified, and cases of possible ami were independently validated by using predefined criteria for ami.10, 11, 12, 13 these criteria included a suggestive clinical history, increases in several serum biomarkers (eg, creatine kinase [ck ], ckmb, and troponin values), and serial electrocardiographic findings during hospitalization consistent with the presence of ami. patients who satisfied at least 2 of these 3 criteria and were residents of the worcester metropolitan area, because this study is population based, were included. because the focus of the current study was rehospitalization after hospital discharge for ami, we included adult residents of the worcester metropolitan area who survived their index hospitalization for ami in 2001, 2003, 2005, 2007, 2009, and 2011. we further restricted our study population to patients hospitalized at the 3 largest tertiary care and community medical centers in central massachusetts (umassmemorial health care and st. this was done since the majority (90%) of patients hospitalized for ami in central massachusetts were discharged from these facilities, which also have excellent electronic medical records. the patient 's index hospitalization occurred in any of the 3 study hospitals, as did any subsequent rehospitalization. patients who had their index hospitalization or their rehospitalization outside of these major medical centers were not included in this study. this study was approved by the institutional review board at the university of massachusetts medical school and that informed consent was waived. trained nurses and physicians abstracted information on patient demographic characteristics, medical history, clinical data, and treatment practices through the review of hospital medical records. these factors included patient 's sociodemographic characteristics (eg, age, sex, race, marital status), year of hospitalization, hospital length of stay, history of previously diagnosed comorbidities (eg, stroke, diabetes, heart failure), ami order (initial versus prior) and ami type (stsegment elevation myocardial infarction [stemi ] versus nonstemi [nstemi]).14, 15 information on the development of important inhospital complications including atrial fibrillation,16 cardiogenic shock,17 heart failure,18 and stroke19 was also collected. data on the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures (cardiac catheterization, percutaneous coronary intervention [pci ], and coronary artery bypass grafting [cabg ]) during hospitalization, and pharmacotherapies at the time of hospital discharge, including the prescribing of 4 effective cardiac medications (angiotensin converting inhibitors [aceis]/angiotensin type ii receptor blockers [arbs ], aspirin, blockers, and lipidlowering agents), were obtained. a rehospitalization was defined as the patient 's first admission to a study hospital within 30 days of discharge after their index hospitalization for ami during the years under study. two of the study investigators adjudicated whether the principal reason for readmission was due to either an ami, cardiovascular disease (cvd) (excluding ami)related, or non cvdrelated readmission based on the review of information contained in hospital medical records. indications for cvdrelated hospitalizations included unstable angina, heart failure, type ii diabetes mellitus, and chronic ischemic heart disease. for ease of analysis and interpretation, we aggregated the 6 individual study years into 2year strata of 20012003 (earliest), 20052007 (middle), and 20092011 (most recent) for purposes of examining trends in our principal study outcomes. differences in the distribution of various patient demographic and clinical characteristics between patients hospitalized during the 3 aggregated periods were examined using the anova test for continuous variables and the test for categorical variables. the cochranarmitage tests and linear regression models were used to assess for linear trends over time among categorical and continuous variables, respectively. shortterm rehospitalization rates were examined by calculating the frequency of having a first rehospitalization within 30 days among patients discharged from the hospital after their index ami during the years under study. we examined the reasons for being rehospitalized during this period and calculated the causespecific 30day rehospitalization rates. multivariableadjusted logistic regression analyses were performed to examine the association between the main explanatory variable of period of hospitalization (20012003, earliest ; 20052007, middle ; and 20092011, most recent) and the outcome of whether the patient was rehospitalized during the following 30 days while adjusting for several potentially confounding variables of prognostic importance. we dummy coded the variable of time period of hospitalization with the earliest period (20012003) serving as the reference group. several covariates associated with rehospitalization after ami in prior studies3, 4 were examined including age, sex, race (white versus nonwhite), marital status (married versus not married), ami order (initial versus prior), ami type (stemi versus nstemi), previously diagnosed comorbid conditions (angina, atrial fibrillation, heart failure, hypertension, peripheral vascular disease, stroke, diabetes, chronic obstructive pulmonary disease, depression, and chronic kidney disease), hospital clinical complications (atrial fibrillation, heart failure, cardiogenic shock, and stroke), and hospital length of stay. we further adjusted for hospital treatment practices, including the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures (cardiac catheterization, pci, and cabg), and the prescribing of 4 guideline recommended cardiac medications (aceis / arbs, aspirin, blockers, and lipidlowering agents) at the time of hospital discharge during the patient 's index hospitalization in our regression analyses to examine the potential effects of hospital treatment practices on 30day rehospitalization trends. we repeated the same analyses after excluding patients (n=165) who were not rehospitalized but died within the 30day postdischarge period. in addition, we repeated the same analyses by treating patients who were not rehospitalized but died within the 30day postdischarge period as those who had a 30day readmission. the results of our logistic regression analyses were presented as multivariableadjusted odds ratios (or) and accompanying 95% cis, which were calculated based on standard errors clustered at the hospital level to account for potential withinhospital correlation with variance adjustment through the use of morel 's small sample bias correction.20 all statistical analyses were conducted by using sas version 9.3 (sas institute, inc). trained nurses and physicians abstracted information on patient demographic characteristics, medical history, clinical data, and treatment practices through the review of hospital medical records. these factors included patient 's sociodemographic characteristics (eg, age, sex, race, marital status), year of hospitalization, hospital length of stay, history of previously diagnosed comorbidities (eg, stroke, diabetes, heart failure), ami order (initial versus prior) and ami type (stsegment elevation myocardial infarction [stemi ] versus nonstemi [nstemi]).14, 15 information on the development of important inhospital complications including atrial fibrillation,16 cardiogenic shock,17 heart failure,18 and stroke19 was also collected. data on the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures (cardiac catheterization, percutaneous coronary intervention [pci ], and coronary artery bypass grafting [cabg ]) during hospitalization, and pharmacotherapies at the time of hospital discharge, including the prescribing of 4 effective cardiac medications (angiotensin converting inhibitors [aceis]/angiotensin type ii receptor blockers [arbs ], aspirin, blockers, and lipidlowering agents), were obtained. a rehospitalization was defined as the patient 's first admission to a study hospital within 30 days of discharge after their index hospitalization for ami during the years under study. two of the study investigators adjudicated whether the principal reason for readmission was due to either an ami, cardiovascular disease (cvd) (excluding ami)related, or non cvdrelated readmission based on the review of information contained in hospital medical records. indications for cvdrelated hospitalizations included unstable angina, heart failure, type ii diabetes mellitus, and chronic ischemic heart disease. for ease of analysis and interpretation, we aggregated the 6 individual study years into 2year strata of 20012003 (earliest), 20052007 (middle), and 20092011 (most recent) for purposes of examining trends in our principal study outcomes. differences in the distribution of various patient demographic and clinical characteristics between patients hospitalized during the 3 aggregated periods were examined using the anova test for continuous variables and the test for categorical variables. the cochranarmitage tests and linear regression models were used to assess for linear trends over time among categorical and continuous variables, respectively. shortterm rehospitalization rates were examined by calculating the frequency of having a first rehospitalization within 30 days among patients discharged from the hospital after their index ami during the years under study. we examined the reasons for being rehospitalized during this period and calculated the causespecific 30day rehospitalization rates. multivariableadjusted logistic regression analyses were performed to examine the association between the main explanatory variable of period of hospitalization (20012003, earliest ; 20052007, middle ; and 20092011, most recent) and the outcome of whether the patient was rehospitalized during the following 30 days while adjusting for several potentially confounding variables of prognostic importance. we dummy coded the variable of time period of hospitalization with the earliest period (20012003) serving as the reference group. several covariates associated with rehospitalization after ami in prior studies3, 4 were examined including age, sex, race (white versus nonwhite), marital status (married versus not married), ami order (initial versus prior), ami type (stemi versus nstemi), previously diagnosed comorbid conditions (angina, atrial fibrillation, heart failure, hypertension, peripheral vascular disease, stroke, diabetes, chronic obstructive pulmonary disease, depression, and chronic kidney disease), hospital clinical complications (atrial fibrillation, heart failure, cardiogenic shock, and stroke), and hospital length of stay. we further adjusted for hospital treatment practices, including the receipt of thrombolytic therapy and 3 coronary diagnostic and interventional procedures (cardiac catheterization, pci, and cabg), and the prescribing of 4 guideline recommended cardiac medications (aceis / arbs, aspirin, blockers, and lipidlowering agents) at the time of hospital discharge during the patient 's index hospitalization in our regression analyses to examine the potential effects of hospital treatment practices on 30day rehospitalization trends. we repeated the same analyses after excluding patients (n=165) who were not rehospitalized but died within the 30day postdischarge period. in addition, we repeated the same analyses by treating patients who were not rehospitalized but died within the 30day postdischarge period as those who had a 30day readmission. the results of our logistic regression analyses were presented as multivariableadjusted odds ratios (or) and accompanying 95% cis, which were calculated based on standard errors clustered at the hospital level to account for potential withinhospital correlation with variance adjustment through the use of morel 's small sample bias correction.20 all statistical analyses were conducted by using sas version 9.3 (sas institute, inc). the study population consisted of 4810 adult residents of the worcester metropolitan area who survived their hospitalization for ami at the 3 major central massachusetts medical centers between 2001 and 2011 (table 1). overall, the average age of this population was 68.9 years, 41.8% were women, 92.4% were white, and 54.6% were married. characteristics of patients who survived an ami : worcester heart attack study, 20012011 ami indicates acute myocardial infarction. pvalues derived from anova tests for continuous variables and tests for categorical variables. p values derived from cochranarmitage tests for categorical variables and linear regression models for continuous variables. during the most recent years under study, patients who survived their ami were more likely to be younger and have a history of hypertension, peripheral vascular disease, diabetes, or chronic kidney disease than were patients who were hospitalized during earlier study periods (table 1). between 2001 and 2011, 32.6% of our study sample was diagnosed with a stemi, which declined from 34.0% in 20012003 to 31.1% in 20092011. the average hospital length of stay in this study population was 5.5 days, which declined from 6.4 days in 20012003 to 4.7 days in 20092011 (table 1). in addition, the likelihood of developing cardiogenic shock and stroke during hospitalization remained relatively low (3.5% and 1.4% overall, respectively), whereas the incidence rates of inhospital heart failure and atrial fibrillation were considerably higher (34.4% and 18.8% overall, respectively) during the years under study (table 1). the average postdischarge 30day rehospitalization rates decreased from 20012003 (20.5%) to 20092011 (15.8%) (p for trend=0.001) (table 2). the proportion of patients who were rehospitalized was the highest (6.6%) during the first week (0 to 7 days) after hospital discharge and continued to decrease as the length of postdischarge time increased (figure 1). rehospitalizations that occurred during the first week after hospital discharge accounted for 35.6% of all 30day rehospitalizations ; this proportion decreased from 39.2% in 20012003 to 27.2% in 20092011. association between time period of hospitalization and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study, 20012011 (n=4810) acei indicates angiotensinconverting inhibitors ; ami, acute myocardial infarction ; arbs, angiotensin type ii receptor blockers ; cabg, coronary artery bypass grafting ; or, odds ratio ; pci, percutaneous coronary intervention. adjusted for age, sex, race, marital status, and previously diagnosed comorbid conditions. adjusted for sociodemographic characteristics, comorbid conditions, ami order, ami type, inhospital complications, and hospital length of stay. adjusted for sociodemographic characteristics, comorbid conditions, inhospital factors, and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures (cardiac catheterization, pci, and cabg) and prescribing of 4 guidelinerecommended cardiac medications (aceis / arbs, lipidlowering agents, blockers, and aspirin) at the time of hospital discharge. rates of rehospitalizations within 30 days after hospital discharge among patients who survived an acute myocardial infarction : worcester heart attack study, 20012011 (n=4810). in examining the specific causes of 30day rehospitalizations, 53.9% were cvd related (excluding ami), 38.1% were non cvd related, and 8.0% were due to a recurrent ami during the years under study. the overall causespecific 30day rehospitalization rates due to cvd, noncvd, and ami were 10.0%, 7.0%, and 1.5%, respectively, during the years under study (figure 2). cvdrelated reasons decreased (p for trend < 0.001) during the years under study, while no significant changing trends in 30day rehospitalization rates due to cvd (excluding ami) or ami were observed (figure 2). causespecific 30day rehospitalization rates after hospital discharge among patients who survived an ami : worcester heart attack study, 20012011 (n=4810). ami indicates acute myocardial infarction ; cvd, cardiovascular diseases exclude ami. in examining changing trends in 30day rehospitalizations after adjusting for several demographic characteristics, comorbidities, and inhospital clinical factors, there was no significant difference in the odds of having a 30day rehospitalization in 20052007 (or 0.88, 95% ci 0.74 to 1.04), but there was a reduced odds of being rehospitalized during the subsequent 30 days (or 0.74, 95% ci 0.61 to 0.91) among patients who survived an ami in 20092011, in comparison with those discharged in 20012003 (table 2). after further adjustment for medical procedures and treatments received during hospitalization, there was a significantly reduced odds of being rehospitalized during the subsequent 30 days (or 0.78, 95% ci 0.65 to 0.93) in 20092011 compared with those discharged from the hospital in 20012003 (table 2). we observed similar results after excluding patients who were not rehospitalized but died during the 30day postdischarge period. we also observed similar results when we analyzed these patients as those who had a 30day hospital readmission. using multivariableadjusted regression analyses, we examined the role of various prognostic factors associated with 30day rehospitalizations in all study patients (table 3). female sex, having previously diagnosed heart failure and chronic kidney disease, and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized for any reason within 30 days after hospital discharge. on the other hand, patients who received various coronary diagnostic and interventional procedures (cardiac catheterization and pci and/or cabg) had a reduced odds for being rehospitalized within 30 days after hospital discharge compared with those who did not undergo these procedures (table 3). we observed similar factors that were significantly associated with 30day rehospitalizations after excluding patients who were not rehospitalized but died during the 30day postdischarge period. we also observed similar factors associated with hospital readmission when we analyzed these patients as having had a 30day hospital readmission. association between various prognostic factors and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study, 20012011 (n=4810) acei indicates angiotensinconverting inhibitor ; ami, acute myocardial infarction ; arb, angiotensin type ii receptor blocker ; cabg, coronary artery bypass grafting ; or, odds ratios ; pci, percutaneous coronary intervention. adjusted for study period, sociodemographic characteristics, and comorbidities. adjusted for study period, sociodemographic characteristics, comorbid conditions, ami order, ami type, inhospital clinical complications, and hospital length of stay. adjusted for study period, sociodemographic characteristics, comorbid conditions, inhospital factors, and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures (cardiac catheterization, pci, and cabg) and prescribing of 4 guidelinerecommended cardiac medications (aceis / arbs, lipidlowering agents, blockers, and aspirin) at the time of hospital discharge. the study population consisted of 4810 adult residents of the worcester metropolitan area who survived their hospitalization for ami at the 3 major central massachusetts medical centers between 2001 and 2011 (table 1). overall, the average age of this population was 68.9 years, 41.8% were women, 92.4% were white, and 54.6% were married. characteristics of patients who survived an ami : worcester heart attack study, 20012011 ami indicates acute myocardial infarction. pvalues derived from anova tests for continuous variables and tests for categorical variables. p values derived from cochranarmitage tests for categorical variables and linear regression models for continuous variables. during the most recent years under study, patients who survived their ami were more likely to be younger and have a history of hypertension, peripheral vascular disease, diabetes, or chronic kidney disease than were patients who were hospitalized during earlier study periods (table 1). between 2001 and 2011, 32.6% of our study sample was diagnosed with a stemi, which declined from 34.0% in 20012003 to 31.1% in 20092011. the average hospital length of stay in this study population was 5.5 days, which declined from 6.4 days in 20012003 to 4.7 days in 20092011 (table 1). in addition, the likelihood of developing cardiogenic shock and stroke during hospitalization remained relatively low (3.5% and 1.4% overall, respectively), whereas the incidence rates of inhospital heart failure and atrial fibrillation were considerably higher (34.4% and 18.8% overall, respectively) during the years under study (table 1). the average postdischarge 30day rehospitalization rates decreased from 20012003 (20.5%) to 20092011 (15.8%) (p for trend=0.001) (table 2). the proportion of patients who were rehospitalized was the highest (6.6%) during the first week (0 to 7 days) after hospital discharge and continued to decrease as the length of postdischarge time increased (figure 1). rehospitalizations that occurred during the first week after hospital discharge accounted for 35.6% of all 30day rehospitalizations ; this proportion decreased from 39.2% in 20012003 to 27.2% in 20092011. association between time period of hospitalization and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study, 20012011 (n=4810) acei indicates angiotensinconverting inhibitors ; ami, acute myocardial infarction ; arbs, angiotensin type ii receptor blockers ; cabg, coronary artery bypass grafting ; or, odds ratio ; pci, percutaneous coronary intervention. adjusted for age, sex, race, marital status, and previously diagnosed comorbid conditions. adjusted for sociodemographic characteristics, comorbid conditions, ami order, ami type, inhospital complications, and hospital length of stay. adjusted for sociodemographic characteristics, comorbid conditions, inhospital factors, and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures (cardiac catheterization, pci, and cabg) and prescribing of 4 guidelinerecommended cardiac medications (aceis / arbs, lipidlowering agents, blockers, and aspirin) at the time of hospital discharge. rates of rehospitalizations within 30 days after hospital discharge among patients who survived an acute myocardial infarction : worcester heart attack study, 20012011 (n=4810). in examining the specific causes of 30day rehospitalizations, 53.9% were cvd related (excluding ami) cvd related, and 8.0% were due to a recurrent ami during the years under study. the overall causespecific 30day rehospitalization rates due to cvd, noncvd, and ami were 10.0%, 7.0%, and 1.5%, respectively, during the years under study (figure 2). the average postdischarge 30day rehospitalization rates due to non cvdrelated reasons decreased (p for trend < 0.001) during the years under study, while no significant changing trends in 30day rehospitalization rates due to cvd (excluding ami) or ami were observed (figure 2). causespecific 30day rehospitalization rates after hospital discharge among patients who survived an ami : worcester heart attack study, 20012011 (n=4810). ami indicates acute myocardial infarction ; cvd, cardiovascular diseases exclude ami. in examining changing trends in 30day rehospitalizations after adjusting for several demographic characteristics, comorbidities, and inhospital clinical factors, there was no significant difference in the odds of having a 30day rehospitalization in 20052007 (or 0.88, 95% ci 0.74 to 1.04), but there was a reduced odds of being rehospitalized during the subsequent 30 days (or 0.74, 95% ci 0.61 to 0.91) among patients who survived an ami in 20092011, in comparison with those discharged in 20012003 (table 2). after further adjustment for medical procedures and treatments received during hospitalization, there was a significantly reduced odds of being rehospitalized during the subsequent 30 days (or 0.78, 95% ci 0.65 to 0.93) in 20092011 compared with those discharged from the hospital in 20012003 (table 2). we observed similar results after excluding patients who were not rehospitalized but died during the 30day postdischarge period. we also observed similar results when we analyzed these patients as those who had a 30day hospital readmission. using multivariableadjusted regression analyses, we examined the role of various prognostic factors associated with 30day rehospitalizations in all study patients (table 3). female sex, having previously diagnosed heart failure and chronic kidney disease, and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized for any reason within 30 days after hospital discharge. on the other hand, patients who received various coronary diagnostic and interventional procedures (cardiac catheterization and pci and/or cabg) had a reduced odds for being rehospitalized within 30 days after hospital discharge compared with those who did not undergo these procedures (table 3). we observed similar factors that were significantly associated with 30day rehospitalizations after excluding patients who were not rehospitalized but died during the 30day postdischarge period. we also observed similar factors associated with hospital readmission when we analyzed these patients as having had a 30day hospital readmission. association between various prognostic factors and 30day allcause rehospitalizations among patients who survived an ami : worcester heart attack study, 20012011 (n=4810) acei indicates angiotensinconverting inhibitor ; ami, acute myocardial infarction ; arb, angiotensin type ii receptor blocker ; cabg, coronary artery bypass grafting ; or, odds ratios ; pci, percutaneous coronary intervention. adjusted for study period, sociodemographic characteristics, and comorbidities. adjusted for study period, sociodemographic characteristics, comorbid conditions, ami order, ami type, inhospital clinical complications, and hospital length of stay. adjusted for study period, sociodemographic characteristics, comorbid conditions, inhospital factors, and inhospital management as represented by thrombolytic therapy and receipt of 3 coronary interventional procedures (cardiac catheterization, pci, and cabg) and prescribing of 4 guidelinerecommended cardiac medications (aceis / arbs, lipidlowering agents, blockers, and aspirin) at the time of hospital discharge. the results of this large observational study suggest that, among greater worcester residents who survived their hospitalization for an ami at the major medical centers in central massachusetts between 2001 and 2011, nearly 1 in 5 patients remained at risk for being rehospitalized within 30 days and 36% of all 30day rehospitalizations occurred during the first week after hospital discharge during the years under study. our findings suggest a decline in the odds of being rehospitalized during the first 30 days after hospital discharge in the most recent years under study, though this odds was slightly attenuated after further adjustment for hospital treatment practices. in addition, we identified several demographic and clinical factors associated with an increased odds for being rehospitalized during the first month after hospital discharge for ami. reducing hospital readmissions is a national priority to improve the quality of patient care and lower health care spending.5, 7, 21 this is because excess hospital readmissions indicate potentially poor health care quality or inadequate coordination of postdischarge care, represent a significant burden to both patients and the health care system, and are costly.5, 7, 21 several prior studies have examined the frequency of 30day rehospitalizations after ami.4, 8, 9 between 2007 and 2009, nearly 1 in every 5 medicare feeforservice patients discharged from all acute care hospitals in the united states after an ami was readmitted within 30 days after hospital discharge.8 in a recent study that used an allpayer administrative data set from california, which consisted of 107 256 hospitalizations for ami among adults younger than 65 years between 2007 and 2009, the 30day rehospitalization rate was 15%.9 a retrospective cohort study conducted in 3 hospitals in olmsted county, mn, during 19872010 found that the 30day readmission rates among adult patients who survived their hospitalization for a first ami were 23% during 19871992, 22% during 19932004, and 19% during the most recent period under study (20052010).4 in our study, we found similar results in that nearly onefifth of adult greater worcester residents who survived their hospitalization for an ami on a biennial basis between 2001 and 2011 were readmitted to the hospital within 30 days after hospital discharge. in addition, our study observed an encouraging decline in the odds of having a 30day rehospitalization during the most recent years (20092011) under study after adjustment for several potentially confounding variables of prognostic importance. since june 2009, the cms began publicly reporting 30day riskstandardized readmission rates for ami as one of the major hospital performance measures.5 further, the patient protection affordable care act of 2010, through the establishment of the medicare hospital readmissions reduction program, has created new payment penalties (effective october 1, 2012) to reduce readmissions because hospitals with excess readmissions can lose up to 3% of their medicare reimbursement by 2015.7 although some early evidence suggests that the medicare hospital readmissions reduction program has had a positive impact on reducing the rates of 30day rehospitalization among medicare beneficiaries,22 there remains no clear consensus on how many hospital readmissions may in all actuality be preventable. moreover, there are also concerns about potential flaws in the methodology for determining excess readmissions and computation of the penalty to hospitals.21 thus, it remains of considerable public health and clinical importance to continue monitoring contemporary trends in 30day rehospitalization rates after ami given ongoing refinement of the methodological approach by the cms to predict the risk of hospital readmissions according to various patient, provider, and health systems characteristics. with regard to the timing of hospital readmissions, a recent study that analyzed medicare feeforservice claims data (20072009) on 30day readmissions after hospitalization for ami showed that 40% of all 30day readmissions occurred during the first week after hospital discharge.8 another recent study using 20072009 administrative data from the state of california found that 19% of readmissions occurred within 0 to 3 days, and 21% occurred during 4 to 7 days, after hospital discharge for ami.9 similar to these results, our study found that 36% of all 30day rehospitalizations occurred during the first week after hospital discharge for ami. these findings suggest that proper arrangement of transitional care and continuing followup with patients during the first several days to first week post hospital discharge can be beneficial in reducing hospital readmission rates within 30 days among these patients. encouragingly, we also observed a decline in the proportion of patients who were readmitted during this particularly highrisk period during the years under study, which may suggest that efforts at reducing hospital readmissions may be paying dividends in reducing shortterm hospital readmissions. while we did not have specific information available to more fully describe and characterize any efforts that were being carried out at participating study hospitals to reduce their hospital readmission rates for patients discharged after an ami, moreaggressive systemwide efforts were being put in place in 2011 at umassmemorial health care to systematically measure and reduce the rates of hospital readmissions at these 2 medical centers. a retrospective cohort study of adult patients in olmsted county, mn,4 who were discharged from the hospital after a first ami found that 43% of 30day rehospitalizations after ami were related to the incident ami, 30% were unrelated, and 27% had an unclear relationship. the investigators also reported that about 8% of all 30day rehospitalizations were due to a recurrent ami.4 a recent study of medicare feeforservice beneficiaries hospitalized for ami at all acute care hospitals in the united states between 2007 and 2009 showed that 10% of patients were readmitted for the same condition after their index ami hospitalization.8 we observed similar results in that 8% of all 30day rehospitalizations were due to ami, and a significant proportion (38%) of all 30day rehospitalizations were non cvd related. as the prevalence of comorbid conditions and aging of the american population increase over time, and efforts continue to be focused on the enhanced use of effective secondary prevention strategies to improve the postdischarge outcomes of patients with ami, 30day rehospitalizations after ami due to noncvd causes require further attention. indeed, declining lengths of hospital stay, number and complexities of evidencebased medications, older age of this patient population, increased use of observation units, and primary focus on the patient 's underlying heart condition, but not on other important comorbidities these patients have been previously diagnosed with, may have in part contributed to the high rate of non recent research has also suggested that patients discharged from the hospital may be vulnerable to posthospitalization syndrome, which puts them at risk for rehospitalization for conditions unrelated to their initial hospitalization.23 further research is needed to confirm the association between this syndrome and other hospital and postdischarge factors that may place patients at risk for non cvdrelated hospital readmissions and identify effective strategies for reducing readmissions. although efforts remain ongoing to find strategies that hospitals can use to prevent many readmissions, there is an ongoing debate on whether the hospital is the appropriate entity to be held accountable for all shortterm readmissions, particularly when many of the events and circumstances that are associated with readmission may take place outside of the hospital setting and after the administration of effective acute care. these factors include patients lifestyle behaviors and practices ; employment, marital, and financial status ; adherence to discharge instructions and medications ; and the availability and quality of postdischarge care. thus, reducing the frequency of hospital readmissions requires considerable collaborations, not only from hospitals but also from patients and their caregivers and other community professionals and providers across the continuum of health. due to ongoing and planned changes in national reimbursement policies,7 there has been great interest from health care providers to better understand and improve modifiable factors associated with 30day rehospitalizations. a recent study in olmsted county, mn, examined factors associated with 30day rehospitalizations after an incident ami.4 the investigators found that certain comorbid conditions, a longer hospital stay, and complications of coronary angiography and revascularization or reperfusion were associated with an increased risk of being rehospitalized.4 our study observed that patients with a history of previously diagnosed heart failure and chronic kidney disease and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized during the first month after hospital discharge for ami. although most of these factors are not modifiable, these findings suggest that health care providers should pay extra attention to these highrisk groups of vulnerable patients to prevent potential early readmissions when planning hospital discharge and postdischarge management. future studies examining the postdischarge transitions of care in higherrisk patients, including those with multiple comorbid conditions and hospital clinical complications, remain needed to achieve greater declines in 30day rehospitalizations in this patient population. despite the potential for confounding by indication given the nonrandomized nature of the present investigation, our multivariable regression analyses adjusting for the use of various hospital treatment practices showed that the use of invasive coronary interventions was associated with a reduced odds of being rehospitalized among patients hospitalized with ami during the decadelong period under study. furthermore, encouraging declines in 30 day rehospitalizations during the years under study were slightly attenuated after adjustment for hospital treatment practices, suggesting the beneficial effects of various cardiac treatment practices on 30day readmission rates. a recent study examining 30day rehospitalizations after an acute coronary syndrome among 5219 patients enrolled in the australian and new zealand populations of the global registry of acute coronary events (grace) between 1999 and 2007 also observed similar results in that coronary revascularization during the acute hospital stay was associated with a reduced odds of being rehospitalized during the next month.24 the strengths of the present study include its large population of residents of all ages and both sexes from a major central massachusetts metropolitan area who were hospitalized with a confirmed ami and examination of relatively contemporary decadelong trends in 30day rehospitalization rates among hospital survivors of an ami. several limitations need to be acknowledged, however, in the interpretation of the present findings. because our study population included only patients who had been hospitalized and discharged at 3 central massachusetts medical centers, one needs to be careful in extrapolating our findings to those who reside in other geographic areas. if a rehospitalization occurred outside of the worcester metropolitan area or at other medical centers in central massachusetts, it was not captured, although it is expected that this number would be quite small and unlikely to have changed during the years under study. this is because most patients typically return to their hospital of admission and the large tertiary care and community hospitals included in the present investigation capture the vast majority of hospitalizations that occur among residents of the worcester metropolitan area. because study patients were predominantly white, the generalizability of our findings to other race / ethnicity groups may be limited. there is also the potential for unmeasured confounding in our observed associations because we did not have information available on several patientassociated characteristics, such as income, education, psychosocial factors, and treatment preference, that may have affected the end points examined. we were unable to collect information on other factors that have been shown to affect 30day rehospitalization after ami, including transitions of care and patients adherence to various postdischarge treatment regimens. finally, although our study observed an encouraging decline in 30day rehospitalizations during the most recent years (20092011) under study, future studies remain warranted to continue monitoring changes in 30day rehospitalization rates after the implementation of financial penalties to hospitals due to excess readmissions in 2012.7 reducing hospital readmissions is a national priority to improve the quality of patient care and lower health care spending.5, 7, 21 this is because excess hospital readmissions indicate potentially poor health care quality or inadequate coordination of postdischarge care, represent a significant burden to both patients and the health care system, and are costly.5, 7, 21 several prior studies have examined the frequency of 30day rehospitalizations after ami.4, 8, 9 between 2007 and 2009, nearly 1 in every 5 medicare feeforservice patients discharged from all acute care hospitals in the united states after an ami was readmitted within 30 days after hospital discharge.8 in a recent study that used an allpayer administrative data set from california, which consisted of 107 256 hospitalizations for ami among adults younger than 65 years between 2007 and 2009, the 30day rehospitalization rate was 15%.9 a retrospective cohort study conducted in 3 hospitals in olmsted county, mn, during 19872010 found that the 30day readmission rates among adult patients who survived their hospitalization for a first ami were 23% during 19871992, 22% during 19932004, and 19% during the most recent period under study (20052010).4 in our study, we found similar results in that nearly onefifth of adult greater worcester residents who survived their hospitalization for an ami on a biennial basis between 2001 and 2011 were readmitted to the hospital within 30 days after hospital discharge. in addition, our study observed an encouraging decline in the odds of having a 30day rehospitalization during the most recent years (20092011) under study after adjustment for several potentially confounding variables of prognostic importance. since june 2009, the cms began publicly reporting 30day riskstandardized readmission rates for ami as one of the major hospital performance measures.5 further, the patient protection affordable care act of 2010, through the establishment of the medicare hospital readmissions reduction program, has created new payment penalties (effective october 1, 2012) to reduce readmissions because hospitals with excess readmissions can lose up to 3% of their medicare reimbursement by 2015.7 although some early evidence suggests that the medicare hospital readmissions reduction program has had a positive impact on reducing the rates of 30day rehospitalization among medicare beneficiaries,22 there remains no clear consensus on how many hospital readmissions may in all actuality be preventable. moreover, there are also concerns about potential flaws in the methodology for determining excess readmissions and computation of the penalty to hospitals.21 thus, it remains of considerable public health and clinical importance to continue monitoring contemporary trends in 30day rehospitalization rates after ami given ongoing refinement of the methodological approach by the cms to predict the risk of hospital readmissions according to various patient, provider, and health systems characteristics. with regard to the timing of hospital readmissions, a recent study that analyzed medicare feeforservice claims data (20072009) on 30day readmissions after hospitalization for ami showed that 40% of all 30day readmissions occurred during the first week after hospital discharge.8 another recent study using 20072009 administrative data from the state of california found that 19% of readmissions occurred within 0 to 3 days, and 21% occurred during 4 to 7 days, after hospital discharge for ami.9 similar to these results, our study found that 36% of all 30day rehospitalizations occurred during the first week after hospital discharge for ami. these findings suggest that proper arrangement of transitional care and continuing followup with patients during the first several days to first week post hospital discharge can be beneficial in reducing hospital readmission rates within 30 days among these patients. encouragingly, we also observed a decline in the proportion of patients who were readmitted during this particularly highrisk period during the years under study, which may suggest that efforts at reducing hospital readmissions may be paying dividends in reducing shortterm hospital readmissions. while we did not have specific information available to more fully describe and characterize any efforts that were being carried out at participating study hospitals to reduce their hospital readmission rates for patients discharged after an ami, moreaggressive systemwide efforts were being put in place in 2011 at umassmemorial health care to systematically measure and reduce the rates of hospital readmissions at these 2 medical centers. a retrospective cohort study of adult patients in olmsted county, mn,4 who were discharged from the hospital after a first ami found that 43% of 30day rehospitalizations after ami were related to the incident ami, 30% were unrelated, and 27% had an unclear relationship. the investigators also reported that about 8% of all 30day rehospitalizations were due to a recurrent ami.4 a recent study of medicare feeforservice beneficiaries hospitalized for ami at all acute care hospitals in the united states between 2007 and 2009 showed that 10% of patients were readmitted for the same condition after their index ami hospitalization.8 we observed similar results in that 8% of all 30day rehospitalizations were due to ami, and a significant proportion (38%) of all 30day rehospitalizations were non cvd related. as the prevalence of comorbid conditions and aging of the american population increase over time, and efforts continue to be focused on the enhanced use of effective secondary prevention strategies to improve the postdischarge outcomes of patients with ami, 30day rehospitalizations after ami due to noncvd causes require further attention. indeed, declining lengths of hospital stay, number and complexities of evidencebased medications, older age of this patient population, increased use of observation units, and primary focus on the patient 's underlying heart condition, but not on other important comorbidities these patients have been previously diagnosed with, may have in part contributed to the high rate of non recent research has also suggested that patients discharged from the hospital may be vulnerable to posthospitalization syndrome, which puts them at risk for rehospitalization for conditions unrelated to their initial hospitalization.23 further research is needed to confirm the association between this syndrome and other hospital and postdischarge factors that may place patients at risk for non cvdrelated hospital readmissions and identify effective strategies for reducing readmissions. although efforts remain ongoing to find strategies that hospitals can use to prevent many readmissions, there is an ongoing debate on whether the hospital is the appropriate entity to be held accountable for all shortterm readmissions, particularly when many of the events and circumstances that are associated with readmission may take place outside of the hospital setting and after the administration of effective acute care. these factors include patients lifestyle behaviors and practices ; employment, marital, and financial status ; adherence to discharge instructions and medications ; and the availability and quality of postdischarge care. thus, reducing the frequency of hospital readmissions requires considerable collaborations, not only from hospitals but also from patients and their caregivers and other community professionals and providers across the continuum of health. due to ongoing and planned changes in national reimbursement policies,7 there has been great interest from health care providers to better understand and improve modifiable factors associated with 30day rehospitalizations. a recent study in olmsted county, mn, examined factors associated with 30day rehospitalizations after an incident ami.4 the investigators found that certain comorbid conditions, a longer hospital stay, and complications of coronary angiography and revascularization or reperfusion were associated with an increased risk of being rehospitalized.4 our study observed that patients with a history of previously diagnosed heart failure and chronic kidney disease and the development of inhospital cardiogenic shock and heart failure were significantly associated with an increased odds of being rehospitalized during the first month after hospital discharge for ami. although most of these factors are not modifiable, these findings suggest that health care providers should pay extra attention to these highrisk groups of vulnerable patients to prevent potential early readmissions when planning hospital discharge and postdischarge management. future studies examining the postdischarge transitions of care in higherrisk patients, including those with multiple comorbid conditions and hospital clinical complications, remain needed to achieve greater declines in 30day rehospitalizations in this patient population. despite the potential for confounding by indication given the nonrandomized nature of the present investigation, our multivariable regression analyses adjusting for the use of various hospital treatment practices showed that the use of invasive coronary interventions was associated with a reduced odds of being rehospitalized among patients hospitalized with ami during the decadelong period under study. furthermore, encouraging declines in 30 day rehospitalizations during the years under study were slightly attenuated after adjustment for hospital treatment practices, suggesting the beneficial effects of various cardiac treatment practices on 30day readmission rates. a recent study examining 30day rehospitalizations after an acute coronary syndrome among 5219 patients enrolled in the australian and new zealand populations of the global registry of acute coronary events (grace) between 1999 and 2007 also observed similar results in that coronary revascularization during the acute hospital stay the strengths of the present study include its large population of residents of all ages and both sexes from a major central massachusetts metropolitan area who were hospitalized with a confirmed ami and examination of relatively contemporary decadelong trends in 30day rehospitalization rates among hospital survivors of an ami. several limitations need to be acknowledged, however, in the interpretation of the present findings. because our study population included only patients who had been hospitalized and discharged at 3 central massachusetts medical centers, one needs to be careful in extrapolating our findings to those who reside in other geographic areas. if a rehospitalization occurred outside of the worcester metropolitan area or at other medical centers in central massachusetts, it was not captured, although it is expected that this number would be quite small and unlikely to have changed during the years under study. this is because most patients typically return to their hospital of admission and the large tertiary care and community hospitals included in the present investigation capture the vast majority of hospitalizations that occur among residents of the worcester metropolitan area. because study patients were predominantly white, the generalizability of our findings to other race / ethnicity groups may be limited. there is also the potential for unmeasured confounding in our observed associations because we did not have information available on several patientassociated characteristics, such as income, education, psychosocial factors, and treatment preference, that may have affected the end points examined. we were unable to collect information on other factors that have been shown to affect 30day rehospitalization after ami, including transitions of care and patients adherence to various postdischarge treatment regimens. finally, although our study observed an encouraging decline in 30day rehospitalizations during the most recent years (20092011) under study, future studies remain warranted to continue monitoring changes in 30day rehospitalization rates after the implementation of financial penalties to hospitals due to excess readmissions in 2012.7 the results of this large observational investigation provide insights into trends and causes of 30day rehospitalizations, and factors associated with an increased risk of 30day rehospitalizations, among patients who survived hospitalization for an ami between 2001 and 2011. the likelihood of subsequent rehospitalizations during the following month remained frequent ; however, we observed an encouraging decline in the 30day rehospitalization rate during the most recent years under study. although most of the identified risk factors were not readily modifiable, our findings can, we hope, lead to better development of innovative, patientcentered, intervention strategies that can improve inhospital management and followup care that will further reduce the 30day rehospitalization rates of patients discharged from the hospital after an ami. this research was made possible by the cooperation of participating hospitals in the worcester metropolitan area. partial salary support for drs gore and goldberg was provided for by national institutes of health grant 1u01hl10526801.	backgroundthere are limited data available describing relatively contemporary trends in 30day rehospitalizations among patients who survive hospitalization after an acute myocardial infarction (ami) in the community setting. we examined decadelong (20012011) trends in, and factors associated with, 30day rehospitalizations in patients discharged from 3 central massachusetts hospitals after ami.methods and resultsresidents of the worcester, ma, metropolitan area discharged after ami from 3 central massachusetts hospitals on a biennial basis between 2001 and 2011 comprised the study population (n=4810). logistic regression analyses were used to examine the association between selected factors and 30day rehospitalizations. the average age of this population was 69 years, 42% were women, and 92% were white. during the years under study, 18.5% of patients were rehospitalized within 30 days after hospital discharge. crude 30day rehospitalization rates decreased from 20.5% in 20012003 to 15.8% in 20092011. after adjusting for several patient characteristics, there was a reduced odds of being rehospitalized in 20092011 (odds ratio 0.74, 95% ci 0.610.91) compared with 20012003 ; this trend was slightly attenuated after further adjustment for hospital treatment practices. female sex, having previously diagnosed heart failure and chronic kidney disease, and the development of inhospital cardiogenic shock and heart failure were associated with an increased odds of being rehospitalized.conclusionswhile the likelihood of subsequent shortterm rehospitalizations remained frequent, we observed an encouraging decline during the most recent years under study. several highrisk groups were identified for purposes of heightened surveillance and intervention efforts to reduce the likelihood of being readmitted.
denovo deletions may affect the terminal part of a chromosome or an interstitial region, and usually affect a fairly large number of genes and produce recognizable syndromes. microscopically visible deletions generally involve multiple genes, and the consequences of losing this much genetic material from even one of the chromosome pair can be severe. if the missing part contains important instructions, it can lead to congenital malformations, development delay, or mental retardation. a one and a half year old girl child born of non - consanguineous marriage to a 27-year - old primi mother was referred to the genetic clinic. the child was born at term by elective cesarean section because of symmetric iugr and oligohydramnios. birth weight was 2.0 kg and length was 48 cm with head circumference 30 cm. there was no significant family history, no evidence of teratogenecity, and no other pregnancy associated complications. clinical examination of the new born revealed grade 3 pansystolic murmurs in the left lower sternal border. echo was suggestive of congenital acyanotic heart disease vsd, asd, pda with moderately severe pulmonary hypertension. the first genetic consultation was at the age of 1 year 6 months for dysmorphic features and congenital heart disease. facial dysmorphism included microcephaly, brachycephaly, hypertelorism, upslanting palpebral fissures, strabismus, broad nasal bridge, wide anterior fontanalle, anteverted nares, high arched palate, microretrognathia, low set dysmorphic ears, and short neck. pallor was seen along with cyanosis and nail bed clubbing of the finger and toes. mri (brain) showed partial agenesis of corpus callosum, bilateral mildly enlarged subarchanoid space, and mildly dilated third and lateral ventricles. cytogenetic analysis from the proband was carried out by peripheral blood lymphocyte culture and gtg banding. karyotype of the proband showed deletion in the terminal region of the long arm of chromosome 6 in all the metaphase analyzed. the karyotype of the child was 46,xx, del(6)(q24qter) [figure 1a and b ]. (a) karyotype 46,xx, del(6)(q24 to qter) showing deletion, (b) partial karyotype showing 6q 24 to terminal deletion cytogenetic analysis from the proband was carried out by peripheral blood lymphocyte culture and gtg banding. karyotype of the proband showed deletion in the terminal region of the long arm of chromosome 6 in all the metaphase analyzed. the karyotype of the child was 46,xx, del(6)(q24qter) [figure 1a and b ]. (a) karyotype 46,xx, del(6)(q24 to qter) showing deletion, (b) partial karyotype showing 6q 24 to terminal deletion cytogenetic analysis from the proband was carried out by peripheral blood lymphocyte culture and gtg banding. karyotype of the proband showed deletion in the terminal region of the long arm of chromosome 6 in all the metaphase analyzed. the karyotype of the child was 46,xx, del(6)(q24qter) [figure 1a and b ]. (a) karyotype 46,xx, del(6)(q24 to qter) showing deletion, (b) partial karyotype showing 6q 24 to terminal deletion here, we describe a case with deletion in the terminal region of long arm of chromosome 6 with break point at q 24 region. chromosome 6q deletion is associated with dysmorphic features and multiple anomalies, which were seen in the index case also. the more frequently observed clinical features in 6q deletion are congenital heart defects, which were also seen in our case. other features like brachydactyly, clinodactyly along with peripheral clubbing and cyanosis were also seen [figure 2a, 2b and figure 3 ]. literature search with chromosome 6q24 deletion showed few reports with varying other anomalies like nuchal cyst, diaphragmatic hernia, multicystic kidney, etc, which was not seen in our case. caselli., have reported a similar case with deletion of 6q24.3 - 25.1 in an 8-year - old with growth failure, cardiac septal defects, mental retardation, and dysmorphic features. (a and b) front and side profile showing dysmorphic facies child with chromosome 6q deletion the region involved in our case is q24 to terminal and therefore explains the neurodevelopmental delay and peculiar facial features. more than twenty two genes are present in this deleted region, which might be important in the normal development of cardiovascular and central nervous system. the karyotype of parents were normal, which further suggests that this must be a denovo event and not due to unbalanced product of familial translocation. as the parental karyotype was normal and the child had a denovo deletion, the chance of recurrence is very low. nevertheless, prenatal diagnosis by amniocentesis and fetal karyotyping has been offered to the couple, in case of future pregnancies. hence, chromosome analysis should be offered to every child with mental retardation and dysmorphism as in this case. fish studies and array - cgh analysis may be useful to delineate the size of the deletion and the genes involved, which in our case was not affordable by the patient.	in this report, we describe a one and a half year old girl showing terminal deletion of long arm of chromosome 6q. the associated abnormalities such as congenital heart disease, mental retardation, and dysmorphic features are described. cytogenetic studies with gtg banding showed 46,xx, del(6)(q24qter). karyotype of the parents was normal suggesting a denovo event.
heterozygous male ren2 rats (age 10 weeks, weight 300500 g) were obtained by crossing homozygous ren2 and sprague - dawley (sd) rats. only male ren2 rats were used for this particular study as the females of this transgenic model develop a much milder phenotype. studies were performed in accordance with the arvo statement for the use of animals in ophthalmic and vision research and under the regulation and permission of the erasmus mc animal care committee. diabetes mellitus was induced by administering streptozotocin (55 mg / kg intraperitoneal [ip ] ; merck millipore, amsterdam, the netherlands), and diabetic animals were studied for 5 or 12 weeks. in the 5-week group, heart rate and bp were measured by radiotelemetry transmitters, implanted 2 weeks before induction of diabetes. rats were checked daily for nonfasting blood glucose and -ketone levels until day 3 after stz injection, and thereafter once weekly or every other week (5- and 12-week groups, respectively ; precision xceed ; abbott, zwolle, the netherlands). only rats with glucose mmol / l were considered diabetic ; they received 2 to 4 u insulin per day (levemir ; novo nordisk, bagsvaerd, denmark). rats in both groups were treated during the final 3 weeks of the study (i.e., during weeks 25 or 912) with vehicle (saline containing 0.2% dimethylsulfoxide [dmso ]), the arb irbesartan (15 mg / kg.day ; sanofi - aventis, chilly - mazarin, france), or the arni irbesartan+thiorphan (0.1 mg / kg.day diluted in dmso ; sigma - aldrich corp., st. louis, mo, usa) making use of osmotic minipumps (2ml4 ; alzet, cupertino, ca, usa). after 3 weeks of treatment, animals were killed by ip pentobarbital injection (200240 mg / kg). in addition, eyes also were obtained from 8 age - matched untreated nondiabetic sprague - dawley rats that were used as wild - type controls. eyes were harvested at the end of the 5-week or 12-week study, one eye from each animal was fixed in 4% paraformaldehyde (pfa) for histologic analysis and the other eye was snap frozen in liquid nitrogen for protein and gene expression analysis. frozen eyes from each experimental group were dissected to isolate retinal tissue that then were homogenized by sonication in nep assay buffer (100 mm tris - hcl ph 7.5, 50 mm nacl, 10 m zncl2). neprilysin activity assay was performed using 5 g of retinal protein in black 96-well opaque plates with the fluorogenic peptide substrate mca - rppgfsafk(dnp)-oh (enzo life science, farmingdale, ny, usa) added at a final concentration of 20 m. the enzymatic reaction was done at 37c in the presence and absence of the nep inhibitor thiorphan at 2 m concentration. the enzymatic reaction was recorded in a spectramax m3 fluorescence microplate reader (molecular devices, sunnyvale, ca, usa) for 1 hour with excitation at 320 nm and emission at 405 nm as described previously. all measurements were performed in duplicate and the data represent the means of three assay results. this was followed by an antigen retrieval step where the slides were boiled for 20 minutes in sodium citrate buffer, ph 6.0. the sections then were incubated in blocking solution (5% bsa+ 0.3 % triton x-100 in pbs) for 1 hour. this was followed by incubation with different primary antibodies : rabbit anti - glial fibrillary acidic protein (gfap 1:1000, sigma - aldrich corp., st. louis, mo, usa), rabbit anti - iba-1 (1:200 ; dako, carpinteria, ca, usa), mouse anti - brn3a (1:200 ; millipore, billerica, ma, usa) diluted in the same blocking solution (overnight at 4c). the sections then were incubated with the appropriate secondary antibodies conjugated to alexa 488 or 594 (molecular probes / invitrogen, eugene, or, usa) for 1 hour at rt. sections were washed in pbs containing the nuclear counterstain dapi (4,6 diamidino-2-phenylindole), and mounted in dako mounting media (dako). for tunel staining the in situ cell death detection kit, tmr red (roche applied science, indianapolis, in, usa) the images were captured on a keyence confocal microscope (keyence corporation, itasca, il, usa) or on a spinning disc confocal microscope (ultra view vox ; perkinelmer, waltham, ma, usa) using a 20, 40, and/or 60 objective lens and were prepared for presentation using adobe photoshop (adobe systems, inc., san jose, ca, usa). for gfap quantification images were thresholded in imagej (national institutes of health [nih ], bethesda, md, usa) and the fluorescence intensity and area were quantified using its measure module. for cell counts and gfap expression, each quantification was performed on at least 5 sections from at least 6 animals (i.e., at least 30 sections each experimental group). to quantify the level of gfap expression in the different experimental groups, retinal tissues were collected in cold ripa buffer (sigma - aldrich corp.) supplemented with protease inhibitors and were homogenized by sonication. homogenized tissues were centrifuged at 12,000 g for 15 minutes at 4c and the supernatant was collected. the protein concentration was detected by bio - rad protein assay kit (bio - rad life sciences, hercules, ca, usa). protein samples (20 g) were loaded and separated on 10% gels for 1 hour at 120 v in tris - glycine buffer and electrophoretically transferred onto polyvinylidene difluoride membrane. immunodetection was performed on blots blocked in fluorescence - blocking buffer for 1 hour (rockland immunochemicals, inc., gilbertsville, pa, usa) and then incubated with primary (rabbit anti- gfap ; 1:2000 ; sigma - aldrich corp.), and secondary (goat anti - rabbit ir dye 800 ; 1:5000 ; rockland immunochemicals, inc.) antibodies. immunoblots were visualized and quantified by using a li - cor odyssey infrared imager after normalizing it to -actin (odyssey ; li - cor, lincoln, ne, usa). briefly, the retinas were dissected from the 4% pfa fixed eye cups, washed in water for an hour, and digested in 3% trypsin for 2 to 3 hours at rt. the tissue then was transferred into water and the network of vessels was freed from adherent retinal tissue by gentle shaking and manipulation under a dissection microscope. the vessels then were mounted on clean slides and allowed to dry and stained with periodic acid schiff - hematoxylin and eosin (pas - h&e ; gill no.3 ; sigma - aldrich corp.). after the tissue was stained and washed in water, it was dehydrated and mounted (permount mounting media ; fisher scientific, pittsburgh, pa). the prepared retinal vessels were photographed by a zeiss microscope equipped with a high - resolution digital camera (axiocam, mrc5, zeiss axionvert 200 ; carl zeiss meditec, jena, germany) using 20 and 40 objective lenses, 6 to 8 representative nonoverlapping fields from each quadrant of the retina were imaged. acellular capillaries were counted from images for each retina and expressed as the number of acellular vessels per square millimeter. total rna was isolated from frozen rat retinal samples using trizol reagent (invitrogen, carlsbad, ca, usa) according to manufacturer 's instruction. reverse transcription was performed using enhanced avian hs rt - pcr kit (sigma - aldrich corp.) following manufacturer 's instructions. real - time pcr was done on a real - time thermal cycler (icycler ; bio - rad life sciences) using iqtm syber green supermix (bio - rad life sciences). the threshold cycle number (ct) for real - time pcr was set by the cycler software. each reaction was run in duplicate or in triplicate, and reaction tubes with target primers and those with actin primers always were included in the same pcr run. the expression levels of the different genes were established based on the ct compared to control housekeeping gene -actin in each sample (amount of target = 2) and presented as fold change. heterozygous male ren2 rats (age 10 weeks, weight 300500 g) were obtained by crossing homozygous ren2 and sprague - dawley (sd) rats. only male ren2 rats were used for this particular study as the females of this transgenic model develop a much milder phenotype. studies were performed in accordance with the arvo statement for the use of animals in ophthalmic and vision research and under the regulation and permission of the erasmus mc animal care committee. diabetes mellitus was induced by administering streptozotocin (55 mg / kg intraperitoneal [ip ] ; merck millipore, amsterdam, the netherlands), and diabetic animals were studied for 5 or 12 weeks. in the 5-week group, heart rate and bp were measured by radiotelemetry transmitters, implanted 2 weeks before induction of diabetes. rats were checked daily for nonfasting blood glucose and -ketone levels until day 3 after stz injection, and thereafter once weekly or every other week (5- and 12-week groups, respectively ; precision xceed ; abbott, zwolle, the netherlands). only rats with glucose mmol / l were considered diabetic ; they received 2 to 4 u insulin per day (levemir ; novo nordisk, bagsvaerd, denmark). rats in both groups were treated during the final 3 weeks of the study (i.e., during weeks 25 or 912) with vehicle (saline containing 0.2% dimethylsulfoxide [dmso ]), the arb irbesartan (15 mg / kg.day ; sanofi - aventis, chilly - mazarin, france), or the arni irbesartan+thiorphan (0.1 mg / kg.day diluted in dmso ; sigma - aldrich corp., st. louis, mo, usa) making use of osmotic minipumps (2ml4 ; alzet, cupertino, ca, usa). after 3 weeks of treatment, animals were killed by ip pentobarbital injection (200240 mg / kg). in addition, eyes also were obtained from 8 age - matched untreated nondiabetic sprague - dawley rats that were used as wild - type controls. eyes were harvested at the end of the 5-week or 12-week study, one eye from each animal was fixed in 4% paraformaldehyde (pfa) for histologic analysis and the other eye was snap frozen in liquid nitrogen for protein and gene expression analysis. frozen eyes from each experimental group were dissected to isolate retinal tissue that then were homogenized by sonication in nep assay buffer (100 mm tris - hcl ph 7.5, 50 mm nacl, 10 m zncl2). neprilysin activity assay was performed using 5 g of retinal protein in black 96-well opaque plates with the fluorogenic peptide substrate mca - rppgfsafk(dnp)-oh (enzo life science, farmingdale, ny, usa) added at a final concentration of 20 m. the enzymatic reaction was done at 37c in the presence and absence of the nep inhibitor thiorphan at 2 m concentration. the enzymatic reaction was recorded in a spectramax m3 fluorescence microplate reader (molecular devices, sunnyvale, ca, usa) for 1 hour with excitation at 320 nm and emission at 405 nm as described previously. all measurements were performed in duplicate and the data represent the means of three assay results. eyes fixed in 4% pfa were processed for paraffin embedding. paraffin sections (4 m thick) were cut and mounted on superfrost slides. this was followed by an antigen retrieval step where the slides were boiled for 20 minutes in sodium citrate buffer, ph 6.0. the sections then were incubated in blocking solution (5% bsa+ 0.3 % triton x-100 in pbs) for 1 hour. this was followed by incubation with different primary antibodies : rabbit anti - glial fibrillary acidic protein (gfap 1:1000, sigma - aldrich corp., st. louis, mo, usa), rabbit anti - iba-1 (1:200 ; dako, carpinteria, ca, usa), mouse anti - brn3a (1:200 ; millipore, billerica, ma, usa) diluted in the same blocking solution (overnight at 4c). the sections then were incubated with the appropriate secondary antibodies conjugated to alexa 488 or 594 (molecular probes / invitrogen, eugene, or, usa) for 1 hour at rt. sections were washed in pbs containing the nuclear counterstain dapi (4,6 diamidino-2-phenylindole), and mounted in dako mounting media (dako). for tunel staining the in situ cell death detection kit, tmr red (roche applied science, indianapolis, in, usa) was used on paraffin sections in accordance with the manufacturer 's instructions. the images were captured on a keyence confocal microscope (keyence corporation, itasca, il, usa) or on a spinning disc confocal microscope (ultra view vox ; perkinelmer, waltham, ma, usa) using a 20, 40, and/or 60 objective lens and were prepared for presentation using adobe photoshop (adobe systems, inc. for gfap quantification, digital images captured in adobe photoshop were adjusted similarly for brightness and contrast. images were thresholded in imagej (national institutes of health [nih ], bethesda, md, usa) and the fluorescence intensity and area were quantified using its measure module. for cell counts and gfap expression, each quantification was performed on at least 5 sections from at least 6 animals (i.e., at least 30 sections each experimental group). to quantify the level of gfap expression in the different experimental groups, retinal tissues were collected in cold ripa buffer (sigma - aldrich corp.) supplemented with protease inhibitors and were homogenized by sonication. homogenized tissues were centrifuged at 12,000 g for 15 minutes at 4c and the supernatant was collected. the protein concentration was detected by bio - rad protein assay kit (bio - rad life sciences, hercules, ca, usa). protein samples (20 g) were loaded and separated on 10% gels for 1 hour at 120 v in tris - glycine buffer and electrophoretically transferred onto polyvinylidene difluoride membrane. immunodetection was performed on blots blocked in fluorescence - blocking buffer for 1 hour (rockland immunochemicals, inc., gilbertsville, pa, usa) and then incubated with primary (rabbit anti- gfap ; 1:2000 ; sigma - aldrich corp.), and secondary (goat anti - rabbit ir dye 800 ; 1:5000 ; rockland immunochemicals, inc.) antibodies. -actin antibody (mouse anti--actin ; 1:5000 ; sigma - aldrich corp.) immunoblots were visualized and quantified by using a li - cor odyssey infrared imager after normalizing it to -actin (odyssey ; li - cor, lincoln, ne, usa). briefly, the retinas were dissected from the 4% pfa fixed eye cups, washed in water for an hour, and digested in 3% trypsin for 2 to 3 hours at rt. the tissue then was transferred into water and the network of vessels was freed from adherent retinal tissue by gentle shaking and manipulation under a dissection microscope. the vessels then were mounted on clean slides and allowed to dry and stained with periodic acid schiff - hematoxylin and eosin (pas - h&e ; gill no.3 ; sigma - aldrich corp.). after the tissue was stained and washed in water, it was dehydrated and mounted (permount mounting media ; fisher scientific, pittsburgh, pa). the prepared retinal vessels were photographed by a zeiss microscope equipped with a high - resolution digital camera (axiocam, mrc5, zeiss axionvert 200 ; carl zeiss meditec, jena, germany) using 20 and 40 objective lenses, 6 to 8 representative nonoverlapping fields from each quadrant of the retina were imaged. acellular capillaries were counted from images for each retina and expressed as the number of acellular vessels per square millimeter. total rna was isolated from frozen rat retinal samples using trizol reagent (invitrogen, carlsbad, ca, usa) according to manufacturer 's instruction. reverse transcription was performed using enhanced avian hs rt - pcr kit (sigma - aldrich corp.) following manufacturer 's instructions. real - time pcr was done on a real - time thermal cycler (icycler ; bio - rad life sciences) using iqtm syber green supermix (bio - rad life sciences). the threshold cycle number (ct) for real - time pcr was set by the cycler software. each reaction was run in duplicate or in triplicate, and reaction tubes with target primers and those with actin primers always were included in the same pcr run. the expression levels of the different genes were established based on the ct compared to control housekeeping gene -actin in each sample (amount of target = 2) and presented as fold change. the rat specific primers used in this experiment are listed in table 1. ren2 rats developed hypertension but had a normal blood glucose level, identical to that in sd rats as reported previously. treatment with arb or arni did not affect the glucose level nor the body weight, but significantly reduced mean arterial blood pressure (table 2). streptozotocin - induced diabetic retinopathy in ren2 rats is associated with a corresponding increase in the activity of nep enzyme (fig. 1). treatment with arb and arni reduced the level of nep activity in the 5- and 12-week studies, with arni having a stronger effect than arb in the 5-week study but appear to have almost a similar effect in the 12-week study (fig. main characteristics of dm ren2 rats that were treated for 3 weeks with vehicle, arb or arni neprilysin activity assay in stz - induced diabetic ren2 rat retinas and control retinas obtained from non - diabetic sd rats. (a) relative fluorescence intensity and (b) accumulative fluorescence intensity as a measure of nep activity level using protein samples extracted from ren-2 rat retinas show an increase in nep activity in stz - induced diabetic ren2 rat retinal samples when compared to control nondiabetic sd rat retinal samples. angiotensin receptor blocker and arni treatment resulted in reduction in the level of nep activity. all measurements were performed in duplicate and the experiment was repeated at least twice with similar results. p < 0.05 compared to control. # p < 0.05 compared to vehicle ; n = 3 per group. immunostaining for gfap, an astrocyte - specific marker, was done in each group to evaluate the level of gliosis. in a normal healthy retina, gfap expression is confined to the astrocytes at the inner limiting membrane. however, under pathologic conditions, like dr, gfap expression is elevated and also observed in the mller cell processes that extend across the retina from the inner limiting membrane to the outer limiting membrane. in a previous study in nondiabetic ren2 rats, we observed that retinal gfap expression is slightly elevated versus age - matched sd controls in astrocytes. in diabetic ren2 rats, retinal gfap expression was greatly elevated, and seen along the mller cell processes (fig. the longer the duration of diabetes, the higher the level of gfap expression that was observed. angiotensin receptor blocker and arni - treated groups showed similarly reduced retinal gliosis compared to the vehicle - treated group in the 5-week study. in the 12-week study, the arni - treated group showed a marked reduction in the level of gfap expression when compared to the vehicle and the arb - treated group (figs. retinal sections from each group also were immunostained for iba-1, which is a marker for activated microglial cells. in the 5-week study, arb- and arni - treated groups displayed almost the same number of iba-1positive cells as the vehicle - treated group. in the 12-week study, the total number of iba-1positive cells was significantly (p < 0.01) reduced in the arni - treated group when compared to the vehicle and arb - treated groups (figs. angiotensin receptor blocker treatment alone also reduced the total number of iba-1positive cells versus vehicle. (a) gfap immunostaining in 5-week (top) and 12-week (bottom) diabetic rats, treated for 3 weeks with vehicle, arb, or arni. onl, outer nuclear layer ; inl, inner nuclear layer ; ipl, inner plexiform layer. (b) quantification of gfap immunofluorescence in representative rat retinal sections from each experimental group, including nondiabetic (control) rats. (c) gfap western blot showing a reduction in gfap expression in arb- and arni - treated groups when compared to the vehicle group. ns, not significant, p < 0.05, p < 0.001. immunofluorescence detection of activated microglial cells in retina. (a) quantification of iba-1 positive cells in the different experimental groups, including nondiabetic control rats. (b) paraffin sections from each group were processed for tunel labeling to evaluate retinal degeneration. compared to the nondiabetic control group the diabetic vehicle - treated groups showed a marked increase in the number of cells undergoing apoptotic cell death in the 5-week (2.4-fold increase) and 12-week (2.8-fold increase) study. the arb- and arni - treated groups showed similarly reduced apoptotic cell death compared to the vehicle - treated group in the 5-week study. in the 12-week study, the arni - treated group showed a marked reduction (51%) in the number of apoptotic cell deaths when compared to the vehicle - treated group, while the arb - treated group showed only a 25% reduction versus vehicle (figs. immunostaining for brn3a which is a specific retinal ganglion cell (rgc) marker was used to quantify the number of rgc in retinal sections from each experimental group as another measure for retinal neurodegeneration. number of brn3a+ cells in the control group was significantly higher when compared to the 5-week and 12-week vehicle - treated group. in the 5-week study, arb and arni treatment resulted in a statistically significant increase in number of brn3a+ rgc cells when compared to the vehicle - treated group. in the 12-week study arni - treated group showed an increase in number of brn3a+ rgc cells while the arb and vehicle - treated group showed a reduced brn3a+ rgc cells (fig. 4c). in situ cell death detection by tunel assay in retina. (a) quantification of tunel - positive cells in the different experimental groups, including nondiabetic control rats. (b) representative images of tunel immunostaining in rat retinal sections from different groups. (c) quantification of brn3a - positive cells in different experimental groups, including nondiabetic control rats. p < 0.05, p < 0.001, n = 6 per group (56 sections / animal). we have reported previously that the ren2 rat retina shows an increased loss of capillaries when compared to age - matched sd rats. angiotensin receptor blocker- and arni - treated groups showed a similar reduction in the number of acellular capillaries compared to vehicle - treated group in the 5-week study. in the 12-week study, arni treatment showed significantly more reduction in capillary loss (68% vs. 43% reduction) than arb treatment (fig. (a) representative images of trypsin - digested retinal vascular preparations from different groups of the 12-week study. real - time rt - pcr was used to evaluate the expression level of inflammatory cytokines and angiogenic factors in the retina from each experimental group. in the 5-week study and the 12-week study arb and arni treatment significantly reduced the mrna levels of tnf-, intercellular adhesion molecule-1 (icam-1), vegf, and monocyte chemoattractant protein-1 (mcp-1) when compared to the vehicle treated groups (fig.. real - time pcr analysis of mrna extracted from rat retinas of different experimental groups for inflammatory marker genes : tnf-, vegf, icam-1, and mcp-1. y - axis shows the fold change in the gene expression level normalized to -actin. ren2 rats developed hypertension but had a normal blood glucose level, identical to that in sd rats as reported previously. treatment with arb or arni did not affect the glucose level nor the body weight, but significantly reduced mean arterial blood pressure (table 2). streptozotocin - induced diabetic retinopathy in ren2 rats is associated with a corresponding increase in the activity of nep enzyme (fig. 1). treatment with arb and arni reduced the level of nep activity in the 5- and 12-week studies, with arni having a stronger effect than arb in the 5-week study but appear to have almost a similar effect in the 12-week study (fig. main characteristics of dm ren2 rats that were treated for 3 weeks with vehicle, arb or arni neprilysin activity assay in stz - induced diabetic ren2 rat retinas and control retinas obtained from non - diabetic sd rats. (a) relative fluorescence intensity and (b) accumulative fluorescence intensity as a measure of nep activity level using protein samples extracted from ren-2 rat retinas show an increase in nep activity in stz - induced diabetic ren2 rat retinal samples when compared to control nondiabetic sd rat retinal samples. angiotensin receptor blocker and arni treatment resulted in reduction in the level of nep activity. all measurements were performed in duplicate and the experiment was repeated at least twice with similar results. p < 0.05 compared to control. # p < 0.05 compared to vehicle ; n = 3 per group. immunostaining for gfap, an astrocyte - specific marker, was done in each group to evaluate the level of gliosis. in a normal healthy retina, gfap expression is confined to the astrocytes at the inner limiting membrane. however, under pathologic conditions, like dr, gfap expression is elevated and also observed in the mller cell processes that extend across the retina from the inner limiting membrane to the outer limiting membrane. in a previous study in nondiabetic ren2 rats, we observed that retinal gfap expression is slightly elevated versus age - matched sd controls in astrocytes. in diabetic ren2 rats, retinal gfap expression was greatly elevated, and seen along the mller cell processes (fig. the longer the duration of diabetes, the higher the level of gfap expression that was observed. showed similarly reduced retinal gliosis compared to the vehicle - treated group in the 5-week study. in the 12-week study, the arni - treated group showed a marked reduction in the level of gfap expression when compared to the vehicle and the arb - treated group (figs. 2a retinal sections from each group also were immunostained for iba-1, which is a marker for activated microglial cells. in the 5-week study, arb- and arni - treated groups displayed almost the same number of iba-1positive cells as the vehicle - treated group. in the 12-week study, the total number of iba-1positive cells was significantly (p < 0.01) reduced in the arni - treated group when compared to the vehicle and arb - treated groups (figs. angiotensin receptor blocker treatment alone also reduced the total number of iba-1positive cells versus vehicle. (a) gfap immunostaining in 5-week (top) and 12-week (bottom) diabetic rats, treated for 3 weeks with vehicle, arb, or arni. onl, outer nuclear layer ; inl, inner nuclear layer ; ipl, inner plexiform layer. (b) quantification of gfap immunofluorescence in representative rat retinal sections from each experimental group, including nondiabetic (control) rats. (c) gfap western blot showing a reduction in gfap expression in arb- and arni - treated groups when compared to the vehicle group. ns, not significant, p < 0.05, p < 0.001. (a) quantification of iba-1 positive cells in the different experimental groups, including nondiabetic control rats. (b) representative images of iba-1 immunostaining in rat retinal sections from different groups. paraffin sections from each group were processed for tunel labeling to evaluate retinal degeneration. compared to the nondiabetic control group the diabetic vehicle - treated groups showed a marked increase in the number of cells undergoing apoptotic cell death in the 5-week (2.4-fold increase) and 12-week (2.8-fold increase) study. the arb- and arni - treated groups showed similarly reduced apoptotic cell death compared to the vehicle - treated group in the 5-week study. in the 12-week study, the arni - treated group showed a marked reduction (51%) in the number of apoptotic cell deaths when compared to the vehicle - treated group, while the arb - treated group showed only a 25% reduction versus vehicle (figs. immunostaining for brn3a which is a specific retinal ganglion cell (rgc) marker was used to quantify the number of rgc in retinal sections from each experimental group as another measure for retinal neurodegeneration. number of brn3a+ cells in the control group was significantly higher when compared to the 5-week and 12-week vehicle - treated group. in the 5-week study, arb and arni treatment resulted in a statistically significant increase in number of brn3a+ rgc cells when compared to the vehicle - treated group. in the 12-week study arni - treated group showed an increase in number of brn3a+ rgc cells while the arb and vehicle - treated group showed a reduced brn3a+ rgc cells (fig. 4c). in situ cell death detection by tunel assay in retina. (a) quantification of tunel - positive cells in the different experimental groups, including nondiabetic control rats. (b) representative images of tunel immunostaining in rat retinal sections from different groups. (c) quantification of brn3a - positive cells in different experimental groups, including nondiabetic control rats. p < 0.05, p < 0.001, n = 6 per group (56 sections / animal). we have reported previously that the ren2 rat retina shows an increased loss of capillaries when compared to age - matched sd rats. angiotensin receptor blocker- and arni - treated groups showed a similar reduction in the number of acellular capillaries compared to vehicle - treated group in the 5-week study. in the 12-week study, arni treatment showed significantly more reduction in capillary loss (68% vs. 43% reduction) than arb treatment (fig. (a) representative images of trypsin - digested retinal vascular preparations from different groups of the 12-week study. real - time rt - pcr was used to evaluate the expression level of inflammatory cytokines and angiogenic factors in the retina from each experimental group. in the 5-week study and the 12-week study arb and arni treatment significantly reduced the mrna levels of tnf-, intercellular adhesion molecule-1 (icam-1), vegf, and monocyte chemoattractant protein-1 (mcp-1) when compared to the vehicle treated groups (fig.. real - time pcr analysis of mrna extracted from rat retinas of different experimental groups for inflammatory marker genes : tnf-, vegf, icam-1, and mcp-1. y - axis shows the fold change in the gene expression level normalized to -actin. the present study first showed that stz - induced diabetes in ren2 rats resulted in increased levels of nep activity, capillary loss, inflammatory cytokine expression, gliosis, and neuronal apoptotic cell death in the retina, which all are indicators of dr. secondly, these symptoms exacerbated after a longer duration of diabetes ; the increase in capillary loss, inflammatory cytokine expression, gliosis, and apoptotic cell death were all significantly worsened after 12 weeks of diabetes compared to 5 weeks of diabetes. this could have important clinical significance in terms of developing potential therapeutics, as dr, a progressive retinal neurovascular disorder, is strongly associated with prolonged duration of diabetes in patients. thirdly, this study provides strong evidence that, in the 12-week study, arni is much more effective than arb alone in ameliorating the retinal neurovascular dysfunctions observed in diabetic ren2 rats, while the two treatments were equally effective at 5 weeks. thus, the use of a nep inhibitor in addition to an arb seems to provide additional benefits effects on the retinal neurovascular system, making arni a promising therapeutic approach in the treatment of dr. to what degree the beneficial effects of arni in the eye at 12 weeks occurred independently of blood pressure still must be investigated. nevertheless, given the identical blood pressure lowering effects of arni and arb at 5 weeks, at this stage there is no reason to believe that this would be entirely different at 12 weeks. a large body of evidence suggests that a deficiency in the natriuretic peptide system in addition to a hyperactive ras is associated with various renal and cardiovascular diseases like heart failure, hypertension, and metabolic syndromes. this system comprises three structurally similar peptides : atrial natriuretic peptide (anp), b - type natriuretic peptide (bnp) and c - type natriuretic peptide (cnp). natriuretic peptides, in addition to having potent natriuretic, diuretic, and vasodilator properties, also lower sympathetic drive, and have antiproliferative and antihypertrophic effects. these actions are mediated by the binding of anp and bnp to the type a receptor, which is coupled to guanylyl cyclase. c - type natriuretic peptide is found mostly in the central nervous system, kidneys, and vascular endothelial cells ; it has antithrombotic and antifibrotic effects and binds to the type b receptor. the activation of both these receptors increases the expression of the second messenger cgmp, which mediates most of the natriuretic peptide mechanisms of action. the natriuretic peptides are cleared from circulation via receptor - mediated internalization (involving the natriuretic peptide clearance receptor) and/or degradation by extracellular proteases, like nep. natriuretic peptides and their receptors are expressed and functional in the rodent and human eyes in lens epithelial cells, vitreous, neural retina, and rpe. although their role in the retina is not yet clear, induction of diabetes in rats causes downregulation of retinal anp expression. the activity level of nep in the vitreous of patients with proliferative dr is increased compared to control patients. additionally, in our present study we showed that stz - induced dr in ren2 rats results in increased level of nep activity, which can be significantly reduced by arb and arni treatment. moreover, it has been shown that anp and cnp can suppress endothelial and rpe leakage, prevent choroidal neovascularization, and reverse advanced glycation end - product - induced retinal blood - barrier dysfunction in rpe. thus, inhibiting nep and increasing the level of natriuretic peptides in the retina could be beneficial in the treatment of dr. increasing the levels of natriuretic peptide by nep inhibitors has been investigated as a therapeutic approach for treatment of hypertension and heart failure. however, the use of nep inhibitors individually was not very beneficial, due to its broad effects on a variety of substrates other than natriuretic peptides. indeed, nep is critical for the processing and catabolism of vasoactive peptides and peptides involved in diuresis, natriuresis, and blood pressure regulation, like angiotensin ii, bradykinin, substance p, adrenomedullin, glucagon, vasoactive intestinal peptide, and endothelin-1. therefore, in recent studies nep inhibitors were used in combination with other cardiovascular agents, such as acei and arbs, to at least counteract their potentiating effects on angiotensin ii. the combination of a nep inhibitor and an acei was not useful because of a high incidence of angioedema, due to increased bradykinin levels related to the fact that nep and ace are the main enzymatic pathways for the breakdown of bradykinin. an alternative combination is that of an arb and a nep inhibitor (arni). angiotensin receptor blockers do not disrupt bradykinin metabolism, and patients on arni did not seem to develop angioedema. this combination could be additionally beneficial because blockade of the angiotensin ii type 1 receptor by arb facilitates the binding of angiotensin ii to the angiotensin ii type 2 receptor that elicits several favorable actions. clinical studies using arni for the treatment of heart failure and hypertension have shown much stronger favorable results when compared to arb, without any extra associated negative side effects. possible chronic adverse effects of nep inhibitors on the eye have not specifically been assessed yet. neprilysin has a possible neuroprotective effect as it brings about degradation of the amyloid peptide. elevated levels of amyloid peptide in the brain is associated with cognitive impairment, and extracellular deposition leads to the development of alzheimer 's disease. elevated levels of amyloid peptide in the eye have been found in different progressive retinal neurodegenerative disorders, such as age - related macular degeneration. hence, further studies must be done to better understand the long - term effects of nep inhibitors on the eye before they can be applied for the treatment of dr. nevertheless, the beneficial effect that arni has over arb on retinal neurovascular symptoms in diabetic ren2 rats suggest that this treatment holds promise as a novel potential therapeutic strategy for treatment of patients with dr.	purposedysfunction of the renin - angiotensin system (ras) contributes to pathogenesis of diabetic retinopathy (dr). yet ras blockers have only limited beneficial effects on progression of dr in clinical trials. the natriuretic peptide system offsets ras, so that enhancing the activity of this system on top of ras blockade might be beneficial. neprilysin has an important role in the degradation of natriuretic peptides. therefore, we hypothesize that dual angiotensin receptor - neprilysin inhibition (arni) may outperform angiotensin receptor blocker (arb) in protection against dr. we tested this hypothesis in streptozotocin - induced diabetic transgenic (mren2)27 rats.methodsadult male diabetic (mren2)27 rats were followed for 5 or 12 weeks. treatment with vehicle, irbesartan (arb), or arb combined with the neprilysin inhibitor thiorphan (irbesartan+thiorphan [arni ]) occurred during the final 3 weeks. retinal cell death, gliosis, and capillary loss were evaluated. real - time polymerase chain reaction (rt - pcr) analyses were performed to quantify the retinal level of inflammatory cell markers.resultsboth arb- and arni - treated groups showed similarly reduced retinal apoptotic cell death, gliosis, and capillary loss compared to the vehicle - treated group in the 5-week study. treatment with arni reduced the expression of inflammatory markers more than arb treatment in the 5-week study. in the 12-week study, arni treatment showed significantly more reduction in apoptotic cell death (51% vs. 25% reduction), and capillary loss (68% vs. 43% reduction) than arb treatment.conclusionstreatment with arni provides better protection against dr in diabetic (mren2)27 transgenic rats, compared to arb alone. this approach may be a promising treatment option for patients with dr.
alcohol use has been identified by the world health organization as the second greatest risk to public health in developed countries. screening and brief intervention (sbi) is established as an effective preventive approach to reduce hazardous or harmful drinking, particularly in primary care settings. brief interventions (bis) may involve 1 to 5 sessions of 5 to 60 min of structured information and advice giving, or counseling based on approaches such as motivational interviewing (mi), wherein patients own motivations are empathetically explored and guided toward change. sbi is widely recommended in public health policies as preventive practice to reduce problem drinking. in the united kingdom, for example, sbi is endorsed in the national guidelines for treatment of alcohol - related risk and harm, and its implementation is central to the government s preventive strategy for public health. in the united states, sbi with referral to treatment (sbirt) for the identification and treatment of hazardous alcohol use is recommended in primary care by the national institute on alcohol abuse and alcoholism. hospital emergency departments (eds) provide a valuable opportunity to treat risky drinking in which patients with relatively high rates of hazardous to dependent drinking present in relation to a recent medical event. routine sbi for alcohol in eds is promoted by the american college of emergency physicians and also mandated in trauma wards by the american college of surgeons [911 ]. while improving the treatment of unhealthy drinking in all health care settings is an important goal, some issues persist. where effectiveness has been shown, it is still not clear how persistent those effects may be. modal follow - up time is 1 year, and the number of studies with longer follow - up is small. there is debate as to how far evidence for the effectiveness of sbi in primary care can be extrapolated to other populations and settings [1317 ]. existing evidence for the effectiveness of bis for alcohol use across hospital sites of emergency, inpatient, and trauma care has been mixed, and drawing overall conclusions is difficult given the distinct characteristics of different hospital departments and different characteristics of patients across these settings. the considerable variation in the scale, approach, and content of bis means that there is a need to clarify and delineate their essential and effective components [18, 19, 20, 21 ]. in addition, it is important to establish the minimum necessary components of effective bi in routine practice, where there may be therapeutic drift from bi protocol. a further key issue is to understand in which contexts or with which populations different models of bi may be most effective. moreover, uptake of bi by professionals in various health care settings continues to fall short of expected levels. to assess how current research is addressing these issues, recent evidence is reviewed here for the effectiveness of bi in health care settings beyond primary care, how efficacy may vary according to characteristics of subgroups within patient populations and the design of bis, and improving the implementation of bis in primary and other health care settings. a search was conducted for recently published research relating to bis in nonspecialist health care settings to moderate alcohol consumption in hazardous or moderately dependent drinkers (fig. 1). the effectiveness of alcohol bis within primary care was further confirmed by a recent major randomized controlled trial (rct) in 5 college health clinics screening 12,900 students, 986 of whom were eligible and took part in the study. at 12 months, those receiving two 5-min, mi - based counseling visits from general practitioners (gps) and two follow - up calls had reduced their previous month s consumption by a mean of 27.2%, which was significantly more than the 21% reduction among the control group. another rct in primary care in thailand found effects of a three - session mi intervention from nurses at 3 and 6 months on drinks per day and frequency of hazardous and binge drinking. also, two rcts investigated the effects of bi in primary care on the underresearched group of at - risk drinkers older than 54 years of age. one trial randomly assigned 631 individuals to receive a control booklet or a multifaceted bi. the other followed up 222 older at - risk drinkers who had received a repeated telephone intervention or control. the trials found short - term effects of these interventions on whether individuals were drinking riskily, the number of drinks they reported consuming, and the rates of heavy drinking, but only the effect on number of drinks in the former trial remained significant at 12 months. recent reviews of studies of bis in hospital settings, while emphasizing their potential as sites for opportunistic sbi, note a lack of consistency in findings. a review of trials of bis targeting patients with comorbid substance use and mental or physical health problems found studies in a range of health care settings that reported effectiveness in terms of alcohol outcomes. two of the six trials for comorbid mental health compared mi with education or informational controls and found positive outcomes at 6 months with regard to frequency or volume of drinking. another found no significant differences in drinking behaviors between groups following a cognitive - behavioral therapy based intervention, while two trials for patients with comorbid physical conditions found significant reductions in alcohol use at 12 months following interventions providing brief advice. more recent studies on adult patients in other health care settings offer some evidence for short - term effectiveness. a quasi - experimental trial of sbirt in the united states recruited 1,132 patients from 14 ed sites, with 433 patients included at final follow - up, and found significant differences at 3 months in typical number of drinks per week and maximum number of drinks per occasion. a bi based on mi also predicted abstinence maintained at 3 months among 50 harmful drinking patients admitted to a danish hospital for alcohol treatment. two studies in poland and switzerland randomly assigned ed patients screening positively for at - risk to dependent drinking (n = 446 and n = 987, respectively) to screening - only, assessment, or bi conditions and found reductions over time within groups in at - risk drinking, drinks per day, and drinking days per week. [30, 31 ]. in a swedish study, 158 transport company employees who had screened positively for hazardous / harmful drinking in occupational health and lifestyle checks were randomly assigned to receive bi, comprehensive intervention, or a control. none of these five studies found significant differences between intervention and control groups in the outcomes stated at 12 months despite some significant reductions in consumption within groups. however, another rct in medical / surgical wards in taiwan recruited 308 male patients who reported consuming more than 14 standard drinks per week. those receiving an mi - based bi with booster sessions were found to be drinking significantly less on significantly fewer days per week with significantly fewer days of heavy drinking per week at 4-, 9-, and 12-month follow - ups. apart from the last study, results from these hospital and occupational health settings seem to indicate only a short - term effect of bi on the consumption of alcohol compared with studies in primary care. nevertheless, there were significant reductions in consumption within groups including controls, and this may indicate a bias toward the null. assessment reactivity and regression to the mean have been highlighted as likely confounding factors contributing to results such as these [32, 34 ]. however, in two of the above studies, the authors did not attribute their results to assessment reactivity, because change was observed in the screened as well as in the assessed control groups [30, 31 ]. bernstein. attributed their lack of significant effect at 12 months to a combination of high attrition and a single - contact intervention. effect sizes for control group change in trials of sbi for alcohol were found in a previous review to be extremely heterogeneous, precluding estimation of an overall effect, and to an extent that can not be entirely accounted for by assessment reactivity or regression to the mean. nevertheless, a more recent systematic review of control group change in 16 trials of bi for alcohol use with more than 30 control group participants indicated a mean consumption change of 0.37 in control groups, and a mean effect size change of 0.37 [20 ]. in 54% of those studies, advice or referral the authors suggested various measures that may allow future research to isolate more clearly the effects of intervention itself : enhancing diversity, blinding participants, simplifying assessments, and using analytic techniques to limit the impact of outliers and regression to the mean. even if the long - term effects on a primary outcome of alcohol consumption are not apparent, effects on secondary outcomes may be important. for instance, a systematic review and meta - analysis of the impact of sbi on usage of hospital resources found a nonsignificant reduction in usage of ed services associated with bi, although the limitations of data available to the study were stressed. in a us study, 3,338 14- to 18-year - olds admitted to an ed were screened for alcohol use and violence in the past year. a total of 726 who scored positively participated in a trial of a therapist - delivered bi for both violence and alcohol based on mi and skills training. at 6 months, the intervention was associated with significantly fewer reports of alcohol consequences than a 3-min computer intervention or delivery of a brochure in the control condition. an intervention that does not show a significant effect on a population as a whole might still be more effective with some individuals than with others, and several studies have examined interactions between intervention effects and other factors. in an rct in the united states, 172 ed patients 18 to 24 years of age received an mi intervention or feedback alone. at 12 months, alcohol use was significantly reduced in the intervention condition only for particular subgroups : those who were at - risk drinkers but had not drank before the medical event that brought them to hospital, those attributing their medical event to alcohol to a low to moderate extent, and those reporting low to medium readiness to change their drinking. the authors concluded that mi is a more effective model than advice giving among young, heavy - drinking patients who do not believe that their drinking has bought them to hospital. those admitted as an acknowledged consequence of alcohol consumption may have already been motivated by their accident to an extent that either model is as effective. replication of these findings in further and older populations could help communicate the wider potential for sbi to ed staff providers, who may view it as an intervention for those admitted with manifest consequences of alcohol problems. furthermore, individuals who had self - inflicted injuries or who were in police custody, for whom the intervention may have been less effective, were excluded. a bi trial in the united kingdom with 103 ed patients who had deliberately self - harmed found no significant reduction in their units consumed per drinking day at 3 or 6 months. in spain, the efficacy of a physician - delivered bi was tested with 752 individuals who scored positively for binge drinking (5+/4 + standard drinks on any one occasion) from among 15,325 screened in primary health care settings. significantly greater reductions persisted at 12 months in the intervention group compared with the control group with regard to how many participants binged and how often, number of drinking episodes, and weekly number of drinks. comparing this with findings from studies of hazardous drinkers in general suggests that bi effects may be more sustained for binge drinkers than for excessive drinkers consuming lower daily amounts. severity of alcohol problems may also be a factor in bi effectiveness. a systematic review of bis in primary care prompted by concern that screening does not usually distinguish between heavy drinkers and dependents found no support for the efficacy of bi among dependent drinkers. among the 16 rcts included, only 2 studies neither of which had shown efficacy had retained heavy or dependent drinkers in their samples. however, a recent rct in texas in which 1,336 ed patients were screened for dependence indicated significant interactions between the effects of brief mi and dependence on alcohol [41 ]. at 12-month follow - up, dependent drinkers who received the intervention were consuming a significantly lower volume per week at a lower maximum amount per day, with more days abstinent than those who received treatment as usual. there were no significant differences between conditions among nondependent drinkers, and their volume consumed per week and days abstinent had increased at follow - up. these results inform the findings of efficacy in a hospital setting from liu and colleagues above. a total of 49% of their sample had a diagnosis of dependence and were more likely than other participants to participate at all three stages of the trial. a separate analysis of this dependent subgroup showed significant effects of bi on alcohol outcomes at 12 months. if those drinking at dependent levels are affected by bis as these two studies indicate, then this may be of benefit not just in reducing their drinking but in encouraging them to seek additional treatment. for instance, liu. noted that among their intervention group, the more intervention sessions attended, the more likely the participant was to seek further treatment. in a study of ed patients with substance use disorders (including alcohol), 2,493 who were screened and received bi were significantly more likely than a matched unscreened comparison group of 2,493 to register for treatment for dependence. a total of 1,365 of those who received a bi had scored positively for harmful to dependent drinking and were referred for 4 to 12 sessions of mi aimed at enhancing the individual s efforts to reduce his or her substance use. the 265 who went on to receive this brief treatment were significantly more likely again to register for dependence treatment than those who did not receive brief treatment. these findings argue against excluding dependent drinkers from trials of bi, and there may be wider exclusions that should be reconsidered. for instance, a review of studies on the effectiveness of bis for alcohol use among traumatic brain injury patients concluded that they are systematically excluded from trials, without conclusive evidence that those drinking riskily would not benefit from intervention. if assessment or screening reactivity means that trials continue to find no significant effect of a longer intervention as opposed to a shorter one, brevity may be considered a key characteristic of bi. a critical review of 12 sbi trials in college health services with before and after data concluded that the 6 controlled studies showing a significant reduction in alcohol consumption indicate that time - limited (< 75 min), single - session interventions with mi and feedback components are effective, although only 3 of these followed up at 12 months. in a qualitative study, 17 physicians perceived the discussion and delineation of drinking and the agreement of life goals and strategies for reduction as the most practical and effective components of bi for alcohol. this suggests that these components are likely to achieve the best uptake by clinical staff. another study tested components of a bi (4060 min of mi, with booster sessions in only one intervention group 710 days after discharge) with 333 hazardous injured drinkers in the hospital. it was determined that a combination of high patient readiness to change and the formation of a change plan of high quality (as coded by two independent raters) yielded better than predicted outcomes, more so than either aspect on its own. analysis of data from an rct in us trauma centers indicated an interaction between bi effects and ethnic matching such that reductions in frequency of heavy drinking, maximum amount consumed in a day, and volume per week were all significantly greater if the patient and provider shared the same ethnicity. this reflects the explanation offered by daeppen and colleagues for nonsignificant results in their rct of a bi. drawing on the process research elements of the study, they found that differences in counselor performance were influential despite systematic mi training, that counselors who had better mi skills achieved better results, and that patients with better communication skills achieved better outcomes. the authors argue for greater attention to provider characteristics relative to design components when evaluating bis. however, this may only be relevant when the model of bi draws on mi, rather than information and advice giving, and when bi is delivered in person. for instance, a study of sbi delivered by phone with interactive voice technology at a primary care center identified similar proportions of patients as responding positively to paper methods, and indicated a 24% reduction in alcohol consumed after 2 weeks [47, 48 ]. computerized bi has been found to be effective. a systematic review of 24 studies of online bi found that this mode of treatment could reduce amounts of alcohol consumed by adults and reduce binge drinking among students, although the measures of central tendency used in many studies did not account for the skewed data. the effect size was greater in nonstudent populations and significant in all but a few of the studies identified. in sweden a total of 41% of 3,848 admissions were directed by nurses to complete a screening instrument themselves and to receive long or short tailored feedback via a dedicated computer. of these, 1,570 (39% aged 1829 years) completed the screening and received the feedback, indicating the acceptability and reach of this format. a total of 93 patients completed a questionnaire at 6 months, although heavy episodic drinkers tended not to consent to follow - up. frequency of heavy episodic drinking, however, was significantly lowered among those receiving longer feedback. even if interventions are proven effective, they may nevertheless provide no benefit to patients unless they are routinely delivered. for instance, only 11% of us eds routinely screen for alcohol, and staff feel they lack the time and resources for this work. qualitative studies and surveys of provider opinion have explored issues concerning the implementation of sbi in health care settings [5358 ]. this work largely paints a familiar picture, albeit extending knowledge to countries such as slovenia and thailand : providers endorse the interventions and believe they could deliver them but do not have the support or opportunity to do so. in england, gps express more commitment to preventive practice for alcohol use than they did 10 years ago and feel more prepared and able to enact this, yet still fall short of expectations for the delivery of sbi. it was found that physicians in korean eds tend to judge the risk of patients drinking against their own consumption, similar to previous findings on gps in the united kingdom. it is typically concluded in these reports that a need exists for further practitioner training and support. however, small or nonsignificant effects continue to be found for initiatives to boost preventive practice with regard to alcohol. a cluster rct of dissemination strategies carried out with 112 german practices found that an online quality improvement program for treatment of alcohol use disorders that included discussions with staff did not significantly affect practitioner performance. an electronic reminder for practitioners in a us veterans clinic to follow up positive screenings did not significantly affect rates of bi observed. finally, an intensive program of training, booster sessions, personalized and handwritten reminders, incentives, and feedback for 31 physicians at 4 us outpatient clinics resulted in referral to bi of only 39% of patients screened as eligible, although variation across 4 clinics was between 17% and 51%. another reason why recent findings from implementation studies may seem to offer little new insight is the difficulty of sustaining evaluative research over the long term. in the latter study, it was noted that rates of referral to bi increased from 34% to 47% in the second year, and the authors speculated that their intervention may have a cumulative effect of change on professional culture over several years. in a focus group study of the views of 40 gps from norway that followed up on issues raised in a survey, gps were found to identify social and structural barriers to implementing sbi, including difficulty accommodating sbi within normal routines, orientation toward treatment rather than prevention, and concern about patient relationships. training on how to deliver sbi or encouragement to do so may be unlikely to overcome these issues unless programs take account of such concerns (eg, by signposting evidence that patients are broadly positive about lifestyle questions if they appear relevant to their own health and are asked in the proper way). rather than simply training one group of practitioners, systematic, large - scale approaches aimed at professional, organizational, and social levels may do more to transform attitudes regarding alcohol and treatment behaviors (eg, by facilitating discussion of health risks between gps and patients) [22, 57, 64, 6668 ]. its objective was to encourage health care professionals in four arenas (primary care, child health care, maternity care, and occupational health) to ask their patients about alcohol use and offer brief, structured advice. adopted as a central plank of national health policy and with evaluative data gathered at baseline and 3-year follow - up, it has provided a uniquely broad and long - term view of how sbi can be instituted in health care contexts and at a population level. at follow - up, substantially more participating practitioners in all arenas reported feeling very knowledgeable about helping patients reduce hazardous alcohol consumption. the proportion of primary and occupational health staff feeling more effective and always or often talking to their patients about alcohol had increased from baseline to follow - up. for instance, all staff at health care institutions were trained, and the concepts of hazardous drinking and preventive approaches were widely marketed. the cross - sectional data limit what can be concluded about causality, and the statistical significance of results is not specified in the study report. the authors relied on self - report rather than more objective measures of outcome, and response rates varied across professions, between 43% and 80%. nevertheless, the scale of the project is exemplary and means that other research findings from the evaluation will be of great interest. trials of the effectiveness of sbi against problem drinking have continued to build on established effectiveness in primary care. however, they continue to reach inconclusive results in hospitals and offer little evidence of long - term effects in this setting. changes in alcohol outcomes over time are frequently found in control and intervention groups, and wider uptake of the suggestions offered by bernstein. [20 ] may tackle the crucial issues of assessment reactivity and control group change for the field. studies of mediating variables and subpopulations among hospital patients show promising results ; in particular, they suggest a need to revise the prevailing wisdom that bis are only effective for hazardous to harmful rather than dependent drinkers, or less effective with dependent drinkers. moving toward specific and testable models or a more detailed understanding of which components yield which effects would lead to greater clarity regarding where and how bis for alcohol are effective. more rigorous and detailed qualitative work would be helpful in this, particularly in explaining how provider characteristics or the absence of a provider in person influence interventions. it would be useful to clarify the role of mi components against information and advice - giving delivery models. finally, recent research into the implementation of bis against problem drinking in health care settings suggests that translational work among researchers, gps, and others to enhance practical applications of sbi and identify broader strategies and outcomes would boost the uptake of this important treatment.	the delivery of brief interventions (bis) in health care settings to reduce problematic alcohol consumption is a key preventive strategy for public health. however, evidence of effectiveness beyond primary care is inconsistent. patient populations and intervention components are heterogeneous. also, evidence for successful implementation strategies is limited. in this article, recent literature is reviewed covering bi effectiveness for patient populations and subgroups, and design and implementation of bis. support is evident for short - term effectiveness in hospital settings, but long - term effects may be confounded by changes in control groups. limited evidence suggests effectiveness with young patients not admitted as a consequence of alcohol, dependent patients, and binge drinkers. influential bi components include high - quality change plans and provider characteristics. health professionals endorse bi and feel confident in delivering it, but training and support initiatives continue to show no significant effects on uptake, prompting calls for systematic approaches to implementing bi in health care.
with one of the highest mortality - to - incidence ratios, pancreatic cancer is the eighth leading cause of cancer - related death in men worldwide and the ninth in women.1 the disease is usually detected at an advanced stage, carries a poor prognosis regardless of treatment, and is associated with debilitating symptoms. after initial diagnosis, most patients have a median survival with treatment of about 6 months.1 even in cases where the cancer is diagnosed at an early resectable stage, 5-year survival is still only 22%.2 advances in treating pancreatic cancer have been few and modest. pancreatic cancer is well recognized as an extremely challenging disease on multiple fronts, and the use of chemotherapy has been shown to improve survival.3 there is now more emphasis on early chemotherapy in locally advanced pancreatic cancer and combination chemotherapy in metastatic disease.1 gambogic acid (ga), a natural compound extracted from gamboges, has recently been identified as a potent anticancer agent. recent studies have shown that ga can inhibit growth of a wide variety of tumor cells, including hepatoma, pulmonary carcinoma, gastric cancer, and breast cancer.47 however, little is known about the effect of ga in pancreatic cancer. in addition, the therapeutic effect of ga is limited due to low water solubility. therefore, efforts should be made to develop new delivery techniques to increase water solubility which could alter its biodistribution, enhance its deposition in tumor sites, and improve its therapeutic efficacy.8 various types of nanosized drug carriers, such as liposomes, polymeric micelles, dendrimers, superparamagnetic iron oxide crystals, semiconductor nanomaterials, and colloidal gold, have been investigated in cancer therapy in order to minimize the side effects of anticancer therapy, improve water solubility of drugs, and enhance the antitumoral efficacy of targeted therapies.9,10 the most promising materials are magnetic nanoparticles. magnetic fe3o4 nanoparticles (mnp - fe3o4), a biocompatible and superparamagnetic nanomaterial with satisfactory chemical stability and low toxicity, are widely used as targeted drug carriers with target orientation and sustained - release properties.1115 in view of this research, we were inspired to explore a drug delivery system for ga based on mnp - fe3o4 to increase its water solubility and enhance its chemotherapeutic efficiency. to the best of our knowledge, no study to date has been carried out of combination therapy with ga and mnp - fe3o4 for pancreatic cancer. we have investigated the anticancer efficacy of this combination in pancreatic cancer for the first time. in this study, ga was loaded onto mnpfe 3o4 (ga - mnp - fe3o4) as a drug delivery system, and we then identified the cytotoxic effects of ga - mnp - fe3o4 in capan-1 pancreatic cancer cells, investigated the apoptosis induced, and further measured the expression of apoptosis - related proteins, including caspase 3, caspase 9, bax, and bcl-2, to elucidate the possible mechanisms involved. iron (ii) chloride tetrahydrate (fecl2 4h2o) and iron (iii) chloride hexahydrate (fecl3 6h2o) were obtained from sinopharm chemical reagent co ltd (shanghai, china). ammonium hydroxide and citric acid were acquired from shanghai lingfeng chemical reagent co ltd (shanghai, china). ga (kanion pharmaceutical co ltd, jiangsu, china) was dissolved in dimethyl sulfoxide (sigma aldrich, st louis, mo), stored at 20c, and then diluted as needed in rpmi-1640 medium (gibco / brl, carlsbad, ca). monoclonal antibodies, including caspase 3, bax, bcl-2, caspase 9, and -actin, were purchased from santa cruz biotechnology (santa cruz, ca). the horseradish peroxidase - conjugated igg antibody was obtained from nanjing keygen biotech inc (nanjing, china). 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (mtt) and 4, 6-diamidino-2-phenylindole (dapi) were obtained from sigma, and stored in the dark. the fluorescent microscopic images were shot on an olympus ix51 inverted microscope. the optical density at 492 nm was recorded using a multiwell spectrophotometer reader (thermo labsystems, vantta, finland). magnetic fe3o4 nanoparticles were prepared by coprecipitation of fe (iii) and fe (ii) with ammonium hydroxide in a nitrogen environment. in a typical synthetic experiment, fecl3 6h2o 2.61 g and fecl2 4h2o 1.04 g were dissolved in 100 ml of deionized water and heated to 80c, followed by the slow addition of 10 ml of ammonium hydroxide with vigorous stirring for 20 minutes. black fe3o4 precipitates were obtained and washed immediately with distilled water five times by magnetic separation. the precipitates were then dispersed in distilled water with 1.25 g citric acid, which acted as a stabilizer of the colloidal nanocrystallites, with vigorous stirring for 90 minutes. the products, ie, citric acid - coated mnp - fe3o4, were cooled to room temperature and extracted by a magnet. finally, after being washed with ethanol and finally with deionized water, the products were lyophilized and stored at room temperature. before being applied in the present experiment, mnp - fe3o4 were well distributed in rpmi-1640 medium with 10% heated inactivated fetal bovine serum using ultrasound treatment in order to obtain a mnp - fe3o4 colloidal suspension. as previously reported,16 ga at different concentrations was conjugated with the mnp - fe3o4 colloidal suspension by mechanical absorption polymerization at 4c for 48 hours to construct ga - loaded mnp - fe3o4 (ga- mnp - fe3o4), which acted as a drug delivery system. the capan-1 pancreatic cancer cells, obtained from the shanghai institute of cell biology, chinese academy of sciences, were cultured in rpmi-1640 supplemented with 10% heat - inactivated fetal bovine serum, 100 u / ml penicillin, and 100 g / ml streptomycin at 37.0c in humidified air with 5% co2. the cytotoxicity of mnp - fe3o4, ga, and ga - mnp - fe3o4 was studied against capan-1 pancreatic cancer cells with mtt assays. cells at 1 10/ml were seeded in 96-well plates and incubated for 24 hours. the growth medium was then replaced with 200 l of the prepared medium containing free ga and ga - mnp - fe3o4, in which the ga concentration was 0, 0.25, 0.5, 1.0, and 2.0 mol / l. the cells were further incubated for 48 hours, and the relative anticancer activity was assessed using mtt assays. in brief, mtt solutions were added after the treatments and incubated for an additional 4 hours. dimethyl sulfoxide was added to solubilize the formazan crystal, and optical density at 492 nm was recorded. the cell viability fraction (%) was calculated as : the cells were treated according to the above methods for 48 hours, and then fixed with 4% polyoxymethylene prior to washing with phosphate - buffered saline. the washed cells were then stained with dapi 1 mg / ml for 15 minutes in the dark. after the different treatments, expression of apoptosis - related proteins was detected by western blot. in brief, total protein was isolated and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis, and transferred to a polyvinylidene fluoride membrane. after being blocked, the membrane was incubated with primary polyclonal antibodies, either anti - caspase 3, bax, bcl-2, caspase 9, or anti--actin overnight at 4c, and subsequently incubated with horseradish peroxidase - conjugated igg antibody as the secondary antibody for one hour at room temperature. the protein bands were detected by an enhanced ecl detection system (amersham, uk). after normalization by the corresponding expression of -actin, protein expression levels of caspase 3, bax, bcl-2, and caspase 9 were determined by densitometry scans. the f - test was used for significance testing, and p 0.05). in contrast, compared with the control group, the levels of bcl-2 protein in cells treated with ga and ga - mnp - fe3o4 were both significantly downregulated. furthermore, the level of bcl-2 in the ga - mnp - fe3o4 group was lower than that in ga group, and was also not obviously altered when the cells were treated with mnp - fe3o4 alone (p > 0.05). in our study, the ratio of bax / bcl-2 protein expression increased dramatically when the capan-1 pancreatic cancer cells were treated with ga - mnp - fe3o4. a large amount of evidence has shown that the sensitivity of cells to the apoptotic stimulus is determined by the relative ratio of proapoptotic and antiapoptotic members of the bcl-2 family, ie, the mitochondrial - related death switch.22 we deduce that upregulated bax leads to disruption of the integrity of the mitochondrial membrane and promotes release of cytochrome c from the mitochondria, resulting in caspase 9/caspase 3 activation and dna fragmentation. caspase activation is generally considered to be a hallmark of apoptosis, and caspase 3 is the main effector caspase that is involved in apoptosis.23 thus, the ratio of bcl-2/bax might be a critical factor in the cell threshold for undergoing apoptosis induced by ga - mnp - fe3o4. collectively, ga combined with mnp - fe3o4 has been shown to elevate the bax / bcl-2 ratio dramatically, enhance caspase 9/caspase 3 activity, and further stimulate the initiation of mitochondrial apoptosis signaling. based on the above studies, figure 6 schematically illustrates the possible processes by which the ga - mnp - fe3o4 drug delivery system induces a distinct improvement in anticancer activity. firstly, ga was conjugated with the mnp - fe3o4 colloidal suspension by mechanical absorption polymerization to construct ga - mnp - fe3o4, which acted as a drug delivery system. this drug delivery system increased the water solubility of ga and enhanced its chemotherapeutic efficiency after endocytosis, and so has tremendous potential for application in cancer therapy by inducing apoptosis, a preferred mode for killing cancer cells in cancer therapy, and is induced synergistically, resulting in a distinct improvement in anticancer activity. the synthesized mnp - fe3o4 capped with citric acid were characterized by transmission electron microscopy. as shown in figure 1, mnp - fe3o4 were observed to have a spherical shape, with a diameter of about 20 nm. it has suitable dimensions to escape renal rapid excretion, as well as to avoid components of the reticular endothelial system, thus facilitating potentially passive targeting of drugs to tumors via the enhanced permeation and retention effect and active targeting with target orientation of magnetic field, then increasing the accumulation of drugs in tumor cells after endocytosis.17 ga exhibits potent anticancer activity in many kinds of cancer cells.47 however, whether or not ga induces apoptosis of capan-1 pancreatic cancer cells, and the molecular mechanisms involved, is not clear. in addition, the therapeutic effect of ga is limited due to low water solubility (0.05). in contrast, compared with the control group, the levels of bcl-2 protein in cells treated with ga and ga - mnp - fe3o4 were both significantly downregulated. furthermore, the level of bcl-2 in the ga - mnp - fe3o4 group was lower than that in ga group, and was also not obviously altered when the cells were treated with mnp - fe3o4 alone (p > 0.05). in our study, the ratio of bax / bcl-2 protein expression increased dramatically when the capan-1 pancreatic cancer cells were treated with ga - mnp - fe3o4. a large amount of evidence has shown that the sensitivity of cells to the apoptotic stimulus is determined by the relative ratio of proapoptotic and antiapoptotic members of the bcl-2 family, ie, the mitochondrial - related death switch.22 we deduce that upregulated bax leads to disruption of the integrity of the mitochondrial membrane and promotes release of cytochrome c from the mitochondria, resulting in caspase 9/caspase 3 activation and dna fragmentation. caspase activation is generally considered to be a hallmark of apoptosis, and caspase 3 is the main effector caspase that is involved in apoptosis.23 thus, the ratio of bcl-2/bax might be a critical factor in the cell threshold for undergoing apoptosis induced by ga - mnp - fe3o4. collectively, ga combined with mnp - fe3o4 has been shown to elevate the bax / bcl-2 ratio dramatically, enhance caspase 9/caspase 3 activity, and further stimulate the initiation of mitochondrial apoptosis signaling. based on the above studies, figure 6 schematically illustrates the possible processes by which the ga - mnp - fe3o4 drug delivery system induces a distinct improvement in anticancer activity. firstly, ga was conjugated with the mnp - fe3o4 colloidal suspension by mechanical absorption polymerization to construct ga - mnp - fe3o4, which acted as a drug delivery system. this drug delivery system increased the water solubility of ga and enhanced its chemotherapeutic efficiency after endocytosis, and so has tremendous potential for application in cancer therapy by inducing apoptosis, a preferred mode for killing cancer cells in cancer therapy, and is induced synergistically, resulting in a distinct improvement in anticancer activity. a ga - mnp - fe3o4 drug delivery system was developed to increase the water solubility of ga and enhance its chemotherapeutic efficiency. mnp - fe3o4 enhanced the anticancer activity of ga in capan-1 pancreatic cancer cells by inducing apoptosis, and the synergistic effect may be due to regulation of various antiapoptotic and proapoptotic gene products, including bax, bcl-2, caspase 9, and caspase 3. all these characteristics demonstrate that combination therapy with ga and mnp - fe3o4 represents a promising strategy in the treatment of pancreatic cancer.	backgroundgambogic acid (ga), a potent anticancer agent, is limited in clinical administration due to its poor water solubility. the aim of this study was to explore a drug delivery system based on magnetic fe3o4 nanoparticles (mnp - fe3o4) conjugated with ga to increase water solubility of the drug and enhance its chemotherapeutic efficiency for pancreatic cancer.methodsga was conjugated with the mnp - fe3o4 colloidal suspension by mechanical absorption polymerization to construct ga - loaded mnp - fe3o4, which acted as a drug delivery system.resultscombination therapy with ga and mnp - fe3o4 induced remarkable improvement in anticancer activity, which was demonstrated by optical microscopic observations, mtt assay, and nuclear dapi staining. furthermore, the possible signaling pathway was explored by western blot. in capan-1 pancreatic cancer cells, our observations demonstrated that this strategy could enhance potential anticancer efficiency by inducing apoptosis. the mechanisms of the synergistic effect may be due to reducing protein expression of bcl-2 and enhancing that of bax, caspase 9, and caspase 3.conclusionthese findings demonstrate that a combination of ga and mnps - fe3o4 represents a promising approach to the treatment of pancreatic cancer.
multiple sclerosis (ms) is the most common degenerative and inflammatory disease of the central nervous system which mainly affects individuals in youth ages. one of the frequent symptoms of the disease is tremor which can severely cause disability and affect daily living and quality of life in individuals who have ms. the possible effect of levetiracetam on ms patients is surveyed in a few previous studies. however, the efficacy of levetiracetam in treatment of ms - related tremor still remains controversial. in this study, we sought to determine if levetiracetam is effective on treatment of tremor in patients with ms. eligibility criteria included : a diagnosis of multiple sclerosis (according to the 2010 revised mcdonald criteria) ; an age of 18 to 55 years ; a score of between 1 and 6 on the kurtzke expanded disability status scale (edss, which ranges from 0 to 10, with higher scores indicating more severe disability) ; and existence of holmes tremor in physical exam. exclusion criteria were as follows : prior use of levetiracetam ; past history of epilepsy ; pregnancy or lactation ; history of renal failure ; any condition that would preclude safe and complete participation in the study ; and lack of appropriate adherence to the study protocol. furthermore, all of the patients were assessed for their edss and tremor rating group scale (trgs) score before starting the intervention. eligible patients were given 500 mg levetiracetam (bakhtar shimi daroo company manufacture in iran) twice a day for 1 week. the drug dosage increased 1000 mg per week until reaching the peak dose of 50 mg / kg. then there was a 2 week period of washout (administration of levetiracetam was discontinued for 2 weeks). after the washout period, first phase was repeated until reaching to peak point again (500 mg levetiracetam twice a day for 1 week and increased 1000 mg per week until reaching the peak dose of 50 mg / kg). to evaluate tremor rate, we used trgs (tremor rating group scale) scale with the total score computed from 0 (no tremor) to 68 (severe tremor, unable to stand without assistance). to determine the disability, we used the edss (which ranges from 0 to 10, with higher scores indicating more severe disability). we measured the trgs four times : first, at the start point ; second, 3 weeks after reaching to maximum dosage ; third, after washout period and, forth, at the end of the study. the statistical analyses were performed using the spss software (version 20.0 shicago) descriptive analyses were adopted for demographic and clinical characteristics reporting the variables as means 1sd. kolmogrove - smear nov test were used for normality distribution variables (age, disease duration, edss). differences among groups were assessed using repeated measures of anova with the tukey post hoc test. the study has been approved by the local ethic committee before initiation of the study. eligibility criteria included : a diagnosis of multiple sclerosis (according to the 2010 revised mcdonald criteria) ; an age of 18 to 55 years ; a score of between 1 and 6 on the kurtzke expanded disability status scale (edss, which ranges from 0 to 10, with higher scores indicating more severe disability) ; and existence of holmes tremor in physical exam. exclusion criteria were as follows : prior use of levetiracetam ; past history of epilepsy ; pregnancy or lactation ; history of renal failure ; any condition that would preclude safe and complete participation in the study ; and lack of appropriate adherence to the study protocol. furthermore, all of the patients were assessed for their edss and tremor rating group scale (trgs) score before starting the intervention. eligible patients were given 500 mg levetiracetam (bakhtar shimi daroo company manufacture in iran) twice a day for 1 week. the drug dosage increased 1000 mg per week until reaching the peak dose of 50 mg / kg. then there was a 2 week period of washout (administration of levetiracetam was discontinued for 2 weeks). after the washout period, first phase was repeated until reaching to peak point again (500 mg levetiracetam twice a day for 1 week and increased 1000 mg per week until reaching the peak dose of 50 mg / kg). to evaluate tremor rate, we used trgs (tremor rating group scale) scale with the total score computed from 0 (no tremor) to 68 (severe tremor, unable to stand without assistance). to determine the disability, we used the edss (which ranges from 0 to 10, with higher scores indicating more severe disability). we measured the trgs four times : first, at the start point ; second, 3 weeks after reaching to maximum dosage ; third, after washout period and, forth, at the end of the study. the statistical analyses were performed using the spss software (version 20.0 shicago) descriptive analyses were adopted for demographic and clinical characteristics reporting the variables as means 1sd. kolmogrove - smear nov test were used for normality distribution variables (age, disease duration, edss). differences among groups were assessed using repeated measures of anova with the tukey post hoc test. the study has been approved by the local ethic committee before initiation of the study. among 25 patients who were initially enrolled, two were excluded from the final analysis (lack of appropriate adherence to the study protocol). three patients were not initially included ; two with edss of more than six and the other one who was pregnant. a total of 20 patients (17 females and 3 males) completed the study. at inclusion, the mean sd duration of the disease from the diagnosis to the study onset was 6.8 4.9 years. the mean sd duration of having tremor was 2.6 1.5 years and, the mean sd score of edss was 2.5 1.6. the average of tremor in different times according to trgrs scale average of tremor rate the drug was well tolerated and no serious adverse events were observed during follow - up. the drug was well tolerated and no serious adverse events were observed during follow - up. our findings suggest a significant difference in tremor rate before and after the intervention. it can be implied that the tremor rate have a declining tendency although it surged again after washout period. tremor is one of the most challenging issues in ms patients ; the treatment of which remains as a matter of debate. there are a number of previous studies that evaluate efficacy of a range of drugs in treatment of ms related tremor, including primidone, gluthetimide, intrathecal baclofen, and isoniazid. the role of levetiracetam on post - ischemic holmes tremor has been previously investigated ; though, there is no convincing evidence on such effects of this drug. levetiracetam is an antileptic drug which also attrected the attention in ms because of its possible anti - inflammatory effect. in experimental studies, likewise, there is a crossover study on six patients by solaro., which showed the effect of levetiracetam on the modification of kinetic parameters in ms patients. there is also a randomized, placebo - controlled, double - blind, crossover study which accomplished by feys. in 14 patients with ms who received increasing dose of levetiracetam. they evaluated the safety and efficacy of levetiracetam and showed it is safe but ineffective for decreasing tremor severity in ms patients.. it may be because of the difference in inclusion criteria and long term of intervention and washout period. in conclusion, this study indicated the possible effect of levetiracetam on treatment of ms related tremor. our results suggest that levetiracetam can be considered as an additional option for treatment ms- related tremor. the elucidation of the results is limited by small sample size, gender and, short duration of drug intake. further studies with larger sample size in both genders in long - term duration needed to confirm this preliminary results and the mechanism of levetiracetam in treatment ms - related tremor.	background : one of the frequent symptoms of multiple sclerosis (ms) is tremor which can severely cause disability. treatment of tremor in ms patients is still very challenging to manage. in this study, we sought to determine the efficacy of levetiracetam on treatment of ms - related tremor.materials and methods : this clinical trial study was conducted among 22 patients from july 2012 to april 2012 in alzahra - hospital, isfahan, iran. patients were given 500 mg levetiracetam twice a day for 1 week. the drug dosage increased 1000 mg per week until reaching the peak dose of 50 mg / kg. after a 2 week period of washout, first phase was repeated. the subjects were assessed at baseline, after first intervention, after wash - out period, and after second intervention.results:a total of 20 patients (17 females and 3 males) were enrolled in our study. there was a significant difference among tremor rate before and after intervention (p = 0.001). the drug was well tolerated and without any serious side effect during follow-up.conclusion:our findings suggest that although levetiracetam caused a decrease tremor rate in ms it surged again after washout period.
	the heme - cytochrome p-450 complexes represent sensitive metabolic systems for examining the biological impact of metals on important cellular functions. many metals, both in the inorganic form and bound to organic moieties, potently induce heme oxygenase, the rate limiting enzyme of heme degradation. the resulting increase in the rate of heme breakdown is reflected in a marked depression of cellular cytochrome p-450 content and impairment of the oxidative metabolism of natural and foreign chemicals dependent on this hemeprotein. organometal complexes do not mimic in all their aspects the actions of the inorganic elements which they contain. for example, organotins, in contrast to inorganic tin, produce a prolonged induction response of heme oxygenase in the liver but not in the kidney. co - protoporphyrin is a much more potent inducer of heme oxygenase in liver than is inorganic cobalt ; and sn - protoporphyrin inhibits heme oxygenase activity nearly completely, whereas inorganic tin is a powerful inducer of the renal enzyme. contrasting effects on heme metabolism exist as well within the metalloporphyrin species as demonstrated by the effects in vivo of co - protoporphyrin and sn - protoporphyrin on heme oxygenase activity ; the former induces the enzyme whereas the latter potently inhibits it. in vitro, however, both compounds competitively inhibit heme oxidation activity. these differences, among others which characterize metal actions in vivo and in vitro attest to the importance of pharmacokinetic, adaptive and other host factors in defining the responses of the heme - cytochrome p-450 systems to the impact of metals in the whole animal.imagesfigure 5.
multiple intracellular signaling pathways play roles in myogenic differentiation via many hormones and growth factors. these include the extracellular signal - regulated kinase (erk)/mapk, p38 mapk and phosphatidylinositol 3-kinase (pi3k)/akt pathways. first, the erk / mapk pathway elicits differentiation signals to promote or inhibit differentiation and fusion in the presence of mitogens. the p38 mapk pathway is required for myogenic differentiation and also promotes skeletal muscle differentiation, at least in part via activation of myocyte enhancer - binding factor 2 (mef2)c. in addition, pi3k / akt signaling positively regulates myogenic differentiation when insulin - like growth factor (igf) is stimulated. the janus kinase (jak)-signal transducer and activator of transcription (stat) pathway also has an important role in the regulatory mechanism of myogenic differentiation ; however, each factor affects myogenic differentiation in an opposite manner. this review provides an overview of current research on the role of the jak - stat pathway and its regulatory mechanism in myogenic differentiation. this event is initiated from muscle precursors called myoblasts, which arise from the somatic mesoderm. however, a muscle injury, exercise, or a pathological state may lead to activation, causing myoblasts to re - enter the cell cycle and proliferate. after proliferation, cells irreversibly withdraw from the cell cycle, differentiate and fuse with existing myofibrils. myoblasts differentiate into mononucleated myocytes in the early differentiation stage, and they fuse into multinucleated myotubes in the late stage of differentiation. the multinucleated myotubes express many muscle structural proteins, such as myosin heavy chain (mhc), muscle creatine kinase (mck) and -actin. myoblasts originate from the mesoderm and are converted to skeletal muscle lineage myoblasts after myod and myf5 expression. when the growth factor or mitogen from myoblast cultures is withdrawn, proliferating cells exit from the cell cycle and initiate differentiation. the multinucleated myotubes express the muscle specific proteins, mhc (myosin heavy chain), muscle creatine kinase (mck) and -actin. two transcription factor families, mrfs (myogenic regulatory factors) and mef2, are known to be critical for regulating myogenic differentiation. at the onset of myogenesis in the embryo, myf5 and then myod myf5 and myod are members of the mrf family, which belongs to the basic helix - loop - helix (bhlh) protein family that consists of myod, myf5, mrf4 and myogenin ; these proteins are able to initiate the myogenic program and convert non - muscle cells to the skeletal muscle lineage. myf5 and myod act as muscle lineage components and also play important roles in the induction of the myogenin gene. furthermore, myf5 deficiency, leading to a lack of amplification of myoblasts and loss of myod, reduced myogenic differentiation. this suggests that myf5 regulates the proliferation rate of myoblasts ; whereas myod is required for the differentiation potential of skeletal myoblasts. the appearance of myogenin reflects that cells have irreversibly withdrawn from the cell cycle and entered differentiation. mrfs normally form heterodimers with e2a gene products (e12/e47), and bind to the e box consensus sequences (canntg) in the promoters of muscle - specific genes and then induce transcription of target genes. the other family is the myocyte enhancer - binding factor 2 (mef2) proteins ; this group includes mef2a, 2b, 2c and 2d. the mef2 family functions as accessory regulators of muscle gene expression and differentiation. in addition, they can physically bind to and cooperate with mrfs to synergically induce many muscle - specific genes. however, silencing of mef2 at early stages of adult myogenesis impairs myoblast fusion and muscle structural protein gene expression, suggesting mef2 is critical at the early stages of adult myoblast fusion. the transcription factors regulate myogenic differentiation through several signaling pathways, mainly, the irs - pi3k - akt and mek / erk. the irs - pi3k - akt pathway promotes myogenic differentiation through myogenin expression by mef2. in contrast, phosphorylated mek1 directly associates with myod, which prevents myod binding to the myogenin promoter, resulting in inhibition of muscle differentiation. the c2c12 cells are murine myoblast cells derived from mouse satellite cells, which differentiate into multinucleated myotubes upon withdrawal of serum or mitogens from myoblast cultures. therefore, c2c12 cells are very useful for studying myoblast differentiation and proliferation in vitro. moreover, myotoxins such as bupivacaine (marcaine), cardiotoxin (ctx) and notexin (ntx), venoms isolated from snakes, are the easiest and most reproducible way to induce regeneration in vivo. injection of ctx in the adult mouse tibialis anterior muscle is a widely used method to study myogenic differentiation for muscle regeneration. jaks are a family of non - receptor tyrosine kinases, comprised of jak1, jak2, jak3 and tyk2 in mammals. the stats family are located downstream of jaks and seven proteins are identified in mammals : stat1, stat2, stat3, stat4, stat5a, stat5b and stat6. the jak - stat pathway is activated by ligands (such as cytokines or growth factors) binding to their cognate receptor. the binding of ligand to the receptor activates receptor - associated jaks by phosphorylation of specific tyrosine residues. activated stats dissociate from the receptor and, in turn, dimerize and translocate into the nucleus where they function as transcription factors to regulate expression of target genes. the jak - stat pathway is important in hematopoiesis, inflammation, immunity and immune - related diseases. the jak - stat pathway is also linked to cell growth, proliferation and differentiation in many cell types, including immune cells, hematopoietic stem cells, osteoblasts, neuronal precursor cells and myoblasts. suggested the possibility that activation of the jak - stat pathway is correlated with myogenic differentiation. in that report, skeletal muscle serotonin increased the expression of myogenin and triggered activation of the jak - stat pathway in primary myoblasts. they elucidated that the nuclear translocation of stat3 by serotonin is related to the upregulation of myogenin, a transcription factor involved in myogenic differentiation. these findings provided the basis for further understanding of the role of the jak - stat pathway in myogenic differentiation. in addition, among transcriptional profile of gtp (guanosine 5-triphosphate)-mediated differentiation of c2c12 myoblasts, genes such as interleukin 6, pim-1 and il1ra (interleukin 1 receptor antagonist homolog 1) are upregulated, and it is suggested that jak - stat pathway can play a crucial role in myogenic differentiation. in next section, we will focus on the role of the jak - stat pathway in the differentiation and proliferation of skeletal muscle myoblasts. knockdown studies showed that myogenic differentiation was accelerated and proliferation was inhibited in both c2c12 cells and primary myoblast cells. jak1-sirna induced the accelerated expression of myod and mef2 and enhanced expression of mef2-dependent genes. jak1-sirna also upregulated the prominent cyclin - dependent kinase 2 inhibitors, p21cip1 and p27kip1, in differentiating cells as well as proliferating cells and downregulated the inhibitor of differentiation, id1. in addition, jak1-overexpressed cells had decreased expression of mhc and mgn (myogenin), which was rescued by stat1-sirna transfection. leukemia inhibitory factor (lif) induced myogenic proliferation through the formation of a stat3 and stat1 complex. in an in vivo study this result revealed jak1-stat1-stat3 is involved in myogenic regeneration, required for myoblast proliferation and serves as a key check point to prevent myoblasts from premature differentiation. the repressive role of jak1-stat1-stat3 on myogenic differentiation was supported by another published paper from the same group. a member of the cytokine interleukin (il)-6 family, oncostatin m (osm), inhibited differentiation of myoblasts through activation the jak1-stat1-stat3 pathway. osm decreased expression of mef2a and the transcriptional activity of mef2 and myod ; whereas, expression of id1 and id2 increased. interestingly, mef2 co - precipitated with stat1, but an n - terminal deletion mutant of mef2 did not. this result revealed that mef2 interacts with stat1 through the n - terminus of mef2. in addition, a pull down assay of mef2 showed the c - terminal portion of stat1 is involved in interacting with mef2. these results implied that the stat1 interaction with mef2 is able to inhibit myogenic differentiation through repression of mef2 transcriptional activity. in ctx - injected mice, in addition, a tibialis anterior muscle transfected with an osm - expressing vector, still had large unrepaired regions induced by ctx. taken together, these data suggested that jak1-stat1-stat3 activation inhibited myoblast differentiation and muscle regeneration, which resulted from the formation of the mef2 and stat1 complex and that mef2 and stat1 are the main effectors for suppression of myogenic differentiation. cardiotrophin-1 (ct-1), another member of the il-6 family, is also a potent inhibitor of skeletal muscle differentiation. however, the inhibitory effect of ct-1 on differentiation is not due to stat3 signaling, but to the mek / erk pathway. even though ct-1 activated stat3, inhibition of the transcriptional activity of myod through mek activation induces suppression of myogenic differentiation. expression of mhc, mgn, mef2 and myod decreased after treatment with the jak2 inhibitor ag490 and jak2-sirna transfection. jak2-sirna also significantly reduced the expression of myogenin-, mrf-, mef2- and myod - dependent luciferase reporter genes. these findings indicated that the pro - differentiation effect of the jak2-stat2-stat3 signaling pathway is partially mediated by myod and mef2. in general, myod directly binds to mef2 and enhances mef2-dependent transcription through its own transcriptional activities, which results in cooperative enhancement of myod- and mef-2-dependent myogenic differentiation. in addition, the hgf - erk and igf - akt pathways were regulated by the jak2-stat2-stat3 pathway. therefore, the study s results suggested that jak2-stat2-stat3 signaling pathway is indispensable for myogenic differentiation. the expression profiles of jak1, jak2, stat1 and stat3 were confirmed in primary human skeletal muscle cells. lif increased the number of c2c12 cells and primary rat satellite cells, which were decreased by incubation with ag490. the phosphorylation of jak2 and stat3 and stat3-activated luciferase activity increased in the presence of lif, which indicated that lif induces proliferation of muscle satellite cells and that activation of the jak2 and stat3 signaling pathway at least partially contributes to the increased satellite cell proliferation. we provided the first evidence that jak3 is expressed in myoblast cells, and jak3 inhibition promotes precocious myogenic differentiation and plays important roles in terminal differentiation. we demonstrated an inhibitor of jak3, whip154, inhibited the formation of multinucleated myotubes by cell fusion and also induced precocious myogenic differentiation. jak3-sirna increased expression of mgn at the mrna and protein levels and endogenous igf - ii mrna expression during differentiation. interestingly, when undergoing differentiation, whip154 not only decreased stat1 phosphorylation but stat3 phosphorylation also increased. these data showed that the precocious myogenic differentiation by jak3 inhibition is prompted via downregulation of stat1 and upregulation of stat3 ; however, unfortunately it is not clear how the activation of stat1 and stat3 is regulated in opposite directions. jak3 inhibition increases expression of a marker of early differentiation, mgn, and a marker of late differentiation, mhc. in contrast with a previous study, the jak2 inhibitor ag490 did not have any change on myogenic differentiation. we explained that this effect is due to the dosage of ag490 and also concluded that jak2 may be more important for survival of myoblasts with differentiation potential. stat3 activity increased in proliferation conditions, and knockdown of stat3 reduced lif - induced myoblast proliferation. when the expression of stat3 was induced by 4-ht (hydroxytamoxifen), myogenin expression was reduced and the suppression of differentiation - induced growth (the s - g2/m phase in the cell cycle) was restored. on the other hand, stat3 activity gradually increased during differentiation and knockdown of stat3 inhibited differentiation, suggesting that stat3 promotes myoblast differentiation. the dual role of stat3 in proliferation and differentiation is regulated by interaction with the transcription factor, myod. the direct interaction of stat3-myod inhibits differentiation through reciprocal inhibition of their dna binding activities, which are proved through transfection of myod or stat3 construct. on the contrary to this, stat3 bound with myod contributed to the stage of differentiation, suggesting that activation of stat3 induced myogenic differentiation through binding with myod. therefore, the interaction between stat3 and myod is considered an important mechanism for the role of stat3 during proliferation and differentiation of myoblasts. fer is an intracellular tyrosine kinase that associates with stat3 in mammalian cells and is thought to be a mediator for regulation of stat3 activity in myogenic differentiation. a study demonstrated that fer is a mediator for stat3 activation in insulin - pi3k pathway - eliciting myogenic differentiation. fer and jak1 co - immunoprecipitated in proliferating cells. however, insulin caused phosphorylation of fer that led to dissociation from jak1. this interaction between fer and stat3 was enhanced and sustained until 48 h after insulin treatment when myotubes appeared in the treated culture. a relevant explanation for this is that fer mediates activation of stat3 to enhance myogenic differentiation by insulin stimulation in myogenic cells. however, further studies are needed to identify the definite role of fer in differentiation. socs is one of the transcripts of stat, which acts as a negative regulator in the positive autoregulatory loop of the jak - stat pathway to suppress further signaling. the socs, pias (protein inhibitors of activated stats) and ptps (protein tyrosine phosphatases) are major classes of negative regulators. this study showed that igf - i increased socs3 transcription through stat3 activation during differentiation. moreover, overexpression of socs3 enhanced srf (serum response factor)-dependent -actin promoter activity during differentiation. srf is a transcription factor that is associated with the differentiation and fusion of myoblasts. consequently, activation of stat3 by igf - i upregulated socs3 stimulates srf transcription factor - mediated myogenic differentiation. therefore, it is likely that socs3 leads to endogenous igf - i - mediated myoblast differentiation. individual knockdown of socs1, socs3 and pias inhibited myogenic differentiation of both primary myoblasts and c2c12 cells ; whereas, overexpression promoted myogenic differentiation. importantly, this report proved strongly that socs1 and socs3 promote differentiation through inhibition of jak1 activation and phosphorylation of the upstream receptor of jak, glycoprotein of 130 (gp130), respectively. also, pias prevents stat1 or stat3 binding to dna, which contributes to the promotion of myogenic differentiation. according to inaba and colleagues, modulation of igf - i receptor signal transduction is a suppressive mechanism of socs1 on myogenic differentiation. generally, igf - i promotes myogenic differentiation via the irs - pi3k - akt pathway and inhibits myogenic differentiation via mek / mapk. however, socs1 induced imbalance between the mek / mapk and irs - pi3k - akt pathways by enhancement of mek and suppression of the irs-1/akt signaling pathway. the irs - pi3k - akt pathway promotes myogenic differentiation through myogenin expression by mef2 ; while, phosphorylated mek1 directly associates with myod, which prevents myod binding to the myogenin promoter and results in inhibition of muscle differentiation. although the effect of jak or stat on the negative role of socs1 was not examined, socs may promote myogenic differentiation through regulation of stat activity. we have described the role of the jaks - stats pathways in the proliferation and differentiation of myoblasts. jak1-stat1-stat3 activation plays a crucial role in proliferation ; whereas, activation of jak2 and inhibition of jak3 are responsible for myogenic differentiation. interestingly, unlike jak2, jak3 regulates myogenic differentiation negatively, through stat1 downregulation and stat3 upregulation. the specificity of jak type is likely able to determine differentiation or proliferation in myoblasts. it is also important which transcription factor interacts with stat3 to determine proliferation or differentiation. jak1 activates stat1 and stat3, and activated stat1 associates with transcription factor mef2 in proliferation. socs1, a negative regulator of stats, is expressed, which inhibits differentiation of myoblasts.. however, activation of jak3 phosphorylates stat1 and suppresses stat3 activation, which inhibits differentiation. activated stat3 forms a complex with myod and the myod - mef2 interaction, which stimulates transcription of myod- and mef2-dependent muscle specific genes. it is a mystery whether fer, a mediator of stat3 activity, is associated with this process. however, it is certain that the pi3k / akt pathway contributes to differentiation, especially in igf - induced myogenic differentiation. socs1, socs3 and pias inhibit activation of jak1, gp130 and stat1/3 binding to dna, respectively. although the role of jak1, 2 and 3 in myogenic differentiation was elucidated, the role of tyk2 is not determined yet. moreover, most previous studies have verified the effect of the jak - stat pathway on muscle differentiation in in vitro culture systems. therefore, we need more evidence from in vivo animal experiments to better understand muscle regeneration. future studies are expected to define more detailed roles of the jak - stat pathway and other regulatory mechanisms on myogenic differentiation.	myogenic differentiation plays an important role in muscle regeneration and is regulated by two transcription factor families, mrfs and mef2, which induce differentiation of myoblasts through expression of the muscle - specific gene, myogenin. in addition, many intracellular signaling pathways are also involved in myogenic differentiation, including p38 mapk, erk / mapk and pi3k / akt. the jak - stat pathway is activated by various cytokines and positively or negatively regulates the differentiation of myoblasts. jak1 plays a notable role in proliferation ; whereas, jak2 and jak3 function mainly in differentiation. the stats, molecules downstream of jak, regulate myogenesis. with jak1, stat1 promotes proliferation, while stat3 has a dual effect on proliferation and differentiation. the jak - stat negative regulator, socs, is also associated with myogenesis ; although, its role is controversial. in this review, we will discuss the role of the jak - stat pathway on myogenic differentiation.
dna polymerases are organized into seven families : a, b, c, d, x, y, and reverse transcriptase [1, 2 ]. among these families, dna polymerases are involved in dna replication, dna repair, dna lesion bypass, antibody generation, and sister chromatid cohesion. despite these diverse roles, dna polymerases catalyze the nucleotidyl transfer reaction using a two divalent metal ion mechanism with at least one positively charged residue that functions as a general acid at their active site, follow a similar minimal kinetic pathway, and share a similar structural architecture consisting of the fingers, palm, and thumb subdomains [8, 9 ]. surprisingly, the polymerization fidelity of eukaryotic dna polymerases spans a wide range : one error per one to one billion nucleotide incorporations (10 to10). the y - family dna polymerases are known for catalyzing nucleotide incorporation with low fidelity and poor processivity. these enzymes are specialized for translesion dna synthesis which involves nucleotide incorporation opposite and downstream of a damaged dna site. lesion bypass can be either error - free or error - prone depending on the dna polymerase and dna lesion combination. to accommodate a distorted dna substrate, y - family dna polymerases utilize several features : a solvent - accessible and conformationally flexible active site, smaller fingers and thumb subdomains, an additional subdomain known as the little finger, the little finger and polymerase core domains move in opposite directions during a catalytic cycle, and a lack of 3 5 exonuclease activity. unfortunately, these features, which facilitate lesion bypass, may also contribute to the low fidelity of a y - family dna polymerase during replication of a damaged or undamaged dna template. thus, it is important to understand the mechanism and fidelity of the y - family dna polymerases. saccharomyces cerevisiae dna polymerase (ypol), a y - family dna polymerase, is critical for the error - free bypass of uv - induced dna damage such as a cis - syn thymine - thymine dimer [1519 ]. to date, pol remains the only y - family dna polymerase with a confirmed biological function. ypol is organized into a polymerase domain, ubiquitin - binding zinc finger (ubz) domain, and proliferating cell nuclear antigen- (pcna) interacting peptide (pip) motif (figure 1). x - ray crystal structures of ypol 's catalytic core have been solved alone as well as in complex with a cisplatin - dna adduct and an incoming nucleotide. due to a lack of structures for full - length ypol, it is unclear if the c - terminal residues 514632 interact with dna and contribute to the polymerase function of ypol. using pre - steady - state kinetic techniques, we have measured the base - substitution fidelity of full - length and truncated ypol (figure 1) catalyzing nucleotide incorporation into undamaged dna. in addition, we have determined the dna binding affinity of both full - length and truncated ypol. our results show that the c - terminus of ypol has a minor effect on the dna binding affinity and the base substitution fidelity of this lesion bypass dna polymerase. materials were purchased from the following companies : [-p ] atp, mp biomedicals (solon, oh) ; biospin columns, bio - rad laboratories (herclues, ca) ; dntps, ge healthcare (piscataway, nj) ; oligodeoxyribonucleotides, integrated dna technologies, inc. (coralville, ia) ; and optikinase, usb (cleveland, oh). the primer strand 21-mer or blunt - end 16-mer was 5-radiolabeled with [-p]atp and optikinase. then, the 21-mer was annealed to the appropriate 41 mer template (table 1) and the palindromic blunt - end substrates were annealed as described previously. the catalytic core of ypol (1513) containing an n - terminal mgssh6ssglvprgsh tag was purified as described previously. all experiments were performed in reaction buffer a which contained 40 mm tris - hcl ph 7.5 at 23c, 5 mm mgcl2, 1 mm dtt, 10 g / ml bsa, and 10% glycerol. a rapid chemical - quench flow apparatus (kintek, pa, usa) was used for fast reactions. for burst assays, a preincubated solution of ypol (320 nm) and 5-[p]-labeled d-1 dna (480 nm) was mixed with dttpmg (100 m). to measure the dissociation rate of the ypoldna binary complex, a preincubated solution of ypol (50 nm) and 5-[p]-labeled d-1 dna (100 nm) was mixed with a molar excess of unlabeled d-1 dna (2.5 m) for various time intervals prior to initiating the polymerization reaction with dttpmg (150 and 400 m for truncated and full - length ypol, resp.) for 15 s. for single - turnover kinetic assays, a preincubated solution of ypol (150 nm) and 5-[p]-labeled dna (30 nm) was mixed with an incoming dntpmg (0.4800 m). reaction products were analyzed by sequencing gel electrophoresis (17% acrylamide, 8 m urea, 1 tbe running buffer), visualized using a typhoon trio (ge healthcare), and quantitated with imagequant software (molecular dynamics). the equilibrium dissociation constant (kd) of the ypoldna binary complex was determined using two techniques. first, an electrophoretic mobility shift assay (emsa) was employed by adding increasing concentrations of ypol (10450 nm) into a fixed concentration of 5-[p]-labeled d-1 dna (10 nm) in buffer a. the solution established equilibrium during a 20-minute incubation period. then, the binary complex was separated from unbound dna using a 4.5% native polyacrylamide gel and running buffer as previously described except the final concentration of tris was adjusted to 40 mm. increasing concentrations of ypol (2300 nm) were titrated into a fixed concentration of f-8 dna (25 nm) in buffer a (devoid of bsa). the f-8 dna substrate (table 1) was excited at a wavelength of 312 nm with emission and excitation slit widths of 5 nm. the emission spectra were collected at 1 nm intervals from 320 to 500 nm using a fluoromax-4 (jobin jvon horiba). emission background from the buffer and intrinsic protein fluorescence were subtracted from each spectrum. for the pre - steady - state burst assay, the product concentration was graphed as a function of time (t) and the data were fit to the burst equation (1) using the nonlinear regression program, kaleidagraph (synergy software) : (1)[product]=a[1exp (k1t)+k2 t ]. a represents the fraction of active enzyme, k1 represents the observed burst rate constant, and k2 represents the observed steady - state rate constant. data for the emsa were graphed by plotting the concentration of the binary complex as a function of enzyme concentration (e0) and fitting it to a quadratic equation (2) : (2)[edna]=0.5(kddna+e0+d0) 0.5[(kddna+e0+d0)24e0d0]1/2. d 0 is the dna concentration. for the fluorescence titration experiments, a modified quadratic equation (3) was applied to a plot of the fluorescence intensity (f) measured at 370 nm versus enzyme concentration : (3)[f]=fmax + [(fmin fmax) 2d0 ] {(kddna+e0+d0) [(kddna+e0+d0)24e0d0]1/2}.fmax and fmin represent the maximum and minimum fluorescence intensity, respectively. for the rate of dna dissociation from the binary complex, a single - exponential equation (4) was applied to a plot of product concentration versus time : (4)[product]=a[exp (kofft)]+c. a represents the reaction amplitude, koff is the observed rate constant of dna dissociation, and c is the concentration of the radiolabeled dna product in the presence of a dna trap for unlimited time. for the single - turnover kinetic assays, a plot of product concentration versus time was fit to a single - exponential equation (5) to extract the observed rate constant of nucleotide incorporation (kobs) : (5)[product]=a[1exp (kobst) ]. to measure the maximum rate constant of incorporation (kp) and the apparent equilibrium dissociation constant (kd) of an incoming nucleotide, the extracted kobs values were plotted as a function of nucleotide concentration and fit to a hyperbolic equation (6) : (6)[kobs]=kp[dntp](kd+[dntp ]). the free energy change (g) for a correct and incorrect nucleotide substrate dissociating from the ednadntp complex, r is the universal gas constant and t is the reaction temperature in kelvin. previously, transient state kinetic techniques have been used to characterize full - length ypol at 30c. therefore, we first performed a burst assay (see section 2) to ensure that our purified proteins, truncated and full - length ypol (figure 1), behaved in a similar manner at 23c. compared to wild - type ypol, the truncated construct contains only the polymerase domain (figure 1). a preincubated solution of ypol (320 nm) and 5-[p]-labeled 21/41 mer d-1 dna (480 nm) was mixed with dttpmg (100 m) and quenched with edta at various times. product concentration was plotted as a function of time and was fit to (1), since there were two distinct kinetic phases : a rapid, exponential phase and a slow, linear phase (data not shown). biphasic kinetics of nucleotide incorporation indicated that the first turnover rate was the rate of nucleotide incorporation occurring at the enzyme 's active site while subsequent turnovers (i.e., linear phase) were likely limited by the dna product release step as demonstrated by full - length ypol at 30c and other dna polymerases [23, 29, 30 ]. the equilibrium dissociation constant for the binary complex of ypoldna (kd) was measured to determine if the c - terminus of ypol affects dna binding affinity (scheme 1). for example, varying concentrations of full - length ypol (10450 nm) were incubated with a fixed concentration of 5-[p]-labeled d-1 dna (10 nm) before separating the binary complex from the unbound dna on a native gel (figure 2(a)). then, a quadratic equation (2) was applied to a plot of the binary complex concentration versus ypol concentration which resolved a kd of 16 1 nm (figure 2(b) and table 2). under similar reaction conditions, the kd of truncated ypol was estimated to be 34 3 nm, a binding affinity (1/kd) value that is 2-fold weaker than that of full - length ypol (table 2). to corroborate these estimated kd values, we measured the true kd for the ypoldna complex using a fluorescence titration assay. an analog of da, 2-aminopurine, was embedded into the 41 mer template of f-8 dna which is identical to 21/41 mer d-8 dna except that 2-aminopurine flanks the 5 end of the templating dc base (table 1). the f-8 dna substrate (25 nm) was excited at 312 nm, and the emission spectrum was collected from 320 to 500 nm. after serial additions of full - length or truncated ypol in independent titrations, a decrease in the fluorescence intensity of f-8 was observed. these changes in fluorescence intensity at 370 nm were plotted as a function of the ypol concentration and were fit to (3) to extract a kd equal to 7 4 nm for full - length ypol (figure 2(c)) and 13 5 nm for truncated ypol (table 2). these kd measurements were tighter than those determined using emsa, since the fluorescence titration assay allows ypol to associate and dissociate during data collection. in contrast, emsa does not maintain a constant equilibrium because dissociated ypol can not reassociate with dna during electrophoresis separation. nonetheless, there was a confirmed ~2-fold difference in the dna binding affinity between full - length and the catalytic core of ypol which indicates that the c - terminal 119 amino acid residues of ypol slightly enhance the binding of the enzyme to dna. next, we directly measured the rate of dna dissociation from the ypoldna complex (see section 2). a preincubated solution of ypol (50 nm) and 5-radiolabeled d-1 dna (100 nm) was combined with a 50-fold molar excess of unlabeled d-1 dna for various time intervals before dttp was added for 15 s to allow ample extension of the labeled d-1 dna that remained in complex with ypol. a plot of product concentration versus the incubation time with the unlabeled dna trap (data not shown) was fit to (4) which yielded dna dissociation rates (koff) of 0.008 0.001 s and 0.0041 0.0008 s for truncated and full - length ypol, respectively (table 2 and scheme 1). interestingly, the rate of dna dissociation from full - length ypol is 2-fold slower than that from truncated ypol, which indicated that the c - terminus of ypol may slightly contribute to this polymerase 's dna binding affinity. based on the measured kd from figure 2(c) and koff values, the apparent second - order association rate constant (kon = koff / kd) of the binary complex ypoldna was calculated to be 0.62 and 0.59 m s for truncated and full - length ypol, respectively (table 2). these similar kon values indicate that the slightly stronger dna binding affinity of full - length ypol is mainly due to a slightly slower rate of dna dissociation (koff). taken together, the data in table 2 suggest that the c - terminal 119 amino acid residues of ypol slightly hinder the dissociation of dna from the binary complex ypoldna. this hindrance is through either direct physical interactions between the c - terminus of ypol and dna, modulation of the conformation of the polymerase domain by the c - terminus of ypol, or both. since a pre - steady - state burst was observed for truncated ypol, we continued to investigate the nucleotide incorporation efficiency (kp / kd) by measuring the maximum rate of nucleotide incorporation (kp) and the apparent equilibrium dissociation constant (kd) of an incoming nucleotide under single - turnover conditions. by performing these experiments with ypol in molar excess over dna, the conversion of d - dnan to d - dnan+1 (scheme 1) a preincubated solution of truncated ypol (150 nm) and 5-[p]-labeled d-7 dna (30 nm) was mixed with varying concentrations of datpmg (0.480 m) and quenched with edta at various times (see section 2). a plot of product concentration versus time was fit to (5) to extract the observed rate constant (kobs) for datp incorporation (figure 3(a)). then, the kobs values were plotted as a function of datp concentration and fit to a hyperbolic equation (6) which resolved a kp of 6.9 0.4 s and an apparent kd of 17 3 m (figure 3(b)). the pre - steady - state kinetic parameters for the remaining 15 possible dntp : dn base pair combinations were determined under single - turnover conditions and were used to calculate the substrate specificity constant (kp / kd), discrimination factor ((kp / kd)correct/(kp / kd)incorrect), and fidelity ((kp / kd)incorrect/[(kp / kd)correct + (kp / kd)incorrect ]) of truncated ypol (table 3). overall, the base substitution fidelity of truncated ypol was in the range of 10 to 10 which translates into 1 misincorporation per 100 to 10,000 nucleotide incorporations (table 3). depending on the mispair, truncated ypol catalyzed a misincorporation with 30- to 2,700-fold (640-fold on average) lower efficiency than the corresponding correct base pair. to better understand the mechanistic basis of truncated ypol 's fidelity, the equation for polymerase fidelity can be simplified as follows : (8)fidelity=(kp / kd)incorrect[(kp / kd)correct+(kp / kd)incorrect](kp / kd)incorrect(kp / kd)correct=[(kp)incorrect(kp)correct]1[(kd)correct(kd)incorrect]1=(rate difference)1(binding affinity difference)1. thus, fidelity is inversely proportional to the rate difference and apparent binding affinity difference between correct and incorrect nucleotide incorporation. in general, the mechanistic basis of ypol 's discrimination was due to a 3- to 68-fold (18-fold on average) weaker apparent binding affinity (1/kd) and 5- to 220-fold (50-fold on average) slower rate constant of incorporation for a mismatched dntp. although all four correct dntps were bound with similarly high affinity (table 3), mismatched purine deoxyribonucleotides have 2- to 6-fold lower apparent kd values than mismatched pyrimidine deoxyribonucleotides. because 5-protruding purines have been found to have stronger stacking interactions with a terminal dna base pair than 5-protruding pyrimidines, the difference in apparent kd values suggests that base - stacking interactions between an incorrect dntp and the terminal primer / template base pair da : dt (table 1) play a role on the binding of dntp by truncated ypol. interestingly, we have previously demonstrated that the preferred nucleotide for template - independent nucleotide incorporation catalyzed by dpo4, another y - family dna polymerase, is datp mainly due to its strong intrahelical base - stacking ability. to further evaluate the role of base stacking, we first examined if truncated ypol can catalyze template - independent nucleotide incorporation of datp or dptp (figure 4) onto four palindromic, blunt - end dna substrates (be1, be2, be3, and be4 in table 1). the base of dptp, a dntp analog, has four conjugated benzene rings but possesses no hydrogen - bonding abilities. the dna substrates possess all four possible terminal base pairs and each molecule of them can be bound by a single polymerase molecule. our radioactive experiments showed that truncated ypol was able to incorporate datp and dptp (data not shown). then, we individually measured the kinetic parameters for datp and dptp incorporation under single - turnover reaction conditions (table 4). interestingly, the apparent kd values of datp were 3- to 5-fold smaller with a purine than those with a pyrimidine on the primer 's 3-base, indicating that base stacking is also important for the binding of datp to the binary complex of ypolblunt - end dna. this base - stacking effect is more dramatic for dptp incorporation onto blunt - end dna because the apparent kd values of dptp are 10- to 80-fold tighter than datp incorporation onto the same blunt - end dna substrate (table 4). thus, the binding free energy difference between datp and dptp is 1.4 to 2.6 kcal / mol. previously, we have obtained a comparable binding free energy difference of 2.3 kcal / mol for similar blunt - end datp and dptp incorporation at 37c catalyzed by dpo4. although neither datp nor dptp forms any hydrogen bonds with a template base when bound by ypolblunt - end dna, the bases of these two nucleotides should have different base - stacking interactions with a terminal base pair of a blunt - end dna substrate considering that a dangling pyrene base (1.7 kcal / mol) has previously been found to possess a higher base - stacking free energy than a dangling adenosine (1.0 kcal / mol). however, the base - stacking free energy difference (0.7 kcal / mol) between pyrene and adenosine is smaller than the aforementioned binding free energy difference (1.42.6 kcal / mol) between dptp and datp. one possible source is favorable van der waals interactions between pyrene and active site residues of truncated ypol. in addition, the base - stacking effect and van der waals interactions may stabilize the ternary complex of ypolblunt - end dnanucleotide and facilitate catalysis, leading to much higher kp values with dptp than those with datp (table 4). due to the differences in kp and apparent kd, the substrate specificity values of dptp are 100- to 1,000-fold higher than those of datp with blunt - end dna (table 4) and 10- to 100-fold higher than mismatched datp with regular dna (table 3). the base substitution fidelities of full - length and truncated ypol may differ because the c - terminal, nonenzymatic regions may alter the polymerization fidelity. for example, the proline - rich domain of human dna polymerase has been shown to upregulate the polymerase fidelity up to 100-fold. to determine if the c - terminus of ypol influences polymerization fidelity, we measured the pre - steady - state kinetic parameters for dntp incorporation into d-1 dna (template da) catalyzed by full - length ypol (table 5). the fidelity was calculated to be in the range of (1.4 to 2.6) 10 for full - length ypol (table 5). relative to the fidelity of truncated ypol with d-1 (table 3), full - length ypol has a 3-fold higher fidelity. therefore, the c - terminus of ypol slightly affects the base substitution fidelity. moreover, truncated ypol discriminated between a correct and incorrect dntp by ~30-fold on average based on the kp difference while the discrimination for full - length ypol was ~170-fold on average for incorporation into d-1 dna (tables 3 and 5). the incorporation rate constant for correct dttp was ~4 s for both ypol enzymes, but the misincorporation rate was 3- to 23-fold faster for truncated ypol. this rate enhancement for truncated ypol is partially offset by a greater discrimination at the apparent ground - state binding level so that the fidelity of truncated ypol was only 3-folder lower than that of full - length ypol. our above studies demonstrated that the c - terminus of ypol enhances this enzyme 's dna binding affinity and base substitution fidelity by 2- and 3-fold, respectively. these results suggest that the nonenzymatic, c - terminal region of ypol (figure 1) has a mild impact on the n - terminal polymerase domain and its activity. this conclusion is inconsistent with previous studies which have qualitatively demonstrated that mutations or deletions in the ubz domain or pip motif do not affect polymerase activity [3537 ]. however, these reported qualitative assays are not sufficiently sensitive to detect the small perturbation on polymerase activity as described in this paper. the presence of the c - terminal 119 residues of ypol may either interact with dna, slightly alter the conformation of the polymerase domain, or both (see above discussion), thereby enhancing its dna binding affinity and polymerase fidelity. the fidelity of several y - family dna polymerases synthesizing undamaged dna has been determined by employing steady - state [3848 ], pre - steady - state [28, 30, 4953 ], or m13-based mutation assays [39, 41, 42, 45, 54, 55 ]. from these studies, the fidelity ranges from 10 to 10. under steady - state reaction conditions, the base substitution fidelity of ypol and human pol has been measured to be in the range from 10 to 10and 10 to 10, respectively [38, 40 ], which is similar to our pre - steady - state kinetic results. consistently, pol displays the highest substrate specificity for the dctp : dg base pair under both steady - state and pre - steady - state reaction conditions (table 3 and unpublished data, brown and suo) [38, 40 ]. this may seem surprising, since pol participates in the efficient bypass of uv - induced dna damage such as a cis - syn thymine - thymine dimer (i.e., a datp : dt base pair) [1520, 56, 57 ]. however, pol has also been shown to be efficient at bypassing guanine - specific damage such as 8-oxo-7,8-dihydro - dg [58, 59 ], 1,2-cis - diammineplatinum(ii)-d(gpg) intrastrand cross - links [6063 ], and various n2-dg lesions [64, 65 ]. among the four eukaryotic y - family dna polymerases (i.e., pol, dna polymerase, dna polymerase (pol), and rev1), rev1 exhibits low fidelity on undamaged dna due to its strong preference for inserting dctp [46, 52 ] while pol has an unusual preference for dgtp : dt mispairs over datp : dt due to hoogsteen base pair formation [51, 69 ]. interestingly, the lowest fidelity base pair for truncated ypol was dgtp : dt (table 3). the two hydrogen bonds established in the wobble base pair may enhance the catalytic efficiency of ypol since hydrogen bonding is important for the efficiency and accuracy of ypol. also noteworthy, the truncated versions of eukaryotic y - family dna polymerases have been used for many biochemical studies in literature. based on our quantitative kinetic analysis of ypol, these results suggested the nonenzymatic regions of y - family dna polymerases do not alter the polymerase activity significantly. as a y - family dna polymerase, ypol displays low fidelity on undamaged dna (tables 3 and 5). in contrast, replicative dna polymerases in the a- and b - families have a polymerization fidelity that is 13 orders of magnitude greater than the y - family dna polymerases (table 6). dna polymerases with higher fidelity are more proficient at using the ground - state binding affinity to discriminate between a correct and incorrect dntp. the y - family dna polymerases provide little to no discrimination based on the kd difference while replicative dna polymerases discriminate up to almost three orders of magnitude. this lack of selection in the ground state by the y - family dna polymerases may be due to the relatively loose and solvent - accessible active site which has minimal contacts with the nascent base pair [11, 21, 71 ]. moreover, nucleotide selection by the y - family dna polymerases in the ground state may be mainly governed by watson - crick base pairing, since the calculated g values (0.951.7 kcal / mol) are similar to the free energy differences between correct and incorrect base pairs (0.31.0 kcal / mol at 37c) at the primer terminus based on dna melting studies (table 6). however, with g values 3.0 kcal / mol, the replicative dna polymerases harness the additional 2.0 kcal / mol of energy from other sources such as a tight active site or close contacts with the nascent base pair. one common fidelity checkpoint among dna polymerases these large differences may correspond to different rate - limiting steps (e.g., protein conformational change, or phosphodiester bond formation) during nucleotide incorporation [9, 30, 71 ]. for ypol, kinetic data suggest that correct and incorrect dntps are limited by a conformational step preceding chemistry, although, additional studies are needed to confirm these results. this work presents the mechanistic basis of the base substitution fidelity of ypol on undamaged dna, which examined all possible dntp : dn base pair combinations for the first time. ypol discriminates against incorrect nucleotides at both the ground - state nucleotide binding and incorporation steps. finally, the 119 residues at the c - terminus have a mild impact on the kinetic mechanism of ypol.	understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism 's genome. saccharomyces cerevisiae dna polymerase (ypol), a y - family dna polymerase, is known to efficiently bypass dna lesions (e.g., pyrimidine dimers) in vivo. using pre - steady - state kinetic methods, we examined both full - length and a truncated version of ypol which contains only the polymerase domain. in the absence of ypol 's c - terminal residues 514632, the dna binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. thus, the c - terminus of ypol may interact with dna and slightly alter the conformation of the polymerase domain during catalysis. in general, ypol discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground - state binding step (18-fold on average). blunt - end additions of datp or pyrene nucleotide 5-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides.
radiation protection is the science and art of protecting people and the environment from the harmful effects of ionising radiation. it is also described as all activities directed towards minimising radiation exposure of patients and personnel during x - ray exposure.1 the objective of radiation protection is to define how one can protect individuals, their descendants and the human race against the potential risks of ionising radiation.2 fundamental principles of radiation protection are justification, optimisation and time. based on the understanding of these fundamental principles, exposing only an individual(s) who should derive maximum benefits from such exposures to ionising radiation (justification), making sure that radiation doses as result of medical exposures are only enough to achieve needed diagnoses (optimisation) and reducing the time of exposure to sources of ionising radiation are means of achieving radiation protection. consequently, uses of immobilisers, positioning aids, beam size (x - ray field) limiting devices, the type and state of x - ray machines are important factors in radiation protection. furthermore, availability of installed radiation protection instruments such as area radiation monitors, air borne contamination monitors and personnel exit monitors ; and portable instruments such survey meters, lead rubber shields and personnel dosimeters for staff and work place monitoring are also essential.3 radiation protection measures also include periodic quality assurance checks on the x - ray machine(s). unbridled exposure to ionising radiation had been scientifically proved to cause damages to living tissue such as skin burns and radiation sickness at high exposures (deterministic effects) and also raises the risks of cancer, tumours and genetic damages (stochastic effects) at low exposures.4 in spite of this, diagnostic uses of ionising radiation have been on the increase globally since x - ray was discovered in 1895. medical uses of ionising radiation now contribute > 95% of man made exposure to radiation and now ranks only second to natural background radiation.56 with computed tomography (ct) (a known high dose modality) becoming more available in developing nations such as nigeria, more recent studies show that about 3.6 billion imaging studies per year are carried out world - wide, leading to an increase of 70% in worldwide collective effective dose for medical diagnostic procedures.7 the annual maximum permissible dose (mpd) recommended for designated radiation workers by international commission on radiological protection (icrp) is 20 msv per year while that of the public is 1 msv, whereas effective dose to organs / tissues from a single ct scan examination has been suggested to approach or even exceed doses calculated from epidemiological studies which are known to increase chances of deterministic effects.8 whereas improvements on designs of x - machines and x - ray facilities have lead to drastic reductions in personnel doses in the last two decades, patients doses within the same period actually increased.910 should radiographers always adhere to radiation protection / safety protocols in their daily practices, they could protect themselves and patients from deleterious effects of ionising radiation. regrettably, unwarranted exposures of patients to ionising radiations due to foreseeable and often avoidable circumstances during diagnostic procedures have been reported.1112 reasons adduced for this include poor knowledge of radiation protection and continued use of obsolete x - ray machines.131415 local legislation in nigeria has recently given impetus to regularization of radiographic practice to conform to international safety standards. moreover, since auditing of radiographic practice is an internationally recognized part of radiation protection practices,16 it is imperative to assess both knowledge and compliance to radiation protection practices among nigerian radiographers in lagos metropolis. convenience sampling method was used to select five hospitals with the largest concentration of radiographers in lagos metropolis. forty - three radiographers (n = 43) who gave consents to participate in the study were recruited. the selected hospitals were lagos university teaching hospital (luth), lagos state university teaching hospital (lasuth), eko hospitals plc (eko), mecure diagnostic centre and reddington hospital. luth and lasuth are government owned tertiary health institutions, while the rest are privately owned. only radiographers in the five centres who are licensed by radiographers registration board of nigeria (rrbn) to practice radiography in nigeria and who are practicing conventional radiography radiographers engaged in ultrasonography, computed tomography (ct) and magnetic resonance imaging (mri) were not recruited. also excluded were students on clinical postings / attachments and very senior radiographers who are engaged in administrative duties. an inventory was taken of all radiation protection kits such as lead rubber aprons, gonad shields etc and personnel radiation monitors such as film badge dosimeters in all the centres before data collection began. all x - ray machines were visually inspected and test exposures carried out on them by one the authors to ascertain their functional statuses. year of manufacture of each x - ray tube, statuses of light beam diaphragms, kv and ma selectors as well as availability of automatic exposure controls (aec) and records of quality assurance tests were all checked and recorded. to obtain an unbiased assessment of radiation protection practices among radiographers studied, one of the authors posed as a student to conceal his identity so as to be able to observe the radiographers while they worked. the rationale behind the use of an unidentified observer was explained and radiographers consented to that before the study started, although some radiographers gave their consent only when assured that the result of the study shall be made known to them. observations made in each centre were ticked off in an assessment chart prepared for that purpose. knowledge was assessed based on radiographers understanding of risks associated with diagnostic use of ionising radiation as well as measures to adequately protect themselves, patients and the public from such risks. radiation protection practices were assessed by observing the availability and use of protective kits such as gonad shields, immobilizers, ray field limiting devices such as light beam diaphragm (lbd), display of x - ray warning signs and exclusion of early cyesis among women of child bearing age prior to exposure of their pelvis to radiation by adhering to the 10-day rule. knowledge shall be assumed to be poor if respondents average score on seven questions used to assess knowledge is < 50%. their radiation protection practices shall be assumed to be poor if basic radiation protection kits such as lead rubber aprons, gonad shields, personnel radiation monitors such as film badges etc are lacking in all the centres. furthermore, if these basic kits are available but are not adequately utilised, practices shall also be assumed to be poor. moreover, if modern methods of radiation protection such as use of pulsed fluoroscopy machines, special paediatric immobilisers and digital radiography machines are not available and if gonads shields are not correctly used when x - raying areas adjacent to the pelvis of women of child bearing age, radiation protection practices shall be assumed to be poor. descriptive statistics such as percentage was used in analysing responses while results were presented in tables. descriptive statistics such as percentage was used in analysing responses while results were presented in tables. forty (n = 40) radiographers of whom 15 (n = 15) were males and 25 (n = 25) were females completed and returned the questionnaires distributed to them (93.0% return rate). thirty - five percent (35%) of the respondents work at the lagos university teaching hospital [table 1 ]. thirty - seven respondents (92.5%) in the five centres indicated that they know that increase in kv increased the energy of the x - ray beam and thus reduces both skin and absorbed doses [table 2 ], while 28 respondents (70%) agree that uses of light beam diaphragm (lbd) to reduce field size and positioning aids such as immobilisers and straps, especially in paediatric radiography,16 are indispensable in radiographic practice. thirty - four respondents (85%) know that justification and optimization are essential principles in radiation protection, while 30 respondents (62.5%) believe there is a need for diagnostic x - ray facilities to have written operating procedures and local rules to serve as guides for radiographers. thirty respondents (63%) said that a radiologist is statutorily responsible for ordering the repeat of radiographs adjudged to be of sub - optimal diagnostic quality whereas 34 respondents (85%) believe that quality assurance tests on x - ray machines and accessories are essential parts of radiation protection practices. twenty - one respondents (53%) said that all designated personnel must wear radiation monitoring badges while working. distribution of respondents by hospital evaluation of knowledge in radiation protection respondents reported availability of high output x - machines, conventional fluoroscopy machines and of such kits as lead rubber aprons, gonad shields, thyroid shield shields, mobile lead screens in all five centres. special paediatric straps were, however, not available in all the centres [table 3 ]. x - ray equipment and radiation protection devices in the five centres on independent observation, it was found that radiographers in both luth and lasuth do not wear dosimeters while those in eko, mecure and reddington (all privately owned) hospitals did wear their dosimeters [table 4 ]. the 10-day rule was used in all the centres as a guide in booking appoints for x - ray investigations of pelvis of women of child bearing ages. however, only radiographers at eko, mecure and reddington made use of gonad shields when examining anatomical areas adjacent to the pelvis of women in the above category. observed radiation protection practices there was neither a quality assurance regime nor a designated trained radiation safety officer in any of the five centres. while there are radiation warning signs and red lights to indicate when exposures are in progress in all the centres, there were no written warnings in the local languages of the people [table 4 ]. the use of ionising radiation for diagnosis could have slight chances of damage to living tissues. provided protection measures are implemented, risks associated with diagnostic use of ionising radiation could be minimised.15 radiographers in lagos, nigeria, exhibited a very good understanding of the issues pertaining to radiation protection. this is better than what was reported in a similar study in england (united kingdom) which found knowledge of radiation protection issues among radiographers in that country to be poor.14 of particular interest is respondents understanding that only a consultant radiologist should statutorily request the repeat of all presumably suboptimal radiographs, including paediatric cases. this agrees with international requirement on radiation protection of paediatrics as well as recommendations of nigeria nuclear regulatory authority (nnra) on radiation protection.16 optimisation of exposures, for instance, is a function of in - depth knowledge and adherence to written down operating procedures. while it is conceded that most radiographers, by reason of their training, job experience and continuous professional development as highlighted by davies.,17 are usually conversant with optimal exposure factors in their centres, some, especially the newly employed ones may not be. this, therefore, makes availability of written exposure charts indispensable especially in centres where manual selection of exposure factors is still in vogue. use of exposure charts reduce selection of sub optimal exposures that often result in repeat of exposures and is, therefore, recognised as radiation protection measure. since only 45% of respondents [table 3 ] believe that written guidelines such as exposure charts is necessary in a country where most x - ray machines are obsolete (some x - ray tubes were more than 10 years old while others were more than 25 years old) and where automatic exposure control (aec) devices are non - existent, it is plausible to infer that patients may have been unnecessarily subjected to avoidable irradiation risks. x - ray machines in the five centres were high output static and mobile types. high output x- ray units are desirable as they allow selection of both high kilovolts (kv) from 70 kv and above and short exposure times (milliseconds) needed to reduce both skin and absorbed doses. selection of high kv to produce more energetic beam of x rays, according to yau idris (practice specific regulations for medical exposure ; national institute of radiation protection and research : training course for radiation safety officers in diagnostic and interventional radiology ; course material ; pp 51 - 56), is an internationally accepted radiation protection practice. desirable as use of high kv may appear, a major constraint of such technique is radiation dose creep. this is a gradual build up of dose parameters following sustained preference of high kv over low kv to reduce absorbed and skin doses. according to schaefer - prokop.,18 consideration of the effect of dose creep is very important if multiple follow - up serial examinations for critically ill patients and vulnerable groups such as children are contemplated. radiographers can, however, only be sure of the outcome of any combination of exposure factors selected if x - machines undergo periodic quality assurances checks. this is even more vital if such machines are old such as were found in the study (they were between 10 years and 25 years old in government centres and between 10 years and 15 years old in private centres). majority (85%) of respondents claimed to have quality assurance programmes included in their radiation protection practices whereas no evidence exists to buttress such claims. furthermore, none of the centres had a resident or consultant medical physicist during the study period. continued use of obsolete x - ray equipment seems to be a common problem with developing countries as muhogora., also reported the same scenario in tanzania. in their study, they reported that obsolete x - ray machines with no record of quality assurance tests being carried out on them were still in use in that country.15 this situation runs counter to extant national and international requirements.19 it can, therefore, be said that radiographers in lagos metropolis neglected an essential aspect in radiation protection practices within the period studied. available fluoroscopy machines in all the centres within the study period were of the conventional type, whereas pulsed fluoroscopy enhances radiation protection. furthermore, none of the centres has acquired digital x - ray machines or adapted their old x - ray machines to digital. during pulsed fluoroscopy, x - rays are delivered in pulses that follow each other in rapid successions with radiation - free gaps that ensure that the dose is significantly reduced. digitisation, on the other hand, allows for post processing of images during which image contrast could be manipulated to ensure that repeat of exposures due to sub optimal exposures are reduced.1920 why these systems have not been embraced in lagos metropolis may not be unconnected with paucity of funds which is often the bane of many health systems in developing nations such as nigeria. however, the situation does imply that a lot still needs to be done to realign radiation protection practices in lagos metropolis to more current standards. while protective barriers such as gonad shields, leaded screens and lead rubber aprons were available in all the centres, none of the centres had any special paediatric immobilisers. children, by nature, are restless and apprehensive in most hospital environments and so they require special care and immobilisation during radiography to prevent motion blurring of images. since use of immobilisation devices such as mummy sheet, pig - o - stat and other special paediatric straps, according to cook, are considered necessities in radiation protection of children.21 it is, therefore, not out of place to assume that children in lagos, nigeria may undoubtedly have received unnecessary exposures to radiation due to possible repeat exposures over the years. in spite of excellent knowledge found among radiographers in the study, it was observed that only radiographers in the private hospitals appropriately used protection devices such as gonad shields when it is necessary. in particular, gonad shields were available in all the centres studied but were either deliberately or inadvertently ignored in government hospitals. it is mandatory, according to icrp radiation safety standards,20 for gonads shields to be used for the protection of the gonads when the pelvis is not part of the anatomical area being examined. their use is more essential when women of child bearing age in whom early cyesis is suspected come for x - ray examinations. a possible explanation of this rather poor attitude exhibited by radiographers in government hospital may be that since regulatory agencies appear not take supervision of radiation protection practices seriously, then there is no fear of possible sanctions among radiographers who compromise radiation safety standards in the country. furthermore, discrepancies were noted between the numbers of radiation protection devices such as sand bags, gonad shields, mobile lead screens etc. we believe that this result could only have been a ploy among radiographers in government hospitals not to expose the dearth of such essential protection kits in their centres. in any case, it points to a better commitment to radiation protection practices by radiographers in private hospitals and that unfortunately, most radiographers in government hospitals in lagos, nigeria were rather unmindful of well documented somatic and genetic effects of ionising radiation.15 personnel radiation monitoring is essential to ensure that annual permissible dose limits are not exceeded. there were no area and air borne radiation monitors in any of the centres studied. furthermore, only 50% of respondents were observed to wear radiation dosimeters during the period studied. this was rather an attitudinal issue as it was found out in the course of this study ; dosimeters were supplied to all radiographers in all the centres studied. eze.,2 reported a better attitude to wearing radiation dosimeters among a sample of industrial radiographers in port - harcourt, nigeria. in spite of reported decline in personnel exposures due to improvements on knowledge, departmental and equipment designs,910 possibility of occupational exposure, according to eze.,2 still exists. since no radiographer should ever lose sight of this fact, radiographers who refuse to wear dosimeters as was found among most radiographers in lagos, nigeria, for whatever reason, stand the chance of unwittingly exceeding their recommended annual maximum permissible doses of dose limits of 20 msv averaged over a 5-year period for designated radiation workers8 without ever knowing what has happened. radiographers in lagos, nigeria, demonstrated a good knowledge of hazards associated with diagnostic use of ionising radiation and also of protection mechanisms from such hazards. their knowledge, however, had little impact on radiation protection practices which were found to be poor. were we able to cite an incidence of radiation induced ailments in the country, it could have improved the quality of the study. functional states of obsolete x - ray machines studied were not assessed beyond visual inspection due to dearth of medical physicists in the country. however, based on our results and on reviewed literature, it is recommended that : all centres working with ionising radiation should ensure a strict adherence to radiation safety practices to protect radiographers, patients and the public from harmful effects ofionising radiation.periodic quality assurance tests should become mandatory in all diagnostic x - ray facilities in the country.the nigerian national assembly should amend laws guiding diagnostic use of ionising in nigeria to make them more effective.since knowledge alone, though very important, can not translate to adequate radiation protection, radiographers must, therefore, update their knowledge often to include the most current trends in radiation protection and then make more concerted efforts to follow existing radiation protection protocols in their daily work routine. all centres working with ionising radiation should ensure a strict adherence to radiation safety practices to protect radiographers, patients and the public from harmful effects ofionising radiation. periodic quality assurance tests should become mandatory in all diagnostic x - ray facilities in the country. the nigerian national assembly should amend laws guiding diagnostic use of ionising in nigeria to make them more effective. since knowledge alone, though very important, can not translate to adequate radiation protection, radiographers must, therefore, update their knowledge often to include the most current trends in radiation protection and then make more concerted efforts to follow existing radiation protection protocols in their daily work routine.	background : use of ionising radiation in diagnostic radiography could lead to hazards such as somatic and genetic damages. compliance to safe work and radiation protection practices could mitigate such risks. the aim of the study was to assess the knowledge and radiation protection practices among radiographers in lagos, nigeria.materials and methods : the study was a prospective cross sectional survey. convenience sampling technique was used to select four x - ray diagnostic centres in four tertiary hospitals in lagos metropolis. data were analysed with epi- info software, version 3.5.1.results:average score on assessment of knowledge was 73%. most modern radiation protection instruments were lacking in all the centres studied. application of shielding devices such as gonad shield for protection was neglected mostly in government hospitals. most x - ray machines were quite old and evidence of quality assurance tests performed on such machines were lacking.conclusion:radiographers within lagos metropolis showed an excellent knowledge of radiation protection within the study period. adherence to radiation protection practices among radiographers in lagos metropolis during the period studied was, however, poor. radiographers in lagos, nigeria should embrace current trends in radiation protection and make more concerted efforts to apply their knowledge in protecting themselves and patients from harmful effects of ionising radiation.
many factors such as changing patterns of sugar consumption and lifestyle might be responsible for the increase in caries rates, especially in developing countries. in iran, despite the high rate of dental caries in 12 years (52.3%), socio - epidemiologic data about oral health behaviors are not available at a national level. therefore, this study was undertaken to collect information about oral health knowledge, attitude, and practice (kap) of 12 years in different regions of iran. this study was a cross - sectional survey of 1691 students studying in sixth grade (12 years of age) in various schools of five provinces (seven urban and eight rural areas) of iran. a stratified sampling procedure was performed per province and cluster (school). in each stratum, a number of schools were selected and in each school, a random sample proportional to the number of students per school was selected. to obtain a national representative sample, the capital of iran (tehran) and four provinces (khorasan in the northeast, isfahan in the center, hormozgan in the south, and kerman in the southeast) were selected. a questionnaire that included 33 closed - ended questions was designed based on a systematic review of related articles and was translated and back - translated in the standard method from english to persian. the final version was evaluated by pediatric dentists and epidemiologists. for assessment of face validity and reliability, a pilot study was carried out on 30 students of sixth grade with an interval of 3 weeks (the consistency rate was over 80%). for assessment of validity, cronbach 's alpha was calculated, which was at an acceptable level (0.88). finally, the persian version was designed to include demographic data and issues in the field of kap. with coordination of the school principal and after student satisfaction was ensured, the questionnaires were completed by the children in school under the teachers supervision. the sample size was 1691 students, with a response rate of about 92% as the incorrectly filled 137 questionnaires were excluded from the analysis. oral health kap was measured based on true answers to the questions related to each variable [table 1 ]. the method of calculating the scores of knowledge, attitude, and practice on oral health data were analyzed with spss 21 using chi - squared test, t - test, correlation coefficient, analysis of variance (anova), and linear regression model. in this study, 1554 students were recruited, with 49.5% males and around 61% from urban areas [table 2 ]. the basic demographic features of the subjects the mean knowledge score was 74.1 21.1%. only 72 (4.7%) of students had poor knowledge [figure 1 ]. the levels of kap on oral health in 12-year - olds the results of the analysis of knowledge questions are presented in table 3. these results show that some of the subjects were unaware that drinking fruit juice (26.6%) and eating candies and pastilles (30.2%) can cause dental caries. the percent of the true responses to knowledge questions according to living in urban and rural regions the mean score of attitude was 72.6 21.1%. only 116 (7.6%) of subjects had a negative attitude [figure 1 ]. approximately 91.8% of students believed that it was important for them to take care of their teeth. but 43.6% of them reported that they did not have a good feeling about dental visits. of the study sample, 94.9% had a toothbrush and 79.8% used it with toothpaste to brush. the results showed that 53.7% of the population visited a dentist when they had pain or a dental problem. only 15.1% visited their dentists every 6 months for the control of oral and dental health. approximately 27.3% of students consumed sweet foods (chocolate / cake / biscuit / chips) and 43% of them drank soft drinks (sugared tea or coffee or milk / soda / syrup) several times a day. but the habit of having fresh fruit and raw vegetables several times a day was reported by 15% of subjects. minimum correlation coefficients (r = 0.05) and (r = 0.11) were between attitude and knowledge with diet practice, respectively. in general, the students in urban areas obtained higher scores in kap (p = 0.0001). the mean scores in urban areas of different provinces were significantly lower than in tehran, the capital of iran. these scores were significantly lower in rural areas in khorasan than in other provinces [figure 2 ]. the mean of scores of oral health kap in urban and rural areas of different provinces female students exhibited higher scores in all fields, but the difference was significant only in brushing practice (p = 0.006). the results of multivariate analysis of practice of oral health are presented in table 4. this analysis showed that children whose mothers had higher education obtained higher scores in all fields. children whose fathers had higher education showed significantly better brushing, but the difference was not significant in relation to diet and referral practice. prediction of the total practice score in the multivariate regression model children whose mothers were employed obtained significantly higher scores in comparison with the children of housewives. in general, the results of this study indicate that the levels of knowledge and attitude were good, but the level of practice was not satisfactory, especially diet - related practice. although it was found that awareness about the effect of excess sweets or soft drinks was high (86%), 43% of children consumed soft drinks and 27.3% ate sweet food several times a day. this can explain that oral health knowledge does not necessarily relate to better health behavior. other studies have confirmed the finding that the association of kap of oral health can not be understood simply based on the kap chain, and other factors such as socioeconomic factors, especially parents education level and region where the children live should also be considered. in this study, studies conducted in rural areas show that the effect of knowledge on oral health was negligible. this may be due to factors such as socioeconomic status and better coverage of the oral healthcare programs. also, the effect of kap on oral health is influenced by the province of residence. in this study, tehran (capital of iran) therefore, it seems the province health authorities should be encouraged to develop school - based educational programs including parents and teachers. in the present study the results showed that employed mothers had an effective role in increasing kap in children, but there was no association with fathers job. however, there are no studies about the effect of parents job on kap of children to compare the results of our study. also, parents educational level had a significant relationship with kap on oral health. it is natural that educated parents improve their children 's oral health. in this study, unfortunately, 5.1% had no toothbrushes, which was lower compared to a study in iraq, in which 78.1% of children used a toothbrush and 16.6% reported using their fingers instead. in our study, 8.1% of the students brushed their teeth at least twice daily. this finding was higher compared to the finding of a study conducted in dehradun, india, in which 4.1% of children brushed their teeth twice a day. however, both studies reported a very low percentage of people brushing their teeth twice a day, compared to other studies. approximately 38.5% of 12-year - olds in bangalore, india, half of the children and adolescents in china and european countries, 61% of children in nairobi, and 30% of 12-year - olds in sudan brushed their teeth at least twice a day. however, the low rate of the number of daily tooth brushing might be attributed to poor knowledge, which can lead to faulty practice. in our study, 78.8% of children knew the effect of dental flossing was to prevent dental caries, which was higher compared to the rates in udaipur, india (48.1%) and in jordan (40%) ; however, despite the high knowledge, only 60.1% of students used dental floss. the knowledge among the children in our study about the effect of fluoride on teeth (62.8%) was lower compared to that among the students (77%) in jordan, but was higher compared to that of children from china (37%) and udaipur in india (12.6%). in our sample, although 84.7% of the students were aware of the importance of regular dental visits, only 35.3% reported that they have visited a dentist during the last 6 or 12 months, 4.4% of students did not visit any dentist, and 53.7% visited a dentist if they had pain or a problem in their teeth or gums. this finding is in line with the results of a study in india, in which 67.8% were aware of the importance of regular dental visits and 35.1% had visited a dentist during the last 12 months. in our sample, 43.6% of participants reported that they did not have a good feeling about dental visits. in a study in india, 46.1% of 12-year - olds feared dental visits, which was the main cause of irregular visits by these students. in jordan therefore, based on these studies and our study, it seems that an unpleasant feeling about or fear of dental visits is the main reason for irregular visits to dentists. however, this study might have had certain limitations.first, the information was collected by a questionnaire, and the subjects might have overestimated positive practices and underestimated negative behaviors. second, recall bias should be considered, probably occurring in relation to the past dental visits and diet history. the results of this study show that 12-year - olds in iran had good knowledge and positive attitude. the results also show that oral health behaviors are not totally explained by knowledge and attitude, and are influenced by parents educational level and region where the children live.	objective : the knowledge, attitude, practice (kap) studies play an important role in promotion of oral health. the aim of this study was to assess oral health kap in 12-year - old schoolchildren in iran.materials and methods : in a cross - sectional study on 1554 students aged 12 years from the rural and urban areas of five provinces, kap of subjects was assessed using a culturally adapted questionnaire. data were analyzed using chi - squared test, t - test, correlation coefficient, analysis of variance (anova), and linear regression. statistical significance was set at p < 0.05.results:in general, the scores of students in knowledge, attitude, and practice were 74.1 21.1%, 72.6 21.1%, and 51.8 12%, respectively. urban students had significantly higher scores in kap (p = 0.0001). female students got higher scores in all the three dimensions, but the difference was significant only in brushing practice (p = 0.006). students in tehran (the capital city) had significantly higher scores in all fields (p = 0.0001). parents education and mothers job had a significant relationship with kap of children.conclusion:the results of this study showed that 12-year - old schoolchildren in iran had good knowledge and positive attitude. but oral health practice was not satisfactory.
solitary plasmacytoma of the thyroid is an uncommon neoplasm constituting 1.4% of the extramedullary plasmacytomas (emps). the patients are often middle - aged to older adults, with a slight male predominance. there are many reported cases of solitary plasmacytomas of the extrathyroidal sites diagnosed on fine needle aspiration cytology (fnac) in literature. a diagnosis of solitary plasmacytoma of the thyroid made during fnac, however, to the best of our knowledge, is rare and unique. the present case illustrates the difficulty in arriving at an fnac diagnosis of solitary plasmacytoma of the thyroid, due to the presence of atypical hurthle cells and the associated amyloid in the tumor. a 60-year - old male presented with a neck mass, hoarseness of voice, and dysphagia of a three - month duration. on clinical examination the thyroid gland was diffusely enlarged, more prominent on the right side, firm, and painless. an ultrasound examination showed hypoechoic areas in both lobes suggestive of a space - occupying lesion. the fnac revealed a cellular aspirate composed of cells arranged in numerous acini, loose clusters, pseudopapillae, as well as singly dispersed [figure 1a ]. many cells showed nuclear grooves as well as marked anisonucleosis, with occasional intranuclear cytoplasmic inclusions [figure 1c ]. the cytoplasm was abundant, pink, and granular in most of the cells [figure 1b ]. a pink amorphous acellular material was identified as large blobs and stained positive for congo red [figure 1d ]. cellular aspirate with acinar cells, papillaroid clusters, and nuclei with grooves (h and e, 200) acini composed of pleomorphic cells with hyperchromatic nuclei and abundant pink cytoplasm (h and e, 400) cluster of cells with an intranuclear inclusion (h and e, 400) positive staining amorphous material in smear background (congo red stain, 200) a possibility of an epithelial neoplasm, either medullary carcinoma (pleomorphic variant) or a follicular variant of papillary carcinoma was given. this was due to the presence of pleomorphic epithelial cells arranged in groups, acini, and papillaroid structures. however, due to the associated amyloid, a strong possibility of medullary carcinoma over papillary carcinoma was considered. gross examination of the thyroidectomy specimen showed the right lobe to be with an isthmus measuring 7 5 4 cm and the left lobe measuring 5 4 3 cm. the cut surfaces of both were nodular and fleshy in appearance [figure 2a ]. cut surface of the total thyroidectomy specimen showing a lobulated fleshy appearance thyroid follicles lined by hurthle cells with intervening sheets of neoplastic plasma cells (h and e, 400) neoplastic cells showing diffuse cytoplasmic positivity for cd138 indicating plasma cell diff erentiati on (ihc, 400) germinal center cells (reactive and part of hashimoto thyroiditis) showing cd19 positivity (ihc, 200) histopathology : the multiple sections studied, revealed diffuse atypical plasma cells in sheets effacing the normal thyroid parenchyma [figure 2b ]. the intervening areas and thyroid tissue at the periphery showed hashimoto thyroiditis, with extensive oncocytic change and bizarre nuclear changes. a diagnosis of plasmacytoma of the thyroid gland was made on histology. a close differential considered on histology was marginal zone lymphoma with extensive plasma cell differentiation. immunohistochemistry revealed plasmacytoid cells with diffuse positivity for cd138 [figure 2c ], and also cytoplasmic positivity for the kappa light chain. on the basis of immunohistochemistry a final diagnosis of extramedullary solitary plasmacytoma (esp) of the thyroid was made, after the workup was found to be negative for multiple myeloma. a diagnosis of this neoplasm by fnac has been made at extrathyroidal sites even without the help of immunohistochemistry. the present case is an example of solitary plasmacytoma of the thyroid, which was diagnosed, after fnac, as a medullary carcinoma, for various reasons outlined below. the needle had sampled predominantly follicular epithelial cells from the periphery of the lesion, which represented changes of hashimoto thyroiditis (the background in the aspirate showed mononuclear cells, which are predominantly lymphocytes). the predominant component of the aspirate constituted hurthle cell clusters with bizarre nuclear morphology (mistaken for carcinoma). some granularity of the cytoplasm and abundant acellular material, which was positive for an amyloid stain, suggested a diagnosis of medullary carcinoma on the aspirate. fine needle aspiration cytology, as outlined in this case, emphasises the limitation of being a diagnostic tool in all thyroid malignancies. a similar case of solitary plasmacytoma of the thyroid has been documented in literature by bourtsos. they are known to show atypical nuclear changes and hyperchromasia and this has been well - documented in literature. most probably, multiple aspirations could have avoided this misinterpretation, but even so, the presence of amyloid in the aspirate associated with some epithelial cells tilted the diagnosis toward a medullary carcinoma. bourtsos. have emphasized that emp should be considered in the differential diagnosis of a neck mass that yields discohesive cells associated with amyloid - like material. they made a diagnosis of medullary carcinoma due to the presence of plasmacytoid tumor cells with an amyloid in the background. the present authors mistook hurthle cells for cells of a pelomorphic variant of medullary carcinoma. the confusion toward malignancy was compounded due the presence of intranuclear inclusions in these cells as well as grooves. sarin. reported five cases of emps on cytology and observed plasmacytoid cells with varying pleomorphisms, bi- and multinucleation, and mitotic figures. all these features posed a diagnostic challenge for them on cytological evaluation. at histology, although plasmacytoma was considered as a diagnosis, the other close differential was marginal zone lymphoma, with extensive plasma cell differentiation, which was the more common occurrence in the thyroid, as compared to plasmacytomas. on immunohistochemistry, the plasmacytomas were negative for cd45, cd19, and cd 20, and strongly positive for cd138. marginal zone lymphomas were, on the contrary, positive for cd45, cd19, and cd20, and would show positivity for cd138, depending on the plasma cell differentiation. the present case was strongly positive for cd138, with light chain restriction for kappa chains, which favored a diagnosis of plasmacytoma. in conclusion, emp of the thyroid can be diagnosed on cytology with multiple aspirations, to avoid sampling error and to arrive at the right diagnosis. amyloid - like material can be associated with this type of tumor and not necessarily be a component of medullary carcinoma alone. the other differentials like lymphoproliferative lesions and plasmacytomas must be kept in mind in the setting of autoimmune thyroiditis, which can be diagnosed on cytology.	a rare case of extra medullary plasmacytoma (emp) of thyroid gland in a 60 year old male, occurring against a background of hashimoto 's thyroiditis is reported. the fine needle aspiration cytology (fnac) initially done as an outpatient procedure, showed atypical epithelial cells on a background of amyloid. considering these findings we gave a diagnosis of medullary carcinoma. histology of the total thyroidectomy specimen showed an extensive infiltration of neoplastic plasma cells against a background of hashimoto 's thyroiditis, with a bizarre hurthle cell change. immunohistochemistry on the histology sections confirmed the diagnosis of solitary plasmacytoma of thyroid against a background of hashimoto 's thyroiditis.
a 25-year - old primiparous lady presented to the antenatal clinic for a routine checkup at 36 weeks gestation. during her visit, she demonstrated a large pedunculated tumor on the dorsal surface of the interphalangeal joint of her right thumb (figure 1). this initially started as a small pimple which she first noticed at approximately 24 weeks gestation. she decided to burst and drain the pimple then, and again 4 weeks later, which resulted in a small bleed from the lesion on both occasions. however, the pimple continued to grow in size, and at 32 weeks gestation she presented to her general practitioner who commenced her on oral co - amoxiclav. this had no effect on the lesion, and it continued to grow, reaching a size of 2.52.51 cm on presentation to her antenatal visit at 36 weeks gestation. it had at that stage become oozy, foul - smelling and was causing her significant local pain. at that point, we referred her to the plastic surgery team at our affiliated general hospital. the lesion was a polypoid lobulated mass measuring 242310 mm, with slicing showing a fatty tan surface admixed with blood. histopathological examination of the lesion showed evidence of a hemangioma with overlying infarction, ulceration and inflammation with no atypical features (figure 2). she was admitted to the rotunda hospital a week after with pregnancy - induced hypertension, which was controlled with labetalol 200 mg twice daily. they are common in infants, and commonly present on the face and scalp, usually spontaneously regressing. in the adult research has suggested a possible role for estrogen as a mediator for vascular proliferation and hemangioma formation. this could potentially explain the rapid growth of this lady s hemangioma during her pregnancy. to the best of our knowledge	this is a case of a rapidly enlarging cutaneous pedunculated tumor on a patient s thumb during her pregnancy. this was excised and identified as a hemangioma. a literature search identified a possible hormonal factor in causing an accelerated growth of this tumor.
reports of sudden death among children and adolescents receiving stimulant medications for treatment of attention deficit disorder with or without hyperactivity (adhd) have raised concerns about the safety of these agents. in the last two years, many articles have been published about the cardiovascular safety of stimulant medication [16 ]. there are very few reports about clinically measured cardiovascular data in adhd children and adolescents [7, 8 ]. it remains controversial if treatment of adhd children with stimulants reduces or increases the risk of sudden death (sd). the assumption that stimulant - treated adhd patients are at higher risk for sd is based on either (a) the proarrhythmogenic effects of these agents, which are closely related members of the class of sympathomimetic amines, or (b) complicated statistical models with estimated data from uncertain data bases like the adverse event reporting system. due to the rarity of sd in pediatric populations, compared to adults, it is extremely difficult to establish a reliable model to predict sudden cardiac arrest in children and adolescents. it is the search for the needle in the haystack. for the assessment of cardiac risk, there is no doubt that an accurate history and physical examination are important, but ambiguities in current screening recommendations with respect to electrocardiogram assessment show the lack of sufficient surrogate measurements. twenty - four - hour holter recordings in post myocardial infarction (mi) in adult patients showed that depressed heart rate variability (hrv) was a significant predictor of mortality after adjusting for clinical and demographic features, including ejection fraction. these studies were further confirmed by others studying post - mi patients, who showed that impaired hrv was an independent predictor of cardiac mortality only within 6 months of mi and seemed to improve over time [10, 11 ]. hrv is also reduced in survivors of sudden cardiac death not associated with coronary artery disease and may be related to the decrease of parasympathetic tone. normal values are available for children and adults. in our pilot study, we investigate whether measurements of autonomic function with time domain analysis of hrv in 24-hour ecg are useful to determine risk factors for sudden cardiac death in patients with adhd. we analysed hrv obtained from children with the diagnosis of adhd prior to (n = 12) or during medical therapy (n = 19) with methylphenidate (mph), aged 10.8 2.0 years. from august 2005 to mach 2010, children with the diagnosis of adhd were referred to our paediatric cardiology outpatient clinic for cardiology assessment. the mean daily mph dosage of 19 children on stimulant medication was 0.8 0.4 mg / kg / day (9 children received methylphenidate extended release). all children received a standard 12-lead ecg, an echocardiogram, and 24-hour holter ecg. as a control group, we compared the hrv data of 19 age - matched healthy children, who were referred to rule out cardiac defects due to heart murmur, palpitation, or chest pain. autonomic control of cardiovagal function was assessed by time domain analysis of 24-hour ambulatory digital recordings of the electrocardiogram using a two - channel holter monitor (pathfinder, spacelabs). all holter recordings were reviewed by the same cardiologist and were edited to validate the system 's qrs labelling. numbers of pairs of adjacent normal beat (nn) intervals differing by more than 50 ms were given as the percentage of the total number of all nn intervals during 24 hours (pnn50). measurement and physiological interpretation of hrv parameters were performed according to the standards of the task force of the european society of cardiology and the north american society of pacing and electrophysiology. rmssd, pnn50, and heart rate reflect predominantly a response to changes in vagal tone. sdnn is dually influenced by cholinergic and adrenergic activity, as well as other physiological inputs. the data of 5 children with adhd and more than 20 premature ventricular contractions per hour were excluded. after adequate explanation of the purpose of the study, informed consent was obtained from the parents. the study protocol was approved by the local ethic committee before the start of the investigation. all results are reported as mean standard deviation. because all variables were normally distributed, a parametric test was used. differences between the controls and adhd patients with and without mph treatment were tested with an unpaired t - test with welch 's correction. the data analyses were performed using excel 2003 (microsoft, usa) and prism (graphpad software inc. as shown in table 1, there is no significant statistical difference with respect to age between the adhd patients (with or without mph) and the healthy control group. average hrv parameters from the 24-hour ecg in the adhd children without mph show significantly lower heart rate variability compared to the healthy children with respect to rmssd (26 4 ms versus 44 10 ms, p 0.0001) and pnn50 (6.5 2.7% versus 21.5 9.0%, p 0.0001). these parameters improve significantly after mph treatment (rmssd : 36 8 ms ; pnn50 : 14.2 6.9%). untreated children with adhd had a higher mean heart rate compared to healthy children (94 7/min versus 85 10/min). in our pilot study, we measured time domain values of heart rate variability in 24-hour holter ecgs in children with adhd. our data demonstrate significantly lower rmssd and pnn50 values and elevated heart rates in nonpharmacologically treated adhd children and adolescents. if we adjust the data of our 12 untreated children with adhd in the figure of published rmssd and pnn50 normal values in children and adults (figure 1), we notice that these data are not only far away from the mean values for healthy children between 8 and 13 years but also near to the dashed line, which represents cutoff for increased risk of sudden cardiac death in adults. furthermore, we demonstrate significant improvement and almost normal values of rmssd and pnn50 after treatment with mph. our data indicate the lack of physiological maturation of autonomic function with low parasympathetic tone in children with adhd at the average age of 10 years. from a pathophysiological point of view, patients with low parasympathic activity have an increased risk for sudden cardiac death, independent of other risk factors. however, higher rmssd and pnn50 values in our children with adhd who were treated with mph indicate a higher vagal tone, which is considered as protective for sudden cardiac death. our data supply the first feasible explanation why recently published population - based cohort studies showed an apparent protective association and not an increased risk of serious cardiovascular events in stimulant users [1618 ]. our data provides new information about autonomic dysfunction in children with adhd and the influence of mph therapy, which could be important for risk stratification for sudden cardiac death in this patient cohort. in contrast to theoretical speculations that mph treatment may increase the risk of sudden death in children with adhd, our data demonstrate improvement of heart rate variability in holter ecg. this indicates higher parasympathetic activity induced by mph, which may be beneficial with respect to the risk of sudden cardiac death in adhd children and adolescents.	background. although stimulants have long been touted as treatments for attention deficit disorder with or without hyperactivity (adhd), in recent years, increasing concerns have been raised about the cardiovascular safety of these medications. we aimed to prove if measurements of autonomic function with time domain analysis of heart rate variability (hrv) in 24-hour holter ecg are useful to predict the risk of sudden cardiac death in adhd children and adolescents. methods. we analysed hrv obtained from children with the diagnosis of adhd prior to (n = 12) or during medical therapy (n = 19) with methylphenidate (mph), aged 10.8 2.0 years (mean sd), who were referred to our outpatient paediatric cardiology clinic to rule out heart defect. as a control group, we compared the hrv data of 19 age - matched healthy children without heart defect. results. average hrv parameters from 24-hour ecg in the adhd children prior to mph showed significant lower values compared to healthy children with respect to rmssd (26 4 ms versus 44 10 ms, p 0.0001) and pnn50 (6.5 2.7% versus 21.5 9.0%, p 0.0001). these values improved in mph - treated children with adhd (rmssd : 36 8 ms ; pnn50 : 14.2 6.9%). conclusion. children who suffer from adhd show significant changes in hrv that predominantly reflects diminished vagal tone, a well - known risk factor of sudden cardiac death in adults. in our pilot study, mph treatment improved hrv.
methylisobutylxanthine, dexamethasone, insulin, and free glycerol determination kit (free glycerol determination kit) were purchased from sigma - aldrich chemical (st. louis, mo, usa). a glycerol-3-phosphate dehydrogenase (g3pdh) activity assay kit was purchased from takara nio (gpdh activity assay kit ; shiga, japan). fbs, dulbecco 's modified eagle 's medium, penicillin / streptomycin, and trypsin were purchased from gibco (grand island, ny, usa). primers for mrna were obtained from genet bio (seoul, korea). all other reagents and general lab chemicals the effects of the pgf2 analogs, latanoprost (xalatan ; pfizer, new york, ny, usa) and travoprost (travatan, alcon) in their commercial formulations, were investigated on adipose differentiation and intracellular, lipid storage. each pg solution was diluted serially to 0.008, 0.08, 0.2, 0.4, 0.8 m and was tested for cytotoxicity with mtt (3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide) assay. solutions tested at a concentration of 0.4 m appeared too toxic to be analyzed, even at 24 hours. however, compounds tested at a concentration of 0.2 m did not reveal significant cytotoxicity. the cultures were divided into three groups based on the stage of differentiation. on day 2 when the cells reached confluency, differentiation was induced by treating the cells for 48 hours with mdi cocktails consisting of 1 g / ml dexamethasone, 0.5 mm isobutylmethylxanthine, and 10 g / ml insulin and maintained for two days. during this time of growth arrest, pgs were added to the media to evaluate the effect of pgs before the start of differentiation. after the growth arrest, pgs were added to the media to evaluate their effect on the early or late stage of differentiation. in another group, the medium was replaced and pgs were added to the media on day 10 and maintained until day 14 to evaluate the effect on lipolysis after differentiation. total rna was extracted with trizol (invitrogen, carlsbad, ca, usa). northern blot analysis to measure the mrna expression of lipoprotein lipase (lpl) and ppar2 was performed before and after the growth arrest to evaluate the effects of pgs on early differentiation. briefly, an rna denaturation mix composed of isolated rna, oligo dt primer, and nuclease - free water was used to denature the rna. the polymerase chain reaction (pcr) primer pairs for cdna amplification were as follows : lpl (forward) 5'-tgccgctgttttgttttacc-3 ' and (reverse) 5'-tcacagtttctgctcccagc-3 ', ppar2 (forward) 5'-tgccgctgttttgttttacc-3 ' and (reverse) 5'-aatcagcaaccattgggtca-3 '. taq green master mix (promega, madison, wi, usa) and 10 pmol of forward primer and reverse primer were added to the synthesized cdna, and amplified with annealing for 30 cycles with dnaengine cycler (bio - rad, hercules, ca, usa). the dna band of amplified pcr products was analyzed by multi - gauze (fujifilm, tokyo, japan) after electrophoresis. g3pdh, known as a late marker of differentiation, participates in the adipose conversion of 3t3 cells. g3pdh activities were assessed on day 10 using commercial kits with the manufacturer 's instructions. the absorbance was measured at 340 nm with a spectrophotometer (fluostar optima ; bmg labtech, offenburg, germany). a glycerol assay was performed to evaluate the effects of pgs on the lipolysis of differentiated adipocytes on day 14. for the quantitative enzymatic determination of glycerol, the expression of mrna was scanned, and the relative intensity of the bands was determined by densitometry. data are expressed as mean standard error of the mean corresponding to the number of wells analyzed. experimental differences between control culture results and the single treatment groups were evaluated using student 's t - test with p - values less than 0.05 considered significant. methylisobutylxanthine, dexamethasone, insulin, and free glycerol determination kit (free glycerol determination kit) were purchased from sigma - aldrich chemical (st. louis, mo, usa). a glycerol-3-phosphate dehydrogenase (g3pdh) activity assay kit was purchased from takara nio (gpdh activity assay kit ; shiga, japan). fbs, dulbecco 's modified eagle 's medium, penicillin / streptomycin, and trypsin were purchased from gibco (grand island, ny, usa). primers for mrna were obtained from genet bio (seoul, korea). all other reagents and general lab chemicals the effects of the pgf2 analogs, latanoprost (xalatan ; pfizer, new york, ny, usa) and travoprost (travatan, alcon) in their commercial formulations, were investigated on adipose differentiation and intracellular, lipid storage. each pg solution was diluted serially to 0.008, 0.08, 0.2, 0.4, 0.8 m and was tested for cytotoxicity with mtt (3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide) assay. solutions tested at a concentration of 0.4 m appeared too toxic to be analyzed, even at 24 hours. however, compounds tested at a concentration of 0.2 m did not reveal significant cytotoxicity. the cultures were divided into three groups based on the stage of differentiation. on day 2 when the cells reached confluency, differentiation was induced by treating the cells for 48 hours with mdi cocktails consisting of 1 g / ml dexamethasone, 0.5 mm isobutylmethylxanthine, and 10 g / ml insulin and maintained for two days. during this time of growth arrest, pgs were added to the media to evaluate the effect of pgs before the start of differentiation. after the growth arrest, pgs were added to the media to evaluate their effect on the early or late stage of differentiation. in another group, the medium was replaced and pgs were added to the media on day 10 and maintained until day 14 to evaluate the effect on lipolysis after differentiation. total rna was extracted with trizol (invitrogen, carlsbad, ca, usa). northern blot analysis to measure the mrna expression of lipoprotein lipase (lpl) and ppar2 was performed before and after the growth arrest to evaluate the effects of pgs on early differentiation. briefly, an rna denaturation mix composed of isolated rna, oligo dt primer, and nuclease - free water was used to denature the rna. the polymerase chain reaction (pcr) primer pairs for cdna amplification were as follows : lpl (forward) 5'-tgccgctgttttgttttacc-3 ' and (reverse) 5'-tcacagtttctgctcccagc-3 ', ppar2 (forward) 5'-tgccgctgttttgttttacc-3 ' and (reverse) 5'-aatcagcaaccattgggtca-3 '. taq green master mix (promega, madison, wi, usa) and 10 pmol of forward primer and reverse primer were added to the synthesized cdna, and amplified with annealing for 30 cycles with dnaengine cycler (bio - rad, hercules, ca, usa). the dna band of amplified pcr products was analyzed by multi - gauze (fujifilm, tokyo, japan) after electrophoresis. g3pdh, known as a late marker of differentiation, participates in the adipose conversion of 3t3 cells. g3pdh activities were assessed on day 10 using commercial kits with the manufacturer 's instructions. the absorbance was measured at 340 nm with a spectrophotometer (fluostar optima ; bmg labtech, offenburg, germany). a glycerol assay was performed to evaluate the effects of pgs on the lipolysis of differentiated adipocytes on day 14. for the quantitative enzymatic determination of glycerol, the expression of mrna was scanned, and the relative intensity of the bands was determined by densitometry. data are expressed as mean standard error of the mean corresponding to the number of wells analyzed. experimental differences between control culture results and the single treatment groups were evaluated using student 's t - test with p - values less than 0.05 considered significant. adipose differentiation has been described as a cascade of events characterized at the molecular level by the induction of early and late markers of differentiation. experiments were performed to determine whether topical pg analogues inhibited the expression of early markers of differentiation. as a result, topical pg analogues did not increase the expression of mrna for both lpl and ppar2 significantly (fig. the activities of early markers of differentiation were not changed significantly before and after growth arrest (figs. 3 and 4). the results shown in fig. 5 indicate that the addition of topical pg analogues to the culture medium of 3t3-l1 cells inhibited the increase of g3pdh specific activity, a late marker of differentiation. with exposure to latanoprost, there was a dose - dependent decrease in the g3pdh activity in the following order : 0.008 m (92.82 1.27%), 0.08 m (60.21 1.96%), and 0.2 m (53.18 1.47%). with exposure to travoprost, there was also a dose - dependent decrease in the g3pdh activity in the following order : 0.008 m (67.97 0.67%), 0.08 m (53.07 1.52%), and 0.2 m (36.44 0.97%). both latanoprost and travoprost decreased g3pdh activity significantly (p 0.05). adipose differentiation has been described as a cascade of events characterized at the molecular level by the induction of early and late markers of differentiation. experiments were performed to determine whether topical pg analogues inhibited the expression of early markers of differentiation. as a result, topical pg analogues did not increase the expression of mrna for both lpl and ppar2 significantly (fig. the activities of early markers of differentiation were not changed significantly before and after growth arrest (figs. 3 and 4). the results shown in fig. 5 indicate that the addition of topical pg analogues to the culture medium of 3t3-l1 cells inhibited the increase of g3pdh specific activity, a late marker of differentiation. with exposure to latanoprost, there was a dose - dependent decrease in the g3pdh activity in the following order : 0.008 m (92.82 1.27%), 0.08 m (60.21 1.96%), and 0.2 m (53.18 1.47%). with exposure to travoprost, there was also a dose - dependent decrease in the g3pdh activity in the following order : 0.008 m (67.97 0.67%), 0.08 m (53.07 1.52%), and 0.2 m (36.44 0.97%). both latanoprost and travoprost decreased g3pdh activity significantly (p 0.05). the results presented in this study demonstrate that topical pgf2 agonists are inhibitors of adipose differentiation in 3t3-l1 cells. the 3t3-l1 cell line is one of the most well - characterized and reliable models for studying the conversion of preadipocytes into adipocytes. in culture, after induction, differentiating preadipocytes undergo a post - confluent mitosis and subsequent growth arrest. adipose differentiation corresponds to a sequential series of events characterized by the induction of early markers of differentiation, followed by the induction of late markers of differentiation. the prostanoids are an established group of ocular hypotensive drugs used for the clinical management of glaucoma. topical application of the prodrug latanoprost (ester) leads to absorption of approximately 1% of the drug through the cornea, where it is completely hydrolyzed to the biologically - active acid form. the pg transporter oatp2a1 is expressed in human ocular tissues and transports the antiglaucoma prostanoids. these compounds have been proven to be highly efficient agents for lowering intraocular pressure, with few local and systemic side effects. the order of potency of various pgs suggests that inhibition of differentiation may be mediated by binding to the pgf2 receptor, which is classified as an fp receptor. a previous study reported a possible mechanism for pgf2 in acting as a barrier to the 3t3-l1 differentiation program through a specific fp receptor. in contrast, compounds structurally related to pge2 such as 17-phenyltrinor pge2, had no effect on adipose differentiation except when added at a 10,000-fold higher concentration. activation of the fp receptor resulted in a transient increase in intracellular calcium, which is known to occur through the g protein - mediated activation of phospholipase c. reginato. showed that pgf2 has an antiadipogenic effect by combining with the cell surface fp receptor to activate mitogen - activated protein kinase, and that it inhibits the nuclear hormone receptor, ppar. fp receptors are present at similar levels in both preadipocytes and adipocytes, and the fp receptor - mediated inhibition of differentiation appears to be regulated by alterations in the pgf2 concentration, rather than in receptor expression. since pgf2 inhibits the differentiation of newborn rat adipocyte precursors in primary culture in defined medium, the inhibitory effect on the adipose differentiation observed with pgf2 is likely physiological. the reduction of pgf2 may allow cells to progress into terminal differentiation as pgf2 concentrations decrease during 3t3-l1 differentiation. expression of mrna for lpl and ppar2, early markers of adipocyte differentiation, was examined in cells treated with pg analogues in this study. expression of mrna for both early markers was not changed in the presence of latanoprost or travoprost. with exposure to travoprost, g3pdh activity was more significantly decreased compared to latanoprost in this study. the discrepancy in the inhibitory effects between latanoprost and travoprost on the differentiation of adipocytes may be explained by the level of affinity to the fp receptors since travoprost is known to have a higher fp receptor affinity than latanoprost. accumulation of glycerol was not inhibited when differentiated adipocytes were exposed to latanoprost or travoprost. since peplinski and albiani smith first reported the upper eyelid sulcus deepening and dermatochalasis involution in three caucasian patients treated with bimatoprost unilaterally, other similar clinical observations have been reported. previous studies suggest that the common pathophysiologic mechanism of periocular changes by pg analogues is atrophy of preaponeurotic and deep orbital fat. a recent histological study also suggests orbital fat atrophy as a mechanism of upper eyelid sulcus deepening in topical pg analog users, including those using bimatoprost. pgf2 analogs exhibit different agonist activities in experimental and clinical applications ; this has been attributed to structural differences between the pgf2 analogs, differences in fp receptor affinity, or minor effects on other pg receptors. a study with human orbital preadipocytes showed that latanoprost had the weakest antiadipogenic effect, and bimatoprost induced the most significant reduction of adipogenesis. as inhibition of adipose differentiation by pgf2 can be reversible, the inhibitory effects of topical pgs may be important for the short term regulation of adipocyte function in vivo within the adipose tissue. future in vivo experiments are necessary to investigate this possibility and determine the physiological significance of this antiadipogenic process of pgf2 in adipose tissue. this study demonstrates that there is a greater suppression of preadipocyte differentiation rather than lipolysis in adipocytes. this discrepancy may result from a cytokine - induced increase in pg synthesis, which would be expected to increase lipolysis since orbital fat tissue represents a highly specialized adipose tissue depot that occupies the space behind the eyeball. orbital fat tissue is biologically distinct from the omental and subcutaneous fat tissue, not only in morphological phenotypic features, but also at a molecular level with respect to expression of distinct surface receptors, cellular proteins, and responses to cytokines or hormones. inhibition of preadipocyte differentiation or reduction of fat accumulation in adipocytes caused by hormones, drugs, or pgs might be linked to orbital volume reduction, and volume deficits of the orbit may lead to deep superior sulcus syndrome and enophthalmos in vivo. in summary, pgf2 inhibits the expression of markers that are induced when the cells have just starting to differentiate. the addition of pgf when the cells had just started to differentiate was sufficient to inhibit 3t3-l1 cell differentiation as pgf2 was added during the differentiation period, and the expression of mrna for the late marker of differentiation (g3pdh activity) was decreased. in contrast, pgf2 added before the onset of the differentiation program had a much less inhibitory effect on differentiation. the results presented here also indicate that pgf2 is less effective in blocking differentiation once the cells have started to differentiate. to conclude, topical antiglaucoma pg drugs inhibited the differentiation of preadipocytes especially at the late stage of differentiation. although reversible in some cases after cessation, this inhibitory effect of pg on orbital adipose precursors and adipogenesis could be an important pathophysiologic mechanism of upper eyelid sulcus deepening in topical pg analog users. thus, when prescribing these drugs, this adverse effect should be explained to patients and monitoring for possible adverse effects should be performed.	purposeto investigate the effects of topical prostaglandin analogue drugs on the differentiation of adipocytes.methodsdifferentiation of 3t3-l1 preadipocytes was induced with isobutylmethylxanthine, dexamethasone, and insulin. 3t3-l1 cells were exposed to 0.008, 0.08, 0.2 m of latanoprost and travoprost. reverse transcription polymerase chain reaction for mrna expression of lipoprotein lipase and peroxisome proliferator - activated receptor 2 (ppar2), and glycerol-3-phosphate dehydrogenase (g3pdh) assays were performed to examine the effects on early and late differentiation, respectively. also, glycerol assays were done to evaluate the effect of prostaglandin analogues on lipolysis after differentiation.resultsboth prostaglandin analogues inhibited differentiation of preadipocytes. topical prostaglandin analogues significantly decreased g3pdh activity, a marker of late differentiation. however, topical prostaglandin analogues did not change mrna expressions of lipoprotein lipase and ppar2, markers of early differentiation. the activities of the early markers of differentiation were not changed significantly before and after growth arrest. compared to latanoprost, travoprost decreased g3pdh activity more significantly (p 0.05).conclusionsprostaglandin analogues display an inhibitory effect on the differentiation of adipocytes when the cells start to differentiate especially in the late stage of differentiation. thus, commercial topical prostaglandin analogues may decrease the fat contents of eyelids.
	plasmonic metamolecules have received much interest in the last years because they can produce a wide spectrum of different hybrid optical resonances. most of the configurations presented so far, however, considered planar resonators lying on a dielectric substrate. this typically yields high damping and radiative losses, which severely limit the performance of the system. here we show that these limits can be overcome by considering a 3d arrangement made from slanted nanorod dimers extruding from a silver baseplate. this configuration mimics an out - of - plane split ring resonator capable of a strong near - field interaction at the terminations and a strong diffractive coupling with nearby nanostructures. compared to the corresponding planar counterparts, higher values of electric and magnetic fields are found (about a factor 10 and a factor 3, respectively). high - quality - factor resonances (q 390) are produced in the mid - ir as a result of the efficient excitation of collective modes in dimer arrays.
patients with gastric cancer may have poor health - related quality of life (qol) resulting from the disease itself before surgery. patients may still suffer from poor qol due to the consequences of surgery after a gastrectomy. the overall survival rate of patients with gastric cancer has increased due to the development of diagnostic tools, mass screening programs, and advancements in multimodality management. however, significant morbidity, including early satiety, loss of appetite, heartburn, dysphagia, nausea, and vomiting is still associated with gastrectomy. these symptoms have a profound impact on qol of postoperative patients. as a result, qol is a multi - dimensional construct covering several key dimensions including disease and treatment - related symptoms as well as physical, psychological, and social functioning. the european organization for research and treatment of cancer (eortc) quality of life questionnaire (qlq)-c30 is a reliable and validated measure of the qol of patients with cancer in international trials in oncology. the korean version of this questionnaire has also been validated. the questionnaire is a cancer - specific, self - administered, structured questionnaire including 30 questions composed of both multi - item scales and single - item measures. these scales / items include five functional scales (physical, role, emotional, cognitive, and social), three symptom scales (fatigue, nausea and vomiting, and pain), a global health status / qol scale, and six single items (dyspnea, insomnia, appetite loss, constipation, diarrhea, and financial difficulties). these 15 scales / items are grouped as follows : a global health status / qol scale, five functional scales, and nine symptom scales / items. the gastric cancer module (qlq - sto22) is a supplement to the qlq - c30. the qlq - sto22 consists of 22 questions evaluating five multi - item symptoms scales (dysphagia, pain, reflux symptoms, eating restrictions, and anxiety), and four single items (dry mouth, taste, body image, and hair loss). qol has become an increasingly important factor for long - term survivors after surgery for gastric cancer. several studies have examined qol after a gastrectomy in patients with gastric cancer using eortc qlq - c30 and qlq - sto22. a few studies have prospectively evaluated changes in qol after surgery in short - term survivors [5 - 9 ]. however, most studies have important limitations, including, above all, small sample size [10 - 12 ] and retrospective study design. researchers attempted to determine the relationship between postoperative qol and the extent of gastric resection, type of reconstruction after gastrectomy, and method of abdominal approach, reaching varied conclusions. as qol changes over time, good knowledge regarding long - term chronological changes in qol of relapse - free patients after a gastrectomy is essential to providing more appropriate care for patients. however, no study has prospectively evaluated the longitudinal changes in qol of long - term survivors. in this study, we prospectively evaluated the chronological changes in qol after a gastrectomy over a 5-year postoperative period in a large group of patients. a total of 1,105 patients who underwent a curative gastrectomy for primary gastric cancer between january 2008 and june 2010 at the kyungpook national university hospital were enrolled in this prospective cohort study. among them, 439 patients completed the entire series of qol assessments during the 5-year postoperative period ; 161 patients with co - morbidities that could affect the qol including cardiovascular disease, diabetes mellitus, chronic respiratory disease, chronic hepatic disease, and cerebrovascular disease and 24 patients who underwent another operation were excluded. the study was approved by the institutional review board of kyungpook national university hospital (no. 201510035001). qol was assessed using the korean versions of the eortc qlq - c30 and qlq - sto22. all patients were asked to complete the questionnaires by themselves on the day of admission and at regular follow - up visits (1, 2, 3, 4, and 5 years after surgery). the raw scores were transformed to scores ranging from 0 to 100 according to the scoring manual provided by the eortc. a high score for a functional scale represents a high / healthy level of functioning and a high score for the global health status / qol represents a high qol, but a high score for a symptom scale / item represents a high level of symptomatology / problems. for the eortc qlq - sto22, the mean scores of each scale were compared in a longitudinal fashion across five postoperative years. one way analysis of variance followed by a bonferroni post - hoc test or dunnett t3 post - hoc test was performed for comparison of differences in the mean scores among the time intervals. a total of 1,105 patients who underwent a curative gastrectomy for primary gastric cancer between january 2008 and june 2010 at the kyungpook national university hospital were enrolled in this prospective cohort study. among them, 439 patients completed the entire series of qol assessments during the 5-year postoperative period ; 161 patients with co - morbidities that could affect the qol including cardiovascular disease, diabetes mellitus, chronic respiratory disease, chronic hepatic disease, and cerebrovascular disease and 24 patients who underwent another operation were excluded. the study was approved by the institutional review board of kyungpook national university hospital (no. 201510035001). qol was assessed using the korean versions of the eortc qlq - c30 and qlq - sto22. all patients were asked to complete the questionnaires by themselves on the day of admission and at regular follow - up visits (1, 2, 3, 4, and 5 years after surgery). the raw scores were transformed to scores ranging from 0 to 100 according to the scoring manual provided by the eortc. a high score for a functional scale represents a high / healthy level of functioning and a high score for the global health status / qol represents a high qol, but a high score for a symptom scale / item represents a high level of symptomatology / problems. for the eortc qlq - sto22, the mean scores of each scale were compared in a longitudinal fashion across five postoperative years. one way analysis of variance followed by a bonferroni post - hoc test or dunnett t3 post - hoc test was performed for comparison of differences in the mean scores among the time intervals. preoperative and 5-year postoperative mean scores of eortc qlq - c30 and qlq - sto22 scales / items are shown in table 2. global health status / qol tended to increase after the first postoperative year and the mean score at the 5th postoperative year was significantly higher than 1 year after the gastrectomy (p=0.012) (fig. 1). physical functioning score, role functioning score, and cognitive functioning score decreased significantly in the first postoperative year (p < 0.001, p < 0.001, and p=0.001, respectively), but showed no significant changes thereafter. social functioning scores showed no statistically significant changes compared to preoperative score during the 5-year postoperative period (fig. fatigue score increased significantly 1 year after surgery (p < 0.001) and then decreased gradually. nausea and vomiting score and pain score increased 1 year after surgery without significance and tended to decrease afterward (fig. 3). there were no statistically significant changes in dyspnea, insomnia, appetite loss, and constipation scores compared with preoperative scores during the 5-year postoperative period. although there was a tendency to decrease afterward, diarrhea score was significantly higher 5 years after surgery compared with the preoperative level (fig. the changes in the mean scores of qlq - sto22 scales / items are shown in figs. 5 and 6. dysphagia and eating restrictions showed significant worsening 1 year after surgery (p < 0.001 and p < 0.001, respectively). despite gradual improvements in these symptoms, the scores showed significantly higher levels compared with preoperative levels 5 years after the gastrectomy (p < 0.001 and p < 0.001, respectively). anxiety had increased significantly 1 year after surgery (p < 0.001), then decreased gradually. although taste score showed significant worsening 1 year after surgery (p=0.008), there were no significant differences after 2 years postoperatively similar to another study, our results showed that the global health status / qol decreased slightly during the first postoperative year and tended to increase afterward. there were no statistically significant changes in the dyspnea, insomnia, appetite loss, constipation, financial difficulties, dry mouth, and hair loss scores compared with preoperative scores during the 5-year postoperative period. hair loss is often used for assessment of qol related to chemotherapy or radiotherapy for various types of cancer. former cancer patients appear to pay less attention to their hair as long as they remain free of disease following cancer surgery. similar to other studies, emotional functioning was the worst at baseline and showed constant improvement after surgery. emotional functioning appears to be related to the depression caused by the initial diagnosis of cancer, and patients were gradually relieved from depression regarding their disease over time. a gastrectomy has a temporary negative impact on most aspects of qol, and recovery typically occurs within the six or 12 postoperative months. the qol of long - term survivors after a gastrectomy is influenced by the surgery itself as well as past memories of malignancy even when patients are considered to be disease - free. reported that physical functioning and role functioning showed the lowest scores after surgery and did not fully recover to preoperative levels until 1 year after surgery. in addition, scores for fatigue, nausea and vomiting, diarrhea, dysphagia, eating restriction, anxiety, taste, and body image remained significantly higher 1 year after surgery. therefore, the authors recommended further follow - up to confirm whether these scales / items will recover or not. among them, our study showed that scores for nausea and vomiting, anxiety, and taste gradually returned to the preoperative levels and showed no significant differences 5 years after a gastrectomy. however, changed physical functioning, role functioning, fatigue, diarrhea, dysphagia, eating restrictions, and body image did not recover even 5 years after a gastrectomy. cancer and its treatments are associated with increased fatigue that may persist for years after cancer eradication. our results showed that fatigue score was the highest 1 year after the gastrectomy and remained at a significantly increased level until 5 years after surgery. although there was no statistically significant change in global health status / qol, our study found low qol related to upper gastrointestinal symptoms including diarrhea, dysphagia, reflux symptoms, and eating restrictions in long - term survivors. decreased physical functioning, role functioning, and cognitive functioning, fatigue, and a poor body image also impact qol for a long time. while surviving 5 years after surgery is often regarded as a turning point in the fight against cancer, in terms of qol, survivors after a gastrectomy still have persistent needs for management of qol. management of symptoms should be specifically targeted as part of patient care after a gastrectomy. development of appropriate interventions and individual management for each symptom by surgeons is required for patients with these symptoms. the ultimate goal of the qol assessment of cancer patients is to restore them to a healthy period as rapidly as possible. although physical functioning, role functioning, cognitive functioning, and body image may deteriorate with age, proper nutritional care including monitoring and correcting patients daily dietary habits will improve food intake resulting in weight gain and improved physical functioning, role functioning, and body image. patients with impaired cognitive functioning should undergo a complete medical checkup and consult with a neurologist or a psychiatrist. in addition, patients should be encouraged to preserve self - esteem and maintain social activity. it is recommended that changes in postoperative qol be used to inform patients about what to expect after surgery and to guide timely supportive postoperative interventions. surgeons should reassure patients that qol will mostly return to baseline about 1 year after surgery and that qol related to upper gastrointestinal symptoms will still be lower but these symptoms will be managed individually and on a timely basis. we enrolled consecutive patients undergoing gastrectomy by the same small group of surgeons at one institution and prospectively collected data on qol. the inclusion of the preoperative qol data of all patients and the postoperative assessments at fixed times enables the comparison of qol between baseline and postoperative changes in qol. preoperative qol refers to qol that has not yet been altered by surgery and still represents postmorbid qol. preoperative - based interpretations of postoperative change in qol may not only exaggerate the persistence of decreased qol but also conceal ongoing qol deterioration after surgery. despite this limitation, we considered preoperative qol as the baseline because acquiring data regarding premorbid qol from patients was not feasible in clinical practice. management of gastrointestinal symptoms should be specifically targeted as a part of long - term patient care after a gastrectomy. proper nutritional care will improve food intake resulting in weight gain and improved physical functioning, role functioning, and body image. in addition, patients should be encouraged to preserve self - esteem and maintain social activity.	purposea few studies have prospectively evaluated changes in quality of life (qol) after surgery in short - term survivors ; however, no prospective study has evaluated the longitudinal changes in qol in long - terms survivors. we prospectively evaluated the chronological changes in qol after a gastrectomy over a 5-year postoperative period in a large group of patients.materials and methodsqol data from the european organization for research and treatment of cancer qlq - c30 and the qlq - sto22 questionnaires were obtained from 254 patients who completed the entire series of qol assessments preoperatively and at 1, 2, 3, 4, and 5 years after surgery.resultsthere was no statistically significant change in global health status / qol during the 5-year postoperative period. decreases in qol from upper gastrointestinal symptoms including diarrhea (p < 0.001), dysphagia (p < 0.001), reflux symptoms (p=0.029), and eating restrictions (p < 0.001) were observed among the long - term survivors. decreased physical functioning (p < 0.001), role functioning (p < 0.001), and cognitive functioning (p < 0.001), along with fatigue (p=0.045) and a poor body image (p=0.003), negatively impacted the patients qol for a long time.conclusionmanagement of gastrointestinal symptoms should be specifically targeted as a part of long - term patient care after a gastrectomy. proper nutritional care will improve food intake resulting in weight gain and improved physical functioning, role functioning, and body image. in addition, patients should be encouraged to preserve self - esteem and maintain social activity.
choroid plexus papillomas are considered as who grade i tumors and are among the most common tumors in children less than 2 years. however the present case illustrates a case where the tumor was detected in - utero and had to be operated upon relatively early because of obstructive hydrocephalus and raised intracranial pressure with excellent outcome. this male infant was the first baby born to parents with non - consanguineous marriage, residing in a remote village. the prenatal period was uneventful except in 8 month of gestational age when a routine ultrasonographic (usg) examination revealed large head size, exact details were not available. although the pregnancy was declared high risk, the baby was born at full term through caeserian section. at birth, although the baby cried immediately after the birth he did not take feeds. in the next few days the baby had progressive increase in head size with excessive crying along with multiple episodes of vomiting. he was brought to us at the age of 3 weeks with complaints of progressive increase in head size, episodes of excessive inconsolable cries associated with multiple vomiting as well as failure to gain weight. on examination, he was subjected immediately to non - contrast computerized tomography (ncct) scan of the brain [figure 1 ] that showed a large hyperdense mass lesion in the left lateral ventricle arising from the atrium causing biventricular obstructive hydrocephalus with enlargement of lateral ventricles. on three dimensional reconstruction it was clear that the lesion was arising from the left lateral ventricle choroid plexus wit h four well - defined stalks of attachments medially to the atrium. these radiological findings pointed towards choroid plexus papilloma (cpp) and he was planned for surgical excision of the lesion. in view of the complaints and features suggesting raised intracranial pressure since birth it was highly likely that the pathology was developed in fetal life and only when the problem became unbearable, parents sought medical advice. pre - operative non - contrast computerized tomographic scan - axial view patient was given general anesthesia and positioned prone and left sided parieto - occipital osteoplastic craniotomy was performed using midas rex drill. brain was tense on removing the bone flap, prophylactic cerebro spinal fluid (csf) drainage from left frontal horn was performed to relax the brain. after this, duramater was opened and transcortical - transventricular approach was taken to the occipital horn of left lateral ventricle. large, soft - firm, white - yellow colored, cauliflower - like lesion were seen that was could be partly sucked out. under high - magnification microscope the feeders from the choroidal arteries were identified, coagulated and severed with minimal retraction of the lesion, utilizing the buoyancy provided by the csf. sequentially the other remaining stalks of attachments were identified microscopically and coagulated with bipolar electrocautery and cut. the complete lesion was excised in - toto [figure 2 ] and the choroid plexus visible in the left lateral ventricle was coagulated. hemostasis was achieved and closed with a ventricular drain placed in left lateral ventricle that was kept for 3 days. post - operative ncct scan of the brain showed complete excision of the lesion with resolved hydrocephalus and accompanying interstitial edema [figure 3 ]. the baby was discharged on post - operative day 10 and he was taking oral feeds with no further episodes of vomiting. post - operative non - contrast computerized tomographic scan the infant was doing well at the last follow - up at 6 months post - operation. a post - operative magnetic resonance imaging (mri) brain revealed no evidence of residual lesion, resolution of hydrocephalus and evidence of corticectomy. when these lesions are located in the lateral ventricle, the median age at diagnosis is 18 months, and there is no predilection to occur in either sex. they are well - circumscribed lobulated intraventricular masses with cysts, necrosis, and hemorrhage. on immunohistochemistry they are positive for cytokeratin, vimentin and s-100 protein which is expressed in 90% of cpps. in around 20% of pediatric cases, these tumors show malignant transformation ; approximately half of them are located within the atrium. they are similar in aspect to the glomus of the choroid plexus, being formed by a single cell layer of cuboid or cylindrical cells surrounded by a thin fibrovascular structure. in the latest world health organization (who) classification, cpps are classified as grade i. on ncct of brain these tumors frequently contain calcifications, hemorrhages in various stages, or cysts. in some cases, cpps may fill the ventricular cavity, whereas in others, the ventricle may be markedly dilated ipsilaterally. the surgical approach should aim to expose and interrupt the proximal arterial supply from the choroidal artery to devascularize the tumor at an early stage of the procedure followed by in - toto excision of the tumor. in the present case, authors illustrate an unusual presentation of cpp with raised intracranial pressure (icp) since birth. after the complete surgical excision post - operative period was uneventful and the baby is doing well till last follow - up, 6 months post surgery. this case illustrates the rare fetal cpp and the need for proper pre - operative planning, meticulous surgical technique, and intensive intra - operative monitoring for normothermia, fluid - electrolyte balance, and blood replacement for achieving excellent results.	choroid plexus papillomas (cpps) are rare tumors having bimodal distribution. pediatric cpps are commonly present in supratentorial compartment and most commonly located in lateral ventricle and usually present at 16 - 18 months. authors could find only one case report of fetal choroid plexus papilloma in the literature. in the present case, authors illustrate an unusual presentation of cpp with raised intracranial pressure (icp) since birth, the need for proper preoperative planning, meticulous surgical technique, and intensive intra operative monitoring for normothermia, fluid - electrolyte balance, and blood replacement for achieving excellent results.
a 32-year - old man visited the emergency room of seoul national university bundang hospital with a complaint of sudden - onset back pain. he had undergone several aortic surgeries at other hospitals and had been diagnosed with marfan syndrome. at the age of 16, he underwent a bentall operation for an acute stanford type a aortic dissection. eight years after the first operation, to address the increased size of the aortic aneurysm, he underwent a replacement of the aortic arch and descending thoracic aorta to the level of the seventh thoracic vertebra via a t - shaped thoracosternotomy. after the second operation, he had been followed up regularly with yearly computed tomography (ct) scans for a remaining thoracoabdominal aortic aneurysm, which remained stable with a maximal diameter of 53 mm over the prior five years. a thorough physical examination and review of previous ct images demonstrated hypertelorism, bifid uvula, arachnodactyly, and a tortuous aorta, which suggested loeys - dietz syndrome (lds) rather than marfan syndrome (fig. preoperative ct imaging showed a periaortic hematoma from the descending thoracic aorta to the abdominal aorta compatible with the concealed rupture of a thoracoabominal aortic aneurysm (fig. the left thoracic cavity was entered through the seventh intercostal space and the incision was extended to a curvilinear thoracoabdominal incision. the left femoral artery and vein were cannulated for cardiopulmonary bypass. as severe pleural adhesion caused by previous aortic surgeries made it difficult to find a safe site for proximal cross - clamping, the proximal anastomosis was made under total circulatory arrest in deep hypothermia (rectal temperature 20c). the remaining anastomoses were made during the rewarming period after cardiopulmonary bypass was reinstituted via the side branch of a four - branch polyester vascular graft (gelweave coselli thoracoabdominal graft ; vascutek, renfrewshire, scotland, uk) and the left femoral artery. two pairs of intercostal arteries, from thoracic ribs 10 and 12, were reimplanted to the main body graft as separate carrel patches. in addition, the visceral branches of the abdominal aorta were reimplanted to the branch grafts, and the distal anastomosis was made at the infrarenal aorta. the operation took 455 minutes including 17 minutes of total circulatory arrest and 132 minutes of cardiopulmonary bypass. the postoperative course was uneventful, and the patient was discharged 21 days postoperatively without any complications. an 18-year - old male was referred to seoul national university bundang hospital for a rapidly increasing thoracoabominal aortic aneurysm. seven months prior, the surgeon in the referring center replaced the proximal half of the descending thoracic aorta based on the diagnosis of acute type b dissection, an aberrant right subclavian artery, and marfan syndrome. the maximal diameter of the remaining thoracic aorta, which had been 31 mm at the time of the first operation, was found to have increased to 63 mm in a postoperative ct scan taken six months later (fig. 3). a physical examination revealed bifid uvula, hypertelorism, and a clubfoot deformity that had required multiple orthopedic operations (fig. moderate dilatation of the aortic root (diameter 41 mm) along with marked tortuosity of the entire aorta and its major branches were noted in the ct scan. the incision and exposure of the aorta were performed in the same manner as the first patient. as there was no severe pleural adhesion despite previous surgeries, a pre - existing proximal thoracic graft was easily mobilized for cross - clamping. all of the anastomoses were made under aortic cross - clamping and partial cardiopulmonary bypass via the left femoral artery and vein. two pairs of intercostal arteries, from thoracic ribs 10 and 12, were reimplanted to a parallel 10 mm dacron graft (vascutek, renfrewshire, scotland, uk) that had been anastomosed to the main body graft before aortic clamping. visceral branch reimplantation and distal anastomosis were performed in the same manner as the first patient. the durations of the entire operation and of the cardiopulmonary bypass were 365 and 123 minutes, respectively. he was readmitted 30 days later and underwent a second surgery : a valve - sparing aortic root replacement (david s reimplantation) and a total arch replacement. this operation was also uneventful and the patient was in good condition at the most recent follow - up, eight months after the operation. a 32-year - old man visited the emergency room of seoul national university bundang hospital with a complaint of sudden - onset back pain. he had undergone several aortic surgeries at other hospitals and had been diagnosed with marfan syndrome. at the age of 16, he underwent a bentall operation for an acute stanford type a aortic dissection. eight years after the first operation, to address the increased size of the aortic aneurysm, he underwent a replacement of the aortic arch and descending thoracic aorta to the level of the seventh thoracic vertebra via a t - shaped thoracosternotomy. after the second operation, he had been followed up regularly with yearly computed tomography (ct) scans for a remaining thoracoabdominal aortic aneurysm, which remained stable with a maximal diameter of 53 mm over the prior five years. a thorough physical examination and review of previous ct images demonstrated hypertelorism, bifid uvula, arachnodactyly, and a tortuous aorta, which suggested loeys - dietz syndrome (lds) rather than marfan syndrome (fig. preoperative ct imaging showed a periaortic hematoma from the descending thoracic aorta to the abdominal aorta compatible with the concealed rupture of a thoracoabominal aortic aneurysm (fig. the left thoracic cavity was entered through the seventh intercostal space and the incision was extended to a curvilinear thoracoabdominal incision. the left femoral artery and vein were cannulated for cardiopulmonary bypass. as severe pleural adhesion caused by previous aortic surgeries made it difficult to find a safe site for proximal cross - clamping, the proximal anastomosis was made under total circulatory arrest in deep hypothermia (rectal temperature 20c). the remaining anastomoses were made during the rewarming period after cardiopulmonary bypass was reinstituted via the side branch of a four - branch polyester vascular graft (gelweave coselli thoracoabdominal graft ; vascutek, renfrewshire, scotland, uk) and the left femoral artery. two pairs of intercostal arteries, from thoracic ribs 10 and 12, were reimplanted to the main body graft as separate carrel patches. in addition, the visceral branches of the abdominal aorta were reimplanted to the branch grafts, and the distal anastomosis was made at the infrarenal aorta. the operation took 455 minutes including 17 minutes of total circulatory arrest and 132 minutes of cardiopulmonary bypass. the postoperative course was uneventful, and the patient was discharged 21 days postoperatively without any complications. an 18-year - old male was referred to seoul national university bundang hospital for a rapidly increasing thoracoabominal aortic aneurysm. seven months prior, the surgeon in the referring center replaced the proximal half of the descending thoracic aorta based on the diagnosis of acute type b dissection, an aberrant right subclavian artery, and marfan syndrome. the maximal diameter of the remaining thoracic aorta, which had been 31 mm at the time of the first operation, was found to have increased to 63 mm in a postoperative ct scan taken six months later (fig. 3). a physical examination revealed bifid uvula, hypertelorism, and a clubfoot deformity that had required multiple orthopedic operations (fig. moderate dilatation of the aortic root (diameter 41 mm) along with marked tortuosity of the entire aorta and its major branches were noted in the ct scan. the incision and exposure of the aorta were performed in the same manner as the first patient. as there was no severe pleural adhesion despite previous surgeries, a pre - existing proximal thoracic graft was easily mobilized for cross - clamping. all of the anastomoses were made under aortic cross - clamping and partial cardiopulmonary bypass via the left femoral artery and vein. two pairs of intercostal arteries, from thoracic ribs 10 and 12, were reimplanted to a parallel 10 mm dacron graft (vascutek, renfrewshire, scotland, uk) that had been anastomosed to the main body graft before aortic clamping. visceral branch reimplantation and distal anastomosis were performed in the same manner as the first patient. the durations of the entire operation and of the cardiopulmonary bypass were 365 and 123 minutes, respectively. he was readmitted 30 days later and underwent a second surgery : a valve - sparing aortic root replacement (david s reimplantation) and a total arch replacement. this operation was also uneventful and the patient was in good condition at the most recent follow - up, eight months after the operation. although lds has similarities with marfan syndrome, which is the most common connective tissue disorder, they have distinctive phenotypic and genetic features. lds is an autosomal dominant genetic disorder caused by the mutation of the transforming growth factor beta receptor 1 or 2 genes, whereas marfan syndrome is caused by the mutation of the gene coding for fibrillin-1. both genes are related to the transforming growth factor beta signaling pathway, which leads to the overproduction of collagen, disarrangement of elastic fiber, and loss of elastin content within aortic media. because of these histological changes, vascular media become weak, which makes the aorta extremely prone to aortic aneurysms and dissection. lds is phenotypically characterized by the triad of hypertelorism, bifid uvula and/or cleft palate, and generalized arterial tortuosity throughout the entire aortic system. as these findings are not found in patients with marfan syndrome, it is clinically important to recognize the characteristic phenotypic findings to differentiate between the two syndromes [24 ]. the differential diagnosis between these connective tissue diseases is important because the progression and prognosis of aortic and branch vessel disease is significantly different. although the two syndromes share genetic mutations in the same signaling pathway, previous studies have reported that vascular disease in lds seems to be more widespread and aggressive than it is in marfan syndrome reported the following distinctive features of lds : fatal aortic events at a very young age, fatal aortic dissection and rupture in the aortic root with diameters smaller than 45 mm, aneurysmal changes in the entire aortic and major arterial tree, and high rates of repeat surgical interventions. for these reasons, elective surgical intervention should be considered for young lds patients with smaller aortic diameter as opposed to the general population and even marfan patients [24 ]. the exact incidence of lds is unknown and there have been very few cases reported in south korea. however, more cases might have gone undiagnosed because of an unawareness of this recently recognized syndrome. this speculation is based on the past medical history of our cases ; in these patients, the characteristic phenotypic features of lds were not noticed and marfan syndrome was diagnosed without referring to the recently established diagnostic criteria. because lds results in a much more aggressive aortic disease than marfan syndrome does, the long - term clinical course of our patients could have been changed if the correct diagnosis had been made at the time of their initial operations. the extent of their first operations would have been greater had lds been diagnosed, thereby obviating the need for multiple operations and the risks involved in repeated thoracotomies. in particular, closer follow - up and early elective surgery before the rupture might have been possible in the first patient. in summary, we report two patients with lds who were only correctly diagnosed after one or two aortic surgeries. we conclude that physicians and surgeons dealing with aortic disease should be aware of this new and rare disorder, to ensure early proper diagnoses resulting in a timely and efficient management strategy and the improvement of the long - term prognosis.	due to its low prevalence and because there is lack of awareness about it, loeys - dietz syndrome is often mis - diagnosed as marfan syndrome, which has similar skeletal abnormalities and aortic pathology. however, the differential diagnosis between these two connective tissue diseases is critical because they correspond to different surgical indications and surgical decision - making. we report two cases of successful thoracoabdominal aortic replacement in patients with previously undiagnosed loeys - dietz syndrome.
in cancer, genes encoding signaling molecules and transcription factors (tfs) can become mutated, thereby leading to changes in homeostatic gene regulatory networks, and a block in the normal program of terminal differentiation. aml is a heterogeneous disease that is caused by multiple mutations that affect normal blood cell development from hematopoietic stem cells (hscs) and prime developing cells to become malignant. however, during the progression of the leukemic state, pre - leukemic and leukemic cells undergo clonal evolution creating heterogeneous cell populations with different functional properties. in recent years it has become clear that the majority of initial mutations occur in genes encoding transcriptional and epigenetic regulators (corces - zimmerman., 2014, corces - zimmerman and majeti, 2014). a few studies have examined in a system - wide fashion how leukemic tfs reprogram chromatin and establish specific epigenetic signatures and gene expression programs (prange., 2014). an example for this notion is the case of aml with t(8;21) chromosomal translocation, which gives rise to the fusion protein runx1/eto. this aberrant tf competes with runx1 for its binding motifs, leading to epigenetic reprogramming with a block in myeloid differentiation and the concomitant activation of a precursor - like aml - specific transcriptional network (martens., 2012, however, in the case of karyotypically normal (kn) aml, it has proved to be much harder to identify consistent patterns of deregulation associated with specific mutations. this difficulty is due to (1) the heterogeneous nature of the combinations of underlying mutations and (2) the fact that aml cells often span a range of differentiation states. there is the added complexity that mutations in genes encoding signaling molecules tend to appear late in the process of leukemogenesis, making it harder to definitively link them to consistent target gene alteration (corces - zimmerman., 2014). some of the most frequent secondary mutations found in aml are in tyrosine kinase receptors such as flt3 and kit, which are rendered constitutively active (masson and rnnstrand, 2009). mutations deregulate this process, thus effectively cutting off cancer cells from normal growth regulating controls. however, we currently know very little about how mutations in signaling molecule genes impact on gene expression and whether they also establish a common epigenetic signature. to address this question, we focused on the identification of changes in the chromatin landscape and patterns of gene expression that are driven by constitutive activation of intracellular signaling pathways and concentrated on kn - aml with internal tandem duplications (itds) in the flt3 transmembrane domain as a paradigm. flt3-itd mutations are found in 25% of kn - aml and lead to constitutive activation of the downstream mitogen - activated protein kinase (mapk), akt, and signal transducer and activator of transcription (stat) signaling pathways linked to flt3 (stirewalt and radich, 2003, thiede., 2002). flt3-itd frequently acts as a partner in aml with other mutations such as those in transcription factors, epigenetic regulators, and nucleophosmin (npm1). tyrosine kinase receptor signaling has a direct influence on multiple signaling pathways (gu., 2011, scholl., 2008) and the activities of many tfs (goyama., 2014, yordy and muise - helmericks, 2000), but could also signal to chromatin directly (badeaux and shi, 2013, dawson. our goal was therefore to examine whether the presence of the flt3-itd leads to the establishment of a common epigenetic signature. to this end we mapped open regions of chromatin that exist as dnase i hypersensitive sites (dhss) as this identifies active regulatory elements (cockerill, 2011). using complementary genome - wide analyses of gene expression and regulation in primary aml cells, we show that the flt3-itd mutation is associated with extensive changes in the epigenetic landscape and report a flt3-itd - specific gene expression signature that is associated with flt3-itd - specific dhss. the integration of these global data reveals a cooperation between the mapk inducible transcription factor ap-1 and runx1 as two of the main drivers of a flt3-itd - specific open chromatin signature. in order to define the specific genomic targets of aberrant signaling in kn aml with the flt3-itd mutation, we purified undifferentiated cd34 or cd117 positive cells, or obtained a mononuclear fraction comprising greater than 92% undifferentiated blast cells, either from peripheral blood or from bone marrow of aml patients. this protocol avoided confounding issues associated with contamination by differentiated cells expressing markers unrelated to leukemogenesis. profiles from aml cells were compared to those of the cd34 + progenitor population of mobilized peripheral blood stem cells (pbscs). to identify specific genetic and epigenetic signatures, we performed a comprehensive set of genome - wide analyses that included (1) global mrna microarray analysis to identify aberrantly regulated genes, (2) a dna sequence screen for exonic mutations within 55 candidate myeloid oncogenes and tumor suppressor genes to uncover pathways responsible for aberrant gene expression patterns (table s1), (3) global dnase sequencing (dnase - seq) mapping of dhs patterns to identify aberrantly activated (and absent) cis - regulatory elements, (4) identification of regions within dhss protected from dnase i digestion (digital footprints), and the underlying specific motifs bound by tfs, (5) chromatin immunoprecipitation sequencing (chip - seq) assays to detect specific proteins bound at dhss, and (6) dna methylation array analysis of 450,000 cg sites to detect epigenetically silenced loci. these analyses included 19 kn aml samples, of which 9 were from flt3-itd+ patients. because the exon sequencing screen was unable to detect all of the flt3-itd mutations, which vary greatly in size and location, we confirmed the predicted flt3-itd status by pcr analyses (figure 1a), which indicated that the it d had occurred on both alleles in three of the samples (itd3, itd5, and itd7), while itd4 had two different forms of the it d mutation. data file s1 describes all of the mutations in all our samples, which were found in 21 different genes, plus their allele frequencies. most of these mutations and flt3 pcr products were detected at levels close to 50% or 100%, indicating that these samples were clonal and that some mutations such as those in jak2 were bi - allelic. of the nine itd+ patients, one sample had no other defined mutations (itd1), and this became the prototype itd+ sample anchoring this study. three of the patients with wild - type (wt) flt3 had mutations in genes encoding other signaling molecules linked to flt3 signaling pathways, which included nras, ptn11, socs1, and jak2, which might therefore share some common features with flt3-itd+ aml. socs1 mutations are also known to cooperate with flt3-itd in aml (reddy., 2012). we used microarray analysis to define mrna levels for 22,000 genes for aml samples and in 2 independent samples of cd34 + pbscs. hierarchical clustering of the pearson correlation coefficients was then used to identify similarities and differences between these amls (figure 1b). this analysis included seven flt3-itd+ amls, five amls with wild - type (wt) flt3 (and no other known receptor mutations), and one aml with an activating jak2 mutation (and wt flt3). the seven itd+ amls formed a discrete cluster with high correlation coefficients, while the five wt flt3 amls clustered more closely with the pbscs, and the jak2 mutated aml had a pattern distinctly different to all the other samples. the parallel mutation analysis revealed that mutations in the epigenetic regulators dnmt3a and tet2 were divided between the flt3-itd+ and wt flt3 groups, and mutations in the genes encoding the tfs runx1, gata2, and c / ebp occurred predominantly in the wt flt3 amls. npm1 mutations, which frequently partner flt3-itd, were restricted to the flt3-itd+ aml cluster, but could not alone account for the observed patterns as they did not independently cluster together. to identify a set of genes specifically deregulated in flt3-itd+ aml, we focused on the most related samples from each group and independently analyzed expression data from three core itd+ amls (itd1, itd2, and itd3) and four core wt flt3 amls (wt2, wt3, wt5, and wt7), for which we also had accompanying dhs data. the three itd+ amls included two with mutated npm1 (itd2 and itd3) plus itd1 with no other defined mutations (data file s1). as an additional control and to assess the stage of the differentiation block, we also compared these values with those from normal bone - marrow derived cd14 + myeloid cells. we used this second criterion to assist in the identification of artifacts arising from high levels of gene expression within minor subsets of more differentiated monocytic cells. within the core group of 3 itd+ amls, we identified 730 upregulated genes with average log2 values at least 1.0 above pbscs, (and absolute log2 values of at least 6.5 to select genes at least 1 log above background), plus 1,021 downregulated genes with values at least 1.0 below that of pbscs (blue and green dots, figure 1c). however, only 134 of the upregulated genes and 77 of the downregulated genes maintained the same specific pattern of deregulation relative to both the wt flt3 aml subset and the cd14+ve cells (figures 1c1e, represented by red and black dots). note that some of the 730 genes upregulated in itd+ cells were expressed at very high levels in cd14 + cells, meaning that the elevated values may have arisen from a minor contamination with more differentiated cells. the 134 itd - specific genes were on average expressed at levels 4-fold higher than in pbscs, wt flt3 aml, and cd14+ve cells (figure 1d). conversely, the 77 downregulated genes were on average expressed at levels 4-fold lower than the other three cell types. we confirmed the generality of these observations by demonstrating that the gene expression profile for the genes upregulated in the core itd+ group was essentially identical to the average mrna profile observed for an additional group of four other itd+ amls (itd4, itd6, itd7, and itd8) (figure 1f). these analyses highlighted the need for more than one reference cell type when assessing expression patterns to identify true flt3-itd responsive genes. our data also suggest that the block in differentiation in the flt3-itd+ aml occurs further down the myeloid differentiation pathway as indicated by the presence of the many genes expressed at levels similar to those in more mature cd14+ve cells (and the wt flt3 aml), but higher than in pbscs. the average values for mrna expression for the above two groups of deregulated genes are listed in data file s2. they include upregulated genes that could influence the development of aml cells such as genes encoding (1) the transcriptional regulators foxc1, prdm16 (mel1), and nfix, (2) growth factor receptor genes such as il2ra, il3ra, tnfsf9, tnfrsf4, and tnfrsf18, (3) additional genes influencing growth and survival such as ccna1 (cyclin a), ptp4a3 (prl3), and igfbp2, (4) genes controlling differentiation such as the hoxb2 to hoxb6 cluster, and pbx3, (5) genes controlling homing such as the chemokine genes ccl1 and ccl5, and (6) genes for proteases that are known to remodel tissues and enhance migration such as ctsg, adamts14, mmp15, and (7) a gene cluster that includes the protease genes elane, prtn3, and azu1 as well as lppr3. the upregulated class of genes also contained other potentially important genes regulating signaling and migration such as ak2 (adenylate cyclase), dsc2 (a protein involved in cell adhesion), and the gene encoding the macrophage scavenger receptor scara3, which may be related to the fact that flt3-itd cells increase ros production (sallmyr., 2008). foxc1 encodes a pioneer - type transcription factor (zaret and carroll, 2011). prdm16 is related to the cancer - promoting histone methyl transferase gene evi1, and both evi1 and prdm16 are activated via ras mutations in models of myeloid leukemia (wolf., 2013). the expression patterns of seven of these upregulated genes, plus tbp as a control, are shown in figure s1a for all of the samples analyzed. within the core cluster of three itd+ amls, foxc1 was the only fox gene significantly upregulated in itd+ aml compared to the cluster of four wt flt3 amls, while foxo1 expression was downregulated (figure s1b). most notable of the 77 downregulated genes was a group of 10 hla class ii genes that were consistently downregulated in itd+ aml and not in wt flt3 aml (figure s1c). to validate the conclusions of our mrna expression analysis, we analyzed data from two published studies of much larger cohorts of aml samples (figure 2). for the it d target genes identified above, we calculated the average mrna levels for data from (1) a study of 461 aml patients comparing flt3 itd+aml samples with wt flt3 aml samples (verhaak., 2009) and (2) a study of 200 patients from the cancer genome atlas (tcga) research network comparing all samples with any flt3 mutations with wt flt3 aml samples (cancer genome atlas research network, 2013). this confirmed that on average the above 134 upregulated genes and 77 downregulated genes displayed the same behavior in these much larger studies (figures 2a and 2b). several genes controlling gene expression or cell growth were confirmed as upregulated it d target genes (figure 2a), including runx1, igfbp2, prdm16, ptp4a3, and ccna1 (figure 2c). tumor - specific dhss patterns provide vital clues regarding the nature of tfs involved in tumorigenesis (kreher., 2014). to identify dhss specifically enriched in the itd+ amls, we performed dnase - seq on a matched set of five itd+ amls, five amls with wt flt3, and two independent samples of cd34 + pbscs. in a global evaluation of all the dhss detected, we first identified all peaks for each dataset and determined the sequence tag counts for 400-bp regions centered on each peak. we then divided the peaks into the two separate groups of distal dhss and promoter associated dhss. because we found that the greatest differences between the itd+ and wt flt3 amls were seen for the distal dhss, we focused most of our subsequent more detailed analyses on this group. previous global studies of transcriptional networks have similarly found that tissue - specific patterns are more associated with distal rather than proximal cis - elements (heinz., 2010). for the initial comparisons, we performed hierarchical correlation clustering of the dnase - seq peak data (figure 3a). as seen for the mrna microarray values, the itd+ samples clustered together as a discrete group distinct from both the wt flt amls and the pbscs. parallel analysis of mutations in these samples again suggested that the it d mutation had the greatest influence in defining the overall patterns of distal dhss (figure 3a, bottom). interestingly, within the wt flt3 group the two amls with mutated runx1 genes clustered together, as did the two samples with both gata2 and cebpa mutations. figure 3b depicts the genome browser view of a gene cluster that includes the myeloid genes lppr3, azu1, prtn3, elane, and cfd. four of these closely linked genes were included in the group of 134 highly itd - specific mrnas listed in data file s2. this region includes an itd - specific dhs within an intron of med16, which was essentially absent in both cd34 + pbscs and in amls with wt flt3. figure 3c reveals a strong trend for specific upregulation of expression of the whole cluster of five genes in the itd+ samples (shown in red), with a modest upregulation of med16, which harbors the specific dhs, and no upregulation of the flanking genes. with the exception of aml sample wt1, which carries a nras mutation, these upregulated genes were actually downregulated in aml with wt flt3 (shown in green). to visualize the overall specific dhs pattern in flt3-itd aml, we calculated the ratios for all of the distal dnase - seq peaks for each of the aml samples depicted in figure 3a relative to the same regions, using a pbsc dnase - seq dataset that was sequenced at high read depth. these ratios were then used for hierarchical clustering of the values, which are represented as a heatmap in figure 3d. this analysis identified a cluster of 2,000 dhss that were consistently enriched in the itd+ samples and under - enriched in the wt flt3 samples. conversely, a separate cluster of dhss was consistently downregulated in itd+ aml and upregulated in the wt flt3 samples, indicating that flt3-itd has both positive and negative effects on dhss. we next identified the full complement of flt3-itd - specific dhs peaks by calculating ratios of dnase - seq tag counts for all distal peaks detected in each aml sample and/or the pbscs. peaks were ranked in order of increasing dnase - seq tag count ratios for the aml sample relative to cd34 + pbscs, and the dnase - seq data were plotted in order of increasing ratio as density maps spanning each 400-bp window. in the case of the prototype itd+ aml sample itd1 (which had no other defined mutations), we identified a total of 19,551 distal peaks present either in the itd1 or pbsc dataset. the dnase - seq density maps are shown side - by - side in figure 3e for both pbscs and itd1, revealing that most dhss spanned 200250 bp and identifying a group of 3,728 distal dhss that were at least 2-fold more intense in itd1 (boxed region in figure 3e). parallel pair - wise analyses were also performed comparing the distal peaks in itd2 and in itd3, and the promoter - associated dhss in itd1, itd2, and itd3, with the equivalent regions in pbscs (figures s2a s2c). in each case we identified the subsets of dhss that were at least 2-fold more intense in the aml sample than in pbscs. the profiles of the average tag counts for the distal dhss are plotted in figure s2d and reveal similar patterns of deregulation in each of itd1, itd2, and itd3. the parallel analyses of the promoter regions showed a less pronounced upregulation of a small subset proximal dhss in each of the itd+ aml samples (figure s2c). to examine how the presence of dhss impacted on the expression of nearby genes, we plotted the relative aml / pbsc mrna expression levels for the genes nearest to each dhs in the three core flt3-itd aml samples relative to pbscs (figures 3e, s2a, and s2b). these heatmaps revealed a trend for upregulation of the genes nearest to itd - specific dhss. in parallel, we determined ratios for the level of dna methylation for cg elements covered by the illumina 450k platform, and we plotted heatmaps of this data for regions spanning both the dhs site itself and the transcription start site of the nearest gene for itd1 and itd2. this revealed a trend for dna demethylation of both the itd - specific dhss and the adjacent transcription start sites (tsss) and for increased dna methylation in the dhss that were absent (figures 2e and s2a). however, the overall changes in dna methylation were less pronounced than the chromatin changes, suggesting that these may be secondary events. using the ranking defined in figure 3e, we also carried out direct side - by - side comparisons of the complete set of 19,551 distal itd1/pbsc dhss with each of the above datasets, plus the data for cd14 + bm cells, and for 3 previously published dhs datasets derived from normal cd34 + and cd14 + cells from the nih epigenome roadmap consortium (bernstein., this confirmed that (1) the dhs pattern for pbscs resembled independently derived equivalent cd34 + cell datasets, and (2) a common subset of dhss was upregulated in each of the itd+ samples, and (3) the dhs patterns present in the two more mature cd14 + cell datasets and the wt flt3 aml samples more closely resembled pbscs than itd+ aml (figure s2e). to better define these profiles, we used the relative dnase i signals to divide the dhss into the three groups of (1) 2-fold downregulated, (2) less than 2-fold change, and (3) 2-fold upregulated (as depicted to the left of figures 3e and s2e). this clearly demonstrates that other itd+ amls shared the same core of upregulated dhss (group 3), whereas the patterns for the wt flt amls more closely resembled the patterns for cd34 + and cd14 + cells. last, but not least, we defined a discrete subset of reproducibly upregulated itd - specific dhss by determining the overlap between the flt3-itd - specific dhss of each of itd1, itd2, and itd3, and we found that 1,216 of these dhss were shared between each group with high significance (figure 4a). itd2 and itd3, which both have npm1 mutations, were the most similar with 83% of the top itd2 group being part of the top itd3 group. however, the npm1 mutation is unlikely to be a major driver of this pattern because the upregulated dhss from aml sample wt1 (figure 4b) and wt8 (data not shown), which each carry an npm1 mutation but wt flt3, showed non - significant overlap with the itd+ group. an equivalent analysis of the dhss that are 2-fold upregulated in 3 aml samples with wt flt3 (wt2, wt3, and wt5) also showed non - significant overlap with each other and with just 29 of the164 overlapping dhss shared with the 1,216 itd - specific dhss (figure 4c). gene ontology analysis of the genes located closest to the 1,216 distal itd - specific dhss identified a strong correlation with genes linked to cell signaling and activation (figure 4d). to directly link the itd - specific epigenetic signature with the gene expression profile, we calculated the distance of each itd - specific gene promoter region from the nearest upregulated dhs for both the highly itd - specific 134 genes (shown in red) and for the additional genes included in the 730 upregulated genes (shown in blue), and we depicted this relationship graphically in figure 4e. interestingly, this revealed an increasing degree of upregulation at the mrna level for the genes closest to an itd - specific dhs. examples of individual itd - specific genes close to itd - specific dhss are shown for scara3, wdr86, and ctsg / gzmb in figures 4f and 4 g and for foxc1, dsc2, and ak2 in figures s1, more complex patterns were seen for the hoxb cluster, where many dhss were upregulated in itd+ aml (figure s3a), in parallel with the cluster of hoxb2 to hoxb6, and for a dhs in the c10orf128 locus, where both c10orf128 locus and vstm4 were included in the group of 134 itd - specific mrnas (figure s3b). a different pattern was seen for id1, a previously defined it d target gene (tam., 2008), which contains an itd - specific dhs at 2 kb and was upregulated in itd+ aml compared to most wt flt3 amls, but not compared to pbsc or normal cd14 + cells (figure s3b). interestingly, id1 is also regulated by a downstream stat5-dependent enhancer at + 5 kb (tam., 2008, wood., 2009). stat5 is flt3-itd inducible (mizuki., 2000). to examine the role of stat5 in the regulation of this and other genes, we therefore measured genome - wide binding sites for this factor by chip - seq. this experiment demonstrates that the + 5 kb element indeed binds stat5 in the mv4 - 11 flt3-itd cell line (figure s3b). overall, the itd - specific genes were upregulated in either all or most itd+ samples (figures 4f and s1a). however, itd9 represented a notable exception to this pattern. interestingly, this patient carried a runx1 frameshift mutation, suggesting an important role of runx1 in activating flt3-itd - specific genes. furthermore, the three samples carrying runx1 mutations (labeled r) tended to have similar expression profiles (wt2, itd9, and wt3 in figures 4, s1, and s3). conversely, we also noted that among these loci there were also numerous examples of dhss that were preferentially enhanced in both the itd+ amls and in aml samples wt1 and/or wt6, which carry mutations in signaling molecules (labeled with asterisks). aml sample wt1 carries an activating nras g12s mutation, which is a powerful activator of the mapk pathway. hence, activating ras mutations with a concomitant upregulation of mapk signaling may activate a subset of genes and dhss that we defined here as flt3-itd targets. taken together, our analysis demonstrates that in spite of the presence of a wide variety of mutations, the presence of a chronically active flt3-itd correlates with a common core epigenetic signature that is associated with a distinct gene expression pattern. in addition, our mutation data suggested a role for both runx1 and mapk signaling in activating flt3-itd - specific dhss. having identified a flt3-itd+ aml - specific epigenetic signature, we investigated its underlying molecular basis by performing an unbiased search for enriched sequence motifs within active chromatin regions using homer (heinz., 2010) this analysis revealed that runx, ap-1, ets, e - box, and c / ebp motifs were the most common binding motifs present in the top 1,216 itd - specific dhss, each being found in 18%55% of all sites. interestingly, we also identified a motif for forkhead (fox) family proteins, which was part of a composite fox / e - box motif that might recruit complexes containing both fox and hlh family tfs such as tal1/scl and lyl1, which function together with runx, ets, and gata family tfs in the combinatorial regulation blood stem cell development (wilson., 2010). we also saw an enrichment of motifs for the inducible tfs nf-b and atf, but with less statistical significance. in order to validate the above results, we plotted the coordinates of each motif found back on to the coordinates of the dhss, plotted in the same order of increasing dhs ratio as above (figure 5b). we also plotted the rolling average of the numbers of each motif found per dhs across the same series of dhss (figure 5c), plus the average distributions of the motifs with each of the previously defined three groups of distal itd1/pbsc dhss (figure s4a). all five motifs were present in the itd - specific dhss at levels substantially higher than the predicted random level (indicated by the dashed lines in figure 5c). most of these motifs aligned with the midpoints of the dhss, suggesting that the two features are functionally related. both the fox / e - box and the c / ebp motifs were preferentially enriched in the itd - specific dhss, represented as group 3 in figure s4a. itd - specific dhss were also highly enriched in motifs widely used in normal myeloid cells (heinz., 2013). runx, ets, and ap-1 motifs were highly abundant in both the itd - specific dhss and the dhss that were shared between the aml and the pbscs. this suggests that the flt3-itd signature involves a substantial degree of redeployment of tfs driving the normal myeloid program. we also looked directly for the presence of binding motifs of other tfs linked to common signaling pathways that were not among the motifs found by homer, such as the flt3-itd inducible tf stat5 (mizuki., 2000). however, we did not see any significant enrichment for stat motifs in itd - specific dhss or for motifs linked to other signaling pathways, such as interferon response factors (irfs), which are common mediators of receptor signaling, or nfat, which is a mediator of ca signaling (figures s4a and s4b). these three classes of motifs were present at low abundance and mostly showed an anti - correlation with the itd - specific dhss. the average densities of each motif across each the three groups of dhs are depicted in figure s4a. because the tf gata2 is important for blood stem cell development (de pater., 2013, wilson., 2010) these motifs were most enriched in the pbsc - specific group 1 but were depleted in the itd - specific group 3 dhss, providing another indication that itd1 represents a more mature myeloid cell. to evaluate the role of stat5 in shaping the flt3-itd - specific epigenetic signature, we integrated the dhs data with the stat5 chip - data from flt3-itd+ mv4 - 11 cells. this analysis revealed stat5 peaks in the hoxb, ak2, vstm4/c10orf128, and id1 loci, but not at the above - defined itd - specific dhss (figure s3). moreover, when stat5 peaks were plotted alongside the itd1/pbsc dhs comparison, they were found to be broadly distributed throughout the genome and predominantly in the shared dhs group (figure s4b). furthermore, just 249 of the 9,572 stat5 peaks detected were present within the group of 1,216 itd - specific dhss (figure s4c). these data suggest that stat5 is binding predominantly at pre - existing dhss and only plays a minor role in maintaining the flt3-itd - specific dhss. a de novo motif analysis of the stat5 chip peaks identified a stat consensus motif in 16% of these peaks and further suggested that much of the stat binding is in association with dhss containing ets, runx, c / ebp, and ap-1 motifs (figure s4d). a parallel analysis of dhss and motifs associated with 380 itd - specific promoter - associated dhss revealed a similar itd - specific epigenetic and binding motif signature (figures s4e and s4f). gene ontology analysis of the genes associated with this group of dhss also revealed a cell activation signature similar to that seen for genes associated with the distal itd - specific dhss (figure s4 g). our motif analysis pointed to a major role for runx and ap-1 in activating flt3-itd - specific dhss. however, the presence of enriched motifs within specific dhss does not necessarily mean that they are occupied. to verify occupancy by runx1, we performed chip - seq assays on itd1, itd4, and pbscs (figures 5d and 5e). the average profiles of runx1 binding (figure 5f) closely mirrored the distribution of itd - specific dhss (figure s2d) and runx motifs (figure 5c). to account for the increase in runx1-bound sites in the itd+ cells runx1 expression was elevated in most of the itd+ amls and in the aml with jak2 mutations compared to normal cd34 + and cd14 + cells, but only in some of the wt flt3 amls (figure 6a ; manual pcr validation shown in figure s5a). a parallel pcr analysis confirmed that foxc1 mrna was also often upregulated in itd+ aml (figure s5b), with both runx1 and foxc1 being significantly increased in each of the core itd+ group of itd1, itd2, and itd3. the upregulation of runx1 expression may be in part due to the presence of an itd - specific dhs within the runx1 gene 43 kb downstream of the downstream promoter p2 (figure 6b), which contains seven motifs linked to itd - specific dhss (runx, ets, fox, ap-1, and e - box) (figure 6c). these motifs were also seen in the itd - specific dhss associated with foxc1, dsc2, ak2, and id1 (figure s3) and in the scara3, ctsg, mdga1, med16, gzmb, vstm4/c10orf128, and ccna1 itd - specific dhss (figure s5c). notable among the 1,216 itd+ dhss was a dhs near c8orf87 containing 5 fox motifs, one of which was the exact composite fox / e - box motif defined in figure 5a. this dhs was 221 kb away from the highly itd - specific gene fam92a1 (figure s5d). in this case, the gene was again not expressed in aml samples with wt flt3 unless they carried other mutations in the signaling molecules nras or socs1 (itd1 and itd6, marked by asterisks), or jak2, and was also not upregulated in samples carrying runx1 mutations. ap-1 is highly relevant to this study because it normally functions as a tightly regulated mapk - inducible factor known to play major roles in the control of cell growth, survival, and cancer (shaulian, 2010, shaulian and karin, 2002). to test for enhanced ap-1 activity, we used electrophoretic mobility shift assays (emsas) to examine the levels of nuclear ap-1 dna - binding activities in both flt - itd+ and wt flt3 myeloid cell lines (figure 6d). both of the itd+ cell lines mv4 - 11 and molm14 had high levels of constitutive ap-1 activity, equivalent to the induced levels of ap-1 seen in the wt flt3 cell lines u937 and thp1. because ap-1 is a mapk - inducible factor, we also used western blots of mv4 - 11 cell proteins to look for evidence of flt3-dependent activation of mapk signaling pathways (figure 6e). this analysis revealed flt3-dependent phosphorylation of both erk1/2 and rsk2 (which are downstream of ras signaling), which was suppressed by small interfering rna (sirna) directed against flt3. this confirmed the flt3-dependent activation not only of mapk and the stat pathways but also of stat5. furthermore, quantitative rt - pcr analyses revealed suppression of expression of several previously defined itd - specific genes in mv4 - 11 cells after treatment with either flt3 sirna or a combination of inhibitors directed against the mek, jnk, and p38 mapk pathways (figure 6f). we used chip to confirm that one partner of the ap-1 complex, fos, was bound to four itd - specific dhss in mv4 - 11 cells (figure 6 g) that each contain ap-1 motifs (figure s5c) and that runx1 was also bound to three of these dhss and to the csf1r fire element (ptasinska., 2014) used here as a control for runx1 binding. in parallel we demonstrated that either flt3 sirna or mapk inhibitors were sufficient to substantially diminish binding of fos and runx1 to these itd - specific dhss, to a greater extent than seen at the fire runx site (figure 6 g). last, but not least, we performed a chip - seq analysis for fos in mv4 - 11 cells treated with flt3 sirna, which demonstrated a global decrease in the binding of fos (figure 6h). in summary, our data demonstrate that constitutive flt3-itd signaling leads to chronic activation of ap-1 via the mapk pathway, which together with runx1 leads to chromatin remodeling and the activation of specific genes. we next wanted to understand the role of other tfs in shaping itd - specific dhs and how they would work together. to find additional evidence for the binding of these factors, we employed our recently developed wellington algorithm that uses dnase - seq data to perform genome - wide in silico dnase i footprinting of regulatory motifs (piper., 2013). this methodology determines statistically whether a given dna sequence is protected from dnase i digestion, thereby indicating that it is occupied by a tf, as modeled in figure 7a. figure 7b depicts the density of upper (red) and lower (green) strand dnase i cleavage sites detected in itd1 and pbscs at all 5,142 flt3-itd - specific predicted footprints and at the specific subset carrying ap-1 motifs. the black gap between the red and the green signal indicates that the ap-1 motifs were occupied at a high frequency in itd+ cells, but not in pbscs. this analysis provided convincing evidence that ap-1 motifs are preferentially occupied in the flt3-itd aml sample, even though itd1 and pbscs share many dhss that contain ap-1 motifs. these itd - specific footprints also included 63 stat5 motifs and 226 stat4 motifs (some of which will be the same motif), but none of these were associated with any of the 134 or 77 flt3-itd - specific upregulated or downregulated genes. a de novo search for motifs within the 5,142 footprints revealed essentially the same signature as that of the 1,216 itd - specific dhss (figure 7c), but with an additional motif for nuclear factor 1 (nf1) that may be linked to the itd - specific upregulation of nf1x, which contains an itd - specific dhs occupied by runx1 (data not shown). figure 7d depicts the locations of the footprinted itd - specific motifs on the itd1/pbsc dhs coordinates displayed above in figures 3e and 5b, demonstrating a close alignment with the dhs peak summits and with the fox / e - box, c / ebp, and nf-b motifs each being preferentially occupied in the itd - specific dhss. occupied ap-1 motifs were equally distributed between itd1-specific dhss and dhss shared with pbscs, indicating constitutive binding of ap-1 to the shared sites in flt3-itd aml. we confirmed the existence of footprints at many of the predicted protected motifs by plotting the frequency of dnase i cleavage on the upper and lower strand in itd1, alongside the footprint probability profiles and the motifs in figure s6a. the parallel analysis of footprints in itd2 showed similar results (not shown). to confirm the ability of our algorithm to detect stat footprints, we show a footprint spanning the stat motif, plus a second footprint spanning ets and ap-1 motifs within the id1 + 5 kb dhs in itd1 (figure s6b). overall, these results highlight (1) that gene activation in itd+ aml involves flt3-itd - driven constitutive binding of normally inducible factors to pre - existing dhss and (2) that runx1 and ap-1 are associated with both pre - existing and itd - specific dhss. to examine, whether tfs binding to itd - specific dhss function in cooperation, we performed a bootstrapping analysis to identify which specific footprinted motifs were co - localized with 50 bp of each other (figure 7e). this revealed a strong co - association of the occupied fox, e - box, c / ebp, runx1, and ap-1 motifs within the same dhss. curiously, the ets motifs were not preferentially footprinted in the itd - specific dhss, and they did not co - localize with the other itd - specific motifs, which may tie in with the finding that pu.1 activity is downregulated in flt3-itd (gerloff., 2015). in summary, these analyses demonstrate that the establishment of flt3-itd - specific dhss is mediated by the interaction of a limited set of constitutive and inducible transcription factors. a two - hit model of leukemogenesis is commonly accepted whereby a mutation in a transcriptional or epigenetic regulator gene impacting on gene expression and differentiation (class ii mutation) cooperates with a mutation in a gene such as a signaling molecule regulating growth (class i mutation) (renneville., 2008). here we show at the systems level, in primary cells from patients, that this distinction is becoming blurred, with signaling having wide - ranging impacts on gene expression. our study uncovers a significant role for chronic signaling by a mutated flt3 growth factor receptor to the nucleus and demonstrates a profound impact of aberrant signaling on transcription factor binding and flt3-itd - specific gene expression. our findings are consistent with the model depicted in figure 7f in which aberrant flt3-signaling activates both stat and mapk signaling. the latter, via the activation of inducible transcription factors such as ap-1/atf family members and nf-b, upregulates genes such as runx1 and foxc1, which in cooperation with other factors, including c / ebp, ets, and e - box family members, activate specific cis - regulatory elements driving the expression of many target genes. a similar cooperation between runx1 and ap-1 in response to mapk signaling has been seen during megakaryocyte differentiation (pencovich., 2011). moreover, our mutation data indicate that alternate mutation of another member of the mapk pathway (nras) may upregulate related sets of cis - regulatory elements. furthermore, the mutation of runx1 disturbs the flt3-itd - specific expression pattern and may also influence the expression of the foxc1 gene, which is not highly expressed in the patient containing mutant runx1 (itd9) (figure s1a). foxc1 is itself linked to an itd - specific dhs that contains three runx consensus motifs and that binds runx1 in itd1 (figure s3a). a surprise finding from our study was the absence of enriched stat motifs in our global analysis of itd - specific dhss in spite of overwhelming evidence (also from this study) that flt3-itd feeds into the stat pathway and is required for enhanced translocation of stat5 into the nucleus and leukemic survival (chatterjee. masson and rnnstrand, 2009, mizuki., 2000, zhang., 2000 furthermore, the data from mv4 - 11 cells suggested that stat5 is bound predominantly at pre - existing dhss that are shared with cd34 + cells, not stat5-dependent dhss, and thus is not involved in opening up additional flt3-itd - dependent dhss. it is also possible that stat5 binding to its targets may be only be required for the upregulation of a limited set of survival genes (such as myc or bclxl) (chatterjee., 2014) it is known that ap-1 regulates the inflammatory response and is involved in activating gene expression in multiple types of cancers with an inflammatory phenotype such as breast cancer, melanoma, and hodgkin s lymphoma (giancotti, 2006, kappelmann., 2014, we previously showed that the chronic activation of regulators of inflammatory response genes such as jun and irf5 activates a hodgkin s lymphoma - specific gene expression program characterized by cytokine and chemokine expression, which during disease progression is progressively upregulated by chronic autocrine and paracrine stimulation (kreher., 2014). it is therefore possible that stat5 interaction with dna is required for the initiation of the leukemic phenotype, but during leukemia development in patients it becomes less important due to the progressive establishment of a flt3-itd - specific transcriptional network that is driven by chronic inflammation and mapk responsive transcription factors. this feature is consistent with our finding of the flt3-itd - specific upregulation of inflammatory response genes, such as chemokine genes, growth factor receptor genes, and genes involved in leukocyte activation and response to bacterial stimuli. the flt3-itd mutation comes with a bad prognosis, and attempts to cure this type of aml using flt3 inhibitors have met with only limited success (grundler., 2003, levis., our system - wide studies of primary cells highlighting a common mapk - responsive transcriptional network are therefore of utmost importance for cancer therapy, which may be applicable to itd+ aml. efforts to evaluate the role of different genes within this network with respect to the maintenance of the leukemogenic phenotype are currently underway. where the blasts were less than 92%, cells were further purified using cd34 or cd117 antibody coupled beads. global analyses of dhss and runx1 binding, and data analyses, were performed as in ptasinska. screening of dna for mutations in the 55 aml - associated genes listed in data file s1 was performed by wmrgl, birmingham women s hospital. analyses of dna methylation were performed by gen - probe using the illumina 450k platform.	summaryacute myeloid leukemia (aml) is characterized by recurrent mutations that affect the epigenetic regulatory machinery and signaling molecules, leading to a block in hematopoietic differentiation. constitutive signaling from mutated growth factor receptors is a major driver of leukemic growth, but how aberrant signaling affects the epigenome in aml is less understood. furthermore, aml cells undergo extensive clonal evolution, and the mutations in signaling genes are often secondary events. to elucidate how chronic growth factor signaling alters the transcriptional network in aml, we performed a system - wide multi - omics study of primary cells from patients suffering from aml with internal tandem duplications in the flt3 transmembrane domain (flt3-itd). this strategy revealed cooperation between the map kinase (mapk) inducible transcription factor ap-1 and runx1 as a major driver of a common, flt3-itd - specific gene expression and chromatin signature, demonstrating a major impact of mapk signaling pathways in shaping the epigenome of flt3-itd aml.
oleanolic acid (3-hydroxy - olea-12-en-28-oic acid, oa) is a pentacyclic triterpene acid which exists naturally in vegetable oil, food, and some medicinal herbs. oa provides protection against experimental hepatic injury in rats and has been used as an oral remedy for human liver dysfunction [2, 3 ]. pretreatment with oa also considerably decreases augmentation of serum alanine transaminase (alt) activity and hepatic centrilobular necrosis induced by chemical hepatotoxicants in mice [4, 5 ]. surgeries such as liver transplantation, partial hepatic resection, and hepatic tumor resection may result in hepatic ischemia - reperfusion (ir) injury, which correlates with clinical reduction of liver function [6, 7 ]. a pathological consequence of the cessation of hepatic blood supply, followed by reperfusion, is cellular damage within the ischemic areas, which induce formation of reactive oxygen species, release of proinflammatory cytokines, and hepatocyte necrosis, ending in liver dysfunction. despite the evidence of oa protection against myocardial or cerebral ir injury [9, 10 ], the potential for this compound to attenuate hepatic ir - induced injury remains unexplored. glycogen synthase kinase (gsk-3) activity has recently been identified in a number of studies as crucial in the regulation of the inflammatory response [11, 12 ]. its inactivation is also involved in indirubin-3-oxime - induced protection against hepatic ir injury in rats. phosphatidylinositol-3-kinase (pi3k)/protein kinase b(akt) dependent inhibition of gsk-3 activity plays an important role in the protective effects of carbon monoxide against hepatic ir injury. these promising results prompted us to investigate the possible beneficial effects of oa pretreatment in rats submitted to partial hepatic ir. in a mechanistic approach, activation of the pi3k / akt pathway in hepatic tissue sodium carboxymethylcellulose (cmc - na) was purchased from sinopharm (shanghai, china). wortmannin was purchased from sigma (st. louis, usa) and dissolved in dimethyl sulfoxide. after approval by the institutional animal care and use committee at nanjing medical university (nanjing, china), 160 male spf sprague - dawley rats (230250 g) were purchased from slac laboratory animal co., ltd. they were maintained at a 12:12 h light : dark cycle and given water ad libitum. partial hepatic ischemia was conducted by performing a midline laparotomy exposing the liver hilum, and subsequent clamping of portal structures to the left and median lobes with a microvascular clip, yielding 70% hepatic ischemia. after 60 min of 70% hepatic ischemia, the clip was removed to initiate hepatic reperfusion. the rectal temperature was maintained at 37 0.5c with a warming pad throughout the surgical process. the rats were injected with buprenorphine (0.1 mg / kg s.c) for postoperative analgesia (five rats, three of them were from anesthetic accident and the remaining two rats from postoperative infection). the 160 rats were randomly but evenly assigned to one of five groups : rats that received a sham operation (sh group) were submitted neither to the clamping procedure nor to drugs ; rats in the ir group underwent ir treatment without drug delivery ; rats in the cm group received 0.5% cmc - na once a day for seven days, followed by ir ; and rats in the oa group received 100 mg / kg oa once a day for seven days, followed by ir ; on the basis of treatment in group oa, group oa+wortmannin further received 15 g / kg of pi3k inhibitor wortmannin, intraperitoneally, 30 min prior to hepatic ir. oa suspension (20 mg / ml) was made with 0.5% cmc - na aqueous solution. with regard to daily substance delivery, sh and ir rats received 2 ml physiological saline, the cm group received 0.5% cmc - na aqueous solution, and the oa group received oa suspension. moreover, according to different time points for collecting serum and hepatic specimens, each group was further equally divided into the following four subgroups : preoperation (prep), 0 h, 3 h, and 6 h after reperfusion. rat livers were collected 6 h after ir and were cut into small tissue blocks (about 1 cm in length, width, and height). after the blocks had been fixed with 10% buffered formalin solution, they were embedded in paraffin. paraffin - embedded sections (10 m thick) were prepared as usual for histological examination after hematoxylin and eosin staining. serum alt activity and the concentrations of il-1 were measured by using alt assay kit (jiancheng bioengineering, nanjing, china) and il-1 elisa kit (uscn, wuhan, china), respectively. blood was taken from the postcaval vein at the four aforementioned time points and then centrifuged for 10 min. alt activity in the serum was determined as described previously and expressed as international units per liter (u / l). production of il-1 in the serum was measured by elisa kit according to the manufacturer 's instructions. total tissue extracts were obtained by lysing the liver in ice - cold ripa buffer in the presence of a cocktail of protease inhibitors (roche, molecular biochemicals, mannheim, germany) and phosphatase inhibitors (1 mm sodium fluoride and 1 mm sodium orthovanadate). after centrifugation, protein concentrations were quantified using the bradford method, and 70 g of protein for each sample was subjected to 12% sodium dodecyl sulfate - polyacrylamide gel electrophoresis. the blots were blocked with 5% milk powder and 0.1% tween 20 in 10 mm tris - hcl (ph 7.5) at room temperature for 2 h and then incubated with rabbit anti - p - pi3k, p - akt, akt, p - gsk3, and gsk3 (1 : 1000, 1 : 1000, 1 : 500, 1 : 1000, and 1 : 500, resp.) at 4c overnight. after three washes with tbs - t, the blots were then incubated with horseradish peroxidase conjugated anti - rabbit secondary antibody at a dilution of 1 : 10,000 at room temperature for 1 h. the bound antibodies were visualized using an ecl system and exposed to x - ray films (kodak, rochester, ny, usa). the immunoblots were washed briefly and then incubated with a rabbit anti - gapdh (1 : 2000) for 40 min at room temperature, followed by a horseradish peroxidase conjugated anti - rabbit antibody. gapdh protein was then visualized and detected as the loading biomarker of proteins mentioned above. for the analysis of normally distributed data, one - way analysis of variance was used followed by dunnett 's t multiple comparison tests. histologically, whereas necrotic areas were significantly decreased in the oa pretreated group at 6 h after reperfusion, the pi3k inhibitor wortmannin worsened the hepatic histological status (figure 1). biochemically, the ir procedure strikingly increased serum alt activity at 3 h and 6 h after reperfusion, indicating that the partial hepatic ir model was established successfully (figure 2 ; p < 0.05). at the same time points, pretreatment with 0.5% cmc - na alone (group cm) did not affect serum alt activity, indicating that cmc - na, which was used as a suspending agent, had no effects on liver function. in contrast, rats pretreated with 100 mg / kg oa had drastically inhibited serum alt activity at 3 h and 6 h after reperfusion (p < 0.05), which reflected protective effects of oa against ir - induced hepatic injury. when compared with group oa, inhibition of pi3k with 15 g / kg wortmannin increased serum alt activity at 3 h and 6 h after reperfusion (p < 0.05). however, serum alt activity at 3 h and 6 h after reperfusion in group oa+wortmannin was still lower than those in group ir and group cm (p < 0.05), suggesting that protective effects of oa involved only partially the pi3k pathway. serum il-1 concentrations were increased following the ir procedure, not only at 0 h after reperfusion, but also at 3 h and 6 h after reperfusion in both ir and cm groups (figure 3). however, these changes were markedly decreased by oa pretreatment (p < 0.05), indicating that oa exerted anti - inflammatory effects against systemic injury induced by partial hepatic ir. furthermore, suppression of il-1 concentrations by oa pretreatment actually emerged at 0 h after reperfusion, prior to the decrease in alt activity. when compared with group oa, wortmannin increased serum il-1 concentration at 0 h, 3 h, and 6 h after reperfusion (p < 0.05). however, the serum il-1 concentration at 3 h and 6 h after reperfusion in group oa+wortmannin remained lower than those in group ir and group cm (p < 0.05). to further evaluate the mechanism of oa - induced protective effects against ir - stimulated hepatic injury, we explored the levels of p - pi3k, p - akt, total akt, p - gsk-3, and total gsk-3 protein expression (figures 4, 5, and 6). there were no significant differences in the basal levels of total akt and total gsk-3 protein expression among the four groups. the ir procedure was followed by increased p - pi3k, p - akt, and p - gsk-3 protein synthesis at 3 h and 6 h after reperfusion (p < 0.05) whether rats were pretreated with cmc - na or not. furthermore, oa pretreatment significantly increased p - pi3k, p - akt, and p - gsk-3 protein synthesis in ir - stimulated rat liver not only at preoperation, but also at 0 h, 3 h, and 6 h after reperfusion (p < 0.05). these results indicated that preoperative oa treatment was an important activator of the pi3k / akt pathway. the present work demonstrated that pretreatment with 100 mg / kg oa could reduce the liver injury caused by partial hepatic ir, as indicated by histological improvement and significant decreases in both serum alt activity and il-1 level. these results were associated with a marked increase in p - pi3k, p - akt, and p - gsk-3 protein expression, strongly suggesting that pi3k / akt - mediated inactivation of gsk-3 may be involved in the protective effect of oa pretreatment towards ir - induced rat liver dysfunction. inhibition of pi3k with 15 g / kg of wortmannin partially reversed the oa protective effects on ir - induced hepatic injury, which further supported the involvement of the pi3k / akt pathway. the rat model with 70% hepatic ir experienced severe hepatic injury without obvious mesenteric venous hypertension. mesenteric congestion was avoided by allowing intestinal blood flow through right and caudate lobes, which led to a satisfactory survival rate despite substantial hepatic ir injury. one major hallmark of hepatic ir is inflammation - induced hepatopathology [19, 20 ]. at ischemia stage, proinflammatory cytokines, such as il-1, were instantly released. after reperfusion, neutrophils, triggered by proinflammatory cytokines, hepatic enzymes and reactive oxygen species are then released to aggravate the associated hepatic tissue injury [2325 ]. oa exerts anti - inflammatory effects on lipopolysaccharide - induced inflammation by inhibiting hyperpermeability and leukocyte adhesion and migration. it also exerts protective effects against hepatic injury by inducing antioxidant enzymes such as ho-1. our results confirmed the development of liver injury by markedly elevated alt activity and, indirectly, by il-1 concentrations, whereas oa pretreatment considerably reduced the enhancement of alt activity and il-1 concentrations induced by ir. in addition, il-1 concentrations were suppressed prior to the reduction of alt activity, suggesting that systemic inflammatory responses induced by partial hepatic ir might be an important promoter for hepatic damage during the acute phase. the pi3k / akt pathway has an endogenous negative regulatory function, which limits proinflammatory mediators and chemotactic events by reducing neutrophil infiltration and production of cytokines [2831 ]. however, the role of the pi3k / akt pathway in the modulation of partial hepatic ir - induced injury was poorly understood. in our study, increased expression of the p13k / akt pathway in the absence of oa may be a compensatory mechanism to counteract cytokine release following ir. the role of pi3k in a given signaling pathway is often examined by the use of pharmacological tools. the pi3k inhibitor wortmannin has been successfully used to clarify the physiological roles of pi3k pathway. in our study, wortmannin partially reversed the protective effects of oa as shown by worsening histological status and increasing serum alt and il-1 levels. our results also showed that oa pretreatment was able to further markedly enhance phosphorylation of pi3k and akt protein expression not only at the preoperative period, but also at 0 h, 3 h, and 6 h after reperfusion. this finding was consistent with previous studies which have reported that activation of the pi3k pathway protected organs against ir injury [32, 33 ]. when n - terminal ser9 residue of gsk-3 is phosphorylated, the phosphate - binding pocket is occupied by an intramolecular interaction with the phosphorylated ser9. this interaction considerably inhibits gsk-3 activity by changing the conformation of the catalytic site and also by preventing the binding of the primed substrate. the n - terminal ser9 residue of gsk-3 is within the consensus sequence of the substrates for akt. a recent study has also shown that gsk-3 inactivation was involved in a propofol - induced protective effect against ir injury in an isolated guinea pig heart. our data showed that the changes in p - gsk-3 paralleled the alterations of serum alt activity and il-1 expression. these results also suggested that the pi3k / akt - mediated inactivation of gsk-3 might play an important role in hepatoprotective action owing to oa pretreatment. firstly, we did not compare the oa effects on hepatic ir injury depending on whether the administration was done before or after ir. indeed, although pretreatment with oa might exert protective effects in some selective hepatic surgeries, posttreatment may be more practical than pretreatment in clinical use since injury is unexpected. secondly, pi3k inhibitor wortmannin only partially reversed the protective effects of oa on hepatic ir injury, so that further studies designed to investigate the overall mechanism of the oa protective effects are warranted. our data suggest that oa pretreatment exerts hepatoprotective effects in a rat model of hepatic ir, likely involving the pi3k, p - akt, and p - gsk-3 pathways (see schematic flow of oa 's role in decreasing hepatic ir injury in figure 7). we think that these findings may pave the road for future innovative therapeutic strategies in the field of ischemia - reperfusion related liver injury.	oleanolic acid (oa) has been used to treat liver disorders, but whether it can attenuate hepatic ischemia - reperfusion- (ir-) associated liver dysfunction remains unexplored. in the present study, 160 male sprague - dawley rats were equally divided into five groups : group sh received neither hepatic ir nor drugs ; group ir received hepatic ir without drugs ; group cm and group oa received 0.5% sodium carboxymethylcellulose and 100 mg / kg oa, intragastrically, once a day for seven days before the hepatic ir, respectively ; on the basis of treatment in group oa, group oa+wortmannin further received 15 g / kg of pi3k inhibitor wortmannin, intraperitoneally, 30 min before the hepatic ir. then each group was equally divided into four subgroups according to four time points (preoperation, 0 h, 3 h, and 6 h after reperfusion). serum alt activity, il-1 concentration, and hepatic phosphorylation of pi3k, akt, and gsk-3 protein expression were serially studied. we found that oa pretreatment improved histological status and decreased serum alt and il-1 levels. it also increased p - pi3k, p - akt, and p - gsk-3 protein expression at all the four time points. prophylactic wortmannin partially reversed oa 's protective effects. the data indicate that oa pretreatment protects liver from ir injury during the acute phase partially through pi3k / akt - mediated inactivation of gsk-3.
busulfan, a bifunctional alkylating agent, has been used for the treatment of chronic myeloid leukemia and for myeloablative - conditioning regimens before stem cell transplantation. in children, there are several reports of diverse effects of busulfan treatment such as pulmonary fibrosis and acute clinical neurotoxicity (spasm). busulfan has teratogenic and cytotoxic potentials, and it is reported that rat fetuses exposed to busulfan developed microencephaly and microphthalmia. our previous studies clarified the systemic histopathological changes and the sequence of the central nervous system (cns) lesions characterized by neural progenitor cell apoptosis in rat fetuses transplacentally exposed to busulfan on gestation day 13. it is also reported that busulfan induces histopathological changes in the lungs in adult humans and in gastrointestinal tissues, lymphoid tissues and gonadal tissues in adult rats. on the other hand, there are few reports of systemic histopathological changes in infant animals induced by busulfan except for our previous report of busulfan - induced cns lesions in infant rats. in the present study, we examined the busulfan - induced systemic histopathological changes in infant rats mainly from the viewpoints of the distribution and sequence of pyknosis of component cells, except for brain and eye lesions, which will be described elsewhere in the near future. male newborn rats were obtained in our laboratory by mating females with males of the same colony of specific pathogen - free rats of the sprague - dawley strain purchased from charles river laboratories japan, inc. one foster mother with 8 male newborns were housed together in plastic econ cages (w 340 mm d 450 mm h 185 mm) with bedding (white flakes : charles river laboratories japan, inc.) in an environmentally controlled animal room (temperature, 23 3c ; relative humidity, 50 20% ; air ventilation rate, 1015 times per hour ; lighting, 12 h/12 h light / dark cycle) and fed an irradiation - sterilized pelleted diet (nmf, oriental yeast co., ltd., finally, a total of fifty 6-day - old male rats were subjected to the experiment. the protocol of this study was reviewed and approved by the animal care and use committee of bozo research center. fifty 6-day - old male rats were equally divided into the control and busulfan groups. the animals of the busulfan group were subcutaneously administered 20 mg / kg (10 ml / kg body weight) of busulfan, and those of the control group were subcutaneously administered 10 ml / kg of olive oil, respectively. five animals each of the busulfan and control groups were euthanized at 1, 2, 4, 7 and 14 days after treatment (dat), respectively. at necropsy, four-m paraffin sections were stained with hematoxylin and eosin (he) and subjected to histopathological examination. some of the paraffin sections were also subjected to immunohistochemical examination for cleaved caspase-3. in brief, sections were reacted with rabbit anti - cleaved caspase-3 polyclonal antibody (1:200, cell signaling technology, beverly, ma, usa) at 4c overnight after pretreatment. then, the sections were reacted with an envision+kit (dako japan) at room temperature for 40 min. these sections were visualized by peroxidase - diaminobenzidine (dab, dojindo laboratories, kumamoto, japan) reaction and then counterstained with hematoxylin. histopathological examination was performed on tissues such as the heart, lungs, stomach, intestines, liver, pancreas, kidneys, testes, epididymides, thymus, spleen, mesenteric lymph node, bone marrow, skin (dorsal) and bone (femur) based on the results of our preliminary study. male newborn rats were obtained in our laboratory by mating females with males of the same colony of specific pathogen - free rats of the sprague - dawley strain purchased from charles river laboratories japan, inc. one foster mother with 8 male newborns were housed together in plastic econ cages (w 340 mm d 450 mm h 185 mm) with bedding (white flakes : charles river laboratories japan, inc.) in an environmentally controlled animal room (temperature, 23 3c ; relative humidity, 50 20% ; air ventilation rate, 1015 times per hour ; lighting, 12 h/12 h light / dark cycle) and fed an irradiation - sterilized pelleted diet (nmf, oriental yeast co., ltd., finally, a total of fifty 6-day - old male rats were subjected to the experiment. the protocol of this study was reviewed and approved by the animal care and use committee of bozo research center. fifty 6-day - old male rats were equally divided into the control and busulfan groups. the animals of the busulfan group were subcutaneously administered 20 mg / kg (10 ml / kg body weight) of busulfan, and those of the control group were subcutaneously administered 10 ml / kg of olive oil, respectively. five animals each of the busulfan and control groups were euthanized at 1, 2, 4, 7 and 14 days after treatment (dat), respectively. at necropsy, four-m paraffin sections were stained with hematoxylin and eosin (he) and subjected to histopathological examination. some of the paraffin sections were also subjected to immunohistochemical examination for cleaved caspase-3. in brief, sections were reacted with rabbit anti - cleaved caspase-3 polyclonal antibody (1:200, cell signaling technology, beverly, ma, usa) at 4c overnight after pretreatment. then, the sections were reacted with an envision+kit (dako japan) at room temperature for 40 min. these sections were visualized by peroxidase - diaminobenzidine (dab, dojindo laboratories, kumamoto, japan) reaction and then counterstained with hematoxylin. histopathological examination was performed on tissues such as the heart, lungs, stomach, intestines, liver, pancreas, kidneys, testes, epididymides, thymus, spleen, mesenteric lymph node, bone marrow, skin (dorsal) and bone (femur) based on the results of our preliminary study. no deaths occurred in any group until 7 dat. thereafter, one animal died with severe myelosuppression at 13 dat in the busulfan group. in the control group on the other hand, in the busulfan group, histopathological changes mainly characterized by pyknosis of component cells were observed in many tissues as listed in table 1table 1. histopathological changes were also detected in the brain and eyes, but their data were excluded from the present paper as mentioned above. in the cardiopulmonary system, pyknosis was observed in a small number of cardiomyocytes (fig. histopathological changes in infant rat tissues. in the busulfan group, pyknosis (arrowhead) was observed in cardiomyocytes (a), alveolar or bronchiolar epithelial cells (b), glandular epithelial cells in the stomach (c), uriniferous tubule epithelial cells in the kidneys (d), spermatogonia (e), lymphocytes in the thymus (g), hair follicle epithelial cells (i) and osteoblasts in the femur (j). pyknotic nuclei were immunohistochemically positive for cleaved caspase-3 (e, inset). at 14 dat, only sertoli cells were left in the germinal epithelium of markedly atrophied seminiferous tubules (f), and marked depletion of hematopoietic cells with prominent infiltration of fat cells was observed in the femur bone marrow (h)., pyknosis was found in a small number of hematopoietic cells in the liver at 2 dat, glandular epithelial cells in the stomach (fig. 1c) from 1 to 7 dat, and crypt epithelial cells in the intestines from 1 to 4 dat. hematopoietic cells in the liver mildly decreased from 4 to 14 dat, and glandular epithelial cells in the stomach showed vacuolation at 4 dat. histopathological changes in infant rat tissues. in the busulfan group, pyknosis (arrowhead) was observed in cardiomyocytes (a), alveolar or bronchiolar epithelial cells (b), glandular epithelial cells in the stomach (c), uriniferous tubule epithelial cells in the kidneys (d), spermatogonia (e), lymphocytes in the thymus (g), hair follicle epithelial cells (i) and osteoblasts in the femur (j). pyknotic nuclei were immunohistochemically positive for cleaved caspase-3 (e, inset). at 14 dat, only sertoli cells were left in the germinal epithelium of markedly atrophied seminiferous tubules (f), and marked depletion of hematopoietic cells with prominent infiltration of fat cells was observed in the femur bone marrow (h). (h) bar=500 m. in the urogenital system, pyknosis was found in a small number of proximal and distal tubule epithelial cells in the kidneys (fig. pyknotic changes in spermatogonia started at 1 dat and became moderate at 2 and 4 dat in the testes (fig. thereafter, seminiferous tubules showed atrophy with depletion of germ cells at 7 and 14 dat, at which point only sertoli cells were left in the germinal epithelium of markedly atrophied seminiferous tubules (fig. pyknosis was also found in a small number of epithelial cells in the epididymides from 2 to 7 dat. in the hematopoietic and lymphoid system, the thymus showed moderate cortical atrophy at 2 and 4 dat following moderate or mild pyknotic changes in cortical lymphocytes at 1 and 2 dat (fig. similar but less severe changes were observed in mesenteric lymph nodes at 4 and 7 dat. in the spleen, a minimal or mild decrease in the number of hematopoietic cells was detected from 2 to 14 dat. in the bone marrow, mild or moderate pyknotic changes of hematopoietic cells were found from 1 to 7 dat. a decrease in the number of hematopoietic cells with fat cell infiltration started at 2 dat, progressed thereafter and became prominent at 14 dat (fig. in the present study, we examined the nature and sequence of systemic histopathological changes observed in infant rats exposed to busulfan (20 mg / kg) at 6 days of age. as mentioned above, those in the cns have been previously reported, and those in the eyes will be published elsewhere in the near future. pyknosis of component cells was detected in many tissues (table 1). among them, the thymus was moderately affected by pyknosis at 1 dat, and the bone marrow and testes were moderately affected by pyknosis at 2 and 4 dat. in addition, moderate cortical atrophy was observed simultaneously with moderate pyknosis of cortical lymphocytes in the thymus, a moderate to marked decrease in the number of hematopoietic cells with infiltration of fat cells was found from 4 to 14 dat in the bone marrow, and moderate or marked atrophy due to depletion of germ cells developed at 7 and 14 dat in the testes. thus, histopathological changes remained until 14 dat in the bone marrow and testes, and whether or not the rats could recover from such lesions in the bone marrow and testes thereafter was not clear in the present study. on the other hand, histopathological changes observed in tissues other than the bone marrow and testes were considered to be transient in nature. although there were no reports of cardiac lesions in fetal or adult rats following exposure to busulfan, apoptosis of cardiomyocytes was detected in infant rats in the present study, suggesting a susceptibility of the infant rat heart to busulfan. regarding pulmonary lesions, it has been reported in humans that long - term and/or high - dose busulfan therapy brought about such pulmonary lesions as bronchopulmonary dysplasia and diffuse interstitial pulmonary fibrosis in adults and children. these lesions are known as busulfan lungs. in the lungs of fetal and infant rats, only transient apoptotic changes were detected in alveolar and terminal bronchiolar epithelial cells. with regard to histopathological changes in the gastrointestinal tissues, apoptotic changes were common in fetal and infant rats. namely, they were milder in the intestine than in the stomach in fetal and infant rats, while they were reported to be milder in the stomach than in the intestine in adult rats. in humans, although there were no reports of histopathological changes in the gastrointestinal tissues, clinical signs of nonspecific gastroenteritis were reported. in the kidneys, although there were no reports of apoptosis in tubular epithelial cells in adult rats and humans, apoptosis of tubular epithelial cells was observed in fetal and infantile rats, suggesting that tubular epithelial cells of infant rats still remain susceptible to busulfan. the outline of the testicular lesions in infant rats was similar to those in adult rats, while there have been no reports of testicular lesions in humans. histopathological changes in the thymus and mesenteric lymph nodes were similar between infant and adult rats. on the other hand, atrophy of the splenic white pulp, reported in adult rats, was not clear in infant rats. in the bone marrow of infant rats, as mentioned above, the number of hematopoietic cells decreased with time and became marked at 14 dat with prominent infiltration of fat cells. this corresponded well to depressed bone marrow cellularity reported in adult rats. in our previous study on histopathological changes in fetal rats, we observed apoptosis of component cells in mesenchymal tissues such as craniofacial tissues, the mandible, limb buds and the tail bud. in the present study on histopathological changes in infant rats, apoptosis was found in hair follicle epithelial cells in the dorsal skin and osteoblasts in the femur, which were not reported in adult rats. in conclusion, the present study showed that busulfan - induced histopathological changes were characterized by apoptosis of component cells and that the distribution and sequence of apoptosis showed some differences, especially between infant and adult rats, probably reflecting the difference in susceptibility of component cells to busulfan between them.	busulfan is an antineoplastic bifunctional alkylating agent. we previously reported the busulfan - induced systemic histopathological changes in fetal rats and the sequence of brain lesions in fetal and infant rats. in the present study, in order to clarify the nature and sequence of busulfan - induced systemic histopathological changes in infant rats, 6-day - old male infant rats were subcutaneously administered 20 mg / kg of busulfan and histopathologically examined at 1, 2, 4, 7 and 14 days after treatment (dat). as a result, histopathological changes characterized by pyknosis of component cells were observed in the heart, lungs, stomach, intestines, liver, kidneys, testes, epididymides, hematopoietic and lymphoid tissues, dorsal skin and femur as well as in the brain and eyes (data not shown in this paper). such pyknosis transiently appeared until 7 dat with prominence at 2 and/or 4 dat in each tissue, except for the thymus, in which pyknosis peaked at 1 dat. most of the pyknotic nuclei were immunohistochemically positive for cleaved caspase-3, indicating that pyknotic cells were apoptotic. different from the reports of fetal and adult rats, apoptosis was also found in cardiomyocytes and osteoblasts in infant rats.
the term skin sparing mastectomy (ssm) was first used by toth and lappert in 1991. they described preoperative planning of mastectomy incisions in an attempt to maximize skin preservation and facilitate immediate breast reconstruction (ibr). the procedure removes the breast, nipple - areola complex, previous biopsy incisions, and skin overlying superficial tumors. preservation of the inframammary fold (imf) and native skin greatly enhances the aesthetic result of breast reconstruction. the operation has been adopted for patients with early breast cancer treated by total mastectomy and immediate reconstruction but has not gained universal acceptance. most surgeons surveyed agree that the procedure improves the cosmetic results of immediate breast reconstruction. despite numerous studies that have demonstrated the oncological safety of the procedure compared to traditional total mastectomy, there are still concerns about the oncological safety [1, 59 ]. one international survey of over 1,000 surgeons found that 78% of respondents believed that the current published literature demonstrated that ssm does not result in higher local recurrence rates of breast cancer, 25% did not believe the data. despite these concerns, the breast is a modified cutaneous gland or skin appendage. it is enclosed between the superficial and deep layers of the superficial fascia of the anterior abdominal wall. large axial vessels lie deep to this plane and send vertical branches to the subdermal plexus. this layer allows the surgeon to dissect the skin flaps in a relatively avascular plane and include minimal mammary tissue. cooper 's ligaments are peripheral projections of breast tissue in fibrous processes, which fuse with the superficial layer of the superficial fascia. skiles demonstrated that these projections were intimately associated with the skin and concluded in order to excise the whole breast that a large amount of skin need be sacrificed or the dissection kept as close to it as run a risk of skin slough. they found the superficial fascia was absent in 44% of the inferior breast quadrants examined. they found that the presence of breast tissue was significantly associated with skin flaps thicker than 5 mm. they found no correlation between the presence of breast tissue in the skin flaps and age, body mass index, or menopausal status. hicken outlined the extent of mammary tissue in 1940 by injecting x - ray contrast material into the lactiferous ducts of 385 mastectomy specimens. he found that in 95% of cases the ducts ascended into the axilla, 15% passed into the epigastric space, and 2% followed the lateral chest wall beyond the anterior border of the latissimus dorsi muscle. this study defined the classic boundaries of a mastectomy : the clavicle, rectus sheath, midline of the sternum, and the anterior border of the latissimus dorsi muscle. the fascial relationships of the breast facilitate its removal along defined tissue planes. the inferior extent to breast tissue, except in rare cases, stops at the separation of the superficial and deep layers of the superficial fascia of the abdominal wall. cooper stated that at the abdominal margin, the gland is turned upon itself at its edge, and forms a kind of hem. the zone of adherence of the superficial fascial to the underlying chest wall in this region is the inframammary fold. it occurs at the inferior margin of the pectoralis major muscle at the 6th and occasionally the 7th rib. its presence has been demonstrated in the 8th month fetus, and its location is fixed throughout life. it generally contains fat, which may become firm and indurated in patients with large, ptotic breasts. haagenson, in his large experience, cited only 26 cases of breast cancer occurring in the region of the imf. preservation of the inframammary fold leaves minimal amount of breast tissue and does not appreciably effect the completeness of a mastectomy. the differences between the various mastectomy techniques are in terms of the amount of microscopic breast tissue left behind in the skin. these small differences have not been shown to impact the local recurrence of breast cancer [1, 58 ]. the type of skin sparing mastectomy has been classified by the type of incision used and the amount of skin removed (figure 1). factors influencing incision choice include previous biopsies, tumor location and depth, and the type of reconstruction planned. a periareolar incision or type i ssm is commonly used in prophylactic cases and for nonpalpable cancers diagnosed by needle biopsy. in patients with small diameter areola, a lateral extension or tennis racquet incision is sometimes necessary to improve exposure to the axillary tail, or to provide access for breast reconstruction (figure 2). if implant / expander reconstruction is planned, the circular incision can be converted to an elliptical incision. the incision should be obliquely oriented toward the axilla to reduce flattening of the central breast mound. a purse string closure of the circumareolar incision has been described in patients with small to medium sized breasts undergoing immediate implant reconstruction. in the author 's opinion, the closure is slow to heal and the resultant scar can make nipple reconstruction difficult. the wide adoption of imaging directed stereotaxic core biopsy has reduced the number of excisional breast biopsies. today, excisional biopsy incisions usually result from failed attempts at breast conservation. the ablative surgeon must be aware of the depth and extent of tumor involvement prior to final decision planning. a type ii ssm is used when a superficial tumor or previous biopsy is in proximity to the areola. in autologous reconstruction, the flap skin can be used to fill the defect (figure 3). in implant - based reconstruction type iii ssm is used when the superficial tumor or previous incision was remote from the areola, usually in the upper quadrants of the breast. a type iv ssm is used in large, ptotic breasts when a reduction is planned on the opposite breast. a common problem with this technique is the occurrence of native skin flap necrosis of the most distal portions of the flap, particularly at the t junction. the area between the vertical limbs of the t and an additional 2 cm outside the horizontal limbs are deepithelialized but not resected. bostwick first described using wise pattern mastectomy incisions for prophylactic mastectomies and immediate implant reconstruction. he released the pectoralis major muscle and used a deepithelialized inferior skin flap to allow placement of definitive silicone prosthesis. other authors have built on bostwick 's work, using an inferior dermal pedicle to cover the prosthesis with acceptable complication rates (table 1). the technique can obviate the need for an acellular dermal matrix and provide a dermal buttress to reduce wound healing complications (figure 4). the skin flap thickness depends on the location on the breast and body habitus of the patient. breast tissue extends closer to the skin in the lower quadrants and the subcutaneous tissue is thicker in the upper, outer quadrant of the breast. exposure of the white dermis indicates the plane is too superficial to assure skin viability. electrical cautery on low blended coagulation current is preferred by many surgeons for flap elevation because it is quicker with less blood loss. the majority of the blood vessels lie deep to the fascia, but perforating vessels to the skin are encountered and controlled with coagulation current. the infiltration of the breast with dilute epinephrine solution has been described to facilitate sharp dissection of the skin flaps and reduce blood loss. the flaps must be handled carefully, and the use of deep abdominal retractors is avoided. scissoring of the fingers of the nondominant hand can assist in the deep dissection (figure 5). because the skin opening is small skin flap viability is usually assessed on clinical grounds but the use of epinephrine solution and blue dye that is used in sentinel lymph node mapping may make this difficult. fluoroscein dye may be helpful in select cases, especially those where implant reconstruction is used, but it tends to underestimate skin viability. intraoperative indocyanine green angiography has been shown to have a high sensitivity and specificity in predicting native skin flap necrosis after ssm. medially, the fascia is not as defined and the dissection ends at the border of the sternum. perforating vessels of the internal mammary artery are frequently encountered along the sternal border and can be controlled with the cautery. attempts should be made to preserve these vessels in cases using type iv ssm to improve skin flap blood supply. inferiorly, the dissection follows the superficial layer of the fascia to its junction with the deep layer (figure 4). laterally, the dissection continues over the pectoralis muscle toward the humerus enabling removal of the axillary tail. if an axillary incision is required, a tunnel is developed between it and the chest incision. the axillary dissection is performed in continuity with the breast tail and the specimen is removed en bloc through the central incision. the reported incidence of native skin flap necrosis after ssm has been reported to be 10% to 22% when followed by ibr [1, 26, 27 ]. predisposing factors include : preoperative radiation, tobacco smoking, incision type, obesity, breast size, and age [2831 ]. skin flap elevation with the scalpel or cautery appears to have similar skin necrosis rates. there are conflicting reports as to its impact of epinephrine infiltration on mastectomy flap viability [29, 30 ]. a review of the emory university experience found that type iii and iv incisions, tobacco smoking, and preoperative radiation predisposed to native skin flap necrosis (table 2). davies. found that periareolar incisions had a significantly lower rates of complications compared to wise pattern or tennis racquet incisions. the management of native skin flap necrosis depends on its depth and extent and the type of reconstruction performed. skin necrosis after expander reconstruction should be managed aggressively to prevent exposure and the development of infection necessitating implant removal (figure 6). antony. reported their experience with 58 cases of mastectomy skin flap necrosis following tissue expander reconstruction. nine patients required removal of the expander because of the large area of skin loss. the use of skin sparing mastectomy has been one of the greatest advancements in immediate breast reconstruction in the last two decades. it is technically more challenging than traditional mastectomy and requires close coordination between the oncologic and reconstructive surgeons.	skin sparing mastectomy has resulted in marked improvement in the aesthetic results of immediate breast reconstruction. mature data has confirmed its oncological safety in the treatment of breast cancer. the procedure has gained wide acceptance and has undergone numerous technical advances since its introduction over twenty years ago. careful patient selection and choice of skin incisions are necessary to avoid complications.
porous materials have been extensively studied as potential adsorbents in energy and environmental applications including hydrogen storage and carbon capture. among the various porous solids, metal organic frameworks (mofs), which are typically constructed from building blocks including inorganic metal (oxide) secondary building units (sbus) and organic ligands, have attracted significant interest since their composition (i.e., chemical functionality) and structure (e.g., pore topology and sizes and internal surface areas) are highly tunable. hence their performance for a given application can be systematically improved by rational materials design. with respect to hydrogen storage and carbon capture (e.g., from flue gas) applications, one of the most important factors which dictates the amount of h2 and co2 that can be adsorbed in a mof material is the adsorbate adsorbent interactions, with mof-74 being considered as one of the best performing mofs because of the presence of a high density of open metal sites that interact strongly with h2 and co2 molecules. despite the many advantages of mofs that result from high tunability of chemistry and structure, the cost of mof production is still a major factor that impedes their large - scale industrial applications. apart from the capital investment in infrastructures, the cost of mof production consists largely of raw materials (including metal salts and organic ligands) and processing, which include but are not limited to nonreusable organic solvents and cost associated with activation. for mof-74 with a molecular formula m2(dobdc) dobdc = 2,5-dioxido-1,4-benzenedicarboxylate), the major cost of raw materials comes from the organic ligand (i.e., dobdc). taking mg - mof-74 as an example, the cost of metal salts, usually mgcl2, can almost be neglected ; i.e., it accounts for only a small percentage of the expense of organic ligands. indeed, mofs built from much cheaper organic ligands will need to be developed before they can be widely used in industry in large quantities. generally speaking, larger and longer aromatic organic ligands however, the majority of the mofs synthesized so far features aromatic organic ligands because the coordination - driven self - assembly of building blocks to produce porous crystalline mofs requires the molecular precursor to be rigid and possess proper directionality. such properties are more likely to appear in conjugated organic ligands, e.g., dobdc and bdc (bdc = 1,4-benzenedicarboxylate), both of which are frequently used in the synthesis of mofs. on the other hand, most of the aliphatic ligands are flexible and do not have sites to form directional metal ligand bonds, and they are less likely to form porous and crystalline solids with metal centers. therefore, aliphatic ligands are rarely employed in mof synthesis. nevertheless, there are still several mofs based on aliphatic ligands, including the commercially available aluminum fumarate (basolite a520). however, there are no open metal sites in these mofs, thereby limiting their co2 and h2 storage potential at low and ambient pressures. it would be extremely useful to develop a mof-74 analogue featuring both open metal sites, which lead to enhanced adsorbate adsorbent interactions and higher gas uptake at ambient pressure, and cheap aliphatic linkers, which lower the overall raw materials cost. to the best of our knowledge, all the mof-74 analogues which have been experimentally synthesized so far were constructed from longer, aromatic organic linkers and are therefore likely to be more expensive with limited improvement on gas adsorption capacity in low to ambient pressure regimes. another popular approach to increase the gas adsorption capacity of mofs is to synthesize mofs with expanded pores and larger internal surface areas, e.g., by replacing the dobdc linker in mof-74 with longer linkers. we investigated the effectiveness of pore expansion in mof-74 analogues in one of our recent high - throughput screening studies, whereby we developed a novel in silico crystal assembly algorithm that differed from previous approaches to create a library of mof-74 analogues which exhibit 1-d metal - oxide rod building units. we found that the gravimetric uptake of co2 dropped significantly in mof-74 analogues with higher pore volumes due to the spatial and gravimetric dilution of the open metal sites which serve as the strong adsorption sites for co2 molecules. thus, the increased pore volume in these analogues (which results from construction with extended ligands) sacrifices gravimetric uptake and further complicates synthesis by introducing more complex organic molecule building units and by potentially reducing mechanical stability while many efforts have been made to tune and improve upon the exceptional small molecule adsorption properties of the original mof-74 framework, we undertake a rational design approach to further improve the gas adsorption capabilities in mof-74 analogues by increasing the density of open metal sites, e.g., by replacing the dobdc linker with a smaller molecule. while dobdc represents the smallest aromatic molecule that satisfies the topological requirement of mof-74, an even smaller molecule can be identified from the thousands of aliphatic molecules which are smaller in size than dobdc. in this work, we rationally design in silico a mof-74 analogue based on a cheaper and commercially available aliphatic ligand, i.e., dhfuma (dhfuma = 2,3-dihydroxyfumarate), and simulate its h2, co2, and h2o adsorption properties, based on extensive previous work dedicated to describing the energetic interactions of small molecules in the mof-74 framework. namely, we predict significantly improved h2 volumetric storage capacity, increased low - pressure co2 adsorption, and higher co2:h2o selectivity in the m2(dhfuma) series than the m2(dobdc) series. the cost (per mol) of dhfuma is lower than that of dobdc by more than 80% from the commercial vendor sigma - aldrich, and the volumetric density of open metal sites in m2(dhfuma) is twice of that of m2(dobdc). typical protocols used to synthesize m2(dobdc) have been tested and shown to result in a crystalline material that is not the desired m2(dhfuma) product (see supporting information) ; however, calculation of the elastic constants and vibrational frequencies demonstrates the dynamical and mechanical stability of m2(dhfuma) and provides justification that the material can be synthesized. m2(dhfuma), if it can be synthesized in large quantities, has the potential to be a better candidate than m2(dobdc) for industrial applications including hydrogen storage and carbon capture. part of our recent work has focused on the in silico crystal design of 1-d rod mofs. the building blocks of these mofs are embedded in three - dimensional space by an optimization routine that is constrained by geometric rules that must hold for a 1-d rod mof. utilizing this method allows for facile substitution of dobdc for dhfuma into the mof-74 framework and quickly creates an accurate starting crystal structure for dft optimization. we believe this to be the smallest possible ligand with which a mof-74 analogue can be constructed. dispersion - corrected dft optimization was performed to relax the m2(dobdc) and m2(dhfuma) frameworks and obtain partial atomic charges for each unique atom type in the framework. (1, 1, 1) oxygens connect to one metal rod in the mof-74-type framework, and (2, 2, 2) connect to an adjacent metal rod. the distance between adjacent open metal sites is shown to be 2 shorter in the mg2(dhfuma) framework. a majority of the periodic density functional theory calculations, including geometry and cell optimizations, have been performed using the cp2k code which uses a mixed gaussian / plane - wave basis set. we have used both gradient - corrected (i.e., pbe) and hybrid density functional (i.e., pbe0 with 25% hartree it is known that a correct description of the dispersion interactions is important to predict the mof structures and host we have used one of the most popular pairwise additive descriptions of the dispersion interactions as developed by grimme., i.e., the d3 method with the axilrod teller muto three - body terms, in combination with the conventional pbe and pbe0 functionals. the same method was used in our previous work on mil-53, uio-66, and mof-74 types of mofs, and we achieved very good agreement between theory and experimental results on structures and calorimetric measurements. we note that a hybrid functional is necessary here to provide a correct description of the electronic structures and host guest interactions of mof-74 materials featuring m cations with unpaired electrons, including mn, fe, co, ni, and cu. fock exchange calculations, which are part of the hybrid dft functional pbe0, were performed and significantly accelerated using the auxiliary density matrix method (admm), which enables us to consider relatively large systems (with the largest system containing 489 atoms) at the hybrid dft level. the partial atomic charge analysis was performed using the repeat method proposed by campana., which was recently implemented into the cp2k code based on a restrained electrostatic potential framework. the repeat method calculates partial atomic charges from electrostatic potentials determined from dft calculations, and only the grid points outside the van der waals radii of each atom were included in the fitting. we have used partial atomic charges determined using the repeat scheme in our recent work on mof-74, in which very good agreement was obtained between theory and experiment on the adsorption isotherms of co2 molecules. the vibrational frequency and elastic constant calculations a critical component in the classical molecular simulation of nanoporous materials is the parametrization of classical potential energy functions (or force fields) that can accurately describe the energetics of hostguest systems. many times off - the - shelf force fields such as uff or dreiding are used in lieu of a more accurate alternative, but this approach breaks down with mofs that contain complex electronic structure features such as open metal sites. several different approaches have been used specifically to generate force fields which successfully describe gas interactions in mof-74 type frameworks which contain these open metal sites. pham. used a many - body polarization approach to classically capture the complex h2open metal site interactions in the mg2(dobdc) framework and later extended their force field development to the entire metal series. in this work, the model of pham was used to model h2 adsorption in mg2(dobdc) and mg2(dhfuma), and we refer the reader to these publications for further details. the grand canonical monte carlo (gcmc) simulations of h2 with many - body polarization were calculated with the raspa2 software package. mercado. used a recently developed approach to parametrize the potential energy surface for the isoreticular series m2(dobdc) [m = mg, mn, fe, co, ni, zn ] such that classical molecular simulation of co2 and h2o could be performed for the entire metal series for the first time. the parametrization was peformed by calculating dft single - point energies along the path of minimum repulsion between unique guest host pairwise types to accurately capture the repulsive behavior between the guest and the excess electon density at the open metal sites. we adopt this force field parametrization for studying the adsorption properties of co2 and h2o in dhfuma and refer the reader to this publication for specific details and the parameters themselves. the unique types assigned to each atom in the dhfuma crystal structure and their correspondence to the atom types of mercado s force field are shown in the supporting information, in addition to a justification for the transferability of the force field. gcmc simulations were executed to calculate adsorption isotherms and isosteric heats of adsorption of the frameworks under consideration. an annealing minimization scheme was used to determine the classical binding energy of adsorbates in all analogues. in this scheme, an nvt ensemble monte carlo simulation consisting of one asorbate molecule is successively quenched from t = 298 k to t = 1 k. the potential energy of the final configuration in the t = 1 k simulation then corresponds to the classical binding energy. the porosity characterization of all frameworks was performed with the zeo++ application using the high accuracy settings. the channel geometry of the mg analogues of the dhfuma and dobdc series were analyzed by zeo++ to demonstrate the differences in porosity which are later shown to have a significant impact on the adsorption properties of the two frameworks. a probe radius of 1.65 was used which corresponds to the kinetic diamter of co2. we note that the distance between the centers of two metal rods opposite each other in a single hexagon of dhfuma, i.e., the approximate diameter of a single channel, is equal to 12.6. when accounting for the van der waal s radii of the framework atoms in dhfuma, the largest free and included spheres are close to half of this diameter as shown in table 1. interestingly, the typical diameter of single - wall carbon nanotubes (swnts), depending on the chirality indices, can range from 6.2 (n + m = 8) to 12.2 (n + m = 18) for the lowest energy tube for each combination of chirality indices. we have therefore designed a mof with a channel geometry that is essentially comparable to a swnt but with a significantly higher degree of chemical diversity due to the presence of oxygens and open metal sites decorating the inside of the channel. the proximity and increased volumetric density of open metal sites in the dhfuma structure compared to the dobdc structure will later be shown to result in a new co2 binding configuration. the volumetric densities of open metal sites in mg2(dhfuma) and mg2(dobdc) are 0.0084 mg / and 0.0044 mg /, respectively. one in every six atoms in dhfuma is an open metal site, whereas one in every nine atoms in dobdc is an open metal site. with nearly two times the volumetric metal site density and one and a half times the molar metal site density of dobdc (in addition to the reduced interatomic distance between adjacent mg atoms in each channel), dhfuma contains a spatial configuration of open metal sites that is more favorable for hydorgen storage and co2 capture. additional pertinent crystallographic data for mg2(dobdc) and mg2(dhfuma) are included in the supporting information. to verify whether m2(dhfuma) is stable and therefore has the potential to be synthesized experimentally, we calculated the vibrational frequencies and elastic constants. our calculated vibrational frequencies and the full elastic matrix of mg2(dhfuma) are shown in the supporting information. we find all the vibrational modes of mg2(dhfuma) have positive frequencies, demonstrating its dynamical stability. we further verify the elastic stability of mg2(dhfuma) against the born stability criteria, and we find the calculated elastic constants of mg2(dhfuma) satisfy all the necessary and sufficient stability conditions (see the supporting information), demonstrating mg2(dhfuma) to be mechanically stable. we expect m2(dhfuma) based on other metals to have the same behavior and suggest these materials have the potential to be synthesized in future experiments. the results of the mechanical and dynamical stability calculations are not surprising, especially since the metal oxide rod m o coordination environment is identical to m2(dobdc) and since dhfuma is an experimentally validated ligand with a fully conjugated backbone exhibiting a planar geometry between the two connection groups (see figure 1). the synthetic difficulties arise in finding the necessary reaction conditions to yield the correct crystalline m2(dhfuma) product, the details of which are elaborated in the supporting information. the doubling of the volumetric density of open metal sites results in a factor of 2 increase in the simulated volumetric h2 storage capacity of mg2(dhfuma) over mg2(dobdc) at cryogenic temperatures. utilizing the many - body polarization scheme implemented in the raspa2 package and the polarizable model of pham. to compute h2 potential energy interactions in mg2(dobdc), we simulate the adsorption isotherms of both mg2(dobdc) and mg2(dhfuma) at 77 k. we assumed that the force field is transferable and adopt all model parameters of pham with the exception of the frameworks partial atomic charges for which we use the values derived from our repeat analysis which are summarized in the supporting information. figure 2(a) demonstrates a good agreement of our isotherm with the theoretical isotherm of pham. and the experimental isotherm of dietzel. (data extracted from ref (40) and ref (69), respectively) for mg2(dobdc) at 77 k. our simulated isotherm as generated by raspa2 slightly overpredicts the gravimetric uptake (by 20% at 1 bar) shown by the experimental results and simulated by pham. which we further discuss in the supporting information. h2 isotherms computed at t = 77 k. (a) mg2(dobdc) isotherms computed in this work, by pham. (extracted from ref (40)), and measured by dietzel. (extracted from ref (69)) and the predicted mg2(dhfuma) assuming a transferable force field. (b) mg2(dhfuma) and mg2(dobdc) simulated isotherms from this work in units of amount adsorbed per framework volume. since the weight compositions of mg in dhfuma (25.2 wt %) and dobdc (20.0 wt %) differ slightly, the amount of h2 loaded per framework weight in dhfuma is marginally better than dobdc at low pressure but does not represent a remarkable improvement as shown in figure 2(a). the strong h2open metal site interactions dominate the adsorption at low temperatures and pressures, and weak h2h2 interactions are not sufficient to provide the strong cooperative binding effects observed with co2 which are later discussed in the section on enhanced co2 heat of adsorption. in other words, h2 gravimetric adsorption is not significantly improved in dhfuma at low pressures, and the framework displays h2 saturation behavior at significantly lower pressures than in dobdc as one would expect from the reduced channel volume. nevertheless, the advantage of mg2(dhfuma) for h2 storage lies exactly in this reduced channel volume and the doubling of volumetric open metal site density. as can be seen from figure 2(b), the h2 storage capacity on a volumetric basis (in which the amount loaded is expressed per total volume of adsorbent) is approximately twice that of mg2(dobdc). not only would a mg2(dhfuma)-based storage device require half the volume to achieve approximately the same h2 storage by weight percent but also the ligand is drastically cheaper. at the cryogenic temperature of 77 k and extremeley low pressure of 0.5 bar, mg2(dhfuma) is predicted to achieve a volumetric uptake of 41.5 g h2/l which is sufficient to surpass the doe s 2020 h2 volumetric storage target of 40 g h2/l. we note that mn - btt (btt = 1,3,5-benzenetristetrazolate), one of the best performing mofs for volumetric hydrogen uptake, has been reported to achieve uptake of 43 g h2/l but at the higher pressure of 1.2 bar. we list our calculated lattice parameters of the all the mofs considered in this work in table 2, and we compare the data on m2(dobdc) with available experimental results (taken from ref (36) ; see references therein) from which we find that the errors of our theoretically predicted lattice parameters of m2(dobdc) are within 1%. we also find that for the same metal the a lattice parameter of m2(dhfuma) is proportionally smaller than that of m2(dobdc) by 2729%, and the c lattice parameter of m2(dhfuma) is almost the same as that of m2(dobdc), with the biggest difference to be only 0.16 (cu and zn). indeed, the decreased unit cell volume of m2(dhfuma), i.e., by 50% in comparison with m2(dobdc), is mainly due to the shortening of the lattice parameter along the a and b axes, and a direct result of that is the doubling of the density of open metal sites. we will see that the shortening of the a lattice parameter and the doubling of the density of open metal sites in m2(dhfuma) have a significant effect on the optimal binding configuration of co2 in m2(dhfuma). taking mg as an example, we show our theoretical optimized binding configuration of co2 in mg2(dobdc) and mg2(dhfuma) in figures 3a and 3b, respectively. from figure 3, we can find that a single co2 molecule has very different binding modes in mg2(dobdc) and mg2(dhfuma). in mg2(dobdc), one terminal oxygen of co2 binds to mg of mg2(dobdc) with a short binding distance of 2.33, while the other terminal oxygen of co2 is aligned with the dobdc linker and points toward the open pore space of mg2(dobdc). however, in mg2(dhfuma), because of the much shorter interchain mgmg distance (i.e., 6.03 in comparison with 8.26 in mg2(dobdc)), both terminal oxygens of co2 are able to bind to two neighboring mg cations simultaneously, with similar binding distances (i.e., 2.592.60). such a unique binding mode results in a much enhanced binding energy of co2 in mg2(dhfuma), i.e., 50.1 kj / mol, which is 20% (8.8 kj / mol) stronger than that in mg2(dobdc). we show a detailed comparison of the binding energies and relevant om binding distances of co2 in m2(dobdc) and m2(dhfuma) with different metals in table 3, in which we also list available experimental data on co2 adsorption in m2(dobdc). we further looked at the adsorption of a single h2o molecule in both m2(dobdc) and m2(dhfuma) with different metals, and we show a detailed comparison of the binding energies and relevant om binding distances in table 4. interestingly, the binding energies of a single h2o molecule in m2(dobdc) and m2(dhfuma) with the same metal are almost identical. taking mg as an example, the binding energies of h2o are 88.6 and 87.4 kj / mol in mg2(dobdc) and mg2(dhfuma), respectively. this is because h2o has only one central oxygen, and it interacts with both mg2(dobdc) and mg2(dhfuma) through a single - contact omg interaction. comparing the whole series of co2 and h2o adsorption in m2(dobdc) and m2(dhfuma) with different metals, we can find that the trend is the same ; co2 tends to have much stronger binding in m2(dhfuma) than that in m2(dobdc) with the same metal, while h2o tends to have almost the same binding strength in m2(dhfuma) and m2(dobdc) with the same metal. this would lead to improved selectivity of co2 in a co2:h2o mixture in m2(dhfuma) than that in m2(dobdc). dft optimized binding configurations of co2 in (a) mg2(dobdc) and (b) mg2(dhfuma). we demonstrate in the supporting information that the force field of mercado can reproduce the ab initio potential energy landscape of co2 in our set of analogues as shown by the agreement of both binding energies and binding geometries. with confirmation of the force field s tranferability, henry coefficients of the m2(dobdc) and m2(dhfuma) structures were computed at temperatures of 313.0 and 400.0 k, shown in table 5. an order of magnitude increase is observed in dhfuma structures over dobdc structures for a given metal substitution. it is also worthwhile to note that, for a given metal substitution, the m2(dhfuma) structure achieves the same order of magnitude (and only slightly lower) henry coefficient at 400 k as its dobdc counterpart at 313 k in all frameworks except for the mg analogues. this large decrease in the free energy of a single adsorbed co2 molecule in dhfuma is a direct result of the decreased potential energy of the one molecule per two open metal sites binding mode, which has been demonstrated in our dft optimization and gcmc simulations. gcmc simulations were utilized to simulate the co2 uptake in m2(dobdc) and m2(dhfuma) structures and calculate isotherms for each material. the higher density of open metal sites and enhanced binding energy results in larger uptake at low pressures ; however, the reduced channel volume results in quicker saturation of the dhfuma adsorbent. the co2 isotherms in mg2(dobdc) and mg2(dhfuma) in figure 4 visualize this trend. thus, at low pressures dhfuma performs significantly better in total co2 uptake but performs worse in total uptake at higher pressures. a detailed view of all co2 isotherms is provided in the supporting information. due to the favorable enhancement of the binding energy, dhfuma analogues are able to capture significantly more co2 in any pressure range relevant to industrial co2 capture from flue gas where pco2 = 0.15 bar. figure 5 demonstrates the excess amount of co2 captured by each metal analogue of dhfuma in comparison to its dobdc analogues across a pressure range applicable to flue gas conditions. the excess value peaks at low pressures and then quickly drops to large negative values after the dhfuma framework saturates with co2. it is also significant that dhfuma analogues continue to load approximately 2 mol / kg more co2 at an elevated temperature of 400 k since high - temperature adsorption can be used to mitigate competitive water adsorption, as will be seen in later discussion. absolute co2 adsorption in mg2(dhfuma) vs the absolute co2 adsorption in mg2(dobdc) at 313 k. the dhfuma structure significantly outperforms the dobdc structure in co2 uptake at low pressures but has far lower capacity of co2 in the limit of saturation. absolute co2 adsorption in dhfuma minus the absolute co2 adsorption in dobdc (a) at 313 k and (b) at 400 k. the pressure region in pink corresponds to the typical partial pressure of co2 (p = 0.15 bar) in the exhaust from a coal - fired power plant. for each metal a temperature exists betweeen 313 and 400 the isosteric heat of adsorption, hads, as a function of loading is a measure of the enthalpy gained on average by adsorbing one additional molecule in the adsorbent system at a specified loading. conversely, the isosteric heat of desorption, hdes, as a function of loading is the amount of enthalpy required to desorb one additional molecule at a specified loading. in figure 6 we observe an interesting feature of co2 adsorption in the dhfuma structure that shows a monotonic increase in the heat of desorption as a function of loading from zero to saturation loading. a molecule that adsorbs when the framework is close to saturation (0.80.9 molec / m) releases nearly 10 kj / mol more enthalpy than the first molecule to adsorb. in other words, the cooperative binding of co2 is very strong (due to the proximity of the primary binding sites) and increases in strength monotonically with loading. this leads to the nonintuitive property that the enthalpy penalty to desorb co2always decreases as the loading decreases from saturation to empty framework. notably, mg2(dhfuma) does not exhibit this trend because the binding energy of one co2 molecule is so strong that cooperative adsorption is only favorable enough to maintain a constant hdes as a function of loading. only a 12 kj / mol increase in hdes is observed in all dobdc analogues between the limit of 0 loading and the inflection point at 1 molecule per open metal site. thus, cooperative adsorption at loadings below 1 molecule per open metal site is negligible in the dobdc frameworks when compared to the dhfuma frameworks. heat of desorption as a function of loading for the m2(dobdc) and m2(dhfuma) analogues. the dhfuma structures, with the exception of the mg analogue, exhibit a 710 kj / mol increase in the hdes between the limit of zero loading and saturation. enhanced co2 uptake in the range of partial pressures relevant to adsorption from a coal - fired flue stream does not necessarily indicate an improved potential for industrial - scale co2 capture. a multitude of other factors must be considered such as co2:h2o selectivity, compression work of the co2-enriched waste stream, and the energy required for adsorbent regeneration, and these attributes can be quantified through a metric known as the parasitic energy. however, the deleterious effects of water on co2 uptake are often overlooked when evaluating materials for co2 capture potential via the parasitic energy. for this reason we investigated water adsorption in the dhfuma and dobdc series as well since creative strategies such as high - temperature adsorption and low - temperature desorption (hald) have been proposed to mitigate the parasitic energy when adsorbing co2 from humid flue gas streams. pure component water isotherms and binding geometries are shown in the supporting information. more relevant to carbon capture, we performed a co2:h2o binary mixture analysis to investigate each structure s potential performance for carbon capture in the presence of water. gcmc simulations were performed at a fixed reservoir pressure of 0.15 bar, and the molar composition of co2:h2o of the reservoir was varied at different temperatures. note that n2 was not simulated in the mixture as its uptake in the mof-74 framework series has been shown to be negligible in comparison to the uptake of co2 and h2o at flue gas adsorption conditions. the same stepped feature of water adsorption occurs in this binary analysis as in the pure component h2o isotherms, and at a certain critical pressure, water condenses within the pore. in the case of this binary mixture analysis, the condensation of h2o is sufficient to entirely remove any adsorbed co2 at equilibrium. figure 7 demonstrates the loss in co2 uptake capacity that occurs after the molar composition of water (at fixed total pressure) in the reservoir becomes too high. mixture analysis of co2 and h2o adsorption in the mg analogues of dhfuma and dobdc. each data point represents an equilibrated absolute adsorption loading from a gcmc simulation at 400 k and fixed total pressure of 0.15 bar, while the molar composition of h2o to co2 is varied between simulations. for each analogue, two values are extracted, and (1) and (2) demonstrate the values extracted for mg2(dhfuma). (1) corresponds to the co2 uptake that is equal to 90% of the uptake in the limit of 0 mole fraction of h2o. (2) corresponds to the h2o mole fraction at which the total co2 uptake has decreased by 10%. yet at higher temeprature, the onset of the water step is shifted to a significantly higher mole fraction. a reduction in co2 uptake capacity follows from this temperature increase, yet this uptake loss is mitigated in the dhfuma structure due to the enhanced co2 affinity. an entire summary of the mixture anlaysis for each structure at various temperatures is presented in the supporting information. from one mixture analysis at a specified temperature, we can extract two values of importance which are visualized in figure 7 : the water mole fraction just before water condensation occurs and the amount of co2 loaded at that specific water mole fraction. at which condensation occurs, we must raise the temperature, which consequently reduces the amount of co2 loaded. these two quantities are plotted for each analogue structure across a range of adsorption temperatures (313400 k for m = [co, fe, ni, zn ] and 400473 k for m = [mg ]) in figure 8. from a carbon capture process design perspective, the ideal material would be located in the top right corner of figure 8 where the material loads large amounts of co2 in the presence of extremely high water mole fractions. since the x and y quantities of figure 8 represent competing variables (but we desire to maximize both of them), we can interpret this summary as a problem of pareto optimality, and a pareto frontier can be observed for co2(dhfuma). this means that regardless of the adsorption temperature chosen for our capture process there is no material that can simultaneously achieve a higher water tolerance and co2 uptake capacity at thermodynamic equilibrium than co2(dhfuma). therefore, regardless of the selected operating temperature, co2(dhfuma) will have the best uptake and water tolerance as is easily visualized in figure 8. in more physical terms, a pareto optimal material in this context of co2 capture in the presence of humidity will be the material which delicately balances two factors. first, co2 uptake must remain the highest with increasing temperature, which fundamentally arises from the highest co2 henry coefficient, which in turn arises from the strength of co2 interactions at the open metal site(s). second, h2o condensation must occur at the highest water mole fraction, which arises from a combination of the weakest possible h2o interactions with the open metal site and the largest pore size. hence we can see the competing nature of these two factors since the strengths of co2 binding and h2o binding at the open metal site are highly correlated, and the advantage of dhfuma becomes immediately clear since we selectively strengthen the binding energetics of co2 across all metals due to the one molecule per two open metal site binding mode. thus, we also notably observe that each m2(dhfuma) represents a pareto frontier over its dobdc counterpart. ni2(dobdc) can not maximize either water tolerance or co2 uptake above ni2(dhfuma) regardless of our specification of the adsorption temperature. mixture analysis of all analogues demonstrating the competing nature of co2 uptake and water tolerance. the y - axis corresponds to value (1) extracted from figure 7, and the x - axis corresponds to value (2). the ideal material for co2 capture would have a data point corresponding to 313 k at the top right corner of the plot. we have demonstrated the in silico design of a new mof-74 analogue based on the aliphatic dhfuma ligand. we predict exceptional small - molecule adsorption properties via a combination of ab initio electronic structure calculations and classical molecular simulation techniques in conjunction with the extensive previous research efforts to create simulation methods that accurately predict guest molecule behavior in mof-74-type frameworks. namely we have predicted (1) a doubling of the volumetric storage capacity of h2 in mg2(dhfuma) over mg2(dobdc) at the cryogenic temperature of 77 k and pressures below 1 bar (and can meet the 2020 doe target of 40 g / l at 0.5 bar) ; (2) a marked enhancement of co2 uptake in low - pressure regimes over the dobdc analogue series ; and (3) a selective increase of co2 binding energy (i.e., stronger co2 binding with no change in h2o binding energy), the basis for which we propose an industrial - scale co2 capture process inspired by the hald scheme (see the supporting information). these enhancements are a direct result of the open metal site properties of the m2(dhfuma) frameworks. this material contains double the volumetric density of open metal sites over dobdc analogues, leading to a remarkable simulated volumetric h2 storage capacity. additionally, the distance between two adjacent open metal sites in each channel is reduced from 8.3 in dobdc to 6.0 in dhfuma. co2 binds to two open metal sites in the m2(dhfuma) framework, resulting in a significantly stronger binding energy than in m2(dobdc). the confined pore channel results in significant cooperative adsorption of co2, with an isosteric heat of adsorption that is 15 kj / mol stronger at saturation than in the limit of zero loading. furthermore, since h2o still can only bind to one open metal site in m2(dhfuma), the ab initio calculated quantity of ebind, h2o ebind, co2 in the dhfuma series is typically 10 kj / mol higher than in the dobdc series, indicating that the dhfuma series has more selective co2 binding energetics relative to h2o. this enhanced selectivity for co2 is exploited in our classical gcmc simulations, and adsorption at high temperatures is proposed, allowing for a theoretical process by which co2 can be captured in appreciable amounts (12 mol / kg) in the presence of nontrace amounts of water (0.11 mol %). the water tolerance and amount of co2 captured is dependent on metal choice and adsorption temperature. finally, an 80% decrease in ligand expense (per mol) suggests that an m2(dhfuma) analogue may in the future represent an economically improved path forward for large scale h2 storage or co2 capture from flue gas. the theoretical work in this paper should motivate efforts to experimentally synthesize m2(dhfuma) analogues and confirm our simulated volumetric h2 storage capacity and adsorption behavior of co2:h2o mixtures. we note the synthesis of m2(dobdc) is usually very challenging. thus far, our efforts to synthesize m2(dhfuma) are unsuccessful. however, we do not see any obvious reason why m2(dhfuma) can not be synthesized experimentally, considering the dynamical and mechanical stabilities of these materials as well as the availabilities and chemical stabilities of the metal and organic precursors. we also believe this framework could be useful for a variety of other separations or storage applications relevant to clean energy. in the future we plan to investigate a range of topics such as selective adsorption of components from light olefin mixtures which are small enough to fit into the dhfuma channel network if the material can be synthesized.	we present the in silico design of a mof-74 analogue, hereon known as m2(dhfuma) [m = mg, fe, co, ni, zn ], with enhanced small - molecule adsorption properties over the original m2(dobdc) series. constructed from 2,3-dihydroxyfumarate (dhfuma), an aliphatic ligand which is smaller than the aromatic 2,5-dioxidobenzene-1,4-dicarboxylate (dobdc), the m2(dhfuma) framework has a reduced channel diameter, resulting in higher volumetric density of open metal sites and significantly improved volumetric hydrogen (h2) storage potential. furthermore, the reduced distance between two adjacent open metal sites in the pore channel leads to a co2 binding mode of one molecule per two adjacent metals with markedly stronger binding energetics. through dispersion - corrected density functional theory (dft) calculations of guest framework interactions and classical simulation of the adsorption behavior of binary co2:h2o mixtures, we theoretically predict the m2(dhfuma) series as an improved alternative for carbon capture over the m2(dobdc) series when adsorbing from wet flue gas streams. the improved co2 uptake and humidity tolerance in our simulations is tunable based upon metal selection and adsorption temperature which, combined with the significantly reduced ligand expense, elevates this material s potential for co2 capture and h2 storage. the dynamical and elastic stabilities of mg2(dhfuma) were verified by hybrid dft calculations, demonstrating its significant potential for experimental synthesis.
epstein - barr virus infectious mononucleosis (ebv - im) is a common infection that affects 25 to 30% of adolescents and adults up to 30 years of age. ebv - im can be complicated by streptococcal pharyngitis in 10% of cases but has not been identified as a predisposing factor for secondary viral infections. herpes simplex virus (hsv) is a rare cause of esophagitis in the immunocompetent host. we present the case of a 15-year - old male who was admitted with hsv-1 eosophagitis (hsve) ten days after the diagnosis of ebv - im. a 15-year - old male presented with a 2-day history of severe odynophagia and malaise. ten days before admission, the patient had visited his general practitioner because of a sore throat and fever and been diagnosed with ebv - im. he reported no medical history of recurrent infections and he was not receiving any medication. at admission, physical examination revealed small palpable cervical lymph nodes and a brownish exophytic lesion on his lower lip, compatible with severe manifestation of herpes labialis. despite the severity of the lip lesion, examination of the oral cavity and throat erythrocyte sedimentation rate was 50 mm / h while the rest of the routine laboratory tests were normal, including blood and differential count. immunoglobulin quantitation was normal, while t cell and b cell count were not performed. esophagoscopy revealed confluent linear and roundish ulcerations in the mid and distal esophagus, which had distinct borders and were covered by whitish exudates. the diagnosis was made by detecting hsv-1 dna with polymerase chain reaction (pcr) in the biopsy specimens. serology revealed elevated igm and igg antibodies against the viral capsid antibody of the ebv which confirmed recent infection with the virus. the igm antibody (elisa) against hsv-1 was negative while the igg was positive. due to the severity of the odynophagia and the endoscopic appearance, acyclovir was administered intravenously (5 mg / kg three times daily) and clinical improvement was rapidly observed. three days after acyclovir administration, second - look esophagoscopy showed a marked improvement of the esophageal lesions ; the depth and the width of the lesions were significantly reduced, and normal mucosa could be seen among the ulcerations (fig. the patient had an uneventful recovery and one year later he was in good health. to our knowledge this is the first case of ebv - im in a previously healthy individual complicated by hsve. although the underlying mechanism for this complication is unclear, we hypothesize that immune deficiency during acute ebv infection might lead to reactivation of hsv. in acute ebv infection the population of the cd8 + cytotoxic t cells expands, inverting the cd4+/cd8 + ratio, and almost half of them are directed against the virus.. showed that ebv affects both b and t lymphocytes and causes broad - based transient immune deficiency in patients with uncomplicated infection. the impaired b cells produce deficient quantities of antibodies while t suppressor cells inhibit antibody production [5, 6 ]. gingivostomatitis with bilateral oropharyngeal lesions, ulcerations and erythema of the gingiva, buccal mucosa and tongue, lymphadenopathy and fever are usual manifestations of primary infection, while unilateral oropharyngeal lesions and cold sores suggest secondary infection. the hsv infection in our case is considered recurrent because of the igg seropositivity at admission and the cold sores (herpes labialis). herpes labialis appears in 20 to 40% of seropositive individuals and has been reported to present with hsve in another two cases [8, 9, 10 ]. it seems that hsv primary infection in young healthy adults causes more severe symptoms compared to hsv infection in childhood. located usually in the mid - distal esophagus, the usual appearance of hsve is of friable, hemorrhagic mucosa with ulcerations of various depth and length that coalesce. biopsies from the edge of the ulcers are the appropriate specimen for detecting the virus. inclusion viral bodies can not be found in half of the cases and pcr has lately been used for detecting virus dna in the biopsy specimens. pcr is a more sensitive, cost - effective and rapid method compared to the viral cultures and enzyme immunoassay, providing results within a few hours [12, 13 ]. only 5% of the seropositive patients who undergo reactivation of the virus have a four - fold rise in titre of the antibody to hsv. although infection in the immunocompetent host is self - limited, in the presence of immunodeficiency, marked clinical symptoms, or complicated course treatment with the guanosine analogue acyclovir shortens the duration of the symptoms and esophageal lesions. improvement of odynophagia is expected within 24 - 72 h and early onset of therapy is believed to speed up symptom resolution. however, whether improvement of the symptoms is the result of acyclovir or of the natural course of the disease is an issue of debate, due to the low incidence of hsve in immunocompetent patients. in conclusion, we report a young patient who presented with hsve ten days after the diagnosis of ebv - im. the transient immune deficiency caused by ebv - im is believed to be the predisposing factor for the reactivation of hsv. in view of the rarity of this condition and the low sensitivity of macroscopic assessment,	epstein - barr virus infectious mononucleosis can cause transient immune deficiency which may predispose to reactivation of latent herpes simplex virus (hsv) infection in the immunocompetent host. we report the case of a 15-year - old male who presented with severe odynophagia and herpes labialis during the course of epstein - barr virus infectious mononucleosis that had been diagnosed ten days before. esophagoscopy revealed extensive ulcerations with distinct borders and whitish exudates at the mid and distal esophagus. polymerase chain reaction detected hsv-1 dna in the biopsy specimens. the patient was treated with intravenous acyclovir. the symptoms resolved rapidly within 3 days, in accordance with improved endoscopic findings.
cystic fibrosis (cf) is a chronic systemic disease where imaging has long been used for monitoring chest status, and for chest evaluation in exacerbation of the disease. computed tomography (ct) is a superior imaging tool compared to radiography [1, 2 ], but despite its use for more than two decades has yet to show its true clinical value [3, 4 ]. ct exposes the patient to a substantially higher radiation dose than chest radiography, rendering it unsuitable for the often needed repeated examinations of these patients. recently tomosynthesis (digital tomography) has appeared as an interesting low dose alternative to chest ct, with significantly better delineation of cf changes than conventional radiography. technical developments have now led to the introduction of the technique also for chest [68 ], abdominal [9, 10 ] and musculoskeletal imaging [11, 12 ]. the aim of this pictorial essay is to give an overview of the tomosynthesis imaging findings in cf for different stages of the disease and to compare them to radiographic and ct findings in the same patients. tomosynthesis images were acquired on a commercially available product (definium 8000 and volumerad ; ge healthcare, chalfont st giles, england). in chest tomosynthesis, tomographic images are generated from multiple low dose exposures directed towards a stationary digital amorphous silicon flat - panel detector, from tube angles of 17.5 to + 17.5 of a moving x - ray tube. these exposures are used to reconstruct up to approximately 60 coronal sectional images with a nominal thickness of 3 mm for children and 4 mm for adults, without overlap. the structures included in each sectional image are sharply depicted, while structures located anteriorly or posteriorly to the section are blurred (fig. 1). an antero - posterior (ap) chest radiograph is always automatically included in the tomosynthesis examination. chest tomosynthesis is performed under breath hold in inspiration for a scan time of approximately 10 s. as small children unfortunately can not cooperate adequately, tomosynthesis is currently used in children from about 8 years of age. adults and teenagers are examined upright. children between about 8 and 12 years are examined supine, which makes it easier for them to be still and concentrate on holding their breath, thus reducing motion artefacts.fig. 1a 13-year - old girl, examined with tomosynthesis to exclude lung metastases from sarcoma. the selected section shows anatomical structures in great detail while structures located anteriorly and posteriorly are increasingly blurred with increasing distance. the vascular branches can be seen as far peripherally as about 1 cm from the pleura a 13-year - old girl, examined with tomosynthesis to exclude lung metastases from sarcoma. the selected section shows anatomical structures in great detail while structures located anteriorly and posteriorly are increasingly blurred with increasing distance. the vascular branches can be seen as far peripherally as about 1 cm from the pleura compared to ct, tomosynthesis has a higher spatial resolution in the imaging (coronal) plane since the full resolution of the detector can be utilised (2,022 2,022 pixels), while a coronal ct mpr section has a matrix size of 512 at most 512 pixels. however, the depth resolution is inferior to ct, since the tomosynthesis sections have non - precise thickness, with a sharper image at the centre and superimposed adjacent anatomical structures that become increasingly blurred with increasing distance from the section. consequently objects such as intravenous lines, tubes or other devices generate artefacts in the adjacent sections, which may obscure the lung parenchyma. all images were selected, after informed consent, from a prospective study population on cf patients, which was approved by the local ethics committee. at the time of this pictorial essay, the population included 36 children from 8 to 18 years with a total of 92 tomosynthesis exams and 39 adults (19 to 59 years) with a total of 43 tomosynthesis exams. when the patients were examined with radiography as part of a clinical control, the reason was a yearly check - up and 10 patients were examined due to an exacerbation of the disease. during the study period seven hrcts and three contrast - enhanced cts of the chest were performed in seven of the paediatric patients for clinical reasons. in the adult group one hrct and one contrast - enhanced ct of the chest were performed in two patients. from the clinical files a number of cases of cystic fibrosis with typical findings were selected. in all cases corresponding radiographs are shown, and in a number of cases sections from chest ct close in time have been selected for comparison. the lungs of newborn children with cf are almost normal, but they are prone to bacterial infection, which triggers an inflammatory response. the vicious circle of infection, impaired mucociliary clearance, inflammation, bronchial obstruction and tissue damage is well documented. inflammation and squamous metaplasia lead to thickening of the bronchial walls, which reduces the size of the small airways causing airway obstruction. the excessive mucus production and airway impaction together with the weakening of airway walls, secondary to infection and inflammation, lead to the development of bronchiectases. common radiologic pulmonary changes seen in cf are mucus plugging, bronchial wall thickening and peribronchial changes, bronchiectases, overinflation and air trapping, atelectases, and consolidation of lung parenchyma [16, 17 ]. in particular mucus plugging, bronchial wall thickening and bronchiectases are better delineated with tomosynthesis compared to radiography (see fig. 2 above). in mild disease, bronchial wall thickening, discrete cylindrical bronchiectases and small mucus plugs can be seen. with advancing disease the bronchiectases increase in number and gradually become more dilated, and large mucus plugs can be seen in the dilated bronchi. in the normal healthy lung, the bronchial walls are visible in the central lung with tomosynthesis but not in the periphery (fig. 1). the vascular tree is depicted in more detail than with radiography, and vascular branches can be seen as far as approximately 1 cm from the pleura. small mucus plugs are usually not visible on radiographs but can be seen as a tree - in - bud pattern or as small clustered nodules in the periphery of the lobes with tomosynthesis (figs. large mucus plugs can be seen as blurred nodular or cylindrical shadows on radiographs, but with tomosynthesis are sharply depicted inside the bronchi (fig. when the bronchi are thickened, they are clearly delineated with tomosynthesis, not only centrally, but also in the peripheral lung (figs. 4 and 5). bronchiectases may be clearly visualised with bronchography and ct, but are often difficult to assess with radiography. radiographs depict suspicious bronchiectases as increased linear markings or blurred cystic lesions ; with tomosynthesis it is possible to differentiate them in detail as cylindrical, varicose or cystic bronchiectases (figs. 6, 7, 8 and 9). when the examination is performed upright air - fluid levels might be observed in the bronchiectases (figs. 4c, 7b and 9b) or in abscesses, and small air - fluid levels seen on tomosynthesis are especially easy to miss on radiographs. in our patient group, no cf patient has yet presented with pneumothorax, but in other patients a small lateral or apical pneumothorax has been better visualised with tomosynthesis than with radiography. localised air trapping and mosaic pattern, which often is well assessed with ct, can not be adequately evaluated with tomosynthesis. these findings can be suspected with tomosynthesis when there is an absence of vascular markings or an area of hyperlucent lung. bullae are more clearly delineated with tomosynthesis than with radiography, but can be seen in more detail with ct.fig. b in the corresponding area, the tomosynthesis section clearly depicts bronchial wall thickening, small mucus plugs (arrowheads) and cylindrical bronchiectasis (arrows), not apparent on the simultaneously obtained radiographfig. a the ap radiograph shows mild to moderate general changes of cystic fibrosis ; with increased linear markings and discrete nodular opacities (arrowheads) in the periphery of both lungs. bronchiectases are suspected in the upper parts of both hilar regions (white arrows). cylindrical bronchiectasis (white arrows) and small mucus plugs (arrowheads), in a tree - in - bud pattern on the right side, are also clearly depicted. artefacts from a central venous access device can be seen in the right upper quadrant (black arrow)fig. b, c two tomosynthesis sections show severely thickened bronchial walls, especially in the left upper quadrant (white arrows). many of the bronchi are dilated and filled with large mucus plugs (arrowheads). a in the right upper quadrant of the ap radiograph increased linear markings are seen, suggestive of bronchiectases. b on the tomosynthesis sections these changes are resolved in more detail as cylindrical bronchiectasis (arrows), bronchial wall thickening and minor areas of small mucus plugging (circles) are seenfig. a on the ap radiograph bronchiectases are suspected in the apical regions of both lungs. b on a tomosynthesis section multiple varicose bronchiectases are clearly seen (two on the right side and one on the left side are marked with arrows)fig. a on the ap radiograph moderate cystic fibrosis changes are seen ; the most severe are in the right lower quadrant. b, c two tomosynthesis sections clearly show cystic bronchiectasis anteriorly in the right hilar region (circle) and varicose bronchiectasis in the perihilar regions bilaterally (white arrows). in addition a small fluid level is seen (black arrow) on the right side. bronchial wall thickening, multiple cylindrical bronchiectases and small mucus plugs in the periphery are also seen in both lungs. d a section from hrct of the lungs performed 1.5 months earlier shows bronchiectases anteriorly in the middle lobe and the lingula segment (arrows), and also in both lower lobes. 8a 32-year - old woman with cystic fibrosis. a an ap radiograph with suspected bronchiectases in the right lower lobe. b the tomosynthesis section shows cystic bronchiectases (circle) with one small fluid level (black arrow). c a section from hrct of the lungs performed 4 days earlier shows almost identical findings a 14-year - old girl with cystic fibrosis. b in the corresponding area, the tomosynthesis section clearly depicts bronchial wall thickening, small mucus plugs (arrowheads) and cylindrical bronchiectasis (arrows), not apparent on the simultaneously obtained radiograph a 12-year - girl with cystic fibrosis. a the ap radiograph shows mild to moderate general changes of cystic fibrosis ; with increased linear markings and discrete nodular opacities (arrowheads) in the periphery of both lungs. bronchiectases are suspected in the upper parts of both hilar regions (white arrows). cylindrical bronchiectasis (white arrows) and small mucus plugs (arrowheads), in a tree - in - bud pattern on the right side, are also clearly depicted. artefacts from a central venous access device can be seen in the right upper quadrant (black arrow) a 35-year - old man with cystic fibrosis. b, c two tomosynthesis sections show severely thickened bronchial walls, especially in the left upper quadrant (white arrows). many of the bronchi are dilated and filled with large mucus plugs (arrowheads). a fluid level is seen in the left upper quadrant (black arrow) a 17-year - old girl with cystic fibrosis. a in the right upper quadrant of the ap radiograph increased linear markings are seen, suggestive of bronchiectases. b on the tomosynthesis sections these changes are resolved in more detail as cylindrical bronchiectasis (arrows), bronchial wall thickening and minor areas of small mucus plugging (circles) are seen a 21-year - old man with cystic fibrosis. a on the ap radiograph bronchiectases are suspected in the apical regions of both lungs. b on a tomosynthesis section multiple varicose bronchiectases are clearly seen (two on the right side and one on the left side are marked with arrows) a 12-year - old girl with cystic fibrosis. a on the ap radiograph moderate cystic fibrosis changes are seen ; the most severe are in the right lower quadrant. b, c two tomosynthesis sections clearly show cystic bronchiectasis anteriorly in the right hilar region (circle) and varicose bronchiectasis in the perihilar regions bilaterally (white arrows). in addition a small fluid level is seen (black arrow) on the right side. bronchial wall thickening, multiple cylindrical bronchiectases and small mucus plugs in the periphery are also seen in both lungs. d a section from hrct of the lungs performed 1.5 months earlier shows bronchiectases anteriorly in the middle lobe and the lingula segment (arrows), and also in both lower lobes. in addition mucus plugging is seen in the right lower lobe (arrowheads) a 32-year - old woman with cystic fibrosis. a an ap radiograph with suspected bronchiectases in the right lower lobe. a coronal section shows large bronchiectases a 13-year - old girl with cystic fibrosis. a an ap radiograph showing suspicious bronchiectases in the right upper quadrant. b the tomosynthesis section shows cystic bronchiectases (circle) with one small fluid level (black arrow). c a section from hrct of the lungs performed 4 days earlier shows almost identical findings as tomosynthesis depicts the lungs in the coronal plane with contiguous slices, it gives a better overview of the bronchial tree (fig. 10a c) compared to traditional axial high resolution ct (hrct) images with 10 mm interspace (fig. however, most centres now have multidetector ct scanners, and traditional hrct examinations have been replaced by multiplanar reconstructions of thin contiguous slices. in our opinion sequential studies are easier to compare when the whole volume of the lungs is included in the tomosynthesis examination or in the volume ct of the lungs.fig. a in the right upper quadrant of the ap radiograph increased linear markings and blurred nodular lesions (arrowheads) are seen. b, c on the tomosynthesis sections, bronchial wall thickening, cylindrical bronchiectases (white arrows), large mucus plugs (black arrows), an area of mucus plugging in a tree - in - bud pattern (circles), and mucus plugs in a bronchus (arrowheads) are clearly depicted. d a section from hrct of the lungs performed 2.5 months earlier also shows bronchial wall thickening, cylindrical bronchiectases and mucus plugging a 40-year - old man with cystic fibrosis. a in the right upper quadrant of the ap radiograph increased linear markings and blurred nodular lesions (arrowheads) are seen. b, c on the tomosynthesis sections, bronchial wall thickening, cylindrical bronchiectases (white arrows), large mucus plugs (black arrows), an area of mucus plugging in a tree - in - bud pattern (circles), and mucus plugs in a bronchus (arrowheads) are clearly depicted. d a section from hrct of the lungs performed 2.5 months earlier also shows bronchial wall thickening, cylindrical bronchiectases and mucus plugging since young patients with cf today may have a life expectancy of 4050 years or more, dose considerations in radiologic examinations have become more important also for these patients. the effective adult dose from an ap and a lateral chest radiograph using a digital detector is approximately 0.04 to 0.05 msv. chest ct may impart a 100-fold increase in effective dose, resulting in an adult effective dose of more than 4 msv. however, dose reduction algorithms and tube current modulations have now been introduced from several scanner manufacturers, which will reduce the dose for ct significantly [2022 ]. with low dose chest ct protocols the effective dose may be reduced to 1.5 0.5 msv for 50 mas, and 1.1 0.3 msv for 34 mas, which is still almost 10 times higher than for tomosynthesis. low dose ct protocols for cf have been designed, but have not been included in cf scoring systems so far. for children 8 to18 years old (median age 13) the effective dose at our department has been determined to be about 0.08 msv from chest tomosynthesis and 0.04 msv from chest radiography (ap and lateral view). the effective dose from chest tomosynthesis is 0.12 to 0.13 msv for adults, which corresponds to the dose from a conventional film - intensifying screen system for radiography. thus chest tomosynthesis results approximately in a two- to three - fold increase in effective dose compared to chest radiography. tomosynthesis is performed on the same x - ray system as chest radiography adding only about 1 min to the normal examination time, which makes it a useful tool in the daily practice. the interpretation time for a tomosynthesis examination is normally shorter than for a ct scan with reconstructions in three planes, since there is only one series of images to evaluate. in many countries the cost of an examination is an important issue, especially if patients are charged directly. in our department, the cost for a tomosynthesis examination, including the automatically generated ap radiograph and a supplemented lateral radiograph, is equivalent to 54, which is about 10% more than for a chest radiograph (48). the price for a chest ct (161) is three times higher and an hrct (214) four times higher (all given prices include film reading and reporting). currently the scan time for tomosynthesis is 10 s, under breath hold in inspiration, which limits the use in small children without anaesthesia or sedation. owing to its sectional imaging, tomosynthesis shows structures in more detail that can not be sufficiently evaluated with radiography, such as a superior assessment of mucus plugging and bronchiectases, which according to some authors are the most specific changes of cf lung disease. since tomosynthesis exposes the patient to a comparatively low radiation dose it can be useful in the regular follow - up of cf patients as well as in everyday clinical practice, reducing the need to perform ct. when a more detailed assessment of the lungs may be required, ct still remains the method of choice. a low dose diagnostic imaging strategy is important in the care of patients with cf, especially in the paediatric population. tomosynthesis has a lower radiation dose than chest ct and gives a superior visualisation of pulmonary cf changes compared to radiography. it is performed on the same x - ray system as radiography, adding only about 1 min to the normal examination time, which makes it a useful tool in the daily practice. we believe that tomosynthesis can be of value in the monitoring of disease progression in cf, as a complement to radiography and ct. however, it is important to further define its role in the follow - up of cf patients and explore the strengths and weaknesses of the method.	the purpose of this pictorial review is to illustrate chest imaging findings of cystic fibrosis (cf) using tomosynthesis (digital tomography), in comparison to radiography and computed tomography (ct). cf is a chronic systemic disease where imaging has long been used for monitoring chest status. ct exposes the patient to a substantially higher radiation dose than radiography, rendering it unsuitable for the often needed repeated examinations of these patients. tomosynthesis has recently appeared as an interesting low dose alternative to ct, with an effective dose of approximately 0.08 msv for children and 0.12 msv for adults. tomosynthesis is performed on the same x - ray system as radiography, adding only about 1 min to the normal examination time. typical pulmonary changes in cf such as mucus plugging, bronchial wall thickening, and bronchiectases are shown in significantly better detail with tomosynthesis than with traditional radiography. in addition, the cost for a tomosynthesis examination is low compared to ct. to reduce the radiation burden of patients with cf it is important to consider low dose alternatives to ct, especially in the paediatric population. tomosynthesis has a lower radiation dose than ct and gives a superior visualisation of pulmonary cf changes compared to radiography. it is important to further determine the role of tomosynthesis for monitoring disease progression in cf.
lactobacillus casei is often present in the non - starter microbiota of cheese at the end of ripening (beresford and williams 2004). this implies that this species plays a significant role in proteolysis and flavor development during cheese ripening and that it could be used as adjunct culture with starter bacteria to improve ripening control and enhance flavor intensity. the increasing number of newly sequenced genomes allows for the prediction of phylogenetic relatedness and metabolic pathways (siezen. 2004 ; liu. 2008). however, annotation of these genomes relies mostly on sequence and structural comparisons, which may lead to incorrect functional gene assignments and consequently to incorrect metabolic pathway predictions. the biosynthesis of cysteine in cheese - inhabiting bacteria is of particular interest since cysteine is, unlike methionine, present in lower amounts in caseins (farrell. 2004) and could therefore be a growth - limiting source. furthermore, cysteine and methionine are precursors for the formation of odor - active volatile sulfur compounds during cheese ripening (landaud, helinck and bonnarme 2008). first, serine is acetylated to o - acetyl - l - serine (oas) by a serine acetyltransferase (sat, ec 2.3.1.30), which is encoded by cyse. second, cysteine synthase (ec 2.5.1.47) encoded by cysk replaces the acetyl group by sulfide to form cysteine. we have recently demonstrated that the orthologous cysk gene from l. casei fam18110 actually synthesized cysteine from oas and sulfide (bogicevic. surprisingly, the annotated genome of l. casei atcc 334 apparently does not carry a gene encoding sat, which is necessary for the formation of oas (makarova. 2006 ; liu. 2008). in connection with the characterization of cysk from l. casei, we observed that the gene was co - transcribed with the coding sequence that lies upstream of cysk (bogicevic. this gene is annotated as homoserine o - succinyltransferase (meta, ec 2.3.1.46) in various l. casei genomes that are deposited in the genbank database (table s1, supporting information). 1) and should therefore be involved in methionine biosynthesis (born and blanchard 1999). recently, we presented functional data for cysk, metb, maly and cgl (irmler. a gene putatively encoding either sat or meta (shaded in gray) was studied in this report. sat : serine acetyltransferase ; cysk : cysteine synthase ; meta : homoserine o - succinyltransferase ; metb : cystathionine gamma - synthase ; maly : cystathionine beta - lyase ; cgs : cystathionine gamma - lyase ; cbs : cystathionine beta - synthase. in this paper, we provide functional data showing that l. casei synthesizes cysteine from serine. first, the growth of various l. casei strains with sulfide as the sulfur source was determined. furthermore, the gene encoding the putative meta was cloned and the recombinant protein was used for enzymatic assays. escherichia coli strains were grown at 37c in lb broth (sambrook, fritsch and maniatis 1989). when necessary, ampicillin (amp) was added at a concentration of 100 g ml. lactobacillus casei strains were grown at 30c in mrs broth (de man, rogosa and sharpe 1960). the chemically defined medium (cdm) described by christensen and steele (2003) was used to study the dependency on various sulfur sources. cdm containing either sodium sulfide, l - cysteine or l - cysteine together with l - methionine at a final concentration of 0.7 mm was inoculated with l. casei (1% v / v). after incubation for 3 days at 30c, the optical density at 600 nm (od600) of the cultures was determined using a spectrophotometer (lkb biochrom 4050 ultrospec ii). the orthologous lsei_0479 gene was amplified from genomic dna of l. casei fam18110 with the primer pair lsei_0479_f1/lsei_0479_r (table 1) and cloned into the pexp5-ct / topo plasmid vector (life technologies, zug, switzerland) according to the manufacturer 's instructions. the plasmid containing the gene in the proper orientation was named pexp5-ct / cyse and maintained in e. coli bl21(de3). the recombinant protein was purified with protino ni - ted 1000 packed columns kit (machery - nagel, dren, germany) according to the manufacturer 's instructions. therefore, bacterial cells were suspended in 1 ml of lew buffer provided in the kit and disrupted with glass beads (212300 m in diameter, 0.6 g) and an omni bead ruptor 24 (omni international, kennesaw, us). after elution, the buffer of the purified protein was exchanged to 20 mm sodium phosphate using pd-10 columns (ge healthcare, little chalfont, uk). finally, the protein was concentrated with ultracel 30k centrifugal filters (millipore, cork, ireland). the concentration and purity of the purified protein was determined with the qubit protein assay kit (life technologies) and with sodium dodecyl sulfate polyacrylamide gel electrophoresis (sds - page), followed by colloidal coomassie staining, respectively. the acylation of l - serine, d - serine and l - homoserine was studied using a method based on mass spectrometry : for this, an enzymatic assay was performed in a syringe at rt containing 200 l of 50 mm ammonium acetate (ph 7.4), 1 mm amino acid, 0.06 mm acyl - coa (acetyl - coa, propionyl - coa, butyryl - coa or succinyl - coa) and recombinant enzyme. to test inhibition, 1 mm l - cysteine was added. the reaction mixture was analyzed via continuous flow injection at 5 l min into a high - resolution bruker maxis 4g+ qtof - mass spectrometer (bruker daltonics gmbh, bremen, germany) equipped with an electrospray ionization (esi) interface. the mass spectrometer was operated in positive ion mode with a capillary voltage of 4 kv, an endplate offset of 500 v, a nebulizer pressure of 0.4 bar and a drying gas flow rate of 8 l min at 200c. data acquisition, processing and reporting were achieved using data analysis 4.2 software (bruker daltonics gmbh, bremen, germany). the release of coenzyme a from the acetylated form was measured with 5,5-dithiobis-(2-nitrobenzoic acid) (dtnb). the reaction mixture contained 0.2 ml of 50 mm ammonium acetate buffer (ph 7.4), 1 mm dtnb, 1 mm edta, various concentrations of l - serine (0.110 mm) and various concentrations of acetyl - coa (0.010.16 mm). the km for l - serine was determined with a fixed concentration of acetyl - coa (0.06 mm), while the km for acetyl - coa was determined with a fixed concentration of l - serine (1 mm). the reaction was initiated by the addition of purified recombinant protein and carried out at 25c. the change of absorption at 412 nm was recorded at 5 min intervals for 60 min. woolf transformation (s versus s v), where v is the formation rate of coa and s is the concentration of each substrate. the plasmids pexp5-ct / cyse and pex5-nt / calml3 (table 1) were used to transform the cysteine auxotroph e. coli jm39 and the methionine auxotroph e. coli dl41. transformants were selected on lb / amp agar plates, checked for the presence of the plasmids and finally grown in lb / amp to yield stocks of the transformed bacteria. transformed e. coli were grown in lb / amp medium for 6 h. after the determination of od600, the cells were harvested by centrifugation (3000 g, 10 min), washed once with 1x m9 salts and then resuspended in 1x m9 salts to a final od600 of 2. transformed e. coli jm39 (50 l) were plated on m9 minimal medium (sambrook, fritsch and maniatis 1989) containing glucose (0.4%), iptg (1 mm) and ampicillin (100 g ml) in the absence and presence of l - cysteine (1 mm). transformed e. coli dl41 were plated as described above but in the absence and presence of l - methionine (1 mm). we studied the requirement for various sulfur sources by inoculating a cdm containing either sulfide, cysteine or cysteine and methionine with various l. casei strains (table 1). all strains also showed proper growth, when either sulfide or cysteine was added as the sole sulfur source, except atcc 334 and fam18172 which failed to grow under both conditions. bacterial growth of various l. casei strains in a cdm that contained neither sulfur containing amino acids nor sulfide (white bars). to study dependency on sulfur sources, sodium sulfide (striped bars), cysteine (gray bars) or cysteine and methionine (dark bars) was added. the genome of six l. casei strains deposited in genbank contains an 816-bp coding sequence, annotated as homoserine succinyltransferase, which lies upstream of cysk (table s1, supporting information). a comparison of these genes showed a high nucleotide sequence identity (above 98%). based on this information, we designed the primer pair lsei_0479_f1/_r (table 1) to amplify the gene from l. casei fam18110. a pcr product of approximately 800 bp was obtained and cloned into the expression vector pexp5-ct / topo, thereby adding a 6 his tag to the c - terminus of the predicted protein. the deduced amino acid sequence of the amplified gene shared a high sequence identity (above 98%) with the putative homoserine succinyltransferases from other l. casei strains (fig. 3). since we assumed that this gene in fact encodes a serine o - acetyltransferase, we call the gene cyse and the protein sat in the remainder of this report. the nucleotide sequence of the cyse gene was deposited at genbank under the accession number ku216159. protein sequence alignment of the sat protein from l. casei fam18110 with the putative homoserine osuccinyltransferase from other l. casei strains. the sequences are labeled with the locus tag and the corresponding strains are given in brackets. matching amino acids heterologous expression of pexp5-ct / cyse in e. coli bl21(de3) yielded a soluble recombinant protein, which was purified by nickel affinity chromatography. the purified protein migrated as a single protein band with a molecular weight of 32 kda in sds - page (expected 32.5 kda ; data not shown). to test whether the purified enzyme exhibited acylation activity, the enzyme was incubated together with various amino acids (l - serine, d - serine and l - homoserine) and acyl - coas (acetyl - coa, propionyl - coa, butyryl - coa and succinyl - coa). when the enzyme was incubated with l - serine and acetyl - coa, a peak with an m / z of 148 appeared (fig. this peak represents the protonated oas (m + h)+. when succinyl - coa or propionyl - coa was used together with serine, the enzyme formed o - succinyl serine (m / z 206 ; fig. the intensities of both peaks were lower than that for oas, demonstrating that propionyl - coa and succinyl - coa were not the preferred acyl donor substrates. the formation of o - butyryl serine (m / z 176) was not observed when butyryl - coa was used as the acyl donor (fig. 4d). further, no product formation was observed when d - serine or l - homoserine was used as acyl acceptors (data not shown). illustrated are the mass spectra of incubation of sat with l - serine and acetyl - coa (a), l - serine and succinyl - coa (b), l - serine and propionyl - coa (c) and l - serine and butyryl - coa (d) after 20 min reaction time. the peak m / z 148.0, 162.0 and 206.0 correspond to o - acetylserine (oas), o - propionylserine (ops) and o - succinylserine (oss), respectively. the formation of o - butyrylserine (m / z 176) was not observed. the two intense peaks at m / z 106.0 and 128.0 that are present in all spectra represent the protonated l - serine (m + h)+ and the serine sodium adduct (m + na)+, respectively. when l - cysteine was added to the enzymatic reaction as a putative enzyme inhibitor, the peak corresponding to oas (m / z 148.0) was still clearly detected by ms (fig. the km for the acetylation of serine was determined by a photometric assay that contained ellman 's reagent. this compound reacts with the sulfhydryl group of the released coa, yielding a yellow color. thus, we determined a km of 1.13 (0.13) mm and 0.021 (0.004) mm for serine and acetyl - coa, respectively. again, when l - serine was replaced by d - serine or l - homoserine, no color formation was observed (data not shown). each of the expression plasmids listed in table 1 was introduced into the cysteine auxotroph e. coli jm39 (cyse mutant) and into the methionine auxotroph mutant e. coli dl41 (meta mutant). transformation of e. coli jm39 with pexp5-ct / cyse resulted in the growth of the strain in the absence of l - cysteine (fig. transformed e. coli dl41 failed to grow in the absence of l - methionine in the culture medium (fig. growth properties of transformed e. coli jm39 and e. coli dl41 bearing either plasmid pexp5-ct / cyse (cyse) or pexp5-nt / calml3 (calml3) on minimal medium (mm) agar plates. when indicated (right - hand side), the medium was supplemented with sulfur - containing amino acid. the genome of l. casei atcc 334 was the first strain of this species to be sequenced (makarova., the gene encoding cysteine synthase is found in the annotated genome, but a gene encoding the enzyme that provides the substrate oas for the cysteine synthase is missing. however, when we inoculated a cdm containing only sulfide as the sole sulfur source with various l. casei strains, we observed growth in seven out of nine strains. this indicated that l. casei, in general, possesses the genes necessary for the synthesis of cysteine from serine and sulfide. atcc 334 and fam18172also did not grow when we used cysteine as the sole sulfur source, but they did grow very well when cysteine and methionine were present (fig. previously, we showed that two genes from l. casei fam18168, named metb and maly, encode cystathionine synthase and cystathionine lyase, respectively (irmler. 2008). we assume that both genes constitute the transsulfuration pathway which converts cysteine to homocysteine, the precursor of methionine. we sequenced both genes from l. casei fam18172 and fam18110 and compared the deduced amino acid sequences with the one of fam18168 and atcc 334 (figs s1 and s2, supporting information). we found that atcc 334 possesses a strain - specific glutamine to proline amino acid substitution (q169p) in maly. a slight truncation of the metb protein as a result from a nonsense mutation in the corresponding gene is specific for fam18172. whether these genetic changes render the strains auxotrophic for methionine needs further investigations. with regard to the synthesis of cysteine from serine, we assumed that the meta gene that forms an operon with cysk in fact encodes a sat protein. to study our hypothesis, we cloned the putative meta from l. casei fam18110 and expressed it heterologously in e. coli. slight acylation activity was also observed when propionyl - coa and succinyl - coa were used as substrates. the enzyme did not show acylation activity when d - serine or l - homoserine was used as acyl donors. taken together with the complementation of an e. coli cyse mutant strain, this study clearly showed that the l. casei gene encodes sat and therefore should be named cyse and not meta. liu. (2012) made a comprehensive in silico comparison of genes involved in sulfur metabolism. the authors describe that the genomes of other lab species such as l. acidophilus, l. delbrueckii subsp. bulgaricus, l. rhamnosus, l. helveticus, l. fermentum, l. kefiranofaciens, l. reuteri and l. salivarius possess a cysk gene but not a cyse gene. moreover, cysk is co - localized with a meta gene in the genomes of this species. the situation resembles the one of l. casei and considering the genetic organization we assume that meta in these lab species could also encode a sat. our assumption could be clarified by studying growth of these bacteria in the presence and absence of various sulfur compounds. it has been reported that sat activity in various organisms is inhibited by cysteine (johnson, roderick and cook 2005). we did not observe this kind of feedback inhibition with the l. casei sat in vitro. the sats from other bacteria, such as e. coli, salmonella enterica, thermus thermophilus, paracoccus denitrificans and haemophilus influenza, have a km for serine of 0.11, 0.77, 0.013, 0.4 and 4.7 mm and for acetyl - coa of 0.56, 0.1, 0.011, 0.1 and 0.7 mm, respectively (kredich and tomkins 1966 ; burnell and whatley 1977 ; baecker and wedding 1980 ; kobayashi. 2004 the l. casei sat showed affinity for both substrates within the same order of magnitude (km of 1.1 mm for serine and 0.02 mm for acetyl - coa). according to johnson, roderick and cook (2005), this classification is based on the presence or absence of imperfect tandem repeats of a hexapeptide sequence. while meta from e. coli and a homoserine acetyltransferase from h. influenzae belong to the non - hexapeptide acyltransferases, sats generally possess this structural motif that can be found using interproscan (ipr001451). we searched for these hexapeptide sequences in the l. casei sat protein but did not detect this structural motif (data not shown). therefore, the l. casei sat is, to our knowledge, the first sat to be described as a non - hexapeptide acyltransferase. with the advent of next - generation sequencing, the amount of assembled and annotated genome data of microbes is rapidly accumulating. this study shows that functional confirmations are very valuable, especially when metabolic pathways that are predicted from genome data seem to be incomplete.	in bacteria, cysteine can be synthesized from serine by two steps involving an l - serine o - acetyltransferase (sat) and a cysteine synthase (cysk). while cysk is found in the publicly available annotated genome from lactobacillus casei atcc 334, a gene encoding sat (cyse) is missing. in this study, we found that various strains of l. casei grew in a chemically defined medium containing sulfide as the sole sulfur source, indicating the presence of a serine o - acetyltransferase. the gene lying upstream of cysk is predicted to encode a homoserine trans - succinylase (meta). to study the function of this gene, it was cloned from l. casei fam18110. the purified, recombinant protein did not acylate l - homoserine in vitro. instead, it catalyzed the formation of o - acetyl serine from l - serine and acetyl - coa. furthermore, the plasmid expressing the l. casei gene complemented an escherichia coli cyse mutant strain but not an e. coli meta mutant. this clearly demonstrated that the gene annotated as meta in fact encodes the sat function and should be annotated as cyse.
an extracellular electrode placed in the brain measures the mean extracellular field potential, comprised of the aggregate electrical activity generated by various neural processes in a cell ensemble around the electrode tip (figure 1a). for instance, the high frequency range (from 0.61 to 3 khz) of this signal has been estimated to carry a signature of the spiking activity of up to a few thousand cells located as far as 140300 m away (e.g. gray., 1995 ; henze., 2000 ; logothetis, 2003, 2008). it is referred to as multi - unit (mu) activity and can be seen as reflecting the output of a local neural population. (a) an extracellular electrode placed in the brain measures the mean extracellular field potential, an aggregate signal originating from the population of neurons in the vicinity of the electrode tip. to obtain multi - unit spiking activity, the recorded voltage trace is high - pass filtered and individual action potentials are detected (top). the local field potential (lfp) is comprised of the low frequency components of the extracellular field potential up to 200 hz (bottom). its frequency composition varies over time. in the example shown here, prominent oscillations in the frequency band between 30 and 90 hz called the gamma - band are visible during the later part of the trace. (b) in primary visual cortex of awake primates, oscillations in the gamma - band of the local field potential are dominant during visual stimulation, as illustrated in the example. the raw signal (black) has been filtered in the gamma frequency range to obtain the gamma lfp (grey). in contrast, low frequency voltage fluctuations (60 difference) indicate sites used for figure 3e. the inset shows the orientation tuning functions of two exemplar sites, with lfp (light grey) and mu (dark grey) tuning functions overlaid. in the site shown on the left, both preferred orientations are close to each other while in the site shown on the right they are nearly 90 apart. the ocularity index measures how strongly the activity at a site is modulated by the eye of stimulation. ocularity indices of the mu activity are significantly stronger than those of the lfp gamma - band, but they are correlated well. (e) histogram of orientation selectivity index computed separately for sites with close (dark grey) and far away (light grey) preferred orientations [sites as in (c) ]. arrows indicate the respective medians. on average, sites where the preferred orientation of the lfp gamma - band agrees well with that of the mu have higher orientation selectivity than the others. (f) average difference in gamma - power (25100 hz) between the spectrum during stimulus presentation and baseline (mean sem) as a function of the diameter of the grating (black line) or the grating annulus (grey line) that was used for stimulation. for gratings, the gamma - power increases as a function of stimulus diameter. in the case of annuli, this alone was not sufficient to elicit pronounced gamma - oscillations. for experimental details regarding this panel, panels (a e) in this figure were adapted from berens. (2008) and data for panel (f) was provided by gieselmann and thiele (2008). to further compare the feature selectivity of the two signals, we also mapped out orientation tuning curves of the average lfp power in the gamma - band and the corresponding mu spiking responses (figure 3c, insets). interestingly, at some sites the preferred orientations of both signals agreed well while at others they did not, and differences in preferred orientation were widely distributed (figure 3c). the overall correlation between preferred orientations obtained from the gamma - band of the lfp and the mu activity recorded simultaneously was surprisingly low (0.2 ; berens., 2008). ocular dominance columns are a second dominant organizational feature of primary visual cortex and typically cover slabs of about 500 m in diameter (blasdel, 1992a ; hubel and wiesel, 1968, 1977). by selectively presenting stimuli to one eye only, we showed that the correlation between the ocular preferences of the mu activity and those of the lfp gamma - power are much better correlated (figure 3d, 0.6 ; berens., 2008). why are the preferred orientations of mu activity and lfp gamma - band power only poorly correlated, while their ocular preferences are well correlated ? orientation tuning of spiking activity is organized at a very fine spatial scale in macaque v1, where orientation columns span about 50 m (hubel and wiesel, 1968, 1974, 1977). ocular dominance columns on the other hand extend over about an order of magnitude more (blasdel, 1992a ; hubel and wiesel, 1968, 1977). the fact that the preferred orientations of mu activity and the lfp gamma - band are not well correlated but ocular dominance properties are, suggests that the lfp gamma - band integrates signals over an area much larger than the size of orientation columns in v1. we therefore conjecture that the gamma - band of the lfp reflects signals integrated from an area spanning at least 500800 m in diameter. according to our reasoning, the difference in correlation between the two signals for orientation and ocularity tuning is due to the scale of spatial integration. a critical test of this hypothesis is that the preferred orientation of the lfp should be close to that of the mu activity when the local neighbourhood of the recording location is comparably homogenous in preferred orientations, such as in linear zones, and differing from it in nonhomogenous parts of the orientation map. while our data did not allow us to test this hypothesis directly, we conjectured that if our reasoning was valid, homogenous zones should be characterized by higher lfp orientation selectivity than nonhomogenous zones (nauhaus., indeed, we found that the orientation selectivity of sites at which the preferred orientations of mu activity and lfp gamma - band power were close was higher than the selectivity of sites at which preferred orientations differed significantly (figure 3e). in addition to differences in their orientation tuning, the gamma - band of the lfp and mu activity show different surround suppression characteristics (gieselmann and thiele, 2008). mu activity was typically maximal when the grating used for stimulation just covered its classical receptive field (crf), and decreased when it was enlarged further. the gamma - power of the lfp, however, increased with grating size beyond the crf (figure 3f, black line). the maximal oscillatory drive contributing to the lfp power occurred when stimuli covered approximately an area of 1 in diameter. converting this via the cortical magnification factor to cortical distance, gieselmann and thiele concluded that the gamma - band of the lfp integrates sources as far as 0.61.2 mm away from the electrode tip. interestingly, stimulation of the surround alone was not sufficient to evoke gamma - oscillations (figure 3f, grey line). feature selectivity can, however, also inform hypotheses regarding other aspects of the underlying mechanisms generating the lfp. first, when we analysed how the correlation between the preferred orientations of mu activity and lfp power changed as a function of frequency band, we found that it increased from its initial low values in the gamma - band to saturate over 150 hz at 0.8 (keep in mind, however, that less sites are tuned over all in these bands and mean selectivity is lower than in the gamma - band ; figure 3a), similar to findings from primary auditory cortex (kayser., 2007), area mt (liu and newsome, 2006) and somatosensory cortex (ray., 2008b). similarly, in a study using more naturalistic stimuli, such as movies, the high frequency regime at frequencies above 70 hz carried information about the stimulus which was very similar to mu activity, i.e. the two signals showed high signal correlations (belitski., 2008). at lower frequencies, like those found to be most tuned to orientation in our study, this correlation was substantially weaker. similarly, for the prediction of spike times from the lfp features in the high gamma - band above 60 hz are most useful (rasch., 2008). together, these findings point towards the hypothesis that the spatial extent of neural processes contributing to the lfp may be frequency dependent (see below). second, it is yet unclear how different cell types contribute to the gamma - band power. the latter is increased by enhancing the contrast of the stimulus (henrie and shapley, 2005). in particular, while many neurons show pronounced saturation in their firing rate at high contrasts, the gamma - power can still increase beyond this saturation point. in addition, as mentioned above, enlarged stimulus size can enhance gamma - power even beyond a point where mu activity is starting to be inhibited (figure 3f ; gieselmann and thiele, 2008). enlarging the stimulus beyond the crf of the spiking responses or enhancing stimulus contrast activates interneuron networks more strongly (angelucci., 2002), leading to the observed dissociations between spiking and lfp activity. these findings therefore hint towards an important role of inhibitory interneurons (see below). the lfp is commonly thought to originate from a weighted average over potential changes in the vicinity of the electrode tip, generated by current sinks and sources in extracellular space (as reviewed by goense and logothetis, 2008 ; logothetis, 2003, 2008). these are generated, for instance, when synchronous excitatory synaptic input activates the dendrites of a neuron, leading to a current sink at the dendrite and a source at the soma (figure 4a ; mitzdorf, 1985). the resulting dipole contributes to the measured lfp depending on the arrangement of the generating cell with respect to the local population. for example, pyramidal cells have large dendritic arbours facing in one direction opposing their somata and their dendrites are neatly aligned with each other (a so - called open field arrangement (johnston and wu, 1995 ; mitzdorf, 1985). therefore, dendritic processes on pyramidal cells in the cortex are thought to contribute strongly to the lfp, as potential differences from the local network do not cancel each other due to their geometrical arrangement (figure 4b). dipoles generated by the spiking activity itself are much faster, however, and therefore do not directly add to the lfp power. while it was originally thought that excitatory postsynaptic potentials form the most important source of lfp generating dipoles (mitzdorf, 1985, 1987), more recently also other sources such as inhibitory synaptic input (hasenstaub., 2005), subthreshold membrane oscillations (kamondi., 1998) and afterpotentials of somatodendritic action potentials (buzsaki, 2002) have been found to contribute significantly to the lfp. (a) illustration of a pyramidal cell, where the dendritic tree is shown schematically on the left, the cell body and axon on the right. a synaptic potential creates a current sink on the dendritic tree and a current - source at the soma. (b) pyramidal cells are aligned in a very stereotype fashion, with large dendritic arbours facing one direction and somata facing to the other. in this so - called open field arrangement, synchronized synaptic input creates strong dipoles, since currents flow from individual cells do not cancel each other. (c) illustration of the excitatory - inhibitory cortical network involved in the generation of gamma - oscillations. thalamic inputs activate populations of infragranular (inf) and supragranular and granular (sup) glutamergic cells, as well as gabaergic cells. inhibitory synapses are indicated by a square (symbol), excitatory synapses by a circle (symbol). adapted from logothetis (2008). the extracellular space acts like a volume conductor, which can, in principle, carry electrical signals over large distances and whose resistance depends on the geometry and layout of the neurons (johnston and wu, 1995 ; logothetis., 2007). the impedance of the cortical tissue has been found to be isotropic and independent of frequency (logothetis., 2007 ; ranck jr., 1963). while recent modelling work suggests that even in purely resistive extracellular medium frequency dependent attenuation can be caused by the dendritic morphology of the neurons (pettersen and einevoll, 2008), the specific shape of the lfp spectrum as shown in figure 2b likely also reflects underlying neural processes. oscillators contributing to the lfp at different frequencies are possibly generated by processes on varying scale and strength (buzsaki and draguhn, 2004 ; logothetis. low frequency oscillations, on the one hand, are thought to be formed by global neuromodulatory inputs (steriade, 2006) giving rise to strong slow oscillators. gamma - rhythms, on the other hand, most likely originate locally within cortical microcircuits consisting of pyramidal cells and interneurons (fries., 2007 ; logothetis, 2008). experimentally, this has been shown to be the source of the gamma - oscillations in the hippocampus of rats (csicsvari., 2003) where pyramidal cells and interneurons form networks with a distinct spatial layout much like in cortical tissue. similarly, we postulate that such circuits in cortex get activated by thalamic input, as surround stimulation alone was not sufficient to evoke gamma - oscillations (gieselmann and thiele, 2008). recurrent processing loops between pyramidal neurons of layer 4 and 2/3 and interneurons then generate the pronounced gamma - oscillations observed during visual stimulation (figure 4c). thus, while pyramidal neurons may be the strongest mediator of dipoles contributing to the lfp due to their size and geometry, interneurons play an important role in generating the dipoles underlying gamma - oscillations : they act as rhythm generators via rhythmic inhibition of pyramidal neurons and synchronized inhibitory synaptic potentials contribute significantly to the membrane oscillations on pyramidal neurons (bartos., 2007 ; fries., 2007 ; hasenstaub., 2005 this is in good agreement with the idea that enhanced gamma activity during high contrast or surround stimulation reflects increased interneuron drive (see above). for a more detailed discussion of interneuron networks and their role for cortical gamma - oscillations, mazzoni. (2008) used a model network consisting of sparsely connected pyramidal and interneurons and simulated the generation of the lfp from excitatory and inhibitory synaptic currents. interestingly, this simple model reproduced quantitatively accurate the dependence of lfp gamma - power on stimulus contrast as well as the dependence of information content in different lfp bands measured under naturalistic stimulation. how exactly these active network processes on different scales interact with passive low - pass filtering properties due to dendritic morphology (pettersen and einevoll, 2008) to form the signal measured as lfp is yet to be determined. if the gamma - band of the lfp originates in local cortical circuits as also revealed by reverse correlation with very localized stimuli (goense and logothetis, 2008), why is the spatial resolution apparently so much poorer compared to mu activity ? we postulate that this results from the interplay of two factors : first, strong oscillations especially like those present under visual stimulation can spread in the extracellular medium for considerable distances, as this acts as an isotropic frequency independent resistor (logothetis. note, however, that this effect becomes only noticeable when large stimuli that excite extended networks of neurons are used (see discussion of berens., 2008). second, the spatial extent of microcircuits oscillating in phase and thus the size of the oscillating dipole is determined by the spread of thalamic axon fields, the size of the dendritic arbours of cortical neurons and intracortical horizontal connections (angelucci., 2002 ; lund., 2003). this will lead to contributions to the lfp signal by tissue at considerable distance from the electrode tip, as for instance thalamic axons in upper layer 4 fan out to cover an area of up to 1.2 mm. in addition, the lfp also integrates subthreshold oscillations, which do not lead to spiking activity. in the cat visual cortex, these synaptic response fields have been shown to extent significantly beyond the region in which spiking activity was evoked (bringuier., 1999). while the above arguments provide a strong indication that the spatial resolution of the lfp gamma - band parallel to the cortical surface is on the scale of 6001000 m, specificity across different layers might be much higher. recent evidence from rodent somatosensory and prefrontal cortex, however, suggests that this is not the case (sirota., 2008). using multiple silicon probes, sirota. (2008) showed that gamma oscillators typically engage cortical circuits spanning several hundred micrometers. the spatial resolution of the lfp is not only determined by the electric properties of the neural tissue and the spatial extent of the biophysical processes contributing to the lfp, but is also affected by properties of the recording apparatus such as electrode type, material and impedance as well as the exposed area at the electrode tip or the position of the reference electrode. the specific processes contributing to the different parts of the gamma - band spectrum, however, are yet unknown. our study (berens., 2008) shows that the feature selectivity of mu activity and the gamma - band of the lfp can differ substantially, as in the case of orientation tuning. for other features, such as ocular dominance, since these two features are organized on spatial scales differing by approximately one order of magnitude, the spatial resolution of the lfp can likely explain this discrepancy. in good agreement with other studies (gieselmann and thiele, 2008), we estimate the spatial resolution of the gamma - band of the lfp parallel to the cortical surface to be 6001000 m. gamma - oscillations in the lfp most likely arise in cortical networks of pyramidal and interneurons, when activated by thalamic stimulation, and are mediated by synchronized synaptic potentials impinging on pyramidal neurons. results on the feature selectivity of the lfp (gieselmann and thiele, 2008 ; henrie and shapley, 2005) as well as direct measurement (hasenstaub., 2005) indicate an important contribution from interneurons as well. to precisely determine the aspects of neural mass action reflected in the gamma - band of the lfp will require an increased effort on many levels : important insight into the relevant subpopulation of neurons and receptors can be achieved through the adaptation of recently developed genetic tools that allow the selective manipulation of specific cell types and channels (aronoff and petersen, 2008). further, detailed reconstruction of neural circuits (briggman and denk, 2006) in combination with biophysical modelling (linden., 2008 ; mazzoni., 2008 ; pettersen and einevoll, 2008) might lead to a better understanding of which features of the anatomical layout are important for the generation and localization of lfp gamma - band oscillations. last, monitoring the activity on the dendrites and somata of many neurons in parallel using novel two - photon techniques might allow direct measurements of the voltage fluctuations recorded as the lfp (reddy., 2008). the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	extracellular voltage fluctuations (local field potentials, lfps) reflecting neural mass action are ubiquitous across species and brain regions. numerous studies have characterized the properties of lfp signals in the cortex to study sensory and motor computations as well as cognitive processes like attention, perception and memory. in addition, its extracranial counterpart the electroencephalogram is widely used in clinical applications. however, the link between lfp signals and the underlying activity of local populations of neurons remains largely elusive. here, we review recent work elucidating the relationship between spiking activity of local neural populations and lfp signals. we focus on oscillations in the gamma - band (3090 hz) of the lfp in the primary visual cortex (v1) of the macaque that dominate during visual stimulation. given that in area v1 much is known about the properties of single neurons and the cortical architecture, it provides an excellent opportunity to study the mechanisms underlying the generation of the lfp.
the production and application of engineered nanomaterials (enms) is exponentially increasing in various fields, and it has led to the concomitant rise in public concern of the potential toxicological impact and risks associated with these nanoparticles. nanomaterial - induced toxicity has been observed in human and other lives via mechanisms related to oxidative stress, inflammatory response, protein binding, ion influx disturbance, and dissolution and release of toxic ions. it is currently accepted that oxidative stress and inflammation are the major mechanisms of nanotoxicity. while most nanotoxicity assessment has been focusing on phenotypic endpoints - based cytotoxicity at relatively higher doses, chronic and lower concentration effects, such as their genotoxic potential on long - term environmental risk and human health have not been extensively investigated. genotoxicity is caused by agents interacting with dna and other cellular targets that control the integrity of the genetic materials, including induction of dna adducts, strand breaks, point mutations, and structural and numerical chromosomal changes. genotoxicity can not only initiate cancer development, but also has an impact on fertility and the health of subsequent generations, and contributes to the potential heritable changes in eco - systems after long - term accumulation. current genotoxicity assays are generally based on detection of induced damages, including ames test, chromosome aberration test, and comet assay in vitro, and chromosome aberration, mutation of endogenous genes, and rodent carcinogenicity bioassay in vivo. on the basis of these conventional tests, many enms have been reported to be genotoxic, including metal nanoparticles (e.g., nanosilver and gold nanoparticles), metal - oxide nanoparticles (e.g., nanotitanium dioxide), and carbon based enms (e.g., carbon black (cb), carbon nanotube (cnt), and fullerene). however, many inconsistencies have been reported among different nanogenotoxicity studies, which are likely related to differences in enms preparation, quantification, and characterization, and inherent limitations in the genotoxicity assays, such as assay - specific target and species - dependent results. most in vitro assays only detect one or limited types of damage, which may lead to false negative results, or can be overly sensitive. one uniquely challenging aspect of nanotoxicology is that it is highly property- and structure - dependent. the challenges in evaluating the large number of enms and their complex variations using resource - intensive and time - consuming in vivo assays motivate research in developing faster, more economical, and reliable genotoxicity assays. genetic biomarkers - based molecular assays have been demonstrated to be promising for rapid and sensitive high throughput screening (hts) evaluation of genotoxicants. particularly, toxicogenomics that monitor many biomarkers simultaneously have been proven to be rapid and sensitive for genotoxicity testing with mechanism identification and adverse health effects prediction. major challenges in application of these molecular assays are the needs to employ battery and/or tiered in vitro and in vivo genotoxicity assays in order to reliably detect all genotoxic effects and, to derive quantitative molecular endpoints that can be linked to meaningful in vivo phenotypic adverse effects. despite the degree of biological organizational level, cells respond to potential dna damage through a common architecture with a number of rather conserved specific response and repair pathways in an effort to repair the dna damage to restore homeostasis. on the basis of this understanding, we recently proposed and developed a quantitative toxicogenomics - based comprehensive genotoxicity assessment approach with dna damage and repair pathway ensemble - based cell arrays for multiple species including e. coli, yeast and human cells. furthermore, we proposed a quantitative molecular endpoints - peli that correlated well with conventional phenotypic genotoxicity endpoints, demonstrating that the proposed quantitative toxicogenomics - based genotoxicity assay can be a promising and alternative tool for mechanistic genotoxicity screening and evaluation in vitro (data not shown). in this study, we performed a comprehensive and comparative genotoxicity evaluation of a number of enms using the newly developed quantitative toxicogenomics - based genotoxicity testing approach as well as conventional genotoxic assay (alkaline comet assay), and across three different cell lines including e. coli, yeast and human cells. the tested enms included ntio2_a, carbon black (cb), single wall carbon nanotube (swcnt), and fullerene (c60). the study aimed to detect the potential genotoxic effect of these common - used enms for both eco - system and human health and, to reveal differences in their genotoxic mechanisms among organisms of different taxonomic order, as well as potential association with their physicochemical properties. four engineered nanomaterials (enms) : ntio2_a (sigma - aldrich), carbon black n110 (cb ; cabot corp.), short single wall cnts (swcnt ; cheap tubes inc.) and purified fullerene (c60 ; m.e.r. co.) were tested in this study (detailed information in si table s1). detailed physical and chemical characterization for these enms enms were prepared as 20 stock in pbs with 1% bsa (acros, nj, u.s.a.) as a dispersant, which is the currently common approach for bioassays. the stock solutions were cup - sonicated at 90 w for 15 min to maintain a better dispersion before tests, and were immediately diluted in the corresponding media (m9, sd or f12) for the following test. cytotoxicity of enms, mitomycin c (mmc, a model genotoxicant as a positive control) and bisphenol a (bpa, reported to be genotoxicity negative) were evaluated by growth inhibition in e. coli, yeast and by cell counting in a549 cells (human lung cancer cells) respectively, with details in si figure s1 and lc5 (concentration that has 95% cell survived) in si table s1. since the molecular assay intends to detect subtle and cellular level response to toxicants, three subcytotoxic doses (lc5) for enms, and six for mmc and bpa were applied for e. coli and yeast, one concentration was applied for human cells for pcr and comet test (si table s1 for details in dose concentrations). pbs with 1%bsa was used as the vehicle control. for library tests, blank wells with medium (with or without chemicals) were used as medium controls for data processing. extensive physicochemical and morphological characterization of enms was performed as previously published. in addition, aggregation sizes of enms in different media for various exposure times for this study were analyzed by dynamic light scattering (dls) analyzer (malvern zetasizer nano zs90) (si table s1). homologous genes specific in the dna repair pathways that are conserved across species were selected for e. coli, yeast, and human cells based on the current knowledge of dna damage and repair literatures as shown in table 1. a library of 20 transcriptional fusions of gfp (open biosystem, huntsville, al) that includes promoters controlling the expression of genes involved in dna damage and repair in e. coli k12, mg1655 (table 1) was employed in this study. a more detailed protocol description for gene expression analysis in the e. coli library is available in our previous study. briefly, e. coli strains selected were grown with m9 medium in clear bottom black 384-well plates (costar) for 46 h at 37 c to reach early exponential growth (od600 about 0.15 to 0.3). freshly prepared enm stock solutions or controls dissolved in pbs-1%bsa were added 10 l per well to obtain the final concentrations (si table s1). plates were then read in a micro plate reader (synergy ht multi - mode, biotech, winooski, vt) continuously for absorbance (od600 for cell growth) and gfp signal (filters with 485 nm excitation and 535 nm emission for gene expression) every 5 min for 2 h. all tests were performed in dark in triplicate. a library of 37 in - frame gfp fusion proteins involved in dna damage and repair of s.cerevisiae (invitrogen, no. 95702, atcc 201388) (table 1), constructed by oligonucleotide - directed homologous recombination to tag each open reading frame (orf) with aequorea victoria gfp (s65 t) in its chromosomal location at the 3 end, was employed as described in our previous publications. yeast strains selected were grown in clear bottom black 384-well plates (costar) with sd medium for 46 h at 30 c to reach early exponential growth (od600 about 0.2 to 0.4). enm stock solutions dissolved in pbs-1%bsa or control were added 10 l per well to obtain the final concentrations. the plates were then placed in a micro plate reader (synergy h1multi - mode, biotech, winooski, vt) for absorbance (od600 for cell growth) and gfp signal (filters with 485 nm excitation and 535 nm emission for protein expression) measurements every 5 min for 2 h after fast shake for 1 min. gene / protein expression profiling data in e. coli and yeast libraries were processed as described previously. for the e. coli library that monitors promoter activities, all data were corrected for various controls, including blank with medium control (with and without nm / chemical) and promoterless bacterial controls (with and without nm / chemical). the alteration in gene expression for a given gene at each time point due to nm / chemical exposure relative to the vehicle control condition without any nm / chemical exposure, also referred as induction factor i, was represented by i = pe / pc, where, pe = (gfp / od) experiment as the normalized gene expression gfp level in the experiments condition with nm / chemical exposure, and pc = (gfp / od) vehicle in the vehicle control condition without any nm / chemical exposure. for the yeast library, od and gfp raw data were corrected by background od and gfp signal of medium control (with or without nm / chemical). the protein expression p for each measurement was then normalized by cell number (odcorrected) as p = (gfpcorrected / odcorrected). the p level was corrected with vehicle internal control (housekeeping gene pgk1) for plate normalization. to quantify the chemical - induced gene / protein expression level changes of a treatment, transcriptional effect level index (teli) for e. coli and protein effect level index (peli) for yeast were proposed and derived as quantitative molecular endpoints (details described in the si, part 3). teli and peli quantify the accumulative altered gene or protein expression change over the exposure period for a given gene (teligene, peligene), pathway (telipathway, pelipathway), or for the overall dna damage and repair pathway ensemble library (teligeno, peligeno). for a given chemical, teligeno or peligeno based dose response patterns (si figure s2) were modeled using four parameter logistic (4pl) nonlinear regression model. genotoxicity positive or negative was determined based on the comparison of the maximal teligeno / peli geno value derived from the teli or peli - dose response curve with a threshold value, which was predetermined based on results with postive and negative genotoxic chemicals, as well as the standard deviation range of our testing systems (data not shown). 2 10/well of human lung epithelial a549 cells were seeded in 6-well plates (costar) for 24h in f12 medium with 10% fbs. enms, mmc or bpa prepared in f12 medium with 1% bsa were added in pbs - washed cells (2 ml in each well). cell samples were harvested at four time points after enms exposure (concentrations in si table s1) in the dark (0.5 h, 2 h, 4 h, or 24 h). rna was extracted by rneasy mini kit (qiagen, valencia, ca, u.s.a.) and reverse transcribed to cdna by iscript cdna synthesis kit (bio - rad, hercules, ca, u.s.a.). q - pcr was performed in duplicate using sybr green supermix on iq5 multicolor real - time pcr detection system (bio - rad). pcr primers targeting the six selected genes in table 1 were obtained from the database at ncbi with the housekeeping gene gapdh as internal control (primers listed in si table s2). fold change that reflects relative gene expression change due to treatment compared to vehicle control, also referred to as induction factor i, was determined by comparative ct method (2). similar to the e. coli library, the transcriptional effect in human cells was integrated into the transcriptional effect level index of genotoxicity (teligeno). the alkaline comet assay in human a549 cells upon exposure to enms or controls for 24 h was carried out according to the protocol of the itrc. dose concentrations were similar to those applied for molecular toxicity assay (si table s1). the slides were stained with ethidium bromide (2 g / ml) and checked by florescence microscope (olympus ix51, camera dp70). fifty cells of each treatment were measured by software casp randomly (university of wroclaw, institute of theoretical physics), and the damage was valued as % tail dna. genotoxicity positive was defined as the significant increase of tail dna % compared to vehicle control with p < 0.05. enms tested in this study were generally stable along the exposure period (2 h/24 h), but had different sizes in different media (see si table s1). for ntio2_a and cb, larger aggregation sizes were observed in sd media for the yeast assay, while smaller sizes were observed in m9 and f12 media for e. coli and human cells, respectively. the temporal altered gene / protein expression profiles provided a holistic view of the dna damage and repair pathways and, reflected dynamic responses of e. coli, yeast, and human cells exposed to enms over the exposure time at different dose concentrations. altered molecular (gene or protein) expression changes were quantified by induction factors as shown in figure 1 for one representative dose condition and in si figure s3 for all other doses. the dna - damaging chemical mmc (positive control, si figure s3) induced significant up - regulation of biomarkers in most of dna repair pathways in e. coli, yeast, and human cells, with time- and dose - dependent patterns. as expected, no significant up - regulation was observed in the three libraries for the negative control bisphenol a (si figure s3). the dna damage potential and mechanisms for different enms seemed to vary and were concentration- and species - dependent, as indicated by the distinct altered molecular expression profiles (figure 1 and si figure s3). ntio2_a (figure 1a) induced expression changes in biomarkers for all the three species. the three carbon based enms induced distinct dna damage repair pathways activation profiles, mainly in eukaryotes, suggesting structure - dependent genotoxicity. cb (figure 1b) seemed to exert more severe dna damaging potential than the other two carbon nanomaterials, namely swcnt (figure 1c) and c60 (figure 1d). temporal gene / protein expression profiles of biomarkers indicative of different dna damage repair pathways upon exposure to four nanomaterials (a : ntio2_a, 50 g / ml, b : carbon black (cb), 5 g / ml, 50 g / ml for human cells), c : single wall carbon nanotube (swcnt, 8 g / ml for e. coli, 10 g / ml / l for yeast and human cells) and d : purified fullerene (c60, 50 g / ml)) across three species. results for other dose concentrations are provided in the si (figure s3). the mean natural log of induction factor (ln i) indicates the magnitude of altered gene / protein expression (represented by a greenblackred color scale at bottom. x - axis bottom : for e. coli and yeast : testing time in minutes, the first data point shown is at 20 min after exposure due to data smoothing with moving average of every five data points ; for human cells : testing time in hours. y - axis left : clusters of genes / proteins by dna damage repair pathways. y - axis right for each species : list of genes or proteins (orfs) tested, with details in table 1. for yeast and e. coli, n = 3, for human cells, n = 2. for cb exposure, corrections are made to the gene expression analysis for the physical interference of cb on the fluorescence signal reading (details in si figure s4). quantitative toxicogenomics assay endpoints, namely teligeno, peligeno, for different dose concentrations were derived for each enm and they exhibited dose response curves for the four enms examined (si figure s2). the maximum values of teligeno for e. coli assay and peligeno for yeast assay, derived from dose response model fitting, were then compared to predetermined endpoint threshold for molecular genotoxicity assay as positive or negative (see description in methods and si). the molecualr genotoxicity assay endpoints from our assay were compared to those from conventional phenotypic genotoxicity assays, including alkaline comet assay in a549 cells (si figure s6) and other in vitro and in vivo assays from literature (table 2). endpoints comparison in table 2 suggested that our molecular assays were sensitive for detecting dna damage and for capturing the potential genotoxicity of the enms tested. the dna - damaging model chemical mmc was positive, while bpa was negative for all assays, as expected. ntio2 _ a and c60 were genotoxicity positive in all eukaryotic cell - based assays, as well as in vivo carcinogenesis test, and were negative in prokaryotic assays, suggesting likely species - specific dna damage mechanisms. varying results were reported for cb and swcnt among different in vitro genotoxicity assays. this is likely due to the varying and limited type of dna damages that can be detected by conventional methods. for example, ames test targets on frame shift or point mutations, comet assay detects strand breaks and, micronucleus assay detects chromosome damages. dna repair pathway biomarkers ensemble based assay proposed in this study seemed to be more accurate compared to these commonly used in vitro assays (assuming in vivo assay produces the most reliable endpoint). genotoxicity positive (+) was defined as maximum teligeno or peligeno value greater than 1.5 for e. coli and yeast assay, 4.113 for human cell assay based on positive and negative controls, as described in methods section. maximum teligeno and peligeno values were determined based on model fitting to dose response curves (details in si, table s1 and figure s2). information of ames and micronucleus assay in vitro and two - year carcinogenesis in vivo was collected from literature for mmc, bpa and the same nanomaterials. carcinogenesis data are based on two - year rodent study, except for swcnt, which is reported to be negative in short to medium - term (6 months or less) carcinogenesis study, because 2-year study is not available. for the first time, we explored and demonstrated a quantitative correlation of the molecular endpoints derived from the molecular assay with enm - induced dna damage (measured by alkaline comet assay in human cell as % tail dna), as shown in figure 2. the phenotypic genotoxicity endpoint based on 24 h comet assay in human cells correlated well with the molecular endpoint teligeno for human cell (rp = 0.8147, p = 0.0483), as well as for the endpoint peligeno in yeast cell (rp = 0.9073, p = 0.0125). the higher correlation coefficient values of eukaryotes than those of prokaryotic e. coli cells (rp = 0.6102, p = 0.1983) suggest that eukaryotic cells shared more similar responses than prokaryotic cells. note that yeast cell assay incorporated much more key biomarkers of dna damage repair pathways than the human cell assay and therefore captures more comprehensive dna damage information, which may explain the better correlation of comet assay results with yeast cells than with human cells. these results suggest that the applied toxicogenomics genotoxicity assay and proposed quantitative molecular endpoints are adequate for genotoxicity assessment across multiple species and, they can be potentially linked to phenotypic effects quantitatively. correlation of teligeno and peligeno in e. coli, yeast (a) and human cells (b) with dna damage induced (measured by % tail dna compared to vehicle control tested by alkaline comet test) in a human a549 cell line for selected concentrations shown in si table s1. the black dashed line indicates the cutoff line (1.5) for e. coli and yeast cells, and the green dashed line indicates the cutoff line for human cells (4.113 based on teligeno of mmc for human cell). x - axis bottom : 24-h dna damage measured by % tail dna compared to vehicle control in human a549 cells (details in si figure s5) ; y - axis : teli / peligeno in e. coli, human cells, or yeast array. rp indicated pearson correlation coefficient of endpoints from three cell arrays to dna damage comet assay phenotypic endpoints (% tail dna). mean sd. for e. coli, yeast, and comet assay, n = 3, for human cells, n = 2. to gain further insights into the detailed dna damage repair pathway activities induced by the tested enms, the magnitude of expression changes in each pathway was quantified by teli pathway or peli pathway (see si, part 3) and compared among enms at multiple concentrations (figure 3). the model genotoxicant mmc induced severe dna damage, as indicated by the sos response activation in e. coli and strong pathway activation for double strand break and base damage repair in all three species. in addition, it seemed to cause a potential dna cross - link, as suggested by the nucleotide excision repair biomarkers in yeast and human cells. these dna damage responses induced by mmc were consistent with its known high alkylation reactivity to produce base alkylation and cross - link to dna. meanwhile, negative control bpa only induced a weak activation of direct reversal repair in e. coli and, no pathway activation in yeast but oxidative damage repair (indicated by ogg1 up - regulation) in human cells, which was consistent with previous report that bpa induced oxidative stress in mammals. dna damage repair pathway responses profiles reveal distinct potential dna damage mechanisms among different enms. the mean natural log value of telipathway or pelipathway indicates the magnitude of pathway responses (represented by a black red color scale at bottom. mmc : mitomycin c ; cb : carbon black ; swcnt : single wall carbon nanotube ; c60 : purified fullerene ; bpa : bisphenol a. x - axis top : pathways of dna damage repair (see table 1 for details). y - axis left : chemical / enm and concentration(s) from lowest to highest from top to bottom (see concentrations in si table s1). ntio2_a induced wide range of pathway activation suggesting strong dna damage potential consistently among all three species. in e. coli, ntio2_a led to activation of sos system indicating severe dna damage. in yeast and human cells, a wide range of repair pathway activation, including severe double strand break repair, was observed and the up - regulation of ogg1 specific for oxidative damage repair (imax = 3.4673 for yeast, imax = 1.9740 for human cells). ogg1 up - regulation in both yeast and human cells suggested that oxidative damage might play an important role in dna damage of ntio2_a, which was agreeable with the current understanding that oxidative damage through reactive oxygen species (ros) production is its main toxicity mechanism. note that in this study, the ros production from photocatalytic reaction was not expected to be significant under our test conditions because all bioassays were performed in the dark and the wavelength of excitation used for od and fluorescence reading (600 and 485 nm) was out of the active photoactive range for ntio2_a (385 nm). several reports were supportive of nonphoto - induced ros generation by unknown mechanism(s). in addition, the dissolution of titanium ions at neutral ph within 2 h was considered to be negligible for nano tio2, and the dissolved ion was reported to exhibit no damage to the cellular dna. three carbon - based enms showed structure - dependent and discernible dna damage response profiles. carbon black (cb) seemed to lead to little response in e. coli, likely due to the uptake limit in prokaryotic cells. in contrast, a wide range of dna repair pathway activities, including nucleotide excision repair and double strand break repair, were observed in yeast and human cells, suggesting potential damage induced by cb exposure. the up - regulation of ogg1 in yeast (imax = 3.3050) suggested that oxidative damage may contribute to the genotoxicity of cb. however, no ogg1 up - regulation was observed in human cells, suggesting that some mechanisms other than oxidative stress may contribute to the severe dna damage of cb in human cells, which needs further investigation. swcnt exposure did not lead to any dna repair pathway activation in e. coli, but seemed to induce strong double strand dna damage in eukaryotes. in contrast to cb, oxidative damage may not be the main mechanism since ogg1 up - regulation was not observed in either yeast or human cells. dna double strand break in eukaryotes may be a result of membrane damage induced apoptosis / necrosis with dna cleavage, which has been reported to be a main target for cnts. although membrane damage of swcnts has also been observed in e. coli, it may not lead to dna damage since e. coli lacks membrane related cell death process. for c60 exposure, specific double strand break response was observed in human cells, but multiple dna damage pathway activities were detected in yeast. oxidative damage may not be the main mechanism either, as ogg1 up - regulation was not observed in either yeast or human cells. another specific repair pathway activation, nhej (nonhomologous end - joining) was observed in both yeast and human cells, which repairs dna double strand break by direct ligation, suggesting some distinguishable mechanism involved in c60 induced dna damage, such as direct cleavage on both strands. c60 has been reported as an electron - poor photosensitizer, which can induce dna photocleavage selectively for g base by visible light. the direct cleavage may break strands with little dna loss, which can be repaired by direct ligation of nhej pathway. as previously mentioned, although the bioassays were conducted in the dark, intermittent excitation during fluorescence reading at 485 nm can potentially irritate the photocleavage of c60, which has a moderate energy gap of about 1.8 ev (690 nm). this study performed a comprehensive and comparative genotoxicity assessment for four commonly - used enms across multiple species using both conventional phenotypic and newly proposed quantitative toxicogenomics approaches. the results demonstrated that the toxicogenomics assay based on conserved dna damage repair pathways across three species could detect various dna damages induced by enms. and, for the first time, the molecular endpoints were quantitatively correlated to phenotypic endpoints and generally consistent with those based on conventional in vitro and in vivo genotoxicity assays, suggesting that the toxicogenomics - based assays can be promising for potential genotoxicity assessment of enms. compared to current genotoxicity assay which takes several days (e.g., over two days for ames test) or even years (two years for in vivo carcinogenesis test), our assay is faster (2 h. for e. coli and yeast, 24 h. for human cells), more sensitive (at subcytotoxic doses), more comprehensive (capture all dna damage types instead of single or a few biomarkers or specific targets as in other assays), and more cost - effective (the gfp - fused whole cell libraries can be easily grown with less complex protocol). in addition, the molecular profiles can provide mechanistic information regarding specific dna damage type and repair pathways. the comparative study of the selected enms provided more insights for a better understanding of their genotoxic mechanisms, which was poorly understood previously. oxidative damage has been considered the main effect of enms leading to the genotoxicity for ntio2_a, cb, fullerene, and swcnt. in this study, oxidative damage was confirmed to play an important role in dna damage for ntio2_a and cb, which is consistent with previous studies. however, our results indicated that the other two carbon enms (swcnt and c60) might induce dna double strand break in eukaryotes through some other mechanisms, implying more structure - and / or property - dependent genotoxicity. although they both lead to dna double strand break in eukaryotes, the differences in the activation of pathway - specific genes, for example, rad51 (for homologous recombination) and ku70 (for nonhomologous end - joining by direct ligation) in human cells revealed different mechanisms of dsb repair. the results demonstrated the specificity and sensitivity of the gene / protein expression methods for detecting and differentiating dna damage and related mechanisms, such as among those carbon - based yet structurally distinct enms. the distinct genotoxic responses between prokaryotic and eukaryotic species revealed in this study were likely related to the different capability and mechanisms of the enms (particularly carbon based enms) uptake among species. for mammalian cells, nanoparticle uptake has been reported to occur through eukaryote - specific processes such as phagocytosis and endocytosis. endocytosis in yeast also makes it possible for enm uptake ; some unclear mechanism in yeast seems to be employed to internalize nanomaterials too. however, the rigid cell wall of bacteria may avoid the direct uptake process. moreover, bacteria lack the ability to perform endocytosis, which may make them more resistant to enms. adhesion of enms to eukaryotic cells may also contribute to a series of membrane damage - related cell death processes, including the dna damage response. as programed cell death is limited in bacteria, this adhesion effect may contribute little to the nanogenotoxicity of e. coli. in conclusion, this study revealed various genotoxicity of the four commonly used enms by real - time gene / protein expression profiling, which seemed to be both species and enm - property - dependent. the differences in cellular structure and defense systems among prokaryotic and eukaryotic species lead to distinct susceptibility and mechanisms for enms uptake and, thus varying dna damages and repair responses. the observation suggested that eukaryotes, especially mammalian cells, are likely more susceptible to genotoxicity than prokaryotes in eco - system when exposed to these enms.	this study reports a comparative and mechanistic genotoxicity assessment of four engineered nanomaterials (enms) across three species, including e. coli, yeast, and human cells, with the aim to reveal the distinct potential genotoxicity mechanisms among the different nanomaterials and their association with physiochemical features. both the conventional phenotypic alkaline comet test and the newly developed quantitative toxicogenomics assay, that detects and quantifies molecular level changes in the regulation of six dna damage repair pathways, were employed. the proposed molecular endpoints derived from the toxicogenomics assays, namely teli (transcriptional effect level index) and peli (protein effect level index), correlated well with the phenotypic dna damage endpoints from comet tests, suggesting that the molecular genotoxicity assay is suitable for genotoxicity detection. temporal altered gene or protein expression profiles revealed various potential dna damage types and relevant genotoxic mechanisms induced by the tested enms. ntio2_a induced a wide spectrum of dna damage consistently across three species. three carbon - based enms, namely carbon black, single wall carbon nanotube (swcnt) and fullerene, exhibited distinct, species and enm property - dependent dna damage mechanisms. all carbon based enms induced relatively weak dna damage repair response in e. coli, but more severe dna double strand break in eukaryotes. the differences in cellular structure and defense systems among prokaryotic and eukaryotic species lead to distinct susceptibility and mechanisms for enm uptake and, thus, varying dna damages and repair responses. the observation suggested that eukaryotes, especially mammalian cells, are likely more susceptible to genotoxicity than prokaryotes in the ecosystem when exposed to these enms.
primary mediastinal large b - cell lymphoma (pmbcl) is a distinct subtype of lymphoma according to the who classification. it usually presents as bulky tumor in the anterior mediastinum giving rise to local compressive effects. pleural and pericardial effusions are common. extra thoracic involvement including bone marrow involvement at the time of initial diagnosis is rare. international prognostic index (ipi) scoring is not very useful in determining prognosis for these patients due to their young age and early stage of presentation. various prognostic factors like elevated lactate dehydrogenase (ldh), age, performance status, male sex and stage have however been described in different studies. r - chop (rituximab - chop) followed by involved field radiotherapy has been the standard treatment in most series. high dose chemotherapy (hdct) and autologous bone marrow transplant in first remission as consolidation has been tried in view of the young age of patients. for patients with residual mediastinal disease at the end of treatment, positron emission tomography (pet) scan has become the investigation of choice, with majority of relapses occurring in those with positive pet scan. we evaluated clinical characteristics, prognostic factors and survival in 28 consecutive arab patients treated with r - chop between 2006 and 2011. diagnostic workup included patient history, performance status according to eastern cooperative oncology group scale, physical examination, complete blood counts, blood biochemistries, ct scan of chest, abdomen and pelvis and bone marrow studies. diagnosis was established by either image - guided core biopsy or by mediastinoscopy and biopsy. pet scan was done at the baseline and the end of treatment for all patients from 2009 onwards. g / l, low albumin as less than 35 g / l and high ldh as more than 245 u / l. complete response (cr) was defined as disappearance of all clinical evidence of disease with all lesions becoming fdg (fludeoxyglucose) non - avid on pet scan. if patient satisfies criteria for partial response (pr) by ct scan, but remains pet positive, it was taken as pr and patients advised re - biopsy whenever feasible. overall survival (os) was measured from the date of diagnosis until death or date of final follow up for survivors. event - free survival (efs) was calculated from date of diagnosis to relapse or death. prognostic value of different variables for os and efs was determined by multivariate analysis using the cox regression model. there were 19 males and 9 females in the study. a majority of the patients presented with chest pain, cough or dyspnea. eight patients (28%) had b symptoms at presentation, while only 10% of the patients had bone marrow involvement. baseline characteristics of the 28 patients with pmbcl size of mediastinal mass at presentation all patients were treated with r - chop chemotherapy. prior to the use of pet scan for response evaluation, all patients with cr or pr by ct scan were treated with involved field radiotherapy. after the advent of pet scan, radiotherapy was used to treat patients who had achieved cr. there were four patients who remained pet positive after six cycles of chemotherapy and they were offered salvage chemotherapy with eshap regimen followed by beam auto transplant. three of the total 28 patients (10.7%) died in a median follow up of 40 months. the mean survival period was 69 months for the entire group with a 5-year overall survival of 85% [figure 2 ]. we could not identify any prognostic factors for survival like sex, ecog status or biochemical parameters. bone marrow involvement at presentation was the only factor identified to predict response with a p value of 0.045. overall survival (os) for the entire group pfs for the entire group pet scan was done in 20 patients, both for initial staging and for disease re - evaluation. four patients were deemed to be in pr by pet scan and received salvage chemotherapy followed by autologous stem cell transplant. one patient in each group relapsed but is still alive at the end of follow up. there were eight patients who did not have pet scan for evaluation and received consolidation radiotherapy. four of these eight patients relapsed including three who died of progressive lymphoma [figure 4 ]. the log rank test for pfs (p = 0.039) and os (p = 0.013) were significant when compared among patients who had pet scan to those without pet scan for response evaluation. pet scan was done in 20 patients, both for initial staging and for disease re - evaluation. four patients were deemed to be in pr by pet scan and received salvage chemotherapy followed by autologous stem cell transplant. one patient in each group relapsed but is still alive at the end of follow up. there were eight patients who did not have pet scan for evaluation and received consolidation radiotherapy. four of these eight patients relapsed including three who died of progressive lymphoma [figure 4 ]. the log rank test for pfs (p = 0.039) and os (p = 0.013) were significant when compared among patients who had pet scan to those without pet scan for response evaluation. primary mediastinal large b - cell lymphoma is a distinct clinico - pathological entity under the who classification of lymphoid malignancies. tumor extension is local leading to effusions and superior vena cava syndrome (svco). the median age of our patients was 31 years [range 16 - 58 years ]. bone marrow involvement was unusual and seen in only 10% of the patients, while 40% had features of svco. pmbcl arises from thymic b cells and can be differentiated from other diffuse large b - cell lymphomas by gene profiling. an important differential diagnosis would be nodular sclerosis classical hodgkin 's lymphoma as it also occurs in young patients and usually presents as bulky mediastinal disease. most of our patients needed a biopsy from the mediastinum either by ct - guided core biopsy or by mediastinoscopy. patients presenting with svco, thrombosis or effusions needed stabilization before undergoing these diagnostic tests. ipi risk scoring is of limited value as a majority of patients tend to have low scores due to young age and low stage. we could not identify any negative predictors for survival like sex, ecog status or biochemical parameters. bone marrow involvement at presentation was able to identify patients for relapse (p = 0.045) on multivariate analysis. multiagent chemotherapy with r - chop followed by involved field radiotherapy is usually the treatment of choice. hdct and autologous bone marrow transplantation as consolidation has been tried in first remission in view of young age of patients and relative absence of marrow involvement. a residual mediastinal mass fdg - pet is usually used to assess these lesions and a negative pet scan has more clinical significance. in many patients with partial response as defined by pet has been shown to be salvaged by hdct. our study includes four patients who had salvage chemotherapy followed by autologous marrow transplant in view of positive pet scan at the end of treatment. various questions still need to be answered in the management of pmbcl like the role of pet scan and consolidation therapy. being a rare disease, it is essential that multinational trials are designed to answer these questions. pmbcl is a discrete clinico - pathological entity clearly distinct from other b - cell lymphomas on gene profiling. the role of pet scan needs prospective evaluation as it may offer valuable prognostic information. it is imperative to cure at the first instance as salvage therapy for progression or relapsed disease is disappointing.	objective : pmbcl is a distinct type of nonhodgkins lymphoma with specific clinicopathological features. to clarify clinical features, treatment alternatives and outcomes, we evaluated 28 arab patients treated with chemotherapy or radiotherapy between 2006 and 2011.patients and methods : pmbcl lymphoma patients identified according to who classification and treated at kccc between 2006 and 2011 were included in this study. demographic and clinical data are presented as means or medians. overall survival was estimated using the kaplan - meier method. survival rates were compared using the log - rank test. a p < 0.05 was considered significant.results:the median age of the patients was 31 years and the male to female ratio was 2:1. majority of the patients (75%) presented with stage i / ii disease. most had features of local extension like pleural effusion (18%) and svco (39%). only 11% of the patients had bone marrow involvement at presentation. 96% of the patients required biopsy from the mediastinal mass either by image guided core biopsy (75%) or by surgical biopsy. most patients were treated by rchop and involved field radiotherapy. patients with positive pet scan after rchop chemotherapy received salvage chemotherapy and beam autologous marrow transplant. the five year os for the entire group was 85% while the pfs was 73%. patients who had pet scan for response evaluation had better os [p = 0.013 ] and pfs [p = 0.039 ] when compared with those patients who received only radiotherapy based on ct scan evaluation.conclusion:pmbcl is a specific lymphoma entity seen in the young with good survival. the role of pet scan for response evaluation and the type of consolidation therapy needs to be further clarified
gender estimation of the bone is a very important part of a study in the field of anthropology and forensic sciences as further interpretations and analysis are based on it. normally, morphological and metric analyses are used to determine the sex of the bone. the sex of an unknown individual can be determined based on the data from the morphology and metric features of the skull and the mandible, soft tissues, dental records as well as by dna analysis of teeth. as evident from the earlier studies, the skull is the most dimorphic and easily sexed portion of the skeleton after the pelvis, providing an accuracy of up to 92%. but in cases where an intact skull is not found, the mandible may play a vital role in gender estimation as it is the most dimorphic, largest, and strongest bone of the skull. the presence of a dense layer of compact bone makes it very durable and hence, it remains well - preserved than many other bones. it is the hardest facial bone and retains its shape better than other bones in the forensic and physical anthropologic fields. dimorphism in the mandible is reflected in its shape and size ; male bones are generally bigger and more robust than female bones. three basic criteria should guide the choice of skeletal elements that may be useful indicators of sex. second, they should be able to withstand the rigors of skeletonization and fossilization and finally the trait should be recognizable through time and across paleospecies. morphological changes of the mandible are thought to be influenced by the occlusal status and age of the subject. the shape of the mandibular base, especially the gonial angle, correlates with the function and shape of the muscles of mastication. with age, the masticatory muscles change in function and structure, as seen in decreased contractile activity and lower muscle density. hence, this paper aims to evaluate the usefulness of various mandibular parameters for gender estimation. to measure, compare, and evaluate the various measurements of the mandibular ramus as observed in digital orthopantomographsto assess the usefulness of the mandibular ramus as an aid in gender estimation. to measure, compare, and evaluate the various measurements of the mandibular ramus as observed in digital orthopantomographs to assess the usefulness of the mandibular ramus as an aid in gender estimation to measure, compare, and evaluate the various measurements of the mandibular ramus as observed in digital orthopantomographsto assess the usefulness of the mandibular ramus as an aid in gender estimation. to measure, compare, and evaluate the various measurements of the mandibular ramus as observed in digital orthopantomographs to assess the usefulness of the mandibular ramus as an aid in gender estimation. the sample size was calculated and validated as follows : proportional power calculation was used to determine the sample size and according to the analysis, a minimum of 36 subjects was needed to detect a sensitivity of 2 mm between two radiographs when the power of the test was 0.80 at a significance level of 0.05. a retrospective study was conducted using 80 digital orthopantomographs of visakhapatnam 's population in the age group of 2050 years. digital radiographs were taken by planmeca promax digital machine helsinki, finland (66kvp, 9ma,16s). the study was conducted on the radiographs stored in the system ; however, consent to use theses radiographs was obtained from the patients for our study. mandibular ramus measurements were performed using planmeca romexis software 2.81 r version helsinki, finland. the exclusion criteria were pathological fractures, developmental disturbances of the mandible, and deformed and edentulous mandible. the following parameters were measured using mouse - driven method by two individuals ; one of them being the faculty and they were recorded, tabulated, and sent for statistical analysis to eliminate the intraobserver errors [figure 1 ]. the investigators demonstrated good intrarater percentage of agreement and kappa statistics, which were 93% and 0.81, respectively. shows various mandibular parameters that were included in the study maximum ramus breadth : largest anterior - posterior diameter of the ramusaminimum ramus width : smallest anterior - posterior diameter of the ramusbmaximum condylar height : from the most superior point on the mandibular condyle to the most inferior point of the mandiblecmaximum height of the ramus : the point of line of intersection from the highest projection point of the condyle to the lower margin of the bonedmaximum coronoid height : projective distance between coronoid and the most inferior point of the boneegonial angle : a line traced tangential to the most inferior points at the gonial angle and the lower border of the mandibular body and another line tangential to the posterior borders of the ramus and the condyle. the intersection of these lines formed the gonial anglefbigonial width : it is the distance between two gonia. maximum ramus breadth : largest anterior - posterior diameter of the ramusa minimum ramus width : smallest anterior - posterior diameter of the ramusb maximum condylar height : from the most superior point on the mandibular condyle to the most inferior point of the mandiblec maximum height of the ramus : the point of line of intersection from the highest projection point of the condyle to the lower margin of the boned maximum coronoid height : projective distance between coronoid and the most inferior point of the bonee gonial angle : a line traced tangential to the most inferior points at the gonial angle and the lower border of the mandibular body and another line tangential to the posterior borders of the ramus and the condyle. the intersection of these lines formed the gonial anglef bigonial width : it is the distance between two gonia. descriptive statistics of various mandibular ramus measurements and associated f ratios for both sexes are shown in tables 1 and 2. it shows the various means of all the variables / parameters, i.e., maximum ramus width, minimum ramus width, maximum ramus height, projection height of ramus, coronoid height, and bigonial angle and bigonial width of both the male and female populations with their significant value. the mean value of maximum ramus width in males was 31.0275 with a standard deviation of 3.54567 ; in females, it was 30.5625 and their standard deviation was 2.92309, which was insignificant (p = 0.524). the mean value of minimum ramus width in males and females was 29.4225 and 29.5525, respectively, with standard deviations of 3.146 and 2.83241, respectively. the maximum height of the ramus mean was determined as 66.9475 with a standard deviation of 4.556 in males and 60.5075 with a standard deviation of 4.09561 in females, which was significant (p = 0.00). the mean value of projection height of the ramus in males and females was 66.1950 and 60.08, respectively, and their standard deviations were 4.75779 and 4.30068, respectively, which was significant (p = 0.00). the various means of all the variables / parameters of both and females with their respective standard deviations, along with their significance values linear discriminant function for males and females in the study group included the parameter coronoid height mean value was 55.98 in males and 51.32 in females and the standard deviations in males and females were 6.5411 and 4.66, respectively, which was found to be significant (p = 0.00). the mean value of bigonial angle in males was 172.9455 with a standard deviation of 31.89837 and the mean value in females was 152.7142 with a standard deviation of 14.69607 with a significance of (p = 0.00). the mean value of bigonial width in males was 182.1325 and in females it was 177.9600 and the standard deviations in males and females were 11.61159 and 9.57721 respectively, which was found to be insignificant (p = 0.083). we have noticed that four variables were significant predictors in classifying a given sample (p maximum condylar height > coronoid height > bigonial angle. the mandibular ramus can be considered as a valuable tool in gender estimation since it possesses resistance to damage and disintegration processes. given methodology used and the significant results obtained, it can be concluded that mandibular ramus measurements using orthopantomographs can be used as a reliable parameter for gender estimation. in view of these findings, further studies on more diverse populations to assess the significance of these parameters are recommended.	background and aims : gender estimation is a very important part of a study in the field of anthropology and forensic sciences. in the skeleton, gender estimation is the first step of the identification process as subsequent methods for age and stature estimation are sex - dependent. skeletal components such as the pelvis and skull are investigated for gender estimation and the mandible is a practical element to analyze sexual dimorphism in fragmented bones. the aim of the present study is to measure, compare, and evaluate various measurements of the mandibular ramus, observed in digital orthopantomographs and also to assess the usefulness of the mandibular ramus as an aid in gender estimation.materials and methods : a radiographic retrospective study was conducted using 80 digital orthopantomographs to measure, compare, and evaluate the measurements of the mandibular ramus such as maximum ramus breadth, maximum ramus height, and coronoid heightusing planmeca promax digital machine to assess the usefulness of mandibular measurements in gender estimation.results:descriptive statistics of various measurements and associated univariate f ratios for both the sexes were determined. four variables were significant predictor in classifying a given sample (p < 0.001). the f - statistic values indicated that measurements expressing the greatest sexual dimorphism were noticed in the maximum ramus height.conclusion:mandibular ramus can be considered as a valuable tool in gender estimation and the most reliable measurements were obtained of linear objects in the horizontal plane by digital panoramic imaging.
polycystic ovary syndrome (pcos) is the most common endocrine disorder in women, with a prevalence of up to 15% (9, 16). although the pathophysiological mechanisms have yet to be totally clarified, the presence of multifactorial events related to genetic factors, body composition, and endocrine - metabolic disorders (especially high levels of androgen) have been observed (7, 9, 16, 19, 41). these alterations appear to promote insulin resistance and hyperinsulinemia by modifying the mechanisms involved in the regulation of the responses of the insulin receptors, and consequently, in glucose absorption (29, 30). in contrast, insulin resistance seems to amplify theca steroidogenesis, an intrinsic abnormality, by stimulating the increase of androgen synthesis (7, 41). additionally, the literature has shown that the excess of androgens present in women with pcos is a contributing factor in the development of a number of disorders, including some cardiovascular diseases such as atherosclerosis and hypertension (4, 16). moreover, increased insulin resistance can lead to the development of type 2 diabetes, general and abdominal obesity, and cardiac autonomic control damage, which may further worsen the prognosis (4, 9, 22, 34, 35, 36, 41). therefore, studies on new therapeutic strategies should be conducted to reduce risks in women exposed to these conditions. the use of a structured aerobic physical exercise program has resulted in a global improvement in cardiovascular and metabolic parameters including insulin sensitivity, hormonal profile and cardiac autonomic balance. however, some studies with other populations have shown that strength training can provide health - related benefits such as the reduction of body fat and a decrease in the risks of hypertension and diabetes (33, 40, 44). in this case, strength training seems to improve the insulin action / sensitivity in the muscles of individuals with diabetes and overweight patients as well as in healthy persons (2,18). this type of training can also promote different adaptations in hormonal profiles, including those of the androgenic hormones (42, 43). these findings are important because the reduction of insulin sensitivity and chronic hyperglycemia may have negative effects on cardiac autonomic control, especially in terms of heart rate variability (hrv), by increasing the influence of the sympathetic component and reducing the influence of the parasympathetic component in the heart. therefore, this autonomic imbalance may serve as a pathway for the development and aggravation of cardiovascular diseases (3, 30, 37). interestingly, it was suggested that the increase of sympathetic cardiac autonomic modulation could be related to high levels of testosterone (8), which further emphasizes the importance of evaluating the effects of strength training in women with pcos. although the health benefits of strength training have been well recognized, scientific evidence is still scarce, especially in women with pcos. therefore, in the present study was investigated the effects of periodized strength training on cardiac autonomic parameters and its correlation with metabolic and endocrine parameters in women with pcos. a convenience sample of 53 participants were recruited and divided into two groups : control group (cg ; n= 26) and group with the polycystic ovary syndrome (pcos group ; n= 27). the participants were aged between 18 and 37 years, had a body mass index (bmi) between 18.0 and 39.9 kg / m, and were not involved in any regular (two or more times a week) or instructed physical exercises at the time of the study. for the cg, the range of the regular menstrual cycle interval was estimated to be 2235 days, with a duration of 37 days (11). pcos was diagnosed based on the criteria established by the rotterdam consensus (16), and the presence of at least two of the following criteria : menstrual irregularity (cycle length > 35 days or variation between consecutive cycles of > 10 days) ; presence of hirsutism evaluated by a ferriman - gallwey score > 8, severe acne and alopecia ; hyperandrogenism (total testosterone concentration > 80 ng / dl) ; or ultrasound evidence of polycystic ovaries. all volunteers with pcos selected for the study had polycystic ovaries ; 70.4% presented with biochemical hyperandrogenism, 66.7% had clinical hyperandrogenism, and 88.9% had irregular menstrual cycles. the following items were used as exclusion criteria : presence of systemic diseases and musculoskeletal disorders that prevented the women from practicing physical exercises ; presence of congenital adrenal hyperplasia, androgen - secreting neoplasms, cushing s syndrome, tabagism, and pregnancy ; and use of hormonal contraceptives or drugs that interfere with the hypothalamic - pituitary axis or cardiac autonomic modulation. this study was conducted in accordance with the ethical standards set forth in the helsinki declaration of 1975 and approved by the human research ethics committee of the clinical hospital of the school of medicine of ribeiro preto, university of so paulo, brazil (case hcrp n. 13475/2009). the evaluations were performed before and after the physical training period and all volunteers provided their free and informed consent. the strength training program lasted for 4 months, which was divided into mesocycles of 4 weeks each. the calculation of one repetition maximum (1rm) was performed for each volunteer (32) and linear periodization was used to gradually decrease the volume and increase the intensity during the training. the exercises included : 1) bench press, 2) leg extension, 3) front lat pull down, 4) leg curl, 5) lateral raise, 6) leg press (45), 5) triceps pulley, 6) calf leg press, 7) arm curl, and 8) abdominal. the training load started with 70% of 1rm, and each exercise was repeated for 12 repetitions. in the first 3 weeks of each mesocycle, the exercises were performed three times / week and the intensity was increased by 5% per week. in the fourth week, these exercises were performed twice / week and the intensity were reduced by 5% (1). blood samples were collected during the follicular phase, and at any time in those with amenorrhea. the tests were performed in the gynecology laboratory of the hc - fmrp, between 07:00 and 09:00 am, after a 12-h fast. blood (15ml) was collected into conical plastic tubes (bd - becton dickinson, plymouth, uk). the blood samples for the analysis of fasting insulin were stored in vacuum tubes, with a separating gel barrier. the blood samples for the other tests, except those for the analysis of fasting glucose, were stored under vacuum in tubes containing edta fasting blood glucose levels was analyzed immediately after collection. blood was then centrifuged at 2500 rpm in a ct 5000 centrifuge (cientec laboratory equipments, so paulo, brazil) at room temperature (2024c) for 10 min and transferred to sealed plastic tubes (eppendorf tubes). the elisa method was used for the analysis of sex hormone binding globulin (shbg). 17-hydroxyprogesterone, testosterone, and androstenedione were measured by means of radioimmunoassay. to detect insulin resistance (> 2.71 nmol u / l), the following equation was used : homa - ir (homeostatic model assessment - insulin resistance) = [(fasting glucose in mg / dl 0.05551) (fasting insulin in u / ml/22.5) ] (13, 24). the free androgen index (fai) was calculated by using the equation [tt (nmol / l)/shbg (nmol / l) ] 100. transvaginal pelvic ultrasound was performed by using voluson 730 pro and expert (ge medical systems, kretztechnik, zipf, austria). the ovarian volume and the number and size of follicles (when present) were determined. the calculation of ovarian volume was performed by using the formula for a prolate ellipsoid (15). body composition was determined via dual energy x - ray absorptiometry, by using the latest program of the system (qdr discovery series ; hologic inc., this test was conducted at the science center of images and medical physics of the hc - fmrp, brazil. in this scanning technique, an x - ray generator emits pulses of double - energy alternate radiation of 70 and 140 kv (14). the photons pass through the tissues of the subject, and thus evaluate total body fat. the volunteers were requested to refrain from consuming alcoholic beverages and caffeine or from practicing physical exercises. they were requested to maintain a regular diet in the 48 h before the examination. the recording for spectral analysis of hrv was accomplished by using ecg signals (ad instruments, sydney, australia), between 8:00 and 11:00am, according to the following protocol : 20 min in the supine position on a special motorized (automated) tilt table (orthostatic table) ; this recording period was followed by 10 min of recording with initial phase adaptation and 10 min of final recording in the supine position. subsequently, the table engine was turned on and the volunteers passively shifted from the supine position to the orthostatic position (90) for 10 min. the hrv analysis was performed by using custom - made computer software (cardioseries version 2.4 ; http://sites.google.com/site/cardioseries). the rr interval (rri) values obtained were resampled (3 hz) by using cubic spline interpolation to adjust the time interval between heartbeats, and were divided into segments with 512 values each, with 50% overlapping (welch protocol). each rri stationary segment was subjected to fast fourier transform, after applying a hanning window function. the oscillatory components were classified as either low frequency (lf : 0.040.15 hz) high frequency (hf : 0.150.5 hz). the mean values of the power spectral densities of rri in both bands (lf and hf) were expressed in absolute units (ms). the relative power (%), also known as normalized units (nu), in each frequency band, as well as the lf / hf ratio powers, were calculated by subtracting the very low frequency (vlf 35 days or variation between consecutive cycles of > 10 days) ; presence of hirsutism evaluated by a ferriman - gallwey score > 8, severe acne and alopecia ; hyperandrogenism (total testosterone concentration > 80 ng / dl) ; or ultrasound evidence of polycystic ovaries. all volunteers with pcos selected for the study had polycystic ovaries ; 70.4% presented with biochemical hyperandrogenism, 66.7% had clinical hyperandrogenism, and 88.9% had irregular menstrual cycles. the following items were used as exclusion criteria : presence of systemic diseases and musculoskeletal disorders that prevented the women from practicing physical exercises ; presence of congenital adrenal hyperplasia, androgen - secreting neoplasms, cushing s syndrome, tabagism, and pregnancy ; and use of hormonal contraceptives or drugs that interfere with the hypothalamic - pituitary axis or cardiac autonomic modulation. this study was conducted in accordance with the ethical standards set forth in the helsinki declaration of 1975 and approved by the human research ethics committee of the clinical hospital of the school of medicine of ribeiro preto, university of so paulo, brazil (case hcrp n. 13475/2009). the evaluations were performed before and after the physical training period and all volunteers provided their free and informed consent. the strength training program lasted for 4 months, which was divided into mesocycles of 4 weeks each. the calculation of one repetition maximum (1rm) was performed for each volunteer (32) and linear periodization was used to gradually decrease the volume and increase the intensity during the training. the exercises included : 1) bench press, 2) leg extension, 3) front lat pull down, 4) leg curl, 5) lateral raise, 6) leg press (45), 5) triceps pulley, 6) calf leg press, 7) arm curl, and 8) abdominal. the training load started with 70% of 1rm, and each exercise was repeated for 12 repetitions. in the first 3 weeks of each mesocycle, the exercises were performed three times / week and the intensity was increased by 5% per week. in the fourth week, these exercises were performed twice / week and the intensity were reduced by 5% (1). blood samples were collected during the follicular phase, and at any time in those with amenorrhea. the tests were performed in the gynecology laboratory of the hc - fmrp, between 07:00 and 09:00 am, after a 12-h fast. blood (15ml) was collected into conical plastic tubes (bd - becton dickinson, plymouth, uk). the blood samples for the analysis of fasting insulin were stored in vacuum tubes, with a separating gel barrier. the blood samples for the other tests, except those for the analysis of fasting glucose, were stored under vacuum in tubes containing edta fasting blood glucose levels was analyzed immediately after collection. blood was then centrifuged at 2500 rpm in a ct 5000 centrifuge (cientec laboratory equipments, so paulo, brazil) at room temperature (2024c) for 10 min and transferred to sealed plastic tubes (eppendorf tubes). the elisa method was used for the analysis of sex hormone binding globulin (shbg). 17-hydroxyprogesterone, testosterone, and androstenedione were measured by means of radioimmunoassay. to detect insulin resistance (> 2.71 nmol u / l), the following equation was used : homa - ir (homeostatic model assessment - insulin resistance) = [(fasting glucose in mg / dl 0.05551) (fasting insulin in u / ml/22.5) ] (13, 24). the free androgen index (fai) was calculated by using the equation [tt (nmol / l)/shbg (nmol / l) ] 100. transvaginal pelvic ultrasound was performed by using voluson 730 pro and expert (ge medical systems, kretztechnik, zipf, austria). the ovarian volume and the number and size of follicles (when present) were determined. the calculation of ovarian volume was performed by using the formula for a prolate ellipsoid (15). body composition was determined via dual energy x - ray absorptiometry, by using the latest program of the system (qdr discovery series ; hologic inc., this test was conducted at the science center of images and medical physics of the hc - fmrp, brazil. in this scanning technique, an x - ray generator emits pulses of double - energy alternate radiation of 70 and 140 kv (14). the photons pass through the tissues of the subject, and thus evaluate total body fat. the volunteers were requested to refrain from consuming alcoholic beverages and caffeine or from practicing physical exercises. they were requested to maintain a regular diet in the 48 h before the examination. the recording for spectral analysis of hrv was accomplished by using ecg signals (ad instruments, sydney, australia), between 8:00 and 11:00am, according to the following protocol : 20 min in the supine position on a special motorized (automated) tilt table (orthostatic table) ; this recording period was followed by 10 min of recording with initial phase adaptation and 10 min of final recording in the supine position. subsequently, the table engine was turned on and the volunteers passively shifted from the supine position to the orthostatic position (90) for 10 min. the hrv analysis was performed by using custom - made computer software (cardioseries version 2.4 ; http://sites.google.com/site/cardioseries). the rr interval (rri) values obtained were resampled (3 hz) by using cubic spline interpolation to adjust the time interval between heartbeats, and were divided into segments with 512 values each, with 50% overlapping (welch protocol). each rri stationary segment was subjected to fast fourier transform, after applying a hanning window function. the oscillatory components were classified as either low frequency (lf : 0.040.15 hz) high frequency (hf : 0.150.5 hz). the mean values of the power spectral densities of rri in both bands (lf and hf) were expressed in absolute units (ms). the relative power (%), also known as normalized units (nu), in each frequency band, as well as the lf / hf ratio powers, were calculated by subtracting the very low frequency (vlf<0.04 hz) values. the normalization tends to minimize the effect of changes in the total power on the values of the lf and hf components (17, 23). the shapiro - wilk test was applied to determine the normality of the sample, with 95% significance. the effects of pcos and of the strength training were evaluated by using two - way anova, and data are presented as means s.e.m. (standard error of the mean). the comparison between groups was analyzed statistically with the student - newman - keuls test, whenever necessary. the associations between the percentage changes in lf / hf ratio and the endocrine - metabolic variables were verified by using the spearman s rank correlation coefficient with spearman s rank correlation test. for the statistical analysis and charts, sigma stat software (version 11.0) the age and height of the women were similar in both groups : cg (31 1.0 years and 1.62 0.1 m) and pcos (29 1.1 years and 1.61 0.1 m). table 1 shows the values of the hemodynamic and metabolic - endocrine parameters. no significant differences were observed in any of the hemodynamic parameters between the cg and pcos groups, before and after strength training. the evaluation of endocrine - metabolic parameters showed that the pcos group, when compared with the cg, presented significantly higher levels of testosterone (p = 0.041) and insulin (p = 0.037) before strength training. moreover, strength training in the cg did not cause any significant change in the values of endocrine - metabolic parameters. interestingly, strength training reduced testosterone levels (p = 0.021) and t / a ratio (p = 0.004) in both groups. on the other hand, table 2 shows the spectral parameter values of hrv obtained in the supine and orthostatic positions in both groups. in the supine position, there were no differences between the study groups, and strength training did not cause any changes. however, during the tilt test, in the orthostatic position, the pcos group presented higher values of lf band oscillations in absolute (p = 0.035) and normalized (p = 0.049) units and lower values of hf band oscillations in normalized (p = 0.049) units compared with the cg. consequently, we also observed a higher lf / hf ratio value in the pcos group (p = 0.047). however, strength training did not have a significant effect on the spectral values obtained in both groups. figures 1 and 2 present the results of the spectral analysis of hrv in the cg and pcos groups, by comparing the values of the total variance (including lf and hf bands in absolute and normalized units) obtained in the supine and orthostatic positions (tilt test) before and after strength training. the results obtained during the tilt test in the cg (figure 1) showed significant reductions in total variance, in the lf band in normalized units, and in the hf band in absolute and normalized units, which significantly increased the lf / hf ratio. the pcos group (figure 2) showed similar results to those seen in the cg, with the exception of the total variance, which did not differ in the transition from supine position to orthostatic position during the tilt test. table 3 shows the correlation values between the percentage variations of the lf / hf ratio and the values of the percentage variation of the endocrine - metabolic parameters in the cg and pcos group, in the supine position and during the tilt test. there was no correlation with any of the variables in both groups in the supine position and during the tilt test for the cg. however, during the tilt test, the pcos group showed a negative correlation between the percentage variation of the lf / hf ratio and the percentage variation of androstenedione values (p = 0.014), as well as a positive correlation between the percentage variation of the lf / hf ratio and the percentage variation of t / a ratio (p < 0.001). the two main findings of the present study are that women with pcos presented higher sympathetic cardiac autonomic modulation during the tilt test and higher levels of testosterone and t / a levels. in addition, strength training was able to reduce testosterone levels and the t / a ratio, however, did not affect cardiac autonomic modulation. damage to the cardiac autonomic imbalance is commonly associated with cardio metabolic disorders such as diabetes, hypertension, and metabolic syndrome. augmented sympathetic tone and reduced hrv are correlated with factors such as increased insulin resistance, hyperandrogenism, increased bmi, vascular alterations, and inflammatory processes (3, 6, 30, 34, 36). in women with pcos, the risks are even higher because these factors contribute to a vicious cycle that increases androgen production and adipogenesis (7, 41). at the same time, the excess of androgens in women stimulates and promotes an increase in insulin resistance (19, 21, 28, 29). in our study, the cardiac autonomic modulation assessed by the analysis of hrv in the supine position showed that the two groups had similar behavior, thus corroborating the findings of a recent study (6). however, other studies have reported an increase in the modulation of the sympathetic component in the supine position (34, 45), whereas other authors have reported a reduced hrv in these women (5, 34, 39). in contrast, during the tilt test, both groups showed an increased lf band in normalized units and reduced hf band in absolute and normalized units in the orthostatic position, thus increasing the lf / hf ratio. however, the two groups showed different results in total variance ; that is, only the cg showed a significant reduction during the tilt test, both before and after strength training. generally, the change of position during the tilt test causes a reduction in the total variance of the spectrum due to the reduction of oscillatory components, which are greater in the supine position and are attributable mainly to the influences of oscillation on the vagal activity present in the hf band (17, 23). the explanation for the no reduction of the total variance in women with pcos is that, unlike the cg, when the tilt test is applied in the pcos group, there is greater response in the lf band, with a maintenance tendency or an increase of the lf oscillations in absolute units (ms). one of the possible reasons for this finding seems to be related to the increased levels of androgens and insulin (27, 31, 38). in another study, it was demonstrated that men exhibit greater sympathetic modulation than women, probably owing to several factors, including the high serum levels of androgens (8). in present study, a positive correlation was observed between the lf / hf ratio and the t / a ratio, and a negative relation between the lf / hf ratio and androstenedione. the explanation for such an outcome has not been completely established. however, it is known that a number of factors, including hyperinsulinemia, can lead to an increased secretion of androgens such as androstenedione (7, 25, 28, 29, 31). thus, androstenedione is then converted into higher testosterone levels, which seem to establish a positive feedback with increased body fat percentage, thus increasing the insulin and testosterone levels and reinforcing the increased insulin resistance (7, 25, 26, 29). however, the reduction on testosterone and t / a ratio levels in the pcos group after strength training did not cause any changes in the cardiac autonomic modulation, both in the supine and orthostatic positions after the tilt test. these results revealed that other factors may have contributed to the modification of hrv after strength training. one of these factors is the high serum insulin concentrations observed in women of the pcos group (3, 17, 37), as the literature has shown that high concentrations of insulin have a strong correlation with an increase in visceral fat. in this case, even lean women with pcos, but with increased visceral fat, would have a greater likelihood of presenting insulin resistance (4, 21, 22). in the present study, women with and without pcos had similar bmi values and body fat percentages, both before and after strength training. these women were considered to be overweight, and in a few cases, were classified as grade i overweight (12). however, the fact that visceral fat was not quantified in our study is a limiting factor for attributing the effects observed in the hrv to this type of fat, even though the literature has shown that its increase can substantially change the cardiovascular and endocrine - metabolic parameters (4, 21, 22). in contrast to results, some studies on strength training found a reduction of hyperinsulinemia, which can be explained by some mechanisms that contribute to increasing glut4 translocation to the cell surface (2,18). however, studies on the effects of strength training on cardiac autonomic modulation and on hyperinsulinemia are scarce, unlike aerobic training that already has well - established benefits (10, 20, 29, 44). on the basis of the results obtained, it can be concluded that strength training is satisfactory and relevant in women with pcos. however, it is suggested the combination with aerobic physical training and dietary intake control to enhance the effects on the metabolism and on the reduction of body fat, thus reducing the risks of cardiovascular and metabolic diseases. lastly, the results suggest that strength training was not able to alter hrv autonomic modulation in women with pcos, however, may reduce testosterone levels and t / a ratio. the study showed that strength training should be prescribed in the treatment of women with pcos, as it promotes the improvement of some parameters evaluated, especially related to the androgenic hormonal profile. future studies should be designed to identify the insulin relationship with the cardiac autonomic control and the role of strength training in other respects, such as its effect on visceral fat and other markers as adipokines and stress oxidative.	polycystic ovary syndrome (pcos) may present important comorbidities, such as cardiovascular and metabolic diseases, which are often preceded by changes in cardiac autonomic modulation. different types of physical exercises are frequently indicated for the prevention and treatment of pcos. however, little is known about the effects of strength training on the metabolic, hormonal, and cardiac autonomic parameters. therefore, our aim was to investigate the effects of strength training on the autonomic modulation of heart rate variability (hrv) and its relation to endocrine - metabolic parameters in women with pcos. fifty - three women were divided into two groups : control (n=26) and pcos (n=27). the strength training lasted 4 months, which was divided into mesocycles of 4 weeks each. the training load started with 70% of one repetition maximum (1rm). blood samples were collected before and after intervention for analysis of fasting insulin and glucose, homa - ir, testosterone, androstenedione and testosterone / androstenedione (t / a) ratio. spectral analysis of hrv was performed to assess cardiac autonomic modulation indexes. the pcos group presented higher insulin and testosterone levels, t / a ratio, along with increased sympathetic cardiac autonomic modulation before intervention. the training protocol used did not cause any change of endocrine - metabolic parameters in the control group. interestingly, in the pcos group, reduced testosterone levels and t / a ratio. additionally, strength training did not have an effect on the spectral parameter values of hrv obtained in both groups. strength training was not able to alter hrv autonomic modulation in women with pcos, however may reduce testosterone levels and t / a ratio.
sleep was first described in drosophila by two independent groups ~14 years ago [1, 2 ]. each of the inaugural papers began their analysis by demonstrating that quiescence episodes met the four historical criteria used to identify sleep (quiescence, increased arousal thresholds, rapid reversibility, and homeostasis). interestingly, neither group relied exclusively upon behavioral criteria but extended their analysis to other important variables that are commonly studied in connection with sleep in mammals (e.g., ontogenetic changes, pharmacological perturbations, and molecular correlates). in the years since, ~100 papers have used genetic tools in the fly to identify genes and circuits that significantly modulate sleep time [4, 5 ]. however, a minority of these studies have extended their analysis to include other variables that have been linked with healthy sleep. not surprisingly then, while ~40 genes have been found to alter some component of sleep time, little is known about precisely how these genetic manipulations impact sleep regulatory mechanisms. with this in mind, it is worth noting that in the absence of an independent assessment of the animal s ability to function properly, it is not possible to gain insight into whether the manipulation has enhanced or disrupted sleep regulatory processes. for example, a genetic manipulation could enhance the ability of sleep to carry out its function, thereby allowing the animal to sleep less. alternatively, the manipulation could disrupt the ability of the fly to obtain needed sleep. similarly, a mutation that reduces the ability of sleep to carry out its function may necessitate that a fly sleep longer to compensate for inefficient sleep. however, a manipulation might increase sleep without enhancing the ability of sleep to carry out its function ; or, better still, enhance sleep function [9, 10 ]. while increased sleep may or may not improve well - being, it should not result in obvious deficits. it seems inaccurate to classify a fly as long - sleeping if they are, in fact, sleeping poorly. unfortunately, the field has not yet developed an alternative nomenclature that can distinguish between manipulations that enhance or disrupt sleep regulation independently from the amount of time the animal spends sleeping. in the end, determining whether a manipulation has enhanced or disrupted sleep regulation requires that investigators extend their analysis beyond sleep. a number of independent variables can be considered when evaluating sleep mutants further including lifespan [1114 ], neurotransmitters [15, 16 ], and metabolic markers [1720 ] to name a few. however, given the overwhelming relationship between sleep and memory that has been found throughout the animal kingdom, we favor using learning and memory [7, 10, 21, 22 ] or synaptic markers [2327 ] as the tools to independently assess the functional outcomes of a manipulation that alters sleep. in this manuscript, we will review the relationship between sleep, performance, and learning in flies. there are few areas of drosophila neurobiology that have been more successful than investigations into learning and memory. drosophila memory assays can be generally broken down into those that use classical conditioning and those that use operant conditioning. in classical conditioning, two stimuli are repeatedly paired such that a previously neutral stimulus (bell) will, over time, induce a response (salivation) that was originally only induced by food (unconditioned stimulus). in operant conditioning, an animal engages in a behavior that is either rewarded or punished ; whether the animal experiences the reward or punishment depends upon the animal s own behavior. a brief description of the memory assays used in sleep research will be outlined below. the success of the drosophila memory field can be largely attributed to the use of aversive olfactory conditioning as the primary tool to identify genes, circuits, and microcircuits important for memory formation (for a complete review see). olfactory conditioning has been so successful, because it severely restricts the number of sensory stimuli that an animal is exposed to and must then process to form a memory. in this paradigm, a group of 50 flies are exposed to an odor (odor - a) as the conditioned stimulus (cs+) and given a series of shocks (the unconditioned stimulus, us). the flies are then presented with a different odor that is not paired with a shock (odor - b ; cs). finally, the flies are tested by allowing them to choose between the odor that had been paired with the shock (odor - a) and the cs (odor - b). the flies are tested in the dark on a flat surface to ensure that their choice is not influenced by visual, phototaxis, or geotaxis cues. flies that have formed a memory will select odor - b and avoid the odor paired with the conditioned stimulus (cs + ; odor - a). in a separate experiment, odor - b is paired with the electric shock (cs+) while odor - a serves as the counter - odor (cs). this reciprocal training protocol ensures that non - associative odor preferences can not be misinterpreted as associative learning. one experiment consists of eight replicates of 100 flies (50 w/ odor - a as the cs+ and 50 with odor - b as the cs+). typically, 80 % of healthy flies will avoid the cs+, while only 20 % of memory - impaired flies will avoid the cs+. perhaps because sleep may be less important for strongly encoded memories, or because sleep is believed to be important for integrating and processing complex information, the majority of drosophila sleep studies have used multisensory operant conditioning assays. one such assay is an operant visual learning paradigm, the aversive phototaxic suppression (aps). in the aps, flies are individually placed in a t - maze and allowed to choose between a lightened and darkened chamber over 16 trials (fig. flies that do not display phototaxis during the first block of four trials are excluded from further analysis. during 16 trials, flies learn to avoid the lightened chamber that is paired with an aversive stimulus (quinine / humidity). the performance index is calculated as the percentage of times the fly chooses the dark vial during the last four trials of the 16 trial test. in the absence of quinine, where no learning is possible, it is common to observe flies choosing the dark vial once during the last four trials in block four. in contrast, flies never choose the dark vial two or more times during block four in the absence of quinine. thus, short - term memory (stm) is defined as two or more photonegative choices in block four.fig. b data for a single replicate of n = 8 flies for cs, rut, dnc, and lio mutants. c data from 4 groups/8 flies expressed as a percentage of flies avoiding light / quinine aversive phototaxic suppression produces robust changes in performance. b data for a single replicate of n = 8 flies for cs, rut, dnc, and lio mutants. c data from 4 groups/8 flies expressed as a percentage of flies avoiding light / quinine in olfactory conditioning, flies are tested once and make a single choice. the performance index is calculated as the percentage of flies in a group that avoid the cs+. when tested using olfactory conditioning, ~80 % of healthy flies avoid the cs+ while only ~20 % of the classic memory mutants (rutabaga, dunce, and linotte) avoid the cs+. in the aps, each fly makes four choices in the last block. as a consequence, the behavior of each individual results in a quantitative score. an example of performance in cs, rutabaga, dunce, and linotte can be seen in fig. note that the performance index seems much smaller in the aps (50 vs. 30 %) compared to olfactory conditioning (80 vs 20 %). if one conducts multiple replicates, as is done with olfactory conditioning, and expresses the performance index as the percent of flies that avoid the quinine / humidity, the performance index for the aps and olfactory conditioning look much the same (fig. thus, while several hundred flies must be evaluated to generate a performance index using olfactory conditioning, only eight flies / genotype are needed to obtain statistical differences using the aps. importantly, performance in the aps does not appear to be highly sensitive to genetic background. the other most commonly used associative memory assay employed in drosophila sleep research is courtship conditioning. in this assay, a male fly is exposed to an unreceptive female which will repeatedly reject the males courtship attempts. the rejection is aversive such that an operant association is formed between the courtship attempts and the rejection. memory is demonstrated when a previously trained male spends less time courting during the test period than his nave brothers. moreover, the assay requires that flies process complex, naturalistic visual, tactile and pheromonal cues in conjunction with social behaviors and postures. perhaps because the assay depends upon naturalistic behavior, significant courtship scores can be obtained using 1620 flies / group, and the resulting memory scores are robust and reproducible. although baseline courtship levels can be influenced by genetic background, the ability to form a memory does not depend upon baseline courtship [40, 41 ]. thus, like the aps, courtship conditioning is a multisensory operant assay that is not strongly confounded by genetic background. in contrast to olfactory conditioning, which requires the investigator to strictly limit all types of sensory stimuli and requires a dedicated room, courtship conditioning uses multisensory information, and therefore is not impacted by small variations in lighting (flies will learn both with and without light) or geotaxic cues, etc. moreover, since the assay is not as sensitive to environmental cues, it does not require a dedicated room. thus, any thoughtful drosophila lab with a computer and a webcam can evaluate memory without the need to purchase expensive equipment and obtain additional space. when, almost 15 years ago, two independent laboratories showed that flies sleep, expectations that the function of sleep would be uncovered using drosophila sleep - studies were raised. that is because drosophila is an ideal model to study sleep and its relationship to other key physiological functions. indeed, there are numerous well - established behavioral and molecular assays that can be used to assess cognitive performance, lifespan, metabolism, neuronal plasticity, etc. in addition, the power of drosophila genetics ensures that genes involved in sleep regulation can be easily identified and manipulated in a circuit specific manner. thus, it is somewhat surprising, that despite the discovery of ~40 genes that alter some component of sleep time, little is known about how sleep impacts the many physiological functions that are part of normal well - being. as mentioned above, we believe that in order to fully understand sleep and its function, the analysis of a given manipulation must be extended to at least one assessment that is independent of sleep. given the well - known relationship between sleep and learning / memory in humans, we favor using cognitive performance as a way to further assess the consequences of genetic manipulations on sleep. as previously stated, numerous genes are known to modulate sleep in drosophila [4, 5 ]. in particular, thus, studying the cognitive abilities of these short - sleeping mutants may provide a unique opportunity to elucidate sleep function. one study that nicely evaluated performance, examined loss - of - function mutations in both the (shaker, sh) and (hyperkinetic, hk) subunits of a tetrameric voltage - dependent potassium channel. when assessed for cognitive performance using an operant heat - box conditioning paradigm (in which flies have to learn and remember to avoid a spatial location associated with heat), short - sleeping sh and hk mutants showed intact learning but reduced short - term memory. thus, the short - sleeping phenotype of sh and hk mutants is associated with a negative cognitive outcome and suggests that neither mutant may be getting enough sleep. another example comes from our recent work, in which we manipulated the expression level of antimicrobial peptides (amps) specifically in glia and in neurons. we found that when we overexpressed drosocin (dro) in neurons, sleep was reduced, and this was associated with impaired stm. thus, while we might have predicted that long - sleeping mtk - expressing flies would have intact stm, we found that they were substantially impaired instead. given that other long - sleeping flies (e.g., creb and pka mutants) are cognitively impaired, we expect that many long - sleeping flies will turn out to have inefficient sleep. being able to distinguish between good and bad learning, long - sleeping flies will be important for understanding how sleep impacts the brain. acute sleep deprivation can be performed on flies to assess sleep regulation as measured by sleep homeostasis. however, if a fly does not have a sleep rebound, it is not clear that they are better able to withstand wakefulness or if they can not initiate homeostatic mechanisms. importantly, sleep deprivation disrupts stm as assessed by aps, courtship conditioning, and olfactory conditioning [21, 22, 42 ]. thus, the assessment of stm can be used to gain additional insight into how the manipulation has impacted sleep regulation. for example, overexpressing the drosophila dopamine 1-like receptor (dda1) specifically in the mushroom bodies (mbs), an important learning and memory center in the fly brain allows the fly to maintain normal performance even after sleep deprivation. similarly, manipulating notch signaling in the mbs also protects flies from sleep loss - induced memory impairments. interestingly, silencing the mbs during sleep deprivation prevents cognitive impairments as assessed using the olfactory conditioning. together, these data indicate that increased waking exerts its effects largely through the mbs. since sleep deprivation is known to be bad for the brain, much of the focus has been on genes that are primarily expressed in neurons such that genes involved in metabolism have not been well studied. however, flies mutant for lipid - storage droplet-2, a gene involved in lipid metabolism, are able to remain awake without suffering cognitive deficits. these data suggest that non - neural tissues may play important roles in regulating how an animal responds to sleep loss. with this in mind, sleep deprivation and starvation differentially impacted stm in different mutant alleles of the foraging (for) gene which codes for protein kinase g (pkg). for example, flies with increased pkg (rovers), are resistant to sleep loss as measured by both low sleep rebound and the ability to form stm after sleep deprivation. in contrast, flies with low pkg (for), are impaired during baseline and following sleep deprivation but regained their ability to form stm following starvation. this surprising observation would not have been possible without evaluating stm and emphasizes further the need to move beyond sleep time during characterization of a given mutant. as previously stated, numerous genes are known to modulate sleep in drosophila [4, 5 ]. in particular, thus, studying the cognitive abilities of these short - sleeping mutants may provide a unique opportunity to elucidate sleep function. one study that nicely evaluated performance, examined loss - of - function mutations in both the (shaker, sh) and (hyperkinetic, hk) subunits of a tetrameric voltage - dependent potassium channel. when assessed for cognitive performance using an operant heat - box conditioning paradigm (in which flies have to learn and remember to avoid a spatial location associated with heat), short - sleeping sh and hk mutants showed intact learning but reduced short - term memory. thus, the short - sleeping phenotype of sh and hk mutants is associated with a negative cognitive outcome and suggests that neither mutant may be getting enough sleep. another example comes from our recent work, in which we manipulated the expression level of antimicrobial peptides (amps) specifically in glia and in neurons. we found that when we overexpressed drosocin (dro) in neurons, sleep was reduced, and this was associated with impaired stm. thus, while we might have predicted that long - sleeping mtk - expressing flies would have intact stm, we found that they were substantially impaired instead. given that other long - sleeping flies (e.g., creb and pka mutants) are cognitively impaired, we expect that many long - sleeping flies will turn out to have inefficient sleep. being able to distinguish between good and bad learning, long - sleeping flies will be important for understanding how sleep impacts the brain. acute sleep deprivation can be performed on flies to assess sleep regulation as measured by sleep homeostasis. however, if a fly does not have a sleep rebound, it is not clear that they are better able to withstand wakefulness or if they can not initiate homeostatic mechanisms. importantly, sleep deprivation disrupts stm as assessed by aps, courtship conditioning, and olfactory conditioning [21, 22, 42 ]. thus, the assessment of stm can be used to gain additional insight into how the manipulation has impacted sleep regulation. for example, overexpressing the drosophila dopamine 1-like receptor (dda1) specifically in the mushroom bodies (mbs), an important learning and memory center in the fly brain allows the fly to maintain normal performance even after sleep deprivation. similarly, manipulating notch signaling in the mbs also protects flies from sleep loss - induced memory impairments. interestingly, silencing the mbs during sleep deprivation prevents cognitive impairments as assessed using the olfactory conditioning. together, these data indicate that increased waking exerts its effects largely through the mbs. since sleep deprivation is known to be bad for the brain, much of the focus has been on genes that are primarily expressed in neurons such that genes involved in metabolism have not been well studied. however, flies mutant for lipid - storage droplet-2, a gene involved in lipid metabolism, are able to remain awake without suffering cognitive deficits. these data suggest that non - neural tissues may play important roles in regulating how an animal responds to sleep loss. with this in mind, sleep deprivation and starvation differentially impacted stm in different mutant alleles of the foraging (for) gene which codes for protein kinase g (pkg). for example, flies with increased pkg (rovers), are resistant to sleep loss as measured by both low sleep rebound and the ability to form stm after sleep deprivation. in contrast, flies with low pkg (for), are impaired during baseline and following sleep deprivation but regained their ability to form stm following starvation. this surprising observation would not have been possible without evaluating stm and emphasizes further the need to move beyond sleep time during characterization of a given mutant. sleep deprivation studies have demonstrated that sleep loss impairs cognitive performance in flies and results in deficits in experience - dependent plasticity [21, 23, 24, 26, 38 ]. these data indicate that behavioral adaptation and structural plasticity are disrupted in the absence of sleep. however, by themselves, sleep deprivation studies can not rule out the possibility that sleep simply plays a permissive role in facilitating changes in neural structure and function. thus, in parallel with sleep deprivation studies, several laboratories have pursued alternative approaches to determine whether sleep plays an active and positive role in memory formation. one alternative to sleep deprivation is to modulate plasticity directly ; if plasticity and sleep are interdependent, then manipulations that increase plasticity should increase sleep. although there are many ways to modulate plasticity, it has long been recognized that exposing animals to an enriched environment increases the number of synapses (reviewed in). when flies were housed in socially enriched environments, they increased their sleep relative to their socially isolated siblings. another way to increase neuronal plasticity is to expose animals to training protocols that induce long - term memory (ltm). not surprisingly, sleep was also dramatically increased when ltm was induced using courtship conditioning. to determine whether the increase in sleep was due to nonspecific features of the training protocol (e.g., exercise) or to memory per se, flies were sleep - deprived for 4 h immediately following training. even though the flies were awake for 4 additional hours, they did not exhibit either the typical post - training increase in sleep or a subsequent ltm. the ability to increase sleep by modulating the environment to induce plasticity has also been reported using different protocols. subsequent mechanistic investigations have used genetic tools to block plasticity [26, 27 ]. these experiments are complementary to post - training sleep deprivation ; in that, they seek to test the hypothesis that the increase in sleep is due to non - specific environmental factors (i.e., independent upon plasticity). interestingly, mutations in genes that are known to be important for neuronal plasticity prevent social enrichment and courtship conditioning protocols from either changing synapses or increasing sleep [25, 26 ]. however, it is important to know whether sleep can, in turn, enhance plasticity. recently, the dorsal fan - shaped body was identified as a major sleep - promoting center in the drosophila brain. similar to the inaugural papers identifying sleep in flies, the characterization of sleep following fan shaped - body activation did not rely exclusively upon the historical criteria, but also evaluated other important variables that are commonly studied in connection with sleep in mammals. results indicated that the sleep induced by fan - shaped body activation is homeostatically regulated, disrupted by caffeine, displays similar ontogenetic regulation, and modulates markers of synaptic plasticity similar to spontaneous sleep [9, 24, 44 ]. despite these observations, there remained a remote possibility that the sleep induced by fan - shaped body activation is not truly sleep. it has been known for some time that social enrichment disrupts the ability of flies to form ltm as assessed by courtship conditioning. it is also known that sleep is required to downscale synapses that were increased following social enrichment [23, 25 ]. thus, we hypothesized that if the sleep seen following fan - shaped body activation plays a role similar to spontaneous sleep, it should expedite the downscaling of synapses and restore the ability of the flies to form ltm. indeed, sleep induction was shown to enhance the sleep - dependent decrease in synapses following social enrichment and restore ltm as predicted by the synaptic homeostasis hypothesis [9, 44 ]. can sleep augment memories as has been predicted by human sleep studies [34, 46, 47 ] ? to test this hypothesis, flies were trained using courtship conditioning. however, in contrast to the experiments described above, flies were trained using a protocol that is only capable of inducing stm. when sleep was induced thermogenetically by activating the fan - shaped body for 4 h immediately after training thus, our data indicate that activating the fan - shaped body not only induces a state of sleep that meets all of the required historical criteria, it also modulates a number of other sleep - related variables appropriately and, importantly, it enhances memory consolidation. if we had not evaluated plasticity, we would never have known that sleep can convert stm into ltm. these data emphasize that sleep is sufficiently complex as to preclude using sleep time as the only and penultimate outcome variable to describe how a manipulation, of any kind, impacts sleep. indeed, one of the earliest reports on fly sleep showed that the mutations in the cyclic amp pathway components the rutabaga adenylyl cyclase and the camp response element binding protein creb increased sleep. as mentioned above, recent work has shown that overexpression of the antimicrobial peptide metchnikowin increases sleep and impairs stm formation as measured with the aps. thus, it is our view that the field would vastly benefit if more investigators would consider evaluating the functional outcomes of their manipulations. in this regard, it is interesting to note a recent report that demonstrated a sleep - promoting role for the neuropeptide snpf. activating snpf neurons dramatically increased sleep, yet appeared to block a homeostatic rebound to sleep deprivation. we believe that this is an exciting possibility that could be tested by evaluating learning and memory. if sleep induced by snpf activation impairs memory or if it does not support memory following sleep loss, then the hypothesis might need further refinement. surprisingly, we can find only one other manuscript that described a genetic manipulation that increases sleep and also evaluates memory. in that report, the authors found that heat shock - induced overexpression of the fatty acid binding protein increased sleep and was also associated with improved performance in a 7-day olfactory memory task. surprisingly, only a small number of drosophila laboratories are specifically addressing questions pertaining to sleep function. some of the work has focused on synaptic plasticity [9, 2325, 27 ], while other studies have examined learning and memory [17, 21, 43 ] or metabolism [17, 19, 49, 50 ]. as mentioned above, it is not possible to fully understand how a manipulation has impacted sleep regulation without first establishing how it has affected the animals well - being. certainly, synaptic plasticity, memory, and metabolism are important functional outcomes that can be used to asses an animal s status. as mentioned, the field has not developed a nomenclature that can distinguish between manipulations that enhance or disrupt sleep regulation independently from the amount of time the animal spends sleeping. as a suggestion on how we, as a field, might proceed, 2 that describes a systematic approach that can help place the outcome of genetic manipulations into the appropriate regulatory context. while sleep time is the most obvious starting point, it does not by itself, provide adequate information to assess sleep regulation. in order to assess sleep regulation sleep homeostasis can be evaluated in any fly as long as baseline sleep is stable ; the magnitude of the sleep rebound is not dependent upon total sleep time (e.g., short and long - sleeping flies exhibit similar sleep rebounds) [9, 14 ]. as seen in fig. 2, after evaluating both sleep time and sleep homeostasis, there are nine possible outcomes. unfortunately, sleep homeostasis, like sleep time, is ambiguous with respect to whether it indicates functional improvements or deficits. if one were to consider memory as one option to further clarify the animals status, there are 27 possible outcomes. nine of these will have similar amounts of baseline sleep, nine will have similar sleep rebounds and nine will have similar learning outcomes. however, within a category, flies will all be different. only three assessments must be made to place a mutant into a category that better describes its phenotype. our previous data has shown that a mutant may be resilient to sleep loss while being vulnerable to starvation. this does not reflect a limitation of the approach as much as it emphasizes that mutants must be better characterized in general. we do not wish to imply that the third assessment must be memory ; it could be any variable that provides unique information about the animals well - being. ultimately, we expect that as drosophila sleep researchers expand their analysis beyond sleep time, in particular memory, the opportunities to discover the function of sleep will be enhanced.fig. we believe that sleep time is an insufficient metric to describe the effect of sleep manipulation on an animal s physiology, and we therefore propose that a minimum of three assessments be made to characterize each manipulation. flies are characterized as either short, normal, or long sleepers and marked with a red, blue and green box outline, respectively. flies are characterized as having a low, normal, or high sleep rebound denoted with filled boxes of colors red, blue, and green, respectively. the level of sleep rebound is independent of the level of baseline sleep so each of the three categories of sleep rebound contains short (s), normal (n), or long (l) sleeping flies yielding a total of nine categories. a fly with low sleep rebound and normal baseline sleep, for example, is thus labeled we propose using memory as the third assessment flies are characterized as having impaired normal or enhanced memory. this measurement is independent of the first two, yielding a total of 27 categories. as above, short, normal, and long levels of baseline sleep are denoted by red, blue, and green box outlines and denoted s, n, and l, respectively. further, the box fill color for each category is color coded to reflect the outcomes of assessments 2 and 3. thus, outcomes of low (l), normal (n), and high (h) sleep rebounds are marked with a fill color on the left of red, blue, and green, respectively, and outcomes of impaired (imp), normal (nrm), and enhanced (enh) memory are marked with a fill color on the right of red, blue, and green, respectively. within each memory outcome category, levels of baseline sleep are arranged in rows, and levels of sleep rebound in columns. a short - sleeping fly, with normal sleep rebound and impaired memory, for example, would be in row 1, column 2 of the impaired category, labeled sn imp, and be marked with box with blue on the left and red on the right with a red border flow chart to characterize sleep manipulations. we believe that sleep time is an insufficient metric to describe the effect of sleep manipulation on an animal s physiology, and we therefore propose that a minimum of three assessments be made to characterize each manipulation. flies are characterized as either short, normal, or long sleepers and marked with a red, blue and green box outline, respectively. flies are characterized as having a low, normal, or high sleep rebound denoted with filled boxes of colors red, blue, and green, respectively. the level of sleep rebound is independent of the level of baseline sleep so each of the three categories of sleep rebound contains short (s), normal (n), or long (l) sleeping flies yielding a total of nine categories. a fly with low sleep rebound and normal baseline sleep, for example, we propose using memory as the third assessment flies are characterized as having impaired normal or enhanced memory. this measurement is independent of the first two, yielding a total of 27 categories. as above, short, normal, and long levels of baseline sleep are denoted by red, blue, and green box outlines and denoted s, n, and l, respectively. further, the box fill color for each category is color coded to reflect the outcomes of assessments 2 and 3. thus, outcomes of low (l), normal (n), and high (h) sleep rebounds are marked with a fill color on the left of red, blue, and green, respectively, and outcomes of impaired (imp), normal (nrm), and enhanced (enh) memory are marked with a fill color on the right of red, blue, and green, respectively. within each memory outcome category, levels of baseline sleep are arranged in rows, and levels of sleep rebound in columns. a short - sleeping fly, with normal sleep rebound and impaired memory, for example, would be in row 1, column 2 of the impaired category, labeled sn imp, and be marked with box with blue on the left and red on the right with a red border	drosophila has proven to be a powerful model to identify genes and circuits that impact sleep. while the majority of studies have primarily been interested in identifying manipulations that alter sleep time, a growing body of work has begun to focus on how changing sleep influences functional outcomes such as cognitive performance, structural plasticity, and metabolism to name a few. evaluating sleep time provides an appropriate entry point into elucidating sleep function. however, it is not possible to fully understand how a manipulation has impacted sleep regulation without first establishing how it has affected the animals well - being. synaptic plasticity and memory are important functional outcomes that can be used to asses an animal s status. in this manuscript, we review recent advances in studies examining sleep, memory, and performance. we conclude that as drosophila sleep researchers expand their analysis beyond sleep time, the opportunities to discover the function of sleep will be enhanced.
arterial hypertension is an established risk factor for stroke, although the exact mechanisms of the development of cerebrovascular complications of hypertension remain unclear. inflammation plays an important role in cardiovascular system remodeling that leads both to elevated blood pressure and stroke. chemokines are small proinflammatory mediators that act as chemoattractants and recruit leukocytes to the site of inflammation. chemokines constitute the largest family of cytokines, consisting of approximately 50 ligands, 20 signaling and 5 nonsignaling receptors. chemokines act synergistically with common risk factors promoting atherosclerosis development and mediate cell communications during cerebral ischemia. in the present paper, we studied the association between chemokines and their receptor gene polymorphisms and the risk of stroke in patients with essential hypertension (eh). the study group consisted of 296 patients with eh without cardiovascular complication (mean age 49.32 9.37 years), 71 patients with eh who suffered from ischemic stroke (mean age 52.55 6.31 years), and 258 healthy individuals (mean age 43.41 7.05 years) without clinical symptoms of cardiovascular or cerebrovascular disease. both patients and controls were men of the tatar ethnic group from the republic of bashkortostan (russia). patients enrolled in the study were treated at the republic centre of cardiology and the ufa city emergency hospital (ufa, republic of bashkortostan, russia). controls were recruited at the republic centre of blood transfusion (ufa, republic of bashkortostan, russia). the clinical characteristics of the study groups are provided in table 1. dna was isolated from 8 ml of whole venous blood using standard phenol - chloroform extraction. genotyping was performed using pcr - rflp or pcr with the allele - specific primers method with primers designed using primerselect 5.05 software (dnastar inc.,, usa). for the ccl2 rs1024611 (-2518 a > g) polymorphism, the primer sequences were as follows : f 5-cagcgggggagggcatct-3, r 5-acagggaaggtgaagggtat-3 ; restriction enzyme pvuii ; fragment lengths : aallele 105 bp, g - allele 51 bp, and 54 bp. for the ccl18 rs8073066 polymorphism, f 5-tgtgatctgtgctgctcccat-3 and r 5-cctgcttatcaagccaaaggtc-3 as well as the bsri restriction enzyme were used ; fragment lengths : c - allele 144 and 91 bp, and t - allele 235 bp. for the ccr2 rs1799864 [190 a > g (val64ile) ] polymorphism, the primers were f 5-tgcggtgtttgtgttgtgtggtca-3 and r 5-agatggccaggttgagcaggt-3 ; restriction endonuclease foki ; fragment lengths : a(i)-allele 198, 84, and 74 bp, and g(v)-allele 282 and 74 bp. for the cx3cr1 rs3732378 [848 a > g (thr280met) ] polymorphism, the primers were f 5-ggactgagcgcccacacagg-3 and r 5-aggctggccctcagtgtgact-3 ; restriction enzyme alw26i ; fragment lengths : a - allele 148 bp, g - allele 128 and 20 bp. for detection of the ccr5 rs333 (32 i / d) polymorphism, we used the following primers : f 5-tgccgcccagtgggactttg-3 and r 5-cggcaggaccagccccaag-3 ; fragment lengths : i - allele 350 bp, d - allele 318 bp. the cxcr2, cxcl1, and cxcl8 (il8) polymorphisms were genotyped using allele - specific primers. for the cxcr2 rs1126579 (+ 1235 t > c) polymorphism, the primer sequences were : f 5-ggcacacttccactactctcta-3, r 5-gcagagctccagcaaatga-3, c - allele 5-cccattgtggtcacaggaag-3, and t - allele 5-cccattgtggtcacaggaagt-3. the positive control fragment length was 253 bp, and the amplified allele fragment was 124 bp. for the cxcl1 rs4074 (57 a > g) polymorphism, the primer sequences were f 5-gccttcatttgaggcccagt-3, r 5-aatgggtgccctgagtaggt-3, g - allele 5-ctggggaaactgcattcggag-3, and a - allele 5-ctggggaaactgcattcggaa-3 ; they produced positive control of 277 bp and allele of 102 bp. for the cxcl8 (il8) rs4073 (-251 a > t) polymorphism, we used the following primers : f 5-tgattggctggcttatcttca-3, r 5-tcagggcaaacctgagtcatc-3, a - allele 5-tccacaatttggtgaattatgaat-3, and t - allele 5-tccacaatttggtgaattatgaaa-3. the positive control length was 316 bp, and the allele length was 196 bp. amplification was performed in a t100 thermal cycler (biorad, berkeley, calif., usa) programmed for an initial denaturation step (95c for 1 min) followed by 28 cycles of amplification (denaturation at 95c for 20 s, primer annealing at a specific temperature for 30 s, elongation at 72c for 30 s) and a final extension (72c for 4 min). pcr and restriction products were separated by the electrophoresis on 2% agarose gel and identified using mega - bioprint 1100 gel documentation system (vilber lourmat, collgien, france). the study data were stored and managed using ibm spss statistics for windows, version 22.0. for each snp fisher 's two - tailed exact test was applied to estimate the differences between allele and genotype frequency distribution in the study groups. the association between allele and/or genotype combinations and the risk of stroke was analyzed by apsampler 3.6.0 ; the program and its description are available at https://code.google.com/p/apsampler (common algorithm has been described elsewhere). the study protocol was approved by the ethics committee of the institute of biochemistry and genetics, usc ras, ufa, russia, and written informed consent was obtained from each participant. the study protocol was approved by the ethics committee of the institute of biochemistry and genetics, usc ras, ufa, russia, and written informed consent was obtained from each participant. the observed genotype and allele frequency distribution of the studied loci are shown in table 2. distribution of the cxcr2 rs1126579 genotype frequencies differed significantly between patients with stroke and the control group, while the frequencies of the cxcl1 rs4074, ccl18 rs8073066, and ccr2 rs1799864 genotypes were significantly different in the group of patients with noncomplicated eh compared to the control group. we observed a statistically significant increase in cxcr2t / c genotype frequency in the group of patients with stroke (60 vs. 46.56% in the control group, p = 0.047) and a reduction of the number of the cxcr2c allele homozygotes in the same group (7.14 vs. 19.34%, p = 0.013). the analysis of the association has shown that the carriers of the cxcr2t / c genotype had a higher risk of stroke (or = 1.72, 95% ci 1.01 - 2.92). the cxcr2c / c genotype was associated with a decreased risk of stroke (or = 0.32, 95% ci 0.12 - 0.83). the group of patients with noncomplicated eh was characterized by overrepresentation of the cxcl1g / g genotype (34.85 vs. 26.47% in the control group, p = 0.039, or = 1.49, 95% ci 1.03 - 2.15). ccl18t / t genotype frequency was also significantly increased in patients with noncomplicated eh (33.8 vs. 18.61%, p = 0.0002, or = 2.23, 95% ci 1.47 - 3.38). the ccl18t / c genotype and c allele were associated with a lower risk of eh (or = 0.67, 95% ci 0.47 - 0.96, p = 0.046, and or = 0.65, 95% ci 0.5 - 0.84, p = 0.001, respectively). comparing the ccr2 rs1799864 polymorphism genotype and allele frequency distribution in patients with noncomplicated eh with the control group, we found a reduced number of ccr2v / v genotype carriers (66.52 vs. 77.84% in the control group, p = 0.042, or = 0.67, 95% ci 0.46 - 0.98). the ccr2i allele was associated with an increased risk of eh (or = 1.42, 95% ci 1.02 - 1.99, p = 0.047). using the apsampler algorithm, we obtained 2,587 genotype / allele combinations of the studied polymorphic variants associated with stroke. combinations that remained significantly associated with stroke after the permutation test had been applied are presented in table 3. cxcr2 rs1126579 was present in all combinations, ccr5 rs333 and ccl2 rs1024611 were featured in two combinations each, il8 rs4073, cx3cr1 rs3732378, and ccl18 rs8073066 made an appearance once. three patterns were associated with an increased risk of stroke, and three were found to be protective against it. in our study, we have shown that the risk of stroke in eh patients is associated with the cxcr2 rs1126579 polymorphism. cxcr2 is involved in the control of immune cell trafficking between bone marrow, blood, and peripheral tissues during inflammation. cxcr2-mediated signals promote the release of neutrophils into blood and into tissues, promote monocyte adhesion to the endothelium, and stimulate mast cell migration to peripheral tissues. the rs1126579 polymorphism (t - to - c substitution at position 1235 in the 3-utr of the cxcr2 gene) is reportedly located in the microrna - binding site and affects cxcr2 protein expression. this polymorphism has been linked with different types of cancer, and the interaction between rs1126579-t and high serum levels of il8, its endogenous ligand, has been demonstrated to play an important role in the protection from cancer. however, the analysis of gene - gene interactions has revealed three combinations associated with stroke (table 2). it is worth noting that all combinations associated with stroke in hypertensive patients included the cxcr2 rs1126579 polymorphism, and the cxcr2t allele was part of all three combinations predisposing to stroke. protective combinations included, in addition to the cxcr2c / c genotype, ccl2a, il8c, or the cx3cr1t allele. while the importance of the interaction between cxcr2 and its ligand il8 has already been established, the cxcr2 interplay with other chemokines is less clear. the ccr532 (rs333) polymorphism consists of a 32-bp deletion and results in frameshift mutation that produces defective protein - lacking regions responsible for signal transduction. the implication of this polymorphism in the susceptibility to hiv infection has been extensively investigated. the ccr5d allele was shown to be protective against cerebrovascular events in patients with rheumatoid arthritis. an association was detected between ccr532 deletion and increased plasma high - density lipoprotein cholesterol and decreased plasma triglyceride levels. reported an association between the ccr5i / i genotype and myocardial infarction in the sicilian population. however, no association with myocardial infarction was detected in the russian population. in our study, we discovered that the ccr5i / i genotype and ccr5i allele are included in the patterns associated with stroke. the ccl2 rs1024611g allele was previously found to be associated with increased ccl2 expression, higher ccl2 serum levels, and enhanced leukocyte recruitment to the tissues. there is abundant evidence of the implication of this polymorphism in different disease phenotypes, but the results are often inconsistent, which may reflect the linkage between rs1024611 and another ccl2 polymorphism, rs13900. no association has been found between the ccl2 plasma level and major adverse cardiovascular and cerebrovascular events. other genes may also have an impact on rs1024611 effects, as shown in our study. the rs3732378 polymorphism in the exon 2 of the cx3cr1 gene results in threonine - to - methionine substitution at position 280 and results in a reduced affinity to fractalkine. an association was reported between the cx3cr1m allele and a decreased risk of carotid atherosclerosis. however, the cx3cr1m / m genotype has been shown to increase the risk of ischemic cerebrovascular disease. this observation is in line with our finding that the cx3cr1t allele is a part of a combination protective against stroke. a triallelic pattern associated with an increased stroke risk included the rs8073066 polymorphism located near the ccl18 gene. this snp is virtually unexplored, and there is no data on its functionality or implication for disease development. all the more interesting is the fact that in our study, this polymorphism was found to be associated with the risk of eh without cardiovascular or cerebrovascular complications. it happens to be the only cross - link between the observed patterns of associations for stroke and noncomplicated eh, since the risk of the latter was found to be associated with the only two of the studied gene markers that were absent in the genotype / allele combinations associated with stroke : ccr2 rs1799864 and cxcl1 rs4074. the results of our study show that the cxcr2 rs1126579 polymorphism is significantly associated with ischemic stroke, both individually and in combination with the genotype and/or alleles of other chemokine genes. further investigation is needed in order to elucidate the exact role of the cxcr2 chemokine receptor in the pathogenesis of stroke, but selective antagonism of the interaction between this receptor and its many ligands may be a promising strategy for stroke therapy. cxcr2 antagonists have already been studied in the treatment of respiratory diseases such as chronic obstructive pulmonary disease and asthma and were shown to reduce neutrophil recruitment into the lung and diminish underlying inflammation. the noncompetitive allosteric antagonist of the cxcr1 and cxcr2 chemokine receptors was found to be protective against brain damage in the murine models of middle cerebral artery occlusion and reperfusion. treatment with the cxcr2 ligand - binding protein evasin-3 was associated with a reduction in ischemic brain neutrophil infiltration at early stages of ischemic brain injury in mice ; however, it did not show further beneficial effects on stroke outcome, which may reflect the complexity of the nonselective ligand - receptor interaction.	hypertension is the major risk factor for stroke, and genetic factors contribute to its development. inflammation has been hypothesized to be the key link between blood pressure elevation and stroke. we performed an analysis of the association between inflammatory mediator gene polymorphisms and the incidence of stroke in patients with essential hypertension (eh). the study group consisted of 625 individuals (296 patients with noncomplicated eh, 71 hypertensive patients with ischemic stroke, and 258 control subjects). both patients and controls were ethnic tatars originating from the republic of bashkortostan (russian federation). the analysis has shown that the risk of ischemic stroke was associated with the cxcr2 rs1126579 polymorphism. our results indicate that among patients with eh, the heterozygous genotype carriers had a higher risk of stroke (or = 1.72, 95% ci 1.01 - 2.92), whereas the cxcr2c / c genotype was protective against stroke (or = 0.32, 95% ci 0.12 - 0.83). as shown by the gene - gene interaction analysis, the cxcr2 rs1126579 polymorphism was also present in all genotype / allele combinations associated with the risk of stroke. genetic patterns associated with stroke also included polymorphisms in the ccl2, ccl18, cx3cr1, ccr5, and cxcl8 (il8) genes, although no association between these loci and stroke was detected by individual analysis.
a pancreaticopleural fistula is a rare complication of chronic pancreatitis. in the literature various therapeutic modalities have been described : inhibition of the exocrine function of the pancreas with drugs (octreotide), endoscopic stenting of the pancreatic duct, and surgical removal of (part of) the pancreas. in this case report a 58-year - old man with a history of a situs inversus totalis, alcohol abuse, hypertension and peripheral vascular disease came to the emergency ward with abdominal pain since three weeks. physical examination showed no abnormalities besides local abdominal pain during palpation of the epigastric region. blood samples showed the following values : wbc 23.5 10/l (410 10/l), thrombocytes 467 10/l (150400 10/l), albumin 28 g / l (3550 g / l), alkaline phosphatase 233 iu / l (< 120 iu / l (< 40 iu / l), sgot 62 iu / l (< 35 iu / l), total bilirubin 14 mol / l (< 17 mol / l), amylase 336 iu / l (< 50 iu / l), triglyceride 1.97 mmol / l (0.6 - 2.2 mmol / l), crp 192 mg / l (< 10 mg / l). a chest x - ray showed a situs inversus totalis without signs of pleural effusion. an additional abdominal ct scan showed intracapsular fluid loculation in the liver and no abnormalities of the pancreas (fig. the loculated fluid was aspirated with ultrasonography guidance revealing 1,600 ml green - yellow fluid. a week later he returned to the emergency department with dyspnea and pain in the upper right quadrant and flank. physical examination showed a breathing frequency of 45/min and a saturation of 97% without supportive oxygen. percussion of the thorax was muffled from the basis of the thorax until the sixth thoracic vertebra on the left side. inherently there were no breathing sounds on auscultation. the abdomen was supple, but on palpation there was pain in the right upper quadrant. new blood samples revealed the following : wbc 19.0 10/l (410 10/l), thrombocytes 447 10/l (150400 10/l), alkaline phosphatase 176 iu / l (< 120 iu / l), sgpt 64 iu / l (< 40 iu / l), sgot 43 iu / l (< 35 iu / l), crp 385 mg / l (< 10 mg / l). chest x - ray showed elevation of the left hemidiaphragm accompanied by some bilateral atelectasis and pleural effusion. the patient was readmitted under suspicion of having a relapse of the fluid loculation in the liver possibly complicated by an infection. ultrasonography of the abdomen confirmed the suspicion, showing a relapse of the fluid collection which was drained at once. the obtained fluid showed the following values : bilirubin 10 mol / l, wbc 116.7 10/l, albumin 7 g / l, total protein 19 g / l, ldh 24,696 iu / l, amylase 40,782 iu / l. following the drainage the patient developed respiratory insufficiency and was admitted to the intensive care unit. he developed a vast amount of pleural effusion on the right side which was drained by thoracocentesis. the highest level of amylase in the pleural effusion was 70,584 iu / l. in this effusion subsequently a magnetic resonance cholangiopancreatography (mrcp) was performed where a fistula was identified originating from the proximal pancreatic duct and ending in a fluid collection located adjacent to the diaphragm. this fluid collection had a close relation to the intracapsular fluid collection in the liver (fig. the high levels of amylase in the fluid collection in the liver and in the pleural effusion strongly suggested that there was a continuum between the identified pancreatic fistula, the pleural cavity and the fluid collection in the liver. since the fistula had its origin in the proximal pancreatic duct, an endoprosthesis was placed covering the origo by endoscopic retrograde cholangiopancreatography. after long - term admission of 28 days in the icu the patient was transferred to the surgical ward. slowly his clinical condition improved and he was discharged to a nursing home for revalidation 43 days after the endoprosthesis was placed. two months prior to presentation at our hospital he had been analyzed elsewhere for complaints of dyspnea. a large volume of pleural effusion had been drained containing an elevated concentration of amylase a. ct scan of the abdomen was performed showing pseudocysts in the upper left quadrant. in addition to the dyspnea he reported abdominal pain in the upper right quadrant for several years which had increased markedly during the last few weeks. at the time of presentation blood samples revealed the following values : white blood cell count (wbc) 8.9 10/l (410 10/l), thrombocytes 455 10/l (150400 10/l), albumin 37 iu / l), ldh 178 iu / l (< 250 iu / l), sgpt 7 iu / l (< 40 iu / l), sgot 20 iu / l (< 35 iu / l), total bilirubin 6 mol / l (< 17 mol / l), amylase 438 iu / l (< 50 iu / l), crp 11 mg / l (< 10 mg / l). plain chest radiography revealed a substantial amount of left - sided pleural effusion. under suspicion of pancreatitis the patient was admitted to the hospital, the pleural effusion thought to be either reactive or caused by a pancreaticopleural fistula. the distal pancreatic duct was deformed and a fistula tract was identified communicating with one of the pseudocysts (fig. this pseudocysts lay in close relation with the left hemidiaphragm and expansion to the pleural cavity was suspected. a fistula was identified originating from one of the pseudocysts and ending at the hiatus aortae. considering the extent of the pseudocysts and the pancreatitis infiltrate a splenectomy was also performed. a 58-year - old man with a history of a situs inversus totalis, alcohol abuse, hypertension and peripheral vascular disease came to the emergency ward with abdominal pain since three weeks. physical examination showed no abnormalities besides local abdominal pain during palpation of the epigastric region. blood samples showed the following values : wbc 23.5 10/l (410 10/l), thrombocytes 467 10/l (150400 10/l), albumin 28 g / l (3550 g / l), alkaline phosphatase 233 iu / l (< 120 iu / l (< 40 iu / l), sgot 62 iu / l (< 35 iu / l), total bilirubin 14 mol / l (< 17 mol / l), amylase 336 iu / l (< 50 iu / l), triglyceride 1.97 mmol / l (0.6 - 2.2 mmol / l), crp 192 mg / l (< 10 mg / l). a chest x - ray showed a situs inversus totalis without signs of pleural effusion. an additional abdominal ct scan showed intracapsular fluid loculation in the liver and no abnormalities of the pancreas (fig. the loculated fluid was aspirated with ultrasonography guidance revealing 1,600 ml green - yellow fluid. a week later he returned to the emergency department with dyspnea and pain in the upper right quadrant and flank. physical examination showed a breathing frequency of 45/min and a saturation of 97% without supportive oxygen. percussion of the thorax was muffled from the basis of the thorax until the sixth thoracic vertebra on the left side. inherently there were no breathing sounds on auscultation. the abdomen was supple, but on palpation there was pain in the right upper quadrant. new blood samples revealed the following : wbc 19.0 10/l (410 10/l), thrombocytes 447 10/l (150400 10/l), alkaline phosphatase 176 iu / l (< 120 iu / l), sgpt 64 iu / l (< 40 iu / l), sgot 43 iu / l (< 35 iu / l), crp 385 mg / l (< 10 mg / l). chest x - ray showed elevation of the left hemidiaphragm accompanied by some bilateral atelectasis and pleural effusion. the patient was readmitted under suspicion of having a relapse of the fluid loculation in the liver possibly complicated by an infection. ultrasonography of the abdomen confirmed the suspicion, showing a relapse of the fluid collection which was drained at once. the obtained fluid showed the following values : bilirubin 10 mol / l, wbc 116.7 10/l, albumin 7 g / l, total protein 19 g / l, ldh 24,696 iu / l, amylase 40,782 iu / l. following the drainage the patient developed respiratory insufficiency and was admitted to the intensive care unit. he developed a vast amount of pleural effusion on the right side which was drained by thoracocentesis. the highest level of amylase in the pleural effusion was 70,584 iu / l. in this effusion subsequently a magnetic resonance cholangiopancreatography (mrcp) was performed where a fistula was identified originating from the proximal pancreatic duct and ending in a fluid collection located adjacent to the diaphragm. this fluid collection had a close relation to the intracapsular fluid collection in the liver (fig. the high levels of amylase in the fluid collection in the liver and in the pleural effusion strongly suggested that there was a continuum between the identified pancreatic fistula, the pleural cavity and the fluid collection in the liver. since the fistula had its origin in the proximal pancreatic duct, an endoprosthesis was placed covering the origo by endoscopic retrograde cholangiopancreatography. after long - term admission of 28 days in the icu the patient was transferred to the surgical ward. slowly his clinical condition improved and he was discharged to a nursing home for revalidation 43 days after the endoprosthesis was placed. two months prior to presentation at our hospital he had been analyzed elsewhere for complaints of dyspnea. a large volume of pleural effusion had been drained containing an elevated concentration of amylase a. ct scan of the abdomen was performed showing pseudocysts in the upper left quadrant. in addition to the dyspnea he reported abdominal pain in the upper right quadrant for several years which had increased markedly during the last few weeks. at the time of presentation blood samples revealed the following values : white blood cell count (wbc) 8.9 10/l (410 10/l), thrombocytes 455 10/l (150400 10/l), albumin 37 iu / l (< 40 iu / l), sgot 20 iu / l (< 35 iu / l), total bilirubin 6 mol / l (< 17 mol / l), amylase 438 iu / l (< 50 iu / l), crp 11 mg / l (< 10 mg / l). under suspicion of pancreatitis the patient was admitted to the hospital, the pleural effusion thought to be either reactive or caused by a pancreaticopleural fistula. the distal pancreatic duct was deformed and a fistula tract was identified communicating with one of the pseudocysts (fig. this pseudocysts lay in close relation with the left hemidiaphragm and expansion to the pleural cavity was suspected. a fistula was identified originating from one of the pseudocysts and ending at the hiatus aortae. considering the extent of the pseudocysts and the pancreatitis infiltrate a splenectomy was also performed. the incidence in series described in the literature lies between 0.4 and 4.5% of patients having pancreatitis [1, 2 ]. the pathophysiological mechanism in chronic pancreatitis most probably consists of leakage from a pseudocyst or rupture of the pancreatic duct. in the described cases both patients had abdominal symptoms, however the pulmonary complaints were the most prominent. pleural effusions frequently recur after drainage and are localised unilateral (left - sided) in 76% of the cases. when patients have signs of chronic pancreatitis accompanied by pleural effusion, the possibility of a pancreaticopleural fistula must always be considered. although it is an uncommon entity, the diagnosis can be made fairly easily by determining the concentration of amylase in pleural effusion. mrcp seems to be the imaging modality of choice because of its superiority to ct in indentifying a fistula in the pancreatic region. its noninvasive character is an advantage compared to endoscopic retrograde cholangiopancreatography [7, 8 ]. the first line of treatment options in pancreatic fistulas is the inhibition of the exocrine function of the pancreas by octreotide. the use of octreotide in gastrointestinal fistulas proved to reduce the time until closure and morbidity. specific rates of successful closure for pancreaticopleural fistulas have not yet been reported, however positive effects have been demonstrated. the expanding knowledge of the pathogenesis of chronic pancreatitis has led to the identification of new molecular targets and subsequent therapeutic agents which might also prove beneficial in pancreatic fistulas. however, until now there are no reports of trials in humans reproducing the beneficial effect found in animal models. besides pharmacological intervention thoracocentesis is recommended. there is no consensus whether or not measures must be taken to prevent food and fluids passing the duodenum. for instance advise enteral feeding through a nasojejunal tube, safadi and marks advise total parenteral nutrition, whereas dhebri and ferran consider neither of these measures meaningful. the duration of treatment with octreotide until the point it should be considered unsuccessful is also subject of debate. in general a period of 34 weeks is accepted. despite adequate drainage and treatment with octreotide there was no clinical improvement in patient a. therefore an endoprosthesis was placed in the pancreatic duct. the positive effect of this procedure is not only attributed to the direct covering of the origin of the fistula, but also to the decrease in pressure in the pancreatic duct [3, 13, 14 ]. the distinction between fistulas suited for treatment with endoprosthesis and those requiring surgery is of great importance. the following three characteristics of the fistula are the limitations to the use of endoprosthesis. first the orirgin of the fistula must not be located in the distal segment of the pancreatic duct, second the duct must not be totally ruptured, and third there must be no obstruction of the duct leading to the impossibility to place a stent. if patients do not have these limitations, the rate of success with endoprosthesis is high [3, 13, 14, 15, 16 ]. there is no uniform opinion on how long the endoprosthesis should rest in place, there are reports ranging from 4 weeks up to 6 months [6, 12 ]. for the remaining patients patient b underwent a distal pancreatectomy and splenectomy since the fistula was located in the distal part of the pancreatic duct. the lack of long - term follow - up for treatment with endoprosthesis as well as for surgery is the reason no accurate data are available on the recurrence of either treatment. the follow - up treatment with octreotide is again subject of discussion, recommendations ranging from a few weeks to several months. pancreaticopleural fistulas are a rare condition, but need to be considered in every patient with signs of chronic pancreatitis and pleural effusion. the diagnosis can be made by determination of the amylase concentration in pleural effusion and can be confirmed by mrcp. having diagnosed a patient with a pancreaticopleural fistula, octreotide is the obvious treatment to start with. if the symptoms do not subside the placement of an endoprosthesis or surgical intervention might be appropriate. the choice of either of these treatment modalities depends on the characteristics of the fistula, such as location or extent.	two patients presented with dyspnea and signs of chronic pancreatitis. patient b had pleural effusion on chest x - ray. patient a developed pleural effusion during the course of disease. on further analysis these pleural effusions showed elevated amylase concentrations. this finding suggested the diagnosis of a pancreaticopleural fistula which was confirmed by magnetic resonance cholangiopancreatography. because of the distinct localization of the fistulas the patients were treated differently. in patient a an endoprosthesis was successfully placed in the pancreatic duct, and patient b underwent distal pancreatic resection. considering the rarity of pancreaticopleural fistula, there is no consensus on diverse aspects of treatment, such as length of treatment with octreotide. however, a rationale for the distinction between fistulas suited for treatment with endoprosthesis or surgery seems to provide some grip.
phacoemulsification of hard cataracts receives much attention but many times it is the softer ones which can present challenges and require special techniques.1,2 the direct jackhammer effect of the tip s impact on hard lens material emulsifies it turning it into particulate dust within a stream of balanced salt solution (bss) (alcon laboratories, inc., cavitation is thought to be a secondary and perhaps negligible effect.3 in softer material, a relatively formed nuclear gel is drawn through the shaft by vacuum and the flow created by pressure differential. the movement is accelerated as the gel deforms and is mixed with bss, changing its viscosity because of increasing tip motion. modern machines are capable of well - controlled high vacuum and flow, short maximum vacuum rise times, and low postocclusion break surge values.4,5 those fluidic features combined with linear control of angled tips using longitudinal or torsional movement68 or a mix of them9 make acquisition and initial emulsification of nuclear quadrants almost immediate, leading to very efficient surgery. surgeons usually feel that they must dial in parameter values in the quadrant removal setting which optimize their techniques over a normal range of cataract hardness. but the use of those parameters may leave the capsules of soft lenses vulnerable to inadvertent aspiration.10 in this paper, i analyze slow - motion video of a case performed by our surgical team which shows an almost instantaneous attraction force reaching through the homogeneous nuclear gel of a soft cataract during phacoemulsification with the alcon centurion machine and balanced tip. i present the evolution of a separate slow aspiration machine setting for the centurion to be used on soft cataracts and its location on the procedure step toolbar so that shifting between it and the normal setting can be convenient and immediate. i also present a technique for soft cataract removal and its results with respect to posterior capsule aspiration over a series of cases. the technique utilizes an oblique tip orientation and the use of the slow speed setting comprised of empirically derived parameters for vacuum, aspiration flow, and torsional tip movement. simultaneous surgeon control of all three of these parameters seems to make acquisition and removal of soft nuclear fragments easier and safer. we started our conversion from the infiniti phacoemulsification machines and partial kelman tips to the centurion machines and balanced tips (all alcon laboratories, inc.) in july 2013. we continued to use our modification of the divide and conquer technique using topical / intracameral anesthesia with 2.4 mm near - clear temporal main and left - handed accessory paracentesis corneal incisions (2.4 mm bi - beveled knife and 22.5 paracentesis knife, both from alcon laboratories, inc.).11 we also continued to use the longitudinal tip motion for sculpting and the torsional with interjected vacuum triggered longitudinal pulses (intelligent phaco) for quadrant removal. the unique feature of the technique is that after deep sculpting and tearing the posterior nuclear plate into four quadrants using countertraction from a cyclodialysis spatula (0.5 modified to 0.35 mm sp765852 ; bausch & lomb incorporated, bridge - water, nj, usa), the deep and central nuclear quarters are further debulked in situ with continued low vacuum and flow. after that, the high vacuum quadrant aspiration phase of surgery occurs within the nuclear bowl which is comprised of the thin plates. most of quadrant removal activity occurs within the confines of the intracapsular space well away from the corneal endothelium. it was immediately apparent that the centurion and balanced tip s performance would be a substantial change from the infiniti and partial kelman s. not only were the fluidics smoother with almost no iris movement or pupil reduction, but the cutting efficiency of the tip was extraordinary. that is, once material was acquired, it seemed to be adherent to the tip held tumbling over the aperture as it disappeared. aspiration of material seemed much faster at all levels of nuclear hardness but seemed almost immediate in softer cataracts creating a concern when attracting them from their position in the periphery for centralized aspiration. both tips feature a 150 m aperture (aspiration bypass system [abs ]) in their shaft to even out vacuum excursion extremes and prevent absolute loss of flow if the tip aperture were to be completely occluded. the aperture results in a 12% reduction in attained maximum vacuum.12 because of the centurion s quick responsiveness, we felt it was necessary to reduce the values of the torsional tip movement, vacuum, and flow parameters that we had used with the infiniti to achieve a similar paced quadrant removal experience. we ultimately derived and used the values which comprise our current quadrant removal setting (figure 1). with a maximum vacuum of 400 mmhg used for both machines, we would sometimes manually reduce the fixed aspiration flow rate when things seem to happen too quickly during quadrant removal of soft cataracts (infiniti 35 to 25 ml / min and centurion 24 to 20 ml / min). four thousand and sixty - two consecutive centurion / balanced tip cases were operated by a single surgeon (jad) from july 2013 through june 2015. we kept a prospective list of inadvertent posterior capsule aspiration and found that two cases experienced that complication. a video recording of the first case was analyzed to study the capsule aspiration event. we started our conversion from the infiniti phacoemulsification machines and partial kelman tips to the centurion machines and balanced tips (all alcon laboratories, inc.) in july 2013. we continued to use our modification of the divide and conquer technique using topical / intracameral anesthesia with 2.4 mm near - clear temporal main and left - handed accessory paracentesis corneal incisions (2.4 mm bi - beveled knife and 22.5 paracentesis knife, both from alcon laboratories, inc.).11 we also continued to use the longitudinal tip motion for sculpting and the torsional with interjected vacuum triggered longitudinal pulses (intelligent phaco) for quadrant removal. the unique feature of the technique is that after deep sculpting and tearing the posterior nuclear plate into four quadrants using countertraction from a cyclodialysis spatula (0.5 modified to 0.35 mm sp765852 ; bausch & lomb incorporated, bridge - water, nj, usa), the deep and central nuclear quarters are further debulked in situ with continued low vacuum and flow. after that, the high vacuum quadrant aspiration phase of surgery occurs within the nuclear bowl which is comprised of the thin plates. most of quadrant removal activity occurs within the confines of the intracapsular space well away from the corneal endothelium. it was immediately apparent that the centurion and balanced tip s performance would be a substantial change from the infiniti and partial kelman s. not only were the fluidics smoother with almost no iris movement or pupil reduction, but the cutting efficiency of the tip was extraordinary. that is, once material was acquired, it seemed to be adherent to the tip held tumbling over the aperture as it disappeared. aspiration of material seemed much faster at all levels of nuclear hardness but seemed almost immediate in softer cataracts creating a concern when attracting them from their position in the periphery for centralized aspiration. both tips feature a 150 m aperture (aspiration bypass system [abs ]) in their shaft to even out vacuum excursion extremes and prevent absolute loss of flow if the tip aperture were to be completely occluded. the aperture results in a 12% reduction in attained maximum vacuum.12 because of the centurion s quick responsiveness, we felt it was necessary to reduce the values of the torsional tip movement, vacuum, and flow parameters that we had used with the infiniti to achieve a similar paced quadrant removal experience. we ultimately derived and used the values which comprise our current quadrant removal setting (figure 1). with a maximum vacuum of 400 mmhg used for both machines, we would sometimes manually reduce the fixed aspiration flow rate when things seem to happen too quickly during quadrant removal of soft cataracts (infiniti 35 to 25 ml / min and centurion 24 to 20 ml / min). four thousand and sixty - two consecutive centurion / balanced tip cases were operated by a single surgeon (jad) from july 2013 through june 2015. we kept a prospective list of inadvertent posterior capsule aspiration and found that two cases experienced that complication. a video recording of the first case was analyzed to study the capsule aspiration event. the first case was a 61-year - old female operated in december 2013 after an initial 227 cases operated with the centurion. her lens soft with respective locs iii values for nuclear opalescence (no) and nuclear color (nc) of 3.4 and 3.2 and we had intended to implant an alcon 20.5 d sn60wf iol. even though a hole was aspirated in the posterior capsule during attempted removal of the first quadrant, the anterior hyaloid membrane remained intact and no vitreous was encountered. employing air to maintain surface tension and pressure along the membrane and then viscoat to replace the air, we were able to implant a three - piece posterior chamber iol (alcon 20.5 d mn60ac) with the haptics in the ciliary sulcus and the optic captured within the capsulorhexis border. video freeze frames from standard slow motion 30 frames / second video (figure 2) show the posterior capsule aspiration event. analysis of the video showed that the posterior capsule was aspirated because of a distant vortex effect of vacuum and flow while the phacoemulsification tip was active. even though the tip was at approximately 1.5 mm from the posterior capsule, a column of tissue comprised of soft nucleus, cortex, and posterior capsule was drawn into the tip s aperture. after the small button of posterior capsule was aspirated, tension from the lens zonule retracted the remaining capsule and adjacent lens material back into their normal positions. in this case, enough fluid separated the anterior hyaloid membrane from the posterior capsule so that no vitreous was aspirated (figure 3)., we derived a separate menu of settings to be used in soft cataract cases identified by locs iii no or nc values of 3.5 or less. in each instance of soft cataract, that soft cataract menu was engaged before the start of the case. the difference in parameter values during removal of soft quadrants was a reduction in torsional amplitude from linear with up to 70% of maximum available to linear with up to 20% available and a reduction in aspiration flow from fixed 24 to fixed 20 ml / min. vacuum remained fixed at 400 mmhg with a 2 vacuum rise. while seemingly effective, overall inefficiency was experienced because sometimes quadrant aspiration proceeded so slowly that we had to stop surgery, come out of the soft cataract menu, enter into the normal cataract menu, and then resume surgery. the second case was a 72 year old female operated in february 2015 after a total experience of 3,238 centurion cases. she had pseudoexfoliation and her lens was also relatively soft (locs iii no3.6 nc3.6) with grade 4 anterior and posterior nuclear clefting. we used the normal cataract menu for that case which resulted in a similar opening in the posterior capsule at the same point in surgery, but this time vitreous was also aspirated so an anterior vitrectomy was required. the presence of it lying on the posterior pole was confirmed with indirect ophthalmoscopy, but we were still able to implant a posterior chamber iol placed as in the first case. a pars plana vitrectomy was accomplished by one of our vitreoretinal surgeons 10 days after the patient s cataract surgery to remove the posterior nuclear fragment. we had intended to use a 16.5 d alcon sn60wf but instead used a 16.5 d alcon mn60ac with a final refraction of + 0.50 0.50080 and 20/20 vision. after that case we developed our current soft cataract setting parameter values and settings procedure step toolbar display, and have used it without incident for an additional 824 cases. only preset terms are available in the centurion settings menu for inclusion as procedure step buttons into its procedure step toolbar, so we selected the epinucleus removal setting designation for the soft cataract values. we inserted that setting button between sculpt and quadrant removal buttons so that it would be instantaneously available to be used, skipped, or switched back and forth from as desired at any time without having to stop and change selection between two separate menus, namely the previously designated soft or normal prior to the start of surgery. the setting features simultaneous surgeon control of torsional amplitude, vacuum, and aspiration flow (figure 4). the surgical technique is most appreciated when applied to cataracts graded locs iii no and/or nc 3.6 or less but is employed in firmer lenses as well. relatively narrow grooves are sculpted into the nucleus using the sculpt setting (figure 5), sometimes after using an akahoshi pre - chopper, ambler surgical, exton, pa, usa to create four quadrants (locs iii no or nc 3.5 or less). the distance from the tip s aperture from the capsule, and the low vacuum and aspiration flow, make inadvertent capsule aspiration unlikely. better visualization of the tip s cutting edge on the progressively thinner posterior nuclear plate is created by turning it into an oblique position with the aperture away from the surgeon (figure 6a). tearing of the posterior nuclear plate from peripheral to central is facilitated using the same tip orientation. the tip is then rotated approximately 90 to achieve a different oblique orientation where the aperture is toward the surgeon for deep nuclear shaving of quadrant corners to reduce nuclear bulk. with the tip in the same orientation, the epinucleus removal using a 2 vacuum rise time, linear control provides the ability for both vacuum and aspiration flow to be simultaneously increased to 400 mmhg and 20 ml / min, respectively, throughout excursion through foot pedal position 2. the machine attempts to hold these maximums as very minimal torsional tip motion is incrementally added with linear control from 0%20% during travel through foot pedal position 3. the quadrant acquisition and centralization process is stretched typically to 1.53 seconds or even longer as desired. we had previously engaged the right corner of the quadrant but changed to acquire the left so that if that corner broke off, the aperture would face a relatively open area of bss and the effects of vacuum and flow would not burst into the relatively closed and nonvisible space through a full thickness defect which might have been created in the right corner if it were to have been acquired and attempted to be drawn centrally. this change also allowed the cyclodialysis spatula to push the adjacent left quadrant away to open a space for the left corner of the first quadrant to rotate through as it was being pulled centrally (figure 6). the quadrant removal setting is typically accessed for removal of the second and subsequent quadrants of relatively firm soft lenses (figure 7). it may be activated even after the first quadrant of such lenses has been partially removed as centralization has been partially accomplished. the intelligent phaco feature is available in the quadrant removal setting but does not come into play in these softer cataracts. for soft lenses where the posterior plate can not be torn with a pre - chopper or by visco - fracture,1 the central and deep peripheral nucleus can be aspirated during sculpting and deeper nuclear thinning, thus creating the desired thin nuclear bowl. using the epinucleus removal setting, the peripheral nucleus can be progressively aspirated as it is rotated to provide new peripheral material for the tip to acquire and roll centrally. as the last peripheral section is drawn centrally, the attached posterior nucleus will usually follow with it and become centralized as well so aspiration of it can be completed away from the posterior capsule.2 we have found that we currently use the epinucleus removal setting in some way in about one - half of our cases, usually unlocking the first quadrant but sometimes in later quadrants especially when centralizing the last. in the others, we skip through it and go directly to the quadrant removal setting. the first case was a 61-year - old female operated in december 2013 after an initial 227 cases operated with the centurion. her lens soft with respective locs iii values for nuclear opalescence (no) and nuclear color (nc) of 3.4 and 3.2 and we had intended to implant an alcon 20.5 d sn60wf iol. even though a hole was aspirated in the posterior capsule during attempted removal of the first quadrant, the anterior hyaloid membrane remained intact and no vitreous was encountered. employing air to maintain surface tension and pressure along the membrane and then viscoat to replace the air, we were able to implant a three - piece posterior chamber iol (alcon 20.5 d mn60ac) with the haptics in the ciliary sulcus and the optic captured within the capsulorhexis border. video freeze frames from standard slow motion 30 frames / second video (figure 2) show the posterior capsule aspiration event. analysis of the video showed that the posterior capsule was aspirated because of a distant vortex effect of vacuum and flow while the phacoemulsification tip was active. even though the tip was at approximately 1.5 mm from the posterior capsule, a column of tissue comprised of soft nucleus, cortex, and posterior capsule was drawn into the tip s aperture. after the small button of posterior capsule was aspirated, tension from the lens zonule retracted the remaining capsule and adjacent lens material back into their normal positions. in this case, enough fluid separated the anterior hyaloid membrane from the posterior capsule so that no vitreous was aspirated (figure 3)., we derived a separate menu of settings to be used in soft cataract cases identified by locs iii no or nc values of 3.5 or less. in each instance of soft cataract, that soft cataract menu was engaged before the start of the case. the difference in parameter values during removal of soft quadrants was a reduction in torsional amplitude from linear with up to 70% of maximum available to linear with up to 20% available and a reduction in aspiration flow from fixed 24 to fixed 20 ml / min. vacuum remained fixed at 400 mmhg with a 2 vacuum rise. while seemingly effective, overall inefficiency was experienced because sometimes quadrant aspiration proceeded so slowly that we had to stop surgery, come out of the soft cataract menu, enter into the normal cataract menu, and then resume surgery. the second case was a 72 year old female operated in february 2015 after a total experience of 3,238 centurion cases. she had pseudoexfoliation and her lens was also relatively soft (locs iii no3.6 nc3.6) with grade 4 anterior and posterior nuclear clefting. we used the normal cataract menu for that case which resulted in a similar opening in the posterior capsule at the same point in surgery, but this time vitreous was also aspirated so an anterior vitrectomy was required. the presence of it lying on the posterior pole was confirmed with indirect ophthalmoscopy, but we were still able to implant a posterior chamber iol placed as in the first case. a pars plana vitrectomy was accomplished by one of our vitreoretinal surgeons 10 days after the patient s cataract surgery to remove the posterior nuclear fragment. we had intended to use a 16.5 d alcon sn60wf but instead used a 16.5 d alcon mn60ac with a final refraction of + 0.50 0.50080 and 20/20 vision. after that case we developed our current soft cataract setting parameter values and settings procedure step toolbar display, and have used it without incident for an additional 824 cases. only preset terms are available in the centurion settings menu for inclusion as procedure step buttons into its procedure step toolbar, so we selected the epinucleus removal setting designation for the soft cataract values. we inserted that setting button between sculpt and quadrant removal buttons so that it would be instantaneously available to be used, skipped, or switched back and forth from as desired at any time without having to stop and change selection between two separate menus, namely the previously designated soft or normal prior to the start of surgery. the setting features simultaneous surgeon control of torsional amplitude, vacuum, and aspiration flow (figure 4). the surgical technique is most appreciated when applied to cataracts graded locs iii no and/or nc 3.6 or less but is employed in firmer lenses as well. relatively narrow grooves are sculpted into the nucleus using the sculpt setting (figure 5), sometimes after using an akahoshi pre - chopper, ambler surgical, exton, pa, usa to create four quadrants (locs iii no or nc 3.5 or less). the distance from the tip s aperture from the capsule, and the low vacuum and aspiration flow, make inadvertent capsule aspiration unlikely. better visualization of the tip s cutting edge on the progressively thinner posterior nuclear plate is created by turning it into an oblique position with the aperture away from the surgeon (figure 6a). tearing of the posterior nuclear plate from peripheral to central is facilitated using the same tip orientation. the tip is then rotated approximately 90 to achieve a different oblique orientation where the aperture is toward the surgeon for deep nuclear shaving of quadrant corners to reduce nuclear bulk. with the tip in the same orientation, the epinucleus removal using a 2 vacuum rise time, linear control provides the ability for both vacuum and aspiration flow to be simultaneously increased to 400 mmhg and 20 ml / min, respectively, throughout excursion through foot pedal position 2. the machine attempts to hold these maximums as very minimal torsional tip motion is incrementally added with linear control from 0%20% during travel through foot pedal position 3. the quadrant acquisition and centralization process is stretched typically to 1.53 seconds or even longer as desired. we had previously engaged the right corner of the quadrant but changed to acquire the left so that if that corner broke off, the aperture would face a relatively open area of bss and the effects of vacuum and flow would not burst into the relatively closed and nonvisible space through a full thickness defect which might have been created in the right corner if it were to have been acquired and attempted to be drawn centrally. this change also allowed the cyclodialysis spatula to push the adjacent left quadrant away to open a space for the left corner of the first quadrant to rotate through as it was being pulled centrally (figure 6). the quadrant removal setting is typically accessed for removal of the second and subsequent quadrants of relatively firm soft lenses (figure 7). it may be activated even after the first quadrant of such lenses has been partially removed as centralization has been partially accomplished. the intelligent phaco feature is available in the quadrant removal setting but does not come into play in these softer cataracts. for soft lenses where the posterior plate can not be torn with a pre - chopper or by visco - fracture,1 the central and deep peripheral nucleus can be aspirated during sculpting and deeper nuclear thinning, thus creating the desired thin nuclear bowl. using the epinucleus removal setting, the peripheral nucleus can be progressively aspirated as it is rotated to provide new peripheral material for the tip to acquire and roll centrally. as the last peripheral section is drawn centrally, the attached posterior nucleus will usually follow with it and become centralized as well so aspiration of it can be completed away from the posterior capsule.2 we have found that we currently use the epinucleus removal setting in some way in about one - half of our cases, usually unlocking the first quadrant but sometimes in later quadrants especially when centralizing the last. in the others, we skip through it and go directly to the quadrant removal setting. the balanced tip used with the centurion machine generates approximately twice the ultrasonic efficiency measured by cumulative dissipated energy (cde) as that experienced with the partial kelman tip used with the infiniti machine across all locs iii cataract grades. efficiency is a substantial advantage when operating hard cataracts because followability seems to be increased, material removal is faster, and the amount of movement of the tip within the incision as measured by cde is substantially less that the amount at the tip aperture. the relative shaft movement reduction should help reduce the likelihood of thermal corneal injury in longer more difficult cases. another advantage of the platform is the reduction in post - occlusion break surge. this surge is seen clinically as a sudden rush of fluid into the tip and a reduction in iop immediately after an occluded tip becomes unoccluded. it occurs when the vacuum which is built up in the aspiration tubing and cassette during tip occlusion suddenly releases when the occlusion clears. the amount of surge is typically measured in the laboratory by completely clamping the aspiration line, building vacuum to a certain level, and then fully releasing the clamp. the event is captured electronically and is defined as the area within the tracing of iop fluctuation from clamp release to normal iop over time. in one study of several phacoemulsification systems, using gravity fluidics with a 75 cm bottle height for each system, the infiniti post - occlusion break surge area has been measured at 1.10.12 mmhg - seconds, while the centurion s was a fraction of it at 0.10.07 mmhg - seconds.5 the centurion with active fluidics (where the plastic bss bag is compressed by a motor driven metal plate) and an equivalent target iop of 55 mmhg had a similarly reduced area at 0.20.06 mmhg - seconds. for comparison to other phacoemulsification systems in that study, the three alcon systems used non - aspiration bypass system (abs) tips whereas the tips used in our study have the normally included abs shaft aperture. the reduction in surge in the centurion has been primarily achieved by decreasing compliance in the aspiration tubing and dual pump cassette and active fluidics software. but even with advanced active fluidics, the transition to centurion / balanced tip technology required an empirical reduction in fluidic parameter values and ultrasonic energy delivery to achieve optimally controlled removal of softer nuclear quadrants. it would appear that this is primarily because the torsionally vibrating balanced tip is so effective at phacoemulsification. as seen in figure 2 posterior capsule aspiration can happen even when the tip is well away from the capsule because of the extending vortex effects of vacuum and aspiration flow through the homogeneous gel - like lens material which is being very rapidly emulsified. it is not caused by anything as gross as complete post - occlusion break surge where all flow has been stopped and then is suddenly restored. it appears to be caused by a more subtle, dynamic, and nearly instantaneous process. the physical characteristics of vitreous have been shown to cause nonuniform flow through a vitrector s aperture and lumen.14 even greater nonuniform flow should be expected during the relatively highly energetic and erratic phacoemulsification process. different shapes and viscosity materials are impacted or sheared by the tip s vibrating edge and are drawn into its lumen. vacuum and flow variations should be caused by the continuum of soft gel to firm nuclear material, or by those materials as they are variably mixed with bss as they tumble over and are drawn through the tip s aperture. as we further study the images in figure 2, it is also interesting to contemplate that the posterior capsule, cortex, and soft relatively uniform peripheral nucleus are actually being deformed as they are pushed in that order toward and into the tip s aperture 1.5 mm away. in our video analysis case, the anterior hyaloid membrane and vitreous seemed to have been insulated by fluid between the membrane and posterior capsule so that they were not pushed toward the tip enough to be aspirated, but in our second case of vitreous loss they were. push exists because of the relatively positive pressure within the globe created in part by the 55 mmhg target iop provided by the active fluidics hardware / software and the negative pressure on the other side of the tip s aperture extending through its shaft and tubing created by the pump and cassette. at an equivalent bottle height of 75 cm above the eye, gravity - fed infusion would have done the same thing. the trouble is these events can happen so quickly that surgeons have no time to react to them. our video showed the entire posterior capsule aspiration event was 0.3 seconds (with capsule aspiration occurring in 0.2 seconds) while the reaction time from seeing an object to applying the brake in an automobile is on average 0.5 seconds.15 all of the vacuum and flow effects will be accelerated with increasing speed of the deformity and physical change of nuclear material by the extremely effective balanced tip. the greater the tip movement, the faster the physical changes in the material which is being emulsified, and the more apparent the flow changes will be. the empirically derived parameters of the epinucleus removal setting and its simultaneous linear control of vacuum, aspiration flow, and torsional tip motion slows the rate of acquisition and aspiration of softer nuclear material and gives the surgeon enough time and material over that time to centralize and further aspirate it. the control feedback sensation experienced by the surgeon is exactly the same as that experienced in irrigation / aspiration during cortex removal, so it might be thought of as phaco - assisted i / a. if the name was available to choose in the machine s software, it could be labeled as soft quadrant removal ahead of a normal quadrant removal. or, since it is basically a reduction in the speed of acquisition and aspiration, it could be better labeled as slow quadrant removal or it could be first gear and second gear since it is analogous to using the first gear of an automobile to slowly pull away from the curb and then shift to second gear to build up speed and move along faster. as they watch the video monitor, they can usually anticipate when i will want to shift gears and they have their finger on the remote control ready to shift on command. regardless of the setting name, we have instantaneous flexibility within the procedure step toolbar so that we can toggle back and forth instantly and almost automatically between these two speeds. we can shift between them at any point in the quadrant removal process, depending on the speed we want to achieve given the quadrant s texture, size, and proximity to the capsule. it can be especially useful for the manipulation and aspiration of the fourth quadrant when the protective physical buffering effect of the other quadrants is no longer available. while crucial in soft nuclei, the epinucleus removal setting can be used to slow down the pace of surgery in lenses of average firmness (locs iii no or nc 3.7 or greater) as well. many times, if the normal quadrant removal setting is used, the tip may just bite off corners of the nucleus and not allow enough time for the tip aperture to bond to the quadrant and roll it centrally. so, if that happens for the left corner of the first quadrant, the epinucleus setting can be used to more slowly access the left corner of the second. the introduction of the small amount of torsional movement creates a better vacuum adhesion by the tip and allows a slow burrowing into the nucleus. this happens because it continually creates a newly modified surface to adhere to as it vibrates. once centralization and aspiration of the first portion of the first quadrant has been accomplished, the quadrant removal setting can be safely reengaged for removal of its remainder and subsequent quadrants as they will be no longer locked into position. acquisition and centralization of quadrants in that setting typically takes about 1/2 a second. as a caution, the shift to quadrant removal settings is instantaneous, so one must be ready for the instantaneously increased aspiration pace and amount of ultrasonic tip motion. it is merely a clinical report of adaptation to technology, complication analysis, and further adaptation. it would be more scientific if it were a properly designed controlled prospective study between the applications of two parameter / technique groupings in similar populations with statistical analysis included. however, that clinical study could not be reasonably undertaken given the knowledge gained through our empirical evolution of parameters and techniques. our study does importantly demonstrate the ability to reduce the pace of fragment acquisition and initial aspiration from 0.5 seconds to a much more manageable 1.5 seconds or longer, and the frequency of use of the soft cataract setting by this surgeon shows the efficiency and versatility of being able to shift between two speeds of phacoemulsification - assisted lens aspiration on the fly. the improvement in control and predictability has improved our confidence in the effectiveness and safety of the operation which we can deliver. such a study has been accomplished comparing 20, 23, and 25 gauge vitrectomy probes.16 vitreoretinal surgeons need to be able to accurately and consistently attract and remove fibrous tissue sheets and bands without aspirating and cutting nearby or adjacent retinal tissue. the study measured the amount of artificial membrane deflection (the attraction distance) as a function of lumen diameters and variably applied vacuum and aspiration flow rates. it demonstrated that larger - gauge instruments operating with lower vacuum and higher flow attracted tissue at a greater distance than smaller instruments with higher vacuum and lower flow. thus, the smaller probes would be more desirable as they would be less likely to inadvertently attract retinal tissue because they have a smaller distant sphere of influence than the larger ones. for phacoemulsification, some efficiencies of 0.9 mm diameter phacoemulsification tips compared to 1.1 mm tips have already been demonstrated.17 a study similar to the vitrectomy study could be accomplished using membrane deflection through a gel - simulating soft nuclear material as vacuum, flow, and phaco - tip movement, and maybe even tips smaller than 0.9 mm were studied. while the setting parameter values and setting menu toolbar displays may be different than the centurion s with its balanced tip, the principles described for optimization, versatility, and flexibility should apply to other machines and tips as well. in any situation, preoperative grading of cataracts according to the locs iii system can sort them into soft and normal and thus help dictate to the staff and surgeon which settings might be desirable to initiate removal of the first nuclear quadrant. regardless of the initial plan, if the cataract seems soft during sculpting, a soft quadrant removal setting can be initially engaged to provide an increased margin of safety as the first nuclear quadrant is acquired and aspirated. for soft lenses, i recommend a slower speed of phacoemulsification which can be achieved by using simultaneous linear control of empirically derived parameters of aspiration flow, vacuum, and torsional tip motion. with this setting integrated into a machine s toolbar, immediate shifting between slow and normal speeds provides increased efficiency and safety during removal of any nuclear material.	purposeto present a cause of posterior capsule aspiration and a technique using optimized parameters to prevent it from happening when operating soft cataracts.patients and methodsa prospective list of posterior capsule aspiration cases was kept over 4,062 consecutive cases operated with the alcon centurion machine and balanced tip. video analysis of one case of posterior capsule aspiration was accomplished. a surgical technique was developed using empirically derived machine parameters and customized setting - selection procedure step toolbar to reduce the pace of aspiration of soft nuclear quadrants in order to prevent capsule aspiration.resultstwo cases out of 3,238 experienced posterior capsule aspiration before use of the soft quadrant technique. video analysis showed an attractive vortex effect with capsule aspiration occurring in 1/5 of a second. a soft quadrant removal setting was empirically derived which had a slower pace and seemed more controlled with no capsule aspiration occurring in the subsequent 824 cases. the setting featured simultaneous linear control from zero to preset maximums for : aspiration flow, 20 ml / min ; and vacuum, 400 mmhg, with the addition of torsional tip amplitude up to 20% after the fluidic maximums were achieved. a new setting selection procedure step toolbar was created to increase intraoperative flexibility by providing instantaneous shifting between the soft and normal settings.conclusiona technique incorporating a reduced pace for soft quadrant acquisition and aspiration can be accomplished through the use of a dedicated setting of integrated machine parameters. toolbar placement of the procedure button next to the normal setting procedure button provides the opportunity to instantaneously alternate between the two settings. simultaneous surgeon control over vacuum, aspiration flow, and torsional tip motion may make removal of soft nuclear quadrants more efficient and safer.
a policy agenda at the european level is the reduction of social exclusion [13 ], defined as a process whereby certain individuals are pushed to the edge of society and prevented from participating fully. social exclusion is associated with reduced quality of life and health deterioration [5, 6 ]. older people have been identified as a population subgroup at particular risk of social exclusion (e.g.,). every second older person in england is experiencing social exclusion and in deprived urban areas in england two - thirds of older people experience social exclusion. while social exclusion has been explored in relation to a number of factors, including income, health, and disability, it has rarely been considered in relation to informal care - receipt. this is despite the fact that with increasing age older people require greater amounts of care and support and that informal care comprises the majority of this care. furthermore, research has shown that the transition to requiring care can reinforce social exclusion (cf.). this paper considers how dimensions of, as well as risk factors for, social exclusion are linked to informal care - receipt in older people. social exclusion is a multifaceted concept covering dimensions such as production activity, financial activities, social relations, social activity, and political / civic activity [12, 13 ]. lack of participation in or access to activities / services specified by these dimensions can be seen as indicators of social exclusion. within social exclusion research concerning older people scharf and colleagues propose that older people may experience social exclusion on the following dimensions : social relationships ; civic activities ; basic services ; neighbourhoods ; and material resources. by comparison a united kingdom (uk) government report defines social exclusion of older people in terms of exclusion on the following dimensions : social relationships ; cultural and leisure activities ; civic activities ; basic services ; neighbourhoods ; financial products ; and material goods. as can be seen, although there are different operationalisations what is apparent is that in social exclusion research on older people there is less emphasis on production activity and more emphasis on the importance of neighbourhood, also often discussed in terms of community. many older people have spent a substantial period of their lives in a particular neighbourhood, have strong emotional investments in the surrounding community, increasingly rely on neighbourhood relationships for support in old age, and also tend to spend more time than younger people in the immediate neighbourhood. research exploring risk factors for social exclusion among older people has identified an enhanced risk of social exclusion with increasing age and ethnic minority origin and, among those living alone, having no children, and being on low income [6, 8 ]. poor health, long - standing illness, and depression have also been found to increase the risk of social exclusion ([6, 8, 15 ], cf.). negative consequences of poor health can to some extent be compensated for by access to social and health care, thereby helping to prevent social exclusion. a few studies have focused on access to formal care in relation to social exclusion [11, 1820 ], but research on access to informal care (i.e., care provided by friends and family) in the context of social exclusion is very limited. this is surprising, since as noted previously the majority of all care for older people in the community is informal and recent research indicates that the level of informal care is increasing [21, 22 ]. as people age, a reduction in functional capacity occurs that increases their need for help with activities of everyday life. while the level of care received by an older person might be expected to map onto their need for care (due to, e.g., functional limitation and frailty), there are many factors that can disrupt this mapping resulting in unmet need for care in a significant minority of older people [2426 ]. unmet need can have serious consequences for an older person including increased mortality risk and also prevent them from participating fully in society. thus, unmet need for care could arguably place an older person at risk of social exclusion. the relationship between care - receipt and social exclusion could be hypothesised to take different forms. it could be argued that the level of care - receipt if directly mapping onto the level of need in the older person would be a marker for his / her level of social exclusion, given that higher levels of care received would be in response to higher levels of illness or frailty, that is, risk factors for social exclusion. yet care - receipt is linked to indicators of social inclusion such as the availability of, as well as access to, social networks, so an alternative hypothesis is that higher levels of contact with family and friends as a result of being a care - receiver might serve to reduce social exclusion. there is also the critical issue of where the level of care - receipt is not appropriate to need : where need for care exists but care is not received, is the degree of social exclusion particularly high ? this paper aims to examine the relationship between social exclusion and the receipt of informal care and reports the analysis of relevant data from the barnsley social exclusion in old age study, which sought to explore social exclusion among older people via a survey of over 1,000 respondents (see also). a questionnaire survey was carried out in the metropolitan area of barnsley, england, uk. barnsley was selected as the study site since it encompasses both urban and rural areas, allowing the exploration of how social exclusion processes might differ in such contrasting areas. to ensure adequate cell size at subgroup level for specific analyses, a sample of n = 600 for each of the two areas (i.e., n = 1200) was proposed, providing good statistical power for the analyses reported in this paper. sampling occurred from seven electoral wards with an urban profile and from 16 electoral wards with a rural profile. within each electoral ward with oversampling of households required in order to obtain sufficient participants, a total of 11,035 households were sampled. potential participants were ineligible if they were under 65 years of age and were excluded from the study if their physical and/or mental health was too poor to allow them to complete an interview or respond to questions reliably ; 59 individuals were excluded from the study as a result of this latter criterion. only one older person was recruited per household regardless of whether more than one older person resided at a given address. in total 1,255 older people participated in the study, of whom 6.5% the response rate was 68.1% and did not differ significantly between urban and rural areas. a questionnaire was developed that addressed a range of indicators of, as well as risk factors for, social exclusion, together with the topic of care - receipt. given the potential frailty of some respondents, the need to keep the questionnaire concise meant that brevity was a key criterion during instrument selection. on occasion items and scales were adapted to more precisely address the study population or agenda. an item used in the eurofamcare study to identify informal carers was adapted to produce a categorical variable of informal care - receipt : do you rely on a friend or relative (including your partner or other people in your household) to provide you with care or support for four hours per week or more ? (response categories : yes / no). participants who responded no were asked : do you have someone who looks in on you to see if everything is all right ' ? (cf.) (the three response categories were yes ; no, no need ; and no, despite need). this procedure therefore produced a four - category variable of care - receipt. in this article, the following dimensions of social exclusion were considered : financial resources ; social relationships ; community ; and social engagement. financial resources were operationalised via the following item measuring income discomfort : which of these descriptions comes closest to how you feel about your household 's income nowadays ? with response options ranging from very comfortable on present income (1) to very difficult on present income (5). social relationships were measured via items on social contacts, informal caregiving, and loneliness. for data on social contacts a question asked how often do you meet and spend time with any of the following people ? independent responses were required for family members (six categories), neighbours, and friends [32, 33 ]. for family member contact responses were coded as weekly contact or more (1) or less than weekly contact (0) for each category and items summed to indicate overall level of contact (scores ranging from 0 to 6, high scores indicating high contact). for the two categories of nonfamily members responses were combined and coded for analysis as no contact (0), at least twice weekly contact with friends or neighbours (1), or at least twice weekly contact with friends and neighbours (2). the informal care item in the eurofamcare study mentioned above was used in its original form for measuring informal caregiving, that is, have you a friend or relative (including your partner or other people in your household) who relies on you to provide them with care or support for four hours per week or more ? (response categories : yes / no). loneliness was measured by the de jong gierveld loneliness scale, in which respondents indicate the extent to which 11 statements relating to loneliness apply to their situation and the way they feel now, with response options yes, more or less, and no. the items are scored in relation to two subscales : emotional loneliness (scale range 06, sample cronbach =.81) and social loneliness (scale range 05, sample cronbach =.76). respondents were asked to what extent they agreed with each of 13 statements about their local community, defined as within 20 minutes ' walk or about a mile from home. example items are i feel really part of this area ; vandalism and graffiti are a big problem in this area (response scale from strongly agree (1) to strongly disagree (4) [7, 8, 35 ]). for data on social engagement participants were asked, first, to consider for how often, if at all, do you engage in the following activities ? and record a response for twenty different activities. example activities are go out for a meal ; attend leisure activities (e.g., dancing, bingo or attend a social club) ; tend to the garden or allotment (response scale several times a week (6) to never (0)) and, second, to indicate for each applicable activity if it is performed usually with somebody (3), sometimes with somebody (2), or usually alone (1) [32, 33 ]. the product of participants ' engagement scores and socializing scores resulted in a single social engagement this study considered the following risk factors for social exclusion : sociodemographic characteristics ; health ; and well - being. the questionnaire contained standard items addressing sociodemographic characteristics : age ; gender ; marital and coresident status ; ethnicity ; and duration of local residence. education was measured by an item with six response categories, merged into two broader categories for analysis : low education (highest level, completed school, no qualification / certificate) and medium to high education (lowest level, completed school with qualification / certificate). self - reported health was assessed via the item : in general, would you say your health is measured on a five - point scale (excellent (1) to very poor (5)). psychological well - being was measured using the world health organisation-5 well - being index (who-5 ; scale range 025 (high score = high well - being) ; sample cronbach =.87). finally information on formal care - receipt was gathered via items asking if the participant had in the last month received medical care, personal care (e.g., from a district nurse), or practical support (e.g., from social services, home help, and warden) ; response categories for all items were yes / no. in order to ensure standardisation of data collection procedures and maximise interviewer sensitivity to reliability issues (e.g., physical or mental health problems in respondents, the influence of people present during interviews), training therefore amounted to a few hours (for experienced interviewers) to two days (for inexperienced interviewers). upon selection an interviewer subsequently visited the address to establish whether anybody in the household was 65 years or older and, if so, whether this person was willing to participate in an interview. seventy - eight percent of the interviews were conducted alone with the interviewee, while the rest were carried out with the interviewee accompanied, usually by a family member. interviewers completed several items at the end of the questionnaire as a quality check addressing whether or not the respondent had tried to answer the questions to the best of his or her ability ; whether the respondent understood the questions ; and whether anyone was present during the interview that could have interfered with the interview. there was also an option for the interviewer to write additional information about the interview. where data drawn from these items indicated a problem with the interview, researchers discussed the problem with the interviewer, and if there was a suggestion that the reliability of the data could be suspected, the interview was excluded from the study. data were analysed using the ibm statistical package for social science (spss) 22.0 for windows. scale development occurred for items on perception of the local community and social engagement, utilizing principle components analysis and reliability (cronbach) analyses with item trial removal. three subscales of perceptions of the local community were developed : perceived community trust (3 items, m = 11.4, sd = 1.89, and =.68) ; perceived community integration (4 items, m = 15.6, sd = 2.39, and =.69) ; and perceived community security (3 items, m = 9.53, sd = 3.27, and =.80). two reliable subscales of social engagement were developed : social, cultural and leisure activity (7 items, m = 26.14, sd = 18.42, and =.65) and sport and outdoor activity (5 items, m = 12.40, sd = 13.06, and = 0.56). bivariate analyses identified significant associations between the dependent variable (dv ; the categorical care - receipt variable) and independent variables (ivs ; indicators of and risk factors for social exclusion and other assessed variables). one - way anova was performed for continuous ivs, with hochberg 's gt2 and games - howell tests as appropriate for post hoc analysis of group differences ; chi - square procedures were used for categorical ivs. a multinomial logistic regression was then performed to determine those ivs that predicted membership of the categories of care - receipt in a multivariable model. no adjustment to experimental alpha was made for multiple testing ; significance for each test was set at p the substantial sample size significant tests should be regarded cautiously and with thought to effect size. regarding care - receipt 21.8 percent of the respondents were care - receivers and 24.1 percent were assurance - receivers, while 5.5 percent were nonreceivers with need and 48.6 percent were nonreceivers without need. a brief summary of the bivariate analyses is described below, with a full presentation of the results of the analyses in table 2. for the sake of concision ivs with nonsignificant associations with the dv are not presented. at the top of the table bivariate associations between care - receipt status and social exclusion dimensions are presented. in post hoc tests nonreceivers without need had significantly lower dissatisfaction with household income than care - receivers and nonreceivers with need. post hoc tests also showed that family contact was significantly lower, and social loneliness and emotional loneliness was significantly higher in nonreceivers with need compared to the three care - receipt categories, and the lowest proportion of older people with contact with friends and neighbours was also found in this group. post hoc tests also indicated that nonreceivers without need were significantly lower on both social and emotional loneliness than care - receivers and lower on emotional loneliness than assurance - receivers. other post hoc tests indicated that nonreceivers with need scored significantly lower on perceived community integration than older people in the other three care - receipt categories. for perceived community trust and perceived community security post hoc tests indicated significantly lower scores for nonreceivers with need and care - receivers compared to assurance - receivers and nonreceivers without need. finally, post hoc tests indicated that nonreceivers without need had significantly higher scores on social, cultural and leisure activity and sport and outdoor activity than older people in the other three care - receipt categories. in the next part of table 2 analyses of risk factors of social exclusion are presented. of the categorical ivs gender, coresident status, education, and place of residence were all significantly associated with care - receipt. of the continuous ivs, in post hoc tests, post hoc tests determined that duration of local residence was significantly greater in care - receivers and nonreceivers with need than among assurance - receivers and nonreceivers without need. for measures of self - rated health and well - being post hoc tests indicated that nonreceivers without need differed significantly from those in the other three categories, having better self - reported health and better well - being. in addition, post hoc tests indicated that care - receivers had poorer self - reported health and well - being than assurance - receivers. at the bottom of table 2 the highest level of medical care receipt was found among nonreceivers with need, with the lowest level in nonreceivers without need. this pattern differed in comparison with formal personal care - receipt and formal practical support - receipt as care - receivers and assurance - receivers were those with the highest proportion in receipt of these formal services. the nonreceivers without need category was used as the reference category for the dv in the multinomial logistic regression. ivs entered into the regression consisted of those established through bivariate analysis to be significantly associated with care - receipt. the iv social, cultural and leisure activity was recoded from a 5-point to a 3-point scale to reduce the number of cells in the model. following trial runs best model fit statistics were obtained when nonfamily contact and perceived community security were deleted. due to missing data model n = 980 (see table 3). in comparison to a constant - only model the model was reliable ((51) = 488.68, p.05, nagelkerke r =.43). table 3 presents for all variables in the model the wald test for significance of each coefficient and the odds ratio with 95% confidence intervals for each of the three comparisons between the three care - receipt categories and the reference category. we consider first the prediction of membership in the care - receiver category relative to being in the reference category. starting with social exclusion variables, a unit increase in perceived community trust and social, cultural and leisure activity corresponded to 0.87 and 0.98 odds of being a care - receiver, and participants at the lowest and middle levels of sport and outdoor activity had, respectively, 4.79 and 1.93 odds of being a care - receiver compared with participants at the highest level. regarding risk factors of social exclusion, a unit increase in age corresponded to a 1.06 increase in the likelihood of being a care - receiver ; participants in the rural group had 0.38 odds of being a care - receiver compared to the urban group ; a unit increase in (poor) self - reported health corresponded to a 2.54 increase in the likelihood of being a care - receiver. regarding formal care use, participants who had received medical care had 2.81 odds of being a care - receiver compared to those who had not received medical care. next we consider prediction of membership in the assurance - receiver category relative to the reference category. regarding social exclusion variables, one - unit increase in family contact and emotional loneliness corresponded, respectively, to 1.21 and 1.16 increases in the likelihood of being assurance - receivers, while participants at the lowest and middle levels of sport and outdoor activity had, respectively, 1.85 and 1.71 odds of being assurance - receivers compared with participants at the highest level. regarding social exclusion risk factors, a unit increase in age corresponded to a 1.05 increase in the likelihood of being an assurance - receiver ; male participants had 0.63 odds of being assurance - receivers compared to female participants ; participants in the rural group had 0.49 odds of being assurance - receivers compared to the urban group ; a unit increase in duration of local residence corresponded to 0.99 odds of being assurance - receivers ; a unit increase in (poor) self - rated health corresponded to a 1.30 increase in the likelihood of being assurance - receivers. finally, participants who had received medical care had 1.51 odds of being assurance - receivers compared to those who had not received medical care. lastly, we considered prediction of membership in the nonreceivers with need category relative to being in the category nonreceiver without need. regarding social exclusion dimensions, analyses show that a unit increase in social loneliness corresponded to a 1.39 increase in the likelihood of being nonreceivers with need. regarding risk factors of social exclusion, a unit increase in age corresponded to a 1.07 increase in the likelihood of being nonreceivers with need ; participants in the rural group had 0.26 odds of being nonreceivers with need compared to the urban group. finally, participants who had received medical care had 5.82 odds of being nonreceivers with need compared to those who had not received medical care. our multivariable analysis produced a significant model that predicted older people 's membership of care - receipt categories on the basis of social exclusion dimensions and a range of risk factors for social exclusion. greater age, recent contact with medical care, and poorer health, all being meaningful indicators of frailty and/or need for support in an older person, increased participants ' likelihood of being an assurance - receiver and were associated with an even greater likelihood of being a care - receiver, relative to being a nonreceiver with no need. another variable significant in the model, sport and outdoor activity, is included in the social exclusion dimension social engagement. the picture that emerges from the model is that older people with higher scores on dimensions of and risk factors for social exclusion were significantly more likely to be in receipt of assurance and care. membership of the nonreceivers with need category was also predicted by indicators of frailty (greater age, recent contact with medical services) and an indicator of social exclusion (greater social loneliness). if one examines the pattern of bivariate associations between the ivs and the care - receipt variable, nonreceivers with need in comparison to older people in the other categories demonstrated the highest levels of social and emotional loneliness and the lowest levels of income comfort, social contact (with family members, friends and neighbours), social engagement (social, cultural and leisure engagement), perceived community integration, trust, and security, indicating that these older people experienced the highest levels of social exclusion. if the categories of care - receipt are considered as a continuum with nonreceivers without need as one end of the continuum, then nonreceivers with need would exist at the other end : the odds ratios for greater age and recent contact with medical services are larger for this category than for care - receivers and assurance - receivers. however, other variables uniquely contributed to membership of different care - receipt categories, suggesting that nonreceivers with need, care - receivers, and assurance - receivers might differ as social positions or roles not just in terms of degree lower perceived community trust and social, cultural and leisure activity increased the likelihood that a participant was a care - receiver ; being female, greater family contact, and greater emotional loneliness increased the likelihood that a participant was an assurance - receiver ; and greater social loneliness increased the likelihood that a participant was a nonreceiver with need. when seeking to conceptualise care - receipt in older people, therefore, one model would be that the experience of care - receipt is a progression through increasing levels of support and care until in many cases the informal care network breaks down. a different model would be that whether one is a care - receiver or an assurance - receiver or a nonreceiver with need is not about the current occupation of one role within a progression of care - receipt, but rather an outcome of that role being more likely when other factors are true, for example, as where being female and having recent contact with one 's family increase the odds that one is an assurance - receiver. an irish study of care - receipt among older people reported that 49% of older people received care over a 12-month period. the study used a broad definition of care - receipt, including people receiving care once weekly or less. this corresponds in our study to those participants in the care - receipt and assurance - receipt categories combined, which comprised 46% of our sample, a similar figure. the present study 's focus on the concept of assurance - receipt is relatively unique : most studies explore the issue of caregiving among burdened carers, that is, those providing many hours of care each week, with few focusing on light carers, and by extension older people in receipt of only a few hours of care (cf.). a question posed in the introduction to this paper was whether being a care - receiver might be associated with lower levels of social exclusion, as care - receipt is almost by definition linked to contact with friends and family, an indicator of social inclusion. being a care - receiver was not significantly associated in the multivariable model with greater contact with friends or greater contact with family. furthermore care - receipt was predicted by lower perceived community trust, suggesting that care - receipt might be linked to a poorer relationship with one 's neighbourhood, another indicator of social exclusion. while one predictor of being an assurance - receiver was greater contact with one 's family, this indicator of inclusion has a counterbalance in the association between being an assurance - receiver and greater emotional loneliness. barrett. argue that home - based formal care contributes to a disconnectedness of the care - receiver from self, family, home, and the broader community, thereby contributing to social exclusion (see also). in the multivariable analysis one of the key predictors of membership in the different care - receipt categories there is a lack of research on rural / urban patterns of informal care - receipt, and the findings from the existing research are contradictory. for example, in line with our findings, it has been suggested that american urban older residents are more likely to have informal support from kin and to have children living nearby, as there is a general pattern of outmigration of children from rural areas and an in - migration of older people to rural areas. on the other hand, canadian research indicates that informal care - receipt is more common among rural residents. with regard to our findings, since several demographic, health, and social variables were controlled for in our analysis, we suggest it is likely a complex interaction of personal, demographic, and social factors related to residence in urban environments that produced high levels of care - receipt and an unmet need for assurance, relative to residence in rural areas. more research is needed in order to obtain a deeper understanding of the mechanisms behind rural / urban care - receipt patterns. one spanish study on older people in need of help with activities of daily living identified a group of older people (5.9% among women, 7.9% among men) who did not receive help, and a canadian study found that approximately 2% of older people outside institutions experienced unmet care needs. in our study such a group was represented by the nonreceivers with need, which comprised 5.5% of our sample. this group was found to score highly on several dimensions of and risk factors for social exclusion (cf.). of interest is the fact that we found that older people with higher levels of care - receipt received more formal personal care and formal practical support. the exception to the pattern was the nonreceivers with need, where despite a lack of informal care and assurance there were also low levels of formal personal care and formal practical support. however, this group had the highest level of recent contact with medical services, a relationship also found in the spanish study mentioned above. similarly, recent research has found that lonely older people have a higher use of health care services than nonlonely people and that loneliness and social isolation are a common nonmedical problem presented by noncritically ill older people in emergency departments (, for a review, see). one interpretation of this finding is that, in the absence of informal care and in the presence of need, older people will turn to medical services (perhaps primary care practitioners) in order to address their unmet need. whatever the contributory factors, an opportunity exists during contact with medical care providers whereby identification and assessment could offer a route into referral for appropriate formal personal care and/or formal practical support. this recommendation is in line with previous calls for integrated care and joined - up services for older people, and programmes have been targeted at referral of medical care patients to social services (e.g.,). potential savings in medical care services that follow such referrals might compensate for increased costs to the social care budget. there is therefore a need for more emphasis on the issue of unmet need in older people within the education of medical and nursing practitioners and their own significant role in appropriate onward referral. this study provides valuable insights into the personal, interpersonal, and social factors related to informal care - receipt in older people, a topic that has received relatively little attention. the experience of care - receipt can last for a substantial amount of an older person 's life and its nature and content impact significantly on quality of life. the present study indicates that the need for and receipt of informal care in an older person is connected to dimensions of, as well as risk factors for, social exclusion. in our model, as older people 's scores on dimensions of and risk factors for social exclusion increased so did the odds of them being care - receivers, or being nonreceivers with need. very little evidence emerged that the receipt of care or assurance was associated with social inclusion. our findings suggest that access to informal care is important to consider when studying social exclusion processes, in that the receipt of informal care may be a marker of social exclusion, that is, that older people relying on informal care may not be integrated into society and may have unmet social needs.	older people have been identified as being at risk of social exclusion. however, despite the fact that care is commonly required in later life and the majority of that care is provided by informal carers, a connection between social exclusion and informal care - receipt has rarely been considered. the aim of this study was to examine how informal care - receipt is related to social exclusion. a face - to - face questionnaire survey on social exclusion and informal care - receipt was carried out among older people (n = 1255) living in barnsley, united kingdom. multivariable analyses examined the association between social exclusion and categories of informal care - receipt : care - receiver ; assurance - receiver ; nonreceiver with no need ; and nonreceiver with need. compared to being a nonreceiver with no need, participants were more likely to be care - receivers or assurance - receivers if they had higher levels of social exclusion. the highest level of social exclusion, however, was found in nonreceivers with need. despite a lack of informal care and support, formal practical support and personal care were also low in this latter group. findings are discussed in relation to the conceptualisation of care - receipt and how contact with medical services could be an opportunity for identification and appropriate referral of nonreceivers with need.
the level of work safety stems from the impact of the energetic hazard factor and the attitudes and behaviour of employees. the quality of the applied technical solutions is being constantly improved, reaching a satisfactory level, and therefore the reasons explaining why accidents (dangerous incidents) happen are frequently attributed to the way work tasks are carried out. inattention and failure to follow the required applicable regulations are habitually the main cause of accidents and material loss. a thesis can be put forward propounding that there are reasons why people behave in a way that leads to an accident. these reasons may take the form of barriers, and their identification and elimination can ensure safer workplaces. human error (human factor error) human error is defined as an action which deviates from the required standards and requirements of a situation.[15 ] we can distinguish omission (negligence) errors and execution errors (giving wrong instruction or providing wrong information, wrong sequence of task realization, run - time errors) which appear when the required procedures or standards of conduct are breached. as the surveys demonstrate, not only the improvement of working conditions, but also the elimination of dangerous behaviours and dangerous activities results in the rise of workplace safety levels.[610 ] therefore, the behaviour - based safety (bbs) methodology is becoming increasingly popular. the methodology is based on the assumption that the level of occupational health and safety (ohs) depends on the combination of three measurable factors : an employee, their behaviour and the environment. bbs encourages the employees to get involved in the issues of work safety improvement (joint responsibility for the ohs level). in poland, the term ohs management became popular in the mid-1990s and involved principally matters connected with the organization and decision - making processes in a company. the need to implement the health and safety management rules was enforced not only by low efficiency of the analysis methods of safety condition used at that time, but also by legal aspects (the need to adjust the legal solutions in poland to the requirements applicable in the member states of the european union), economical aspects (different insurance premiums) and social reasons (no consent to work in high hazard and accident conditions). the management process of the ohs must provide means and tools ensuring proper monitoring of the undertaken actions and their supervision along all management levels. these objectives are realized, among other things, by the use of audit examinations of the health and safety management system. in accordance with the polish standard, audit is a systematic and independent examination with the aim to determine whether proper actions are undertaken, whether the obtained results correspond to the expected arrangements and whether these arrangements have been implemented. with respect to the audit of the health and safety management system, every employee can participate in the assessment process of the health and safety management system. in the audit examinations of the health and safety management system we can single out a strategic audit (company level), tactical audit (level of company organizational units) and operational audit (executive level). in each of these cases, both the internal and external audits can be performed. the examinations can include the entire community (surveys of the entire population, called exhaustive surveys) or the selected units only (called non - exhaustive surveys). this article discusses the results of an external audit performed on a group of employees from two mining departments, i.e., departments g-1 (129 people) and g-2 (143 people) at jan, a coal mine. the author 's questionnaire based on the method management evaluation regarding itemised tendencies (merit) method was used in the surveys. the number of people in the two groups taking part in the audit ranged from 80 to 123, which accounted for 6286% of the total number of employees working in the departments. the audit examinations were carried out every quarter between 2002 and 2012, and they were developing the research problem investigated by the author in his doctoral dissertation. questionnaire surveys were used for the quality assessment of health and safety management at the organizational level (departments) selected for the audit from the organizational structure of jan. in such surveys, three basic phases can be identified : survey design phase, data collection phase and result analysis phase. in the first phase the problem is formulated the second phase includes the analysis of secondary data, the determination of the primary data collection method, the testing of research tools and the execution of surveys, while the third phase consists of the analysis and interpretation of data and the assessment of results. in the questionnaire surveys, the respondents replied in writing to 26 questions divided into 12 problem areas (a l) : area a. assessment of task setting at the department, taking into consideration the ohs issues.area b. assessment of work adjustment to psychophysical abilities of the employees.area c. assessment of the reliability of machines and work tools as well as their availability at workplaces.area d. assessment of the knowledge of ohs issues necessary for safe working.area e. assessment of the promotion quality of ohs principles at workplaces within the department.area f. assessment of the incentives motivating to safe work at the department.area g. assessment of the occupational risk related to the performed activities.area h. assessment of the knowledge of near - miss incident investigations conducted at the department.area i. assessment of the knowledge of the principles of modern health and safety management.area j. assessment of the quality of ohs training carried out at the department.area k. assessment of the organization of safe work at the department.area l. assessment of law and order at the department. area a. assessment of task setting at the department, taking into consideration the ohs issues. area c. assessment of the reliability of machines and work tools as well as their availability at workplaces. area e. assessment of the promotion quality of ohs principles at workplaces within the department. area h. assessment of the knowledge of near - miss incident investigations conducted at the department. area i. assessment of the knowledge of the principles of modern health and safety management. each respondent was to choose only one answer to each of the questions, scored from 0 to 5 (0 = fail, 5 = ideal), i.e., the answer which, in their opinion, provides the best description of the realization status of the activities undertaken in a specific health and safety management area at their department. based on the obtained answers, rating indexes were determined for individual problem areas (wopi), and then the health and safety management quality rating index (w jo) was determined for the entire department as the arithmetic mean of wopi values. the mathematical model used in the examinations the values of partial (wopi) and final (w jo) ratings are shown in figures 14. department - wide operational audit of the health and safety management system : values of the final rating index jo in successive editions for departments g-1 and g-2. department - wide operational audit of the health and safety management system : arithmetic means of wopi ratings for individual problem areas between 2002 and 2012. department - wide operational audit of the health and safety management system (department g-1) : summary of wopi rating indexes between 2002 and 2012. note : wopi = partial rating. figure 4. department - wide operational audit of the health and safety management system (department g-2) : summary of wopi rating indexes between 2002 and 2012. department - wide operational audit of the health and safety management system : values of the final rating index jo in successive editions for departments g-1 and g-2. department - wide operational audit of the health and safety management system : arithmetic means of wopi ratings for individual problem areas between 2002 and 2012. department - wide operational audit of the health and safety management system (department g-1) : summary of wopi rating indexes between 2002 and 2012. note : wopi = partial rating. department - wide operational audit of the health and safety management system (department g-2) : summary of wopi rating indexes between 2002 and 2012. note : wopi = partial rating. the summary of evaluation measures of goodness of fit between the trend function and the set of empirical data is presented in table 1. the areas of variability and mean values of wopi ratings in individual problem areas are provided in table 2. the values of variability index for each of the problem areas in the consecutive years are provided in table 3, and the seasonal fluctuations are specified in tables 4 and 5. evaluation measures of goodness of fit between the theoretical data of the trend function and the set of empirical data.departmentproblem areats(et)rs(a)s(b)g-1at = 0.0057 t + 3.08610.05690.63130.00060.0162 bt = 0.0019 t + 2.97120.02570.46800.00060.0145 ct = 0.0063 t + 3.58420.06090.64620.00070.0183 dt = 0.0033 t + 3.22390.02890.68800.00090.0244 et = 0.0082 t + 3.18240.09880.53630.00070.0170 ft = 0.0053 t + 3.14610.05720.58800.00090.0221 gt = 0.0043 t + 4.15530.04050.65820.00050.0141 ht = 0.0082 t + 2.64190.06390.73600.00050.0122 it = 0.0096 t + 2.83550.07860.71650.00030.0071 jt = 0.0101 t + 2.51740.12090.53890.00030.0079 kt = 0.0158 t + 3.39560.12290.73500.00040.0112 lt = 0.0022 t + 3.03620.04270.30100.00070.0169g-2at = 0.0029 t + 2.39770.05290.33690.00060.0162 bt = 0.0046 t + 2.59920.04720.61180.00060.0145 ct = 0.0054 t + 2.98720.29300.58480.00080.0183 dt = 0.0084 t + 3.42320.07940.65140.00090.0244 et = 0.0049 t + 2.21730.05550.56520.00070.0172 ft = 0.0101 t + 2.49680.07210.76800.00090.0221 gt = 0.0029 t + 2.63650.04580.39760.00050.0141 ht = 0.0032 t + 1.94740.03970.52480.00050.0122 it = 0.0014 t + 1.94570.02330.37640.00030.0071 jt = 0.0016 t + 2.45750.02580.40290.00030.0079 kt = 0.0096 t + 2.61460.03650.92100.00040.0112 lt = 0.0093 t + 2.93630.05510.82930.00070.0169note : t = linear trend function (t =, where a, b = estimated structural parameters of the linear trend function, t = time) ; s(e t) = standard deviation of residual component (mean error of estimate) ; r = coefficient of determination ; s(a) = standard error of structural parameter a of linear trend function ; s(b) = standard error of structural parameter b of linear trend function. table 2. areas of variability and mean values of partial ratings for departments g-1 and g-2. wopiminwopimaxo (wopi)problem areag-1g-2g-1g-2g-1g-2a3.022.353.392.573.222.46b2.872.523.082.853.012.70c3.223.003.593.303.443.11d3.203.353.413.823.303.61e2.892.153.552.453.372.33f3.012.033.422.553.262.27g4.102.554.372.804.252.70h2.291.922.772.102.462.02i2.771.853.232.013.051.98j2.472.453.112.582.742.49k3.092.554.053.053.752.83l2.992.483.172.903.082.73note : wopi min = minimum value of partial assessments wopi ; wopi max = maximum value of partial assessments wopi ; o (wopi) = mean value of partial assessments wopi ; g-1, g-2 = departments. year 20022003200420052006200720082009201020112012departmentproblem areav (wopi)g-1a0.5392.6421.4051.0750.6550.8901.0222.4840.6511.0001.851 b0.3202.0460.3320.9460.2710.4180.1661.3360.3150.3150.559 c0.6702.2711.0602.6481.0490.9470.9873.0760.7711.9960.725 d0.5230.3070.5901.1390.6650.8700.7110.9320.5190.9920.764 e1.5197.9290.8953.6190.3441.1851.2913.3131.7660.8140.776 f0.3123.2861.0253.0520.8650.5860.3832.6211.0170.3440.737 g1.2630.9840.8960.2350.5760.5740.6960.5540.9881.0930.230 h4.5904.3911.6573.1910.6671.3120.5300.7261.2530.4251.659 i2.5640.7413.2423.5131.6021.7300.3171.0410.9010.8651.240 j0.4314.0950.7132.0201.2780.8001.0273.9256.0601.2430.915 k1.7527.1362.1424.8432.6991.0451.2470.2550.8401.8871.193 l0.8231.2760.8160.8161.2870.9241.1100.0001.1371.6941.538g-2a0.5700.8510.6270.0003.2680.3241.1870.7711.0170.6860.926 b1.4202.4630.7780.9511.0832.6211.0791.8652.3280.8971.062 c0.8300.8300.8231.3392.9073.5342.8462.0051.5752.0021.804 d2.1981.7531.3532.4920.5612.4222.4121.0681.7960.0000.930 e1.1562.8252.0701.2421.2151.2423.0662.0261.0702.7231.008 f0.9850.6143.5711.7461.1052.2991.1433.8773.4362.7521.451 g1.8450.9301.4101.5050.9130.3711.7491.5601.6180.8840.544 h2.3571.2012.6992.3171.7221.7222.2281.2122.4121.7961.198 i1.2432.5970.5891.0451.4361.0450.8680.5800.7530.2500.250 j0.6101.2510.9881.0150.4010.8250.0001.1660.4601.1301.581 k2.3550.9841.3230.8841.2121.7890.8241.5781.1571.1180.952 l1.0211.0090.6000.4981.0811.2490.8910.9970.8371.2260.764note : v (wopi) = variability index of partial assessments wopi. department g-1 : raw and adjusted frequency indexes for individual quarters by problem area. raw seasonal indexes adjusted seasonal indexesproblem area1st quarter2nd quarter3rd quarter4th quarteradjustment factor1st quarter2nd quarter3rd quarter4th quartera0.00240.00120.01900.01800.00060.00170.00060.01970.0174b0.00110.00520.01400.00590.00100.00010.00620.01300.0069c0.00080.00200.00480.00250.00090.00170.00110.00390.0033d0.00590.00010.00290.00420.00030.00620.00040.00270.0039e0.00180.00100.01830.01530.00050.00230.00040.01770.0159f0.00260.00720.00070.00120.00100.00360.00620.00030.0023g0.01010.01370.00760.00940.00040.01060.01330.00720.0099h0.01210.00150.00060.01060.00010.01220.00140.00040.0104i0.02070.01690.01460.00950.00030.02110.01660.01430.0099j0.00500.00230.02790.03110.00100.00400.00100.02700.0320k0.00900.02680.03170.04520.00110.01000.02600.03100.0460l0.00880.00540.00770.00810.00090.00800.00600.00900.0070 table 5. department g-2 : raw and adjusted frequency indexes for individual quarters by problem area. raw seasonal index adjusted seasonal indexproblem area1st quarter2nd quarter3rd quarter4th quarteradjustment factor1st quarter2nd quarter3rd quarter4th quartera0.00870.00330.00110.00640.00000.00870.00330.00110.0064b0.02030.00690.00320.00680.00090.01950.00780.00410.0076c0.23260.24070.25610.24690.24410.01150.00340.01200.0029d0.00310.01530.00090.00880.00110.00420.01420.00010.0099e0.00380.00330.01180.00760.00070.00310.00250.01260.0069f0.01350.00190.00720.00350.00020.01330.00210.00750.0037g0.00100.00060.00770.01060.00080.00020.00150.00850.0098h0.01190.00420.00350.01310.00010.01200.00430.00340.0129i0.00670.01560.00060.00890.00020.00690.01540.00050.0090j0.00290.00090.00840.00230.00060.00400.00100.00800.0030k0.00470.01130.00010.00500.00040.00500.01100.00000.0050l0.00720.00440.00060.00580.00090.00800.00400.00000.0050 note : t = linear trend function (t =, where a, b = estimated structural parameters of the linear trend function, t = time) ; s(e t) = standard deviation of residual component (mean error of estimate) ; r = coefficient of determination ; s(a) = standard error of structural parameter a of linear trend function ; s(b) = standard error of structural parameter b of linear trend function. note : wopi min = minimum value of partial assessments wopi ; wopi max = maximum value of partial assessments wopi ; o (wopi) = mean value of partial assessments wopi ; g-1, g-2 = departments. note : v (wopi) = variability index of partial assessments wopi. a linear trend function was used for the description of changes in the rating indexes. in the case of the values of the final rating index w jo, the fitting of the trend function for the investigation results of both departments was similar : for department g-1 the coefficient of determination r was 0.7147 (trend function t = 0.0043 t + 3.148) and for the department g-2 it was 0.7737 (trend function t = 0.0021 t + 2.5549). with reference to the individual areas, the best fitting of the trend function (table 1) was for areas : k assessment of the organization of safe work at the department (department g-2) : 92.1% (standard error of parameter a = 0.0004, standard error of parameter b = 0.0122),l assessment of law and order at the department (department g-2) : 82.9% (standard error of parameter a = 0.0007, standard error of parameter b = 0.0169),f assessment of the incentives motivating to safe work at the department(department g-2) : 76.8% (standard error of parameter a = 0.0009, standard error of parameter b = 0.0221), assessed within the scope of the department wide operational audit carried out in department g-2. k assessment of the organization of safe work at the department (department g-2) : 92.1% (standard error of parameter a = 0.0004, standard error of parameter b = 0.0122), l assessment of law and order at the department (department g-2) : 82.9% (standard error of parameter a = 0.0007, standard error of parameter b = 0.0169), f assessment of the incentives motivating to safe work at the department (department g-2) : 76.8% (standard error of parameter a = 0.0009, standard error of parameter b = 0.0221), with respect to the department - wide operational audit carried out in department g-1, the best fitting of the trend function was observed for areas : h assessment of the knowledge of near - miss incident investigations conducted at the department : 73.6% (standard error of parameter a = 0.0005, standard error of parameter b = 0.0122),k assessment of the organization of safe work at the department : 73.5% (standard error of parameter a = 0.0004, standard error of parameter b = 0.0112),i assessment of the knowledge of the principles of modern health and safety management : 71.7% (standard error of parameter a = 0.0003, standard error of parameter b = 0.0071). h assessment of the knowledge of near - miss incident investigations conducted at the department : 73.6% (standard error of parameter a = 0.0005, standard error of parameter b = 0.0122), k assessment of the organization of safe work at the department : 73.5% (standard error of parameter a = 0.0004, standard error of parameter b = 0.0112), i assessment of the knowledge of the principles of modern health and safety management : 71.7% (standard error of parameter a = 0.0003, standard error of parameter b = 0.0071). the worst fitting of the trend function was observed for areas : l assessment of law and order at the department (department g-1) : 30.1% (standard error of parameter a = 0.0007, standard error of parameter b = 0.0169),a assessment of task setting at the department, taking into consideration the ohs issues (department g-2) : 33.7% (standard error of parameter a = 0.0006, standard error of parameter b = 0.0162),i assessment of the knowledge of the principles of modern health and safety management (department g-2) : 37.6% (standard error of parameter a = 0.0003, standard error of parameter b = 0.0071),g assessment of occupational risk related to the performed activities (department g-2) : 39.8% (standard error of parameter a = 0.0005, standard error of parameter b = 0.0141). l assessment of law and order at the department (department g-1) : 30.1% (standard error of parameter a = 0.0007, standard error of parameter b = 0.0169), a assessment of task setting at the department, taking into consideration the ohs issues (department g-2) : 33.7% (standard error of parameter a = 0.0006, standard error of parameter b = 0.0162), i assessment of the knowledge of the principles of modern health and safety management (department g-2) : 37.6% (standard error of parameter a = 0.0003, standard error of parameter b = 0.0071), g assessment of occupational risk related to the performed activities (department g-2) : 39.8% (standard error of parameter a = 0.0005, standard error of parameter b = 0.0141). the downward tendencies of the trend function were observed for four problem areas : c assessment of the reliability of machines and work tools as well as their availability at workplaces (a = 0.0063), f assessment of the incentives motivating to safe work at the department (a = 0.0101), h assessment of the knowledge of near - miss incident investigations conducted at the department (a = 0.0082) and l assessment of law and order at the department (a = 0.0093). for areas c and h the downward tendencies involve department g-1, and for areas f and l the downward tendencies involve department g-2. the highest growth dynamics was observed for areas k (a = 0.0158) and j (a = 0.0101), assessed in the audit by the staff of department g-1. due to the impact of seasonal fluctuations, the differences between the determined rating index and the trend were the highest for area k assessment of the organization of safe work at the department (in the 4th quarters the value wopk was higher as compared to the trend by 0.046) and for area j assessment of the quality of ohs training at the department (in the 4th quarters the value wopj was higher as compared to the trend by 0.032). in both cases, the obtained results involve the results of audit examinations carried out in department g-1 (tables 4 and 5). the mean value of the final rating index w jo was 3/24 for department g-1 between 2002 and 2012 and 2.60 for department g-2. in neither quarter was the final rating index of the department - wide operational audit w jo for department g-2 higher than that obtained for department g-1 (table 1). the differences between the final rating indexes in individual quarters ranged between 0.51 and 0.71. the determined values of variability indexes (table 3) show explicitly that there is a slight diversity of wopi ratings within each of the problem areas : standard deviation here is approximately 6.1% of the mean value at the most (department g-1, area j in 2010). in the opinion of the respondents from department g-1, the instructions they are given are clear and comprehensible (wopa = 3.22). however, the employees are not informed how to safely execute the assigned tasks in spite of the fact that workplaces are supervised on a regular basis. the employees know how to fulfil their obligations safely (wopd = 3.3) and they can use the possessed knowledge practically (wopk = 3.75). as to the supervising staff in department g-2, the tasks are formulated in an unclear manner, while the control over the performed works is occasional (wopa is only 2.46). most employees declare that they have sufficient knowledge and skills to fulfil their obligations safely (wopd = 3.611 and wopk = 2.83). the assigned tasks often exceed the psychophysical abilities and capabilities of the staff, and the measures aiming to reduce the workload the employees are burdened with are undertaken occasionally (department g-1) or seldom (department g-2). for department g-1 the wopb index is 3.01 (10th place in the problem area ranking) and for department g-2 the wopb index is 2.702 (5th place in the problem area ranking). in the opinion of the respondents, only a small part of machines and equipment does not meet safety requirements (e.g., damaged rope windlass shields or malfunctioning loudspeakers on walls). in most cases the employees have access to operational tools in good condition and to proper protective equipment which they use as instructed. in the ranking of problem areas, area c was placed third (wopc = 3.44 in the audit in department g-1) and second (wopc = 3.11 in the audit in department g-2). in the case of department g-1, modern and comprehensible means promoting work safety rules are used (e.g., large outdoor screens), and the information provided to the staff is updated on a regular basis (wope = 3.37). in department g-2, the promotion of ohs rules is rather occasional (wope = 2.33). in the department 's system of rewards and punishments (department g-1), the positive motivation system promoting proper behaviour and attitudes of employees is predominating (wopf = 3.26). in the case of department g-2, this system is unclear and used selectively (wopf = 2.27). in the opinion of the employees of department g-1, the assessment of occupational risk is carried out for each workplace and all employees are informed about the level of such risk. area g got the mark 4.25 and took the first place in the ranking. for department g-2 this area was placed 6th (wopg = 2.701). in this case the employees claim that they are informed about the level of risk, but the rating itself is updated occasionally. in the opinion of the respondents, near - miss incidents are hardly ever analysed. it is possible to report such situations, but they are not reviewed. in the audit examinations carried out in department g-1, this area was placed last in the problem areas ranking (woph = 2.46), while in the case of the audit carried out in department g-2, it finished last but one (woph = 2.02). with respect to the staff of department g-1 we can say that they know basic principles and procedures of the health and safety management programme used at the coal mine (wopi = 3.05). in the case of department g-2, the employees have no knowledge about the basic principles and procedures of the health and safety management programme. this is the only area with the rating index below 2 (wopi = 1.98). the employees from this department had no knowledge of the objectives of this programme and did not know that they could participate in the programme, evaluating the decisions made with regard to work safety management. the quality of ohs training was assessed as poor (wopj = 2.74 for department g-1 and wopj = 2.49 for department g-2). the reasons for this situation can be attributed to the limited time dedicated to weekly ohs training. in the opinion of the respondents, the information from post - accident statements is not discussed and the content of periodic ohs briefings for the supervision personnel is passed out to the staff occasionally. the order at workplaces at the department is reposted mainly by the staff of department g-1 (wopl = 3.08). the situation in this respect is definitely worse in department g-2 (wopl = 2.73). in the opinion of the respondents, there are frequent conflicts between employees. the management of health and safety is frequently considered to be as important as production. such an attitude has been enforced by economic calculation, legal regulations as well as the lack of social consent to work in conditions that pose hazards to human life or health. therefore the application of ohs controlling is becoming more common. the audit of the health and safety management system, viewed as a form and tool of controlling, is an example of a modern research instrument. it allows us to analyse the potential hazard and then to identify and implement necessary preventive measures. the safety management is based on the assumption that dangerous activities, work conditions and accidents should be treated as phenomena (incidents) which reflect malfunctions of the management system. the audit of the health and safety management system allowed us to propagate the idea of participation among the staff (the awareness of co - responsibility for the matters involving ohs), which is also in compliance with the methodology of bbs. in the author 's opinion, the surveys presented in this article may supplement the merit method used in coal mines for the assessment of the health and safety management quality at the strategic level. the discussed research studies not only allow us to keep track of the changes in the values of rating indices in time, but they will also be helpful to identify strong and weak aspects of ohs management at particular departments of a company. in the case of both audited departments, the assessment of conditions under which the work tasks are performed has been confirmed by accident statistics. between 2002 and 2012, no fatal accidents were reported in department g-1 (w jo = 3.24), whereas in department g-2 (w jo = 2.60) there was one fatal accident. within the referred period, in department g-1, 78 accidents were reported altogether, including one serious one, while in department g-2 there were 125 accidents, including six serious ones.	the audit of the health and safety management system is understood as a form and tool of controlling. the objective of the audit is to define whether the undertaken measures and the obtained results are in conformity with the predicted assumptions or plans, whether the agreed decisions have been implemented and whether they are suitable in view of the accepted health and safety policy. this paper presents the results of an audit examination carried out on the system of health and safety management between 2002 and 2012 on a group of respondents, the employees of two mining departments (g-1 and g-2) of jan, a coal mine. the audit was carried out using the questionnaire developed by the author based on the merit - apbk survey.
epstein - barr virus (ebv) is a herpes virus that is usually transmitted by oropharyngeal secretions and is the causative agent of infectious mononucleosis. more than 90% of the world 's population carries ebv as a life - long, latent infection of b lymphocytes. infectious mononucleosis is caused by an intense cytotoxic t lymphocyte response to eliminate ebv - infected b cells. usually, primary ebv infection in children is asymptomatic with seroconversion. if primary infection occurs in adolescents or in adulthood, the most common manifestation is infectious mononucleosis with the classic presentation of fever, oropharyngitis, and bilateral lymphadenitis. in the acute phase of infectious mononucleosis, elevated transaminases are found in 80% of patients, while jaundice is noted in only 5.0 - 6.6%. hepatitis owing to primary ebv infection is usually mild and self - limited, although the mechanism is unclear. rarely, it results in hepatic failure with severe jaundice in fatal infectious mononucleosis. here, we report two cases : the first case with acute hepatitis secondary to infectious mononucleosis, and a second case with acute hepatitis secondary to infectious mononucleosis concomitantly infected with hepatitis a, in young adults presenting with fever, pharyngitis, lymphadenopathy, hepatosplenomegaly, and atypical lymphocytosis confirmed by serologic test, liver biopsy and electron microscopic study. a 20-year - old male was admitted due to nausea, vomiting, fever, myalgia, and sore throat for the past 7 days. he had no history of smoking or alcohol, and no family history of liver disease. on admission to the hospital, his body temperature was 38.3, blood pressure 130/80 mmhg, pulse rate 100 beats per minute, and respiratory rate 20 breaths per minute. upon physical examination laboratory findings revealed hemoglobin, 14 g / dl ; platelet count, 85,000/mm ; white blood cell count, 13,500/mm with 13% granulocytes, 34% atypical lymphocytes. the liver function tests reported aspartate aminotransferase, 532 iu / l ; alanine aminotransferase, 412 iu / l ; alkaline phosphatase, 583 iu / l ; gamma - glutamyl transpeptidase, 235 iu / l, and albumin, 3.6 g / dl. total bilirubin was 2.1 mg / dl and direct bilirubin was 1.2 mg / dl. the prothrombin time was 12.3 seconds and the activated partial thromboplastin time was 30.3 seconds. abdominal sonography showed no change in liver echogenicity and no focal lesion in liver with marked splenomegaly, sized about 18.8 cm. on hospital day 3, a liver biopsy was conducted and the patient was then transferred to the intensive care unit temporarily, due to iatrogenic subcapsular hematoma and hemoperitonium confirmed by ct scan of the abdomen, which resolved spontaneously 10 days later. serological tests for hepatitis a, b, c, cytomegalovirus (cmv), leptospirosis were negative. serology for both serum igm and igg antibodies against ebv capsid antigen (ebv vca igm, igg) showed positive. the liver biopsy showed infiltration of atypical lymphocytes within sinusoid, and some hepatocytes revealed acidophilic degeneration with frequent mitosis due to regeneration. the lymphocytes were mostly positive for cd3, cd8 cytotoxic t lymphocytes and negative for cd20, cd4 cytotoxic t lymphocytes by immunohistochemistry (fig. electron microscopy findings showed degenerated hepatocytes with markedly dilated bile canaliculi and increased collagen fiber bundles in the periportal area (fig. 2). large and pale looking atypical lymphocytes with abundant cytoplasm and irregular nucleus could be seen in the sinusoid and portal area. in the portal area, extensive fibrosis and impaired bile ductules were observed with infiltrations of mononuclear cells and macrophages. after 2 weeks of conservative treatment, his condition was well and he was discharged without any complications. a 24-year - old woman presented with a one - week history of fever, sore throat and palpable neck mass. she had lived in canada for 10 years and was visiting seoul for summer vacation. recently, she noticed progressive fatigue, malaise, nausea, and vomiting with mildly swollen glands bilaterally. she had no history of dental treatment, blood transfusion or sexual activity in the previous 6 months. she had a travel history to the countryside for swimming about 10 days previously. on admission to the hospital, her body temperature was 38, blood pressure 120/80 mmhg, pulse rate 104 beats per minute and respiratory rate 20 breaths per minute. upon physical examination laboratory findings revealed hemoglobin, 12 g / dl ; platelet count, 69,000/mm ; white blood cell count, 8,400/mm with 10% atypical lymphocytes. liver function tests reported aspartate aminotransferase, 368 iu / l ; alanine aminotransferase, 319 iu / l ; alkaline phosphatase, 544 iu / l ; gamma - glutamyl transpeptidase, 69 iu / l, and albumin, 3.3 g / dl. total bilirubin was 4.0 mg / dl and direct bilirubin was 2.4 mg / dl. treatment with ceftriaxone was administered for persistent fever and she was treated symptomatically for dehydration. abdominal sonography showed the liver to be enlarged with a secondary change of gallbladder wall thickening. there was no biliary tree dilatation or pathology. a ct scan of chest and neck revealed several enlarged lymph nodes of suspicious necrotic change at the supraclavicular area, mediastinal area and axillary area. on hospital day 3, neck node and liver biopsy were conducted. on hospital day 7, her course was complicated by several episodes of fever with negative blood cultures. serologic and virologic studies revealed the absence of hepatitis b surface antigen, hepatitis b core antibody igm, hepatitis c antibody, and negative cmv, but positive for hepatitis a virus antibody igm and ebv vca igm, ebv vca igg was positive and epstein - barr nuclear antigen (ebna) igg was negative. the liver biopsy revealed dense mononuclear cell infiltration, indicating activated lymphocytes in the portal tract. the hepatic lobular architecture was generally preserved and the lobule showed sinusoidal lymphocytic infiltration, individual hepatocyte degeneration and few spotty necrosis. electron microscopic findings showed acute hepatitis, with hepatocytes containing several bile pigments and lipofusin pigments near bile canaliculi in the cytoplasm (fig. mononuclear cells and atypical lymphocytes with a large and pale looking cytoplasm occupied the lumen. in the portal area, bile ducts were also injured with infiltration of atypical lymphocytes and increased collagen fiber bundles. a 20-year - old male was admitted due to nausea, vomiting, fever, myalgia, and sore throat for the past 7 days. he had no history of smoking or alcohol, and no family history of liver disease. on admission to the hospital, his body temperature was 38.3, blood pressure 130/80 mmhg, pulse rate 100 beats per minute, and respiratory rate 20 breaths per minute. upon physical examination laboratory findings revealed hemoglobin, 14 g / dl ; platelet count, 85,000/mm ; white blood cell count, 13,500/mm with 13% granulocytes, 34% atypical lymphocytes. the liver function tests reported aspartate aminotransferase, 532 iu / l ; alanine aminotransferase, 412 iu / l ; alkaline phosphatase, 583 iu / l ; gamma - glutamyl transpeptidase, 235 iu / l, and albumin, 3.6 g / dl. total bilirubin was 2.1 mg / dl and direct bilirubin was 1.2 mg / dl. the prothrombin time was 12.3 seconds and the activated partial thromboplastin time was 30.3 seconds. abdominal sonography showed no change in liver echogenicity and no focal lesion in liver with marked splenomegaly, sized about 18.8 cm. on hospital day 3, a liver biopsy was conducted and the patient was then transferred to the intensive care unit temporarily, due to iatrogenic subcapsular hematoma and hemoperitonium confirmed by ct scan of the abdomen, which resolved spontaneously 10 days later. serological tests for hepatitis a, b, c, cytomegalovirus (cmv), leptospirosis were negative. serology for both serum igm and igg antibodies against ebv capsid antigen (ebv vca igm, igg) showed positive. the liver biopsy showed infiltration of atypical lymphocytes within sinusoid, and some hepatocytes revealed acidophilic degeneration with frequent mitosis due to regeneration. the lymphocytes were mostly positive for cd3, cd8 cytotoxic t lymphocytes and negative for cd20, cd4 cytotoxic t lymphocytes by immunohistochemistry (fig. electron microscopy findings showed degenerated hepatocytes with markedly dilated bile canaliculi and increased collagen fiber bundles in the periportal area (fig. 2). large and pale looking atypical lymphocytes with abundant cytoplasm and irregular nucleus could be seen in the sinusoid and portal area. in the portal area, extensive fibrosis and impaired bile ductules were observed with infiltrations of mononuclear cells and macrophages. after 2 weeks of conservative treatment, his condition was well and he was discharged without any complications. a 24-year - old woman presented with a one - week history of fever, sore throat and palpable neck mass. she had lived in canada for 10 years and was visiting seoul for summer vacation. recently, she noticed progressive fatigue, malaise, nausea, and vomiting with mildly swollen glands bilaterally. she had no history of dental treatment, blood transfusion or sexual activity in the previous 6 months. on admission to the hospital, her body temperature was 38, blood pressure 120/80 mmhg, pulse rate 104 beats per minute and respiratory rate 20 breaths per minute. upon physical examination laboratory findings revealed hemoglobin, 12 g / dl ; platelet count, 69,000/mm ; white blood cell count, 8,400/mm with 10% atypical lymphocytes. liver function tests reported aspartate aminotransferase, 368 iu / l ; alanine aminotransferase, 319 iu / l ; alkaline phosphatase, 544 iu / l ; gamma - glutamyl transpeptidase, 69 iu / l, and albumin, 3.3 g / dl. total bilirubin was 4.0 mg / dl and direct bilirubin was 2.4 mg / dl. treatment with ceftriaxone was administered for persistent fever and she was treated symptomatically for dehydration. abdominal sonography showed the liver to be enlarged with a secondary change of gallbladder wall thickening. a ct scan of chest and neck revealed several enlarged lymph nodes of suspicious necrotic change at the supraclavicular area, mediastinal area and axillary area. on hospital day 3, neck node and liver biopsy were conducted. on hospital day 7, her course was complicated by several episodes of fever with negative blood cultures. serologic and virologic studies revealed the absence of hepatitis b surface antigen, hepatitis b core antibody igm, hepatitis c antibody, and negative cmv, but positive for hepatitis a virus antibody igm and ebv vca igm, ebv vca igg was positive and epstein - barr nuclear antigen (ebna) igg was negative. the liver biopsy revealed dense mononuclear cell infiltration, indicating activated lymphocytes in the portal tract. the hepatic lobular architecture was generally preserved and the lobule showed sinusoidal lymphocytic infiltration, individual hepatocyte degeneration and few spotty necrosis. electron microscopic findings showed acute hepatitis, with hepatocytes containing several bile pigments and lipofusin pigments near bile canaliculi in the cytoplasm (fig. mononuclear cells and atypical lymphocytes with a large and pale looking cytoplasm occupied the lumen. in the portal area, bile ducts were also injured with infiltration of atypical lymphocytes and increased collagen fiber bundles. ebv is part of the herpes virus family and infects up to 90% of the population. initial infection is often subclinical in children, but will generally result in symptomatic infectious mononucleosis in adults who were not exposed during childhood. transmission occurs through close personal contact among young children and via intimate oral contact among adults. transmission by blood transfusion and from a transplanted organ in a previously seronegative recipient have been documented. more rare manifestations of infectious mononucleosis include hemolytic anemia, thrombocytopenia, aplastic anemia, myocarditis and neurological complications. hepatic involvement with infectious mononucleosis varies in severity and its frequency varies with age, which is estimated to be 10% in young adults and 30% in the elderly. ebv infections are often associated with mild hepatocellular hepatitis and can go undetected and resolve spontaneously. the elevated aminotransferases are usually less than five - fold normal levels, and bilirubin may be elevated in up to 5%, which may be due to intrahepatic cholestasis or hemolytic anemia. in our cases, both immunocompetent adult patients had mild hepatitis with moderate elevation of aminotransferases. in the second case, the patient initially presented with icteric feature, as compared to the first patient, and was later found to be infected concomitantly with infectious mononucleosis and hepatitis a. the incubation period of hepatitis a is 15 - 45 days, and 30 - 50 days for ebv infection. though their transmission routes are different, hepatitis a spreads via the fecal - oral route and infectious mononucleosis spreads via nasopharyngeal secretion, their incubation periods may overlap and these viruses may be acquired at nearly the same time. only a few cases of cholestatic hepatitis by ebv infection have been reported. the mechanism for the obstructive component is not well known, but it is assumed to be related to a mildly swollen bile duct rather than an infection of the epithelial cells of the bile duct. it may occur, in particular, in immunodeficient states such as x - linked lymphoproliferative disease, human immunodeficiency virus co - infection and complement deficiency. the histological findings of infectious mononucleosis hepatitis include minimal swelling and vacuolization of hepatocytes, as well as infiltration with lymphocytes and monocytes in the periportal area. the sinusoidal invasion by monocytes in an ' indian bead ' pattern, areas of scattered focal necrosis and proliferation of kupffer cells, has also been observed. an evaluation of infectious mononucleosis hepatitis has demonstrated that the virus did not infect hepatocytes, biliary epithelium, or vascular endothelium but, rather, the infiltration of cd8 t cells led to indirect hepatic damage. traditionally, it has been thought that hepatotropic viruses are not directly cytotoxic but, instead, that the immune responses to viral antigens on hepatocytes result in hepatocyte death. cd3 positive t lymphocytes present as the main lymphocytic population in ebv hepatitis, which are mainly cytotoxic cd8 positive t - lymphocytes. a recent animal model showed that activated cd8 + t cells were trapped in the liver selectively, primarily by intracellular adhesion molecule 1 (icam-1), which is expressed constitutively on sinusoidal endothelial cells and kupffer cells. in infectious mononucleosis hepatitis, ebv infected cd8 + t cells, presumably activated t cells, may accumulate in the liver. a series of experiments have shown that certain soluble products of the immune response, especially interferon, tumor necrosis factor and fas ligand, induced hepatitis [18 - 20 ]. these products, which are produced by either ebv - infected cd8 + t cells or infiltrating cytotoxic t lymphocytes, may, therefore, induce hepatocyte injury. the diagnosis of ebv infection is made by appropriate clinical symptoms, laboratory findings, and positive ebv igm antibody and heterophil antibody tests. the ebv - specific serology is a confirmative diagnostic tool, but can be negative initially in patients who have been ill for only a few days at the time of their first visit. however, within 1 to 2 weeks, antibodies to ebv - specific antigens appear at the expected titers. the serology of anti - vca igm generally persists for about 1 - 2 months. the original serologic test for infectious mononucleosis, the paul - bunnell test for detecting heterophil antibodies by agglutination of sheep or horse red blood cells, is now available as a convenient latex agglutination or solid phase immunoassay form. the false negative rate is as high as 25% in the first week, 5 - 10% in the second week and 5% in the third week. the primary acute ebv infection is associated with vca - igm, vca - igg, and absent ebna antibodies. recent infection in 3 to 12 months includes positive vca - igg and ebna antibodies, negative vca - igm antibodies, and usually positive ea antibodies. infectious mononucleosis hepatitis should be differentiated from other viral hepatitis a, b, c, hiv, cmv, varicella zoster virus and herpes simplex virus. in the present two cases, the patients were in acute phase of ebv infection and the diagnosis was based on typical symptoms, including atypical lymphocytosis, elevated liver enzymes, serologic marker of positive anti - ebv igm and, subsequently, igg with mononuclear cell infiltration of the portal tract and sinusoids in liver biopsy. treatment for infectious mononucleosis hepatitis is usually supportive as it is generally self - limiting. steroids and antiviral medications have been utilized to treat cases of severe infectious mononucleosis hepatitis. acyclovir has not been shown to be efficacious for the treatment of severe ebv hepatitis. there is a case report of the successful use of ganciclovir in two immunocompetent patients with severe infectious mononucleosis hepatitis. however, randomized studies have not been performed for all of these treatments of infectious mononucleosis hepatitis. in our cases, both patients soon recovered with only conservative treatment. ebv is a rare causative agent of acute hepatitis, during the course of infectious mononucleosis. we should consider infectious mononucleosis hepatitis in differentiating patients presenting with liver abnormality, fever, pharyngitis, and lymphadenopathy.	infectious mononucleosis due to epstein - barr virus (ebv) infection sometimes causes acute hepatitis, which is usually self - limiting with mildly elevated transaminases, but rarely with jaundice. primary ebv infection in children is usually asymptomatic, but in a small number of healthy individuals, typically young adults, ebv infection results in a clinical syndrome of infectious mononucleosis with hepatitis, with typical symptoms of fever, pharyngitis, lymphadenopathy, and hepatosplenomegaly. ebv is rather uncommonly confirmed as an etiologic agent of acute hepatitis in adults. here, we report two cases : the first case with acute hepatitis secondary to infectious mononucleosis and a second case, with acute hepatitis secondary to infectious mononucleosis concomitantly infected with hepatitis a. both cases involved young adults presenting with fever, pharyngitis, lymphadenopathy, hepatosplenomegaly, and atypical lymphocytosis confirmed by serologic tests, liver biopsy and electron microscopic study.
a 30-year - old previously healthy man presented with a solitary palpable mass in his right scrotal sac, which appeared 3 months earlier. abdominal / pelvic computed tomography (ct) showed a 5.0 cm mass in the right scrotal sac, separated from the adjacent testis and spermatic cord (fig. the cut surface of the mass was yellowish tan, rubbery, and trabeculated, without necrosis or hemorrhage (fig. microscopically, the mass was composed of bland spindle cells with haphazardly arranged collagen fibers and numerous mast cells. individual adipocytes and adipose tissue were admixed with the spindle cells, which showed immunopositivity for desmin (1:200, dako, glostrup, denmark) and cd34 (1:500, immunotech, marseille, france) (fig. 2c, d) and negativity for smooth muscle actin (1:200, dako), s-100 protein (1:100, zymed, san francisco, ca, usa), and human melanoma black 45 (1:50, dako). a 58-year - old man presented with a slowly growing right axillary mass that had appeared 15 months earlier. a chest ct revealed a 5.5-cm lobulated mass with infiltration of the surrounding soft tissue in the right axilla (fig. because of the possibility of metastatic carcinoma of unknown origin, a needle biopsy was performed. the cut surface was yellowish tan, smooth, and glistening with focal myxoid change. microscopically, the mass was composed of haphazardly arranged, variably sized fascicles of bland spindle cells and numerous mast cells. the spindle cells showed immunopositivity for desmin, cd34, and estrogen receptor (1:100, novo, newcastle upon tyne, uk) and negativity for smooth muscle actin, s-100 protein, and retinoblastoma (1:20, dako) (fig. f). the institutional review board (irb) of asan medical center (irb no. 2015 - 1303) approved this case report. a 30-year - old previously healthy man presented with a solitary palpable mass in his right scrotal sac, which appeared 3 months earlier. abdominal / pelvic computed tomography (ct) showed a 5.0 cm mass in the right scrotal sac, separated from the adjacent testis and spermatic cord (fig. the cut surface of the mass was yellowish tan, rubbery, and trabeculated, without necrosis or hemorrhage (fig. microscopically, the mass was composed of bland spindle cells with haphazardly arranged collagen fibers and numerous mast cells. individual adipocytes and adipose tissue were admixed with the spindle cells, which showed immunopositivity for desmin (1:200, dako, glostrup, denmark) and cd34 (1:500, immunotech, marseille, france) (fig. 2c, d) and negativity for smooth muscle actin (1:200, dako), s-100 protein (1:100, zymed, san francisco, ca, usa), and human melanoma black 45 (1:50, dako). a 58-year - old man presented with a slowly growing right axillary mass that had appeared 15 months earlier. a chest ct revealed a 5.5-cm lobulated mass with infiltration of the surrounding soft tissue in the right axilla (fig. because of the possibility of metastatic carcinoma of unknown origin, a needle biopsy was performed. the cut surface was yellowish tan, smooth, and glistening with focal myxoid change. microscopically, the mass was composed of haphazardly arranged, variably sized fascicles of bland spindle cells and numerous mast cells. the spindle cells showed immunopositivity for desmin, cd34, and estrogen receptor (1:100, novo, newcastle upon tyne, uk) and negativity for smooth muscle actin, s-100 protein, and retinoblastoma (1:20, dako) (fig. f). the institutional review board (irb) of asan medical center (irb no. 2015 - 1303) approved this case report. nevertheless, in many previously reported cases, the tumor did not contain any breast tissue. mcmenamin and fletcher described the possibility of ectopic breast in locations remote from the embryonic milkline. in addition, millo. suggested mesenchymal cd34-positive stem cells as an explanation for the hepatic location of mammary - type mfb. mfb cells demonstrate immunopositivity for desmin and cd34. in addition, at least focal expression of androgen, estrogen, and progesterone receptors has been reported. expression of smooth muscle actin is present in one - third of mfb cases. in the two cases presented here, the tumor cells showed immunopositivity for desmin and cd34 and immunonegativity for smooth muscle actin. the differential diagnoses of mammary - type mfb include other low - grade spindle cell neoplasms such as spindle cell lipoma, cellular angiofibroma, and solitary fibrous tumors (sfts). recently, howitt and fletcher reported a large series of 143 cases of mammary - type mfb. they described complicated situations with mammary - type mfb, such as morphologic variation and cd34 and/or desmin negativity. spindle cell lipoma and cellular angiofibroma show overlapping histologic and immunophenotypic features with mammary - type mfb and share similar genetic findings, with loss of 13q14. spindle cell lipoma has similar histologic features to mfb such as bland spindle cells, abundant mast cells in the stroma, and admixed adipose tissue. the spindle cells of mammary - type mfb show a fascicular arrangement, whereas those of spindle cell lipoma show a more haphazard arrangement. cd34 expression is present in both tumors, whereas desmin immunopositivity is rarely present in spindle cell lipoma (< 2%). explained these different histologic features and immunoprofiles as due to stromal precursor cells with a variable capacity to differentiate into fibroblastic / lipocytic or myofibroblastic cells. histologically, cellular angiofibroma is composed of short spindle cells arranged without any pattern and numerous small- to medium - sized thick - walled hyalinized vessels. tumor cells can express cd34, but smooth muscle actin and desmin are usually negative. mammary - type mfb, spindle cell lipoma, and cellular angiofibroma share not only histologic features, but also similar genetic alterations. the rb1 gene, as well as the foxo1 (forkhead box protein o1, previously known as fkhr, forkhead in rhabdomyosarcoma) gene, is located in the 13q14 tumor suppressor locus, and deletion of this region, which was originally identified in spindle cell lipoma, has been reported in several cases of mammary - type mfb and cellular angiofibroma. described the loss of rb/13q14 and fkhr/13q14 loci in mammary - type mfb using fluorescence in situ hybridization (fish) and suggested a genetic link with spindle cell lipoma, which has a characteristic loss of 13q and 16q. hox. reported a loss of rb/13q14 loci in mammary - type mfb of the head and neck region. described a deletion of foxo1, which is located on 13q14.11, both in mammary and vaginal mfb. in that study, five of seven cases of mammary - type mfb and three of five cases of vaginal mfb showed deletion of this locus. described the heterozygous loss of rb1 in seven cases of cellular angiofibroma according to fish. magro suggested the term benign stromal / mesenchymal tumor with 13q14 deletion, as these three entities share the same genetic alteration, and a minority of cases of spindle cell lipoma and cellular angiofibroma showed histologic similarity to mammary - type mfb. the tumor is composed of spindle cells surrounding thick - walled, branching staghorn - like blood vessels. the spindle cells show a haphazard arrangement with intertwining thin collagen fibers, whereas those in mammary - type mfb show short fascicles with broad interrupting collagen bands. oval myoid cells with abundant eosinophilic cytoplasm, which are distinguishing features of mammary - type mfb, are not observed in sft. sft commonly expresses cd34 (90%) and cd99 (70%), especially the fibrous form. although sft shares the histological and immunohistochemical characteristics of mammary - type mfb, the cytogenetics of sft are different from those of mammary - type mfb. the absence of rb/13q14 loss in sfts is the key point for the differential diagnosis. we report these cases due to the rare incidence and diagnostic utility of desmin immunoreactivity. we conclude that, if spindle cell lesions with myofibroblastic differentiation and admixed adipose tissue and mast cells in unusual locations are observed, the diagnosis of mammary - type mfb should be considered as a differential diagnosis, and desmin immunopositivity could be helpful for diagnosis.	mammary - type myofibroblastoma (mfb) is a rare, benign spindle cell neoplasm occurring along the milkline, with extension from the mid - axilla to the medial groin. it is histologically and immunohistochemically identical to mfb of the breast and is part of a spectrum of lesions that includes spindle cell lipoma and cellular angiofibroma. recently, we experienced two cases of mammary - type mfb involving male patients aged 30 and 58 years, respectively. the tumors were located in the right scrotal sac and in the right axilla. wide excisions were performed. microscopically, the masses were composed of haphazardly arranged, variably sized fascicles of bland spindle cells and were admixed with mature fat tissue. the spindle cells in both cases showed immunopositivity for desmin and cd34 and negativity for smooth muscle actin. loss of retinoblastoma (rb)/13q14 loci is a characteristic genetic alteration of mammary - type mfb, and we identified loss of rb protein expression by immunohistochemical staining. we emphasize the importance of awareness of this rare neoplasm when a spindle cell neoplasm is accompanied by desmin immunopositivity. the second patient was alive without recurrence for 20 months, and the first patient had not been followed.
adenosine is an inhibitory neurotransmitter and a signaling molecule that is involved in energy production in the form of adenosine triphosphate (atp) at the molecular level. adenosine signaling was first discovered in the beginning of the 20th century, and it is known to regulate innumerable physiological functions within animal cells. adenosine also plays a key role in chemical neurotransmission1 and in the control of coronary blood flow in human beings. the effects of adenosine at the cellular level are complicated, because its mediation can be either excitatory or inhibitory. adenosine is also used to treat supraventricular tachycardia, which is cardiac arrhythmia caused by faulty electrical functioning of the heart.2 over the past two decades, several analytical methods have been developed for quantifying adenosine, including potentiometry, colorimetry,3 electrochemical methods,4 high - performance liquid chromatography with fluorescence detection,5,6 and capillary electrophoresis.7 all these methods have several drawbacks, including poor sensitivity, poor detection limits, difficulties with sample separation, and expensive instrumentation. photoluminescence (pl) spectroscopy has high sensitivity and a wide linear working range, and the instrumentation is simple and inexpensive ; it has therefore become an attractive analytical tool for the analysis of pharmaceutical and biological samples. polydimethylsiloxane (pdms) is a biocompatible amorphous polymer8 and is commonly used as a drug - delivery vehicle in medicine. recently, reactive plasmas have been developed to enhance the adhesion of pdms on glass slides and the immobilization of biomolecules. several studies have been performed on surface modifications of pdms using plasma treatment.9 microfluidic techniques are attracting increased attention because of their advantages over macroscopic instrumentation, eg, small amounts of samples and reagents are needed, and the techniques are faster and more accurate. recently, the integration of efficient sample handling by microfluidics and microbead - based arrays has been reported for multitarget detection, providing an ideal platform for sensitive detection of disease - related biomolecules and neurotransmitters.10 a microfluidic bead - based platform has been developed that requires smaller amounts of samples and gives reaction times of a few minutes rather than several hours.11 dopamine (da), which is neurotransmitter belonging to the catecholamine family, plays an important role in the human brain and body. da is released by nerve cells as a chemical messenger to send signals between neurons. the brain includes several distinct da systems, one of which plays a major role in reward - motivated behavior, and these da systems mediate the enhancement of da neuronal activity in nerve cells.12,13 cdse, cds, and cdte quantum dots (qds) have several advantages, such as high photoluminescence quantum efficiency and size - tunable absorption and photoluminescence in the visible to near - infrared (nir) region, yet concerns about their toxicity due to the presence of cadmium are to be resolved.14 compared with cd - based qds, inp qds are nontoxic and promising for in vivo imaging and clinical application in medicine field and photodynamic cancer therapy. although qds based on pb and hg core or shell show nir absorption and photoluminescence characteristics, those are less promising for biological applications due to the presence of toxic heavy metals. thus, we excluded pb-, cd-, and hg - based qds and focused on the synthesis of inp / zns core and shell qds that are being widely applied in clinical applications.1517 recently, ni - imidazole moieties in histidine affinity systems have been widely used for the detection of histidine - containing peptides and biomolecules. the specific interaction between ni and l - histidine was accomplished through coordination of ni and the imidazole residue of l - histidine.1821 here, we used the interaction between zn and adenosine to develop a novel fluorescence probe for adenosine detection based on beads - qds - da. we prepared water - soluble mercaptopropionic acid (mpa)- and mercaptoundecanoic acid (mua)-capped inp / zns qds. da was linked to the qd surfaces using a 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide / n - hydroxysuccinimide (edc / nhs) coupling reaction. the pl intensity of qds - da is quenched by zn via strong coordination interactions. in the presence of adenosine, the zn cations preferentially bind to adenosine, and the qds - da pl intensity is recovered. the detection of adenosine in the presence of zn cations was confirmed by fluorescence quenching and recovery of beads - qds - da in the microfluidic chip. inp / zns qds in toluene (5 mg / ml, emission wavelength 610 nm) were purchased from mesolight (people s republic of china). polystyrene / divinyl benzene beads (diameter 30 m) were purchased from ge healthcare (seoul, south korea). su-8 2050 and su-8 developers were purchased from micro chem (newton, ma, usa). pdms (sylgard 184) and a curing agent were purchased from dow corning (midland, mi, usa). mpa, mua, l - dopamine hydrochloride, adenosine, edc, nhs, znso4, and n - hexane were purchased from sigma - aldrich (st louis, mo, usa). fluorescence emission spectra of the qds were obtained using a fluoroluminescence spectrometer (quanta master, photon technology international, nj, usa) equipped with a xenon lamp (arc lamp housing, a-1010b), monochromator, and power supply (brytexbox). fourier - transform infrared (ftir) spectra were recorded using a bruker vortex 70 ftir spectrometer. fluorescence images were obtained using a fluorescence microscope (nikon, melville, ny, usa). o2 plasma treatment was performed using plasma cleaner (harrick scientific co., germany). an inp / zns qd solution (100 l) was added to 2 ml of n - hexane and ethanol, and the mixture was centrifuged at 3,000 rpm for 15 minutes. an excess of thiol - terminated mpa and mua was added to the qd solution. the mixture was then centrifuged at 5,000 rpm for 5 minutes and washed with ethanol. the supernatant was removed, and the residue was dried under vacuum for 1 hour to yield water - soluble mpa - and mua - capped inp / zns qds. the surface - modified qds (100 l) were treated with edc (3.8 mg / ml, 50 l), nhs (4.6 mg / ml, 50 l), and da (3.5 mg / ml, 50 l) in phosphate buffer for 3 hours continuous stirring at room temperature to produce qds - da. the obtained qds - da was purified by precipitation with addition of excess phosphate buffer to the reaction system, and the purified qds - da powder was redissolved in aqueous solution and stored in a darkroom. these coupling reagents caused reaction of the activated carboxylic acid groups of mpa and mua with the amine functional group of da, to produce amide linkages between da and mpa or mua on the qds. the da - functionalized inp / zns qds were conjugated with polystyrene microbeads with amine functional groups through an edc / sulfo - nhs coupling reaction using a previously described method.22 a pdms microfluidic chip with a line of pillars was fabricated using a protocol described in a previous paper.23 su-8 masters were prepared via a photoresist process, and the microfluidic chip was prepared by thermal curing of pdms. a pdms slide with channels and holes the surfaces of the pdms microfluidic chip and glass slides were both activated by o2 plasma, using plasma cleaner, at 10.5 w for 1 minute. after the plasma treatment, they were bonded in an oven at 80c for 40 minutes. the punched holes on the channel were used as the inlet and outlet, and the silicon tubes (od 1.6 mm and od 0.8 mm) were inserted to introduce beads - qds - da into the channel. the beads with qds were packed into a microchannel blocked by pillars using syringe pump. since the size of the beads is larger than the space between pillars, the beads could not penetrate the pillars in the microchannel of the pdms chip. the flow rate of the solution was kept at 50 l / min using a syringe pump. after injection of zn solution, the fluorescence images on the microchannel were quantified by using image analysis program (im-1 2005) ratio fluorescence imaging system (pti), equipped with a xenon lamp and a fluorescent microscope (olympus ix71). inp / zns qds in toluene (5 mg / ml, emission wavelength 610 nm) were purchased from mesolight (people s republic of china). polystyrene / divinyl benzene beads (diameter 30 m) were purchased from ge healthcare (seoul, south korea). su-8 2050 and su-8 developers were purchased from micro chem (newton, ma, usa). pdms (sylgard 184) and a curing agent were purchased from dow corning (midland, mi, usa). mpa, mua, l - dopamine hydrochloride, adenosine, edc, nhs, znso4, and n - hexane were purchased from sigma - aldrich (st louis, mo, usa). fluorescence emission spectra of the qds were obtained using a fluoroluminescence spectrometer (quanta master, photon technology international, nj, usa) equipped with a xenon lamp (arc lamp housing, a-1010b), monochromator, and power supply (brytexbox). fourier - transform infrared (ftir) spectra were recorded using a bruker vortex 70 ftir spectrometer. fluorescence images were obtained using a fluorescence microscope (nikon, melville, ny, usa). o2 plasma treatment was performed using plasma cleaner (harrick scientific co., germany). an inp / zns qd solution (100 l) was added to 2 ml of n - hexane and ethanol, and the mixture was centrifuged at 3,000 rpm for 15 minutes. an excess of thiol - terminated mpa and mua was added to the qd solution. the mixture was then centrifuged at 5,000 rpm for 5 minutes and washed with ethanol. the supernatant was removed, and the residue was dried under vacuum for 1 hour to yield water - soluble mpa - and mua - capped inp / zns qds. the surface - modified qds (100 l) were treated with edc (3.8 mg / ml, 50 l), nhs (4.6 mg / ml, 50 l), and da (3.5 mg / ml, 50 l) in phosphate buffer for 3 hours continuous stirring at room temperature to produce qds - da. the obtained qds - da was purified by precipitation with addition of excess phosphate buffer to the reaction system, and the purified qds - da powder was redissolved in aqueous solution and stored in a darkroom. these coupling reagents caused reaction of the activated carboxylic acid groups of mpa and mua with the amine functional group of da, to produce amide linkages between da and mpa or mua on the qds. the da - functionalized inp / zns qds were conjugated with polystyrene microbeads with amine functional groups through an edc / sulfo - nhs coupling reaction using a previously described method.22 a pdms microfluidic chip with a line of pillars was fabricated using a protocol described in a previous paper.23 su-8 masters were prepared via a photoresist process, and the microfluidic chip was prepared by thermal curing of pdms. a pdms slide with channels and holes the surfaces of the pdms microfluidic chip and glass slides were both activated by o2 plasma, using plasma cleaner, at 10.5 w for 1 minute. after the plasma treatment, they were bonded in an oven at 80c for 40 minutes. the punched holes on the channel were used as the inlet and outlet, and the silicon tubes (od 1.6 mm and od 0.8 mm) were inserted to introduce beads - qds - da into the channel. the beads with qds were packed into a microchannel blocked by pillars using syringe pump. since the size of the beads is larger than the space between pillars, the beads could not penetrate the pillars in the microchannel of the pdms chip. the flow rate of the solution was kept at 50 l / min using a syringe pump. after injection of zn solution, the fluorescence images on the microchannel were quantified by using image analysis program (im-1 2005) ratio fluorescence imaging system (pti), equipped with a xenon lamp and a fluorescent microscope (olympus ix71). in this study, mpa- and mua - capped inp / zns qds were prepared, and da was linked to the qd surfaces and pl quenching as shown in figure 1. in figure 1a, paths i and ii show schematic representation of pl quenching and recovery by the addition of zn cations and adenosine, respectively, to the system. the pl intensity of the da - qds is quenched by zn because of the strong coordination interactions between da and zn. zn ions induce electron transfer from the qds, and pl quenching occurs. in the presence of adenosine, the zn cations preferentially bind to adenosine, and electron transfer from the qds decreases ; therefore, the pl intensity of the qds - da is recovered. the pl quenching and recovery also depend on the chain length of the organic ligand on the qd surfaces. mpa and mua both were thiol - substituted carboxylic acids with three and eleven carbon chain lengths, respectively. organic qds surface was modified with this ligand to produce water soluble qds for biological assays. fluorescence quenching was broadly explained by two possible mechanisms.24 one is dynamic quenching, which results from the collision between the fluorophore and a quencher, and the second one is static quenching, which results from the ground - state complex formation between the fluorophore and a quencher. according to studies on the mechanisms of fluorescence quenching of qds and metal ions,2527 the above process can be attributed to effective electron transfer from the qds to the zn ions, and fluorescence recovery can be attributed to effective electron transfer from zn ions to qds after addition of adenosine, based on the strong affinity of zinc for nitrogen atoms, which correspondingly yields the nonradiative recombination of excited electrons (e) in the conduction bands and holes (h) in the valence band on the surface of qds. figure 2a and b shows photographs of the photomask for the photoresist process for su-8 molding and the fabricated pdms microfluidic chip on the glass slide by using o2 plasma, respectively. the chip (25 mm 12 mm) was fabricated using a conventional photo process. the channel width and height were 400 m and 50 m, respectively, and the distance between pillars was 25 m. the elliptical pillar was constructed with a long diameter of 100 m and a short diameter of 50 m. the gaps between the pillars were small enough to block the beads but large enough for buffer solution to flow through the channels. figure 3a c shows the ftir spectra of mpa, l - da, and beads - qds - da, respectively. the peak at 2,580 cm in (a) arises from the s - h stretching vibration of mpa. this peak is not observed in (c), which confirms covalent bond formation between the thiol group of mpa and the metal atom in the qd. the peaks at 1,654 cm and 2,978 cm in (a) are attributed to the c = o stretching of carboxylic groups and c - h stretching of methylene groups, respectively. the peaks at 3,206 and 2,977 cm in (b) are attributed to n h stretching of amine functional groups and c h stretching of aromatic benzene rings, respectively. the peaks at 1,684 cm and 1,610 cm in (c) are attributed to the conh amide band i group and the n h amide band ii group, respectively, and the peak at 1,230 cm is attributed to the c n stretching of amide bond, these arise from conjugation of da with the mpa - capped qds. figure 4a and b, respectively, shows photographs of the qds before and after surface modification with mpa under ultraviolet (uv) illumination. the inp / zns qds are dispersed in a two - layered mixture of n - hexane (upper) and deionized water (lower). the figure shows that before the surface treatment, the qds were dispersed in the organic phase, but after treatment with mpa, they were dispersed in the water phase since the mpa ligand was water soluble. these surface modified qds were used for the detection of adenosine in presence of zn. figure 5 shows the fluorescence spectra of the qds - da, qds - da - zn, and qds - da - zn - adenosine after surface modification with (a) mpa and (b) mua. inset photographs depict the (i) qds - da, (ii) qds - da - zn, and (iii) qds - da - zn with adenosine system. after the addition of 10 (imol l zn, the pl intensity of the qds - da decreased. when 10 (imol l adenosine was added to the qds - da - zn system, the pl intensity increased significantly. the pl intensity was quenched by 62% by electron transfer from the qds to the zn cation ; 90% of the pl intensity was recovered in the case of beads - qds - mpa - da and 78% in the case of beads - qds - mua - da after addition of adenosine, as a result of preferential binding of zn to adenosine. figure 6 shows the fluorescence microscope images of beads - qds - da in the microfluidic channel under (a) bright field and (b) dark field conditions, and (c) as a function of time after introduction of zn solution. the figure shows that the qds are well bound to the polystyrene bead surfaces, and the microfluidic chip channels are filled with beads - qds - da. initially, the microchannel was washed with di water, and zn and adenosine were injected into the microchannel for 30 minutes. after injection of zn using a syringe pump, the fluorescence microscope images were recorded as a function of time. after injection of zn solution, the fluorescence images on the microchannel were quantified by using image analysis program (im-1 2005) and redrawn as intensity line profile and also the fluorescence intensity per minute at 360 pixel of line profiles were averaged and converted to intensity profile as a function of time as shown in figure 6. the fluorescence emission intensity from qds attached to microbeads decreased gradually due to strong affinity between zn and adenosine. after 30 minutes, it was very difficult to observe further change of the fluorescence intensity, which may be due to the saturation of preferential binding of zn to adenosine. figure 7 shows the fluorescence intensity variations of the qds as a function of time after 1.5 ml injection of 10 mol l zn and adenosine solution. after addition of 10 mol l zn, the pl intensity of the qds - da gradually decreased within 30 minutes and the fluorescence was significantly recovered by the addition of 10 mol l adenosine. the pl intensity was quenched by ~60%65% by electron transfer from the qds to the zn cation ; 85% of the pl intensity was recovered in the case of beads - qds - mpa - da and 75% in the case of beads - qds - mua - da after addition of adenosine, as a result of preferential binding of zn to adenosine. the figure also shows that for a shorter chain length between zn and the qds (mpa), pl quenching was faster. the recovery of pl intensity was higher for a shorter chain length and vice versa. the experiment was repeated three times, with the fluorescence intensity vs time expressed as the mean standard deviation, as shown in figure 7. in summary, water - soluble inp / zns qds were prepared by surface modification with mpa and mua ligands. the qds were immobilized on polystyrene microbeads by an edc / sulfo - nhs coupling reaction, and da was conjugated with the qds. fluorescence quenching and recovery were observed as a result of electron - transfer interactions between da and zn. a pdms microfluidic chip was fabricated with polystyrene beads - qds - da packed in the channel. after addition of zn, the pl intensity of the qds - da decreased and was recovered by addition of adenosine. a shorter chain length between zn and the qds gave faster pl intensity quenching and recovery. the proposed fluorescence bioprobe has potential application in biological systems for the detection of adenosine in solution and serum at low concentration levels.	microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. chip - based, quantum dot (qd)-bead - biomolecule probes have been used for the detection of various types of dna. in this study, we developed dopamine (da)-functionalized inp / zns qds (qds - da) as fluorescence probes for the detection of adenosine in microfluidic chips. the photoluminescence (pl) intensity of the qds - da is quenched by zn2 + because of the strong coordination interactions. in the presence of adenosine, zn2 + cations preferentially bind to adenosine, and the pl intensity of the qds - da is recovered. a polydimethylsiloxane - based microfluidic chip was fabricated, and adenosine detection was confirmed using qds - da probes.
diabetes and obesity are associated with low - level, chronic inflammation (1). in recent years, the gut microbiota have come to be recognized as a contributor to this inflammation (2,3). gram - negative bacteria contain lipopolysaccharide (lps) in their outer membranes (4), and through their life cycles the bacteria can shed lps into the circulation (5). lps in the circulation can initiate an immune response and promote the release of inflammatory cytokines (4,5). the gut microbiota can therefore be a generator of lps and a potential contributor to low - level inflammation. lps - binding protein (lbp) is produced primarily by the liver and helps mediate the lps - induced inflammatory response (5,6). when lbp is found at low levels in the serum, it binds lps and forms complexes with cd14, which then associates with toll - like receptor 4 (tlr4) on the macrophage and initiates the inflammatory cytokine response (7). however, when found at higher levels, lbp helps attenuate the immune response by transferring lps to lipoproteins for clearance (8,9). lbp levels are greater in the presence of cytokines such as interleukin (il)-6 and il-1 (5), and although lbp is produced at constitutively low levels during normal physiological states, levels rise rapidly during infection (5). there are several difficulties in accurately measuring lps in serum using the limulus amebocyte lysate test, including potential interference by lps inhibitors (10). lbp is strongly correlated with lps levels (r 0.6) in human serum (11) and increases in response to greater lps in mouse models (12). therefore, owing to its crucial role in modulating the immune response and its known correlation with lps, lbp is generally considered to be a reasonable surrogate biomarker for assessing lps - induced inflammation in humans (13,14). lbp levels are higher among individuals who are obese, have diabetes, or have metabolic syndrome or glucose intolerance (1318). although cross - sectional studies have shown that lbp levels are associated with anthropometric and metabolic measurements (11,15,18), few longitudinal studies have investigated lbp in relation to obesity- and diabetes - related measures (13). to our best knowledge, no longitudinal studies have been conducted among african ancestry men, a population group disproportionately affected by type 2 diabetes (19,20), and thus, in particular, there is need for such study. in the current study, we tested whether baseline lbp is associated with changes in overall, central, and skeletal muscle adiposity, glucose homeostasis, and new cases of prediabetes and type 2 diabetes in a cohort of middle - aged and elderly african ancestry men. between 1997 and 2003, 3,170 previously unscreened men were recruited for a population - based prostate cancer screening study on the caribbean island of tobago, trinidad and tobago (21). to be eligible, men had to be ambulatory, noninstitutionalized, and not terminally ill. recruitment for the survey was accomplished by flyers, public service announcements, and posters, informing health care workers at local hospitals and health centers, and word of mouth. approximately 60% of all age - eligible men on the island participated, and participation was similar across the island parishes. all men were invited to participate in a follow - up clinic examination between 2004 and 2007, and 2,031 men (70% of survivors) and 451 new participants completed the visit. men were invited to complete a dual - energy x - ray absorptiometry (dxa) whole - body scan and a peripheral quantitative computed tomography (pqct) scan of the lower leg., we invited these men to return for repeat clinical examinations and dxa and pqct scans. the baseline and follow - up visits followed the same procedures for questionnaire interviews, biospecimen collection, and dxa and pqct scans. a total of 1,611 men completed the follow - up assessment (82% of survivors). on the basis of power calculations (see statistical analyses below), we randomly selected 580 of these men for the current study of lbp. the institutional review boards of the university of pittsburgh and the tobago ministry of health and social services approved this study. all participants provided written informed consent before data collection. a pqct scan of the calf was performed using the stratec xct-2000 to evaluate skeletal muscle fat and muscle cross - sectional areas. scans were obtained at 66% of the calf length, proximal to the terminal end of the calf. this site was chosen because it is the region of the lower leg with the largest circumference with very little variability across individuals (22). different tissues in the analyses were separated according to different density thresholds, using the soft tissue algorithm. on the basis of this calibration, fat, muscle, and cortical bone are measured with mineral equivalent densities of 0, 80, and 1,200 mg / cm, respectively. therefore, changes in muscle tissue to fat - like tissue will be detected as a shift in mineral equivalent density of the muscle from 80 to 0 mg / cm. images of the cross - sectional area of skeletal muscle and fat were analyzed using stratec 5.5d analysis software (orthometrix, inc. we assessed intramuscular fat using measures of calf muscle density (mg / cm). muscle density is a valid measure of fat accumulation within the skeletal muscle and reflects the fat content such that greater intramuscular fat is associated with lower muscle density (23). dxa measurement of total body and trunk fat was made using a hologic qdr 4500 w densitometer (hologic inc., standing height was measured to the nearest 0.1 cm using a wall - mounted stadiometer. body weight was recorded to the nearest 0.1 kg without shoes on a balance beam scale. waist circumference was measured at the narrowest point of the waist using an inelastic fiberglass tape. all biochemical assays in fasting serum samples were performed in the heinz nutrition laboratory at the university of pittsburgh. fasting serum glucose was measured using an enzymatic procedure ; the coefficient of variation percentage (cv%) between runs was 1.8%. the degree of insulin resistance (ir) was estimated by homa according to the method described by matthews. baseline fasting serum lbp was measured using a human lbp elisa kit (cell sciences, canton, ma) according to the manufacturer s protocol. information on lifestyle habits (current smoking [yes / no ], walking more than twice in the past week [yes / no ], watching 14 or more hours of television per week [yes / no ], and current intake of alcohol of more than 3 drinks per week [yes / no ]), history of medical conditions, and medication use were assessed using standardized interviewer - administered questionnaires. men were asked to bring all prescription medications taken in the past 30 days to their clinic visit. type 2 diabetes was defined as currently taking an antidiabetic medication, regardless of fasting serum glucose level, or having a fasting serum glucose level of 126 mg / dl. impaired fasting glucose (ifg), also known as prediabetes, was defined as a fasting serum glucose level of 100125 mg / dl without being on any antidiabetic medication. hypertension was defined as a systolic blood pressure of 140 mmhg and/or diastolic blood pressure of 90 mmhg and/or currently taking antihypertensive medication. high triglycerides was defined as a fasting serum triglycerides level of 150 mg / dl. low hdl cholesterol (hdl - c) was defined as a fasting serum hdl - c level of < 40 mg / dl. we estimated that to have the power to detect a univariate correlation of 0.12 (= 0.8, = 0.05) between lbp and changes in adiposity or glucose homeostasis, we needed to assay at least 500 samples. owing to assay requirements and formatting we then categorized baseline serum lbp into quartiles (n = 145 each) and tested its association with baseline cross - sectional and longitudinal changes in metabolic measures using a test of linear trend. cross - sectional models were first adjusted for baseline age and then were additionally adjusted for smoking, walking, history of cancer, perceived health status, and alcohol intake. longitudinal models were first adjusted for baseline age and baseline metabolic measures and then additionally adjusted for smoking, walking, history of cancer, perceived health status, alcohol intake, and low hdl - c status. we used multivariable logistic regression to test for an association of lbp with new cases of ifg or type 2 diabetes identified at follow - up. models for ifg were run in only those with normal glucose at baseline, whereas models for type 2 diabetes were run in individuals without diabetes at baseline only. statistical significance was based on an = 0.05, and analyses were performed using sas 9.3 software (sas institute, inc., cary, nc). between 1997 and 2003, 3,170 previously unscreened men were recruited for a population - based prostate cancer screening study on the caribbean island of tobago, trinidad and tobago (21). to be eligible, men had to be ambulatory, noninstitutionalized, and not terminally ill. recruitment for the survey was accomplished by flyers, public service announcements, and posters, informing health care workers at local hospitals and health centers, and word of mouth. approximately 60% of all age - eligible men on the island participated, and participation was similar across the island parishes. all men were invited to participate in a follow - up clinic examination between 2004 and 2007, and 2,031 men (70% of survivors) and 451 new participants completed the visit. men were invited to complete a dual - energy x - ray absorptiometry (dxa) whole - body scan and a peripheral quantitative computed tomography (pqct) scan of the lower leg., we invited these men to return for repeat clinical examinations and dxa and pqct scans. the baseline and follow - up visits followed the same procedures for questionnaire interviews, biospecimen collection, and dxa and pqct scans. a total of 1,611 men completed the follow - up assessment (82% of survivors). on the basis of power calculations (see statistical analyses below), we randomly selected 580 of these men for the current study of lbp. the institutional review boards of the university of pittsburgh and the tobago ministry of health and social services approved this study. all participants provided written informed consent before data collection. a pqct scan of the calf was performed using the stratec xct-2000 to evaluate skeletal muscle fat and muscle cross - sectional areas. scans were obtained at 66% of the calf length, proximal to the terminal end of the calf. this site was chosen because it is the region of the lower leg with the largest circumference with very little variability across individuals (22). different tissues in the analyses were separated according to different density thresholds, using the soft tissue algorithm. on the basis of this calibration, fat, muscle, and cortical bone are measured with mineral equivalent densities of 0, 80, and 1,200 mg / cm, respectively. therefore, changes in muscle tissue to fat - like tissue will be detected as a shift in mineral equivalent density of the muscle from 80 to 0 mg / cm. images of the cross - sectional area of skeletal muscle and fat were analyzed using stratec 5.5d analysis software (orthometrix, inc. we assessed intramuscular fat using measures of calf muscle density (mg / cm). muscle density is a valid measure of fat accumulation within the skeletal muscle and reflects the fat content such that greater intramuscular fat is associated with lower muscle density (23). dxa measurement of total body and trunk fat was made using a hologic qdr 4500 w densitometer (hologic inc., standing height was measured to the nearest 0.1 cm using a wall - mounted stadiometer. body weight was recorded to the nearest 0.1 kg without shoes on a balance beam scale. waist circumference was measured at the narrowest point of the waist using an inelastic fiberglass tape. all biochemical assays in fasting serum samples were performed in the heinz nutrition laboratory at the university of pittsburgh. fasting serum glucose was measured using an enzymatic procedure ; the coefficient of variation percentage (cv%) between runs was 1.8%. insulin was measured using a radioimmunoassay procedure developed by linco research, inc. ; the cv% between runs was 2.1%. the degree of insulin resistance (ir) was estimated by homa according to the method described by matthews. baseline fasting serum lbp was measured using a human lbp elisa kit (cell sciences, canton, ma) according to the manufacturer s protocol. information on lifestyle habits (current smoking [yes / no ], walking more than twice in the past week [yes / no ], watching 14 or more hours of television per week [yes / no ], and current intake of alcohol of more than 3 drinks per week [yes / no ]), history of medical conditions, and medication use were assessed using standardized interviewer - administered questionnaires. men were asked to bring all prescription medications taken in the past 30 days to their clinic visit. type 2 diabetes was defined as currently taking an antidiabetic medication, regardless of fasting serum glucose level, or having a fasting serum glucose level of 126 mg / dl. impaired fasting glucose (ifg), also known as prediabetes, was defined as a fasting serum glucose level of 100125 mg / dl without being on any antidiabetic medication. hypertension was defined as a systolic blood pressure of 140 mmhg and/or diastolic blood pressure of 90 mmhg and/or currently taking antihypertensive medication. high triglycerides was defined as a fasting serum triglycerides level of 150 mg / dl. low hdl cholesterol (hdl - c) was defined as a fasting serum hdl - c level of < 40 mg / dl. we estimated that to have the power to detect a univariate correlation of 0.12 (= 0.8, = 0.05) between lbp and changes in adiposity or glucose homeostasis, we needed to assay at least 500 samples. owing to assay requirements and formatting we then categorized baseline serum lbp into quartiles (n = 145 each) and tested its association with baseline cross - sectional and longitudinal changes in metabolic measures using a test of linear trend. cross - sectional models were first adjusted for baseline age and then were additionally adjusted for smoking, walking, history of cancer, perceived health status, and alcohol intake. longitudinal models were first adjusted for baseline age and baseline metabolic measures and then additionally adjusted for smoking, walking, history of cancer, perceived health status, alcohol intake, and low hdl - c status. we used multivariable logistic regression to test for an association of lbp with new cases of ifg or type 2 diabetes identified at follow - up. models for ifg were run in only those with normal glucose at baseline, whereas models for type 2 diabetes were run in individuals without diabetes at baseline only. statistical significance was based on an = 0.05, and analyses were performed using sas 9.3 software (sas institute, inc., baseline characteristics for the 580 african ancestry men overall and according to quartiles of lbp are reported in table 1. only 8% of men were current smokers, 9% had moderate alcohol intake, 38% watched more than 14 h of television in a week, and 88% typically walked for exercise. approximately 5% of men had a history of cancer, and 6% had a history of any cardiovascular disease. prevalence of ifg, type 2 diabetes, high triglycerides, low hdl - c, and hypertension were high, at 23%, 21%, 19%, 22%, and 53%, respectively. greater lbp quartile was associated with greater baseline age, having diabetes, low hdl - c status, and taking antidiabetic medication (p < 0.05 for all). however, having a history of cancer decreased with increasing quartiles of lbp (p = 0.04). general characteristics of 580 african ancestry men overall and by quartile of lbp values are presented as mean (range), mean (sd), or as indicated. greater baseline lbp was associated with greater baseline bmi, waist circumference, whole - body and trunk fat percentage, and fasting insulin and homa - ir, and inversely associated with skeletal muscle density independent of age and other covariates including smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status (all p < 0.05) (table 2). association of lbp with baseline anthropometric and metabolic measures in african ancestry men baseline values are presented as mean (se). multivariable models include adjustment for baseline age, smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status. metabolic factors are reported only in men who were nondiabetic at baseline (n = 457). baseline lbp was associated with an increase in trunk fat (p = 0.025) and homa - ir (p = 0.034) at follow - up after adjustment for all significant covariates (table 3). lbp was also associated with a decrease in calf skeletal muscle density in minimally adjusted models (p = 0.048) (table 3). however, the association was attenuated after additional adjustment for smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status (p = 0.057). association of lbp with absolute changes in anthropometric and metabolic measures in african ancestry men absolute changes in values are presented as mean (se). multivariable models include adjustment for appropriate baseline metabolic trait, and baseline age, smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status. metabolic factors reported only in men with follow - up data who were nondiabetic at baseline (n = 426). at the follow - up visit, 13.5% of normoglycemic men from baseline had developed ifg and 8.2% of men free of diabetes at baseline had developed type 2 diabetes (table 4). baseline lbp levels were positively associated with new cases of ifg, independent of age, trunk fat percentage, physical activity, health status, and low hdl - c status. each 1-sd greater baseline lbp was associated with an 51% increased risk of ifg (95% ci 1.022.21). the association was slightly attenuated and of borderline significance after accounting for change in trunk fat (p = 0.067), bmi (p = 0.046), or skeletal muscle density (p = 0.052). association of baseline serum lbp with new cases of impaired fasting glucose and diabetes in african ancestry men odds ratios (95% ci) are shown for 1-sd greater lbp. baseline characteristics for the 580 african ancestry men overall and according to quartiles of lbp are reported in table 1. only 8% of men were current smokers, 9% had moderate alcohol intake, 38% watched more than 14 h of television in a week, and 88% typically walked for exercise. approximately 5% of men had a history of cancer, and 6% had a history of any cardiovascular disease. prevalence of ifg, type 2 diabetes, high triglycerides, low hdl - c, and hypertension were high, at 23%, 21%, 19%, 22%, and 53%, respectively. greater lbp quartile was associated with greater baseline age, having diabetes, low hdl - c status, and taking antidiabetic medication (p < 0.05 for all). however, having a history of cancer decreased with increasing quartiles of lbp (p = 0.04). general characteristics of 580 african ancestry men overall and by quartile of lbp values are presented as mean (range), mean (sd), or as indicated. greater baseline lbp was associated with greater baseline bmi, waist circumference, whole - body and trunk fat percentage, and fasting insulin and homa - ir, and inversely associated with skeletal muscle density independent of age and other covariates including smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status (all p < 0.05) (table 2). association of lbp with baseline anthropometric and metabolic measures in african ancestry men baseline values are presented as mean (se). multivariable models include adjustment for baseline age, smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status. metabolic factors are reported only in men who were nondiabetic at baseline (n = 457). baseline lbp was associated with an increase in trunk fat (p = 0.025) and homa - ir (p = 0.034) at follow - up after adjustment for all significant covariates (table 3). lbp was also associated with a decrease in calf skeletal muscle density in minimally adjusted models (p = 0.048) (table 3). however, the association was attenuated after additional adjustment for smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status (p = 0.057). association of lbp with absolute changes in anthropometric and metabolic measures in african ancestry men absolute changes in values are presented as mean (se). multivariable models include adjustment for appropriate baseline metabolic trait, and baseline age, smoking, walking, history of cancer, health status, alcohol intake, and low hdl - c status. metabolic factors reported only in men with follow - up data who were nondiabetic at baseline (n = 426). at the follow - up visit, 13.5% of normoglycemic men from baseline had developed ifg and 8.2% of men free of diabetes at baseline had developed type 2 diabetes (table 4). baseline lbp levels were positively associated with new cases of ifg, independent of age, trunk fat percentage, physical activity, health status, and low hdl - c status. each 1-sd greater baseline lbp was associated with an 51% increased risk of ifg (95% ci 1.022.21). the association was slightly attenuated and of borderline significance after accounting for change in trunk fat (p = 0.067), bmi (p = 0.046), or skeletal muscle density (p = 0.052). association of baseline serum lbp with new cases of impaired fasting glucose and diabetes in african ancestry men odds ratios (95% ci) are shown for 1-sd greater lbp. to our knowledge, our study is the first to examine lbp and longitudinal changes in adiposity, glucose homeostasis, and diabetes risk in a population of african ancestry men, who have a high risk of developing type 2 diabetes. we found that greater lbp levels are associated with increasing central and skeletal muscle adiposity and ir as well as with an increased risk for developing ifg. adjusting for changes in adiposity attenuated the association between lbp and ifg, suggesting that increased adiposity may play a causal role in the lbp association. these data provide further evidence for a potential link between lbp and age - associated increases in adiposity and impaired glucose metabolism. chronic inflammation is believed to be a risk factor for obesity and ir (26,27). lps is derived from the outer membrane of gram - negative bacteria (4,5), and although low levels of lps can be found in the circulation of healthy individuals, higher levels can produce inflammatory responses (5). lbp is expressed at constitutively low levels and increases in the presence of inflammatory cytokines such as il-6 and il-1 (5). lbp functions by binding to lps, which accelerates lps binding to cd14 and subsequent presentation to macrophage tlr4 receptors (7). 28) showed that chronic infusion of lps caused weight gain in mice similar to that of a high - fat diet, thereby linking metabolic lps from the gut microbiome to systemic inflammation and weight gain. owing to limitations in accurately measuring lps levels in the serum (10), not many studies have directly correlated lbp to lps levels in the serum of humans. however, a single study by moreno - navarrete. (11) showed that lbp and lps levels were strongly correlated with coefficients 0.6. in addition, lbp has been widely suggested to be a potential marker of gut - derived lps and consequent lps - induced inflammation (1315,17,18). therefore, most current human research infers that lbp variation is both correlated and caused by variation in lps. however, it is also possible that variations in lbp in our study may be due to variations in cytokines or an acute - phase reaction unrelated to lps (29). our findings that lbp was significantly and positively associated with baseline obesity measures are in line with other findings in the literature (1113,1618). a longitudinal study among 2,529 chinese individuals found that higher baseline levels of lbp were correlated with an increased number of metabolic syndrome components (13). in contrast, baseline lbp measurements were not related to changes in bmi, waist circumference, whole - body fat, or fasting insulin levels in our sample. however, we found that lbp was associated with an increase in trunk fat over an average of 6 years of follow - up. our findings raise the possibility that lps may be more strongly associated with central adiposity, which is a stronger risk factor for type 2 diabetes, than overall adiposity (30). an association of lbp with adiposity is biologically plausible because lbp, which is primarily produced by hepatocytes, is also produced by adipocytes in response to local proinflammatory cytokines (12). we also found that lbp was positively associated with homa - ir at baseline and during follow - up in individuals without diabetes and positively associated with insulin at baseline, although this association was not confirmed by changes in insulin during follow - up. one previous study found that higher levels of serum lbp correlate with homa - ir (17), while another found that an association with homa - ir may depend on obesity status (16). we also found, for the first time, that greater lbp levels are associated with a lower skeletal muscle density and its decrease with aging, indicative of an increase in ectopic skeletal muscle adiposity. this finding is in line with other previous data, in particular, a study using mouse models, which showed that lps injections can lead to changes in muscle quality (31). ectopic skeletal muscle adiposity is greater among african ancestry individuals than caucasians (3236) and has been shown to be an important risk factor for type 2 diabetes (37,38). whether lbp may partly explain ethnic / racial differences in skeletal muscle adiposity is unclear. our findings will need to be confirmed in other populations, including those of african ancestry. in our sample, greater lbp was associated with an increase in ir and increased odds of newly generating an ifg over 6 years of follow - up. tlr4 activation on insulin target cells by lps can lead to activation of the jun n - terminal kinase and inhibitor of b kinase pathways, both of which can inhibit insulin s action by blocking phosphorylation of insulin receptor substrates proteins and increasing insulin receptor substrates degradation. furthermore, the jun n - terminal kinase / inhibitor of b kinase pathways lead to activation of nuclear factor-b, which increases production of proinflammatory cytokines and further inhibits insulin signaling (1). skeletal muscle tlr4 expression is known to be higher in individuals who are obese or who have type 2 diabetes and to correlate with ir (39). lbp is a marker of circulating lps and facilitates the binding of lps to tlr4 ; thus, lbp may be an important biomarker for predicting the development of ir due to lps - induced inflammation, and therefore, prediabetes. lack of a significant association with new cases of type 2 diabetes in our population may be due to lack of statistical power, although a recent publication by zhou. (40) suggests that lbp measurements alone are not sufficient to predict type 2 diabetes. alternatively, lbp may be an important marker of only the early metabolic disturbances seen in prediabetes. only one other longitudinal study has been conducted to date, and it was in a chinese population (13). in addition, the availability of dxa and ct measures allowed us to more accurately describe general and regional body fat distribution associated with lbp, compared with previous studies. our sample included middle - aged and elderly african ancestry men, and thus, our findings may not apply to younger men, women, or other ethnic groups. also, dietary data were limited in our study and because dietary influences can affect gut bacteria or may affect diabetes risk through other means, having information on food intake could allow for us to have a more holistic picture of how lifestyle might affect lbp. lbp is primarily a hepatically produced protein, and the liver is a site for ectopic fat development ; thus, this information may be an important factor to investigate in future studies. finally, we measured lbp only at baseline and, therefore, can not examine whether change in lbp is a stronger correlate of metabolic changes than a single lbp measurement. in conclusion, the current study shows that greater serum lbp concentrations are associated with increases in trunk and skeletal muscle adiposity and ir with aging among african ancestry men. the association with ifg and early changes in ir suggest that lbp may be more informative among individuals with normal serum glucose. further research is needed to better understand the mechanisms underlying the relationship between lbp, adiposity, and ir and prediabetes.	objectivecross - sectional studies suggest that lipopolysaccharide - binding protein (lbp) may be associated with obesity and metabolic disorders. however, prospective studies examining lbp are lacking. this prospective study investigated the association between lbp and metabolic abnormalities in 580 african ancestry men (mean age, 59.1 10.5 years).research design and methodswe measured fasting serum lbp at baseline. changes in adiposity and glucose homeostasis as well as case subjects with new type 2 diabetes and impaired fasting glucose (ifg) were assessed at a follow - up visit 6 years later. baseline lbp values were tested across quartiles for linear trend with metabolic measures. multivariable logistic regression was used to determine the odds of new cases of ifg or diabetes per 1-sd greater baseline lbp.resultslbp was significantly associated with baseline bmi, waist circumference, whole - body and trunk fat, skeletal muscle density, fasting serum insulin, and homa - insulin resistance (ir) (all p < 0.01). greater baseline lbp was significantly associated with longitudinal increases in the percentage of trunk fat (p = 0.025) and homa - ir (p = 0.034), but only borderline so with a decrease in skeletal muscle density (p = 0.057). in men with normal glucose, baseline lbp was associated with increased odds of having ifg at follow - up after adjustment for age, baseline trunk fat, and lifestyle factors (odds ratio per 1-sd lbp : 1.51 ; 95% ci 1.022.21). this association was attenuated after additional adjustment for change in trunk fat (p = 0.067).conclusionslbp may be a marker of prediabetes. some of this association appears to be mediated through increased central and ectopic skeletal muscle adiposity.
fortunately, we are now able to test for an increasing number of antibodies that offer a definitive diagnosis for cases that would have been previously categorized as viral or idiopathic encephalitis. the california encephalitis project found that the frequency of autoimmune encephalitis was greater than any single viral etiology. anti - n - methyl d - aspartate receptor (nmdar) encephalitis was, in fact, the most frequent cause of immune mediated encephalitis in the pediatric population. any child who presents with memory deficits, aphasia, seizures, movement disorders, or behavioral changes of a subacute nature should have autoimmune encephalitis in the differential diagnosis. the initial presentation of these patients can vary depending on the receptor being targeted, but it is crucial to always consider immune - mediated encephalitis because of the potential for a successful outcome with prompt treatment. the case we present is of a young man with an elevated titer of n - type voltage - gated calcium channel antibody and a relatively acute change in mental status including memory deficits, mood changes, and transient fever. our initial instinct was to look for a bacterial or viral etiology. when the lumbar puncture was benign, however, an autoimmune etiology became the leading consideration in our differential diagnosis. entities such as fever - induced refractory epileptic encephalopathy in school - aged children (fires) or rasmussen encephalitis were also considered. fever - induced refractory epileptic encephalopathy in school - aged children is triggered by fever and an underlying inflammatory response in the suspected culprit. although our patient 's clinical history was preceded by fever, his clinical course and prompt positive response to steroids and ivig are different from patient with fires because those patients present with drug - resistant status epilepticus, csf pleocytosis, and perisylvian / mesial temporal lobe abnormalities. rasmussen encephalitis is a presumed inflammatory encephalopathy and a recognized cause of an intractable focal epilepsy or epilepsia partialis continua (epc). in most cases, only one hemisphere is involved, and patients progress to have weakness on the contralateral side. our young man 's initial mri scan was reminiscent of this type of unilateral hemispheric dysfunction, although his lack of epc or clinically evident focal seizures or weakness led us away from this diagnosis. the etiology of rasmussen encephalitis remains largely unknown, although it is considered a prototype of immune - inflammatory epilepsy syndrome, and multiple mechanisms have been proposed. patient 's with rasmussen encephalitis also do not typically respond readily to immunotherapies, often requiring hemispherectomy to afford seizure freedom. treatment for encephalitis often needs to be initiated before the results of confirmatory tests are available. typically, intravenous immunoglobulin and high - dose steroids are used in tandem as initial therapy. supportive care and treatment of seizures also play a crucial role in a favorable outcome. finding an underlying malignancy in an adult is more likely than in the pediatric population, but children should still be screened because a dramatic response can be seen after tumor removal. our case demonstrates that an autoimmune etiology must always be considered in patients who present with acute behavioral change because of the potential for improved outcome with early administration of immunotherapy. a previously healthy and normally developing 14-year - old boy presented with one week history of intermittent confusion, memory deficit, emotional liability, inactivity, and transient fever and complained of headaches, dizziness, and inability to talk. his brother had a febrile illness earlier in the week, and the patient experienced one day of fever, with a maximum temperature of 101.7 f a day before the acute change in his mental state. examination on admission was remarkable for an ill - appearing, tearful boy with significant deficits in memory, attention, language, and orientation. he was oriented to person and place but not time and had difficulty naming simple objects (bone his digit span was only 2 forward, and he could not follow the directions for backward digit span. head computed tomography (ct) was unremarkable, and a lumbar puncture (lp) was performed to rule out meningoencephalitis, which showed only 5 white blood cells (wbcs) with normal glucose and protein (table 1). overnight video electroencephalogram (veeg) showed marked left hemisphere dysfunction, a lack of a posterior dominant rhythm on the left and epileptogenicity with temporal and occipital maximum. electroencephalogram captured multiple, 20- to 30-second - long, subtle / stuttering electrographic seizures emanating from the left hemisphere (fig. 1). magnetic resonance imaging (mri) revealed cortical thickening involving the left hippocampal and parahippocampal gyri and temporal lobes with associated abnormal flair signal and restriction. the imaging pattern was most suggestive of an underlying inflammatory process such as encephalitis or prolonged seizure activity (fig. 2). one gram of intravenous (iv) methylprednisolone (solumedrol) was started soon after mri and eeg and within 24 h of admission. the patient was also loaded with fos - phenytoin and started on maintenance fos - phenytoin and topiramate. intravenous solumedrol was continued for a total of 3 days followed by dexamethasone (6 mg tid 5 days, 6 mg bid 5 days, 6 mg daily 5 days, 3 mg daily 5 days). he continued to demonstrate waxing and waning mental status after a high - dose solumedrol burst. repeat video - eeg monitoring on day 9 no longer detected seizures but continued to show absence of a posterior dominant rhythm on the left. single photon emission computed tomography scan was performed on day 9 to address continued concern for ongoing subclinical seizure activity that was not being captured on eeg. it demonstrated an asymmetric hyperperfusion throughout the left cerebral hemisphere with posterior predominance, corresponding to the findings seen on mri, which may have reflected ongoing seizure activity (fig. repeated doses of lorazepam were given at times of aphasia, confusion, and sleepiness and produced a transient clinical improvement. repeat mri of the brain (with and without contrast) on day 10 of the hospital stay displayed marked improvement ; only subtle t2 hyperintensity, with minimal cortical thickening in the left occipital and inferior temporal lobes, was noted. the repeat lumbar puncture on day 10 was again unremarkable (table 1). the patient was given 2 doses of 1-g / kg intravenous immunoglobulin (ivig) on days 11 and 12 of hospitalization. on day 18, he was transferred to inpatient rehabilitation with a plan for clobazam monotherapy (10 mg bid). one month after initial presentation, the paraneoplastic panel came back positive for n - type calcium channel binding antibody (0.26 testicular ultrasound showed 1-cm hypoechogenicity in the upper pole of the right testis and bilateral microlithiasis. the most recent mri of the brain, completed four months after the initial mri, demonstrated complete / near - complete resolution of abnormal t2 hyperintense signal and cortical thickening. our patient has been able to go back to school and has not had any notable residual deficits. one gram of intravenous (iv) methylprednisolone (solumedrol) was started soon after mri and eeg and within 24 h of admission. the patient was also loaded with fos - phenytoin and started on maintenance fos - phenytoin and topiramate. intravenous solumedrol was continued for a total of 3 days followed by dexamethasone (6 mg tid 5 days, 6 mg bid 5 days, 6 mg daily 5 days, 3 mg daily 5 days). he continued to demonstrate waxing and waning mental status after a high - dose solumedrol burst. repeat video - eeg monitoring on day 9 no longer detected seizures but continued to show absence of a posterior dominant rhythm on the left. single photon emission computed tomography scan was performed on day 9 to address continued concern for ongoing subclinical seizure activity that was not being captured on eeg. it demonstrated an asymmetric hyperperfusion throughout the left cerebral hemisphere with posterior predominance, corresponding to the findings seen on mri, which may have reflected ongoing seizure activity (fig. repeated doses of lorazepam were given at times of aphasia, confusion, and sleepiness and produced a transient clinical improvement. repeat mri of the brain (with and without contrast) on day 10 of the hospital stay displayed marked improvement ; only subtle t2 hyperintensity, with minimal cortical thickening in the left occipital and inferior temporal lobes, was noted. the repeat lumbar puncture on day 10 was again unremarkable (table 1). the patient was given 2 doses of 1-g / kg intravenous immunoglobulin (ivig) on days 11 and 12 of hospitalization. on day 18, he was transferred to inpatient rehabilitation with a plan for clobazam monotherapy (10 mg bid). one month after initial presentation, the paraneoplastic panel came back positive for n - type calcium channel binding antibody (0.26 nmol / l [0.03 nmol / l ]). testicular ultrasound showed 1-cm hypoechogenicity in the upper pole of the right testis and bilateral microlithiasis. the most recent mri of the brain, completed four months after the initial mri, demonstrated complete / near - complete resolution of abnormal t2 hyperintense signal and cortical thickening. our patient has been able to go back to school and has not had any notable residual deficits. early recognition of encephalopathy being related to an underlying autoimmune mechanism in our patient led to expedited immune - modulatory therapy and subsequent favorable outcome. detection of elevated antibody titer of n - type vgcc in his serum and his positive response to steroids and ivig point towards an autoimmunity as the cause of his symptoms. a case report of two boys with encephalitis of unknown etiology demonstrated the positive effect of immunotherapy even in the absence of a known antibody as the cause. patients with immune - mediated encephalitis can present with the wide spectrum of symptoms including psychosis, catatonia, alterations of behavior and memory, seizures, abnormal movements, and autonomic dysregulation. a high degree of suspicion for an autoimmune etiology may, therefore, lead to an early administration of immune - modulatory therapy and a better outcome. in cases of underlying malignancy, it is important to also treat and remove the malignant tumor for successful outcome. as noted in the literature on anti - nmdar encephalitis, over 75% of patients have significant recovery of neurologic issues when treated early with immunotherapy and tumor removal whenever applicable. at the time of initial presentation, also, we have no reason, at this point, to suspect an underlying malignancy. close follow - up is necessary as encephalitis often develops prior to the diagnosis of cancer. the adult guidelines recommend repeating the screening in 36 months if primary screening is negative and then every 6 months for 4 years, except in lambert eaton myasthenia syndrome (lems). for lems, follow - up for 2 years is recommended. we are unaware of another case report of a child with encephalitis secondary to n - type calcium channel receptor antibody. a case report was found of a 65-year - old woman with small cell lung cancer who presented with seizure, confusion, dizziness, and lethargy and was subsequently found to have anti - n - type voltage - gated calcium channel titer elevation (0.42 nmol / l [< 0.03 nmol / l ]). n - type voltage - gated calcium channel antibody does not have a well - described association with a specific paraneoplastic syndrome or underlying malignancy, whereas in other antibodies associated with characteristic cns syndromes, the presence of various tumors has been found as the underlying source of the antibody production. n - methyl d - aspartate receptor encephalitis, for example, is often found in association with ovarian teratoma. easton myasthenic syndrome (lems) and paraneoplastic cerebellar degeneration are commonly associated with small cell lung cancer (sclc). easton myasthenic syndrome is associated with voltage - gated calcium channels (most of the p / q type with n - type found in about 35%). other synaptic proteins targeted in limbic encephalitis or autoimmune epilepsies include -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (ampar), -aminobutyric acid (gaba) receptor, voltage - gated potassium channel complex (vgkc), glutamic acid decarboxylase (gad) 65, collapsin response - mediated protein 5 (crmp5), and ganglionic acetylcholine receptor. limbic encephalitis is more often a paraneoplastic syndrome in adults, while children are far less likely to have an underlying malignancy. in summary, we present this unique case of a young man with encephalitis and high antibody titers of n - type voltage - gated calcium channel. our case underscores the importance of early immune - modulatory therapy when an underlying autoimmune process is suspected. patients presenting with new onset memory deficits, behavioral changes, and seizures of unknown etiology should have autoimmune encephalitis at the top of their differential diagnosis. immunotherapy can be started prior to confirmation, and the timely treatment of these patients can facilitate improved outcome.	we report, to our knowledge, the only known pediatric case with encephalopathy and significantly elevated titers of n - type voltage - gated calcium channel antibody (n - type vgcc). the patient, an 8th grader, was previously healthy and presented with a one - week history of confusion, aphasia, transient fever, headaches, and dizziness. an underlying autoimmune process was suspected because of inflammatory changes in the brain mri and multiple focal electrographic seizures captured in the eeg in the absence of csf pleocytosis. within 24 h of presentation, the patient was empirically started on immune - modulatory therapy, and a full recovery was achieved within 3 months of the initial presentation. immune therapy included high - dose intravenous (iv) methylprednisolone followed by a 2-week course of dexamethasone and 2 monthly courses of iv immunoglobulin (ivig). he was also treated with anticonvulsants for one month. no tumor has been found to date. there is a paucity of reports on autoimmune epilepsy or encephalopathy associated with n - type vgcc. complete resolution of brain lesion, seizure freedom, and full recovery of function following early and aggressive immunotherapy demonstrate that a high index of suspicion is crucial for early recognition and treatment of autoimmune encephalitis.
obesity and overweight represent risk factors for chronic diseases emphasizing diabetes mellitus, hyperlipidemia, heart disease, hypertension, and so forth. while in the united states actually two thirds of the adult population are overweight or obese, obesity is continuously increasing in european citizens with currently approximately 20% [1, 2 ]. in contrast, the incidences of eating disorders resulting in significant underweight are increasing as well, revealing one of the most common health problems in female adolescents and young women [3, 4 ]. physical complications are common among these patients based on endocrinological, electrolyte, hematological, and metabolic abnormalities [3, 4 ]. consequently, obesity as well as underweight induce anatomical and physiological changes interfering with the body 's response to trauma and emergency surgery. however, consequences of weight disorders on complications and outcome following trauma and emergency surgery are still poorly understood and conflicting results have been reported [6, 7 ]. focusing on the relationship between body weight and mortality, a u - shaped correlation between the body mass index and in - hospital mortality is described [2, 8 ] demonstrating increased mortality in underweight but less markedly in obese patients [2, 7, 8 ]. nevertheless, increased morbidity is found in obese patients manifested in impaired hemodynamics and tissue perfusion leading to an increased incidence of multiple organ failure after elective surgery. consequently, following the literature on critical care medicine, increased mortality in obese patients emphasizing on critical airway management, difficult surgical exposures, challenging nursing care, and complicated diagnostics is expected [5, 10, 11 ]. emerging theories are currently suggesting that trauma- and obesity - induced inflammatory stress plays a pivotal role in increased morbidity and mortality in severe trauma combined with weight disorders [12, 13 ]. in general, trauma induces an immunological response with a complex acute - phase protein and cytokine release resulting in endothelial cell damage, dysfunction of vascular permeability, microcirculatory disturbances, and necrosis of parenchymal cells. among inflammatory markers, interleukin- (il-) 6 levels currently represent the best correlation with severity of injury and the risk of organ dysfunction [1518 ]. in addition, several studies have elucidated increased il-6 levels in obese patients correlated with insulin resistance [19, 20 ] and the incidence of diabetes. the present study intends to clarify the relationship between body mass index, complications and outcome after severe multiple trauma. in order to understand the biochemical coherences in these patients in vivo, the present study follows the guidelines of the revised un declaration of helsinki in 1975 and its latest amendment in 1996 (42nd general meeting). a retrospective analysis of all multiple traumatized patients, defined as injury severity score (iss) 16 points, primarily admitted to a level i trauma center between january 1, 2005 and june 30, 2011, was performed. further inclusion criteria were admission to intensive care unit (icu) within the first 24 hours and age 16 years. admission weight and height were used to calculate the body mass index (bmi (kg / m)). patients were assigned to four groups based on the bmi using the classification of the world health organization as follows : group i (underweight) (i) bmi 30.0 demographics, mechanism of injury, injury distribution and severity, clinical course, serum markers, complications, and outcome were analyzed. injury distribution was determined with the 2005 revised edition of the abbreviated injury scale (ais) and summarized to the injury severity score (iss) reflecting the overall injury severity. each injury is assigned an ais score according to its relative importance on a six - point scale (1, minor ; 2, moderate ; 3, serious ; 4, severe ; 5, critical ; 6, unsurvivable) and is allocated to one of six body regions : head and neck ; face ; thorax ; abdomen ; extremities (including pelvis) ; and external. only the highest ais score in each body region is used. the three most severely injured body regions have their score squared and added together to the iss. clinical course included duration of ventilation (hours), duration of icu treatment (days), and the overall length of stay (los) in days. the duration of initial emergency surgery (minutes) was defined as any surgery performed in the operating room within the first 24 hours after hospital admission. in order to estimate the risk of mortality, the (apache ii) score and its predicted mortality were documented on admission to icu after emergency surgery was performed. systemic inflammatory response syndrome (sirs), sepsis, the acute respiratory distress syndrome (ards), and the multiple organ dysfunction syndrome (mods). ards was assumed following the recommendations of the the american - european consensus conference on ards [25, 26 ]. considering multiple organ failure if the score was greater than 12 points on two consecutive days or at least three days during a 14-day observation period [27, 28 ]. c - reactive protein (crp) and il-6 levels were measured with blood samples taken during emergency room management after hospital admission as a standard procedure. the samples represent the immunological response to trauma before emergency surgery was initiated. during the icu stay, blood samples were taken repetitively every morning at 07:00 a.m. for at least 14 days after admission to icu. the data were analyzed using the statistical package for the social sciences (spss ; version 19 ; ibm inc., somers, ny, usa). incidences are presented with counts and percentages while continuous values are presented as mean standard deviation (sd). differences between the groups were evaluated with analysis of variance (anova) for continuous data, while pearson 's -test was used for categorical values. a pairwise comparison was not performed due to an increased type i error. in order to reveal the impact of bmi on complications, a multivariate logistic regression analysis was performed with mods as a target variable and bmi group, injury severity (iss), and apache ii score as potential predictors. the spearman rank correlation coefficient was used to determine the connection between il-6 and crp levels and development of mods. a two - sided p value < 0.05 was considered to be significant. 660 adult multiple traumatized patients were treated between january 1, 2005, and june 30, 2011. a total of 74 patients (11.2%) were excluded due to missing body weight or height data preventing bmi measurements. including 586 patients, the overall mean bmi was 26.0 4.5 kg / m (range 15.156.8 kg / m). the male to female ration was 2.3 : 1 with a mean age of 42.0 18.0 years. diversifying the included trauma collective, 4.8% patients were underweight, 45.2% had normal weight, 36.0% were overweight, and 14.0% were obese. we elucidated significant differences between these four groups with regard to age, gender, and severity of head injuries (table 1). obese patients demonstrated the highest age and ratio of males while underweight patients were younger females (table 1). analyzing injury distribution, the lowest severity of head injuries was noted in obese patients while no differences were found regarding the overall injury severity as well as the remaining injury distribution (table 1). duration of ventilation, length of icu treatment and the overall length of stay increased consistently with the bmi. duration of initial emergency surgery was not influenced by the bmi at admission (table 2). according to the measured apache ii score and its predicted mortality furthermore, no statistical differences referring to incidence of sirs, sepsis, and ards were evaluated between the bmi groups. however, a strong trend towards an increased rate of mods in obese patients was proven (table 4). in a multivariate analysis, obesity was revealed as the highest risk factor for development of multiple organ dysfunction syndrome (or 4.209, 95%-ci 1.51511.692 ; p = 0.006) beside injury severity (or 1.054, 95%-ci 1.0201.089 ; p = 0.001) and the prognostic apache ii score (or 1.059, 95%-ci 1.0011.121 ; p = 0.047) (table 5). regarding outcome, there was no influence of the nutrition status on mortality although mortality was increased in underweight patients without reaching statistical significance (p = 0.484). the descriptive course of il-6 and crp according to the different bmi groups is illustrated in figures 1 and 2. descriptively, obese patients have been admitted with increased mean plasma il-6 levels (1,122.6 4,376.5 pg / ml), overweight (620.9 1,330.0 pg / ml), and underweight (310.0 494.5 pg/ ml) (p = 0.470) (figure 1). however, on day 1 il-6 values in obese patients were comparable to levels found at admission while in overweight patients an increase was revealed. in contrast, il-6 levels in normal and underweight patients were decreased at that time (p = 0.008). overall, underweight patients demonstrated the lowest systemic il-6 values during the observed period (figure 1). nevertheless, statistical significant differences of il-6 levels according to the different bmi groups were only verified on day 1 (p = 0.008). emphasizing on the impact of il-6, a positive correlation with the incidence of mods was present at any time during the study period (table 6). regarding crp values, obese patients demonstrated increased levels after admission without reaching statistical significance (bmi group i 7.5 11.8 mg / l ; bmi group ii 12.6 24.5 mg / l ; bmi group iii 11.5 25.1 mg / l ; bmi group iv 15.3 25.6 mg / l ; p = 0.452). a continuous increase with a maximum on day 3 was observed followed by a continuous decrease during the observation period. during the first 14 days highest levels were observed in obese patients followed by overweight, normal weight, and underweight patients. significant differences between the illustrated crp values according to the bmi groups were found from day 1 to day 3, from day 4 to 9, and day 11 to day 13 (figure 2). increased crp values were positively correlated with the incidence of mods from day 3 (table 6). the influence of an increased body mass index on morbidity and mortality in critically injured patients has shown conflicting results [5, 29, 30 ]. however, the present study provides new insights regarding impact of body weight in multiple traumatized patients evaluating the posttraumatic systemic immune response. the main results of the present study could be summarized as follows : obesity was revealed as highest risk factor for development of mods while no influence on mortality was shown. although not reaching statistical significance, underweight patients showed twice the mortality rate as compared to obese patients which may be of clinical significance and should be considered in future diagnostic and therapeutic steps, obese patients have been admitted with increased il-6 levels for the first four days. overall, underweight patients demonstrated the lowest il-6 values during the observed period, measuring systemic crp levels, obese patients had significantly increased values for almost the complete study period, increased il-6 levels were positively correlated with the incidence of mods during the whole study period, while increased crp levels were positively correlated with mods after day 3. obesity was revealed as highest risk factor for development of mods while no influence on mortality was shown. although not reaching statistical significance, underweight patients showed twice the mortality rate as compared to obese patients which may be of clinical significance and should be considered in future diagnostic and therapeutic steps, obese patients have been admitted with increased il-6 levels for the first four days. overall, underweight patients demonstrated the lowest il-6 values during the observed period, measuring systemic crp levels, obese patients had significantly increased values for almost the complete study period, increased il-6 levels were positively correlated with the incidence of mods during the whole study period, while increased crp levels were positively correlated with mods after day 3. the first study investigating the relationship between body mass and trauma was performed in 1991 by choban. including 184 multiple traumatized patients. the authors showed a 42% mortality rate in obese patients compared to 5% in those with normal weight. due to the remaining question, if this tremendous difference in mortality is based upon a specific injury pattern, boulanger. interestingly, obese trauma victims were more likely to suffer from severe thoracic injuries but incidence of severe head injuries decreased. according to the results of our study with less severe head injuries in obese patients, obesity seems to influence the injury pattern even 20 years later in the same way despite improving active and passive vehicle safety systems. several reports were recently performed due to increasing public awareness of the obesity epidemic and its wide influence. referring to differences in study designs diverse findings according to morbidity and mortality in obese patients were revealed [2, 59, 29 ]. in the current study we were able to identify obesity as the most important risk factor for the development of mods but interestingly without significantly influencing mortality. in line with these results, obesity has been verified as an isolated risk factor for postinjury multiple organ failure with an odds ratio of 1.8 beside age, massive blood transfusion, and injury severity in a recent study. moreover, obesity increased length of icu treatment and in - hospital time. the prolonged requirement of icu treatment and in - hospital time in our as well as other studies may be a direct consequence of increased incidence of mods [32, 33 ]. according to newell., obesity in traumatized patients influenced multiple organ failure with a risk of 2.6 odds ratio without effecting mortality (or 0.81). in contrast, neville and colleagues showed an increased incidences of multiple organ failure (13% versus 3%) and increased mortality rates (32% versus 16%) in obese critically injured patients. contrary to the presented results, the authors assigned their patients only to two groups, obese (bmi 30) and nonobese (bmi < 30) which might not adequately consider the complexity of weight disorders. one of the largest studies with data of 5,766 traumatized patients from the trauma registry of the german trauma society showed an increased incidence of multiple organ failure in obese patients while underweight was associated with a lower incidence. similar to our results no differences between the bmi groups were revealed referring to mortality in a direct comparison. but according to a multivariate analysis, underweight as well as obesity were associated with increased mortality. in brief summary, considering these studies an indisputable association of weight disorders and morbidity and respectively mortality was shown. although these results are confirmed by data of the present study, to date no potential reasons for the increased morbidity and mortality were proven. one explanatory approach was found by belzberg., who measured reduced tissue perfusion and cardiac output in obese nonsurvivors following severe trauma. consequently, emerging theories suggested that the cytokine response to trauma as well as surgical interventions might be altered in obesity. lately, il-6 as a part of the proinflammatory cascade was verified as the most reliable prognostic marker following trauma. il-6 not only correlates with injury severity but is highly associated with multiple organ failure and outcome [16, 18 ]. congruent to these findings, increased levels of il-6 were strongly correlated with the incidence of mods during the whole study period in the presented study. however, increased systemic concentrations of proinflammatory cytokines such as il-6 are associated with systemic insulin resistance [19, 20 ] and the incidence of diabetes. considering that basal systemic il-6 concentrations are enhanced in obese patients increased plasma levels could be expected following major trauma. following surgical stress, gletsu. monitored plasma and adipose tissue concentrations of il-6 after abdominal surgery. the circulating il-6 concentrations at baseline and after surgery were related to the abdominal adipose tissue content and exaggerated in obese patients. after surgery, worsening of insulin resistance was correlated with increased systemic as well as adipose tissue content of il-6. the effect of surgical interventions on il-6 release might be similar in major trauma considering the presented results. comparing systemic il-6 levels on admission and day one, considerable differences of il-6 values dependent on the nutrition status were found demonstrating a systemic increase in overweight and obese patients as compared to normal - weight and underweight patients. since the durations of the initial surgery and the injury severity were comparable between bmi groups, an influence of the nutrition status could be suggested. an increased initial inflammatory state illustrated by systemic il-6 levels thus, elevated systemic il-6 levels in obese trauma victims on admission in the presented study may be from relevance for the further clinical course. in addition, the lowest levels of il-6 in underweight may result of reduced adipose tissue and fatty acids which release inflammation - related adipokines commonly related to obesity - associated pathologies. contrary to the proinflammatory adipokines, adiponectin acts as insulin - sensitizing, antiatheroganic hormone with an anti - inflammatory potential. this interaction of pro- and anti - inflammatory mediators is demonstrated to be negatively influenced in obesity which has been characterized as a continuous state of mild inflammation [35, 37, 38 ]. measuring an inflammatory status, the c - reactive protein has been proven to be one of the most sensitive inflammatory markers [37, 38 ]. furthermore, current studies revealed an association with atherosclerotic diseases and diabetes mellitus type ii [39, 40 ]. within the regulation of the inflammatory cascade, crp suppresses adiponectin exaggerating to the inflammatory reaction in obesity [37, 38 ]. this exaggeration of inflammation could be demonstrated according to the presented results illustrating increased systemic crp levels for almost the complete study period in obese patients. similar to our suggestions referring the il-6 values, the highest measurements of crp in obese patients and, respectively, the lowest in underweight seemed not to be influenced by injury severity, duration of emergency surgery, or the incidences of clinical complications. similarly, kraft. demonstrated increased crp and triglyceride levels in overweight pediatric burn patients. the authors explained this finding with the increased proinflammatory, catabolic state of obese patients. although the prognostic power of crp referring to complications is debatable [42, 43 ], increased crp levels were correlated with the incidence of mods after day 3 in the present study. apriori, a substantial number of patients had to be excluded due to missing weight and height data preventing the bmi measurement. this limiting aspect is known in comparable studies [2, 5, 7, 8, 30 ], wherein missing data lead to exclusion up to 17%. in addition, excluded patients in the presented study had the same characteristics as compared to the whole population (data not shown). nevertheless, one can argue whether the bmi represents an accurate tool to determine weight disorders. even though a correlation exists between bmi and body fat (%), classification of individual weight disorders may show discrepancies when body fat analyses were performed. although divergent results have been demonstrated whether bmi or body fat measurements are more accurate to determine potential outcome prognoses, we feel safe to use bmi measurement since it represents the mostly accepted parameter in the current literature analyzing trauma populations [2, 5, 7, 8, 30, 41 ]. emphasizing our suggestions of adipokines and adiponectin influencing the inflammatory response in multiple trauma, this aspect could not be proven due to the retrospective design of this study. these hormones are not measured as standard laboratory parameters in our multiple trauma patients. to field this limiting aspect, further research is required in order to verify presumable correlations between il-6 and crp with these hormones, which have been related to common obesity - associated pathologies. according to the presented results, obesity was revealed as an independent risk factor for the development of mods in severely traumatized patients. in obese patients, systemic il-6 levels were elevated until day four while crp presented the highest levels in obese patients followed by overweight, normal - weight, and underweight patients during the whole period. in conclusion, an altered inflammatory reaction following the double hit of obesity and multiple trauma seems to determine the risk for multiple organ failure after severe trauma. thus, the nutrition status seems to play a pivotal role in the posttraumatic clinical course and therefore should be considered in therapeutic strategies in patients suffering from major trauma. further research with attention to obese patients might ascertain presumable correlations of il-6 and crp with adipokines as well as adiponectin, which are commonly related to obesity - associated pathologies.	obesity is known as an independent risk factor for various morbidities. the influence of an increased body mass index (bmi) on morbidity and mortality in critically injured patients has been investigated with conflicting results. to verify the impact of weight disorders in multiple traumatized patients, 586 patients with an injury severity score > 16 points treated at a level i trauma center between 2005 and 2011 were differentiated according to the bmi and analyzed regarding morbidity and outcome. plasma levels of interleukin- (il-) 6 and c - reactive protein (crp) were measured during clinical course to evaluate the inflammatory response to the double hit of weight disorders and multiple trauma. in brief, obesity was the highest risk factor for development of a multiple organ dysfunction syndrome (mods) (or 4.209, 95%-ci 1.51511.692) besides injury severity (or 1.054, 95%-ci 1.0201.089) and apache ii score (or 1.059, 95%-ci 1.0011.121). in obese patients as compared to those with overweight, normal weight, and underweight, the highest levels of crp were continuously present while increased systemic il-6 levels were found until day 4. in conclusion, an altered posttraumatic inflammatory response in obese patients seems to determine the risk for multiple organ failure after severe trauma.
although renal cell cancer (rcc) may reach almost every organ to form metastases, the most common metastatic sites include the lungs, abdomen, bones and brain. whereas metastases of rcc to different sites are not uncommon, contralateral adrenal gland is rarely involved. in one autopsy study of more than 400 patients who had undergone nephrectomy for rcc, the contralateral adrenal gland was the sole site of metastatic infiltration in only 2.5%. among those with widespread rcc metastases identified in autopsy, in addition to being able to metastasize to numerous different organs, rcc can recur or metastasize many years after the removal of the primary tumor. one of the unique forms of rcc growth is the ability to infiltrate the renal vein or even the vena cava, and propagate within the vessels to reach the right atrium in selected cases. it has been estimated that among those diagnosed with rcc, tumor thrombus is located in the renal vein or vena cava inferior (vci) in approximately 10% of patients, including 1% of those with right atrium involvement. we present the case of a metachronous contralateral adrenal metastasis of rcc with tumor thrombus located in the adrenal vein. according to our knowledge, our case is the second similar entity described in the literature of the subject so far. a 47-year- old woman presented with a left - side renal mass detected incidentally in an ultrasound scan (uss). this lesion was further evaluated in computer tomography (ct) imaging of the abdomen, which revealed a solid 3-cm - in - diameter lesion in the upper pole of the left kidney without lymphadenopathy. chest x - ray (cxr) was normal and the creatinine level was 1.4 mg%. on the 6 of october 1994, she was subjected to left - side radical nephrectomy with adrenalectomy, performed without complications. the pathologic examination confirmed clear cell carcinoma g2 without metastases to the lymph nodes and the left adrenal gland. one of the recent uss, conducted in january 2011, did not show any abnormalities, but the next one, performed in january 2012, revealed a solid 6x3 cm lesion in the right adrenal gland (fig. a ct scan of the chest and abdomen was carried out on the 10 of january 2012, and revealed a metastasis in the lung, and confirmed a solid 41x21x30 mm lesion in the right adrenal gland, with adhesion to vci (fig. ultrasound image of the right adrenal gland lesion selected ct images of the adrenal lesions since the lung lesions were deemed resectable, right adrenalectomy was proposed and consented to. prior to the procedure, the patient was seen by an endocrinologist, and steroid supplementation was prescribed. plasma levels of cortisol, aldosterone, 17-oh - progesterone, dehydroepiandrosterone sulfate and 4-androstenedione were all normal. the patient was operated on at the age of 64, on the 19 of january 2012, when right adrenalectomy was performed with adrenal vein tumor thrombectomy (fig. there were no complications after the procedure, and the patient was discharged on the 5 post - op day. she was referred to a thoracic surgeon for further treatment of the metastasis in the lungs. postoperative picture of the removed metastasis histological confirmation of clear cell type of rcc adrenal metastasis the behaviour of rcc is unpredictable, metastases may be found synchronously with the primary tumour, or in various organs many years after the treatment of the primary lesion. metastasis of rcc to the contralateral adrenal gland can be diagnosed as late as 23 years after nephrectomy. first, some metastases can be very slowgrowing, especially if they are low grade. second, failure to use routine imaging studies might explain the delayed detection in some cases. adrenal metastases are usually anatomically and functionally silent, and patients rarely have symptoms or signs of adrenal insufficiency. the underlying biological pathway for secondary involvement of the contralateral adrenal gland by rcc is unknown. the routine follow - up ultrasound evaluation may therefore miss adrenal lesions with diameters 5 years after removing the metastasis. therefore the longest disease - free interval after removing a cam was 12.1 years, and the longest crude survival 14.3 years. a contralateral adrenal metastasis from rcc is a rare finding with the potential benefit of cure after resection. care must be taken in preoperative diagnostics, as thismetastasis is capable of causing inferior vena cava tumour thrombus via the suprarenal venous route. interestingly, the ability of venous involvement shown by primary rcc is preserved by the metastatic lesions, though not uniformly. to the best of our knowledge, we present the second similar entity described in literature so far. although rarely encountered, late metastases may occur in patients managed due to renal cancer even in low risk disease. nonetheless, ct repeated on a regular basis in this cohort would hardly be substantiated over the period of 5 years. the role of uss that revealed the lesion in our case should be emphasized. the remote but existing risk of developing contralateral adrenal metastasis after primary radical nephrectomy supports the idea of sparing the ipsilateral adrenal gland in suitable patients who undergo radical nephrectomy.	a 64-year - old woman presented with contralateral right adrenal metastasis with adrenal vein thrombus, which was diagnosed many years after left nephrectomy with adrenalectomy due to renal cell cancer. the patient underwent right adrenalectomy with adrenal vein tumor thrombectomy for treatment. the pathologic examination confirmed metastatic clear cell carcinoma. the remote but existing risk of developing contralateral adrenal metastasis (cam) after primary radical nephrectomy supports the idea of sparing the adrenal gland in suitable patients who undergo radical nephrectomy. contralateral adrenal metastasis from rcc is a rare finding with the potential benefit of cure after resection. care must be taken in preoperative diagnostics, as this metastasis is capable of causing inferior vena cava tumor thrombus via the suprarenal venous route. according to our knowledge, our case is the second similar entity described in literature so far.
psoriasis vulgaris (pv) is a common chronic skin disease with a worldwide distribution, affecting 13 % of the general population (henseler 1998 ; kurd and gelfand 2009). like many other immune - mediated diseases, psoriasis results from a combined action of multiple genes and environmental triggers. the age at disease onset is highly variable ; however, studies have shown that 7590 % of patients develop psoriasis before the age of 40, with a peak around puberty and a smaller peak around 5060 years of age (henseler and christophers 1985). among psoriatic patients, up to 40 % develop psoriatic arthritis (psa)an associated inflammation of the joints (weger 2010). the human leukocyte antigen (hla) region on chromosome 6p21 is well known to carry the most important genetic factors in the susceptibility to psoriasis, whereas the critical segment appears to be a 300-kb interval at the centromeric end of hla class i, named psors1 (nair. the first reports on the association of both hla class i and class ii antigens (e.g. hla - b13, b17, dr7) with psoriasis were obtained by serologic methods already in the 1970s (russel. 1972 ; brenner. 1978). in the following years, molecular genotyping was introduced, and many independent groups have proven that among hla alleles, hla - c06 confers the major and most consistently demonstrated risk factor (elder. hla - c06 carriers have a significantly higher risk of developing pv with risk ratios ranging in caucasoid psoriatic patients from 3 to 36 (cassia. 2007). however, not all hla - c06 psoriasis - associated haplotypes appear to confer an equal risk of pv in different populations as reviewed by elder. multiple hla alleles have been identified in increased occurrence rates, most probably because of linkage disequilibrium in the hla region. in the german, italian and thai population, the extended haplotype (eh) hla - c06-b57-drb1 0701-dqa1 0201-dqb1 0303, named according to the b allele eh-57.1, was reported to be highly overrepresented in patients with psoriasis (schmitt - egenolf 1996 ; choonhakarn. another similar predisposing haplotype, hla - c0602-b57-drb1 0701-dqa1 0201-dqb1 0201 (eh-57.2), was observed in croatian patients (kastelan. 2003). however, many of the associated alleles tend to vary among patients of different racial and ethnic backgrounds as reviewed by cassia. the aim of our study was to provide the first survey of the hla - c as well as hla - drb1 and dqb1 allele distribution in slovak psoriatic patients as a contribution to the precise definition of hla class i- and class ii - associated loci in different ethnic populations. one hundred forty - seven unrelated patients with chronic stable plaque pv were included in the study. detailed clinical parameters of the study group were recorded by the dermatologists, and they are summarized in table 1. mean age at disease onset was 28 years (range 767, standard deviation (sd) 14). of the patients, 82.3 % had disease onset before 40 years of age and 17.6 % after 40. severity and extent of the disease were estimated using the scoring system psoriasis area and severity index (pasi). the average pasi score was 22 17.table 1characteristics of the study groupparameterpsoriatic subjects (n = 147)gender ratio m / f95/52mean age sd (years)47 12mean onset age sd (years)28 14onset at 40/>40 years121/26familiar occurrence + /67/80psoriatic arthritis + /68/79average pasi score sd22 17sd standard deviation, pasi psoriasis area and severity index characteristics of the study group sd standard deviation, pasi psoriasis area and severity index according to the criteria proposed by henseler and christophers (1985), patients may be subdivided into two subsets : type i psoriasis (age at onset before 40, presence of a positive family history and strong association with hla - c06) and type ii (age at onset after 40, no family history and weak association with hla - c06). at first, we have subdivided our patients into subsets according to the following criteria : age of onset 40 versus > 40 years and/or a positive family history of psoriasis versus negative history. family history was considered positive when at least one first- or second - degree relative had psoriasis. no statistically significant differences were found when comparing the hla allele frequencies observed in those subsets (data not shown). similarly, we have divided our patients into a subset with psoriatic arthritis (46.3 % of the psoriatic patients) and a subset without signs of psa (remaining 53.7 % of subjects). again, no significant differences in frequencies were observed between the psa - positive versus psa - negative subsets. therefore, we decided to report our results on the whole group of our psoriatic patients regardless of the above - mentioned criteria (table 1). the reference group comprised 194 unrelated subjects without a history of pv who were randomly recruited from blood and bone marrow donors. data on the control subjects have been reported elsewhere (cechova. 1998 ; kulcsarova. romanies who constitute a fraction of about 5 % were not included in this study. a written informed consent for enrolling in the study and for personal data management was obtained from all patients and control subjects. all investigations were carried out in accordance with the principles of the declaration of helsinki. both hla class i and class ii alleles were determined by molecular typing that proved superior to serological methods due to higher specificity and sensitivity (bunce. dna was extracted from whole blood using a modified salting - out procedure (miller. genotyping was performed using the pcr - ssp technique according to the 12th workshop protocol using olerup ssp hla - c low resolution, resp. dq - dr ssp combi tray (olerup ssp ab, sweden) (olerup and zetterquist 1992 ; olerup. amplification reactions were prepared according to manufacturers protocols, and electrophoresis was performed in a 1.5 % agarose gel for 20 min at 10 v / cm. allele frequencies in the study group and in the controls were evaluated by direct counting. data were tested for the goodness of fit between the observed and expected genotype frequencies, and no deviations from the hardy weinberg equilibrium were found. associations of particular alleles with psoriasis were expressed as odds ratios (or) with 95 % confidence intervals (ci) calculated according to woolf s formula. statistical significance of these associations was assessed using the p values defined by the two - sided fisher s exact test. as multiple comparisons were made, bonferroni s correction was applied multiplying the obtained p values by the number of alleles considered at each locus (pcor). one hundred forty - seven unrelated patients with chronic stable plaque pv were included in the study. detailed clinical parameters of the study group were recorded by the dermatologists, and they are summarized in table 1. mean age at disease onset was 28 years (range 767, standard deviation (sd) 14). of the patients, 82.3 % had disease onset before 40 years of age and 17.6 % after 40. severity and extent of the disease were estimated using the scoring system psoriasis area and severity index (pasi). the average pasi score was 22 17.table 1characteristics of the study groupparameterpsoriatic subjects (n = 147)gender ratio m / f95/52mean age sd (years)47 12mean onset age sd (years)28 14onset at 40/>40 years121/26familiar occurrence + /67/80psoriatic arthritis + /68/79average pasi score sd22 17sd standard deviation, pasi psoriasis area and severity index characteristics of the study group sd standard deviation, pasi psoriasis area and severity index according to the criteria proposed by henseler and christophers (1985), patients may be subdivided into two subsets : type i psoriasis (age at onset before 40, presence of a positive family history and strong association with hla - c06) and type ii (age at onset after 40, no family history and weak association with hla - c06). at first, we have subdivided our patients into subsets according to the following criteria : age of onset 40 versus > 40 years and/or a positive family history of psoriasis versus negative history. family history was considered positive when at least one first- or second - degree relative had psoriasis. no statistically significant differences were found when comparing the hla allele frequencies observed in those subsets (data not shown). similarly, we have divided our patients into a subset with psoriatic arthritis (46.3 % of the psoriatic patients) and a subset without signs of psa (remaining 53.7 % of subjects). again, no significant differences in frequencies were observed between the psa - positive versus psa - negative subsets. therefore, we decided to report our results on the whole group of our psoriatic patients regardless of the above - mentioned criteria (table 1). the reference group comprised 194 unrelated subjects without a history of pv who were randomly recruited from blood and bone marrow donors. data on the control subjects have been reported elsewhere (cechova. 1998 ; kulcsarova. 2000). romanies who constitute a fraction of about 5 % were not included in this study. a written informed consent for enrolling in the study and for personal data management was obtained from all patients and control subjects. all investigations were carried out in accordance with the principles of the declaration of helsinki. both hla class i and class ii alleles were determined by molecular typing that proved superior to serological methods due to higher specificity and sensitivity (bunce. dna was extracted from whole blood using a modified salting - out procedure (miller. genotyping was performed using the pcr - ssp technique according to the 12th workshop protocol using olerup ssp hla - c low resolution, resp. dq - dr ssp combi tray (olerup ssp ab, sweden) (olerup and zetterquist 1992 ; olerup. amplification reactions were prepared according to manufacturers protocols, and electrophoresis was performed in a 1.5 % agarose gel for 20 min at 10 v / cm. allele frequencies in the study group and in the controls were evaluated by direct counting. data were tested for the goodness of fit between the observed and expected genotype frequencies, and no deviations from the hardy weinberg equilibrium were found. associations of particular alleles with psoriasis were expressed as odds ratios (or) with 95 % confidence intervals (ci) calculated according to woolf s formula. statistical significance of these associations was assessed using the p values defined by the two - sided fisher s exact test. as multiple comparisons were made, bonferroni s correction was applied multiplying the obtained p values by the number of alleles considered at each locus (pcor). the investigated hla class i and class ii allelic frequencies observed in 147 patients with pv and in the control group are given in tables 2, 3 and 4. they are indicated in the tables only when statistically significant, i.e. when the p value corrected for the number of alleles considered at each locus was < 0.01.table 2distribution of hla - c alleles in patients with psoriasis and controlshla - cpsoriasis vulgaris (2n = 294)controls (2n = 214)or95 % cipcorcountf (%) countf (%) 01134.42136.070.710.321.59n.s.02113.74125.610.660.281.52n.s.03248.16198.880.920.491.72n.s.044214.293415.890.880.541.45n.s.05103.4094.210.800.322.00n.s.066923.47167.483.852.136.67<0.0001 075017.015827.100.550.360.85n.s.0820.6873.270.200.040.99n.s.125217.693214.951.220.762.00n.s.1410.34002.190.0954.12n.s.1541.3631.400.970.224.35n.s.16134.4241.872.440.787.69n.s.1710.3452.340.140.021.23n.s.1820.6820.930.720.105.26n.s.or odds ratio, ci confidence interval, pcor corrected p value, n.s. not significanttable 3distribution of hla - drb1 alleles in patients with psoriasis and controlshla - drb1psoriasis vulgaris (2n = 294)controls (2n = 388)or95 % cipcorcountf (%) countf (%) 01113.744210.820.320.160.64<0.001 03206.80317.990.840.471.52n.s.04268.84359.020.980.571.67n.s.078528.915413.932.561.723.70<0.0001 0882.72102.581.050.412.70n.s.0920.6810.262.630.2433.33n.s.1041.3641.031.330.335.26n.s.113611.576316.240.720.461.12n.s.12134.4251.293.571.2510.00n.s.133812.935614.430.880.561.37n.s.14113.74112.831.330.573.13n.s.15237.825213.400.550.330.92n.s.16196.47246.181.050.561.96n.s.or odds ratio, ci confidence interval, pcor corrected p value, n.s. not significanttable 4distribution of hla - dqb1alleles in patients with psoriasis and controlshla - dqb1psoriasis vulgariscontrol subjectsor95 % cipcor(2n = 294)(2n = 388)countf (%) countf (%) 055117.358521.910.660.450.97n.s.065017.009223.711.751.232.50n.s.028629.257419.071.090.791.49<0.01 0310335.0412933.250.660.202.22n.s.0441.3682.060.750.511.10n.s.or odds ratio, ci confidence interval, pcor corrected p value, n.s. not significant distribution of hla - c alleles in patients with psoriasis and controls or odds ratio, ci confidence interval, pcor corrected p value, n.s. not significant distribution of hla - drb1 alleles in patients with psoriasis and controls or odds ratio, ci confidence interval, pcor corrected p value, n.s. not significant distribution of hla - dqb1alleles in patients with psoriasis and controls or odds ratio, ci confidence interval, pcor corrected p value, n.s. not significant as may be seen in table 2, the strongest association among hla - c alleles is conferred by the c06 allele. the allelic frequency of c06 was 23.5 % in patients compared to 7.5 % in controls, which is an extremely statistically significant difference (or = 3.85, pcor = 0.000025). out of the hla - drb1 alleles presented in table 3, only drb1 07 was positively associated with the disease, showing a frequency of 28.9 % in the patients versus 13.9 % in the control group. this association is again extremely statistically significant (or = 2.56, pcor = 0.000019). on the contrary, the drb1 01 allele was associated with pv negatively (or = 0.32, pcor = 0.0097). out of the dqb1 alleles, the dqb1 02 was observed to have a significantly increased frequency in the patients (29.3 % versus 19.1 %, or = 1.09, pcor = 0.0095) as shown in table 4. we have divided our 147 patients into two subsets according to the presence (46.3 %) versus absence (53.7 %) of psoriatic arthritis. no statistically significant differences in the investigated hla allele frequencies were observed between the two cohorts. on the contrary, significant differences were noted when each of the two subsets was compared with population controls, namely a strong positive association of hla - c06 with psoriasis with the presence of psa (or = 3.94, pcor < 0.0001) and a slightly weaker association with psoriasis alone (or = 3.72, pcor < 0.0001). similarly, there was a statistically significant association of hla - drb1 07 with psoriasis + psa (or = 2.75, pcor < 0.0001) and a weaker association with psoriasis without psa (or = 2.27, pcor = 0.002). although the aetiology of psoriasis vulgaris is still unknown, there is a common consensus that it is a complex disorder occuring in a sensitive genetic territory. multiple genes seem to be involved in the pathogenesis of psoriasis ; however, the major genetic determinant is located within the psors1 segment of the hla region on chromosome 6p21.3, as reported by several independent groups (nair. our study confirmed the strong positive association of psoriasis with hla - c06, observed mainly in caucasoid populations as well as in several other ethnically different groups. there are only a few studies from oriental populations, e.g. the japanese reported association with other hla - c alleles, most often with the hla - c07 allele (roitberg - tambur. interestingly, the occurrence rate of hla - c07 was increased also in our psoriatic patients, though only on the edge of the statistical significance (pcor = 0.07). the hla - c06 allelic frequency of 23.5 % observed in our psoriatic subjects (compared to 7.5 % in the controls) highly corresponds with that of 23.9 % observed in the pv patients of neighbouring poland and fits into the general image seen in the central european geographic region (szczerkowska - dobosz. though hla - c06 is undoubtedly associated with pv, limited data exist to explain the functional role of hla - c in the pathogenesis of psoriasis. according to many researchers, it is unlikely that hla - c itself is the susceptibility gene (elder. hla - c is most probably a marker of another closely linked gene, or a block of genes at a distinct locus. thus, major effort has been put into the identification of candidate genes close to hla - c such as the corneodesmosin gene, which encodes an adhesive protein expressed by keratinocytes or the alpha - helix coiled - coil rod homologue gene. however, there is a lack of evidence confirming their direct involvement in the development of psoriasis, and none of the candidates are convincingly associated with psoriasis independent of hla - c (tazi - ahnini. the hla - c06 allele is the only genetic variant repeatedly observed to be associated with the phenotypic features of pv, especially with an early onset of the disease as confirmed among others by szczerkowska - dobosz. according to henseler and christophers (1985), patients may be classified into two distinct types : type i (age at disease onset before 40 years, familial occurrence and high frequency of hla - c06) and type ii psoriasis (age at onset after 40, occuring sporadically, characterized by a weak association with hla - c06). however, it proved difficult to classify our subjects as either having the type i or type ii psoriasis as many patients were in an intersection of the two types showing features of both groups, and thus, we failed to confirm this observation. comparison of the two types was also limited by the fact that we had only a relatively small fraction of late - onset patients (17.6 %). in order to determine whether hla - c06 and, respectively, other alleles are associated with psa itself or primarily with psoriasis, we have compared the allele frequencies obtained in psoriatic patients with psa with frequencies in patients having psoriasis alone. our results suggest that the primary association with hla - c06 and hla - drb1 07 is with psoriasis and not with psa per se. significant overrepresentation of the neighbouring hla class ii alleles, namely the drb1 07 and dqb1 02 in our study group, is most probably due to the fact that they are contained within the same extended haplotype. this particular risk haplotype was observed also in croatian psoriasis patients and was named eh-57.2 (kastelan. many authors have reported some alleles that occur in lower occurrence rates in patients with pv, indicating they may have a protective effect (cassia. the only allele with a significantly decreased frequency in our patients was the hla - drb1 01 (or = 0.32, pcor < 0.001). however, as the palette of published protective alleles is very variegated and they show only mild association, we assume that they occur at the expense of the highly overrepresented predisposing alleles. in conclusion, our study provides the first report on hla class i and class ii allele association with psoriasis vulgaris in the slovak population. our data point toward the alleles hla - c06, drb1 07 and dqb1 02, respectively, as major genetic risk factors for pv. precise identification of genetic factors that increase the risk of psoriasis and psoriatic arthritis will help to elucidate the pathogenesis of this troubling disease and identify targets for a more specific and effective therapy.	psoriasis vulgaris is a complex chronic skin disease with immunological and genetic background. the most important predisposing genetic factors in psoriasis are genes of the human leukocyte antigen (hla) region. accumulative evidence has shown that several hla alleles are closely associated with psoriasis ; however, they tend to vary in different racial and ethnic backgrounds. one hundred forty - seven unrelated slovak patients with psoriasis vulgaris (average age at onset 28 14 years) were genotyped for the hla - c, dqb1 and drb1 alleles by the polymerase chain reaction using sequence - specific primers. allele frequencies observed in the group of psoriatic patients were compared to those obtained in the ethnically matched control group comprising 194 subjects with no history of psoriasis. susceptibility to psoriasis vulgaris in our study group is significantly associated with hla - c06 (odds ratio (or) = 3.85), drb1 07 (or = 2.56) and dqb1 02 (or = 1.09), respectively, whereas drb01 (or = 0.05) is associated negatively. hereby, we provide the first report on the association of hla - c, drb1 and dqb1 alleles with psoriasis in the slovak population. our findings confirm hla - c06 and drb1 07 as the most important genetic risk factors for psoriasis. however, the role of hla genes as causative in the pathogenesis of the disease remains unclear. identification of genetic factors that increase the risk of psoriasis is a precondition that helps to elucidate the pathogenesis of this troubling disease and identify targets for a more specific and effective therapy.
mental disorders constitute 14% of the global burden of disease and the overall prevalence rate of mental disorders in india is 10 - 12 percent. in addition, the global burden of disease study 2010 (gbd 2010) stated that major depressive disorder is one of the top five leading causes of years lived with disability (yld) in india. being a developing country, in india there are paucity of mental health professionals for instance, psychiatrists < 0.5 per 100,000 population. majority of the population live in rural areas and it was found that about 80% to 90% of the mental disorders were undiagnosed and untreated due to lack of knowledge and negative attitudes toward mental illness. further, stigma and negative attitudes toward people with mental illness have been observed to be common worldwide among general population. in indian culture, family is regarded as the most important structure in caring for vulnerable family members including those with mental illness and more than 90% of patients with chronic mental illness live with their families. the caregivers not only provide the basic needs of care like long - term assistance of housing and financial aid, they also take care of the day - to - day needs of the people with mental illness, monitoring the mental state, identify the early signs of illness, relapse and deterioration, and help the patient in accessing services. however, the lack of knowledge and relatively lower mental health literacy pose challenges to family caregivers, mental health patients and service providers. nevertheless, people 's symptom - management activities will be influenced by mental health literacy. mental health literacy has been defined as knowledge and beliefs about mental disorders, which aid their recognition, management or prevention. further, researchers have suggested that mental health literacy is not a single dimension but rather represents knowledge and beliefs about mental health disorders that emerge from general pre - existing belief systems. however, most of the literature found that mental health literacy among the public is unfortunately poor. most of the mental health literacy surveys have been conducted in western countries, with few studies in indian cultural context. furthermore, no published research available specially was focusing on mental health literacy among caregivers of persons with mental illness from india. therefore, the present study was aimed to examine the mental health literacy among caregivers of persons with mental illness. this study was a descriptive study carried out among caregivers of people with mental illness at out patient department tertiary care centre, bangalore, south india. participants were selected through a random sampling method from the outpatient follow - up cohort. caregivers of every fifth patient among first hundred according to the outpatient register were invited to participate in the study. the study criteria included : (a) their relative must be diagnosed as mentally ill as per icd-10 criteria, (b) aged above 18 years old, (c) must be the main caregiver, (d) more than 6 months caring for mentally ill patients and (e) should be willing to participate in the study. the relatives of patients with substance abuse or mental retardation were excluded. in the concerned hospital, approximately 300 adult patients per day visit the follow - up opd. everyday approximately 15 caregivers were eligible to participate in the study. however, few refused to participate in the study due to lack of interest, lack of time and were unable to manage the patients. overall 230 caregivers were included in the study over a period of 3 weeks and the final sample comprised of 161 caregivers with 70% response rate. the first part of the questionnaire included socio - demographic details of participants such as age, gender, education, income, marital status, religion, residence and relationship with patient. the second part of the questionnaire collected information regarding mental health literacy of the caregivers by using this instrument had 33 items that measured mental health literacy of the participants regarding etiology of mental illness (6 items), knowledge of people with mental illness (6 items) and attitude toward people with mental health problems (12 items), and management of people with mental health problems (9 items). answers were coded on a 5-point scale (agree, somewhat agree, neutral, somewhat disagree, disagree). the researchers administered the tool among a group of caregivers (n = 16) at the follow - up outpatient through face to face interview method over a 2 week period and it was found that the study was suitable to indian context. data was collected by the primary author through a face - to - face interview in a private room at the treatment facilities where the participants were recruited. the interview took approximately 25 - 30 min to complete. after obtaining formal permission from authorities, questions regarding the study were invited from the participants and they were given freedom to leave the study whenever they desire and also they were assured that withdrawal from this study will not affect the treatment of their relative. this study was a descriptive study carried out among caregivers of people with mental illness at out patient department tertiary care centre, bangalore, south india. participants were selected through a random sampling method from the outpatient follow - up cohort. caregivers of every fifth patient among first hundred according to the outpatient register were invited to participate in the study. the study criteria included : (a) their relative must be diagnosed as mentally ill as per icd-10 criteria, (b) aged above 18 years old, (c) must be the main caregiver, (d) more than 6 months caring for mentally ill patients and (e) should be willing to participate in the study. the relatives of patients with substance abuse or mental retardation were excluded. in the concerned hospital, approximately 300 adult patients per day visit the follow - up opd. everyday approximately 15 caregivers were eligible to participate in the study. however, few refused to participate in the study due to lack of interest, lack of time and were unable to manage the patients. overall 230 caregivers were included in the study over a period of 3 weeks and the final sample comprised of 161 caregivers with 70% response rate. the first part of the questionnaire included socio - demographic details of participants such as age, gender, education, income, marital status, religion, residence and relationship with patient. the second part of the questionnaire collected information regarding mental health literacy of the caregivers by using this instrument had 33 items that measured mental health literacy of the participants regarding etiology of mental illness (6 items), knowledge of people with mental illness (6 items) and attitude toward people with mental health problems (12 items), and management of people with mental health problems (9 items). answers were coded on a 5-point scale (agree, somewhat agree, neutral, somewhat disagree, disagree). the researchers administered the tool among a group of caregivers (n = 16) at the follow - up outpatient through face to face interview method over a 2 week period and it was found that the study was suitable to indian context. data was collected by the primary author through a face - to - face interview in a private room at the treatment facilities where the participants were recruited. after obtaining formal permission from authorities, researchers explained the aims and methods of the study to all participants. questions regarding the study were invited from the participants and they were given freedom to leave the study whenever they desire and also they were assured that withdrawal from this study will not affect the treatment of their relative. the present study investigated mental health literacy among 161 caregivers of the persons with mental illness, of whom 59% (n = 95) of them were women. the majority of the participants (n = 92, 57.2%) were aged between 36 and 55 years. the majority of the participants were married (n = 139, 86.3%) and hindus (n = 135, 83.9%). nearly half (n = 68, 42.3%) of the participants were illiterates / primary education and 60.2% of them were from the rural background. almost all participants (95.7% ; n = 154) of the caregivers were family members [table 1 ]. socio - demographic characteristics of participants table 2 shows the responses of the participants to various dimensions of the public perceptions of mental illness questionnaire. concerning the etiology of mental illness, 69% of the participants agreed that mental illness caused by genetic inheritance followed by substance abuse (64%). regarding knowledge of people with mental illness, a majority of the participants (68.4%) agreed that anyone could suffer from mental illness. however, 61.5% of them agreed that people with mental health problems are largely to blame for their condition and are usually dangerous (n = 87, 54%). the participants toward people with mental illness expressed mixed opinions. while 47.8% of them agreed that people with mental illness could get married, nearly two - thirds (62.2%) approved that people with mental illness have the same rights as anyone else. however, 55.9% would not want people to know if they had a mental illness and feel ashamed if a family member had a mental illness. concerning care and management of the people with mental illness, nearly half thought they could hide his / her mental illness from his / her family and believed that mental illness neither can be cured nor recover from mental illness. nearly two thirds of them approved that people with mental illness should be in an institution under supervision and control. nonetheless, 44.1% of the participants disapproved that primary health care centers (phc) provides good care for mental illnesses. this present study was aimed to examine mental health literacy among caregivers of people with mental illness. the few studies that were conducted in india so far either mainly focused on relationship between first treatment contact and supernatural beliefs in caregivers of patients with schizophrenia or religious and traditional modes of intervention which are still widely practiced, especially in rural areas, where mental health services are almost nonexistent. yet, we know very little about the caregivers attitude and knowledge toward mental illness. thus, the present study attempted to investigate the caregivers mental health literacy factors such as etiology, knowledge, attitude and management of people with mental health problems. in line with findings of the studies, the caregivers in the present study demonstrated understanding about the reasons for mental illness as majority of them cited mental illness is caused mainly by genetic inheritance, substance abuse, brain disease. however, they also viewed bad things happening, personal weakness and gods punishment as important factors. similar to these findings, 2009) found that the most commonly acknowledged causes for mental illness were a range of socio - economic factors (conflict with family, at work and with neighbors ; an addicted family member ; not being married ; crisis ; bereavement ; problems from childhood ; financial difficulties ; poverty), while neither supernatural causes nor biological explanation were widely endorsed. on the other hand, a number of studies from india demonstrated peoples belief in supernatural powers as the causative agents of mental illness. however, it can be argued that similar to other studies the participants in the present study were caregivers and they learnt about mental illness through their experiences of caring for a person with mental illness. the majority of caregivers in the present study accepted that anyone can experience mental health problem reflecting the findings of the previous studies. like previous research, the participants hold negative perceptions such as mentally ill are to blame for their condition, not capable to work or to maintain friendships. similarly, the participants had negative attitudes toward mentally ill. however, nearly two thirds of the participants agreed that people with mental illness should have the same rights as anyone else. in a recent survey, 36.9% of rural subjects, 43.2% of urban subjects, and 44.7% of the medical professionals reported that they would oppose marriage with a person recovered from mental illness. however, in both low - income and high - income countries, the stigmatization of people with mental disorders has persisted throughout history. stigma is manifested as bias, stereotyping, fear, embarrassment, anger, rejection, or avoidance. for people suffering from mental disorders, there have been violations of basic human rights and freedoms, as well as denials of civil, political, economic, and social rights, in both institutions and communities. in a recent descriptive study carried out among recovered mentally ill demonstrated that irrespective of gender, literacy, socioeconomic status and residence, human rights violations are occurring at family and community level. the current study also reveals negative attitudes of participants regarding social participation of mentally ill in the community as they cited they would be ashamed if people knew that someone in their family had been diagnosed with a mental illness as well they would not want people to know about their illness. it clearly shows that stigma and discrimination toward people with mental illness exists. in india, it was found that the main predictor of a variable of social distance from people with mental illness perceived the person as dangerous. the present study findings concur with this study as majority (54%) perceived mentally ill as dangerous. on the other hand, it was generally argued that people do not sympathize with a mentally ill person because they impart value to the patient and believe that the person lacks the will power to pull him or herself up and is just not making an effort. however, nearly half of the participants in the present study agreed that people are generally caring and sympathetic toward people with mental illness. in general, the public tends to view the mentally ill as dangerous, unpredictable and prone to violence. in addition, a recent body of research evidence suggests that patients who suffer from serious mental conditions are more prone to violent behavior than persons who are not mentally ill. likewise, in the present study also nearly two thirds of participants opined that mentally ill people should be in an institution where they are under supervision and control. like other studies, in current study, nearly half of them agreed that they are free to discuss mental health issues related to them or their family members. in contrast, most of the studies found that in general people were reluctant to discuss mental disorders with relatives and friends than physical disorders. in india, due to stigmatizing attitudes patients have been found to present their distress in somatic rather than psychological terms. the present study has certain limitations such as small sample that was restricted to one tertiary care centre and lack of compare group. further, the research tool was not validated and there may be the possibility of bias due to social desirability (especially due to the face - to - face interview). hence, the findings of the study may not be generalized and future research should focus on larger sample and comparative studies with qualitative methods (focus group discussions) may be helpful to understand in depth about this issue. despite of these limitations, random sample of the present study the present study has certain limitations such as small sample that was restricted to one tertiary care centre and lack of compare group. further, the research tool was not validated and there may be the possibility of bias due to social desirability (especially due to the face - to - face interview). hence, the findings of the study may not be generalized and future research should focus on larger sample and comparative studies with qualitative methods (focus group discussions) may be helpful to understand in depth about this issue. despite of these limitations, random sample of the present study in summary, the present study highlighted that participants had understanding about the causes of mental illness. however, the majority of the participants are holding stigmatizing attitudes toward people with mental illness in relation to social participation, treatment, work, marriage and recovery. thus, there is an urgent need to educate and change the attitudes of the caregivers regarding mental illness through mental health literacy programs specifically on certain groups within the population who have a particular need for mental health education.	background : despite of growing evidence of mental disorders in developing countries, research on mental health literacy is limited from india.aim:to examine mental health literacy among caregivers of persons with mental illnessmaterials and methods : a cross - sectional descriptive survey was carried out among 161 randomly selected caregivers of persons with mental illness at outpatient department of a tertiary care centre. data was collected through face to face interview using a structured questionnaire.results:regarding the causes of mental illness, a majority agreed that genetic inheritance (69%), substance abuse (64%) and brain disease (59.6%) are main factors for developing mental illness. although more than two - thirds agreed that anyone could suffer from mental illness, 61.5% also agreed that people with mental health problems are largely to blame for their condition. the majority of the participants also agreed that mentally ill are not able to maintain friendships (45.9%), are dangerous (54%), and not capable to work (59.1%). just over half (55.9%) of the participants would not want people to know if they had a mental illness and nearly half of them also expressed that they would feel ashamed if a family member had a mental illness.conclusion:based on the findings of the present study researchers suggest that there is an urgent need to educate and change the attitudes of caregivers through mental health literacy programs specifically designed for them.
benzene is a clear, colorless, flammable liquid with a gasoline - like odor that can volatilize to vapors in air. it is an organic compound found most often in air as a result of emissions from burning coal and oil, gasoline vapors, motor vehicle exhaust, cigarette smoke, wood - burning fires, and other sources. environmental contamination of benzene mainly comes from industrial uses through improper discharge and vehicle traffic. means of transportation emissions represent the major source of benzene in urban ambient air, while its concentrations in indoor air are significantly increased in homes where people smoke. the two primary sources of industrial exposure to benzene are activities associated with both its synthesis and its use to produce other chemicals. a number of other occupations may be exposed to benzene through the use of petroleum products or solvents (reviewed in). in occupational settings the primary contact routes on the other hand, assessment of benzene exposure for general population is harder to quantify because of the differences in lifestyles, weather conditions, and living environments. human exposure to benzene can occur not only through inhalation and dermal absorption, but also through ingestion of food and drinking water. elevated concentrations of benzene in the groundwater could cause potential risk to human health and change the diversity and structure of ecological systems. in addition, natural gas has been reported as a source of benzene contamination in groundwater. in both occupational and general populations benzene is converted in the liver into toxic metabolites such as benzene oxide, phenol, hydroquinone (hq), catechol, 1,2,4-benzenetriol, and a ring - opened product, trans, trans - muconic acid. the selective toxicity of benzene for hematopoietic tissue is apparently connected with the capacity of these hepatic metabolites to specifically accumulate in the bone marrow. health risk and stress posed by benzene have long been a concern because of the carcinogenic effects of the compound which was classified as a group 1 carcinogen to humans and animals. for instance, epidemiological and laboratory studies have shown a close correlation between leukemia, especially acute myeloid leukemia (aml), and benzene exposure [8, 9 ]. moreover, there is limited evidence that benzene may also cause acute and chronic lymphocytic leukemia, non - hodgkin 's lymphoma, and multiple myeloma and aplastic anaemia [8, 10 ]. recently, relatively low - level exposure to benzene was associated with an increased risk of myelodysplastic syndrome (mds). in addition, exposure to benzene can cause harmful effects on immunological, neurological, and reproductive systems. benzene can reduce both b - cell and t - cell proliferation, decrease the host resistance to infection in animals exposed to it, and produce chromosomal aberrations in human peripheral lymphocytes. cytokines are signaling molecules that mediate and regulate immunity, inflammation, hematopoiesis, and many other cellular processes, forming a cytokine network. t helper cell (th) subsets are regulators of the adaptive immune response against infection. th1-type cells produce cytokines which activate macrophages and promote cell - mediated immunity, protective against intracellular infections. th2-type cells produce a variety of anti - inflammatory cytokines that promote humoral immune responses against extracellular pathogens. th17 cells are a subset of cd4 t cells that play a critical role in clearing pathogens during host defence reactions and in inducing tissue inflammation in autoimmune disease. regulatory t cells (treg) are thought to be the master regulators of the immune response in humans. defects in the transcription factor forkhead box protein 3 (foxp3), which defines the treg lineage, result in multiple autoimmune diseases and atopy. benzene can directly damage hematopoietic progenitor cells, which in turn could lead to apoptosis or may decrease responsiveness to cytokines and cellular adhesion molecules. alternatively, benzene toxicity to stromal cells or mature blood cells could disrupt the regulation of hematopoiesis, including hematopoietic commitment, maturation, or mobilization, through the network of cytokines, chemokines, and adhesion molecules [1418 ]. accordingly, hematotoxic effects could be enhanced among individuals exposed to benzene who have genetic variants that alter key pathways that regulate hematopoiesis (reviewed in). today there is mounting evidence that benzene may alter the gene expression, production, or processing of several cytokines in vitro and in vivo. the purpose of this review was to systematically analyze the published studies about cytokine effects on human benzene exposure. benzene appears to cause hematotoxicity through multiple mechanisms that may involve alterations in the expression of numerous genes and proteins, dna methylation patterns, and mirna profiles, even at low doses. toxicogenomic studies, including genome - wide analyses of susceptibility genes (genomics), gene expression (transcriptomics), protein expression (proteomics), and epigenetic modifications (epigenomics), of human populations exposed to benzene are crucial for understanding gene environment interactions and providing the ability to develop biomarkers of exposure, early effect, and susceptibility. effects of benzene and its metabolites on the immune system can be investigated through the expression of cytokines and chemokines (table 1). stimulation of some inflammatory cytokines production by human peripheral blood mononuclear cells (pbmc) and the inhibition of others were observed in response to benzene treatment in the work by gillis.. the authors showed a dose - dependent increase in the production of tnf- by activated pbmc for all benzene metabolites. also, il-6 concentration was increased only by treatment with catechol, benzenetriol, and bq, while ifn- production was increased by hq treatment. in contrast, secretion of il-1 and gm - scf was suppressed by hq and catechol. renz and kalf in 1991 demonstrated that hq prevents the proteolytic conversion of 31 kda pre - il - l to the mature cytokine by the processing protease calpain in purified murine stromal macrophages. the first study that examined the role of hq in the release of il-1 and il-1 by mononuclear phagocytes in humans was in 1995. the results of the study showed a dose - dependent reduction of il-1 secretion by hq that also determined the fall of total protein content. this suggests that reduction of il-1 production caused by hq results from a global impairment of monocytes ' essential functions such as transcription or translation. therefore, the inhibition of cytokines production by mononuclear phagocytes involved in the regulation of hematopoiesis can contribute to myelotoxicity. the authors showed that 1,4-benzoquinone, the oxidation product of hq in the cell, causes a concentration - dependent inhibition of highly purified human platelet calpain. moreover, they demonstrated that hq also inhibits the processing of pre - interleukin - l by interleukin - l convertase. the addition of hq to bl human cells, which undergo autocrine stimulation by interleukin - l, resulted in both cessation of autocrine cell growth and interleukin - l secretion into the culture medium. in the study of gillis., the authors also noted strong inhibition of the production of the anti - inflammatory cytokine il-10 by higher concentrations of hq and catechol. enhanced production of proinflammatory cytokines coupled with the suppression of anti - inflammatory cytokines could lead to tissue damage and could predispose an individual to the development of autoimmunity. interleukin-3 (il-3) and granulocyte / macrophage - colony - stimulating factor (gm - csf) are responsible for maintaining survival and stimulating growth of early dormant hematopoietic progenitor cells (hpc). these cytokines exhibit extensive overlap, with gm - csf supporting growth and differentiation of myeloid hpc. it has been demonstrated that pretreatment of cd34 cells, human bone marrow cells containing hpc, with hq results in enhanced clonogenic response with gm - csf but not il-3. these findings suggest that an early step in chemical leukemogenesis may involve transient alterations in the regulation of cytokine response to gm - csf. it seems that hq activates a mechanism involving one or more secondary signals that are not sufficient to induce hpc into cycle but will synergize with gm - csf to do so. in a rapidly dividing tissue, such as bone marrow in which control of stem and progenitor cell proliferation commands a high priority, changes in proliferation or survival may predispose susceptible target cells to replication - dependent damage and subsequent neoplastic transformation. another possible mechanism leading to suppression of hematopoiesis involves the inhibition of nuclear factor kappa b (nf-b). it is known that tumor necrosis factor alpha (tnf-) activates nf-b in multiple cell types and inhibits proliferation and colony - forming activity of bone marrow cells. activated nf-b is required for many cells to escape apoptosis, including hematopoietic progenitor cells (hpc). hq alters cytokine response, induces cell death in hpc, and inhibits nf-b activation in t and b cells. a study demonstrated that in a hematopoietic cell line and primary hpc hq exposure inhibits tnf--induced activation of nf-b in a dose - dependent manner. the authors further investigated the ability of hq to potentiate tnf--induced apoptosis in these cells and found that hq sensitized the cells to the proapoptotic effect of tnf-. these results suggest that nf-b plays a key role in hpc survival and that hq - induced inhibition of nf-b leaves these cells susceptible to cytokine - induced apoptosis. the same authors investigated the association of four single nucleotide polymorphisms (snps) in the promoter region of tnf- on the development of a transient hematotoxicity induced by benzene (benzene poisoning, bp), a persistent bone marrow dysplasia with unique dysplastic and inflammatory features developing in individuals previously exposed to benzene (bid) and de novo myelodysplastic syndrome (mds). only the 238 (ga) polymorphism was significantly associated with the development of bid and was specific for bid and not de novo mds or bp. these findings suggest the possibility that cell - specific alterations in tnf- expression linked to this polymorphism may facilitate the escape of damaged hematopoietic progenitor cells from cd8 t - cell targeting and promote clonal selection in the evolution of neoplastic hematopoietic disease. it is also possible that 238a may be linked in an extended haplotype with other genes that play a role in influencing tnf- expression in hematopoietic progenitor cells. another study on snps of 20 candidate genes of cytokines, chemokines, and cellular adhesion molecules involved 250 workers exposed to benzene and 140 unexposed controls. the authors found that snps in five genes (four cytokines and one adhesion molecule) were associated with a statistically significant decrease in total white blood cell counts among exposed workers, and one snp was associated with an increase in white blood cell counts. in particular, il-1a and il-10 variants were significantly associated with only granulocytes ; the il-4 promoter snp was associated with a decline in both granulocytes and total lymphocytes, and the il-12a snps were associated with declines in three white blood cell subtypes. the adhesion molecule vcam1 variant was particularly noteworthy as it was associated with a decrease in b cells, natural killer cells, cd4 t cells, and monocytes. further, vcam1 and csf3 were associated, respectively, with decreased and increased colony - forming unit granulocyte - erythroid - macrophage - megakaryocyte progenitor cells in a subgroup of 29 benzene - exposed workers. therefore, selected variants seemed to influence only granulocytes, whereas others altered cell types of both myeloid and lymphoid lineage, suggesting effects that could extend to earlier progenitor and possibly stem cells. a chinese study from 1996 on peripheral cytokine levels, as il-3, il-6, erythropoietin, g - csf, and tnf-, in a group of 11 benzene - exposed healthy workers and 11 unexposed controls showed that levels of il-6, erythropoietin, and tnf- were similar in exposed subjects and controls. later, a mexican study evaluated the relationship between occupational exposure to benzene - toluene - xylene mixture (btx) and il-10, tnf, and il-12 production by peripheral blood mononuclear cells. the study involved 54 workers divided into two exposure groups : high and low btx accumulated potential dose. workers highly exposed to btx showed a significant fall in tnf production ; although without statistical significance, a reduction for il-10 and il-12 was also observed. a recent italian study evaluated il-10 serum levels in 51 oil refinery employees exposed to benzene and in 16 nonexposed office workers who resided in the same area. the authors found no statistically significant difference between serum concentrations of il-10 in both groups. moreover, a statistically significant relationship in exposed subjects between age, working years, and serum concentration of il-10 and the latter with the employment age was found. among chemokines, three proteins were consistently downregulated in workers exposed to benzene compared to control individuals. two of these proteins were identified as platelet factor 4 (pf4), also downregulated at gene expression level, and connective tissue activating peptide ctap - iii, respectively, both platelet - derived cxc chemokines. thus, reduced protein levels of pf4 or ctap - iii are potential biomarkers of benzene 's early biologic effects and may play a role in the immunosuppressive effects of benzene. cxcl12 chemokinesis is crucial for the homing process of haematopoietic stem cell (hscs). bone marrow cxc chemokine ligand- (cxcl12-) abundant reticular cells originate from mesenchymal stem cells (mscs) as well. short term ablation of these cells severely impairs the adipogenic and osteogenic differentiation capacity of marrow cells and gives rise to a marked reduction in cycling lymphoid and erythroid progenitors. in a recent study the effects of a range of benzene concentrations along with those of its reactive metabolites, p - benzoquinone (bq) and hq, on the viability of mscs were analyzed. in particular, some genes such as cxcl12, which are expressed by mscs and play roles in adipo - osteogenic differentiation of these cells and the regulation of haematopoiesis, were investigated. with regard to cxcl12, treatment with enhanced cxcl12 expressions probably lead to an increase in the attraction and adhesion of hscs to haematopoietic niche while downregulation of cxcl12 could have a converse effect. moreover, the observed alterations in the expression of cxcl12 can also lead to disturbance of hcs niche which in turn can result in haematopoietic failure and contribute to leukemia development. in another study significant concentration - dependent increases in the expression of most extracellular chemokines, such as il-8, eotaxin, mip1-, and rantes, by pbmc were observed in response to four benzene metabolite (catechol, hq, 1,2,4-benzenetriol, and 1,4-benzoquinone) treatments. an increase in mcp-1 chemokine secretion was observed for cells treated with hq, benzenetriol, and benzoquinone, but not catechol. in addition, these treatments resulted in the induction of the inflammatory cytokine il-6. this study is in agreement with other studies reporting increased il-8 production by various types of cells in the presence of benzene metabolites [35, 36 ]. the study of gillis. showed that pbmc stimulation with the pma ionomycin mixture induced production of cytokines at 10-to - several - thousand - fold higher levels, resulting in a dramatic increase in cytokine levels in the medium. the effects of benzene metabolites on the secretion of soluble cytokines by activated pbmc varied. for example, dramatic concentration - dependent decreases in the production of the chemokines il-8 and mcp-1 were observed for hq and catechol, but not for benzenetriol and bq. it is known that nad(p)h : quinone oxidoreductase 1 (nqo1) deficiency due to a polymorphism is a risk factor for benzene - induced myeloid toxicity. a study demonstrated that inhibition or knockdown of nqo1 in human bone marrow endothelium leads to decreased tnf--induced adhesion molecule expression and adhesion of progenitors to endothelial cells via an nf-b mechanism. besides its direct toxicity, benzene exerts multiple effects after being converted to reactive metabolites such as hq and benzoquinone. for instance, benzene and its metabolites can directly or indirectly influence the responses of mast cells and basophils (reviewed in), which are primary effector cells involved in the development of respiratory allergies such as rhinitis and bronchial asthma. these compounds may act directly or together with other cells, such as t cells, macrophages, and monocytes, which are functionally connected. in particular, hq and benzoquinone inhibit the release of preformed mediators, leukotriene synthesis, and cytokine production in human basophils stimulated by ige- and non - ige - mediated agonists. furthermore, these metabolites reduce ige - mediated degranulation of mast cells and the development of allergic lung inflammation in rats (reviewed in). it is also known that benzene metabolites alter biochemical and functional activities of other immunocompetent cells and may impair immune responses in the lung. these inhibitory effects of benzene metabolites are primarily mediated by interference with early transduction signals. together, the currently available studies indicate that benzene metabolites interfere by multiple mechanisms with the role of basophils and mast cells in innate immunity and in lung chronic inflammation (reviewed in). the studies on atopy induced by benzene and/or its metabolites are shown in table 2. in a study performed on a group of both asymptomatic atopic and nonatopic women and a group of women residing in urban and suburban areas with almost uniform levels of toxic compounds produced by vehicular traffic and low air pollution produced by factories, urinary trans, trans - muconic acid, a metabolite of benzene, did not show differences but was significantly correlated with nk cd16cd56 lymphocytes in both groups. the correlation of nk cells with urinary trans, trans - muconic acid in women with low levels of environmental exposure suggests that low levels of exposure to benzene may stimulate nk activity. another study carried out in a group of 3-year - old children showed that exposure to aromatic compounds, such as chlorobenzene, may contribute to the risk of allergic sensitization to the food allergens milk and egg white. moreover, exposure to benzene, ethylbenzene, and chlorobenzene was associated with higher percentages of il-4 producing cd3 t cells. both an increase in il-4 producing type 2 t cells and a reduction of ifn - gamma producing type 1 t cells may contribute to a type 2 skewed memory in response to allergens. reported that the treatment with four different benzene metabolites, such as catechol, hq, 1,2,4-benzenetriol, and 1,4-bq, increased secretion of th2-type cytokines il-4 and il-5. all four benzene metabolites augmented production of il-4, while increased expression of il-5 was observed only for catechol and hq treatments. hq is present in large quantities in cigarette tar as a result of the combustion of tobacco leaf pigments. it has been demonstrated that hq in concentrations comparable to those found in cigarette tar is a potent inhibitor of il-2-dependent t - cell proliferation. the authors demonstrated that exposure of primary human t lymphoblasts (htl) to hq in vitro blocked il-2-dependent proliferation by 90% with no loss in viability. moreover, hq inhibited the il-2-dependent progression of htl through s phase of the cell cycle without blocking binding of il-2 to the cells. therefore, these results may help to explain the potent immunosuppressive effects of cigarette smoke on lung lymphocytes. nowadays, the carcinogenic effects of benzene are well established in particular for aml and mds. low - risk mds is characterized by increased apoptosis in the bone marrow with autoimmune characteristics whereas the advanced or high - risk stages involve immune evasion and secondary dna damage, giving cells growth potential to progress into aml. nevertheless, the causes of mds remain poorly defined and it is not clear how the disease progresses from an early stage to advanced mds and aml. although there are clear indications for the role of the immune system, the exact mechanism by which the immune response contributes to the progression is not yet clear. some of the mechanisms of hematotoxicity involve the network of cytokines, chemokines, and adhesion molecules. this review shows that the actions of benzene and its metabolites on immune system can involve different kinds of cytokines both in vivo and in vitro. therefore, the increase in production of proinflammatory cytokines and the reduction of anti - inflammatory cytokines induce the development of chronic inflammation and autoimmunity that can be responsible for the onset of mds and/or its progression to aml. moreover, benzene and its compounds not only produce toxic and/or cancerogenic effects but also can influence immune response in atopy. in the future it could be useful to identify one or more biomarkers of exposure, early effect, susceptibility, and disease development in patients exposed to benzene, which will be useful as a novel target for therapy.	benzene represents an ubiquitous pollutant both in the workplace and in the general environment. health risk and stress posed by benzene have long been a concern because of the carcinogenic effects of the compound which was classified as a group 1 carcinogen to humans and animals. there is a close correlation between leukemia, especially acute myeloid leukemia, and benzene exposure. in addition, exposure to benzene can cause harmful effects on immunological, neurological, and reproductive systems. benzene can directly damage hematopoietic progenitor cells, which in turn could lead to apoptosis or may decrease responsiveness to cytokines and cellular adhesion molecules. alternatively, benzene toxicity to stromal cells or mature blood cells could disrupt the regulation of hematopoiesis, including hematopoietic commitment, maturation, or mobilization, through the network of cytokines, chemokines, and adhesion molecules. today there is mounting evidence that benzene may alter the gene expression, production, or processing of several cytokines in vitro and in vivo. the purpose of this review was to systematically analyze the published cases of cytokine effects on human benzene exposure, particularly hematotoxicity, and atopy, and on lungs.
activated lymphocytes undergo a rapid burst in cellular proliferative, biosynthetic, and secretory activities and must obtain metabolic substrates to attempt this dramatic increase in metabolism. their insignificant intracellular store of nutrients obligates lymphocytes to markedly increase the uptake of metabolic substrates from their microenvironment. although lymphocytes are able to use glucose, glutamine, ketone bodies, and fatty acids (fa), it was determined that glucose and glutamine are quantitatively the most important fuel for activated lymphocytes. regarding the new metabolic demands of activated lymphocytes, glucose is initially retained in the cell by phosphorylation into glucose 6-phosphate by hexokinases (hks). from there, glucose 6-phosphate can be used as a substrate by aerobic glycolysis or by the pentose - phosphate pathway (ppp). in the ppp, glucose 6-phosphate serves to generate ribose (for the synthesis of rna and dna) and nadph (for fa synthesis) [1, 2 ]. for glucose 6-phosphate that enters aerobic glycolysis, the molecule is converted to pyruvate, after which it can be converted to lactate or acetyl - coa or be fully oxidized. the majority is converted to lactate (approximately 91%) [47 ], while most of the remaining pyruvate is converted to acetyl - coa, which has a central role in membrane biogenesis, serving as a precursor to phospholipids, cholesterol, and triacylglycerol [1, 3 ]. thus, only a small percentage of glucose 6-phosphate is fully oxidized in lymphocytes. in this scenario, the removal of citrate (pyruvate converted to acetyl - coa plus oxaloacetate) from the tricarboxylic acid (tca) cycle for biosynthetic reactions imposes the need to continue replenishing intermediates to maintain this cycle 's function [2, 9 ]. thus, beyond glucose, activated lymphocytes also increase their update of glutamine and convert it to glutamate, which is in turn converted to -ketoglutarate via glutamate dehydrogenase. in addition to replenishing intermediates to maintain the tca cycle using glutamate, lymphocytes also convert glutamine to aspartate and ammonia, providing biosynthetic precursors, purines, and pyrimidines, for the synthesis of dna and rna. finally, a limited percentage of glutamine can be converted to lactate or be fully oxidized. in fact, although oxidative phosphorylation still occurs in effector t lymphocytes, it seems that, of the glutamine (and glucose) utilized by these cells, only approximately 1.5% is oxidized. in accordance with the importance of glucose and glutamine in activated lymphocytes, early studies of these cells demonstrated that, to meet the new bioenergetic and biosynthetic demands imposed by activation, lymphocytes also increase the maximal activity levels of enzymes, such as hk, glucose-6-phosphate dehydrogenase (g6pdh) and phosphate - dependent glutaminase (glutase), which are key enzymes in the glycolysis, pentose - phosphate, and glutaminolysis pathways, respectively. the mitochondrial enzyme citrate synthase (cs), an important enzyme in the tca cycle, is also affected [6, 7 ]. comparatively, b cell metabolism has been less well investigated than t cell metabolism ; however, the metabolic characteristics of both lymphocyte types might be similar [2, 10 ]. an outstanding feature of lymphocytes is that these cells utilize glucose and glutamine at high rates in a strictly function - dependent manner. furthermore, more recently, studies of direct modifications to t lymphocyte metabolic pathways demonstrated that metabolic reprogramming and lymphocyte activation are intricately linked, as cellular metabolism was found to be directly controlled by the signaling pathways that drive cell survival and activity. notably, pearce and colleagues stated that the reasons why t cells would adopt specific metabolic programs and the impacts of such programs on cell function and immunological responses were unclear. in this sense, t lymphocytes adopt a metabolic program that reflects their energetic and biosynthetic needs in specific states, ranging from resting to memory cell conversion. for resting lymphocytes, it is worth mentioning that, despite the name, these cells continuously migrate through secondary lymphoid tissues to maintain immune surveillance prior to activation ; to accomplish this activity, these cells rely on the oxidative metabolism of glucose, amino acids, and lipids. however, as previously discussed, once activated, lymphocytes grow, proliferate, differentiate, and adapt to stress, and the mixed oxidative metabolism associated with a nave resting state, which preferentially generates atp, does not support these new functions. thus, the prioritization of the synthesis of macromolecules, rather than atp production, explains the already - mentioned dependence of activated lymphocytes on aerobic glycolysis. in other words, the cell replaces its previous efficient atp production (resting state) with efficient and rapid macromolecule biosynthesis (activated state). additional support for the finding that cell metabolism is a key regulator of lymphocyte function and differentiation has been provided by the patterns of fuel usage and transcriptional and posttranscriptional factors that control metabolism in the various activated t cell lineages. the helper t cell lineages th1, th2, and th17 all exhibited increased aerobic glycolysis (as previously mentioned for activated lymphocytes), the posttranscriptional regulator mtorc1 was found to control glucose metabolism in th1 and th17 t cells, whereas mtorc2 controlled glucose in th2 cells. t regulatory (treg) cells exhibit lipid oxidation as a primary metabolic phenotype, which is controlled by ampk. similarly, memory t cells also oxidize lipids, although in these cells, this metabolic phenotype is controlled by the posttranscriptional regulators traf6 and ampk. the signals and stimuli that normally control the immune system (is) can be affected by conditions such as obesity and type 2 diabetes (t2d). in this sense, it was proposed that the direct control of lymphocyte metabolism mediated by survival and activity - related signaling pathways could introduce the potential for metabolic changes to promote diseases. more specifically, the inability of cell metabolism to meet the energetic and biosynthetic demands of lymphocytes could disrupt immune functionality, a process that has been observed in several immunological diseases. for example, the inhibition of glycolytic metabolism can suppress cell proliferation and cytokine production and also compromise effector t cell differentiation. in contrast, mitogen - induced t cell activation can reflect the glycemic statuses and insulin levels of type 1 diabetes and t2d patients. furthermore, hyperglycemia and ketoacidosis were found to increase the levels of proinflammatory cytokines and the numbers of activated t lymphocytes in diabetic patients. lymphocyte metabolic and/or functional dysregulation has been observed in a diet - induced obesity (dio) model. these phenomena were reported to promote reductions in the treg and th2 cell populations and increases in the resident inflammatory lymphocyte population. similarly, our laboratory recently reported that dendritic cells cultivated under leptin - free conditions exhibited a different phenotype from that of wild type cells ; this phenotype was characterized by a reduced ability to induce cd4 cell proliferation, while inducing increased treg and th17 cell differentiation. these results proved useful for increasing our understanding of whether leptin can induce beneficial (increased treg cell numbers) or detrimental (increased th17 numbers) clinical outcomes. in lymphocytes from graves ' disease patients, the maximal activity levels of hk, g6pdh, cs, and glutase were all reduced. in vitro, thyroid hormones were found to increase glucose and glutamine metabolism in the lymphocytes from these patients. additionally, it was reported that concomitant acute and chronic infections in patients with several diseases, such as cancer or asthma, are associated with an imbalance of t1 (t helper type 1 and t cytotoxic type 1) and t2 (t helper type 2 and t cytotoxic type 2) immune functions [18, 19 ]. in graft - versus - host disease (gvhd), one of the few studies that investigated t lymphocyte metabolism in vivo demonstrated that cells activated under gvhd conditions became highly dependent on lipid metabolism, rather than exhibiting the expected increase in glycolytic metabolism. in accordance with the results of that study, the fa metabolism dependence of allogeneic t cells distinguishes these cells metabolically from other activated t cell subsets, thus providing targets for therapeutic intervention (e.g., blockade of fa transport, inhibition of fa oxidation, and limitation of fuel sources). cancer is another condition associated with inflammation. in fact, the concept that an inflammatory tissue injury could induce neoplasia and the existence of a close relationship between carcinogenesis and inflammation were initially postulated by the greek physician galenus approximately 2000 years ago. current estimations suggest that approximately 25% of cancers require a chronic inflammatory microenvironment for development. additionally, obesity, which is associated with chronic low - grade inflammation, increases the risk of developing certain types of cancers. therefore, in accordance with the hypothesis suggested by caro - maldonato and coworkers, lymphocytes from animals and humans with cancer are expected to exhibit metabolic dysregulation or mismatches. in fact, cells from primary effusion lymphoma (pel), a subtype of b cell non - hodgkin 's lymphoma with a median patient survival duration of 6 months, provide support for this hypothesis. in vitro, these cells exhibit an increased dependence on aerobic glycolysis through the pi3 k / akt / mtor pathways that control glycolysis via glut1. in fact, these cells, as well as those from other b cell non - hodgkin 's lymphoma subtypes, are dependent on fa synthase to such an extent that bhatt and coworkers suggested the possibility of using this enzyme as a unique molecular treatment target in these cancers. three possible outcomes of the occurrence of a mismatch or insufficient fuel usage in t lymphocytes were described. in accordance with these results, the above - described outcomes for t and b lymphocytes have been observed in several immunological diseases and have also provided opportunities to selectively modulate specific immune functions by targeting glucose, lipid, and amino acid metabolism. the studies mentioned in this section were designed in accordance with two main research approaches that have been proposed to establish a link between exercise and the is : a metabolic approach, which considers plasma glutamine concentrations / metabolism, and a neuroendocrine approach, which considers changes in the levels of immunomodulatory hormones and neurotransmitters. interestingly, in vitro studies demonstrated that the stress hormones adrenaline and cortisol are able to modulate lymphocyte metabolism. the organism exerts tight control over the internal environment, and any subtle disruption of the regulated limits triggers physiological feedback mechanisms to reestablish the internal milieu. among these mechanisms is integration of the nervous and endocrine systems (or the neuroendocrine system, nes) with is, which is systematically controlled by the nes. of note, the integrated communication between the nes and the is possibly consists of the sharing of common signaling proteins and their corresponding receptors [28, 29 ]. in the face of any stimuli able to disrupt homeostasis, the response of the nes is invariably (regardless of the nature of the stress) the same : activation of the sympathoadrenal (sa) system and consequent release of catecholamines (i.e., adrenaline and noradrenaline) and activation of the hypothalamic - pituitary - adrenal (hpa) axis, which, in humans, results in cortisol production and release [30, 31 ]. the stereotypic response of the nes to stress aids in understanding of the effects of exercise upon the is because among the several molecules (e.g., hormones, cytokines) able to affect immune cell function, catecholamines, and cortisol appear to be particularly involved in exercise - induced immune responses. specifically, activation of the sa system occurs several seconds after exercise initiation, whereas the hpa response and the secretion of cortisol often need 2030 minutes before beginning. additionally, catecholamines appear to be responsible for the initial effects of acute exercise on the is (e.g., the migration of lymphocyte subpopulations), whereas cortisol appears to exert its effects within a period of at least 2 hours 's work exercise presents a unique stress on the homeostatic conditions, and this stress is specific to the nature and configurations of the protocol and associated elements (i.e., the environmental conditions or nutritional status). that is, the magnitude of nes activation in response to exercise stress is determined by the intensity and duration of such exercise. consequently, the exercise protocols that most affect the is are those in which the intensity and duration (acute variables) and frequency (chronic variable) are higher. not surprisingly, aerobic exercise protocols with longer durations (> 1.5 hours) and greater intensities (55/6075% of vo2max) induce greater release of catecholamines and cortisol in comparison with aerobic exercise at lower intensity. discussing the effects of different intensities, durations, and modes of exercise on the response of the nes is obviously beyond the scope of this review. however, briefly, noradrenaline presents a curvilinear increase in response to acute exercise as workload augments, while adrenaline increases at workloads over 60% vo2max. regarding cortisol, mild - intensity, moderate - duration aerobic exercise does not appear to alter its levels. however, exercises with intensity above 85% vo2max [40, 41 ] or with a duration greater than 60 minutes typically lead to increases in cortisol secretion. rosa and coworkers previously demonstrated the ability of adrenaline to increase the proliferative index of mesenteric lymphocytes and to concomitantly augment the maximal activities of hk, glutase, and cs, as well as glucose and glutamine consumption. however, the excess of systemic catecholamines induced by high - intensity, exhaustive exercise could have an immunosuppressive effect, such as a reduction in the plasma levels of interferon- (ifn) and an antiviral cytokine. in addition to its antiviral property, ifn has antiapoptotic and antiproliferative effects on activated lymphocytes. regarding the effects of this cytokine on lymphocyte metabolism, we demonstrated that the ability of ifn to limit t and b cell proliferation could be explained by the suppression of glucose and glutamine metabolism and reduced maximal g6pdh, cs, and glutase activities. the immunosuppressive effect of glucocorticoids on mesenteric lymphocytes is associated with a 40% reduction in pyruvate utilization due to inhibition of pyruvate dehydrogenase 's maximal activity. additionally, as mentioned, cortisol increases are typically observed during high - intensity exercises. we recently demonstrated that basketball players participating in an official game (stressful exercise) presented increases in salivary cortisol and a reduction in levels of interleukin (il)-21, a cytokine that stimulates immunoglobulin a - secreting cells. additionally, in accordance with the immunosuppressive ability of cortisol, it was observed that the numbers and proliferative ability of circulating lymphocytes are affected by a single bout of intense exercise. for example, a 3050% decrease in the lymphocyte count occurs at 30 minutes after exercise. regarding the proliferative index of lymphocytes, our results demonstrated that participation in very intense exercise protocols, an olympic triathlon (swimming for 1.5 km, cycling for 40 km, and running for 10 km) [49, 50 ] or a simulated cycling competition (6 sets of 20 minutes at 90% of the individual 's anaerobic threshold) reduced the proliferative indices of t and b lymphocytes and plasma glutamine levels. these changes were associated with reduced cytokine production (e.g., il-1, il-2, il-4, tumor necrosis factor (tnf), and interferon (ifn)) by mononuclear peripheral cells in response to mitogens. it was proposed that the ifn/il-4 ratio in the culture supernatants of stimulated t cells could act as an objective indicator for monitoring the th1/th2 balance (cell - mediated / humoral immunity). as such, these studies suggested that an intense bout of acute exercise could affect this balance [19, 4951 ]. to maintain homeostasis in the face of all organic changes induced by physical exercise (e.g., increased body temperature, dehydration, ion imbalances, hypoxia, and blood pressure changes), other hormones (e.g., insulin, growth hormone, aldosterone, glucagon, and thyroxin) are necessary in addition to cortisol and catecholamines during exercise and recovery. although the involvement of these hormones in exercise 's ability to modulate the is needs further investigation, certain evidence reinforces possible involvement. for example, insulin can control the metabolism and functionality of lymphocytes, and its infusion into critically ill patients is used to achieve tight hyperglycemic control and to fight systemic inflammation. thyroid hormones in turn stimulate aerobic glycolysis, glutamine consumption, and aerobic metabolism in human lymphocytes. as previously discussed regarding the effect of an excess of catecholamines on plasma tnf, the plasma levels of other cytokines are affected by exercise, and it has been suggested that the impact of exercise on cytokine production could partially explain how this stressor modulates the is. regarding this concept, the cytokine that is most responsive to exercise is il-6, whose levels increase up to 100 fold as the duration of exercise progresses. the increase in il-6 levels is followed by an increase in the levels of an il-1 receptor antagonist that is an inhibitor of the inflammatory cytokines il-1 and il-10, important anti - inflammatory cytokines. in addition to the neuroendocrine and immune responses to exercise mentioned above, exercise may modulate immunity in alternative ways. one of these ways is exercise - induced muscle damage, which results in the secretion of inflammatory cytokines by innate immune cells. thus, the reduction in the levels of this amino acid after strenuous exercise could be related to immunosuppression, whereas the increase in glutamine levels induced by chronic moderate - intensity exercise would induce a positive effect upon immune function. finally, it is worth mentioning that, in many respects, the responses and adaptations to chronic exercise are the result of the cumulative influence of repeated acute exercise bouts. thus, to understand how exercise training can modulate lymphocyte function as well as metabolism, it is important to know the acute effects of exercise. regarding the chronic effects of physical exercise, the protection that it offers against all - cause mortality is known to occur primarily due to the ability of exercise to protect against atherosclerosis, t2d, colon cancer, and breast cancer. the fact that the above - mentioned diseases seem to associate with low - grade chronic inflammation and the finding that acute exercise increases the systemic levels of several anti - inflammatory cytokines (especially exercise that is not high intensity or exhaustive) suggest the possibility that regular exercise can protect against the chronic conditions associated with low - grade inflammation via an anti - inflammatory effect. in accordance with certain authors, the potential underlying mechanisms of the anti - inflammatory effects of regular moderate exercise primarily include a reduction in visceral fat mass, increased production, and release of myokines and reduced expression of toll - like receptors on monocytes and macrophages ; however, these mechanisms likely also include inhibition of monocyte and macrophage infiltration into adipose tissues, a reduction in the number of circulating proinflammatory monocytes and an increase in the number of circulating treg cells. the modulation of lymphocyte metabolism by exercise, however, is not included on this list. in accordance with the proposal that regular moderate - intensity exercise has beneficial anti - inflammatory (and immunomodulatory) effects, it seems that when chronic, this exercise intensity is able to reverse the age - associated reduction in th1 cell numbers or th1-cell derived cytokine levels that are normally observed in older adults. moreover, other studies have reported that moderate exercise training increased the production of th1 response - associated cytokines in both humans and rats [5963 ]. still, experimental evidence suggests that chronic moderate exercise could normalize il-4 concentrations and increase il-2 concentrations in a heart failure model in which the t2-type response had been initially elevated. it was demonstrated that when chronic, this level of exercise stimulates a type 2 t cell phenotype in trained individuals and that this tendency might be associated with the high incidence of upper respiratory infection episodes among athletes. in fact, two recent studies have suggested that lifelong participation in high volumes of intense exercise could compromise immune functionality [65, 66 ]. together, these studies reported that young athletes had fewer cd4 t lymphocytes and that these cells exhibited reduced functionality and a higher degree of differentiation in comparison with those from young nonathletes. regarding cd8 t lymphocytes, it was observed that despite, the higher number of these cells, there was a lower frequency of thymic emigration. however, this altered lymphocyte functionality observed in young athletes was not found in elderly athletes ; however, in the latter group, natural killer cells exhibited increased activation and degranulation. therefore, it is possible that, in elderly individuals, the is can adapt itself to the detrimental effects of lifelong exhaustive exercise. thus, considering the strict relationship between function and metabolism in these cells, it is important to understand how glucose and glutamine consumption in lymphocytes is modulated by regular moderate- and high - intensity exercise. evidence suggests that these effects of exercise are at least partly due to the ability of exercise to modulate cell nutrient metabolism and particularly glucose and glutamine metabolism. for example, navarro and colleagues demonstrated the ability of chronic moderate - intensity exercise (eight weeks of treadmill running) to modulate the activation, proliferation, cytokine production, and glucose and glutamine metabolism of t and b lymphocytes. in support of the statement that lymphocytes utilize glucose and glutamine at high rates according to their specific immune functions, the exercise - induced metabolic changes observed by navarro and colleagues were accompanied by concomitant alterations in functionality. for example, increased expression of il-2 and its receptor (il-2r) and decreased expression of il-4 and its receptor (il-4r) were observed in t cells relative to b lymphocytes. these data suggest that chronic moderate exercise in healthy animals primarily enhances the th1 response phenotype. as several immunological disorders have been associated with a dysregulated th1/th2 balance, this is an important finding. regarding humoral immunity, chronic moderate exercise was shown to increase igg production in lymphocytes from trained rats compared with lymphocytes from sedentary animals, thus indicating an improvement in humoral immunity. in support of the finding that both cellular and humoral immune functions improved in response to exercise, increases in the expression and modulation of cd8, cd54, and cd30 were observed, potentially indicating improvements in both types of immunity. it was observed that the changes in lymphocyte function were accompanied by a differential effect of moderate exercise on t and b lymphocyte metabolism. specifically, t lymphocytes increased glutamine utilization by shifting the metabolism of this amino acid to an aerobic pathway (as previously mentioned herein, only a minor percentage of glutamine is oxidized in lymphocytes). concomitantly, these cells reduced their glucose consumption and lactate production levels (lymphocytes typically convert most of their glucose to lactate). in contrast, b lymphocytes exhibited increases in both glucose and glutamine consumption, although only glutamine aerobic metabolism was increased. all of these lymphocytic changes were possible because key glucose and glutamine metabolic enzymes were targets of the modulatory effect of chronic exercise. therefore, in accordance with enhanced aerobic glutamine metabolism, the maximal activities of glutase and cs increased in t lymphocytes ' response to exercise. in addition to these 2 enzymes, the maximal activities of hk and g6pdh were also augmented in b lymphocytes in response to chronic exercise. the effects of chronic moderate - intensity exercise were also investigated in animal models of chronic diseases. recently, activated t lymphocytes were proposed as a model to understand carcinogenesis. through changes in transporter expression and isozyme switching, both activated lymphocytes and cancer cells become highly glycolytic and glutamine dependent to promote growth, proliferation, and differentiation. therefore, an understanding of the metabolism of activated t cells could facilitate the identification of new therapeutic strategies that would selectively target tumor metabolism or inflammatory immune responses. thus, the effects of exercise were investigated in lymphocytes obtained from walker-256 tumor - bearing rats. in response to the tumor, the metabolism and function of these cells were compromised ; t and b cells from the tumor - bearing rats exhibited lower proliferative indices relative to those of cells from sedentary animals and increased glucose consumption and lactate production in comparison with cells from control animals. eight weeks of moderate - intensity treadmill running suppressed tumor growth and reversed the repressive effects of the walker-256 tumors on the lymphocytes ' proliferative indices. additionally, exercise training reversed the effect of the tumor by reducing glucose consumption and lactate production while counterbalancing the effects of the disease on the maximal activities of g6pdh, hk, and cs. therefore, the immunomodulatory effects of exercise were characterized by a reversion of the tumor - induced changes. finally, the exercise - induced effects on lymphocyte function and metabolism were accompanied by altered plasma hormone levels (e.g., growth hormone, testosterone, and corticosterone) and beneficial changes in cytokine levels (e.g., il-1, il-2). rheumatoid arthritis (ra) is an autoimmune disease that causes several disturbances in immunological functioning [72, 73 ]. previously, it had been speculated that because certain immune functions are exacerbated in ra, improved is functioning with exercise could theoretically be detrimental to ra patients. however, the opposite was found to be true, as studies performed in the 1990s regarding exercise and inflammatory disease demonstrated that nearly any type of exercise was superior to a sedentary lifestyle for ra patients [74, 75 ]. additionally, it was observed that exercise appeared to be beneficial for individuals with ra because of its anti - inflammatory effects [22, 74 ]. therefore, we decided to verify whether alterations in glucose and glutamine metabolism were present in a model of experimental arthritis (collagen - induced arthritis, cia) and whether a chronic swim training regimen could counterbalance the deleterious effects of ra by modulating the metabolism of these nutrients. initially, we observed that lymphocytes from cia animals consumed more glucose, despite exhibiting reduced lactate production relative to lymphocytes from healthy animals, thus indicating that cia induced defective lymphocyte activation. additionally, cia reduced glutamine consumption and glutamate / aspartate production, and these metabolic changes were associated with an elevated proliferative index in the cells from cia animals. however, an eight - week moderate - intensity swim training regimen reduced the proliferative index and glucose consumption of lymphocytes from the cia animals and increased their glutamine metabolism (figure 1). to obtain a more complete understanding of the immunomodulatory effects of exercise trained cia rats exhibited lower levels of the proinflammatory hormone prolactin and higher levels of the immunosuppressive hormones progesterone and corticosterone. interestingly, chronic exercise also increased the plasma levels of il-2, a cytokine that can both initiate and terminate inflammation under different conditions, as well as increased plasma levels of glutamine. taken together, the data from the trained cia animals suggested that the ability of swim training to counterbalance several effects of cia resulted from the modulation of lymphocyte metabolism and the balance between proinflammatory and anti - inflammatory hormones and cytokines. despite the common belief that high - intensity exercise is immunosuppressive, it is important to note that, in this case, high intensity means chronic exercise of high intensity and volume, such as those physical training regimens used by athletes. that is, it is possible to speculate that high - intensity exercise at a low / moderate volume would induce beneficial effects on the is because this type of exercise would allow the organism to become adapted to it. in support of this speculation, an eight - week anaerobic jumping training (a high - intensity exercise) regimen was reported to increase the expression of the proapoptotic protein bax and reduce the expression of the antiapoptotic protein bcl-2 ; these findings were associated with reduced walker-256 tumor growth consequent to apoptosis. subsequently, our group observed that walker-256 tumor - bearing rats subjected to high - intensity running training for an 8-week period (85% vo2max thirty minutes per day for five days) exhibited a 40% reduction in tumor growth and a 35.5% increase in lifespan relative to sedentary, tumor - bearing rats. these changes were accompanied by reduced lactate production in the walker-256 tumor cells, suggesting that the tumor cells had become less glycolytic. moreover, in the trained animals, the tumor cells exhibited increased glutamine consumption and glutamate and aspartate production. despite these findings, glutamine consumption due to aerobic metabolism was reduced. regarding lymphocyte function and metabolism, the same study demonstrated that the exercise training protocol counterbalanced the effects of the walker-256 tumors on lymphocyte metabolism. lymphocytes from trained animals exhibited an increased proliferative index, reduced glucose consumption (aerobic and anaerobic), and reduced lactate production in comparison with immune cells from sedentary, tumor - bearing rats. similarly, the high - intensity exercise program reversed the tumor - induced effects on glutamine metabolism. notably, the modulatory effect of exercise was accompanied by increased cytokine levels (e.g., il-1, il-2, and tnf) and changes in plasma hormone levels (e.g., increased corticosterone levels, reduced growth hormone levels). therefore, the immunomodulatory effects of exercise occurred in response to a complex interaction of hormones, cytokines, and metabolic changes. acute exercise and chronic exercise affect lymphocyte function in a manner associated with the modulation of glucose and glutamine metabolism. although further studies are necessary, the primary experimental evidence suggests that the well - known anti - inflammatory and immunomodulatory effects of exercise are at least partly characterized by the ability of chronic exercise to adjust the energetic and biosynthetic demands of lymphocytes in response to physiological and pathological conditions.	glucose and glutamine are important energetic and biosynthetic nutrients for t and b lymphocytes. these cells consume both nutrients at high rates in a function - dependent manner. in other words, the pathways that control lymphocyte function and survival directly control the glucose and glutamine metabolic pathways. therefore, lymphocytes in different functional states reprogram their glucose and glutamine metabolism to balance their requirement for atp and macromolecule production. the tight association between metabolism and function in these cells was suggested to introduce the possibility of several pathologies resulting from the inability of lymphocytes to meet their nutrient demands under a given condition. in fact, disruptions in lymphocyte metabolism and function have been observed in different inflammatory, metabolic, and autoimmune pathologies. regular physical exercise and physical activity offer protection against several chronic pathologies, and this benefit has been associated with the anti - inflammatory and immunomodulatory effects of exercise / physical activity. chronic exercise induces changes in lymphocyte functionality and substrate metabolism. in the present review, we discuss whether the beneficial effects of exercise on lymphocyte function in health and disease are associated with modulation of the glucose and glutamine metabolic pathways.
we describe our successful experience using a capsular tension ring (ctr) and iris repair during cataract surgery in a patient with bilateral coloboma. a 67-year - old woman had no history of trauma, but had zonular deficiency and inferonasal iris defects in both eyes. an extracapsular cataract extraction and intraocular lens (iol) scleral fixation was performed in the left eye. after the iol was placed centrally in the capsular bag, two paracenteses were made at the limbus (5 o'clock and 7 o'clock). a long, straight needle was passed through the 7 o'clock paracentesis site into a angled, blunt tipped 27 gauge needle inserted from the 5 o'clock paracentesis. the two needles were pulled out at 5 o'clock. after inserting the long needle into the blunt tipped needle at 7 o'clock, both were passed back through the 7 o'clock paracentesis site. both capsular tension ring implantation and iris repair was successfully performed at the time of cataract surgery in a coloboma patient, which resulted in improvements in visual function and cosmesis. a 67-year - old woman presented to department of ophthalmology, hanyang university guri hospital in april 2004 reporting visual deterioration in both eyes. aware of her poor vision, the patient had no history of oculopathy, ophthalmic surgery, trauma, or disease. on initial examination, the manifest refraction was -1.50 diopters (d) with a best corrected visual acuity (bcva) of 20/200 in the right eye and -2.00d with a bcva of hand motion in the left eye. intraocular pressure was 15 mmhg in the right eye and 14 mmhg in the left eye. a slit lamp examination with mydriasis revealed a corticonuclear cataract and dehiscence of the inferior zonules without phacodonesis or subluxation of the lenses. fundoscopy showed a tessellated fundus with inferior chorioretinal coloboma that did not involve the macula or optic nerves in the right eye. we were not able to observe the retina in the left eye due to a dense brunescent cataract. ascan biometry demonstrated an axial ocular length of 24.29 mm in the right eye and 25.38 mm in the left eye. under retrobulbar anesthesia, phacoemulsification was attempted on the left eye. because the brunescent lens could not be phacoemulsified, we performed extracapsular cataract extraction (ecce). during the operation, a posterior capsule rupture and a serious zonule defect after two days, the procedures were done in the right eye by the same surgeon (j.h. under retrobulbar anesthesia, a 3 mm sclerocorneal incision, paracentesis at the 2 o'clock position, ccc with a bent 25-gauge needle, and hydrodissection were performed uneventfully. despite mild phacodonesis, subsequently, high viscosity sodium hyaluronate was injected in order to expand the lens capsule completely. because zonular weakness can cause lens decentration, a ctr was implanted through a sclerocorneal incision using a sinskey hook. after the iol (ma 60bm, alcon, usa) was placed centrally in the capsular bag, acetylcholine chloride 1:100 (miochol, novartis, usa) was injected through a side - port. two paracenteses at 5 o'clock and 7 o'clock limbus were prepared for the iris repair. a long, straight needle (10 - 0 prolene ethicon 1713 ; johnson & johnson, usa) was introduced into the anterior chamber through the 7 o'clock paracentesis site. the right and left iris borders were picked up by the long, straight needle while the angled, blunt tipped 27 gauge needle, inserted from the 5 o'clock paracentesis, countered the pressure of the long, straight needle (fig. 2) the straight needle was then inserted into the blunt tipped 27 gauge needle (fig. after inserting the long needle into the blunt tipped needle from 7 o'clock, both were passed back through the 7 o'clock paracentesis site (fig., the blunt end of the long needle must be inserted first into the anterior chamber. if the sharp end of the needle gets into the anterior chamber first, it could go through the limbal tissue around the paracentesis and the thread could get caught on the limbal tissue. the needles were pulled out again at the 5 o'clock paracentesis site to be tied (fig. postoperatively, visual acuity was 20/20 in the right eye and 20/40 in the left eye. in comparison with the left eye, at 3 months postoperatively, the iol and pupil were centrally positioned in the left eye and no secondary problems were present. zonular and iris defects create potential misalignment problems of the pupillary center and the center of the intraocular lens.4 moreover, iris defects may be associated with photophobia, and glare. the use of ctrs has been proven to be beneficial for iol centration. when a zonular defect is present and a ctr is inserted at any stage of the procedure to reestablish the capsule 's contour, the ctr protects against capsular fornix aspiration, consecutive zonular dialysis extension, irrigation fluid flow behind the capsule, vitreous herniation into the anterior chamber, iol decentration, and closure of the capsular opening.5 we performed a phacoemulsification with ctr implantation in the right eye..6, before performing phacoemulsification, they inserted a ctr in order to perform the phacoemulsificaiton in a stabilized condition. in contrast to mizuno, we attempted to well centralize the iol in the capsular bag. iris suture and prosthetic iris devices improve postoperative outcomes by reducing glare disability in iris deficiency and absence. an iris suture method is generally used, because prosthetics are generally implanted only in special situations and are very expensive.7 therefore, we repaired the iris using the modified suture method. moreover, a small stab incision is made in the clear cornea at 6 o'clock to retrieve the thread at the point when most surgeons repair the inferior iris defect.4,8 - 10 in the modified mccannel suture method used by blackmon, a long, straight needle was employed, similar to our method in limbus, but the thread was retrieved at 6 o'clock.10 in siepser 's slip knot method, tying was done on one side.11 however, these methods sometimes make it difficult to retrieve a part of the thread, especially when repairing a large iris defect. siepser 's method requires a larger wound so that the thread can be pulled out. we retrieved one end of the thread at the opposite site using a blunt 27 gauge needle, and tied it with same tension on both sides. our technique has no need for an additional wound through which to pull out the thread because we use the cataract operation incision. additionally, this method does not have a steep learning curve. this same technique can be used to repair other pupillary abnormalities such as those following trauma, previous sector iridectomies, and pupils that are permanently dilated. we had to perform scleral fixation in the left eye because the posterior capsular rupture occurred due to a zonular defect during ecce. consequently, instability of the lens and a permanent iris defect remained, causing glare and a cosmetic problem in the left eye. despite this problem, at 3 months postoperatively, the iol and pupil were well positioned in the center due to ctr and iris repair. the patient did not suffer from glare and has good visual acuity (20/20) in the right eye in comparison to the left eye (20/40). in conclusion, we recommend using ctr and iris suturing techniques for functional and cosmetic iris abnormalities in coloboma while performing cataract surgery.	purposewe describe our successful experience using a capsular tension ring (ctr) and iris repair during cataract surgery in a patient with bilateral coloboma.methodsa 67-year - old woman had no history of trauma, but had zonular deficiency and inferonasal iris defects in both eyes. an extracapsular cataract extraction and intraocular lens (iol) scleral fixation was performed in the left eye. a ctr was implanted in the right eye through a sclerocorneal incision. after the iol was placed centrally in the capsular bag, two paracenteses were made at the limbus (5 o'clock and 7 o'clock). a long, straight needle was passed through the 7 o'clock paracentesis site into a angled, blunt tipped 27 gauge needle inserted from the 5 o'clock paracentesis. the two needles were pulled out at 5 o'clock. after inserting the long needle into the blunt tipped needle at 7 o'clock, both were passed back through the 7 o'clock paracentesis site. the needles were pulled out again at the 5 o'clock paracentesis site tied. equal tension was used to tie both sides.resultsvisual acuity improved to 20/20 in the right eye.conclusionsboth capsular tension ring implantation and iris repair was successfully performed at the time of cataract surgery in a coloboma patient, which resulted in improvements in visual function and cosmesis.
telomerase is a multi - component ribonucleoprotein located within the nucleus, the function of which is to synthesise the repetitive nucleotide sequence forming the telomeres at the end of chromosomes. during cell division, dna polymerase is unable to fully replicate the ends of linear dna and genetic material is lost which eventually can result in chromosome instability and cellular senescence. telomerase synthesises a new copy of the telomere repeat so that cellular proliferation can continue leading to cellular immortality. telomerase is active in 70 90% of malignant tissues and many immortal cell lines, but most somatic cells have no detectable telomerase activity. we detected telomerase activity in 74% of invasive breast cancers and in none of benign or normal breast tissue specimens. furthermore, we observed a correlation between telomerase activity and tumour size, nodal status, lymphovascular invasion and ki-67 expression. the fundamental components of telomerase have been identified as the rna template (htr), the reverse transcriptase (htert) and telomerase associated proteins, including (tep1). of these htr and tep1 are expressed ubiquitously in both normal and cancerous tissue, whereas htert is detectable in tumour cells but not in normal somatic cells [9 - 11 ]. telomerase enzyme activity can be reconstituted in fibroblasts by the ectopic expression of htert and induction of htert expression has been shown to be essential for telomerase activation in cell - lines. these observations suggest that htert is the rate - limiting determinant of telomerase enzyme activity. we have recently reported that htert mrna is much higher in breast cancer specimens compared with adjacent non - cancerous breast tissue and that telomerase activity is significantly correlated with htert mrna expression. investigation of the mechanisms of htert control is important in elucidating the pathways that may be amenable to therapeutic manipulation and one such pathway involves the transcription factor myc. an increased level of c - myc occurs frequently in a wide range of tumours due to de - regulated expression of myc through gene amplification, retroviral insertion or chromosomal translocation. sequence analysis of the htert gene promoter has shown the presence of at least 2 and perhaps as many as 29 e boxes, potential binding sites for the myc oncoprotein, and the possibility of a regulatory role for myc has been explored in a number of studies. it has been found that purified myc interacts with the e box sequences and that cotransfection of myc induces activity in the isolated htert promoter. it has been shown that retroviral expression of c - myc increases the amount of htert mrna in human mammary epithelial cells and fibroblasts and telomerase activity could thereafter be detected. it has also been reported that expression of c - myc leads to increased htert expression and telomerase activity in human b cells. moreover, since this does not require protein synthesis this appears to be due to a direct effect of myc on the htert promoter and not secondary to an increase in cellular proliferation by myc. in addition, the introduction of myc anti - sense rna has been shown to lead to a reduction in htert promoter activity. our aim in this study was to investigate whether the level of c - myc mrna expression correlates with telomerase activity in human breast carcinomas. specimens of human breast carcinoma tissue (n = 18) were acquired from the md anderson centre (texas, usa). these had been analysed already for quantitative telomerase activity (using a variation on the trap assay), er (er+ = 3 fmol / mg protein), pgr, (pgr+ = 5 fmol / mg protein), s - phase fraction (10% = high}dna and ploidy status (diploid or aneuploid), by this unit as described previously. total cellular rna was extracted from 1020 mg of these tumours using the rneasy mini isolation kit (qiagen, hilden, germany) according to the manufacturer 's protocol. quantification of the rna following treatment with dnase (promega) was carried out in triplicate using the ribogreen reagent (molecular probes europe bv) according to the manufacturers protocol. taqman rt - pcr was performed in duplicate for each sample using the abi prism 7700 sequence detector (perkin - elmer applied biosystems) and the taqman ez rt - pcr core reagents kit (perkin - elmer applied biosystems). the rt - pcr was performed for c - myc using the forward and reverse oligonucleotide primers and taqman probes given in table 1. these oligonucleotides were designed using primer express software (pe - applied biosystems, warrington, uk) using gene sequences obtained from the genbank database. primers and probe were intron spanning to prevent amplification of genomic dna and define a 71 base pair amplicon crossing from exons 2 to 3 in the c - myc gene (accession number v00568.1) sequences of taqman primers and probes for rt - pcr. conditions for the reverse transcription step were 50c for 2 minutes, 60c for 10 minutes, and 92c for 5 minutes. the polymerase chain reaction was carried out for 50 cycles of 20 seconds at 92c and 25 seconds at 62c. for the negative control rnase free water was used in the rt - pcr mix instead of rna. for the positive control, - myc was constructed using serial dilutions of a single stranded sense oligonucleotide specifying the amplicon as previously described by bustin and this together with the known rna concentration was used to quantify the mrna copy number per microgram of rna. total cellular rna was extracted from 1020 mg of these tumours using the rneasy mini isolation kit (qiagen, hilden, germany) according to the manufacturer 's protocol. quantification of the rna following treatment with dnase (promega) was carried out in triplicate using the ribogreen reagent (molecular probes europe bv) according to the manufacturers protocol. taqman rt - pcr was performed in duplicate for each sample using the abi prism 7700 sequence detector (perkin - elmer applied biosystems) and the taqman ez rt - pcr core reagents kit (perkin - elmer applied biosystems). the rt - pcr was performed for c - myc using the forward and reverse oligonucleotide primers and taqman probes given in table 1. these oligonucleotides were designed using primer express software (pe - applied biosystems, warrington, uk) using gene sequences obtained from the genbank database. primers and probe were intron spanning to prevent amplification of genomic dna and define a 71 base pair amplicon crossing from exons 2 to 3 in the c - myc gene (accession number v00568.1) sequences of taqman primers and probes for rt - pcr. conditions for the reverse transcription step were 50c for 2 minutes, 60c for 10 minutes, and 92c for 5 minutes. the polymerase chain reaction was carried out for 50 cycles of 20 seconds at 92c and 25 seconds at 62c. for the negative control rnase free water was used in the rt - pcr mix instead of rna. for the positive control, - myc was constructed using serial dilutions of a single stranded sense oligonucleotide specifying the amplicon as previously described by bustin and this together with the known rna concentration was used to quantify the mrna copy number per microgram of rna. telomerase activity varied between 0 and 246 units of total protein generated (tpg), where one unit of tpg was equal to 600 molecules of telomerase substrate primers extended by at least three telomeric repeats [figure 1 ]. positivity is indicated by the presence of a dna ladder after electrophoresis on a polyacrylamide gel. c - myc mrna levels were between 1.14 10and 2.14 10(mean 6.92 10) copy numbers per g of rna. statistical analysis was performed using sas (version 6.11, sas institute, cary, north carolina). the c - myc expression, er, pgr, s - phase fraction and telomerase activity were considered as continuous variables and the relationship between them was investigated using spearman 's nonparametric correlation coefficient. no significant relationship was found between c - myc expression and telomerase activity (rs = 0.05691, p = 0.8225), [figure 2 ]. c - myc mrna expression was however, found to be inversely correlated with er status (rs = -0.52583, p = 0.0250) but not to correlate with pgr status (rs = -0.149, p = 0.55) or s phase fraction (rs= -0.334, p = 0.1708). we also examined whether there are any differences in c - myc mrna expression by er status (er+ = 3 fmol / mgprotein), pgrstatus (pgr+ = 5 fmol / mg protein), dna ploidy status (diploid or aneuploid), s - phase fraction (10% = high) and observed a strong relationship was observed between c - myc mrna expression and diploidy (p = 0.03) [tables 2, 3 ]. the relationships between c - myc mrna expression and, er, pgr, ploidy and spf using kruskal - wallis p - values. spearman correlation coefficients (sccs) demonstrating no significant correlation between c - myc mrna expression and tpg by telomerase. however there is a significant correlation between htert mrna expression and tpg and between c - myc and absence of er. each cell of the table shows scc, p - value and number of observation. although the htert promoter contains e - boxes, we have found no correlation between c - myc mrna levels and telomerase activity. the control of htert is undoubtedly a complex one and it is likely that a number of other transcription factors influence its expression than c - myc. these might act together with c - myc, as has been shown for sp1 or independently. in this respect, it has been shown that transfer of a normal chromosome 3 into human breast carcinoma cells results in abolition of htert transcripts without any change in c - myc levels. furthermore, it is known that another member of the myc family, mad1 forms a complex with max and acts as a transcriptional repressor at the same binding sites as myc - max. it has been shown that, the proportion of mad1 binding to the htert promoter rises and that of myc falls, during the differentiation of hl60 cells. this is associated with reduced acetylation of the htert promoter and measurement of the mad / myc ratio is likely to be important in establishing the overall level of transcriptional activation of htert.	backgroundtelomerase is a ribonucleoprotein enzyme that synthesises telomeres after cell division and maintains chromosomal length and stability thus leading to cellular immortalisation. the htert (human telomerase reverse transcriptase) subunit seems to be the rate - limiting determinant of telomerase and knowledge of factors controlling htert transcription may be useful in therapeutic strategies. the htert promoter contains binding sites for c - myc and there is experimental and in vitro evidence that c - myc may increase htert expression.materials and methodsrna was extracted from 18 breast carcinomas and c - myc mrna expression was estimated by quantitative reverse transcriptase - pcr (rt - pcr) with taqman methodology. these tumours had already been analysed for er and pgr status using ligand - binding assays and had had their dna ploidy and s - phase fractions measured by flow cytometry. telomerase activity had already been determined by using a modified telomeric repeat and amplification protocol (trap) assay.resultstelomerase activity ranged from 0 to 246 units of total protein generated (tpg), where one unit of tpg was equal to 600 molecules of telomerase substrate primers extended by at least three telomeric repeats. median levels of tpg were 60 and mean levels 81. there was no significant correlation between levels of c - myc mrna expression, telomerase activity, s phase fraction or pgr. there was a significant negative correlation with er status.conclusionalthough the htert promoter contains potential binding sites for c - myc oncoprotein, we have found no correlation between c - myc mrna levels and telomerase activity.
we all use space when dealing with quantities, both in real - life situations and in our minds. examples include the sorting of objects into physical piles when counting them, or organizing tallies into spatially separate groups. documenting this pervasive use of mental space, well over 100 experiments have now studied our tendency to associate small numbers (1 or 2) with left hemispace and larger numbers (8 or 9) with right hemispace, usually in parity or magnitude classification tasks (wood., 2008). but spatial numerical associations (snas) influence our entire behavioral repertoire, from response selection to response force, from movement initiation speed to subsequent attention allocation (hubbard., 2005 ; fischer, 2011). spatial activities including drawing and gesturing help both children and mathematicians to solve numerical problems (nunez, 2006 ; goldin - meadow., 2009 ; lubin., 2010). finally, we also think of even numbers as more right than odd numbers (nuerk., 2004) and of addition as rightward movement and subtraction as leftward movement (mccrink., 2007 ; pinhas and fischer, 2008 ; knops., we refer to all such relationships collectively as snas. despite the remarkable prevalence of snas this omission hampers our understanding of numerical cognition and is incompatible with the prevalent theoretical framing of cognition as an abstract and amodal process (barsalou, 2008). we address this omission by first reviewing the notion, prominent in current theoretical arguments, of snas as emerging from reading habits. then we describe recent behavioral and neuroscientific evidence in support of an alternative origin of snas, namely finger counting habits. we argue that reading - related biases are only a minor contributor to snas, and that finger counting is an important universal factor that shapes the spatial nature of numerical representations and processing. despite being the most conspicuous element of embodiment in the domain of numerical cognition, therefore we sketch out theoretical implications of finger counting for grounded, embodied, and situated cognition more generally in a final section. we conclude that the study of manumerical cognition, the role of fingers in our comprehension of numbers, holds great promise for grasping the embodied nature of thought. cumulative number of publications found in web of knowledge on july 2, 2011, using as search terms (a) ts = (embodied cognition) or ts = (embodied process) ; (b) ts = (finger count) ; (c) ts = (num cognition or early studies of snas in western countries proposed that a directional left - to - right scanning habit is initially acquired with reading and subsequently spills over into the numerical domain, thus causing horizontal snas (dehaene. but at least four arguments suggest that reading habits themselves can not fully account for the multitude of snas and are unlikely to be their ultimate cause. first, even within a given culture, the notion of a well - defined one - way reading direction is an oversimplification. for instance, hebrew readers, who read text right - to - left still read embedded numbers left - to - right. presumably because word and number reading habits cancel each other (shaki., 2009). consistent with this observation, snas do obtain in hebrew readers when the spatial associations of numbers are made consistent with the general reading direction (fischer., 2010 ; figure 2), or when the association is assessed orthogonally to the conflict - inducing dimensions, i.e., by using vertical response keys (shaki and fischer, 2011). in chinese english bilingual readers the presentation format of numbers (chinese or arabic symbols) determines their mapping along the vertical or horizontal dimension (hung., 2008), again indicating the presence of multiple snas. in both cases it is not reading direction per se, but their spatial consistency, or their contextual association, which shapes snas. change in snas of hebrew and english participants reading cooking recipes with different number magnitudes at the beginning and end of each line. change was measured per regression slopes calculated from number classification speed in the parity task before vs. after reading. in both languages secondly, the assumption that years of exposure to a reading culture gradually shape a person s snas runs against more recent observations. russian hebrew bilinguals modify their sna after reading a few minutes of cyrillic or hebrew text (shaki and fischer, 2008) ; in fact, merely reading a single cyrillic or hebrew word changes their sna from 1 s to the next (fischer., 2009). even during reading, snas depend on the positioning of digits within a text (fischer., 2010, figure 2), clearly indicating that effects of reading are much more short - lived and fragile than originally thought. directional reading habits provide, at best, only a small contribution to the overall snas. developmental data provide a third argument against a role of reading as the origin of snas. for example, 4.5-year - old children already explore objects more efficiently when they are numbered in left - to - right ascending order (opfer and furlong, 2011 ; see also tversky., 1991). these observations establish the small - left association as a default in western cultures that needs to be explained. the developmental time - line of snas is more fully discussed in a recent review by gbel. participants moved a mouse cursor to indicate the numerically larger of two dot patterns, and response latencies showed a horizontal sna for both groups. in another animal study, newborn domestic chicks learned the positions of 10 pecking holes arranged in a radial array (extending from near to far). when later tested with the array rotated 90, i.e., in a horizontal extension, they spontaneously translated the formerly radially ascending sequence into a left - to - right, but not a right - to - left ascending sequence (rugani., 2010). spatial exploration biases have been made responsible for this asymmetric organization of number space in the avian brain (rugani., 2011). together, these animal studies indicate that directional scanning habits in a linguistic context are not needed to explain the emergence of systematic snas. given the limited legs of the reading hypothesis, we propose that snas might instead originate from a different directional habit that exhibits both universality and cross - cultural variability : finger counting. across the world, most children initially acquire number concepts through finger counting, by either spontaneous practice, observing their parents, or direct tutoring. finger counting has a long cultural tradition (gbel., 2011) and is surprisingly prevalent today, both as an overt behavior and as a cognitive representation. a girl born without forearms and hands used her phantom fingers to solve arithmetic problems (poeck, 1964). while this behavior could have been learned from observing other people, a scaffolding function of innate components of both a finger schema and basic calculation routines this hypothesis receives tentative support from the fact that newborns already imitate finger postures (nagy., 2005). interestingly, they prefer to do so with their left hand, which, in turn, links in with findings from an ongoing internet - based study (please visit www.counting.cognitive-psychology.eu/) which showed that adults in english - speaking countries also prefer to start counting on the fingers of their left hand (lindemann., 2011). thus, they associate small numbers with left space, and might have done so as children. it is not clear why this pattern is less biased in some mid - european and mediterranean cultures but the preference clearly reverses in middle eastern cultures, where there are more right - starters. importantly, left - starters as a group have stronger and more consistent snas than right - starters (fischer, 2008), possibly due to congruency between their individual snas and the population stereotype that is expressed on rulers, graphs, etc. this makes finger counting a prime candidate for the origin of directional snas and their cross - cultural variation. given this potential of finger counting as a foundation of snas, we now review the empirical evidence for an involvement of fingers in numerical cognition, including behavioral, and neuroscientific studies. recent research has established links between hand movements and number processing, such as congruency effects between number magnitude and grasp aperture (reviewed in andres., 2008 ; badets and pesenti, 2010). but several observations show that the sna can be traced to the finger level : finger responses are faster when the mapping of number stimuli onto fingers agrees with the direction of finger counting (di luca., 2006). seeing canonical finger counting postures differs from seeing arbitrary finger postures : di luca and pesenti (2008), di luca. (2010) documented faster naming of numerosities indicated by canonical postures, and ruled out differential familiarity or saliency as confounds. di luca. (2010) found that canonical postures selectively prime one target number whereas arbitrary finger postures prime all numbers - up to and including the target. we will return to this important observation of a modulation of grounded number representations by embodied number associations. finally, addition is faster when canonical finger postures appear after naming the result, thus providing evidence for arithmetic outcome anticipation in terms of finger associations (badets., 2010). early studies reporting a negative relationship of finger counting with intelligence did not control for individual differences in the ability to differentiate between the single fingers (sauls and beeson, 1976). in fact, this faculty of finger gnosis predicts future numerical skills (fayol. children between 7 and 9 years no longer use fingers overtly during mental calculation but make a disproportionate number of split-5 errors (deviating by 5 from the correct solution), suggesting they forgot to keep their hand in mind (domahs., 2008). in adults, classifying the digit pairs 46 and 57 by magnitude is slower in germans (who count up to 5 on one hand) than in chinese (who count up to 9 on one hand), suggesting that it takes longer to compare bimanually than unimanually represented numbers (domahs., 2010), presumably because the latter do not require interhemispheric communication. some studies that investigated finger - number associations as a function of hand posture (palm down, i.e., right thumb is left of pinkie vs. palm up, i.e., right thumb is right of pinkie) seem to weaken the case for exclusively finger - based snas. (2008) found that, after seeing a small number, participants responded faster to tactile stimuli on either the thumb or the pinkie, whichever was the leftmost finger in space (see also behrmann and moscovitch, 1994). likewise, in a finger - number size compatibility task the speed advantage of the index over ring finger was inverted when hand posture was changed (leuthard. similar space - based rather than hand - based finger - number associations resulted from another hand posture manipulation, arm crossing. when participants tapped their fingers repeatedly in random order, while simultaneously naming the numbers from 1 to30 in a random sequence, they named smaller random numbers when the new tap occurred to the left of the previous one in space, regardless of whether their hands were straight or crossed (plaisier and smets, 2011). both hand posture manipulations (pronation / supination and midline crossing) seem to show dominance of external over hand - based space in the mapping of numbers. however, on second consideration, these findings do not diminish the impact of finger - number associations, but only show how flexible the reference frames are that allow an optimal orientation in physical as well as in number space and that guarantee rapid adjustments to a given situation. detailed processing models that combine somatotopic and external referencing of fingers and hands, respectively (haggard., 2006) are currently missing. they will have to consider that the cortical representation of hands and fingers are overlapping to a large extent, but once required by situational demands can function surprisingly independently (heed., tang. (2006) showed that numerical tasks activate motor cortex in chinese but not western adults. this was taken to reflect arithmetic learning with an abacus in asian cultures, indicating their embodied representation of number facts. (2008) showed that children s (but not adults) brain activity during magnitude judgments reflected finger - based processing strategies. two tms studies showed increased corticospinal excitability specifically for the hand muscles during numerical judgments (andres., 2007 ; sato., 2007). also, when tms is applied to the angular gyrus (rusconi., 2005) it disrupts both access to the finger schema and number magnitude processing. evidence for a functional overlap of number and finger representations is often claimed from gerstmann syndrome (gerstmann, 1940), where acalculia is accompanied by finger agnosia. although this interpretation is now unlikely (rusconi., 2010), co - morbidities involving writing and left right discrimination put the association between fingers and numbers in the larger context of symbolic action in space. the spatial (2008) and plaisier and smets (2011) may make digits as body parts ideal candidates to deal with digits as points in number space. finally, tschentscher. (2010) recently compared activation in primary hand motor cortex in adults who start finger counting on either their left or their right hand. the authors found that passively looking at small numbers or number words activated right motor cortex in left - starters but not in right - starters. this work extends the influential demonstration of a somatotopic activation of motor cortex by the reading of action verbs (pulvermller, 2005) to the reading of numerical concepts. together, this behavioral, neuropsychological, and neuroscientific evidence supports the idea of a close link between number and finger knowledge. recent research has established links between hand movements and number processing, such as congruency effects between number magnitude and grasp aperture (reviewed in andres., 2008 ; badets and pesenti, 2010). but several observations show that the sna can be traced to the finger level : finger responses are faster when the mapping of number stimuli onto fingers agrees with the direction of finger counting (di luca., 2006). seeing canonical finger counting postures differs from seeing arbitrary finger postures : di luca and pesenti (2008), di luca. (2010) documented faster naming of numerosities indicated by canonical postures, and ruled out differential familiarity or saliency as confounds. di luca. (2010) found that canonical postures selectively prime one target number whereas arbitrary finger postures prime all numbers - up to and including the target. we will return to this important observation of a modulation of grounded number representations by embodied number associations. finally, addition is faster when canonical finger postures appear after naming the result, thus providing evidence for arithmetic outcome anticipation in terms of finger associations (badets., 2010). early studies reporting a negative relationship of finger counting with intelligence did not control for individual differences in the ability to differentiate between the single fingers (sauls and beeson, 1976). in fact, this faculty of finger gnosis predicts future numerical skills (fayol., 1998 ; nol, 2005). children between 7 and 9 years no longer use fingers overtly during mental calculation but make a disproportionate number of split-5 errors (deviating by 5 from the correct solution), suggesting they forgot to keep their hand in mind (domahs., 2008). in adults, classifying the digit pairs 46 and 57 by magnitude is slower in germans (who count up to 5 on one hand) than in chinese (who count up to 9 on one hand), suggesting that it takes longer to compare bimanually than unimanually represented numbers (domahs., 2010), presumably because the latter do not require interhemispheric communication. some studies that investigated finger - number associations as a function of hand posture (palm down, i.e., right thumb is left of pinkie vs. palm up, i.e., right thumb is right of pinkie) seem to weaken the case for exclusively finger - based snas. (2008) found that, after seeing a small number, participants responded faster to tactile stimuli on either the thumb or the pinkie, whichever was the leftmost finger in space (see also behrmann and moscovitch, 1994). likewise, in a finger - number size compatibility task the speed advantage of the index over ring finger was inverted when hand posture was changed (leuthard. similar space - based rather than hand - based finger - number associations resulted from another hand posture manipulation, arm crossing. when participants tapped their fingers repeatedly in random order, while simultaneously naming the numbers from 1 to30 in a random sequence, they named smaller random numbers when the new tap occurred to the left of the previous one in space, regardless of whether their hands were straight or crossed (plaisier and smets, 2011). both hand posture manipulations (pronation / supination and midline crossing) seem to show dominance of external over hand - based space in the mapping of numbers. however, on second consideration, these findings do not diminish the impact of finger - number associations, but only show how flexible the reference frames are that allow an optimal orientation in physical as well as in number space and that guarantee rapid adjustments to a given situation. detailed processing models that combine somatotopic and external referencing of fingers and hands, respectively (haggard., 2006) are currently missing. they will have to consider that the cortical representation of hands and fingers are overlapping to a large extent, but once required by situational demands can function surprisingly independently (heed., tang. (2006) showed that numerical tasks activate motor cortex in chinese but not western adults. this was taken to reflect arithmetic learning with an abacus in asian cultures, indicating their embodied representation of number facts. (2008) showed that children s (but not adults) brain activity during magnitude judgments reflected finger - based processing strategies. two tms studies showed increased corticospinal excitability specifically for the hand muscles during numerical judgments (andres., 2007 ; sato., 2007). also, when tms is applied to the angular gyrus (rusconi., 2005) evidence for a functional overlap of number and finger representations is often claimed from gerstmann syndrome (gerstmann, 1940), where acalculia is accompanied by finger agnosia. although this interpretation is now unlikely (rusconi., right discrimination put the association between fingers and numbers in the larger context of symbolic action in space. the spatial (2008) and plaisier and smets (2011) may make digits as body parts ideal candidates to deal with digits as points in number space. finally, tschentscher. (2010) recently compared activation in primary hand motor cortex in adults who start finger counting on either their left or their right hand. the authors found that passively looking at small numbers or number words activated right motor cortex in left - starters but not in right - starters. this work extends the influential demonstration of a somatotopic activation of motor cortex by the reading of action verbs (pulvermller, 2005) to the reading of numerical concepts. together, this behavioral, neuropsychological, and neuroscientific evidence supports the idea of a close link between number and finger knowledge. the brain has developed together with the rest of the body as a way to regulate perception and bodily actions in a situation- and task - appropriate manner. we propose a hierarchical relationship between these terms before discussing implications of this view for the origin of snas (figure 3). illustration of the hierarchical relationship of grounded, embodied, and situated cognition in the numerical domain. the most fundamental aspect of cognitive representations is their grounding which reflects universal properties of the world. one example is the large numbers - up and small numbers - down association that comes from accumulating objects into piles and that subsequently pervades our metaphorical use of language (lakoff and nunez, 2000). on top of this environment - based conceptual grounding, the sensorimotor constraints of our bodies shape embodied knowledge representations, as in grasp aperture modulation during object interactions or finger counting (de cruz, 2008). finally, range- and context - dependence of snas (dehaene., 1993 ; bchtold., this theoretical stance is orthogonal to other theoretical views such as the extended mind hypothesis (clark, 2008) or the more general theory of magnitude representation (bueti and walsh, 2009). it makes several predictions about mathematical practice that can inform our search for the origins of snas and the nature of human thought. first, the hierarchical priority of grounding over embodiment implies that summation coding should be more robust than place coding of numerosities, i.e., larger numerosities should experientially encompass smaller numerosities, unless a cognitively higher level of processing intervenes. this prediction is in line with empirical findings, summarized above, on place vs. summation coding as a function of canonical vs. arbitrary finger postures (di luca., 2010). by the same rationale, vertical snas should be more robust and harder to abolish than horizontal snas (fischer, 2011 ; shaki and fischer, 2011). second, an embodied stance on numerical cognition predicts that different body postures, and their effects on spatial reference frames, should influence snas. supporting this prediction, healthy adults generate smaller random numbers while turning their head left and larger random numbers while turning their head right (loetscher., 2008). also, both horizontal and vertical eye positions reliably predict the magnitude of a number emitted at random crossing one s hands over lateralized response keys can eliminate snas (wood., 2006). patients with right - hemisphere lesions, who fail to attend to the left side of their body and who neglect left hemispace, err toward large numbers when asked to bisect number intervals (zorzi., 2002). the error in explicit number interval bisection is not correlated, however, with rightward displacements in the bisection of real lines (doricchi., 2005), nor does left - sided neglect manifest itself as small number bias in random generation (loetscher and brugger, 2009). this indicates that, while hemispatial neglect affects orientation along a number line, the laws that govern attention in physical and number space are not identical. evidence for such flexibility comes from dual - task paradigms, where left - hemisphere verbal memory load abolished snas in parity decisions but not in magnitude comparisons, whereas the opposite interference pattern occurred for right - hemisphere visual spatial load (van dijck., 2009). hemispheric activation paradigms can also bias healthy subjects preference for small or large numbers during digit randomization (loetscher and brugger, 2007), and individual preferences for left- vs. right - hemisphere mediated tasks bias number choices toward higher or lower magnitudes (bachmann., 2010). finally, handedness, one of the most conspicuous signs of hemispheric specialization, does not influence snas per se (dehaene., (rather than worse), interactions between emotional valence and hemispace (casasanto, 2009) are to be expected. thus, we recently found regular snas as long as small numbers denoted undesirable and large numbers desirable events, but as soon as emotional connotations were reversed, no snas were observed (in preparation). our brief review illustrates the bewildering number of potential sources of the association between number and space. we believe that this reflects the human capacity to quickly learn to associate any symbol or abstract relation with a spatial position or relationship (bchtold., 2000 ; gattis, 2002). thus, snas are the expression of some general cognitive rule that reflects the placement of an image in space (the spatialization of ideas) and the relative (in) compatibility that emerges from using lateral effectors to respond to these ideas. studies with children and amputees are likely to further advance our understanding of this intriguing phenomenon. the embodied cognition approach is a most suitable framework for further progress along this path, and the study of manumerical cognition (fischer, 2008) holds great promise for our understanding of the embodied nature of thought. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	spatial numerical associations (snas) are prevalent yet their origin is poorly understood. we first consider the possible prime role of reading habits in shaping snas and list three observations that argue against a prominent influence of this role : (1) directional reading habits for numbers may conflict with those for non - numerical symbols, (2) short - term experimental manipulations can overrule the impact of decades of reading experience, (3) snas predate the acquisition of reading. as a promising alternative, we discuss behavioral, neuroscientific, and neuropsychological evidence in support of finger counting as the most likely initial determinant of snas. implications of this manumerical cognition stance for the distinction between grounded, embodied, and situated cognition are discussed.
though considerable declines in new hiv infections have been observed since the late 1980s, injection drug use continues to account for an estimated 12% of incident hiv infections in the united states. recent behavioral surveys suggest that approximately 30% of idus have shared syringes or other injection equipment in the last year. the social context of injection drug use has been shown to differ for men and women, which has been posited to explain gender differences in risk for hiv / hcv infection among idus [3, 4 ]. these social differences include the role relation of the injecting partner (women more frequently use drugs with individuals with whom they have a relationship, usually a sex partner) ; the drug use behavior of women 's social network contacts (female idus ' social networks tend to have more hard drug users (e.g., heroin and cocaine) and idus than male idus ' networks) ; and the greater degree to which women 's drug, sex, and friend networks overlap [3, 6 ]. women 's risk is also elevated because their access to drugs, injection paraphernalia, and other resources are often controlled or determined by their sex partners and/or others within their social network [5, 79 ]. finally, and perhaps most importantly in terms of injection - related risk, women often relinquish control over the actual preparation and injection processes to others, usually their male sex partners. not feeling in control over the injection event has been associated with unsafe injection practices among women, and hiv infection has been shown to be almost twice as high among drug users who require help injecting. initiation into injection drug use is a significant event with well - documented health risks [1315 ]. however, there is far less information on the effects of experimentation with the injection of a new drug and how behaviors associated with the injection process change over time. there is some evidence that the context of initiation of a new drug (i.e., ketamine) among established idus can introduce new and unexpected risks for hiv / hcv. ketamine is a legally manufactured, dissociative anesthetic that was originally developed for surgical use, but which has emerged as a recreational drug. young people who inject ketamine have been found to be a particularly high - risk group of idus who tend to engage in sequential and/or simultaneous polydrug use [18, 19 ] and a number of risky injection practices, including sharing injection paraphernalia. ketamine can usually be obtained in two forms on the street : powder or liquid. powder ketamine is often used intranasally, but can also be mixed with water and injected. liquid ketamine is generally sold in pharmaceutically sealed vials with lids that are designed to be pierced by hypodermic syringes and can be injected intramuscularly or intravenously. while sometimes addressed as separate risk factors in various reports, this study examines five interrelated features of the social context of injection drug use that may have implications for increased risk of exposure to hiv and hcv among young female idus : characteristics of the using group, control over access to drugs, control over access to injection paraphernalia, control over preparation of drugs, and control over injection of drugs. in particular, we examine how the context of injection drug use changes among young female idus by comparing the first injection event of any drug (e.g., heroin, cocaine, and methamphetamine) with the first injection of ketamine, which occurred later in the injection career. last, we examine implications for hiv / hcv risk and identify opportunity for risk reduction and targeted hiv and hcv prevention interventions among young female idus. the current study examines a sample of 30 young female idus recruited as part of a larger, three - site mixed - methods study designed to investigate the role of ketamine injection in shaping hiv risk among young idus. the larger study included 222 young ketamine idus recruited from three data collection sites : new york city, los angeles, and new orleans. all data were collected between march 2004 and june 2006, and respondents completed a single cross - sectional interview in each site. sampling and data collection procedures were the same in all three sites and were approved by local institutional review boards. data for the current analysis were drawn from the los angeles site in order to reduce the variability introduced by differences in geographic locations. data collection began with a community assessment process (cap), in which ethnographers conducted interviews with key informants and community members (e.g., directors of local service agencies for youth and idus) in order to identify locations for participant recruitment. based on the information provided in the cap, ethnographers recruited young ketamine injectors using a combination of chain referral sampling [22, 23 ] and targeted sampling. both sampling strategies are nonrandom methods that are effective in sampling hidden populations for whom no population estimates exist. in the los angeles area, ethnographers focused recruitment efforts in the cities of hollywood, santa monica, and venice beach. eligible individuals were 16 to 29 years old and had injected ketamine at least once within the past two years. ethnographers first administered a series of screening questions that asked about health behaviors, recent drug use, and history of homelessness in order to conceal the eligibility criteria. eligible individuals provided informed consent and completed a single cross - sectional interview that lasted approximately one hour. participants were compensated with $ 20 cash payments and referral information for local needle exchanges, health clinics, homeless shelters, and other service provider information. because this analysis included data from both the first injection event and the first injection of ketamine, women who initiated injection drug use with ketamine one additional woman was excluded due to inconsistent responses, yielding an analytical sample of 30 women. the interview guide contained a mix of structured, closed - ended questions and open - ended, qualitative questions. interviews were conducted using a computer - assisted interview, programmed in questionnaire development software (qds) and were digitally recorded. closed - ended questions included standard demographic items (e.g., age, race / ethnicity, self - reported sexual identity, education level, homelessness, employment history, history of drug treatment, and mental health care, and criminal justice involvement). hiv and hcv status were assessed using self - report of having been tested and results of the most recent test, if applicable (positive, negative, and unknown). type of drug injected, number of people present at the injection event, and whether the injection event was planned (yes / no) were also collected with closed - ended questions. syringe source was assessed using a single question that asked whether the participant obtained the syringe herself from a syringe exchange or pharmacy (primary source) or from someone else (secondary source). closed - ended questions also assessed the participants ' relationship with others involved in the preparation and injection of the drug. for example, participants were asked about the geographic location, physical setting (i.e., in a building, outside, etc.), social setting (i.e., who else was present), why they injected, how they obtained the drugs, and a detailed description of the procedures for preparing and injecting the drug. interviewers used follow - up probes to elicit more information about details of the injection events, as appropriate. data for the current analysis were drawn from two interview modules, which asked participants about two injection events : the initiation of drug injection with any drug and the initiation of ketamine injection. to describe how women 's injection behaviors changed over time, we compared circumstances at the first injection of any drug to those at the initiation of ketamine, which occurred an average of two years later. first, transcripts were read and a series of memos was developed, which documented initial impressions. second, based on the initial reading of the transcripts and some a priori understanding of themes that have been identified in the literature, a list of open codes was developed. these codes were applied to segments of text using the atlas.ti program, which allows the analyst to code and organize text. when new codes emerged from the transcripts during the coding process, the emergent codes were added to the existing list, and all transcripts were reviewed again to ensure the coding of relevant passages. third, reports were generated that contained blocks of coded text from all the interview transcripts, and the results were compared for the two injection events (first injection of any drug and first injection of ketamine) to identify similarities and differences. participants had a median age of 21 years and were mostly white (table 1). women reported high rates of involvement with the criminal justice system, high rates of hiv and hcv testing, and low rates of employment in either full or part time work. no women reported being hiv positive, and 33% reported being hcv positive. in terms of drug use, about half of women reported that heroin was the first drug they ever injected, while just over one - quarter initiated with methamphetamine (table 2). at the time of the first injection, women reported that they injected with a median of 2 other people (range 15). in their descriptions of the first injection event, most women (about two - thirds) noted the presence of friends, sometimes described as members of their street family. almost half also reported the presence of a sexual partner (i.e., boyfriend, girlfriend, fianc, or husband) at their first injection episode. often, using groups were composed of mixed groups of friends and sex partners. most women initiated injection of any drug with a using group that comprised older individuals, though some reported groups that were approximately of their same age. no women reported strangers as part of their using group, and only two reported injecting alone. an average of two years elapsed (range 010 years) between the first injection of any drug and first injection of ketamine. while the median size of using groups remained the same, the range increased (median = 2, range 115). the composition of women 's using groups at their first ketamine injection differed from what they described at their first injection event. rather than mostly older groups, women described an almost equal number of older and same age individuals, with a large proportion of mixed age groups. while slightly fewer women reported having friends present, there were more relationship types reported, including sugar daddy, random people at a party, and drug dealers. again, only two women reported injecting alone. at the time of their first injection, only one in five women paid for the drug that they injected (table 2). half said that their first injection was planned, or that they had deliberately sought out the opportunity. pay for their own drugs, and only a few women reported having a direct connection to the drugs (i.e., to a dealer) ; the majority of women acquired their drugs through someone else. only one woman made explicit reference to a female as the one who helped her obtain drugs. these individuals served as a connection to drugs, but they also exercised power in that role to restrict access. for instance, one woman describes the barriers she faced from her peers in obtaining heroin for her first injection : there 's all kinds of drugs there, but it 's like family status out there. we 're all a bunch of homeless kids they make it a total pain in your ass to get any new drugs there we 're all like really good friends but nobody would give me a fucking bag [of heroin ], you know ? and when i finally go the goddamn bag, nobody would give me a needle. so i had to run around and buy one from somebody.this woman reported that she ultimately gave money to her boyfriend, who purchased heroin for her from a female friend. there 's all kinds of drugs there, but it 's like family status out there. we 're all a bunch of homeless kids they make it a total pain in your ass to get any new drugs there we 're all like really good friends but nobody would give me a fucking bag [of heroin ], you know ? and when i finally go the goddamn bag, nobody would give me a needle. the frequency with which women paid for their drugs increased for the first injection of ketamine, such that about three in ten paid for it. given that an average of two years elapsed between the first injection event of any drug and the first injection of ketamine, women may have had time to form more connections through which they could obtain drugs. however, the proportion of women who said that the injection was planned decreased in comparison to the first injection event (23% versus 53%), suggesting a concurrent increase in the spontaneity of their drug use. several women gave accounts of receiving unsolicited offers of ketamine, or buying or being given ketamine when they were looking for some other drug:it was free hey, spare any change ? cause he kind of looked like he had money, you know ? i do not have any change, but i got a little k [ketamine ]. and we were like can we have it ? and he was like sure. ok.so we sat in the corner and fuckin jammed [injected ] it while he watched. hey, spare any change ? cause he kind of looked like he had money, you know ? i do not have any change, but i got a little k [ketamine ]. and we were like can we have it ? and he was like sure. ok.so we sat in the corner and fuckin jammed [injected ] it while he watched. at their first injection event, 30% of women accessed their syringes from a primary source, 60% obtained them from a secondary source, and 10% did not know where the syringe came from (table 2). in contrast, for their first injection of ketamine, 50% obtained their syringe from a primary source, 47% from a secondary source, and only 3% did not know the origin of their syringe. overall, reports of receptive syringe sharing (i.e., using a syringe after someone else) were low (3%) at the first injection event, but increased by the first injection of ketamine (13%). at both injection events most of the women said that the syringe they obtained from a secondary source (i.e., a source other than a needle exchange or pharmacy) was a brand new, sterile syringe that their friend or partner had procured from a needle exchange program : my friend who i knew he 's a regular drug user. like intravenous drug user, so he always has a few extras that are definitely clean. however, several other responses suggested that the origin of the syringes may be less certain for example, they were pretty much regular users so i am assuming that they probably did use a needle exchange or something. a minority of women at both injection events controlled the preparation of their own drugs (20% at the first injection, 37% at first injection of ketamine ; table 2). among those who did not prepare their own drugs for injection at the first injection event, almost half (46%) reported that a sexual partner prepared their drugs. in contrast, at the first injection of ketamine only 19% of women reported that a sexual partner prepared their injection. women commonly said that they were not in the same room with the individual who was preparing their drugs and often were simply handed a filled syringe. for example, this woman recounts her first injection of ketamine, which was prepared by her husband : he came back, he said, i 'm gon na go mix it up and he went and mixed it up and he came and had my shot for me. while rates of syringe sharing were relatively low, almost two - thirds of women reported injecting with shared paraphernalia (i.e., cookers, cottons) at their first injection event (table 2), and nearly three - quarters reported using shared paraphernalia (i.e., cookers, cottons, and ketamine vials) at the first ketamine injection. at the first injection event, a more experienced injector typically prepared enough for both people using a single cooker and a single cotton filter. since the bulk of women reported acquiring new syringes from either primary or secondary sources, it is possible that the paraphernalia used in some of these shared injection events was new. among the women who reported using shared cookers and cottons at their first injection event, almost all reported that someone else prepared the drug solution. in contrast, among those who used separate injection equipment, less than half reported that someone else prepared the drug. at the first ketamine injection event, many women were faced with a novel drug form : liquid ketamine in a pharmaceutically manufactured, multi dose vial. most of the women who shared injection equipment at the first ketamine injection reported sharing a multi dose vial. while several women reported that they used clean syringes to draw drug solution out of the vial, all participants did not. similar to their first injection, almost all of the women who shared injection equipment had someone else prepare the drug. none of the women who used separate equipment reported that someone else prepared the drug for them. at the first injection event, a small proportion of women (17%) injected themselves (table 2). among those who did not inject themselves, most relied on friends (52%) or sexual partners (48%) to perform their first injection for them. most women learned how to inject in the intervening time between their first injection and their first injection of ketamine ; 80% of women performed their own first injection of ketamine. this is significant in light of the much lower proportion of individuals who prepared their own ketamine for injection (37%), suggesting that while most individuals gained control over the actual injection, many continued to rely on someone else for preparation. among those who did not perform their own injection, two - thirds of women relied on a friend, while one - third of women had a sexual partner most women said the primary reason that they performed their first ketamine injection themselves was that they were now familiar with how to administer an intravenous or intramuscular injection. once i learned how to hit, like, i learned how to use needles, i was pretty adamant about (injecting myself). however, another woman said that she only injected herself that time because her boyfriend was already too high to do the injection for her, suggesting that her preference would have been to have him do it. as was the case with drug preparation, for some individuals the injection of ketamine for the first time required learning a new skill. women described two modes of administration of the first shot of ketamine : intravenously (57%) and intramuscularly (43%). women who self - administered their first injection of ketamine were more likely to have been injected intravenously (54%) versus intramuscularly (46%). again, this association may be due to the fact that intravenous administration was a more familiar mode than intramuscular. the social context of drug injection and associated risk for hiv and hcv among female idus is particularly relevant as some scholars have described the feminization of the hiv epidemic in recent years. in this study, we asked a sample of young female idus to describe the social context of two pivotal events in their injection careers : their first injection of any drug and their first injection of a new drug (i.e., ketamine), which occurred an average of two years later. we found important differences in several aspects of the social environment that have implications for hiv / hcv risk in this group of high - risk women. the group of idus with which women injected became larger and more diverse over the two years between injection events. this included an increase in different relationship types, including more strangers or casual acquaintances. as women matured in their drug using careers and became more confident, they may have also become more integrated into larger and more diverse drug using networks. this type of change in drug using social networks has implications for hiv / hcv risk, as introduction of new members of discordant or unknown serostatus may change the risk profile of the entire network [30, 31 ]. the prominent role of women 's sexual partners in the events described here is consistent with the finding that young women are more likely than men to initiate injection with a sexual partner and to have that individual perform the injection [13, 32, 33 ]. it also illustrates the overlap in drug using and sexual networks (i.e., multiplexity) that has been shown to increase risk for hiv and hcv infection [3, 4 ]. women 's access to drugs was often facilitated by other people and women seldom paid for their own drugs. for many women, ketamine was encountered spontaneously and unexpectedly, usually offered for free by others in the using group. dependence on others for access to drugs, which can result from women 's marginalized positions in their drug - using social networks, could create scenarios in which women are unable to demand the use of separate, sterile injection equipment. spontaneous drug injection may also create scenarios in which sterile injection equipment is unavailable. both of these situations could elevate the likelihood that contaminated injection equipment is used, thereby increasing risk for hiv / hcv infection. women appeared to increase their ability to access syringes from a primary source over time. increased access may be a product of women 's maturation in their drug using career and increasing familiarity with community resources for syringes. still, only half of women reported that they obtained their syringe from a primary source for their first ketamine injection. women were not always certain that the syringes they obtained from secondary sources were sterile ; therefore, obtaining syringes via secondary routes to engage in an unplanned injection event could have increased their risk for hiv / hcv infection. however, the risk associated with this strategy likely depends on the type of relationship and level of trust and communication about infectious disease between partners. in fact, procuring syringes from friends and/or sex partners may be a risk reduction strategy, particularly if the option is obtaining syringes from a stranger. drug preparation is a critical point in the injection process during which contamination with bloodborne pathogens such as hiv or hcv can be introduced via contaminated cookers, cottons, or syringes, which are sometimes shared in order to prepare or divide drug solution. women were, to a large extent, dependent on others to prepare their drugs for them. in the current sample, importantly, women who shared equipment at either injection event were more likely to have had someone else prepare the drug those who used separate equipment tended to report that they prepared their own drug solution. the introduction of a new drug (ketamine) in unique forms (liquid and powder) could have increased the dependence on others. in several accounts of the first injection of ketamine, women said they did not witness the preparation of the drug, but they were willing to be injected with syringes prepared for them by others. not seeing or having control over the preparation of one 's drugs may dramatically increase the potential for cross - contamination and infection with hiv and/or hcv. research suggests that many young people have others inject them for the first time, which was supported by our findings. after the first injection, most women learned to inject themselves, a step that vastly increases women 's control over not only the sterility of the injection, but also over when and how much they inject. at the first ketamine injection, women who self - injected tended to inject intravenously, a mode with which they were already familiar, versus those who injected intramuscularly and required assistance. nonetheless, at the first ketamine injection a substantial proportion (20%) still required or preferred that someone else inject them. requiring help injecting or having someone else perform therefore, the remaining women who continued not to inject themselves are likely at increased risk of infection for as long as they continue to have someone else perform their injections. this situation also reinforces their dependence on their drug - using partners and may elevate risk for drug overdose since they are not in control of the dosage of drugs. there were few reports of knowingly injecting with previously used syringes, and women commonly indicated that they knew that the use of previously used syringes was risky. the low frequency of reported syringe sharing could indicate a reporting bias induced by social desirability. however, it is also possible that this population of young injectors has grown up and begun injecting in an era of intense hiv and hcv prevention efforts, and therefore they actually have minimized syringe sharing, a phenomenon that has been reported elsewhere [13, 36 ]. a full 97% of women reported receiving at least one hiv test and 90% reported having had an hcv test in their lifetime, where they likely received some risk reduction counseling. importantly, however, reports of sharing other injection paraphernalia (cookers, cotton, or ketamine vials) were frequent, a trend that has been identified as an independent risk for bloodborne pathogens. our findings also suggest that it is possible that women had unknowingly used contaminated injection equipment. additionally, few women had a thorough understanding of the dynamics of cross - contamination. therefore, a lack of known sharing events may not reflect the use of new, sterile equipment for every injection. due to the small sample size and nonrandom sampling techniques, it is difficult to know whether our findings are generalizable to the larger population of female idus. reports of stigmatized behaviors such as syringe sharing may be subject to socially desirable reporting, and so the proportion of shared syringes may be under reported. the risk associated with shared paraphernalia in the current study may be overestimated ; while we report that a large proportion of respondents shared some paraphernalia, in many accounts it was unclear whether the shared equipment was new at the time it was shared, or if it was previously used. reports are also subject to recall bias, particularly given that, in some cases, several years had elapsed since the injection event. due to the design of the study, participants reported a wide range of time elapsed between their first injection and their first injection of ketamine. future research that systematically investigates these differences is needed. finally, it is unknown whether the behavior reported at the first injection of ketamine is unique to the drug, or whether it can be generalized to injection initiation with other substances. more investigation into the initiation of new substances among idus is warranted, and such investigations would benefit from longitudinal designs that are able to observe trajectories of drug use as they occur. a strength of the current study is that it is one of the few investigations to focus on the unique risks faced by young female idus, see also [4, 33, 35 ], and that we were able to obtain reports of two injection events separated by an average of two years, which allowed us to examine the evolution of injection behaviors over time. the majority of existing investigations into the role of sex differences in injection - related risk have been conducted with significantly older populations [9, 11, 3739 ], within which the dynamics of social relationships and habitual patterns drug use may be more established and differ from those of young women. the current analysis contributes to the growing body of literature that acknowledges the social nature of women 's drug use and the unique challenges faced by female idus. our findings describe features of injection events in which women 's lack of control may elevate their risk for infectious disease and suggest that these phenomena should be considered together as a behavioral risk factor, in addition to traditional indicators such as syringe and paraphernalia sharing. current public health recommendations indicate that the most effective means of limiting hiv transmission among idus is the once - only use of sterile injection equipment. given the limited availability of injection equipment and clandestine nature of injection drug use, however, women take steps to reduce their risk for infectious disease in a less predictable environment that is contextualized by their social and intimate relationships. by understanding the dynamics of power and control over women 's drug injection behavior within the social context, the current study has identified windows of opportunity to reduce the harm associated with drug injection. hiv and hcv prevention interventions tailored to address areas where women lack control over important aspects of their drug use, particularly the preparation of the drug and its injection, are an important next step in reducing hiv and hcv infections in this population. our findings suggest that the spontaneous nature of injection events, and a lack of control over drug and syringe acquisition, preparation, and injection may elevate young women 's risk for infectious disease. additionally, interventions that focus on the mechanisms of cross - contamination are needed to assist young idus in making educated decisions about how and with whom they share drugs, particularly when they are confronted with new drugs or drugs in new forms.	young female injection drug users (idus) are at risk for hiv / hcv, and initiating the use of a new drug may confer additional and unexpected risks. while gender differences in the social context of injection drug use have been identified, it is unknown whether those differences persist during the initiation of a new drug. this mixed - methods study examined the accounts of 30 young female idus in los angeles, ca, usa from 2004 to 2006, who described the social context of initiating injection drug use and initiating ketamine injection. the analysis aimed to understand how the social context of young women 's injection events contributes to hiv / hcv risk. women 's initiation into ketamine injection occurred approximately 2 years after their first injection of any drug. over that time, women experienced changes in some aspects of the social context of drug injection, including the size and composition of the using group. a significant proportion of women described injection events characterized by a lack of control over the acquisition, preparation, and injection of drugs, as well as reliance on friends and sexual partners. findings suggest that lack of control over drug acquisition, preparation, and injection may elevate women 's risk ; these phenomena should be considered as a behavioral risk factor when designing interventions.
endothelial - overexpressed lipopolysaccharide - associated factor 1 (eola1, genbank number 074889, also named as cxorf40a) has been identified by our research group from the genes with differential expression after stimulation of ecv304 cells with lipopolysaccharide (lps) in 2004 [1, 2 ] ; however its biological function is less understood. eola1 is located at human chromosome xq28 and contains 6,248 bases in genomics and 5 exons separated by 4 introns. the eola1 gene is highly conserved in chimpanzee, rhesus monkey, dog, mouse, rat, chicken, zebrafish, and frog. eola1 protein comprises 158 amino acids and has several glycosylation and phosphorylation sites and the helix - turn - helix motif without signal peptide and membrane spanning domain. these structural features indicate that eola1 is an intracellular protein and may interact with other unknown proteins in the cytoplasm and nucleus to regulate cell function. the bioinformatics analysis reviewed that eola1 gene belongs to the activating signal cointegrator-1 (asc-1) homology (asch) superfamily, which is frequently observed in many organisms [3, 4 ]. eola1 is weakly expressed under the steady condition and highly expressed in response to lps in ecv304 cells. the discovery of the protein association between eola1 and metallothionein 2a (mt2a) has been confirmed by yeast double - hybridization and coimmunoprecipitation assay [2, 5 ]. mt2a is known to have anti - inflammatory, antiendotoxin, and tumor - inhibiting effects in cell cultures [6, 7 ]. in addition, mt2a inhibits cell growth through the induction of apoptosis and g2/m arrest, which negatively regulates nf-b pathway by upregulation of ib- and downregulation of p - ib- and cyclin d1. based on a rat liver transplantation model these results suggest a possible role of eola1 in transmitting inflammation - related signals through association with mt2a and thus participating the regulation of inflammatory response in endothelial cells. lps is the major outer surface membrane component present in almost all gram - negative bacteria and acts as ligand in triggering innate immune response via specific receptors in diverse eukaryotic species ranging from insects to humans [10, 11 ]. the induction of vascular cell adhesion molecule-1 (vcam-1) is the hallmark of activated vascular endothelial cell. vcam-1 belongs to the immunoglobulin superfamily, regulates leukocyte recruitment and immune response to sites of inflammation, and accelerates the development of atherosclerosis [13, 14 ]. lps is also known to induce inflammatory immune response at least in part via the upregulation of vcam-1 expression in vascular endothelial cells. to further understand the biological function of eola1 in regulating inflammatory immune response, we focused on determining the subcellular distribution of eola1 and its efficacy in the regulation of lps - induced inflammatory gene response including vcam-1 in ecv304 cells. purified native lps phenol extracted from e. coli serotype 0111 : the b4 (sigma) was dissolved in phosphate - buffered saline (pbs) to the dilution of 1 mg / ml and stored at 20c. for experiments, the lps stock solution was further diluted into supplemented tissue culture media to the working concentration of 100 ng / ml. ecv304 cells (atcc) were cultured in medium 199 supplemented with 10% fetal bovine serum, 3 mg / ml hepes, 100 u / ml penicillin g, 100 mg / ml streptomycin, and 6 u / l insulin on gelatin coated dishes in a humidified atmosphere of 5% co2. confluent cultures were detached with edta - trypsin solution and split into 1 : 3 for further use. a pair of primers was synthesized according to the open reading frame (orf) sequence of eola1 (forward primer : 5-accaggatcctctcttcatgcccaaag-3, reverse primer : 5-agcaggatcctctcttcatgccccaaag-3) ; ecor i and bamh i endonuclease sites were introduced into the terminals of forward and reverse primers, respectively. ecv304 cells were stimulated with lps (100 ng / ml) for 6 h, and then the total rna was extracted for rt - pcr (takara), and finally the orf sequence of eola1 was amplified. the pcr product and pegfp - n2 plasmid (clontech) were cut with endonucleases ecor i and bamh i, then the enzyme cutting products were recovered by electrophoresis and linked with dna ligase (takara), and finally the target orf sequence was inserted into pegfp - n2 plasmid and single colonies were selected for sequencing (takara) after transformation of competent escherichia coli dh5. for cell transfection, ecv304 cells were split onto 6-well culture plate (precovered with a sterile coverslip) by 1.5 10/well and continually cultured. then, the fusion protein expression plasmid pegfp - eola1 and the control plasmid pegfp - n2 were transfected into cells using the liposome lipofectamine 2000 (invitrogen) for 48 h. the transfection efficiency was determined by gfp positive versus negative cells. after cell transfection for 48 h, the culture medium was removed, and then the cells were rinsed twice with pbs and fixed with 4% pfa. a part of cells was used to examine the subcellular location ; the cells were incubated with rat anti - gfp antibody (primary antibody) and goat anti - rat antibody (secondary antibody), stained with dapi, and photographed under lsm510 meta laser confocal microscope (zeiss). for observation under immunoelectron microscope, the cells were fixed with 4% pfa and then oxidized with 3% hydrogen dioxide and incubated with serum. the incubation was performed with the previously prepared rabbit anti - eola1 polyclonal antibody as primary antibody and hrp - labeled goat anti - rabbit igg antibody as secondary antibody. then the cells were stained with hrp - labeled streptoantibiotin and diaminobenzidine (dab), refixed with 2.5% glutaral and fixed with 0.1% osmic acid, dehydrated with acetone at a gradient, and then preserved overnight in the saturated uranyl acetate prepared with 70% acetone. the cells were further rinsed with pure acetone, soaked with the mixture of acetone and epoxy resin (v : v = 1 : 1), treated with pure embedding medium (without epoxy resin curing promoter dmp-30) and embedding medium (with dmp-30) at 40c, and embedded with epoxy resin 618. finally the cells were made into ultrathin sections, stained with lead, and observed and photographed under tecna110 transmission electron microscope (philips). the oligonucleotide sequences of eola1 shrna (small hairpin rna) were as follows : sense : 5-aggaggcaaggatgtattcttcaagagagaatacatccttgttttttt-3 and antisense : 5-aattaaaaaaaggaggcaaggatgtattctctcttgaagaatacatccttgcctcctggcc-3. for knockdown of mt2a, the oligonucleotide sequences of mt2a - shrna were as follows : sense : 5-gatccgccgtg accgtttgctatatttcaagagaatatagcaaacggtcacggttttttggaaa-3 and antisense : 5-agctttccaaaaaaccgtgaccgtttgctatattctcttgaaatatagcaaacggtcacggcg-3. the shrna expression cassette driven by h1 promoter was engineered by inserting those oligonucleotides into the plasmid psilencer 3.1/h1 hygro (ambion). the cells were transfected with ph1, ph1-eola1 shrna, or ph1-mt2a shrna with lipofectamine 2000 in serum - free opti - memi (invitrogen) according to the instruction manual. the concentration of dna vectors for transfection was 8 g / ml in a final volume of 500 l. the cells were washed after 4 h incubation and resuspended in complete growth medium with serum for further experiments. the total rna was isolated from the cells using trizol reagent following the manufacturer 's instructions (invitrogen). to measure the gene mrna expression level, rt - pcr the primers are synthesized from commensal (eola1 upstream : 5-gctcgaattcatgaagtttggctgcctctc-3, downstream : 5-agcaggatcctctcttcatgccccaaag-3 ; -actin : upstream : 5-cgggaaatcgtgcgtgacatt-3, downstream : 5-ctagaagcatttgcggtggac-3). for vcam-1 assay, the cells were homogenized in pbs (1 : 2, w / v) containing 1% protease inhibitors and then centrifuged at 12,000 g for 20 min at 4c. the anti - eola1 polyclonal antibody was produced from new zealand white rabbits immunization and identified by western blot. the supernatants were analyzed using elisa kit (sigma) according to the manufacturer 's instructions. transfected cells were lysed with ripa buffer supplemented with complete protease inhibitor tablets (roche). the protein samples (30 g) were loaded on sds-9% polyacrylamide gels and then transferred to protan nitrocellulose membranes in an electroblotting apparatus, using standard procedures. immunodetection was performed as described previously by using anti - eola1, anti - mt2a, or anti - gfp as primary antibody and secondary antibody ig - horseradish peroxidase conjugate (invitrogen), anti--actin as loading control. the anti - eola1 polyclonal antibody was produced from new zealand white rabbits immunization and identified by western blot. student 's t - test was performed to determine the statistical significance for the assays of elisa ; p < 0.05 was considered statistically significant. ecv304 cells were transfected with pegfp - eola1 fusion protein expression plasmid and the control of pegfp - n2 plasmid for 48 h. the images were observed under laser confocal microscope. ecv304 cells transfected with either control plasmid or fusion protein expression plasmid demonstrated uniform whole - cell distribution by green fluorescence, while the cells transfected with fusion protein expression plasmid also had nuclear aggregation (figures 1(a) and 1(b)). with the prepared rabbit anti - eola1 polyclonal antibody as primary antibody, there was no immunological precipitate in the cells transfected with control plasmid, but significantly immunological precipitates were deposited in the cytoplasmic ground substance of cells transfected with fusion protein expression plasmid (figure 1(c)). ecv304 cells were grown to 80% confluence and then stimulated with lps (100 ng / ml) for a time - course as indicated. the cells showed that eola1 expression was increased in a time - dependent manner at both gene transcription (figure 2(a)) and translation (figure 2(b)). exposure of the cells to lps (100 ng / ml) resulted in significant increase of vcam-1 production after 3 h (p < 0.05) (figure 2(c)). all the data were repeated by three independent experiments. to further characterize the functional effects of eola1 on vcam-1 induction in ecv304 cells, the cells were cotransfected with poprsvi - eola1-egfp and pcmv - laci plasmids to stably overexpress eola1 after induction by iptg (figure 3(a)). the cells with overexpression of eola1 were treated with lps (100 ng / ml) after adding iptg for 48 h. the vcam-1 protein production in cell supernatant was detected by elisa assay in 6 h after lps treatment. the results show that lps significantly induces vcam-1 protein secretion, and overexpression of eola1 reduces the vcam-1 protein level induced by lps in ecv304 cells (figure 3(b)). to further investigate the efficacy of eola1 on lps - induced vcam-1 production a significant downregulation of eola1 expression was confirmed in eola1 shrna transfected cells by western blot. knockdown eola1 resulted in the enhancement of lps - induced vcam-1 protein secretion (figure 4(b)). eola1 has an association with mt2a in ecv304 cells, and eola1 regulates the expression of mt2a, suggesting eola1 mediates vcam-1 production through association with mt2a. mt2a knockdown cells were treated with lps, and the cell supernatant of vcam-1 was measured by elisa assay in 6 h after lps treatment. the results show that knockdown mt2a downregulates lps - induced vcam-1 protein secretion in ecv304 cells (figure 5). eola1 is a novel gene firstly identified by our research group from the screening of lps - induced gene expression in ecv304 cells ; however, little is known about its biological function in inflammation. to understand the subcellular distribution of eola1, we directionally cloned the orf sequence of eola1 into pegfp - n2 carrier and thus successfully constructed the eukaryotic expression plasmid of egfp - eola1 fusion protein to transfect ecv304 cells. the dapi staining confirmed that the fusion protein was expressed in the cytoplasm and aggregated in the nucleus. besides, we further observed the subcellular localization of eola1 at a level of cell ultrastructure by the use of immunoelectron microscopic enzyme labeling technique, and the results confirm that the expression of eola1 is mostly localized in the cytoplasm. the above observations indicate that eola1 is an intracellular protein and has a capacity to translocate into the nucleus from the cytoplasm, although such phenomenon still needs to be further confirmed in the future. ecv304 cells belong to human umbilical vein endothelial cells, which can be activated by lps stimulation. lps has been shown to initiate tlr4 mediated intracellular signaling events, including the activation of nf-b, which ultimately leads to the transcription and release of vcam-1 in endothelial cells to attract mononuclear macrophage accumulation for inflammatory response [15, 16 ]. recent study also showed that lps - induced vcam-1 expression contributes to the initiation of the atherosclerotic process [17, 18 ]. our experiments showed that lps induces eola1 expression along with vcam-1 induction, overexpression of eola1 reduces the lps - induced production of vcam-1 in ecv304 cells, and depletion of eola1 significantly enhances the lps - induced production of vcam-1. our results suggest that eola1 regulates the degree of endothelial cell activation by lps and possibly negatively regulates the inflammatory immune response. mt2a is a low - molecular - weight protein in the cytoplasm, plays multiple roles in cell metabolism, and has the effects on anti - inflammation and antiendotoxin and inhibiting tumor growth. recent report indicates that mt2a reduces cell inflammatory response by inhibiting the activation of nf-b, through upregulating ib-. our results show that eola1 regulates the expression of mt2a and affects the production of vcam-1 by association with mt2a ; therefore the excessive activation of ecv304 cells could be avoided, and the fine regulation and timely control of inflammatory reaction could be thereby achieved. the detailed mechanism of eola1 association with mt2a and its functional effects on the nf-b signaling pathway needs to be further characterized. in conclusion, eola1 plays a negative regulatory role in lps - induced vcam-1 expression under the association with mt2a in ecv304 cells.	our research group firstly discovered endothelial - overexpressed lipopolysaccharide - associated factor 1 (eola1, genbank number ay074889) as a lipopolysaccharide (lps) responsive gene in ecv304 cells. the previous studies have further demonstrated the association of eola1 with metallothionein 2a (mt2a), while the role of eola1 during lps - induced inflammatory response in ecv304 cells is unknown. in this report, we determined the subcellular localization of eola1 and the regulatory capacity of eola1 on vascular cell adhesion molecule-1 (vcam-1) in response to lps in ecv304 cells. our results show that eola1 is broadly diffuse in the cells, and eola1 expression is dramatically induced by lps. eola1 knockdown results in significant enhancement of lps - induced vcam-1 production. consistent with this, overexpression of eola1 leads to the reduction of lps - induced vcam-1 production. furthermore, mt2a knockdown reduces lps - induced vcam-1 production. collectively, our results demonstrate a negative regulatory role of eola1 on lps - induced vcam-1 expression involving its association with mt2a in ecv304 cells.
dye - sensitized solar cell (dssc) is a photovoltaic technology developed by o'regan and grtzel in 1991, also known as grtzel cell. dssc is designed based on light harvesting by a sensitizing dye attached to the nanostructured semiconductor. using inorganic dyes as sensitizers had shown great potential for dssc [13 ]. study of dssc using ruthenium - based complex as dye sensitizer and zn - porphyrin (dye sensitizer) with a co - based electrolyte achieved maximum efficiencies of 11.5% and 12.3%, respectively. however, due to the presence of heavy metal complexes, it poses an issue for the environment. anthocyanin, chlorophyll, tannin, and carotene, extracted from various plants, fruits, flowers, and leaves, have been successfully used as sensitizers in dsscs [2, 3 ]. however, natural dyes as sensitizers showed quite poor performance and instabilities in dssc. one approach in optimizing the efficiency of dsscs is by making cocktail dye (mixing two or more dyes) to increase the absorption spectrum of the dyes [7, 8 ]. mixed dyes, containing anthocyanin and betalains, had shown overall solar energy conversion efficiency of around 2%. natural dyes are relatively easy to obtain and extract from plants, reducing the cost manufacturing of dssc, as opposed to the production of synthetic dyes. although the currently most efficient grtzel cell is still less efficient than the standard conventional solar cell, due to the light absorption mechanism of the natural dyes, dsscs function even in low - light conditions. anthocyanins are natural components that are responsible for the red - purple color of fruits, flowers, and leaves of plants. they may also present in other plant tissues such as roots, tubers, and stems [2, 3 ]. they absorb light in the range of 520550 nm wavelength and are ph dependent, usually red in color in an acidic medium but turning into blue in less acidic condition. several factors such as light, temperature, and ph can destabilize the anthocyanin molecular structure. zeta - potential (surface charge), sizes of aggregated dye molecules, ph, and conductivity can be used to determine the stability of anthocyanin. in this study, the performance of a common group of natural dyes abundant in flowers and fruits, namely, anthocyanin, is evaluated in dsscs. the natural dyes used in this study were obtained from petals of dark red colored ixora sp. (coded as ix) and purple lower epidermal leaves of tradescantia sp. ixora coccinea (rubiaceae), also known as flame of wood, is usually grown as ornamental. it is a shrub notable for its bright colored flowers, which are composed of many small blooms massed together into dense, flat - topped flower heads. tradescantia spathacea is an herbaceous plant that is commercially grown for bedding and rock garden. t. spathacea is a plant that adapts to low - light environment and can grow in both shade and exposed light environment. this paper describes the use of these two natural anthocyanin dyes from both plants as cocktail dye in dssc. cocktail dye is made by mixing two or more natural dyes together, with the aim of improving the range of absorption of light in the visible region and thus of improving the overall efficiency. the effect of different volume - to - volume ratio concentrations on the photoelectric conversion efficiency of dye - sensitized solar cells is determined. petals of i. coccinea and lower epidermal leaves of t. spathacea were harvested to extract natural anthocyanin dyes. 25 g of petals of i. coccinea and lower epidermal leaves of t. spathacea was ground with 50 ml of 70% ethanol and stored overnight in the refrigerator at 4c. on the following day subsequently, the extracts were centrifuged at 4500 rpm using a denley bs400 (uk) centrifuge machine for five minutes to separate any remaining residues. the next step was to purify the sample using petroleum ether to separate polar and nonpolar components of the extracted dyes. for t. spathacea the extract was placed in a 4550c water bath after grinding to dissolve more pigments into the extracting solvent and then kept in a refrigerator at 4c. during the purification step, petroleum ether was first used and then diethyl ether to remove remaining impurities because it is more nonpolar than petroleum ether. the purified samples were then stored in a reagent bottle at 4c for further study. the anthocyanin dyes extracted from t. spathacea (trant) and i. coccinea (ix) were mixed at different v / v ratios to make five cocktail dye mixtures. for example, 1 ml of trant was mixed with 4 ml of ix to make a cocktail dye 1 : 4 (v / v). the same method was used to prepare trant / ix cocktail dyes of ratios 2 : 3 (v / v), 1 : 1 (v / v), 3 : 2 (v / v), and 4 : 1 (v / v). the content of anthocyanin presence in the dye extract was determined using the formula described by giusti and wrolstad based on the known fact that anthocyanin is ph dependent. two dilutions of each cocktail dye were prepared before absorbance reading, one with potassium chloride buffer (0.025 m, ph 1.0) and the other with sodium acetate buffer (0.4 m, ph 4.5). the absorbance was read at 520 nm and 700 nm against a blank cell containing 70% of ethanol using uv - vis spectrophotometer (shimadzu uv-1800, japan). the monomeric anthocyanin pigment content in the original sample was calculated according to the following formula : (1)anthocyanin pigment content = amwdf103l, where a = (a520 nm a700 nm) at ph 1.0 (a520 nm a700 nm) at ph 4.5, mw (molecular weight) is 449.2 g / mol for cyaniding-3-glucoside, df is dilution factor, 10 is factor for conversion from g to mg, is 26900 l mol cm, and l is the assumed path length of incident light in cm. presence of anthocyanin pigments was determined by measuring their absorbance spectra using uv - vis spectrophotometer (shimadzu uv-1800, japan). the zeta - potential and zetasizer of the individual dyes and cocktail mixtures were measured using malvern zetasizer (nano man 0317) at a temperature of 25c in 70% of ethanol solution. each measurement was repeated thrice to confirm the accuracy of readings. a conductive glass (fto) containing sintered tio2 was prepared as the photoanode. the photoelectrodes (anodes) were fabricated using a tio2 paste solaronix (nanoxide - t, colloidal anatase particles size : ~13 nm, ~120 m g (bet), switzerland). the tio2 was coated on precleaned fluorine - doped conducting tin oxide (fto) glasses (nippon sheet glass ~7 sq) by doctor blade method. electrodes were preheated (~50c) using a hair dryer and sintered at 450c for 30 minutes. the thickness of the tio2 electrodes used for this investigation was ~9 m (scanning electron microscope, sem). the anodes were dipped in respective dye solutions (trant, ix, and the cocktail dyes) as the photosensitizers. these were left submerged approximately for 16 hours at room temperature in the dark to avoid light exposure. electrolyte, containing tetrabutylammonium iodide (tbai, 0.5 m)/i2 (0.05 m), in a mixture of acetonitrile and ethylene carbonate (6 : 4, v / v), was then introduced between the dyed tio2 electrode and platinum counter electrode. these dsscs were placed under irradiation of light (100 mw / cm) using sun simulator (dyesol) for about 4 hours for better incorporation of electrolyte into the tio2 layer. the performance of the cell in terms of energy conversion efficiency () was evaluated by using relation of short - circuit current (isc), open - circuit voltage (voc), and fill factor (ff) as shown below : (2)=ffiscvocp, where isc is the short - circuit photocurrent density (a cm), voc is the open - circuit voltage (v), p is the intensity of the incident light (w cm), and ff is the fill factor defined as ff = imvm / iscvoc, in which i m and vm are the optimum photocurrent and voltage that can be extracted from the maximum power calculated from the i - v data. a cocktail dye mixture that showed higher conversion efficiency was selected for further evaluation on the impacts of varying temperature regimes for anthocyanin storage. the extracts were stored in enclosed glass bottles to avoid exposure to light at three different storage temperatures 20c, 4c, and 25c. in order to determine the anthocyanin contents, the spectroscopic absorbance of the extracts was initially determined for three consecutive days followed by weekly measurements over a period of one month followed by a final measurement after a 2-month period. kinetic parameters of anthocyanin degradation were calculated using the following formulae : (3)lnctc0=kt, t1/2=ln0.5k, where c0 is initial anthocyanin content and ct anthocyanin content after t - minute storage at the given temperature. the presence of anthocyanin dyes was confirmed using uv - visible spectrophotometer, where peaks at 525 nm and 540 nm after acidification of ix and trant dyes, respectively, indicate the presence of anthocyanidin (see figure 2). acids remove the sugar component, which converts anthocyanin into anthocyanidin that give absorption spectra peaks in the region of 490~570 nm. the three distinct peaks at 511 nm, 548 nm, and 588 nm of the trant curve suggested that the extracts might as well contain chlorophylls, which is absorbed most strongly in the blue and red regions of the absorption spectra. figure 3(a) shows the absorption spectra for five cocktail dye mixtures before the adsorption of dyes onto the tio2 paste. the figure shows the maximum absorption peak for all cocktail dye mixtures at 550 nm, and for the cocktail mixture, the absorption range varies within 490~650 nm. figure 3(b) shows the absorption spectra for five cocktail dye mixtures after adsorption onto the tio2 paste. results show that the cocktail dyes after adsorption onto tio2 paste have increased the range of the absorption wavelength and have allowed further absorption of more visible light. the highest absorbance readings were from cocktail mixture trant / ix 1 : 4, which contains more ix, while the lowest absorbance readings were from cocktail mixture trant / ix 4 : 1, which had the lowest concentration of ix among the mixtures. this shows that tio2 dyed with ix might have better absorption capability compared to tio2 dyed with trant, and this can be attributed to its homogeneous adsorption onto the tio2 surface that increases the absorption of light in the visible region. experimental results showed that average zeta - potentials of anthocyanin extracted from ix, trant, and the cocktail mixtures prepared using different ratios of these pigment extracts occurred between 0.4 mv and 0.9 mv (figure 4(a)). this value indicates a high possibility for all tested anthocyanin dyes undergoing molecular aggregations and showing increased instability of colloids. this is because the least stable colloidal systems have no force to repel molecule that can cause high charge transfer resistance that in turn hinders the electron injection efficiency during the i - v performance [26, 27 ]. the aggregation could also result in poor physical contacts between the anthocyanins pigment and the tio2 layer, which causes desorption of dyes from the tio2 layer. as depicted in figure 4(b), the average size of aggregated dye molecules of trant is 34 900 nm while ix dyes reached a dimension of 2810 nm. however, all the cocktail dyes had average sizes in the range of 2500 to 5120 nm, approximately 6 to 7 times lower when compared to the individual pigment of anthocyanins extracted from t. spathacea. the small aggregated sizes indicate an increase in the surface area and thus, a large amount of the dyes can adsorb onto the tio2. this resulted in the increased absorption by the dyes as shown in the absorption spectra of ix and cocktail mixtures of figures 3(a) and 3(b) and increased efficiencies of dssc prepared by cocktail dye mixtures (see table 1). hwang. have reported that the photocurrent densities increase with higher adsorption of dyes that may in turn give superior characters to dsscs owing to the low charge transfer resistance from the monolayer adsorption. figure 5 and table 1 show the photoelectrical parameters for a dssc that is sensitized using five cocktail dye mixtures from anthocyanins pigment extracted from lower epidermis of t. spathacea leaves and i. coccinea flowers. this is attributed to better absorption intensity, and the absorption wavelength range is broader than in those individual dyes ' extract only (figure 3)., who also studied the performance of cocktail dye in dssc, where sensitized cocktail dye has exhibited better result than individual dye alone. it is also evident that the short - circuit current or the open - circuit voltage of dssc sensitized by the individual dyes is lower than that sensitized by the cocktail dyes. therefore, the efficiencies of photoelectric conversion of dssc sensitized by the cocktail dyes are higher than the individual dye (trant and ix) constituents. dssc sensitized with cocktail dye ratio 1 : 4 (v / v) produces the highest i - v performance with = 0.80% with open - circuit voltage (voc) of 0.343 v, current density (jsc) of 4.185 ma / cm, and fill factor of 0.499, under the irradiance of 100 mw cm. this might be due to the lower concentration of trant to ix in the cocktail dye ratio 1 : 4 (v / v). ix better performance than trant in dssc might be because anthocyanin of i. coccinea favors a monolayer adsorption, which optimizes the dssc efficiency [29, 31 ], and homogeneous adsorption on the tio2 surface. stability of the anthocyanin pigment in the cocktail dye mixture trant / ix 1 : 4 was relatively high when they were stored at 20c and 4c but decreased progressively when pigments were stored at 25c over a two - month period (see table 2 and figure 6). the cocktail mixture was shown to be most stable when stored at 20c with a percentage loss of 2.53%, followed by the storage at 4c (4.72%) and 25c (28.20%), respectively. the degradation rates are represented by half - life (t1/2) values ; the higher the half - life value, the slower the degradation rate. the highest half - life period (1727.05 days) was recorded from anthocyanin pigments which was in the cocktail dye mixture trant / ix 1 : 4 stored at 20c. the half - life was reduced to 133.88 days, when it was stored at 25c over a period of two months. previous study of pigments from melastoma malabathricum, hibiscus rosa - sinensis, and codiaeum variegatum stored at 20c showed t1/2 values of 539.13, 336.37, and 405.72 days, respectively. the t1/2 values of those pigments which were stored at 25c were markedly reduced to 110.71, 219.74, and 254.25 days, respectively. krca and cemerolu also have suggested that the lowest storage temperature should be used where possible to minimize the anthocyanin degradation. this is in line with our observations where the most stable anthocyanin extracts of cocktail dyes have been obtained when they had been stored at 20c over a period of two months. five cocktail mixtures (different v / v ratios) of dyes extracted from ixora coccinea (ix) flower petals and tradescantia spathacea (trant) lower epidermal peels were assessed as potential candidates to increase the efficiency in dsscs. the aggregated molecule sizes were determined (between 2500 and 5120 nm) in cocktail dyes. smaller sized aggregated dye molecules aid in the adsorption of dyes onto the tio2 layer of dssc. cocktail dyes exhibited higher conversion efficiencies than the pigments extracted from ix flowers and trant leaves individually. best overall energy conversion efficiency (= 0.80%) was obtained from the dssc sensitized with the cocktail prepared in the trant / ix ratio 1 : 4 (v / v). modifications of cocktail dyes as reported here will further enhance the stability of zeta - potential to further increase the affinity of the dyes onto tio2 nanocrystalline thin films. although the solar - to - electrical energy conversion efficiencies recorded here were lower than those measured for silicon based solar cells, our dssc developed with a cocktail dye mixture prepared using two tropical plant sources shows promising potential for further improvements in relation to its efficiency, stability, and commercialization.	the use of anthocyanin dyes extracted from epidermal leaves of tradescantia spathacea (trant) and petals of ixora coccinea (ix) was evaluated in the application of dye - sensitized solar cells (dsscs). subsequently, cocktail anthocyanin dyes from these dyes were prepared and how they enhanced the cell 's overall performance was assessed using five different volume - to - volume ratios. cocktail dyes absorbed a wider range of light in the visible region, thus increasing the cell efficiencies of the cocktail dyes when compared to the dssc sensitized by individual dyes. the surface charge (zeta - potential), average size of aggregated anthocyanin molecules (zetasizer), and anthocyanin stability in different storage temperatures were analyzed and recorded. lower size of aggregated dye molecules as revealed from the cocktail dyes ensured better adsorption onto the tio2 film. tradescantia / ixora pigments mixed in 1 : 4 ratio showed the highest cell efficiency of = 0.80%, under the irradiance of 100 mw cm2, with a short - circuit current density 4.185 ma / cm2, open - circuit voltage of 0.346 v, and fill factor of 0.499. it was found that the desired storage temperature for these cocktail dyes to be stable over time was 20c, in which the anthocyanin half - life was about approximately 1727 days.
new monoclonal antibodies (mabs) targeting the immune checkpoint blockade have revolutionized the treatment of advanced melanoma patients. although these novel mab therapies can induce remarkable antitumor - specific immune responses, they have distinct side effects as compared with chemotherapy, including nonspecific immunological activation.1 to our knowledge, we report the first case of organizing pneumonia (op) in a melanoma patient under immunotherapy with pembrolizumab, a pd-1 targeting mab. a 64-year - old woman presented to our emergency department with a 10-day history of progressive dyspnea and dry cough nonresolving after a 9-day course of oral antibiotics (levofloxacin 750 mg daily). she had been diagnosed with a c - kit / braf wild - type, stage iv mucosal melanoma of the nasal cavity with involvement of cervical and mediastinal lymph nodes and metastases to the liver, brain, and bones nine months earlier. initial treatment included two cycles of dacarbazine 1000 mg / m and zoledronic acid 4 mg every three weeks. one month later, the patient experienced disease progression and was treated with four cycles of ipilimumab immunotherapy 3 mg / kg and zoledronic acid 4 mg q3 weeks intravenously (iv). three months later, the disease advanced further, and a second - line immunotherapeutic agent with pembrolizumab was initiated. thirteen days prior to her admission, she had received her fourth cycle of immunotherapy with pembrolizumab. her pretherapeutic thoracic ct scan was normal. on examination, she was pale and tachypneic. the chest auscultation revealed diffuse bilateral coarse crackles and areas of bronchial breathing mainly in the right middle lobe. her blood tests were normal except an erythrocyte sedimentation rate of 200 mm / hour, a white blood count of 10,970 cells/l (differential : 83.6% neutrophils, 9.7% lymphocytes, and 6.7% monocytes), and a c - reactive protein of 173 mg / l (normal value : 06 mg / l). a chest radiography demonstrated patchy alveolar infiltrates mainly on the right upper, the right middle, and the left upper lobe. an initial diagnosis of a lower respiratory tract infection was made, and antibiotics were commenced, including ceftriaxone 2 g / day iv and azithromycin 500 mg / day orally. subsequently, the patient underwent a high - resolution computed tomography (hrct) of the chest and fiberoptic bronchoscopy with bronchoalveolar lavage (bal). samples were submitted for staining and culture for bacteria, fungi, mycobacteria, and nocardia, special staining for pneumocystis jirovecii, cytology, immunophenotyping, and molecular testing for viral infection. the hrct demonstrated patchy consolidation with a predominantly subpleural and peribronchial distribution, small ill - defined peribronchiolar nodules, tree - in - bud sign, and reverse halo sign, involving all lobes mainly the lower ones (fig. the immunophenotyping of the bal lymphocytes by flow cytometry revealed macrophage and monocyte predominance (60.7%) with a lymphocyte count of 28.7% and a cd4+/cd8 + index of 0.4. based on the imaging and clinical and bal findings that were consistent with op, therapy with corticosteroids (prednisolone 50 mg / day iv) her c - reactive protein declined to 20 mg / l within two days of steroid treatment. the treating physician assessed that op represented a grade 3 adverse event,2 most probably related to treatment with pembrolizumab, which was discontinued. advanced melanoma has been a challenge in oncology as the five - year survival rates were immensely low with standard chemotherapy.3 newer mab therapies targeting the immune checkpoint, ipilimumab (yervoy ; bristol - myers squibb), nivolumab (opdivo ; bristol - myers squibb), and pembrolizumab (keytruda ; merck sharp & dohme corp) were shown to prolong progression free and overall survival compared with chemotherapy.4 pembrolizumab is a humanized igg4 mab raised against the programmed cell death protein 1 (pd-1) immune checkpoint, recently approved by the us food and drug administration and the european medicines agency for the treatment of advanced melanoma, as a result of a randomized controlled phase iii trial showing improved overall survival.5 pd-1 is a cell surface receptor that belongs to the immunoglobulin superfamily and is normally expressed on b - cells,6 t - cells,7 and macrophages.8 pd-1 and its ligands, namely, programmed cell death ligand 1 (pd - l1) and 2 (pd - l2), have been found to be abnormally expressed by tumor cells.9 these molecules play an important role in inhibiting antitumor immune responses and are responsible for the immune evasion of cancer cells by the cytotoxic effector immune cells. mab therapies against the pd-1 can reverse immune tolerance and achieve high tumor response rates and improvement of survival.10 the therapeutic effects of mabs are not fully understood, but they are mediated through direct signaling, complement - dependent cellular cytotoxicity, and antibody - dependent cellular cytotoxicity.11 pemprolizumab (previously known as mk-3475 or lambrolizumab) is a humanized monoclonal igg4kappa isotype antibody. its variable region sequences were derived from a very high - affinity mouse antihuman pd-1 antibody (dissociation constant, 28 pm) that was grafted into a human igg4 immunoglobulin with a stabilizing s228p fc alteration that does not engage fc receptors or activate complement, thus avoiding cytotoxic effects of the antibody when it binds to the pd-1 receptor of t - cells that are intended to activate against tumor cells.12 it is reasonable to assume that the mechanism of action and the resulting side effects of pembrolizumab are mediated through pd-1 direct signaling on t - cells or macrophages. cryptogenic organizing pneumonia (cop), the idiopathic form of op (formerly called bronchiolitis obliterans op), is a type of diffuse interstitial lung disease that affects the distal bronchioles, respiratory bronchioles, alveolar ducts, and alveolar walls. the primary area of injury is within the alveolar wall. since many cases of cop are secondary, it is more proper to use the term op associated with the name of the secondary cause.13 histopathologic study through lung biopsy via video - assisted thoracoscopic surgery or open thoracotomy is the optimal method for establishing the diagnosis of cop, in order to have enough tissue for the pathologist to exclude other processes. because of the low oxygen saturation level, we selected to combine the cytological profile of bal with characteristic clinical and imaging features. a previous study has already described in detail the cytological and immunocytological profile of bal in cop, which include foamy macrophages, mast cells, plasma cells, a decreased cd4/cd8 t - cell ratio, an increase in activated t - lymphocytes based on hla - dr or interleukin-2 receptor expression and a lymphocyte increase of 20%40% also documented in our patient with bronchiolitis obliterans. the most commonly occurring clinical findings in cop are similar to our patient s symptoms, including nonproductive persistent cough, dyspnea, and malaise without fever.14 since the most common manifestations are nonspecific, diagnosis is often delayed (613 weeks), and similar to our patient, a lack of response to empiric antibiotics for community - acquired pneumonia may be the initial clue to the presence of a noninfectious, inflammatory pneumonia.15 similar to that in our patient, hrct has findings that are characteristic for cop and include peripheral bilateral patchy opacities, more frequently in the periphery and in the lower lung zone, air bronchogram, and reverse halo sign.16 once the diagnosis of cop is made, rapid clinical and imaging improvement is obtained with corticosteroid treatment, but relapses are common after stopping treatment, indicating an established immune reaction requiring long - term therapy.15 when cop is suspected in cancer patients, differential diagnoses that need to be considered include disease progression, cardiogenic edema, radiation pneumonitis, allergies, pulmonary hemorrhage, and infections that cause diffuse interstitial infiltrates in the lungs such as gram - negative or gram - positive bacteria, fungi (aspergillus, candida, and p. jirovecii), parasites (toxoplasma gondii), or viruses (herpes simplex, varicella zoster, and cytomegalovirus).17 on the other hand, pneumonitis in cancer patients may hold a heterogeneous pathological background based on various antineoplastic agents including chemotherapy, such as taxanes, targeted therapy, such as everolimus, and mabs, such as rituximab, a chimeric igg1.17 in retrospective analysis of patients with non - hodgkin lymphoma treated with rituximab, 8 of 23 patients, diagnosed with cop and treated with corticosteroids, died, indicating that cop although rare may become a fatal pulmonary toxicity and the oncologists or internists must maintain a high index of suspicion to recognize this complication early. little is known regarding the clinicopathologic features of pneumonitis related to the novel immune checkpoint inhibitors. a recent study indicated the development of pneumonitis in three patients treated with nivolumab, an anti - pd-1 mab, 724.3 months after treatment initiation.18 two patients were radiographically found with acute interstitial pneumonia / acute respiratory distress syndrome, and one patient was with nonspecific interstitial pneumonia. two of these patients required admission in the intensive care unit, and one succumbed four weeks after diagnosis of pneumonitis. computed tomography findings differed from cop, and bal or transbronchial biopsy was not performed in these patients. another report involving a patient treated with nivolumab described an op diagnosed both radiographically and pathologically.19 similar to our case, ct of the chest showed the typical reversed halo sign and had a favorable response to corticosteroid therapy. with novel immunotherapies, the incidence of autoimmune phenomena is rising ; therefore, it is important to recognize an op early in any patient receiving anti - pd-1 and presenting with symptoms of new cough or shortness of breath. although the exact causative mechanism of op by anti - pd-1 mab therapy can not be established as yet, a t - cell or macrophage - driven effect is the most plausible explanation, and further studies are warranted to define the pathogenic mechanism underlying this possibly lethal side effect.	until recently, chemotherapy for metastatic melanoma had disappointing results. the identification of immune checkpoints such as ctla-4 and pd-1/pd - l1 has led to the development of an array of monoclonal antibodies (mabs). these immunologic approaches against tumoral cells come with a novel kind of side effects that the clinician needs to be familiarized with. herein, we report for the first time a case of organizing pneumonia, based on imaging and cytological analyses of bronchoalveolar lavage, possibly associated with the use of pembrolizumab, an anti - pd-1 mab recently approved for the treatment of metastatic melanoma.
hemifacial spasm (hfs) is a hyperactive cranial nerve dysfunction syndrome characterized by unilateral involuntary contractions of muscles innervated by the affected facial nerve. causes of hfs include blood vessel, tumor, and bony abnormality15). since campbell and keedy2) first described vascular arterial compression of the facial nerve among patients with hfs. the cause of this condition is thought to be mainly neurovascular compression of the facial nerve at its root exit zone (rez) from the brainstem13). therefore, microsurgical neurovascular decompression (mvd) is now widely performed as the most logical and curative treatment of hfs. in general, the offending vessels are the anterior inferior cerebellar artery (aica), posterior inferior cerebellar artery (pica), vertebral artery (va), or branches of these main arteries encountered during mvd. hfs caused by vertebrobasilar dolichoectasia (vbd), however, is quite rare30). the offending in cases of vbd is difficult to move during mvd due to its character of enlargement and elongation. we compared outcomes of mvd for hfs caused by vbd with the outcomes of non - vbd cases, and analyzed the complication occurrence rate in mvd for hfs related with vbd. al.28,29) reviewed normal high - resolution computed tomographic (ct) scans of 123 patients and defined the diameter, the height of the bifurcation, and the transverse position of the normal basilar artery. according to smoker 's criteria, we use the term elongation if the basilar artery, at any point throughout its course, lies in a lateral position to the margin of the clivus or dorsum sellae (position 2, 3) (table 1) or if the artery bifurcation lies above the plane of the suprasellar cistern (height 2, 3) (table 2). enlargement is diagnosed if the diameter of the basilar artery is greater than 4.5 mm. giang.9) reported that mri diagnosed vbd as well as ct, and it was proved to be superior to ct in delineating the anatomical relationship of the vessels to the neural structures. therefore, although smoker. defined the normal basilar artery based on data from ct imaging, we measured elongation and enlargement on time of flight magnetic resonance image (tof mri) and magnetic resonance angiography (mra). a total of 2,064 mvds for hfs were performed at our institution between september 1978 and september 2008. in six patients, hfs was not resulting from a blood vessel, and these patients were excluded from the current study. among the remaining 2058 cases with vascular compression, 2047 cases (99.5%) had non - vbd hfs, and 11 cases (0.5%) had hfs caused by vbd. the clinical outcomes and image findings of tof mri and mra of these 11 cases were analyzed. we retrospectively evaluated the available preoperative images from tof mri and mra, which were performed with a 1.5-tesla imaging system (signa ; ge medical systems, milwaukee, wi, usa). enlargement of the vertebrobasilar artery was measured on mra by picture archiving communication system (pacs ; ge medical systems, milwaukee, wi, usa) and diagnosed if the diameter of the basilar artery was greater than 4.5 mm. elongation was evaluated on tof mri and diagnosed in the case of position 2 or 3 or height 2 or 3 (table 1, 2). in all patients, exposure and dissection were performed using standard surgical techniques for microvascular decompression procedures with the lateral decubitus position through a lateral retrosigmoid suboccipital craniectomy14,19). in patients with vbd dissection of the arachnoid membranes was carefully continued from the lower cranial nerves up to the petrosal vein to enhance the exposure and mobilization of the cerebellum. release of the vbd artery (va or ba) was meticulously obtained not only near the rez but also from the proximal portion to the distal for as great a distance as possible. in this way, the vbd artery was made to move easily, to allow complete decompression of the nerve, and stretching of the seventh and eighth cranial nerves was lessened during the insertion of teflon felt and balls to reposition the offending vessels. after the vessel was freed, teflon felt and balls were inserted in a step - by - step manner without retraction of the vessel. the first teflon was placed between the vessel and the nerve beside the compression site and was then gently pushed along the nerve toward the compression site. as second teflon was placed where the first was originally positioned, and this was repeated, until complete vascular decompression was achieved. the clinical data and intra - operative findings of the selected patients were reviewed retrospectively. after mvd, the patients were classified into the following five grades, on the basis of the degree of hfs present : 1) " excellent " if no hfs was present ; 2) " good " if the hfs was more than 90% resolved ; 3) " fair " if the hfs was more than 50% resolved ; 4) " poor " if the hfs was less than 50% resolved ; and 5) " failure " for all remaining results. outcomes of " excellent " and " good " were considered successful outcomes. clinical outcomes were evaluated immediately after the surgery and at outpatient visits during the subsequent follow - up period. comparisons between two groups (non - vbd vs. vbd) were tested for statistical significance with the fisher exact test. case no 3 (table 4) was excluded from statistical analysis, because it did not involve a dolichoectatic artery. all data analyses were performed with pasw statistics version 18.0 (spss inc., somers, ny, usa). al.28,29) reviewed normal high - resolution computed tomographic (ct) scans of 123 patients and defined the diameter, the height of the bifurcation, and the transverse position of the normal basilar artery. according to smoker 's criteria, we use the term elongation if the basilar artery, at any point throughout its course, lies in a lateral position to the margin of the clivus or dorsum sellae (position 2, 3) (table 1) or if the artery bifurcation lies above the plane of the suprasellar cistern (height 2, 3) (table 2). enlargement is diagnosed if the diameter of the basilar artery is greater than 4.5 mm. giang.9) reported that mri diagnosed vbd as well as ct, and it was proved to be superior to ct in delineating the anatomical relationship of the vessels to the neural structures. therefore, although smoker. defined the normal basilar artery based on data from ct imaging, we measured elongation and enlargement on time of flight magnetic resonance image (tof mri) and magnetic resonance angiography (mra). a total of 2,064 mvds for hfs were performed at our institution between september 1978 and september 2008. in six patients, hfs was not resulting from a blood vessel, and these patients were excluded from the current study. among the remaining 2058 cases with vascular compression, 2047 cases (99.5%) had non - vbd hfs, and 11 cases (0.5%) had hfs caused by vbd. the clinical outcomes and image findings of tof mri and mra of these 11 cases were analyzed. we retrospectively evaluated the available preoperative images from tof mri and mra, which were performed with a 1.5-tesla imaging system (signa ; ge medical systems, milwaukee, wi, usa). enlargement of the vertebrobasilar artery was measured on mra by picture archiving communication system (pacs ; ge medical systems, milwaukee, wi, usa) and diagnosed if the diameter of the basilar artery was greater than 4.5 mm. elongation was evaluated on tof mri and diagnosed in the case of position 2 or 3 or height 2 or 3 (table 1, 2). in all patients, exposure and dissection were performed using standard surgical techniques for microvascular decompression procedures with the lateral decubitus position through a lateral retrosigmoid suboccipital craniectomy14,19). in patients with vbd dissection of the arachnoid membranes was carefully continued from the lower cranial nerves up to the petrosal vein to enhance the exposure and mobilization of the cerebellum. release of the vbd artery (va or ba) was meticulously obtained not only near the rez but also from the proximal portion to the distal for as great a distance as possible. in this way, the vbd artery was made to move easily, to allow complete decompression of the nerve, and stretching of the seventh and eighth cranial nerves was lessened during the insertion of teflon felt and balls to reposition the offending vessels. after the vessel was freed, teflon felt and balls were inserted in a step - by - step manner without retraction of the vessel. the first teflon was placed between the vessel and the nerve beside the compression site and was then gently pushed along the nerve toward the compression site. as second teflon was placed where the first was originally positioned, and this was repeated, until complete vascular decompression was achieved. the clinical data and intra - operative findings of the selected patients were reviewed retrospectively. after mvd, the patients were classified into the following five grades, on the basis of the degree of hfs present : 1) " excellent " if no hfs was present ; 2) " good " if the hfs was more than 90% resolved ; 3) " fair " if the hfs was more than 50% resolved ; 4) " poor " if the hfs was less than 50% resolved ; and 5) " failure " for all remaining results. clinical outcomes were evaluated immediately after the surgery and at outpatient visits during the subsequent follow - up period. comparisons between two groups (non - vbd vs. vbd) were tested for statistical significance with the fisher exact test. case no 3 (table 4) was excluded from statistical analysis, because it did not involve a dolichoectatic artery. all data analyses were performed with pasw statistics version 18.0 (spss inc., somers, ny, usa). the clinical characteristics of 2,058 cases of hfs treated by mvd are summarized in table 3. the diameter, height, and transverse position of the basilar arteries of the vbd cases are presented in table 4. the mean diameter of the basilar arteries was 5.05 mm (range, 4.61 - 5.93 mm). offending vessels identified visually during surgery were 4 aica, 1 pica, 1 va, and 5 multiple artery. 1) had left - sided facial spasm. in all cases except one, the va or basilar artery (ba, case no 2) (fig. 2) affected neurovascular compression of the facial nerve directly or over the offending vessel. 3) had only the aica as the offending vessel, not related with va or ba compression. levels of successful outcomes were 93.1% in non - vbd and 90.9% in vbd, a difference which was not statistically significant (p=0.779) (table 5). postoperative complications related to facial nerve and cochlear nerve in non - vbd were noted in 24.7% (permanent in 2.4%) these complications included facial palsy in 18.5% (permanent in 0.9%) and hearing impairment in 6.1% (permanent in 1.5%). however, the postoperative complication rate in vbd was 45.5%, greater than the rate of 24.7% in non - vbd. there was transient facial palsy in three cases (27.2%), transient hearing impairment in one case (9.1%), and one permanent case of facial palsy (9.1%). there was no statistically significant difference in age and sex ratio between the complication and no complication groups. diameter of the vbd was significantly greater in the complication group than in the group with no complications (p=0.028). however, there were no statistically significant differences in height and position of the vbd between the complication and no complication groups. vbd is a rare arteriopathy characterized by elongation and enlargement of the vertebrobasilar artery with subsequent thrombosis, micro - embolization, and brainstem compression, with or without aneurysm formation6,11,12,16,18,21,31,34,35). this arteriopathy is known to cause variable neurologic deficits, including combined brainstem and cranial nerve syndromes3,6,7,12,24,31), cervicomedullary junction compression12,16,18,20,31,33) transient or permanent motor deficits12,16,20,21,23,35), cerebellar dysfunction16), central sleep apnea22), hydrocephalus, ischemic stroke33,35), and subarachnoid hemorrhage5,8,26). vbd is a potentially serious condition that may cause severe disability due to ischemic or compressive dysfunction in the posterior fossa27,32). furthermore, manipulation of the dolichoectatic artery during surgical procedures may also result in these hemodynamic changes. therefore, an effort should be made to minimize the manipulation of the dolichoectatic artery in order to prevent ischemic dysfunction in the posterior fossa. in the procedure described here, the vbd artery was released from the proximal portion to the distal as far along its length as possible before decompression of the seventh nerve, and teflon felt and balls were inserted in stepwise manner without retraction of the vessel. in our study, 10 patients had hemifacial spasm caused by vbd without any other neurologic deficits preoperatively, and fortunately, no ischemic dysfunction occurred following microsurgical neurovascular decompression. vascular compression of the facial nerve at the root entry zone was considered the cause of hfs. chakravarty4) reported hfs resulting from pontine compression by a large fusiform dolichoectatic basilar artery without any compression of the facial nerve at the rez. in all our cases, we identified an offending artery compressing the facial nerve at the rez. there was direct compression of the facial nerve by the va in six cases, including right va compression of the left facial nerve (fig. 2) over the offending vessel in four cases, and compression by the aica alone, with no relation to a dolichoectatic artery (fig. 3) who had only the aica offending vessel on the right side, underwent microsurgical neurovascular decompression for hfs in left side first. even though this patient had vbd, microsurgical neurovascular decompression for the right side was similar to other usual decompression procedure. a dolichoectatic artery as the offending vessel or over the offending vessel makes surgical procedures difficult to perform completely without any complications because of its character of enlargement and elongation. the prevalence of vbd is 0.5% of all hfs patients in this study. even though vbd is a very rare arteriopathy, there is the problem of selection and referral bias in these results. the male to female ratio in vbd is greater than in non - vbd (1 : 1.2 vs. 1 : 3). multiple offending vessels are more frequent in vbd than in non - vbd (45.5% vs. 12.5%). in our study, a success rate of 90.9% was achieved in vbd, similar to the 93.2% success rate in non - vbd (p=0.779). if the dolichoectatic artery is released only near the rez, it is difficult and dangerous to retract the dolichoectatic artery to directly insert teflon felt and balls into the compression site because of the artery 's character of enlargement and the ischemic attack risk. successful neurovascular decompression could be performed without retraction of dolichoectatic artery with sufficient release of the artery and a step - by - step manner of insertion of the teflon. it is thus a mandatory step in neurovascular decompression to release the dolichoectatic artery from surrounding structures enough to allow its easy movement, as in the procedure described here. nevertheless, one patient in our study (case no 1) developed transient facial weakness and hearing impairment, two patients (case no 2, 6) developed transient facial weakness, and one (case no 4) developed permanent facial weakness. although the difference was not statistically significant (p=0.154), the postoperative complication rate (45.5%) in vbd was higher than that in non - vbd (24.7%). excessive retraction of the cerebellar flocculus to obtain surgical visibility during release of the dolichoectatic artery from its surrounding structure might play a role in increasing the complication rate. our findings suggest that the degree of height and position of the vbd may not contribute to the occurrence of complications. only increase of diameter of the vbd was significantly associated with the occurrence of complications (p=0.028) in our study. this result shows that the enlargement character of the vbd may be meaningful in development of complications. in fact, increase of a dolichoectatic artery 's diameter results in much more increase of volume of that artery. therefore, much greater retraction of the cerebellum may be needed to obtain sufficient release of the artery. a wider craniectomy and dissection of the arachnoid membranes from the lower cranial nerves up to the petrosal vein to enhance the exposure and mobilization of the cerebellum, the procedures followed here, are helpful for lessening retraction of cerebellum during release of the dolichoectatic artery, but not enough to prevent complications. recently, some authors have used an endoscope to assist in the decompression procedure of trigeminal neuralgia or hfs caused by an elongated, tortuous or enlarged va or ba17). the use of an endoscope is another method that may prevent complications through lessening retraction of the cerebellum. to prevent postoperative complications, minimal manipulation of the dolichoectatic artery and lessening retraction of the cerebellum in this study, there were no statistically significant difference in surgical outcomes of mvd between vbd and non - vbd. therefore, we would recommend microsurgical neurovascular decompression as treatment for hemifacial spasm caused by vbd. to obtain good outcomes and to reduce postoperative complication, the dolichoectatic artery, from the proximal portion to the distal, must be made sufficiently free from its surrounding structures before neurovascular decompression without excessive retraction of the cerebellum.	objectivehemifacial spasm (hfs) caused by vertebrobasilar dolichoectasia (vbd) is very rare, and in theses cases, it is difficult to decompress the nerve from its vascular compression. the objective of this study was to investigate the outcome of microvascular decompression (mvd) for hfs caused by vbd.methodsthere were 10 patients of hfs caused by vbd at our hospital between september 1978 and september 2008. we evaluated magnetic resonance angiography (mra) and time of flight magnetic resonance imaginge (tof mri) findings using the criteria for vbd. we compared the clinical outcomes of mvd for the 10 patients with vbd with the overall outcomes of the total 2058 mvds performed for hfs.resultsthe results of mvd for hfs caused by vbd were successful in 90.9% of cases. the postoperative complication rate in vbd was 45.5%. offending vessels in patients with vbd were identified visually during surgery. adverse effects after mvd were found in 4 patients. we found that the diameter of vbd was significantly greater in patients with complications than in those with no complications (p=0.028).conclusionour data shows that mvd may be a good treatment modality for hfs caused by vbd but care must be taken to avoid adverse effects from the procedure. it is important to detach the dolichoectatic artery from its surrounding structures sufficiently to allow it to be easily movable. in addition, attempts should be made to lessen the retraction of the cerebellum during release of the dolichoectatic artery.
malassezia species are lipophilic or lipid - dependent, budding yeasts, which are part of the skin microflora of humans and other warm - blooded animals. it can become pathogenic under certain predisposing factors, such as alterations in the skin s condition and changes in the host s defenses. malassezia species are associated with various human diseases, especially pityriasis versicolor (pv), which is a chronic superficial skin disorder (1). pityriasis versicolor is a superficial fungal infection characterized by the appearance of round to oval lesions. pv is a chronic cutaneous disorder, and it can occur in any part of the word ; however, it is more common in tropical, humid areas. despite antifungal treatment the disease is more common between puberty and middle age, when there are maximum amount of malassezia yeast on the skin. pv is characterized by a low to more scaly macule that can present as either hyper or hypopigmented (1), and it is usually present on the neck and upper trunk (2). moreover, malassezia species are an etiological agent of catheter - associated ; fungemia, seborrheic dermatitis (3), folliculitis (1, 4), dacryolitis, and blepharitis, as well as nosocomial bloodstream infections in pediatric care units (5). in recent years, molecular studies have changed the taxonomy of the genus malassezia to a considerable extent. sequence variability between malassezia species has been documented in rrna genes. in 1996, gueho. (6), classified the genus of malassezia in seven distinct species, namely ; m. furfur, m. pachydermatis, m. sympodialis, m. globosa, m. obtusa, m. restricta and m. slooffiae. recently, based on dna analysis, six new species have been introduced : m. dermatis, m. nana, m. japonica, and m. yamatoensis, m. equine, m. caprae. of these m. caprae, m. equine and m. nana have only been isolated from domestic animals (6 - 10). however, these methods do not have enough discriminatory power and therefore, can not characterize the newly defined species. in addition, biochemical and phenotypical methods are not able to achieve an immediate diagnosis. in recent years, molecular approaches and pcr methods for the discrimination of malassezia species are the most accurate (11, 12). polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) using restriction enzyme digestion is a simple, reliable, and cost - effective method for the differentiation of malassezia species, which has been described by mirhendi. after amplification of the partial 26s rdna, digestion of the pcr product with the enzyme cfoi produced the predicted species specific pattern for all species tested. using cfoi, nine different species, including ; m. furfur, m. pachydermatis, m. globosa, m. obtuse, m. restricta, m. slooffiae, m. nana, m. japonica, and m. yamatoensis could be distinguished, however, m. sympodialis and m. dermatis produced the same digestion pattern. our data offers insight into the epidemiology of pv in iran, but it is limited to areas such as ; tehran, ahvaz, yazd and mazandaran (4, 14 - 17). furthermore, there is evidence suggesting geographical variations in the distribution of the species. on the other hand, the majority of these studies have identified malassezia species based on biochemical and phenotypical characterization, such as assimilation of tween, and pcr based techniques were not used. the objective of this study was to determine the malassezia species which grew on culture from the skin scrapings of patients with pv in kashan (central region of iran), using molecular methods. there is little current information about the molecular epidemiology and ecology of malassezia species available in kashan, iran. in total, 140 subjects with skin lesions suspected to be pv from the shahid beheshti skin clinic, during 2012, who were referred to the fatemieh zeidi clinical laboratory, kashan, iran, were enrolled in this study. a data collection form which included ; sex, age, disease duration, and lesion area, was completed for the patients. identification of pv on the lesions was initially clinically diagnosed after that the final diagnosis was confirmed by direct microscopic examination using the sellotape method and methylene blue stain for skin samples, obtained by the scraping method (18, 19). this medium consisted of 3.6% malt extract (merck, germany), 2.0% desiccated ox - bile, 1.0% tween 40 (sigma & aldrich), 0.2% glycerol (merck, germany), 0.2% oleic acid (merck, germany), 0.05% chloramphenicol (sigma, usa), 0.5% cycloheximide (sigma, usa), and 1.2% agar. the harvested cells were preserved at -20c until diagnostic analysis. suspected malassezia species were identified to the level of species on the basis of the pcr - rflp method (13). dna was extracted with phenol chloroform - isoamyl alcohol as described by gupta. each reaction contained 1 l of dna template, 0.5 l of each primer, 0.20 mm of each deoxynucleoside triphosphate (dntps), 5 l of 10x pcr buffer, and 1.25 u of taq polymerase, using 2720 applied biosystem thermocycler (life technologies, us). the primer nucleotides was as follows : forward, 5taacaaggattcccctagta-3, and reverse 5-attacgccagcatcctaag-3. after initial denaturation at 94c for 5 minutes, the reaction was followed by 30 cycles of denaturation at 94c for 45 seconds, annealing at 55c for 1 minute, and extension at 72c for 45 seconds, with a final extension step of 72c for 7 minutes. pcr products were evaluated by 1.5% (w / v) agarose gel electrophoresis in tris - boric acid - edta (tbe) buffer, stained with ethidium bromide, and photographed under uv transillumination. the target part of the 26rdna region was amplified for the malassezia isolates, to produce a pcr product approximately 580bp in length (figure 1). pcr products were used for further restriction fragment length polymorphism (rflp) by cfoi (roche, germany) enzymes. digestion was performed by incubating a 20 l aliquot of pcr products with 10 u of the enzyme in a final reaction volume of 25 l at 37c for 3 hours, followed by 2% ethidium bromide agarose gel electrophoresis in a tbe buffer (figure 2). in total, 140 subjects with skin lesions suspected to be pv from the shahid beheshti skin clinic, during 2012, who were referred to the fatemieh zeidi clinical laboratory, kashan, iran, were enrolled in this study. a data collection form which included ; sex, age, disease duration, and lesion area, was completed for the patients. identification of pv on the lesions was initially clinically diagnosed after that the final diagnosis was confirmed by direct microscopic examination using the sellotape method and methylene blue stain for skin samples, obtained by the scraping method (18, 19). this medium consisted of 3.6% malt extract (merck, germany), 2.0% desiccated ox - bile, 1.0% tween 40 (sigma & aldrich), 0.2% glycerol (merck, germany), 0.2% oleic acid (merck, germany), 0.05% chloramphenicol (sigma, usa), 0.5% cycloheximide (sigma, usa), and 1.2% agar. the harvested cells were preserved at -20c until diagnostic analysis. suspected malassezia species were identified to the level of species on the basis of the pcr - rflp method (13). dna was extracted with phenol chloroform - isoamyl alcohol as described by gupta. (20). the pcr reaction was performed in a final volume of 50 l. each reaction contained 1 l of dna template, 0.5 l of each primer, 0.20 mm of each deoxynucleoside triphosphate (dntps), 5 l of 10x pcr buffer, and 1.25 u of taq polymerase, using 2720 applied biosystem thermocycler (life technologies, us). the primer nucleotides was as follows : forward, 5taacaaggattcccctagta-3, and reverse 5-attacgccagcatcctaag-3. after initial denaturation at 94c for 5 minutes, the reaction was followed by 30 cycles of denaturation at 94c for 45 seconds, annealing at 55c for 1 minute, and extension at 72c for 45 seconds, with a final extension step of 72c for 7 minutes. pcr products were evaluated by 1.5% (w / v) agarose gel electrophoresis in tris - boric acid - edta (tbe) buffer, stained with ethidium bromide, and photographed under uv transillumination. the target part of the 26rdna region was amplified for the malassezia isolates, to produce a pcr product approximately 580bp in length (figure 1). pcr products were used for further restriction fragment length polymorphism (rflp) by cfoi (roche, germany) enzymes. digestion was performed by incubating a 20 l aliquot of pcr products with 10 u of the enzyme in a final reaction volume of 25 l at 37c for 3 hours, followed by 2% ethidium bromide agarose gel electrophoresis in a tbe buffer (figure 2). direct examination of the specimens was positive in 93.3% (112/120) of questionable pv lesions. however, only 89.3% (100/112) of the positive specimens yielded malassezia in modified dixon agar. the patients with pv included 60 men and 52 women, aged between 1 and 85 years. statistically there was no significant difference regarding gender and nor was it observed in the frequency of malassezia species isolated between women and men in each group or between groups (p = 0.3). the prevalence of pv in patients 2130 years - of - age was higher than in the other age groups (table 1). in the present study, no difference was seen in the frequency of malassezia species occurrence depending on the age of the patients. in total, 65% of patients with pv had hyperhidrosis. in 86% of patient samples, yeast and hyphal forms of malassezia m. globosa (66%) was the most frequent malassezia species isolated in the pv lesions followed by m. furfur (26%), m. restricta (3%), m. sympodialis (3%), and m. slooffiae (2%), respectively. the prevalence of malassezia species based on the gender of patients is shown in table 2. in addition, the lowest number of malassezia species isolated were from the arms and abdomen (table 3). a statistical analysis of isolated malassezia species showed that there was no significant relationship between malassezia species and any of the anatomical sites (p values = 0.2). the distribution of sites and malassezia species based on pigmentation, is shown in table 4. the duration of the disease ranged less than six months in 44% of patients, followed by ; six months to one year (26%), one to two years (10%), and over two years (20%). 26s rdna pcr products before digestion with cfoi (lanes 1, 7 : m. furfur, lanes 2 - 4, 6, 8 - 11 : m. globosa, lane 5 : m. restricta, lane 1, 14:100 bp ladder). lanes 2, 8 : m. furfur, with 250, two ~107 - 113bp (as overlapping) fragments, lanes 3 - 5, 7, 9 - 13 : m. globosa, with 129 and 455bp fragments, lane 6 : m. restricta, with 581bp fragments, lane 1, 14:100 bp ladder. m. furfur has multiple fragments (59, 30, 21, 2bp) not distinguishable after gel electrophoresis. the genus of malassezia consists of at least thirteen different species, which have been identified based on biochemical and morphological features. however, biochemical and morphological features often do not allow the rapidly and exact characterization of related malassezia species, so molecular approaches need to be used in studies of the epidemiology of malassezia, and pathogenesis and disease caused by the malassezia genus. the present study used the pcr - rflp method for the identification of the malassezia genus in order to determine the specific identification of malassezia species and the diagnosis of related infections. m. globosa and m. furfur were isolated significantly more often than other species in this study ; albeit at unequal rates, as m. globosa was isolated from 66% of patients with pv. recent studies from iran have showed that m. globosa is the commonest malassezia species isolated from malassezia skin disorders. in contrast to our results, others studies from iran have reported lower rates of isolation of m. globosa as predominant in different geographical areas at the rate of 41 - 47.6 (4, 14, 16, 19). in addition, compatible with present studies, m. globosa are the major causative agent of pv in other countries (21, 22). (15), reported that m. furfur is the most common malassezia species isolated from psoriasis and healthy individuals. some investigators from other countries have reported m. globosa as the prevailing malassezia species correlated to pv, while others report m. sympodialis or m. furfur as the species with the highest rates of isolation from pv lesions, however, we found no m. sympodialis in our findings. in accordance with our data m. slooffiae and m. restricta were less commonly isolated species as found in previous studies (23). on the other hand, similar to other published data, the highest prevalence of pv in our study was observed in the 2130 year - old group, this is likely to be the result of increased sebum discharge at these ages (4, 24). previous studies have shown that pv is less common in children (4, 14, 25), but we found 11 cases of pv in children, and this may be due to climate and geographical conditions. kashan is located on the border of a desert, and as a result it has a hot climate that facilitates the occurrence of malassezia skin infections. (25) also reported 9% and 24% of children with malassezia infections in the under 5 and up to 15 years, respectively. different studies have concluded that pv is rarely found in the aged individual, and we had lower cases of pv in the over 50 year old group. we found no isolates of m. obtusa and m. pachydermatis in this study, although in other studies in iran these species were isolated at a low frequency. in previous reports from iran, m. pachydermatis was not isolated, or it was isolated at a low frequency (8.5%). these differences in the prevalence of malassezia species between our study and other reports may be due to geographical variation and some laboratory techniques such as sampling and diagnostic methods. we have isolated single separated colonies from each lesion site, as suggested by some investigators in patients with pv. however, different studies have isolated more than one species from each sample. obtaining pure culture from mixed samples is usually very difficult, due to the fact that, some fast and simple growing malassezia species inhibit other species in the culture. pv lesions were frequently observed on the trunk and arms (26, 27). the high frequency of pv lesions on the neck in our study is controversial, we also observed a number of patients with multiple lesions (30%). on the other hand, some patients with lesions in unexpected locations, such as the face and limbs, and especially the groin, were diagnosed. epidemiological studies have mentioned the distribution of some species in defined anatomical sites (27). we observed no differences in the frequency of malassezia species based on the anatomical sites, which might be related to the high number of pv patients. our findings were compatible to those of other similar studies (17, 25). in this study, in similar studies, this ratio was different and ranged between 45 - 90% (4, 17, 18, 22, 27). in the new taxonomy by gueho. (6), different studies have evolved with the purpose of clarifying the epidemiology and role of the malassezia species in skin disorders. this work will help improve knowledge of malassezia genus epidemiology, especially in the central areas of iran. future studies will be necessary in order to explain the ecology and relationships of these species with human disease. molecular techniques have been useful in the identification and discrimination of malassezia species and this provides information about their epidemiology. by using these methods, the detection and identification of individual malassezia species from clinical samples	background : malassezia species are lipophilic yeasts found on the skin surface of humans and other warm - blooded vertebrates. it is associated with various human diseases, especially pityriasis versicolor, which is a chronic superficial skin disorder.objectives:the aim of the present study was to identify malassezia species isolated from patients samples affected by pityriasis versicolor, using molecular methods in kashan, iran.patients and methods : a total of 140 subjects, suspected of having pityriasis versicolor from kashan, were clinically diagnosed and then confirmed by direct microscopic examination. the scraped skin specimens were inoculated in modified dixon s medium. dna was extracted from the colonies and pcr amplification was carried out for the 26s rdna region. pcr products were used to further restriction fragment length polymorphism by cfoi enzyme.results:direct examination was positive in 93.3% of suspected pityriasis versicolor lesions. no statistically significant difference was observed in the frequency of malassezia species between women and men. the highest prevalence of tinea versicolor was seen in patients 2130 years - of - age. no difference could be seen in the frequency of malassezia species depending on the age of the patients. in total, 65% of patients with pityriasis versicolor had hyperhidrosis. the most commonly isolated malassezia species in the pityriasis versicolor lesions were ; malassezia globosa (66%), m. furfur (26%), m. restricta (3%), m. sympodialis (3%), and m. slooffiae (2%). malassezia species were mainly isolated from the neck and chest.conclusions:this study showed m. globosa to be the most common malassezia species isolated from malassezia skin disorders in kashan, iran. the pcr - rflp method was useful in the rapid identification of the malassezia species. by using these methods, the detection and identification of individual malassezia species from clinical samples was substantially easier.
atrial myxomas account for nearly half of all cardiac tumors, mostly seen in the 3 - 6 decades of life, myxomas commonly originate from subendocardial mesenchymal cells of the left atrium. signs of heart failure, including dyspnea and pulmonary edema, could accompany left atrial myxomas in addition to syncope, sudden death, or signs of systemic embolism in some cases. additionally, in almost 50% of the cases in which cerebral arteries are affected by embolization of tumor particles or thrombotic material covered with tumor cells embolic ischemic stroke is dreaded, in this report, we are describing a patient presented with a right - sided hemiparesis due to cerebral infarction. further investigations including transthoracic echocardiography (tte) detected a four chamber myxoma as a source of cardiogenic embolism. our patient was a 24-year - old male presented to the emergency department with the chief complaint of right - sided weakness without any loss of consciousness. he reported sudden onset of weakness within the previous 24 h having occurred after exercise and followed by difficulty in speech. no further specific symptoms including nausea, vomiting, vertigo, chest pain, or headache were noted prior to the emergence of sudden weakness except for a complaint of recent dyspnea on exertion (doe). in his medical history, we detected a period of posttraumatic seizure that had been controlled with carbamazepine ; he had stopped the course of medication 3 months ago. also, a suspicious history of rheumatic fever in childhood without any documented therapy or diagnosis was present. in physical examination, he was alert and oriented with obvious aphasia as he was able to obey the commands yet unable to speak. his vital signs were as follows : bp = 110/70 mm hg, pr = 70/min, rr = 16/min, bt = 37c. in his respiratory and cardiovascular examination, he had a right - sided hemiplegia with muscle force of 2/5 in upper and lower extremities ; right plantar reflex was extensor, while the left plantar reflex was flexor and his deep tendon reflexes were increased up to 3 +. due to his lateralized signs, the spiral brain computed tomography (ct) scan was recommended and routine lab tests were checked simultaneously. in spiral brain ct, a hypodense lesion could be observed in the left middle cerebral artery (mca) [figure 1 ]. patient 's computed tomography scan in admission the lab tests results were as follows : erythrocyte sedimentation rate (esr) = 47 mm / h, pt = 14.4 s, international normalized ratio (inr) = 1.33, ptt = 30.9 s, k = 4.5 mmol / l, na = 141 mmol / l, blood sugar (bs) = 94mg / dl, blood urea nitrogen (bun) = 13 meq / dl, cr = 1.06mg / dl, creatine phosphokinase (cpk) = 116 u / l, creatine phosphokinase - mb (cpkmb) = 27u / l, lactate dehydrogenase (ldh) = 358 u / l, white blood cells (wbc) = 6700/mm (neut = 57%, lymph = 40%, mono = 3%, eos = 0%, baso = 0%, band = 0%.), red blood cells (rbc) = 4.32 million / mm, hemoglobin (hb) = 11.5g / dl, hematocrit (hct) = 35.5 g%, platelet (plt) = 221000/ mm. the nihss of the patient was 14 ; however, no intravenous thrombolysis therapy was considered due to the delayed referral to our center (more than 3 - 4.5 h). due to his history of doe and occurrence of his signs and symptoms exactly following exercise, echocardiography was suggested. interestingly, echocardiography revealed multiple masses in all cardiac chambers [left atrium (la) and left ventricular (lv) (two separated), right ventricle (rv) and right atrium (ra) in order of largest to smallest, respectively ] [figure 2 ]. findings were in favor of a multiple myxoma. on the basis of cardiology consultations, association of a multiple cardiac myxoma and probable cerebral emboli originating from it forced anticoagulant therapy because of he was admitted at cardiac surgery intensive care unit and scheduled to undergo cardiac myxoma resection 2 days after his emergency department admission. the day following cardiac surgery, his hemiplegia resolved and furthermore, muscle forces of the upper and lower limbs improved from 2/5 and 2/5 to 3/5 and 4/5 before and after operation, respectively. postoperation imaging of the patient including brain ct scans and magnetic resonance imagings are presented in figures 3 - 5. the follow - up ct scan revealed evidences of remained ischemic injury in the left mca 2 months after operation [figure 4 ]. patient 's echocardiography in admission patient 's postoperation magnetic resonance imaging patient 's computed tomography scan in 2 months after admission patient 's magnetic resonance imaging 12 months after admission myxomas commonly affect the left atrium ; however, right atrium, ventricles, or mitral valve could also be involved contributing to clinical manifestations including embolism, obstruction of the mitral valve, and general findings (i.e., fever, anemia, and elevated erythrocyte sedimentation rate). a set of diagnostic criteria have been recommended ; differential diagnosis is difficult due to the fact that myxomas typically remain uninfected. cerebral infarction prompted by cardiogenic embolism is seen in almost 20% of stroke patients of whom atrial fibrillation accounts for over 50% of the cardiogenic emboli, while myxomas have been reported in only 0.5% of emboli and their consequent ischemic strokes. owing to the ability of producing instantaneous emboli, myxomas are able to become fatal despite being commonly asymptomatic. a median delay of 36 months has been reported between commencement of symptoms and diagnosis in myxoma patients with neurologic manifestations. the findings provided by cerebral imaging often include multiple infarcts being suggestive of a cause with an embolic origin ; however, small subcortical ischemic lesions mimicking lacunar disease is occasionally reported as well. although, the sensitivity of transesophageal examination is higher, tte with a sensitivity of almost 90% would serve as an excellent diagnostic tool in the detection of left atrial myxoma. myxomas might be asymptomatic until they are bulky enough to either produces emboli or obstruct the mitral or tricuspid valves. due to their intravascular and fragile nature, myxomas are known as the major cause of tumor emboli which occurs in almost 30%-40% of patients. the location of the myxoma (left or right atrium) and the presence of an intracardiac shunt are the main factors affecting the site of embolism. the emboli that occur are either a tumor fragment that is released from the myxoma or a blood clot that is formed on the surface of the myxoma. these subsequent emboli can result in infarction, as occurred in our patient. on the, the cerebral embolus was due to mural thrombosis mounted on the myxoma in our patient, fragmentation of the embolus into smaller particles downsizing the ischemic area might have contributed to the partial improvement and hemiparesis reduction. in addition, thrombosis is composed of blood elements primarily affecting larger and consequently smaller arteries following degradation which could result in symptom reduction. almost half of the patients with myxomas have been reported to suffer neurologic manifestations having resulted from embolizations (pulmonary, myocardial, mesenteric, retinal artery occlusion, spinal cord ischemia, and stroke). mca, having a dominant blood flow, is often and in myxoma cases with the suspected involvement of either frontal or parietal lobes, mca proximity should be carefully probed. diagnosis is frequently made using two - dimensional echocardiography which is considered the gold standard ; however, tee might be distinctive in equivocal or confusing findings. in addition to the detection of other cardioembolic sources such as a patent foramen ovale, mitral valve calcification, or aortic atherosclerosis ; both tte and tee are able to clarify the location, size, shape, and movement of myxomas. cardiac catheterization might be required especially if other concurrent cardiac diseases are assumed or in the presence of equivocal diagnostic findings. in a literature review that we performed on the emergence of the myxoma resection, most authors agreed that early resection of a myxoma leading to stroke is highly recommended. however, the procedure should be postponed in cases which have undergone thrombolytic therapy which could increase the risk of hemorrhage. as in our case, no thrombolytic therapy course had been initiated due to the loss of 24 h golden time, the patient underwent prompt resection. resection should be performed with negative margins due to the postoperative recurrence rate of 1%~3%. hence, long - term follow - up with echocardiography is highly recommended in all patients. tte is used routinely in stroke patients by physicians in the search for cardiogenic embolic sources. however, myxomas might be missed in case of exclusive use of tte especially in the obese. therefore, further supplementary diagnostic approaches and modalities should be taken into consideration in these patents. the reasons for reporting this case are rarity of myxoma, asymptomatic nature of the disease until cva occurrence (except for a recent dyspnea following exercise), lack of any previous syncope history, and involvement of all four cardiac chambers. emboli and their neurological complications occur frequently in patients with cardiac myxoma. early and prompt cardiac evaluation using echocardiography in the emergency department seems reasonably necessary in order to detect the source of any probable stroke. as the main involved cerebral site, more accurate exploration of mca is recommended. finally, surgical resection of the myxoma in asymptomatic or stroke patients in whom intravenous thrombolysis course has not been implemented due to any limitations should be considered a priority and performed without any delay.	myxomas, the most common primary cardiac tumors, are known as a source of cardiogenic emboli. the possibility of their early detection has made them of great importance for emergency medicines. detection of the disease is probable at early stages using echocardiography and associate complications such as syncope, cerebral embolic ischemic strokes, and sudden death. we report experience of a rare case of juvenile acute stroke in a patient with cardiac myxoma affecting all cardiac chambers presenting to the emergency department. in young stroke patients with signs and symptoms compatible with cardiovascular involvement, cardiogenic emboli should be taken into consideration ; early echocardiographic studies are highly recommended. prompt myxoma resection is required in both asymptomatic and stroke patients in whom intravenous thrombolysis course has not been implemented due to any limitations.
in this issue of critical care, robinson and colleagues investigate the effect of increasing doses of the low molecular weight (lmw) heparin enoxaparin (commonly used as prophylaxis against venous thromboembolism (vte)) on systemic heparin concentrations, expressed as anti - factor xa levels. reported rates for deep venous thrombosis in patients admitted to the icu range from 22 to 80% depending on patient characteristics. thromboprophylaxis with unfractionated or lmw heparin lowers the risk for deep venous thrombosis by more than 50%. nevertheless, the risk of vte in critically ill patients receiving lmw heparin prophylaxis is still much higher than in other patient groups. amongst several factors that may explain the higher incidence of vte in critically ill patients, such as full immobilisation or withholding anticoagulant prophylaxis is still much higher than in other patient groups. amongst several factors that may explain the higher incidence of vte in critically ill patients, such as full immobilisation or withholding anticoagulant prophylaxis because of a high bleeding risk, it was hypothesized that limited bioavailability (that is, lower plasma anti - factor xa activity) of subcutaneously administered heparin in those patients with impaired peripheral circulation, due to vasopressor medication to maintain central blood pressure, might be important. indeed, in a first comparative trial it was shown that critically ill patients on high dose vasopressor medication had much lower anti - factor xa concentrations after the subcutaneous administration of lmw heparin in comparison with intensive care patients that had lower doses of vasopressor or in comparison with patients in the surgical ward. a subsequent study also found consistently lower anti - factor xa levels after subcutaneous heparin in critically ill patients. in another similar study, critically ill patients with excessive subcutaneous oedema had lower anti - factor xa concentrations compared to a control group without oedema. this observation was confirmed in a group of critically ill multiple trauma patients, who showed variable and low heparin concentrations after subcutaneous injections. robinson and colleagues compared plasma anti - factor xa levels after the subcutaneous administration of the lmw heparin enoxaparin at the conventional dose (40 mg) and at increasingly higher doses (up to 70 mg) in intensive care patients. they found a dose - dependent increase in peak anti - factor xa levels (4 hours after the injection) ranging from 0.13 iu / ml at the conventional 40 mg dose to 0.29 iu / ml at the 70 mg dose. considering that optimal efficacy and safety of lmw heparin for thromboprophylaxis in orthopaedic and abdominal surgery was achieved with dosages of heparin resulting in peak plasma anti - factor xa activities ranging between 0.25 and 0.30 iu / ml, it may be concluded that critically ill patients need much higher doses of lmw heparin than other patients. based on the findings of robinson and colleagues, the subcutaneous dose of lmw heparin should be increased to 60 mg daily. alternatively, direct intravenous administration of (lmw) heparin may be considered ; however, experience with this type of thromboprophylaxis is limited. the mechanism by which critically ill patients have lower anti - factor xa levels after subcutaneous administration of heparin is not completely understood. the initial hypothesis was that patients on high dose vasopressor medication had impaired subcutaneous blood flow and thereby limited ability to adsorb the subcutaneous heparin. an alternative explanation is that the presence of oedema hinders the absorption of heparin, although that hypothesis was not proven. in addition, it has been suggested that systemic inflammation and associated multiple organ dysfunction may have an impact on heparin binding to plasma proteins and drug metabolism. the clinical relevance of lower anti - factor xa levels after conventional doses of (lmw) heparin in critically ill patients is also not totally clear. theoretically, the low anti - factor xa levels may lead to suboptimal prophylaxis and could indeed be a contributory factor to the higher incidence of thromboembolic complications in critically ill patients despite routine thromboprophylaxis based on the observations of robinson and colleagues and others, a randomized controlled trial with conventional versus higher doses of thrombosis prophylaxis in critically ill patients aiming at the reduction of the incidence of vte and other clinically relevant outcomes is justified. such a study would also enable the evaluation of bleeding complications related to the administration of prophylactic heparin, as intensive care patients are at higher risk for hemorrhage as well. in summary, there is ample evidence that conventional thromboprophylaxis leads to lower systemic heparin levels in critically ill patients. it is not clear whether this contributes to the relatively high incidence of vte in intensive care patients. a clinical trial evaluating higher doses of heparin for prevention of vte and assessing the bleeding risk of such an approach is justified.	venous thromboembolism is a relatively frequently occurring complication in critically ill patients admitted to the icu despite prophylactic treatment with subcutaneous low molecular weight heparin. several studies show that critically ill patients have significantly lower plasma anti - factor - xa activity levels compared to control patients after administration of subcutaneous heparin. robinson and colleagues show in this issue of critical care dose - dependent but relatively low levels of anti - factor xa activity at increasing doses of enoxaparin. anti - factor xa levels thought to be required for adequate thromboprophylaxis are observed only at doses of enoxaparin that are one and a half times higher than the conventional dose (40 mg).
important natural indoles include tryptamines melatonin and serotonin, which act as vital elements in brain function, as well as auxin, a crucial plant hormone, which regulates gene expression associated with plant growth. 5,6-dihydroxyindole serves as a universal precursor for natural pigments, and it is implicated in malignant melanoma. furthermore, natural indole alkaloids have been exploited for the treatment of a variety of human diseases. currently in clinical use are anticancer agents vinblastine and vincristine, the antimigraine drug ergotamine, and the antiarrythmic ajmalicine, to mention a few. because of the rich chemistry and biological activity of indole - containing natural products, chemists have been attracted to synthesis and study of non - natural indole derivatives. indeed, synthetic variants of indole natural products have found wide - ranging applications as pharmaceuticals (e.g., iprindole, pindolol, and indomethacin). tryptophan occupies a unique position among the canonical amino acids because of its ability to participate in a wide range of inter- and intramolecular interactions and because it represents the main source of uv absorbance and fluorescence in proteins. for instance, the tryptophan radical cation is actively involved in the reactivity of cytochrome c peroxidase, and it is implicated in long - range electron - transfer pathways in proteins (e.g., in dna photolyases). underlying the biochemistry and function of tryptophan and many indole - containing molecules is the 6,5 bicyclic indole motif (scheme 1). we have initiated a research program directed at expanding the chemical space of biologically active motifs through bn / cc isosterism, i.e., the replacement of a carbon carbon unit with the isosteric boron nitrogen unit. in view of the importance of the indole structure in biomedical research, we have directed our attention to apply the bn / cc isosterism to indole. to date, two families of bn isosteres of indole have been developed, the bn indoles (or 1,3,2-benzodiazaborolines) i and fused bn indoles ii (scheme 1). goubeau reported the first example of an external bn indole in 1957 by treating trimethylboron with o - phenylenediamine. he and his co - workers also prepared the parent external indole i in 1964. since goubeau s pioneering work, external bn indoles have been utilized as building blocks in optoelectronic materials and as boryl ligands in organometallic chemistry. the liu group reported the first examples of fused bn indoles in 2010 and one year later disclosed the synthesis and characterization of the parent compound ii (scheme 1) of this family of indoles. while the synthetic preparation of these compounds has been making steady progress, our understanding of the electronic structure of bn indoles (in particular that of fused bn indole) is still very limited. in this work, we provide a comprehensive electronic structure analysis of parental structures of bn indoles in direct comparison to the natural indole using a combined uv - photoelectron spectroscopy (uv - pes)/computational chemistry approach. uv - pes experimentally determines the gas - phase ionization energies (ies) of molecules that can be correlated to the energies of occupied molecular orbitals. for a reliable assignment of uv photoelectron spectroscopic bands and for the interpretation of spectra, the chrostowska group has calibrated different computational methods (e.g., the standard outer valence green function (ovgf), density functional theory (dft), self - consistent field / time - dependent density functional theory (scf / td - dft), td - dft, complete active space second - order perturbation theory (caspt2), and statistical average of different orbital model potential exchange correlation functional (saop xc) against the experimentally determined uv - pes ies. the combined uv - pes / computational modeling approach developed by chrostowska and co - workers is used to investigate the electronic structure of the compounds illustrated in scheme 1. the uv - pes spectra were recorded on a home - built (iprem / ecp), three - part spectrometer equipped with a main body device, he i radiation source (21.21 and/or 48 ev), and a 127 cylindrical analyzer. the spectrometer works at constant analyzer energy under 5 10 hpa working pressure and 10 hpa for channeltron (x914l) pressure. the monitoring is done by a microcomputer supplemented by a digital analogue converter (aei spectrum). the spectra resulting from a single scan are built from 2048 points and are accurate within 0.05 ev. spectra are calibrated with lines of xenon (12.13 and 13.44 ev) and of argon (15.76 and 15.94 ev). the accuracy of the ies is 0.03 ev for sharp peaks and 0.05 ev for broad and overlapping signals. mass spectra were recorded on a modified quadrupole mass spectrometer (pfeiffer prisma qms200) with an electron - impact at 50 ev (mass range : 200 amu ; detection limit : 10 hpa ; working pressure : 2 10 hpa ; operating temperature : 200 c ; electronic amplifier in working conditions : 10 a, quad star422 software for recording and treatment of ms data). the samples were slowly vaporized under low pressure (10 torr) inside a handmade three - valve injector (3/4 in. diameter ; 10 cm length ; working temperature : 190 t + 300 c), and the gaseous flow was then continuously and simultaneously analyzed by both uv - photoelectron and mass spectrometers. all calculations were performed using the gaussian 09 program package with the 6 - 311g(d, p) basis set. extra diffuse functions (6 - 311++g(d, p)) are included in the basis set to improve the description of the electron affinities (ea). dft has been shown to predict various molecular properties of similar compounds successfully. all geometry optimizations were carried out with the cam - b3lyp functionals and were followed by frequency calculations in order to verify that the stationary points obtained were true energy minima. ionization energies were calculated with scf - dft, which means that separate scf calculations were performed to optimize the orbitals of the ground state and the appropriate ionic state (ie = ecation eneutral). the advantages of the most frequently employed scf - dft method of calculations of the first ies have been demonstrated previously. the td - dft approach provides a first - principal method for the calculation of excitation energies within a density functional context taking into account the low - lying ion calculated by the scf method (the excitation energies of the radical cation obtained from a td - dft treatment were added to the ie that was computed with the scf - dft method). the vertical ies were also calculated at the ab initio level according to ovgf (in this case the effects of electron correlation and reorganization are included beyond the hartree fock approximation and the self - energy part was expanded up to third order) and sac ci (symmetry adapted cluster / configuration interaction methods of nakatsuji and co - workers which describes accurately and efficiently the electronic structures of the excited, ionized and electron - attached states of molecules) methods. the uv - photoelectron spectra of external bn indole i and fused bn indole ii are illustrated in figure 1. the known uv - pe spectrum of indole is also given to allow a direct comparison with the compounds under current investigation. for the reliable assignment of pe bands, dft (scf / td - dft (cam - b3lyp)) and ab initio (ovgf and sac ci) calculations of ies using the 6 - 311g(d, p) basis set have been carried out on optimized geometrical parameters of bn indoles i and ii. the comparison of the theoretically predicted ies and experimental observed data is summarized in the table in figure 1. it appears that the dft calculations (cam - b3lyp) best model the experimentally determined ies. the photoelectron spectrum of natural indole exhibits a low - energy band at 7.9 ev which is associated with its homo of symmetry (a). the second (homo-1), third (homo-2), and fourth (homo-3) bands correspond also to mo of symmetry (a) and are located at 8.5, 9.9, and 11.05 ev, respectively. similar to indole, the fused bn indole ii has also cs symmetry. the first broad pe band located at 8.05 ev contains two a-symmetry mo (homo and homo-1) ionizations. the next ionization at 10.2 ev is also linked with a mo (homo-2) of a symmetry, while the fourth ionization at 11.2 ev corresponds to a mo (homo-3) of symmetry (a). in contrast to natural indole and fused bn indole, the external bn indole i has c2v symmetry. the first pe band for bn indole i appears at the same ie value as for indole molecule (at 7.9 ev) and corresponds to the antibonding combination of the delocalized nbn system with benzene system (b1 symmetry (1nbn)). the second sharp and intense band located at 8.5 ev (homo-1) is attributed to a mo with a2 symmetry featuring two nitrogen lone pairs and -antibonding interactions in the benzene ring (nnc = c). the third pe band (homo-2) at 10.7 ev and a shoulder at 11.05 ev (homo-3) reflect the ionizations from orbitals of a2 (ccn) and b1 (2nbn) symmetry, respectively. the higher - energy bands (> 12.2 ev) for all three molecules are associated with mos of various symmetries (a, a1, b2). it should be noted that the chosen computational models agree reasonably well with the experimentally determined ies. uv - pes spectra of external bn indole i, fused bn indole ii, and natural indole. the seven homos with the corresponding ies for each of the three molecules are illustrated. sham mo shapes and symmetries (molekel visualization) and calculated scf / td - dft (cam - b3lyp), ovgf, and sac ci ies of natural indole, i, and ii, in comparison with experimental ie values (in ev). for all calculations 6 - 311g(d, p) basis set was applied ; iso value = 0.05 e / bohr. the comparison of these experimental and computational data (figure 1) shows that the replacement of two adjacent carbon atoms in indole by nitrogen and boron does not result in significant changes in the energy level of the corresponding homos, a finding which is in stark contrast to simple monocyclic arenes where bn / cc isosterism leads to significant destabilization of the homo. the molecular structure change associated with the external bn indole i relative to natural indole does not cause any changes in the energy level for the homo-1 ; both mos have ies at 8.5 ev. on the other hand, the homo-1 for the fused bn indole ii is destabilized by 0.45 ev relative to the corresponding mo for the natural indole. for homo-2, the following energetic trend is observed : external bn indole i at 10.7 ev ie is most stable followed by fused bn indole ii at 10.2 ev ie and natural indole at 9.9 ev ie. the ies for homo-3 for all three indole molecules are fairly similar (11.1 ev). however, while homo-3 in fused bn indole ii has symmetry (a), the homo-3 for natural indole and the external bn indole i have symmetry (a and b1, respectively). according the frontier molecular orbital theory, the electronic structure determination of the homo is the most significant in terms of property and reactivity predictions. despite the similar homo energy levels of natural indole and bn indoles i and ii, the nature of these homos is quite distinct. the homo of the indole system can be best described as the antibonding combination of the nitrogen lone pair (in indole) or the nbn system (in compounds i and ii) with an adjacent carbon system. because of the different locations of the bn unit in i and ii and thus different symmetries, the orbital coefficient distributions are quite different between i and ii, a result that may shed some light into the different properties and reactivities between the bn indole families (vide infra). the natural indole and fused bn indole share the same symmetry point group (cs). thus, it appears from figure 1 that the electronic structure of natural indole more resembles that of fused bn indole ii than that of external bn indole i, and one might predict similar reactivity patterns between natural indole and bn indole ii as a consequence (vide infra). we have investigated the ground - state dipole moments of the three indole compounds. as can be seen from table 1, cam - b3lyp/6 - 311g(d, p) calculations predict the following trend in molecular dipole moments in the order of increasing strength : bn indole i (0.543 d), bn indole ii (1.512 d), and natural indole (2.177 d). it is worth noting that while bn isosteres of monocyclic arenes are significantly more polar (by > 1.5 d) than their carbonaceous counterparts, the bn indoles in this study exhibit weaker dipole moments than the natural indole. td - dft calculations suggest that the direction of the dipole moments does not significantly change upon excitation of the ground state to the first excited state for all three indoles. on the other hand, the magnitude of the dipole moment can change dramatically depending on the structure. an increase in polarity by 0.29 and 0.56 d is predicted for natural indole and bn indole i upon excitation to the first excited state, respectively. uniquely, a polarity increase of 2.57 d is predicted for the fused bn indole ii upon excitation to the first excited state. the direction and magnitude of the ground - state dipole moments are consistent with the calculated electrostatic potential surface (eps) maps for the three indoles at the 0.001 electron au density isocontour level. the color red indicates negative charge, whereas the color blue represents positive charge. qualitatively, the eps maps illustrate that the higher symmetry of bn indoles i and ii (i.e., two electronegative n atoms are arranged in relatively symmetrical fashion) minimizes the overall dipole moment compared to natural indole. for the external bn indole i, the negative charge is mostly localized on the six - membered carbocyclic ring while the positive charge is located at the n - substituent. the boron atom in the external bn indole i is also devoid of negative charge, consistent with the relatively electropositive character of boron. in contrast to the external bn indole i, significant negative charge can be found near the boron position in the fused bn indole ii, and the liver - shaped negative charge distribution in bn indole ii resembles that of natural indole. the observation of significant negative charge at the least electronegative boron atom in fused bn indole ii is consistent with strong resonance/ electron delocalization effects that provide the boron atom with extra negative charge. conversely, the lack of negative charge at the boron position in the external bn indole i suggests that the electron density is less delocalized in the five - membered ring system of i relative to ii and indole. the comparison of calculated electron affinities (cam - b3lyp/6 - 311++g(d, p)) for the three indole molecules indicates that external bn indole i exhibits the most negative electron affinity, followed by fused bn indole ii and natural indole. cam - b3lyp/6 - 311++g(d, p) electron affinity (ev), (ie - ea) and first homo lumo uv transition (ev) for bn indoles i, ii, and natural indole. figure 2 shows the calculated nucleus - independent chemical shifts (nics) (0) (in parentheses) and nics (1) [in brackets ] values of the five- and six - membered rings of bn indoles i and ii and indole. indole is an aromatic heterocycle as evidenced by the strongly negative nics values for both the five- and six - membered rings. the replacement of cc with bn at the 8,9-positions in fused bn indole ii introduces localization of electron density and reduces the aromatic ring current as evidenced by the less negative nics values. interestingly, a stronger reduction of aromaticity is observed for the six - membered ring vs the five - membered ring. for the external bn indole i, the aromatic character of the six - membered carbocyclic ring is retained. however, strong localization of electron density is observed for the five - membered heterocyclic ring as evidenced by the relatively less negative nics values. this observation is also consistent with the eps map for compound i, in which a stronger electron localization is predicted. calculated (cam - b3lyp/6 - 311(d, p)) nics (0) (in parentheses) and nics (1) [in brackets ] values of bn indoles i, ii and natural indole. vis absorption spectra and the calculated absorption maxima of indole and bn indoles i and ii. the highest probability low - energy transition for natural indole is calculated to be at 243 nm. this band is observed in the uv vis spectrum at max = 270 nm (figure 3, entry 1). in the case of external bn indole i, the max is calculated to be at 247 nm and is experimentally observed at max = 282 nm (figure 3, entry 2). for fused bn indole ii, the lowest - energy absorption band is calculated to be at 256 nm and is observed at max = 292 nm (figure 3, entry 3). in comparison to the theoretically derived gas - phase values, a similar difference is also observed for monocyclic arenes. comparison of td - dft calculations (cam - b3lyp/6 - 311++g(d, p)) and observed uv vis absorption spectra for indole and bn indoles i and ii. as established by previous uv - pes experiments, bn / cc isosterism of simple monocyclic arenes (e.g., benzene and toluene) leads to heterocycles with higher homo energy levels (> 0.38 ev). on the other hand, the homos of bn indoles i and ii in this study do not appear to have higher energy levels than the natural indole. in fact, the homo of fused bn indole ii is somewhat stabilized relative to natural indole according to the experimental gas - phase uv - pes analysis (figure 1). cyclic voltammetry also probes the homo energy levels of molecules, albeit in the solution phase, where dipole moment and solvent polarity may additionally influence the oxidation potential. figure 4 illustrates that all oxidations are irreversible and centered around 1.0 v potential vs saturated calomel electrode (sce). natural indole has an oxidation wave peaking at 1.22 v vs sce, compared to 1.05 and 0.95 v measured for bn indole ii and bn indole i vs sce in mecn, respectively. the difference in oxidation potential of 0.3 v between natural indole and its bn isosteres i and ii is significantly smaller than the observed difference of 1 v in oxidation potentials between benzene and 1,2-dihydro-1,2-azaborine. it is also worth noting that the anodic peak potential trend correlates with calculated dipole moment of the indoles. it appears that the relatively polar acetonitrile solvent is exerting some stabilizing effect on indoles with stronger ground - state dipole moments. cyclic voltammograms of indole, bn indole i, and bn indole ii (0.1 m tbapf6 in mecn ; scan rate, 50 mv / s). we have previously determined that the n - t - bu - substituted fused bn indole a undergoes electrophilic aromatic substitution (eas) reactions with the same regiochemistry as natural indole, i.e., preferentially at the three - position (figure 5, eq 1). in this study, we investigated the eas behavior of the parental structures. to the best of our knowledge, i with dimethyliminium chloride showed incomplete conversion (ratio of starting material to product 1.3:1, see supporting information for details) at room temperature with 30 min reaction time (figure 5, eq 2). on the other hand, the fused bn indole ii reacted cleanly with the dimethyliminium electrophile to furnish the c3-substituted product in 95% yield and complete regioselectivity under identical conditions as in eq 2 (figure 5, eq 3). we were able to obtain the x - ray crystal structure of the eas product and thus unambiguously determine the substitution pattern. it is worth noting that the product illustrated in eq 3 is a bn isostere of the biologically active indole alkaloid gramine. in a direct comparison, natural indole reacts with dimethyliminium chloride to give a mixture of two products, gramine and its bisalkylated adduct, in approximately 2.1 to 1 ratio, respectively (figure 5, eq 4). the regioselective eas reaction of the parent fused bn indole ii is somewhat surprising if one considers only the homo -orbital coefficients, which are very similar for the 2- and 3-carbon positions (0.589 vs 0.582). however, the eps map of bn indole ii indicates an apparent localization of negative charge around the 3-position. thus, the observed eas regioselectivity for bn indole ii could potentially be rationalized by the synergistic combination of both the frontier orbital coefficients and the charge distribution. similar to bn fused indole ii, the regioselectivity for natural indole is consistent with the -orbital coefficient distribution in the homo and the charge distribution according to the eps map (figure 5, bottom right). despite the relatively low oxidation potential (see figure 4) the external indole does not undergo substitution reactivity with dimethyliminium chloride efficiently at the corresponding 3-position (i.e., at nitrogen). this is consistent with the relatively small homo -orbital coefficient at nitrogen for compound i (figure 5, bottom left). it appears that the homo -orbital coefficient and the charge distribution are the dominant factors in determining relative reactivity and selectivity rather than the homo energy levels. homo with corresponding -orbital coefficients, and electrostatic potential surface at the 0.001 electron au density isocontour level (+ 12.55 to 12.55 kcal mol1) of external bn indole i (left), fused bn indole ii (middle), and natural indole (right). we have also performed direct eas competition experiments among the parental indole structures. using 1 equiv of each bn indole ii, bn indole i, and dimethyliminium chloride in cd2cl2, we observed exclusively the eas adduct associated with fused bn indole ii (scheme 2, eq 5). similarly, a competition experiment between natural indole and external bn indole i showed exclusive formation of the eas adduct of natural indole (scheme 2, eq 6). finally, a competition experiment between fused bn indole ii and natural indole revealed a preference for the electrophile to react with the fused bn indole ii (scheme 2, eq 7). thus, the relative eas reactivity for the parental indoles is as follows : fused bn indole ii > natural indole > external bn indole i. this trend correlates with the -orbital coefficient at the 3-position which are 0.582, 0.561, and 0.354 for bn indole ii, indole, and bn indole i, respectively. in summary, we described a comprehensive electronic structure analysis of bn indoles i and ii in direct comparison with the natural indole using a combined uv - pes / computational chemistry approach. in contrast to monocyclic arenes, bn / cc isosterism in the context of indole does not result in significant changes in the energy level of the homos. gas - phase uv - pes studies revealed the following homo energies : natural indole (7.9 ev), external bn indole i (7.9 ev), and fused bn indole ii (8.05 ev). furthermore, while bn isosteres of benzene and toluene exhibit stronger ground - state dipole moments than their carbonaceous counterparts, external bn indole i (0.543 d) and fused bn indole ii (1.512 d) are significantly less polar than the natural indole (2.177 d). on the other hand, the lower band gap observed for bn isosteres of benzene and toluene vs their carbonaceous counterparts is also observed for the indole system. the trend for max in the uv vis absorption spectrum (longest to shortest wavelength) is as follows : fused bn indole ii (292 nm) > external bn indole i (282 nm) > natural indole (270 nm). while the experimental gas - phase uv - pes data of the indole molecules do not show a particular trend with regard to the first ie, electrochemistry data in solution phase reveal a small trend with regard to the anodic peak potential (lowest to highest) : external bn indole i (0.95 v) natural indole > external bn indole i. this trend correlates with the -orbital coefficient at the 3-position. nics calculations show that the introduction of boron into an aromatic 6-electron system leads to a reduction in aromaticity, presumably due to a stronger bond localization. we conclude from this study that trends and conclusions from bn isosteres of simple monocyclic aromatic systems such as benzene and toluene are not necessarily translated to the bicyclic indole core. electronic structure consequences resulting from bn / cc isosterism will need to be evaluated individually from system to system.	we present a comprehensive electronic structure analysis of two bn isosteres of indole using a combined uv - photoelectron spectroscopy (uv - pes)/computational chemistry approach. gas - phase he i photoelectron spectra of external bn indole i and fused bn indole ii have been recorded, assessed by density functional theory calculations, and compared with natural indole. the first ionization energies of these indoles are natural indole (7.9 ev), external bn indole i (7.9 ev), and fused bn indole ii (8.05 ev). the computationally determined molecular dipole moments are in the order : natural indole (2.177 d) > fused bn indole ii (1.512 d) > external bn indole i (0.543 d). the max in the uv vis absorption spectra are in the order : fused bn indole ii (292 nm) > external bn indole i (282 nm) > natural indole (270 nm). the observed relative electrophilic aromatic substitution reactivity of the investigated indoles with dimethyliminium chloride as the electrophile is as follows : fused bn indole ii > natural indole > external bn indole i, and this trend correlates with the -orbital coefficient at the 3-position. nucleus - independent chemical shifts calculations show that the introduction of boron into an aromatic 6-electron system leads to a reduction in aromaticity, presumably due to a stronger bond localization. trends and conclusions from bn isosteres of simple monocyclic aromatic systems such as benzene and toluene are not necessarily translated to the bicyclic indole core. thus, electronic structure consequences resulting from bn / cc isosterism will need to be evaluated individually from system to system.
this randomized controlled trial was conducted at harvard pilgrim health care, a not - for - profit health plan. a flow diagram of study participation is shown in supplementary figure 1 (available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-2332/dc1). in 2006, we identified all 35,065 adult health plan members with diabetes, 95% of whom had type 2 diabetes. we limited the sample to individuals with no insurance claim for a dilated eye examination in the prior year and no claim for one or more of the following tests : a1c, ldl cholesterol, or microalbumin. from 5,140 eligible patients, we randomly selected 1,200 individuals and randomly allocated them to the intervention (n = 600) and usual care (n = 600) groups. we mailed a letter to all 600 patients in the intervention group, informing them that they would receive a series of automated calls from harvard pilgrim to support their diabetes care. in particular, we conducted a series of interviews with harvard pilgrim patients and physicians to characterize their willingness to interact with ato - sr and identified topics of interest (8). the computerized system placed three calls to the participants ' home telephone numbers, encouraging the participants to fulfill recommended testing if it had not been performed in the preceding year. the computerized system used speech recognition to respond to participants with segments of recorded text spoken with a human voice. the automated system offered a live telephone call back to assist in scheduling tests and also offered to send participants the following items : 1) a voucher that would allow the provider to waive the co - payment for a dilated eye examination ; 2) an educational nutrition video ; 3) a cookbook ; or 4) a pill box. for each of the three intervention calls, the automated telephone system made up to six attempts to reach the patient, leaving up to two messages requesting a call back. the primary outcome measure was the completion of a dilated eye examination among individuals without evidence of examination in the preceding year. secondary outcome measures were the completion of a1c, ldl cholesterol, and microalbumin testing. we used the kaplan - meier method and log - rank test to assess the differences between the intervention and usual care groups in the time to the receipt of recommended testing and segmented proportional hazards regression to account for baseline differences in measured variables and for differential completion of testing prior to the intervention. we used the kaplan - meier method and log - rank test to assess the differences between the intervention and usual care groups in the time to the receipt of recommended testing and segmented proportional hazards regression to account for baseline differences in measured variables and for differential completion of testing prior to the intervention. compared with the usual care group, the intervention group was younger (50 vs. 52 years, p = 0.02) and had a greater proportion of men (64 vs. 41%, p = 0.04) ; the groups were comparable on other socio - demographic measures and clinical indicators as shown in supplementary table 2. the factors associated with call participation are shown in supplementary table 3. in the primary analysis, there was no difference in the time to the completion of a dilated eye examination and no difference in the time to the completion of a1c and microalbumin tests ; the intervention group had a shorter time to ldl cholesterol testing (p = 0.045 by the log - rank test)., there was no difference between the intervention and usual care groups in the time to a dilated eye examination (adjusted hazard ratio [hr ] 0.93 [95% ci 0.711.22 ]) and no effect on times to the secondary outcomes of a1c testing (0.72 [0.381.37 ]), ldl cholesterol testing (1.31 [0.563.05 ]), and microalbumin testing (1.14 [0.691.89 ]). in this randomized controlled trial, only 39% of health plan members randomized to the automated telephone outreach interacted verbally with the system. previous studies have shown modest effects of automated telephone outreach interventions to improve diabetes care, although those interventions capitalized on the involvement of a nurse or a diabetes educator (6,7). to enhance the participants ' engagement, this study included token gifts, which could reasonably be included in a real - world intervention program, but these gifts appeared to have no effect on the outcome. the intervention appeared to fail in part because a majority of targeted patients did not meaningfully interact with the system. first, the intervention was designed to rely on automated systems rather than human interactions. second, the high overall rates of recommended testing in our health plan population and the study 's focus on members who had not completed testing in the prior year may have limited effectiveness. third, although we compared ato - sr with usual care, comparing this approach with a telephone intervention using human callers would also be useful. fourth, some patients may have been told by their doctors that they do not need to obtain an annual eye exam. because this was a randomized trial, these patients were likely distributed with similar frequency in both study groups, making confounding unlikely. automated telephone outreach may be a valuable adjunct to programs for improving diabetes care in large populations. as with any technological intervention, refinement of this approach may enhance its effectiveness ; this negative study does not rule out the potential for future success. to be effective, these interventions need to incorporate methods for ensuring greater participation, possibly through a partnership with clinicians. further research is also needed to understand the characteristics of patients who may resist this type of intervention in order to develop alternative approaches that might be more effective.	objectivethe study 's objective was to assess the effects of automated telephone outreach with speech recognition (ato - sr) on diabetes - related testing.research design and methodswe identified 1,200 health plan members who were overdue for diabetes - related testing and randomly allocated 600 to ato - sr and 600 to usual care (no intervention). the intervention included three interactive calls encouraging recommended testing. the primary outcome was retinopathy testing, since this was the health plan 's principal goal. tests for glycemia, hyperlipidemia, and nephropathy were secondary outcomes.resultsin total, 232 participants (39%) verbally responded to the calls. there was no difference between the intervention and the usual care groups in the primary outcome (adjusted hazard ratio 0.93 [95% ci 0.711.22 ]) and no effect of the intervention on any of the secondary outcomes.conclusionsfewer than 40% of the patients randomized to ato - sr interacted verbally with the system. the intervention had no effect on the study 's outcomes.
forty heat processed polymethyl methacrylate (pmma) acrylic resin blocks of dimension 1.4 cm 1.4 cm 0.25 cm were obtained by processing wax blocks of similar size poured out of a custom made stainless steel die. these acrylic blocks were smoothened with sandpaper of grit sizes of 100 and 120 respectively and were stored in distilled water at 37c 1c for 50 2 h for the denture base polymer to reach water saturation. this procedure was adopted to simulate the effect of saliva during denture wear before relining. the denture base resin surface to be bonded was smoothed on silicon carbide paper to simulate clinical relief of the denture base for bonding of the reline resins. the bonding surfaces of the acrylic blocks were abraded with 50 m aluminum oxide particles under 0.5 mpa of pressure for 6 s. the surfaces were then brushed with liquid detergent for 20 s, washed with distilled water and blot dried. a cylindrical teflon jig, 24 mm in diameter and 6 mm in height was fabricated. the closed end had a central circular opening, 6 mm in diameter and 3 mm in height so as to limit the bonding of the soft liner to a circular area of 6 mm diameter and standardize the height of the soft liner to 3 mm [figure 1 ]. the custom made teflon jig was placed on the surface treated end of the acrylic resin block. the design of the jig was such that the resin block fits snugly into the internal surface of the cylindrical jig. thus, the assembly serves the dual purpose of delineating the shape and size of the bonding area and preventing the soft liner from contacting the acrylic resin surface outside the circular bonding area [figure 2 ]. assembly of teflon jig acrylic resin block schematic representation of teflon jig acrylic resin block assembly two types of temporary chairside reline materials - an acrylic - based resilient liner (n = 20), and a silicone - based resilient liner (n = 20) were tested in this study. the materials were mixed according to the manufacturer 's instructions and introduced into the teflon jig acrylic resin block assembly and covered on top by an acetate sheet and were allowed to set. thus, 20 bonded specimens were obtained for each type of resilient liner, of which 10 from each group were subjected to thermal cycling for a total of 250 cycles in a distilled water bath between 5c and 55c with a dwell time of 60 s and dry time of 10 s at 27c between the warm and cold cycles using a thermocycling apparatus (haake, w15, germany). all the samples were then tested for shear bond strength in a universal testing machine (instron, llyod instruments, uk) [figure 3 ]. force was applied to the sample in such a way that shear load was exerted directly to the bonding interface at a crosshead speed of 1 mm / min until failure of the bond occurred. shear bond force at which the bond failed was recorded in newton and shear bond strength (mpa) was calculated by dividing the force (n) at which failure of the bond occurred by the surface area of adhesion (mm). surface analysis was carried out on one representative sample per test group selected randomly using scanning electron microscope (sa400n, canada). the mode of failure of tested samples was assessed under 14, 50 and 150 magnifications. the mean shear bond strength values for the four test groups are summarized in table 1. the groups were compared using an independent t - test which showed a statistically significant difference (p = 0.0001) between the acrylic and silicone - based soft liners for both the thermal cycled and nonthermal cycled groups [table 2 ]. furthermore, thermal cycling did not result in any significant change in the shear bond strength both for acrylic and silicone - based soft liner groups (p = 0.194 and p = 0.101, respectively). mean shear bond strength values (mpa) for two types of soft resilient liners overall comparison of the mean shear bond strength values of acrylic based soft liner and silicone based soft liner before and after thermocycling (groups a1, a2, s1 and group s2) sufficient bond strength between the soft liner material and denture base is required to avoid the interfacial separation at the denture borders. lack of durable bond between the resilient liner and the denture is a common clinical problem. the bond strength of the liner - denture base interface has been researched extensively by many authors. al - athel and jagger studied the various bond strength assessment methods namely peel test, tensile bond strength, and shear bond strength between the liner - denture base interface. he concluded that shear forces best represent the oral conditions in which the liner functions. hence, shear bond strength of the material is more indicative of its clinical longevity. the peel test is believed to simulate the horizontal component of masticatory forces as it causes lateral displacement of the denture. tensile test on the other hand predominantly represents the vertical component of the masticatory force. this study was undertaken primarily to evaluate the shear bond strength of two commonly used soft chairside relining materials namely autopolymerizing plasticized acrylic resin (coe soft, gc usa) and vinyl polysiloxane elastomer (gc reline soft, gc usa) to heat processed pmma resin (dpi, india) which is a commonly used denture base material for removable prosthesis. the results showed that the acrylic - based liners demonstrated lower shear bond strength values than the silicone - based liners before and after thermal cycling. the higher bond strength of the silicone - based liners may be attributed to the improved adhesive bonding system used which usually contains silicone polymer in volatile solvents that can penetrate the acrylic resin. the acrylic - based liners though chemically similar to the resin denture base show lower bond strength because of the limited ability of the monomer to penetrate the resin and the varying degrees of polymerization seen. it has been proposed that highly cross - linked denture or denture teeth polymers restrict the penetration of monomers because of the high density of the polymer network, and thus are not as effectively bonded. the mean shear bond strength values obtained for plasticized autopolymerizing acrylic resin - based liner before and after thermal cycling were 0.3365 0.025 mpa and 0.31638 0.04 mpa, respectively. the mean shear bond strength values obtained for silicone baseliner before and after thermal cycling were 0.4159 0.025 mpa and 0.43349 0.02 mpa, respectively. it was noted that the autopolymerizing plasticized acrylic liners demonstrated a marginal decrease in the shear bond strength after thermal cycling, whereas the silicon - based liners demonstrated a marginal increase. the decrease in the bond strength of acrylic - based liners can be attributed to hydration and stress concentration at the bonding interface, in the presence of residual monomer. furthermore silicon - based liners, on the other hand, are hydrophobic and have very low water absorption. after thermocycling, silicone based liner showed an increase in bond strength, which may indicate that the material became more brittle and less viscoelastic. this can also be attributed to its continued polymerization, less water sorption, and changes in the viscoelastic properties which increase the hardness of the liner. it has been suggested that the filler particles present in these materials are responsible for the minimal water absorption seen. the improved bonding of the filler to resin by means of an acryloxy silane and the complete polymerization and cross - linking lead to less unreacted monomer and impurities, more dense material and therefore less water sorption. in this study, surface pretreatment was done to simulate the clinical scenario of chairside relining by removal of a layer of acrylic resin by mechanical abrasion using silicone carbide paper followed by sandblasting. for the silicone liner groups (s1, s2) this was followed by application of primer liquid supplied by the manufacturer since silicone - based soft liners have little or no chemical adhesion to pmma denture base resin. thus, the bond strength of silicone based denture liners depends on the strength of the liner and the adhesiveness of primers used. although the exact chemical composition of such proprietary primers is not known, it is speculated that they may consist of an organic solvent and adhesive monomer which react with both silicone and resin material. soft denture liners are expected to function in the adverse oral environment for long periods of time as well as under rapidly changing temperatures. however, it must be noted that with cyclic temperatures, the thermal behavior of the structural components within a material can influence the latter 's mechanical and physical properties. in this connection, the thermal cycling process can give useful data on the longevity of denture liners with respect to mechanical properties under conditions that simulate clinical usage. the marginal decrease or increase in the shear bond strength of the materials tested after thermal cycling in this study has been shown to be not statistically significant. the paired t - test yielded a two - tailed p = 0.106 for the acrylic control and thermocycled groups (a1, a2). the same for silicone control and thermocycled groups (s1, s2) was 0.161. the independent t - test between the acrylic and silicone control groups (a1, s1) yielded a p < 0.0001. this difference is considered to be extremely statistically significant. the independent t - test between the thermal cycled groups of acrylic and silicone soft liner (a2, s2) yielded a p < 0.0001. the inference is that there is a significance difference in the shear bond strength values between the acrylic - based liner and the silicone - based liner. hence, the choice of a soft liner is based on the expected duration of service of the material in addition to a host of other factors. it can be concluded that both acrylic and silicone based soft liners can be used as temporary and interim resilient liners effectively for a period ranging from 7 days to 3 months. to be used as a permanent liner, silicone - based liners are recommended since they have a better bonding to the denture base and are also known to retain their softness and viscoelastic properties for a longer period. the minimal water sorption, improved polymerization, and biocompatibility favor the use of these materials for long - term relining. qualitative analysis of the interface after testing was performed using scanning electron microscopy to characterize the mode of failure. when observed under the scanning electron microscope, both the acrylic liner groups showed a predominantly adhesive mode of failure with only a few areas of liner remaining adhered to the acrylic resin [figures 4 and 5 ]. this is indicative of the weak adhesive bond which may be attributed to the poor monomer penetration and failure to form a strong interpenetrating network of polymers. silicone based liners under magnification showed mixed mode of failure [figures 6 and 7 ]. areas of both the liner and resin were visible, but the area of liner was more than that which is seen in the acrylic - based liner groups. the predominant mixed mode of failure in silico ne liner groups can be attributed to the primer used. the outline of the primer can be seen as a distinct layer along the boundary of the bonding area. hence, it can be safely inferred that the bonding of silicone based liner was definitely better than the acrylic based liner to the heat polymerized pmma resin used in this study. the focus of this study was to evaluate the shear bond strength of soft liners mainly used for a short term such as during healing period of the denture bearing tissues. as the clinical relevance of thermal setting varies depending on the protocols, equating thermocycling to actual clinical usage may not be accurate. scanning electron microscope photomicrograph of bonding interface between acrylic based soft liner and heat processed polymethyl methacrylate resin (nonthermal cycled- 150) scanning electron microscope photomicrograph of bonding interface between acrylic based soft liner and heat processed polymethyl methacrylate resin (thermal cycled - under 150) scanning electron microscope photomicrographs of bonding interface between silicone based soft liner and heat processed polymethyl methacrylate resin (nonthermal cycled - under 150) scanning electron microscope photomicrographs of bonding interface between silicone based soft liner and heat processed polymethyl methacrylate resin (thermal cycled - under 150) on overall comparison, the silicone - based soft liner showed higher shear bond strength than acrylic - based soft liner both before and after thermal cycling. shear bond strength was found to decrease in case of acrylic - based soft liner while it increased for silicone - based soft liner after thermal cyclingthe qualitative evaluation of the mode of failure of the tested samples using scanning electron microscopy revealed the following : acrylic - based soft liner exhibited predominantly adhesive failure pattern at the liner - acrylic resin interfacesilicone - based soft liner exhibited a mixed adhesive and cohesive failure pattern at the liner - acrylic resin interface. on overall comparison, the silicone - based soft liner showed higher shear bond strength than acrylic - based soft liner both before and after thermal cycling. shear bond strength was found to decrease in case of acrylic - based soft liner while it increased for silicone - based soft liner after thermal cycling the qualitative evaluation of the mode of failure of the tested samples using scanning electron microscopy revealed the following : acrylic - based soft liner exhibited predominantly adhesive failure pattern at the liner - acrylic resin interfacesilicone - based soft liner exhibited a mixed adhesive and cohesive failure pattern at the liner - acrylic resin interface. acrylic - based soft liner exhibited predominantly adhesive failure pattern at the liner - acrylic resin interface silicone - based soft liner exhibited a mixed adhesive and cohesive failure pattern at the liner - acrylic resin interface.	background : chairside softliners are used more frequently than is reported and studies regarding the bond strength of chairside softliners to heat - polymerized denture base resin are few and limited. hence, this study was conducted to comparatively evaluate the shear bond strength of two chairside soft relining materials viz., autopolymerizing plasticized acrylic resin liner and a silicone - based liner bonded to heat polymerized polymethyl methacrylate denture base resin and to analyze the mode of interfacial bond failure.materials and methods : forty test specimens (n = 40) were prepared by bonding plasticized acrylic- and silicone - based soft liner to heat polymerized acrylic resin blocks. twenty specimens, ten from each group, were subjected to thermal cycling and later to shear bond strength testing. the debonded specimens were then qualitatively analyzed for the mode of failure using scanning electron microscopy. the results obtained were tabulated and statistically analyzed.results:the mean shear bond strength values obtained for acrylic - based soft liner before and after thermal cycling were 0.3365 0.025 mpa and 0.3164 0.04 mpa, respectively. the mean shear bond strength values obtained for silicone - based soft liner before and after thermal cycling were 0.4159 0.025 mpa and 0.4335 0.02 mpa, respectively. silicone - based soft liner showed higher shear bond strength than the acrylic - based both before and after thermal cycling (p = 0.0001). scanning electron microscopy analysis showed a predominantly mixed mode of failure with silicone - based liner and predominantly adhesive mode of failure with acrylic - based soft liner.conclusion:the silicone - based soft liner showed higher shear bond strength to heat polymerized acrylic resin than acrylic - based soft liner both before and after thermal cycling.
central serous chorioretinopathy, first described by von graefe in 1866 and also known as recurrent central retinitis,1 is a well characterized disorder leading to serous neurosensory elevation of the retina. the acute form of the disease is associated with focal leakage at the level of the retinal pigment epithelium and hyperpermeability of the choroid, and can be diagnosed on fluorescein and indocyanine green angiography.2 the disorder is self - limiting in the majority of patients, who usually retain excellent vision. however, cases that do not resolve spontaneously can develop pigment epithelium and photoreceptor damage, resulting in permanent visual impairment. the pathophysiology of central serous chorioretinopathy remains poorly understood, but the cascade of events leading to neurosensory detachment includes, or might even be triggered by, changes in choroid permeability. curcumin has antioxidant and anti - inflammatory activity, and has shown efficacy in animal models of acute and chronic inflammation of relevance to eye disease. using cultured corneal cells from the transgenic mouse, it was shown that curcumin targets fibroblast growth factor-2 and inhibits expression of gelatinase b, critically affecting angiogenesis.3 furthermore, in an animal model of dry eye, curcumin showed anti - inflammatory effects in cultured corneal epithelial cells exposed to hyperosmotic conditions.4 finally, curcumin has been shown to reduce oxidative stress, the main cause of cataract progression,3,515 in a murine model of chemically induced hyperglycemia,16 by inhibiting cell proliferation and production of cytokines, which are the main triggers of the inflammatory response.15 curcumin is a pleiotropic agent, for which over 100 different targets have been identified. within an anti - inflammatory context, upregulation of peroxisome proliferator - activated receptor (ppar)-, a ligand - inducible transcription factor, plays a key role, because activation of ppar- controls responses of the microglia and limits inflammation.1721 taken together, these observations provided a rationale for studying the effect of curcumin in patients with central serous chorioretinopathy. this condition is triggered and sustained by inflammation, and a previous study had identified ibuprofen and aspirin as promising agents for the treatment of central serous chorioretinopathy,17,18 in which elevated levels of plasminogen activator inhibitor occur.22,23 curcumin has poor systemic availability, but formulation with phospholipids from lecithin (meriva) dramatically increases its oral absorption,2428 so avoids the use of megadoses that would jeopardize patient compliance. a total of 18 eyes from 12 patients (11 men, one woman) referred to our tertiary retinal center in milan for treatment of central serous chorioretinopathy were enrolled in the study. all patients provided their written informed consent before entering the study, in accordance with the tenets of the declaration of helsinki. diagnosis of central serous chorioretinopathy was based on optical coherence tomography (oct) and angiography with fluorescein and indocyanine green. ophthalmological examination also included slit - lamp examination, early treatment diabetic retinopathy study best - corrected visual acuity measurement, intraocular pressure measurement, and fundus examination using a volk + 90 d lens. enhanced - depth oct is a new imaging modality (spectralis, heidelberg engineering, heidelberg, germany) that allows reproducible measurement of choroidal thickness and may be useful as an aid for differentiating central serous chorioretinopathy from other retinal pathology, eg, age - related macular degeneration. the most recent version of the spectralis software incorporates enhanced - depth imaging into the scanning protocol, but was not available for this study. follow - up is ongoing, but all patients successfully completed at least 6 months of treatment. all patients underwent a full ophthalmological examination at days 0, 30, 90, and 180. all patients received two norflo tablets (eye pharma co, italy) per day, corresponding to 1.2 g of lecithinized curcumin (meriva, indena, milano, italy), during the study period. this therapy was administered to patients who had frequent relapses in the last one year of follow - up, and was started at the time of first diagnosis in nave patients. we also investigated the percentage of satisfaction and tolerance to additional therapy by means of a detailed questionnaire (included on the clinical record sheet) developed to assess patient tolerance and compliance with norflo treatment. visual acuity and neuroretinal or pigment epithelial detachment the student s t - test and wilcoxon signed - rank test were used to assess the statistical significance of changes in best - corrected visual acuity and retinal thickness. at baseline, mean best - corrected visual acuity was 0.63 0.2 (logmar 0.2 0.7). after 6 months of treatment, best - corrected visual acuity improved to 0.8 0.2 (logmar 0.1 0.7) ; 0% of eyes showed reduction in visual acuity, 39% showed stability, and 61% showed improvement (figure 1). average neuroretinal / retinal pigment epithelium detachment at baseline was 317.8 80.2. seventy - eight percent of eyes showed a reduction of neuroretinal / retinal pigment epithelium detachment, 11% showed stability, and 11% showed an increase (figures 2 and 3). mean neuroretinal / retinal pigment epithelium detachment decreased to 277 49.5 in the treatment group, and the difference was statistically significant after 6 months (p = 0.96). no statistically significant differences were observed for near best - corrected visual acuity, and all patients reported improvement in the appearance of the amsler grid as distortions, blurring, discoloration, or other change. the significance testing results simply reflect an insufficient sample size and the distribution of data obtained for visual acuity and oct retinal thickness. anti - inflammatory agents, including ibuprofen and aspirin, have been used in the treatment of central serous chorioretinopathy,23,29 providing a rationale for the use of curcumin in this condition. the anti - inflammatory mechanism of curcumin is pleiotropic, and involves inhibition of proinflammatory transcription factors and enzymes at both the functional and genomic levels. curcumin is also an activator of ppar-,30 a transcription factor, the stimulation and upregulation of which is associated with significant anti - inflammatory activity.7 the main immune cells involved in ocular inflammation are the glia and microglia, in which the function of ppar-, a sensor of metabolism, is critically involved. therefore, modulation of ppar- has considerable potential in many ocular diseases, including vitreoretinopathy, diabetic retinopathy, glaucoma, and age - related macular degeneration.17 despite these interesting clues, the clinical activity of curcumin does not correspond to its pharmacological potential, with the dismally low oral bioavailability of the natural product hampering translation of the many promising results observed in in vitro and animal studies into the clinical setting. to overcome the bioavailability problem, a lecithin formulation of curcumin (meriva) has been developed, and incorporation into a phospholipid matrix leads to an almost 30-fold increase in absorption, effectively overcoming the megadose issue reported in the literature to have plagued this compound.2528,31,32 encouraged by the activity of curcumin in inflammatory eye diseases,1719,26,3341 as well as the improvement in absorption associated with meriva, we investigated the potential of curcumin formulated as norflo tablets in the management of central serous chorioretinopathy, a chronic relapsing eye disease. central serous chorioretinopathy is associated with various conditions characterized by exposure to increased levels of endogenous or exogenous glucocorticoids, as shown by its association with cushing s syndrome. it is also prevalent in patients with type a behavior, and stressful events and pregnancy might represent other risk factors for the disease, all conditions being characterized by endogenous hypercortisolism. in addition, many cases of central serous chorioretinopathy have been described during or following treatment with glucocorticoids administered by any route for various systemic or ocular conditions.42,43 twelve patients were enrolled in this open - label study, with examination of 18 eyes. all patients completed at least 6 months of follow - up with no dropouts, indicating the excellent tolerability of the treatment and good quality of life for patients, with follow - up visits consistently showing overall patient well being. significant reversal of decreased visual acuity and improvement in the histological status of the disease were observed in all patients. in view of the small number of patients in this study, its short follow - up duration, and inclusion of different types of central serous chorioretinopathy, it is theoretically possible that the observed improvement was spontaneous or that resolution was simply coincident with the study treatment. nevertheless, the reduction in retinal pigment epithelium and neurosensory detachment, as well as improvement in visual acuity, but not necessarily disease resolution, suggests that meriva may be efficacious in the treatment of central serous chorioretinopathy. in general, central serous chorioretinopathy has an unpredictable prognosis, so it is difficult to make specific treatment recommendations. however, treatment should be considered after 3 months without spontaneous resolution of acute or chronic central serous chorioretinopathy.43 resolution of detachment can usually be achieved in acute central serous chorioretinopathy by focal photocoagulation of leaking retinal pigment epithelium lesions, and in chronic central serous chorioretinopathy by photodynamic therapy, but the effect of these therapies on long - term visual outcome is not adequately documented. reattachment within 4 months of onset is considered an appropriate therapeutic aim because prolonged detachment is associated with atrophy of photoreceptors. these considerations suggest that treatment with lecithinized curcumin could be useful both as prompt therapy aimed at retinal reattachment and as adjunctive therapy to reduce the number of relapses in the advanced stages of the disease. because of its anti - inflammatory profile and angiogenesis - modulating properties, curcumin has great potential in the treatment of retinal inflammatory conditions and retinal neovascular proliferative diseases sustained by activity of vascular endothelial growth factor.18,19,26,4446 formulation with lecithin has been shown to be beneficial for the absorption of curcumin, and we have shown that lecithinized curcumin (meriva), administered in the form of two tablets of norflo per day, could provide beneficial effects in patients suffering from central serous chorioretinopathy, reversing their decline in visual acuity and improving the histological status of their disease. despite the limitations of this study in terms of number of patients, duration of follow - up, and heterogeneity of central serous chorioretinopathy, the reduction in retinal pigment epithelium and neurosensory detachment, as well as improvement in visual acuity, is very promising. our results suggest that appropriately formulated curcumin has great potential in the management of central serous chorioretinopathy, and provides a rationale for initiation of larger placebo - controlled studies that might also consider the combination of curcumin with other therapeutic options to treat this disease, eg, low - fluence photodynamic therapy and intravitreal therapy.	backgroundthe purpose of this open - label study was to investigate the effect of a curcumin - phospholipid (lecithin, meriva) formulation (norflo tablet) on visual acuity and retinal thickness in patients with acute or chronic central serous chorioretinopathy.methodsvisual acuity was assessed by ophthalmologic evaluation, and optical coherence tomography was used to measure retinal thickness. norflo tablets were administered twice a day to patients affected by central serous chorioretinopathy. the study included 18 eyes from 12 patients who completed a 6-month follow - up period. visual acuity before and after norflo treatment was the primary endpoint. the secondary endpoints were neuroretinal or pigment epithelial detachment, as measured by optical coherence tomography.resultsafter 6 months of therapy, 0% of eyes showed reduction in visual acuity, 39% showed stabilization, and 61% showed improvement. the improvement was statistically significant (p = 0.08). after 6 months of therapy, 78% of eyes showed reduction of neuroretinal or retinal pigment epithelium detachment, 11% showed stabilization, and 11% showed an increase.conclusionour results, albeit preliminary, show that curcumin administered as norflo tablets is efficacious for the management of central serous chorioretinopathy, a relapsing eye disease, and suggest that bioavailable curcumin is worth considering as a therapeutic agent for the management of inflammatory and degenerative eye conditions, including those that activate the retinal microglia.
unlike t and b lymphocytes, which are defined by the expression of their canonical receptors tcr and bcr, respectively, the definition of other immune cell lineages requires careful use of both analytical and functional readouts because of the promiscuous expression of certain receptors on multiple cell types. this has led to significant controversy in the literature in assigning lineages to certain cell populations. defining nk cell populations exemplifies this issue, as nk cell receptors are expressed on a large variety of hematopoietic cell types. nk cells are a major component of the innate immune system, mediating killing of tumors and virus - infected cells. nk cells can also mount anamnestic responses, and thus presumably go beyond the conventional boundaries of innate and adaptive immunity (cooper., 2009). interestingly, il7rcd3nk1.1 cells have also been implicated in the neonatal phase of lymph node maturation (coles., nk cells are thought to differentiate from the common lymphoid progenitor that generates b and t lymphocytes. interestingly, nk cell precursor activity has been found outside the bone marrow, suggesting that cnk cells may develop under the influence of local cues in the periphery. nk cell development is tightly controlled by il-15, which is critical for their generation, differentiation, and survival (kennedy., 2000). defining cnk cells in the periphery is complicated because of their ability to differentiate into functionally distinct populations. in humans, cd56 nk cells have an enhanced capacity for cytokine production, whereas cd56 cells have more potential for cytotoxic killing. similar populations can be found in mice based on their expression of cd27. additionally, as seen with t helper subsets, nk cells can differentiate into nk1 and nk2 populations based on cytokine secretion profiles (cooper., nkp46 is used to distinguish nk cells from other lymphoid populations across mammalian species (walzer., 2007). however, recent studies have described additional diversity within nkp46 populations from the intestine and tonsils (satoh - takayama., 2008 ; cella., 2009 ; for example, mouse intestinal cd3nkp46 cells can be divided into two main subsets based on the expression of il7r (cd127) and nk1.1 (satoh - takayama., 2008). importantly, these subsets appear to mediate different functions because il7rnk1.1 cells are similar to cnk cells, producing perforin and ifn-, whereas il7rnk1.1 cells lack these effector functions. instead, they express il-22 and rorc (satoh - takayama., 2008 ; luci. interestingly, cells with similar characteristics to murine nkp46il7rnk1.1 cells have also been described in human tonsils, intestinal lamina propria, and peyer s patches (cella., 2009 ; cupedo., rorc is involved in a variety of different processes, including thymocyte survival, differentiation of il-17producing t cells, and development of lti cells, but it is dispensable for the development of cnk cells (sun., 2000 ; ivanov., 2006 ; satoh - takayama., thus, these cells may express a putative universal nk marker, but they also express a factor shown to be essential for the development of different cell lineages. given the promiscuity of surface molecule expression, accurate classification of nk lineages may need to rely more on transcription factor expression patterns. for example, differential expression of the transcription factors foxp3, gata-3, t - bet, and rorc has, rather reliably so far, identified t helper cell subsets that could not be distinguished through the expression of surface markers alone (dong and flavell, 2000). although cnk cells have been studied for many years, the role of lti cells in the immune system has been addressed only relatively recently. it is commonly accepted that development of secondary lymphoid tissues depends on productive interactions between hematopoietic lymphoid tissue inducer (lti) cells and stroma lymphoid tissue organizer cells (veiga - fernandes. lti cells were first characterized by saxer in 1896 as wandering lymphocytes found in the early stages of developing lymph node anlagen (sabin, 1913). the current common view is that lti cells express rorc, il-7r, lymphotoxin 12, and, in mice, cd4 (randall., 2008). despite the absence of lineage marker expression on these cells, experimental evidence has suggested that lti cells may be developmentally related to conventional nk cells (mebius., 1997). for instance, in the absence of helix loop helix inhibitor id2, both lti cells and nk cells fail to develop, as e2a - encoded e proteins repress the development of both cell types (yokota., 1999 ; furthermore, nk1.1 cells can develop in in vitro cultures of fetal lti cells (mebius., 1997). however, despite being developmentally related, it is clear that lti and conventional nk cells belong to distinct lineages. thus, although rorc is required for lti development, it is dispensable for the development of nk cells (sun., 2000 ; satoh - takayama., conversely, the transcription factor e4bp4 is absolutely required for the development of conventional nk cells, but lti development is seemingly unaffected in e4bp4-deficient mice, as revealed by normal development of secondary lymphoid organs (gascoyne., 2009). finally, although cnk cells are highly dependent on il-15, lti development is not affected by the absence of this cytokine (kennedy., 2000 ; the discovery of rorcnkp46il7rnk1.1 cells and their human equivalents raised the possibility that this cell type could be the missing developmental link between lti and nk cells. in fact, it was shown that human cd56 il7r lti - like cells develop into cd56il7r cells after in vitro culture (cupedo., 2009). given their immature phenotype, it is possible that the population of nkp46il7r cells could contain nk cell precursor activity, which can differentiate in a local environment and give rise to specialized nk subsets (colonna, 2009). in this issue, two studies address the question of whether mouse and human nkp46 cells are nk precursor cells or a distinct lineage. because id2 is essential for lti and nk cell development, the study by satoh - takayama. (2010) starts by revisiting the impact of id2 ablation on enteric nkp46 cells (yokota., 1999). analysis of id2-deficient mice revealed that, indeed, normal development of nkp46 subsets required id2, strengthening the notion that, at least developmentally, these cells are related to lti and cnk cells. to further explore the relationship between enteric nkp46 cells and their putative relatives, lti and cnk cells, the authors examined mice with altered expression of il-15 or il-7. analysis of enteric nkp46 cells in mice that overexpress il-15 in the intestine revealed that although nkp46il7rnk1.1 homeostasis was not perturbed, the numbers of nkp46il7rnk1.1 cells were significantly increased in these mice. conversely, although the homeostasis of nkp46il7rnk1.1 cells was strongly impaired by an absence of il-7, nkp46il7rnk1.1 cnk cell numbers were not affected. thus, nk1il7r and nk1il7r subsets are seemingly two separate cell subsets with respect to il-7 and il-15 dependency (fig. 1). ncr22 and conventional nk cells have different function and ontogeny. ncr22 and cnk cells home to mucosal sites and mucosal - associated lymphoid tissues. upon interaction with microbial components, mucosal dendritic cells produce il-23, which stimulates ncr22 cells to secrete il-22, which is believed to protect the mucosa and control inflammation. in response to dendritic cell - derived cytokines such as il-1, il-12, and il-18, cnk cells produce ifn-, perforin and granzymes, which target pathogen infected cells. in the absence of helix - loop - helix inhibitor id2, however, the development of these cell types differs in its dependency on il-7, il-15, rort and e4bp4. (2010), which initially examined whether human lti - like cd56il7r or cd56il7r cells convert to cnk cells upon in vitro expansion. using bulk cultures and clonal analysis, the authors show that cd56il7r lti - like cells differentiate in to cd56il7r cells, but importantly, both subsets maintain rorc expression and do not convert to cnk cells. these observations support the idea that lti - like cells and cd56il7r cells belong to a lineage distinct from cnk cells. (2010) provide further support for this concept with elegant in vivo fate mapping experiments. bac transgenic mice that express cre recombinase under control of the rorc promoter were bred to mice that have the eyfp gene knocked into the ubiquitously expressed rosa26 locus, which is preceded by a triple polyadenylation signal flanked by two loxp sites. in these mice, cells that express rorc at some point during development the authors found that although nkp46il7r cells in the intestine expressed eyfp, no eyfp expression was observed in nkp46il7r enteric cells or cnk cells found in lymphoid organs. collectively, these two studies demonstrate that despite expressing nk receptors, nkp46il7r cells are a distinct lineage and not precursors of cnk cells. in general, the naming of cells and receptors brings with it welcome simplicity in an ever complex world of cell types, but it also brings a burden of expectation. thus, the expression of nk receptors does not mean a cell has nk function. ncr22s, succinctly highlighting the key functional features of these cells : natural cytotoxicity receptor expression, rorc expression, and il-22 production, which differentiates them from cnk cells in both phenotype and function. the development and maintenance of specialized lymphoid stromal cells is essential for the generation of protective immune responses. although the function of lti lineage in lymphoid organ development has been well established, their role in adult tissue maintenance is less clear. the discoveries that il-22 production by ncr22 cells may mediate mucosal immune defense, and adult lti - like cells contribute to stromal regeneration after lcmv infection, suggest a significant role for the adult lti lineage in the maintenance and regeneration of adult tissues (satoh - takayama. however, many interesting questions remain regarding the function of ncr22 cells and the role of il-22 within specific tissue microenvironments in development, homeostasis, and disease. since sykes and ballas first showed expression of nk cell receptors on t cells 20 yr ago (ballas and rasmussen, 1990 ; sykes, 1990), the presence of nk cell receptors on unconventional lymphocytes has identified exciting new cell populations.	a population of cells that expresses the nk cell receptor nkp46 and produces interleukin (il)-22 have recently attracted considerable attention. the identity of these cells is still the subject of speculation, being variably defined as a novel nk cell subset or as a population containing conventional nk (cnk) cell precursors. in this issue, two studies shed light on this conundrum, demonstrating that nkp46 + il-22 + cells and cnk cells belong to distinct lineages.
the optimal treatment of schatzker type v and vi tibial plateau fractures is a controversial and challenging. most patients have significant residual dysfunction even after the completion of treatment.1 though open reduction and internal fixation (orif) of these fractures provides good fracture reduction and stability, several authors have reported high rates of complications deep wound infection, unplanned secondary procedures, and even amputation.1234 lasanianos.5 in their biomechanical study comparing intramedullary nailing and compression bolt fixation with single lateral locking plate fixation and dual plating technique in the osteosynthesis of schatzker type vi fractures showed that the collapse of the medial tibial plateau occurred exclusively in the single lateral locking plate fixation group.5 though superior to single lateral plate fixation, the dual plating technique is more damaging to the already compromised soft tissues in these high energy injuries and the wound infection rate with dual plating is as high as 20%.1 these problems prompted the development of ilizarov ring fixation with or without minimal internal fixation as an alternative method for bicondylar fracture treatment. while the ilizarov fixator seems a reasonable method of fixation of these fractures, there are few problems, including the inconvenience of an external fixator that requires careful maintenance, possibility of pin tract infections and subsequent collapse of the fracture fragments.4 however, it is useful in the treatment of open schatzker type v and vi tibial plateau fractures, where the incidence of infection has been shown to be relatively high with plating. we managed our cases of schatzker type v and type vi fractures with such a protocol, which combines the benefits of both systems [figure 1 ]. we do not intend to compare the results of dual plating vs ilizarov fixation, as both have been used under different circumstances in our study. all patients with schatzker type v and vi tibial plateau fractures admitted in our institute between 2006 and 2010 were recruited. they were excluded if they had ipsilateral fractures of the femur, any other lower limb fractures, open type 3 c tibial fractures, or severe head injury with permanent neurological deficits. they were evaluated clinically and standard antero - posterior (ap) and lateral radiographs were taken. computerized tomography (ct) scans were done only in selected patients, who had significant articular depression and comminution on x - rays. patients were treated with dual plating or the ilizarov fixator, based on the above mentioned protocol [figure 1 ]. in a closed fracture with minimal articular displacement (2 mm, we prefer orif with dual plates using two incisions, as reduction of markedly displaced fractures and maintenance of the reduction is better with plates. we use the posteromedial approach as described by barei.,6 along with the standard anterolateral approach. we initially used small fragment reconstruction plates on the medial side, but now prefer locked reconstruction plates. proximal tibial locking plates are used on the lateral sidedue to the possibility of infection in open fractures, dual plating is not done, even if there is marked displacement. at the time of the initial debridement, articular reduction is obtained and maintained with k wires and screws and a ring fixator is applied. if soft tissue cover is required or if there is significant soft tissue damage to warrant secondary soft tissue procedures, a trans - articular external fixator is applied, as it is difficult to do a flap cover with the ring fixator in situ. once the soft tissues heal, this is converted to an ilizarov fixator (usually at 3 weeks)in open fractures with marked displacement thatrequire bone grafting / substitutes, it is done primarily along with minimal internal fixation and ring fixator application, only if the wound contamination and soft tissue damage are minimal and if surgery is done early, usually within 12 hours of the injury. else, it is done as a staged procedurethe ring fixator is usually a three ring construct that consists of a proximal ring with two wires, just above the level of the fibular head ; with an additional drop - wire if needed, in the proximal fragment. the second ring is placed at the level of the distal shaft fragment, 1 inch below the fracture line. a third ring is placed distally, near the ankle. for severely comminuted and displaced plateau fractures, an additional distal femoral ring with three wires this is removed after 4 - 6 weeks. in a closed fracture with minimal articular displacement (2 mm, we prefer orif with dual plates using two incisions, as reduction of markedly displaced fractures and maintenance of the reduction is better with plates. we use the posteromedial approach as described by barei.,6 along with the standard anterolateral approach. we initially used small fragment reconstruction plates on the medial side, but now prefer locked reconstruction plates. proximal tibial locking plates are used on the lateral side due to the possibility of infection in open fractures, dual plating is not done, even if there is marked displacement. at the time of the initial debridement, articular reduction is obtained and maintained with k wires and screws and a ring fixator is applied. if soft tissue cover is required or if there is significant soft tissue damage to warrant secondary soft tissue procedures, a trans - articular external fixator is applied, as it is difficult to do a flap cover with the ring fixator in situ. once the soft tissues heal, this is converted to an ilizarov fixator (usually at 3 weeks) in open fractures with marked displacement thatrequire bone grafting / substitutes, it is done primarily along with minimal internal fixation and ring fixator application, only if the wound contamination and soft tissue damage are minimal and if surgery is done early, usually within 12 hours of the injury. else, it is done as a staged procedure the ring fixator is usually a three ring construct that consists of a proximal ring with two wires, just above the level of the fibular head ; with an additional drop - wire if needed, in the proximal fragment. the second ring is placed at the level of the distal shaft fragment, 1 inch below the fracture line. a third ring is placed distally, near the ankle. for severely comminuted and displaced plateau fractures, an additional distal femoral ring with three wires postoperatively, patients were encouraged to start early knee range of movement exercises and quadriceps strengthening exercises. knee rom was allowed only after distal femoral ring removal (usually at 6 weeks), in cases where it was used. partial weight bearing with crutches was allowed in patients with the ring fixator and non - weight bearing crutch walking for patients with dual plating, started after drain removal. the final outcome measures were assessed at a minimum of 1 year from the date of surgery. the outcome measures were assessed using the honkonen and jarvinen (hj) criteria7 subjective, radiological, clinical, and functional outcome measures and the womac8 - western ontario and mcmaster universities arthritis index. twenty one patients were assessed with a minimum follow up of 1 year. there were 20 males and 1 female in the study group. the mean age of the group was 43.85 years (range 22 - 61 years). three patients had associated anterior cruciate ligament (acl) tibial bony avulsion and one patient had patellar tendon avulsion from the tibial tuberosity. four patients with type 3a open fractures and eight patients with closed fractures and poor skin condition / minimal articular displacement (n=12) underwent minimal internal fixation and ilizarov ring fixation, while nine patients underwent dual plating. one of the patients with ilizarov fixation had fixation of acl tibial avulsion and another had fixation of the patellar tendon with cancellous screws. distal femoral ring was used in addition to the three - ring construct in these two patients, and was removed at 6 weeks. the mean duration between the injury and the primary surgery was 5.11 days (range 12 hours-21 days). the mean time of follow up for the outcome assessment from primary surgery was 29 months (range 13 - 47 months). all patients were walking without aids at an average period of 5.86 months from surgery (range 4 - 7 months). patients with ilizarov rings walked without any aid at an average of 5.6 months, while the patients who underwent dual plating did so at 6 months. the average time to return to their job after the injury was 6.66 months (range 3 - 18 months). thirteen patients returned to their original job within 6 months from injury, once they were able to walk unassisted. one patient had to change his job due to decreased range of movement of the injured knee. the womac score is primarily used to assess pain, stiffness and physical function in patients with osteoarthritis of the knee and hip. we used the womac score in our study to look for early secondary knee osteoarthritis after tibial plateau fractures. the average womac score in our study was 7.23, which is a good outcome on the scale between 0 [best ] and 96 [worst ]. 14 patients had a score of 1 - 11 and 4 had a score of 12 - 22. the symptoms analyzed include pain during activities, swelling, stiffness, weakness, limping, giving way, and crepitation. a score of 1 to 5 was excellent ; 6 to 10 good ; 11 to 15 fair ; and 16 to 25 poor. the subjective score in the study group was excellent for 76.2% of the patients. sixteen patients were totally pain free during activities and five had mild pain. of the five, one had a minimally displaced open fracture, one had a markedly displaced closed fracture, and the remaining three were minimally displaced closed fractures. one patient felt occasional giving way at the operated knee, which was of slight importance to him. the final clinical outcome score was good in 13 patients, fair in 7 patients, and poor in 1 patient. the clinical outcome score has 4 components : extension lag, range of movement, thigh atrophy and stability at the knee. the average knee flexion was 128.09 [figures 2a, 2b, 3a and 3b ]. the range of movement varied from 90 to 145. there were three patients with a flexion range of less than 110. two had markedly displaced closed fractures and one had a minimally displaced open fracture treated with a ring fixator. the average thigh atrophy in the operated side was 1.5 cm (range 1 - 4 cm) as compared to the contralateral normal thigh. though three patients had mild anteromedial instability on clinical assessment, only one patient had a sense of occasional giving way at the knee on walking. (a) x - ray of knee joint (anteroposterior and lateral views) showing tibial plateau fracture (b) anteroposterior radiograph of knee joint showing ilizarov fixator in situ (c) anteroposterior and lateral radiographs of knee joint of same patient showing followup radiograph after ilizarov removal. good knee flexion in a patient treated with a circular fixator x - ray anteroposterior and lateral views showing (a) tibial plateau fracture (b) dual plating for tibial plateau fracture clinical photograph of same patient showing range of motion 19 patients had excellent walking and 2 had good walking function (walking with slight limp). 19 patients had excellent stair climbing function and 2 had mild pain while climbing stairs. two of them had markedly displaced closed fractures and one had minimally displaced closed fracture. the poor squatting function in the 3 patients was due to poor knee range of movement and not due to pain. excellent jumping meant that they were able to jump a distance similar to the uninjured leg, without pain. most patients had a good radiological score, with only two having a fair score. differences of even 1 degree of plateau tilt from the opposite knee or 1 mm of articular step would classify the result as good and not excellent. a difference of more than 5 degree plateau tilt or a 3 mm articular step was a there were four components in the radiological score and the worst of them was shown as the final radiological score. figures 4 and 5 show the radiographs of patients treated with the ring fixator and dual plates respectively with good radiological outcome. (a) x - ray anteroposterior view of knee joint showing tibial plateau fracture (b) x - ray anteroposterior view treated with minimal internal fixation and a ring fixator (c) x - ray anteroposterior and lateral views showing negligible plateau tilt and articular step anteroposterior and lateral radiographs of a patient showing (a) tibial plateau fracture (b) dual plates / bone grafting and good radiological outcome. seventeen patients had plateau tilt within 5 degrees from the opposite side and had scored good. three patients had scored fair (mean tilt-7 degrees) and only one patient had scored poor with a tilt of 11 degrees. this patient had a markedly displaced closed fracture with a preop articular step of 10.54 mm and preoperative intercondylar widening of 13.34 mm. the fracture was fixed using dual plates and postoperatively, there was no intercondylar widening or an articular step ; but at years follow - up, there was 11 degrees varus tilt. seventeen patients did not have any articular step at final follow up based on radiographs. the average pre - operative articular step was 5.34 mm (range 0 - 10.54 mm). the average articular step postoperatively was 0.42 mm (range 0 - 2.74 mm). of the four patients with a mild articular step postoperatively (1 - 3 mm), three had been treated with the ilizarov fixator and one with dual plating. the average postoperative condylar widening was 3.17 mm (range 0 - 10 mm). the average preoperative condylar widening was 6.19 mm (range 5 - 16.97 mm). fourteen patients scored good (within 5 mm) and one patient scored poor with condylar widening of 10 mm. this patient had a closed fracture treated with minimal internal fixation and ilizarov ring and had fair final functional score. four patients did not have any decrease in joint space as compared to the uninjured knee in anteroposterior radiographs. in the remaining 17 patients, two patients treated with minimal internal fixation and ilizarov ring fixation had pin site infection, which did not require wire exchange. one of these patients had an open fracture and the other had a closed, minimally displaced fracture. the womac score is primarily used to assess pain, stiffness and physical function in patients with osteoarthritis of the knee and hip. we used the womac score in our study to look for early secondary knee osteoarthritis after tibial plateau fractures. the average womac score in our study was 7.23, which is a good outcome on the scale between 0 [best ] and 96 [worst ]. 14 patients had a score of 1 - 11 and 4 had a score of 12 - 22. the symptoms analyzed include pain during activities, swelling, stiffness, weakness, limping, giving way, and crepitation. a score of 1 to 5 was excellent ; 6 to 10 good ; 11 to 15 fair ; and 16 to 25 poor. of the five, one had a minimally displaced open fracture, one had a markedly displaced closed fracture, and the remaining three were minimally displaced closed fractures. one patient felt occasional giving way at the operated knee, which was of slight importance to him. the final clinical outcome score was good in 13 patients, fair in 7 patients, and poor in 1 patient. the clinical outcome score has 4 components : extension lag, range of movement, thigh atrophy and stability at the knee. the average knee flexion was 128.09 [figures 2a, 2b, 3a and 3b ]. the range of movement varied from 90 to 145. there were three patients with a flexion range of less than 110. two had markedly displaced closed fractures and one had a minimally displaced open fracture treated with a ring fixator. the average thigh atrophy in the operated side was 1.5 cm (range 1 - 4 cm) as compared to the contralateral normal thigh. though three patients had mild anteromedial instability on clinical assessment, only one patient had a sense of occasional giving way at the knee on walking. (a) x - ray of knee joint (anteroposterior and lateral views) showing tibial plateau fracture (b) anteroposterior radiograph of knee joint showing ilizarov fixator in situ (c) anteroposterior and lateral radiographs of knee joint of same patient showing followup radiograph after ilizarov removal good knee flexion in a patient treated with a circular fixator x - ray anteroposterior and lateral views showing (a) tibial plateau fracture (b) dual plating for tibial plateau fracture clinical photograph of same patient showing range of motion 19 patients had excellent walking and 2 had good walking function (walking with slight limp). 19 patients had excellent stair climbing function and 2 had mild pain while climbing stairs. two of them had markedly displaced closed fractures and one had minimally displaced closed fracture. the poor squatting function in the 3 patients was due to poor knee range of movement and not due to pain. excellent jumping meant that they were able to jump a distance similar to the uninjured leg, without pain. most patients had a good radiological score, with only two having a fair score. differences of even 1 degree of plateau tilt from the opposite knee or 1 mm of articular step would classify the result as good and not excellent. a difference of more than 5 degree plateau tilt or there were four components in the radiological score and the worst of them was shown as the final radiological score. figures 4 and 5 show the radiographs of patients treated with the ring fixator and dual plates respectively with good radiological outcome. (a) x - ray anteroposterior view of knee joint showing tibial plateau fracture (b) x - ray anteroposterior view treated with minimal internal fixation and a ring fixator (c) x - ray anteroposterior and lateral views showing negligible plateau tilt and articular step anteroposterior and lateral radiographs of a patient showing (a) tibial plateau fracture (b) dual plates / bone grafting and good radiological outcome. seventeen patients had plateau tilt within 5 degrees from the opposite side and had scored good. three patients had scored fair (mean tilt-7 degrees) and only one patient had scored poor with a tilt of 11 degrees. this patient had a markedly displaced closed fracture with a preop articular step of 10.54 mm and preoperative intercondylar widening of 13.34 mm. the fracture was fixed using dual plates and postoperatively, there was no intercondylar widening or an articular step ; but at years follow - up, there was 11 degrees varus tilt. seventeen patients did not have any articular step at final follow up based on radiographs. the average pre - operative articular step was 5.34 mm (range 0 - 10.54 mm). the average articular step postoperatively was 0.42 mm (range 0 - 2.74 mm). of the four patients with a mild articular step postoperatively (1 - 3 mm), three had been treated with the ilizarov fixator and one with dual plating. the average postoperative condylar widening was 3.17 mm (range 0 - 10 mm). the average preoperative condylar widening was 6.19 mm (range 5 - 16.97 mm). fourteen patients scored good (within 5 mm) and one patient scored poor with condylar widening of 10 mm. this patient had a closed fracture treated with minimal internal fixation and ilizarov ring and had fair final functional score. four patients did not have any decrease in joint space as compared to the uninjured knee in anteroposterior radiographs. in the remaining 17 patients, seventeen patients had plateau tilt within 5 degrees from the opposite side and had scored good. three patients had scored fair (mean tilt-7 degrees) and only one patient had scored poor with a tilt of 11 degrees. this patient had a markedly displaced closed fracture with a preop articular step of 10.54 mm and preoperative intercondylar widening of 13.34 mm. the fracture was fixed using dual plates and postoperatively, there was no intercondylar widening or an articular step ; but at years follow - up, there was 11 degrees varus tilt. seventeen patients did not have any articular step at final follow up based on radiographs. the average pre - operative articular step was 5.34 mm (range 0 - 10.54 mm). the average articular step postoperatively was 0.42 mm (range 0 - 2.74 mm). of the four patients with a mild articular step postoperatively (1 - 3 mm), three had been treated with the ilizarov fixator and one with dual plating. the average postoperative condylar widening was 3.17 mm (range 0 - 10 mm). the average preoperative condylar widening was 6.19 mm (range 5 - 16.97 mm). fourteen patients scored good (within 5 mm) and one patient scored poor with condylar widening of 10 mm. this patient had a closed fracture treated with minimal internal fixation and ilizarov ring and had fair final functional score. four patients did not have any decrease in joint space as compared to the uninjured knee in anteroposterior radiographs. in the remaining 17 patients, two patients treated with minimal internal fixation and ilizarov ring fixation had pin site infection, which did not require wire exchange. one of these patients had an open fracture and the other had a closed, minimally displaced fracture. the optimal treatment of schatzker type v and vi tibial plateau fractures has remained challenging and controversial, despite the development of various new techniques of fracture reduction, implants for fracture fixation and better techniques of soft tissue handling. the earlier reports of internal fixation with plates by young and barrack,2 moore.,3 and mallik.4 had unacceptably high rates of deep wound infection. uhl.9 reported postoperative skin infection and osteomyelitis in 42% and 33% of patients treated with dual plates. the recent randomized controlled trial by the canadian orthopedic trauma society reported 20% deep wound infection in the patient group treated with open reduction and dual plating.1 they also reported high rates of unplanned secondary procedures which included incision and drainage, soft tissue flaps, redo orif, plate removal, knee manipulation, total knee replacement and even above knee amputation. this prompted several authors to use the ring fixator with or without minimal internal fixation as an alternative method for tibial bicondylar fracture fixation. kataria.10 evaluated 38 high - energy tibial plateau fractures (16 schatzker type v and 22 type vi fractures) treated with ring fixators. they showed promising results with only two superficial infections and three minor pin site infections. the average knee flexion was 132. the canadian orthopedic trauma society study group also had excellent results with the use of ring fixators. we treated these complex injuries in a more systematic way, utilizing the benefits of both the treatment methods available. the subjective score as scored by the patients themselves regarding various symptoms was excellent in most of the patients. the average postoperative knee flexion in our study was 128.09, which is better than results in recent literature. the average knee range of movement in the randomized controlled trial by the canadian orthopedic trauma society was 109 in the dual plating group and 120 in the circular external fixator group.1 in our study, no patient had significant deep infection, requiring implant removal prior to bony union. the average wound infection rate in the literature is around 20% in the dual plating group,1 requiring significant number of unplanned secondary procedures. also, orif with dual plates is associated with many complications, especially with open tibial plateau fractures.11 by not performing orif in open cases and closed fractures with compromised skin, we have managed to reduce complication rates to a minimum in these complex fractures. all patients except one were able to return to their job at an average of 6.66 months. in other studies, patients with bicondylar tibial fractures have significant residual dysfunction even after completion of treatment.112 the canadian orthopedic trauma society 's study showed that only few patients were able to return to their normal pre - injury activities. to conclude, schatzker type v and vi tibial plateau fractures when treated using our protocol had good clinical, functional, and radiological outcomes, with low infection rates. however, prospective studies involving larger number of patients are required to establish a protocol for this type of injuries.	background : schatzker type v and vi tibial fractures are complex injuries, usually treated with open reduction and internal fixation (orif) using dual plates or ring fixators. orif has the advantage of not requiring pin tract care, but has a higher infection rate, especially in open fractures. we have combined the advantages of these two methods to treat these difficult fractures.materials and methods : ten schatzker type v and 11 schatzker type vi fractures were treated between 2006 and 2010. orif with dual plates was performed, only if there was marked articular displacement (> 2 mm) in a closed fracture. all other fractures including open fractures and closed fractures with soft tissue compromise or minimal articular displacement were treated with ring fixators. the outcomes were analyzed and documented using the honkonen and jarvinen subjective, clinical, functional, and radiological criteria and the western ontario and mcmaster universities arthritis index (womac).results : nine closed fractures with marked articular displacement (> 2 mm) were treated with dual plates. eight closed fractures with minimal articular displacement (< 2 mm) and poor skin condition and four open fractures were treated with ring fixators. the mean follow - up period was 2 years. the mean postoperative knee flexion was 128. all patients could walk, jump, and climb steps. 90% could squat, though only 50% could duck walk properly. radiologically, 85% had a plateau tilt of less than 5, 92% had an articular step of less than 2 mm, and a residual articular widening of less than 5 mm. there were no major infections. two patients had minor pin tract infections and two requested that their plates be removed subsequently.conclusion:the protocol used to treat schatzker type v and vi tibial plateau fractures has had excellent results and we suggest that all open fractures be treated with ring fixators and that orif should be done only for closed fractures with marked displacement.
diverse pathogens have evolved virulence factors that mimic host cell functions (elde and malik, 2009). this molecular mimicry, presumably acquired through either divergent or convergent evolution, is indispensible for pathogens to exploit or subvert the host cellular processes for efficient infection. a fascinating example of the molecular mimicry is pathogen - encoded f - box proteins. as a component of the scf (skp1-cul1-f - box protein) ubiquitin ligase complex, f - box proteins mediate polyubiquitination of target proteins and the subsequent proteasome - dependent protein degradation in eukaryotic cells (petroski and deshaies, 2005 ; lechner., 2006 ; vierstra, 2009 ; hua and vierstra, 2011). surprisingly, an f - box - coding gene was also found in agrobacterium tumefaciens, a bacterial pathogen that causes neoplastic growths and crown gall disease in plants (schrammeijer., 2001). considering that prokaryotes possess neither the ubiquitin/26s proteasome system (ups) nor the functional scf ubiquitin ligase complex, the agrobacterium - encoded f - box protein presumably does not function in the bacterial cell. rather, agrobacterium translocates this f - box effector into plant cell (vergunst., 2000, 2005) and hijacks the host scf complex to facilitate bacterial infection (tzfira., 2004). since this discovery, similar f - box - like effector proteins have been described in many other viral and bacterial pathogens, including a human pathogen legionella pneumophila (price., 2009 ; lomma., furthermore, a recent bioinformatic analysis identified at least 74 putative f - box proteins encoded by 22 different bacterial species, most of which are known pathogens (price and kwaik, 2010). this finding further suggests the importance and widespread utilization of pathogen - derived f - box proteins for the infection strategy. like animals, plants face a challenge to adapt their development and growth to a rapidly changing environment. in particular, preparing for a potential threat from a wide array of pathogens is crucial for survival of plants. increasing evidence suggests that plants utilize the ups to recognize and combat pathogen invasion (zeng., 2006 ; citovsky.,, plants often exploit the scf ubiquitin ligase complexes, thereby targeting negative regulators of their own defense response and/or pathogen - derived proteins for degradation (zeng., 2006 ; citovsky., notably, plants encode an unusually large number of f - box proteins, the substrate specificity module of the scf complex (gagne., 2002 ; hua and vierstra, 2011). for example, the model plant arabidopsis thaliana possesses almost 700 f - box genes, which represent almost 2.3% of the protein - coding genes (gagne., 2002 ; hua and vierstra, 2011). by comparison, fruit flies and humans encode only 27 and 69 f - box proteins, respectively (hua and vierstra, 2011). furthermore, a maximum - likelihood analysis of codon evolution predicted that most of plant f - box genes are likely subject to positive selection specifically in the c - terminal substrate - binding domains (thomas, 2006). such site - specific positive selection in plant f - box genes as well as their high degree of diversity are reminiscent of the major histocompatibility complex (mhc) molecules (hughes and nei, 1988, 1989a, b), the membrane - associated proteins that activate immune responses in vertebrates by binding fragments of foreign proteins (i.e., antigens). based on these evolutionary features shared by plant f - box genes and mhc molecules, it is tempting to speculate that plants may have evolved a diverse array of f - box proteins (hence, a wide variety of different scf complexes) to enable broad protection against innumerable invading pathogens. if this is the case, it is not surprising that plant pathogens, in turn, have evolved a counter - defense strategy using a molecular mimic of f - box proteins to disrupt or co - opt the defense - associated scf machinery of the host plants. although only a few phytopathogen - encoded f - box proteins have been intensively studied thus far, understanding the role of such an f - box effector during the corresponding pathogen infection process is highly informative to illustrate the molecular arms race between host plants and pathogens. here, we summarize the basic concepts of the ups as well as the scf ubiquitin ligase complex, and provide several case studies on plant pathogen - derived f - box proteins, including virf of a. tumefaciens, galas of ralstonia solanacearum, and p0 of poleroviruses. post - translational modifications regulate the molecular function of target proteins by modulating their activity, stability, localization, and affinity to other molecules. among many known post - translational modifications, addition of ubiquitin moieties (i.e., ubiquitination) is known to be a highly complex process regulated by numerous cellular factors, and plays an essential role in diverse biological processes. ubiquitin is a 76-amino acid polypeptide that is highly conserved among eukaryotes. as its name suggests, covalent attachment of ubiquitin to its target protein is mediated by a reaction cascade involving three classes of enzymes : ubiquitin - activating enzymes (e1), ubiquitin - conjugating enzymes (e2), and ubiquitin ligases (e3) (petroski and deshaies, 2005 ; vierstra, 2009 ; hua and vierstra, 2011 ; figure 1). the sequential reactions start with atp - dependent activation of ubiquitin by an e1 enzyme, resulting in formation of a high energy thioester linkage between a cysteine residue present in e1 and the c - terminal glycine residue of ubiquitin. this activated ubiquitin is then transferred to another cysteine residue in an e2 enzyme, and subsequently conjugated to a lysine residue in the target protein with the help of a substrate - specific e3 ligase. e3 ligases are the largest and most diverse class of ubiquitinating enzymes, which is prominent especially in plants. for example, a. thaliana possesses more than 1,500 different e3 enzymes (hua and vierstra, 2011), suggesting that e3 ligases have evolved to regulate a wide spectrum of endogenous and foreign proteins through ubiquitination. e3 ligases are classified into two major types : the hect - type and the ring finger - type ubiquitin ligases (figure 1). the hect - type ligases accomplish ubiquitin ligation by two steps, where the activated ubiquitin first becomes covalently attached to a cysteine residue in the hect domain of the e3 ligase and then transferred to the final substrate. on the other hand, the ring finger - type ligases, which include the scf complex, transfer the activated ubiquitin directly from the e2 enzyme to the target protein. ubiquitination is accomplished by sequential reactions involving three classes of enzymes (e1, e2, and e3). first, a ubiquitin - activating enzyme (e1) activates a ubiquitin molecule in an atp - dependent manner, resulting in formation of a high energy thioester linkage between e1 and the c - terminal glycine residue of ubiquitin. the activated ubiquitin is then transferred to a ubiquitin - conjugating enzyme (e2), and subsequently conjugated to a lysine residue in the target protein with the help of a substrate - specific ubiquitin ligase (e3). ring finger - type e3 ligases transfer a ubiquitin moiety directly from e2 to a lysine residue of the target protein. hect - type e3 ligases conjugate ubiquitin in two steps : first, a ubiquitin moiety is transferred from e2 to the hect domain of a hect - type e3 ligase and, then, to a lysine residue of the target protein. lys11- or lys48-linked polyubiquitination targets the substrate for 26s proteasome - dependent protein degradation. in many cases, ubiquitin polymers are assembled by reiterative rounds of ubiquitination, where the first ubiquitin monomer is conjugated to a lysine residue of the target protein, followed by attachment of additional ubiquitin monomers to any of 7 lysine residues available in the previously attached ubiquitin molecule (figure 1). the type of linkage in a polyubiquitin chain determines the fate of the substrate protein. substrates with these polyubiquitin chains are directly recognized and degraded by the 26s proteasome, a very large protein complex of 2.5 mda that catalyzes proteolysis (figure 1). this ups not only facilitates removal of misfolded proteins, but also regulates a plethora of cellular processes by targeting regulatory proteins for selective degradation. furthermore, the ups is also known to play a key role in host immune responses against invading pathogens (zeng. for instance, some plant virus - encoded movement proteins (mps), the essential factors for the cell - to - cell spread of viral infection, are targeted for degradation by the ups (reichel and beachy, 2000 ; drugeon and jupin, 2002). similarly, the viral rna - dependent rna polymerase (rdrp), which is required for genome replication of positive - strand rna viruses, is also degraded by the ups in plant cells (camborde., 2010). these examples illustrate the importance of the defensive role of the ups in host pathogen interactions and imply that the host ups represents a challenge that pathogens need to overcome for successful infection. the role of e3 ubiquitin ligases in the ups is substantial as these enzymes determine substrate specificity by selectively recruiting target proteins to the ubiquitination machinery. among the e3 families, the scf complex is by far the largest and best characterized class of e3 ligases. the scf complex is comprised of cullin 1 (cul1), s - phase kinase - associated protein 1 (skp1), ring - box 1 (rbx1), and an f - box protein (petroski and deshaies, 2005 ; lechner., 2006 ; vierstra, 2009 ; hua and vierstra, 2011 ; figure 2). in this multi - protein complex, cul1 serves as a scaffold that tethers skp1 and rbx1 to its n - terminal and c - terminal domains, respectively. an f - box protein, which confers substrate specificity to the scf complex, directly interacts with skp1 via its f - box domain whereas rbx1 functions as the docking site for e2 ubiquitin - conjugating enzymes. most, but not all, f - box proteins harbor an additional interaction domain that brings specific target proteins in close proximity to the catalytic core of the scf complex (gagne., 2005 ; assembled from protein data bank files 1ldk and 2ass) and a simplified cartoon of the scf complex (bottom). the n - terminal half and the c - terminal half of cul1 interact with skp1 and rbx1, respectively. an f - box protein interacts with skp1 via its f - box domain and recruits the target protein to the ubiquitin ligase complex. in plants, the scf complex has been shown to regulate a multitude of developmental processes (lechner. indeed, different scf complexes are involved in signaling pathways of almost all plant hormones, including auxin, gibberellins, jasmonic acid, etc. in addition, the scf complex plays a critical role in plant pathogen interactions (zeng., 2006 ; citovsky., one such example is the involvement of the acif1 (avr9/cf-9-induced f - box1)-containing scf complex (scf) in disease resistance in tomato and tobacco (van den burg., 2008). silencing of the acif1 gene in tobacco compromises the host defense responses to tobacco mosaic virus (tmv) as well as to the bacterial pathogen pseudomonas syringae (van den burg., 2008). in tomato, knockdown of acif1 attenuates resistance against the pathogenic fungus cladosporium fulvum (van den burg., the arabidopsis homologs of acif1 are also implicated for defense responses as simultaneous knockdown of three acif1 homologs alters expression of defense - responsive genes, including those coding for pathogenesis - related (pr) proteins (van den burg., thus, the f - box protein acif1 and the scf complex may serve as a conserved, integral part of plant defense against various pathogens, from viruses to bacteria to fungi. the role of the scf complex in plant pathogen interactions is also exemplified by the rice defense - related f - box (osdrf1) protein (cao., 2008). expression of the osdrf1 transcripts is induced by infection of the rice blast fungus magnaporthe grisea, as well as by treatment of benzothiadiazole (bth), a chemical inducer of plant defense responses (cao., 2008). interestingly, overexpression of osdrf1 in tobacco transgenic plants leads to enhanced disease resistance to tomato mosaic virus (tomv) and p. syringae (cao. these results suggest that the potential osdrf1-containing scf complex (scf) may positively regulate plant defense responses against diverse pathogens. the scf complex functions not only as a positive regulator but also as a negative regulator of plant defense responses. for instance, the arabidopsis f - box protein cpr1 (constitutive expresser of pr genes 1, also known as cpr30) is involved in negative regulation of plant immunity via the ups (gou. the cpr1-containing scf complex (scf) mediates degradation of at least two resistance (r) proteins, snc1 (suppressor of npr1 - 1 constitutive 1) and rps2 (resistance to p. syringae 2), both of which are critical immune receptors that recognize pathogen invasion (cheng., 2011 ; gou., consistent with this negative role of scf, loss - of - function mutations in cpr1 lead to enhanced resistance to p. syringae (gou., 2009, 2011) as well as the oomycete pathogen hyaloperonospora arabidopsidis (cheng., 2011). utilization of the scf complex in plant defense responses should exert selective pressure on pathogens toward evolution of counter - defense strategies by which they can subvert or co - opt the host scf machinery. indeed, increasing evidence suggests that several plant pathogens, such as a. tumefaciens, r. solanacearum, and poleroviruses, hijack the host scf complex for their own benefits by translocating or expressing their own f - box effectors in the host cell (tzfira. moreover, recent bioinformatic analyses revealed that many other plant pathogens also encode f - box - like proteins table 1), suggesting that hijacking of the host scf machinery through this molecular mimicry may be a widespread infection strategy. to better understand the plant pathogen molecular arms race revolving around the scf complex, we summarize recent advances in the studies of phytopathogen - encoded f - box effectors. agrobacterium tumefaciens - encoded virf is the first f - box protein that was identified in prokaryotes and proved functional in eukaryotic host cells (schrammeijer., 2001 ; tzfira., agrobacterium is a phytopathogenic soil bacterium that causes neoplastic growths (crown gall tumors) on various plant species by transferring and integrating its own genetic materials into the host genomes. this agrobacterium - mediated genetic transformation has been considered to represent the only known natural example of trans - kingdom gene transfer until a recent study using cultured human cells showed that the zoonotic pathogen bartonella henselae is also capable of mobilizing its dna into the eukaryotic host (schrder., 2011). furthermore, under laboratory conditions, agrobacterium can genetically transform virtually any eukaryotic species, from fungi to human cells (bundock., 1995 ; piers., 1996 ; kunik., 2001 the infection process of agrobacterium is regulated by many bacterial factors as well as the host cellular components (tzfira and citovsky, 2006 ; gelvin, 2010 ; pitzschke and hirt, 2010 ; figure 3). first, agrobacterium activates expression of virulence (vir) proteins in response to phenolic compounds exuded from wounded plant tissues. among the induced vir proteins, vird1 and vird2 mediate generation of a single - stranded copy of transferred dna (t - dna), a specific dna segment of the bacterial tumor - inducing (ti) plasmid. the resulting mobilized single - stranded (ss) dna molecule, termed t - strand, is then delivered into the host cell via the type iv secretion system composed of the virb and vird4 proteins. within the plant cell, the t - strand is thought to exist as a nucleoprotein complex called t - complex, in which its 5 end is covalently attached to one vird2 molecule and the entire length of the t - strand is coated with numerous molecules of the ssdna binding protein vire2, another bacterial effector exported into the host cell (sheng and citovsky, 1996 ; gelvin, 2000 ; tzfira and citovsky, 2000, 2002 ; zupan., 2000). furthermore, the host vire2-interacting protein 1 (vip1) directly binds to vire2 and facilitates the nuclear import of t - dna as well as its subsequent targeting to the host genome (tzfira., 2001 ; li. agrobacterium exports a single - stranded copy of t - dna (t - strand) as well as virulence (vir) effector proteins into plant cell. within plant cell, t - strand is assembled into a nucleoprotein complex (t - complex) in which one vird2 molecule is attached to the 5 end of the t - strand and multiple vire2 molecules coat the entire length of the t - strand. in addition, the plant factor vip1 directly interacts with vire2 and guides the t - complex into the host cell nucleus. once the t - complex enters the nucleus, it is presumably disassembled by an scf complex containing virf as an f - box component. the scf complex mediates polyubiquitination of vip1, thereby targeting vip1 as well as its associated vire2 for 26s proteasome - dependent degradation. in plant species that do not require virf for full virulence, agrobacterium most likely also utilizes the host f - box protein vbf for the t - complex uncoating. as a defense strategy, the host plants destabilize virf via the ubiquitin/26s proteasome system (ups), presumably using an as yet unidentified plant scf complex. another exported effector, vird5, counteracts this host - induced degradation of virf by directly binding to and stabilizing virf. once the t - complex reaches the host chromatin, the coating vire2 and vip1 proteins are most likely removed from the t - strand, resulting in release of the naked dna molecule as a substrate for integration. presumably, this uncoating process is mediated by virf (tzfira., 2004), another bacterial effector that is translocated into the host cell independently of the t - strand (vergunst., 2000, 2005) and localizes to the host cell nucleus by as yet unknown mechanism (tzfira., 2004 the agrobacterium f - box effector virf has been shown to interact with the plant skp1 through the f - box domain (schrammeijer., 2001), suggesting that virf functions as a component of the scf complex in plant cell (schrammeijer., 2001 ; although virf does not possess any additional protein interaction domains, which are usually found in many f - box proteins, it directly binds vip1 and targets it for 26s proteasome - dependent degradation in plant and yeast cells (tzfira., 2004). in addition, vire2, which is associated with vip1, is indirectly destabilized by virf at least in a heterologous yeast system (tzfira., 2004). the degradation of vip1 and vire2 is indeed mediated by the virf - containing scf complex (scf) because this degradation does not occur in yeast mutant cells that do not express functional skp1 (tzfira., together, these observations suggest that agrobacterium hijacks the host scf machinery for efficient infection with the help of the bacterial f - box effector. it remains unknown how agrobacterium controls the timing of the scf - mediated t - complex uncoating, but the proposed role of virf during agrobacterium infection illustrates the strategic importance of molecular mimicry by pathogen - encoded f - box effectors. the paradox of the infection strategy using virf is, however, that f - box proteins are inherently unstable due to their own degradation mediated by the autocatalytic mechanism (zhou and howley, 1998 ; galan and peter, 1999) or other e3 ligases (ayad., 2003 ; guardavaccaro., 2003 ; margottin - goguet., thus, agrobacterium, which delivers only the virf protein molecules but not the virf gene into the host cell, faces a challenge to protect virf against detrimental degradation. most likely, this is achieved by another translocated effector of agrobacterium, vird5, that directly binds to and stabilizes virf, which otherwise undergoes rapid degradation via the host ups (magori and citovsky, 2011 ; figure 3). this degradation of virf is likely mediated by an unknown plant e3 ligase, but not the autocatalytic mechanism because mutations in the f - box, a domain required for autoubiquitination, do not stabilize the virf protein (magori and citovsky, 2011). although it remains elusive whether the host - induced degradation of virf is actually associated with bona fide plant defense responses, these observations illustrate a novel type of host pathogen molecular arms race, in which both sides compete for the control of the stability of pathogen - encoded f - box effectors. it should be noted that virf was originally identified as a bacterial host range factor, the function of which is required for agrobacterium infection in some, but not all, plant species (hooykaas., 1984 ; melchers., 1990 ; jarchow., 1991 ; regensburg - tuink and hooykaas, 1993). for example, agrobacterium strains lacking the virf gene exhibit substantially attenuated infectivity on tomato and tree tobacco (nicotiana glauca ; hooykaas., 1984 ; melchers., 1990), while such strains still exhibit wild - type virulence on arabidopsis (zaltsman., 2010). thus, in plant species that are susceptible to the virf - lacking strains, agrobacterium may utilize a host f - box protein as an alternative to virf. consistent with this notion, an arabidopsis f - box protein, vip1-binding f - box protein (vbf), was shown to substitute for the virf function during agrobacterium infection (zaltsman., 2010 ; figure 3). similarly to virf, vbf interacts with the plant skp1, and promotes proteasomal degradation of vip1 as well as vire2 (zaltsman., 2010). interestingly, the vbf transcripts are upregulated in arabidopsis upon inoculation with agrobacterium (ditt., 2006) and fungal pathogens (li., this, in turn, suggests that agrobacterium may co - opt the plant defense responses to facilitate the t - complex uncoating and, hence, successful infection. another phytopathogenic bacterium r. solanacearum causes a lethal wilting disease on more than 200 plant species, which belong to as many as 50 families (schell, 2000). this unusually wide host range may be related to a diverse array of effector proteins that ralstonia potentially uses during the infection process. indeed, genomic and gene expression studies have predicted that ralstonia injects over 70 different effectors into the eukaryotic host cell via the type iii secretion system (salanoubat., 2002 ; cunnac.,, the gala family plays an essential role in ralstonia pathogenicity (angot., 2006). this protein family is a group of seven members (gala1 to 7), each of which contains an f - box domain as well as a c - terminal leucine - rich repeat (lrr) domain (cunnac., 2004). gala derives from a conserved gaxala amino acid sequence in the lrr domain of these effectors (cunnac., the evolutionary origin of the gala family is unknown, but a phylogenetic analysis of various f - box domains suggested that the ralstonia gala genes may have been acquired from plants via horizontal gene transfer (kajava., 2008). like virf of agrobacterium, at least four gala proteins (gala1, 5, 6, and 7) have been shown to interact with the arabidopsis skp1 (angot., 2006), suggesting that translocated galas may be incorporated into the host scf complex. although mutating any single gala gene does not alter ralstonia infection of arabidopsis or tomato (cunnac., 2004), a strain harboring simultaneous mutations of all of the seven gala genes shows almost no virulence in arabidopsis and exhibits significantly attenuated infectivity in tomato (angot., 2006). these observations suggest that the gala family members have partially overlapping functions during ralstonia infection of its plant hosts. however, among seven gala proteins, at least gala7 appears to possess a distinct host - specific function as its mutation alone does not affect the bacterial virulence in arabidopsis or tomato, but leads to reduced disease symptoms in medicago truncatula (angot., 2006). it is tempting to speculate that the specific role of gala7 in medicago may be conferred by its c - terminal lrr domain, which potentially recruits medicago - specific factors to the scf ubiquitin ligase complex. similarly, the other gala members may also target different and specific host factors in different plant species. nevertheless, this bacterial f - box protein family can be a good model to understand not only how ralstonia exploits the host scf machinery for infection of specific hosts, but also how this plant pathogen has used this machinery to expand its host range. rna silencing, also known as post - transcriptional gene silencing (ptgs), plays a central role in plant defense responses against viral pathogens (vance and vaucheret, 2001 ; baulcombe, 2004 ; voinnet, 2005 ; diaz - pendon and ding, 2008). in this defense system, double - stranded rna molecules derived from viral genomes or transcripts are processed into 2125 nt small interfering rna (sirna) duplexes by the rnaseiii enzyme dicer. subsequently, a single - stranded sirna is incorporated into the rna - induced silencing complex (risc), which then degrades viral rnas that are complementary to the bound sirna. interestingly, many plant and animal viruses are known to encode suppressor proteins that suppress this host rna silencing machinery (vance and vaucheret, 2001 ; baulcombe, 2004 ; voinnet, 2005 ; diaz - pendon and ding, 2008). among such viral suppressors, the polerovirus p0 protein harbors an f - box motif that is required for the interaction of p0 with the plant skp1 (pazhouhandeh., 2006). mutations in the f - box domain of p0 not only abolish the interaction between p0 and skp1, but also significantly reduce accumulation of the viral rnas in the host plants (pazhouhandeh., 2006), indicating that p0 is a bona fide f - box protein essential for viral infectivity. the potential targets of the scf complex include argonaute1 (ago1), the catalytic component of the risc complex (baumberger., 2007 ; bortolamiol., 2007). p0 directly interacts with ago1 and targets it for degradation in the host cell (baumberger. indeed, transient expression of p0 in nicotiana benthamiana or arabidopsis leads to substantial reduction in the ago1 protein levels (baumberger. consistent with this result, ectopic expression of p0 in transgenic arabidopsis plants elicits pleiotropic developmental abnormalities that are reminiscent of ago1 mutants (bortolamiol., 2007). together, these observations reveal a novel counter - defense strategy, in which viral pathogens disrupt the host rna silencing through targeted degradation of ago1. the p0 protein of poleroviruses is the first evidence that not only bacterial pathogens but also viral pathogens have evolved to encode their own f - box proteins and hijack the host scf machinery to enhance infection efficiency. host pathogen interactions represent a never - ending arms race between host organisms defending against unwanted invaders, and pathogens counteracting the host defense system. due to their short generation times and large population sizes, bacterial, and viral pathogens are thought to evolve much faster than multicellular, eukaryotic hosts (arber, 2000). in addition, horizontal gene transfer, a process in which different prokaryotic species exchange their genetic materials, further speeds up evolution of pathogens (arber, 2000). thus, it is not surprising that pathogens, rather than hosts, seem to dominate the battle by constantly updating their infection strategies. in particular, use of f - box effectors within host cells illustrates how elaborate pathogens are when infecting their hosts. hijacking the host scf machinery by pathogens makes biological sense because the scf complex plays a key role in host defense responses in many cases. furthermore, due to the essential function of the scf complexes in diverse cellular processes, hosts can not modify this ubiquitin ligase system just to evade pathogen attack, further allowing for evolution of pathogen - encoded f - box proteins. ever since the discovery of the agrobacterium virf protein, many additional pathogen - encoded f - box effectors have been identified, and at least several of them have been demonstrated to play an indispensible role in pathogenicity. how widespread is this infection strategy ? how have pathogens evolved such eukaryotic f - box effectors ? how have the f - box effectors affected evolution of host defense systems ? with the advent of the discovery and studies of pathogen - encoded f - box proteins, we are beginning to understand the true complexity of host pathogen interactions. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.	the scf (skp1-cul1-f - box protein) ubiquitin ligase complex mediates polyubiquitination of proteins targeted for degradation, thereby controlling a plethora of biological processes in eukaryotic cells. although this ubiquitination machinery is found and functional only in eukaryotes, many non - eukaryotic pathogens also encode f - box proteins, the critical subunits of the scf complex. increasing evidence indicates that such non - eukaryotic f - box proteins play an essential role in subverting or exploiting the host ubiquitin / proteasome system for efficient pathogen infection. a recent bioinformatic analysis has identified more than 70 f - box proteins in 22 different bacterial species, suggesting that use of pathogen - encoded f - box effectors in the host cell may be a widespread infection strategy. in this review, we focus on plant pathogen - encoded f - box effectors, such as virf of agrobacterium tumefaciens, galas of ralstonia solanacearum, and p0 of poleroviruses, and discuss the molecular mechanism by which plant pathogens use these factors to manipulate the host cell for their own benefit.
preoperative fine needle aspiration has been an effective tool in differentiating primary and secondary thyroid carcinomas. the presence of nests of clear cells with distinct borders, compact dark nuclei and extensive vascularity should increase the suspicion of metastatic renal cell carcinoma (rcc). the thyroid gland is a rare site of metastasis. in one study metastatic cancers in the thyroid accounted for 0.1% of all thyroid nodular lesions that were investigated by fine needle aspiration. clinically recognized metastasis to the thyroid is much less common than metastasis found at autopsy. the overall incidence varies from 1.25% in unselected patient autopsy series to 24% in autopsies of patients with widespread malignant neoplasms. rcc is the most common, constituting 56% of all secondary malignancies. in clinical and autopsy series performed in europe and us, breast carcinoma, lung carcinoma and melanoma are the most frequent source of metastasis to the thyroid gland. awareness and knowledge of occurrences of these lesions will help in making a correct diagnosis in cytology. we report a case of isolated thyroid metastasis from rcc, 3 years after nephrectomy without local recurrence or metastasis to other organs. a 65-year - old woman presented with a palpable mass in the left neck region of 20 days duration. physical examination revealed a 3 4 cm hard, nontender mass without associated palpable cervical lymph node enlargement. grossly, the specimen measured 4 4 3 cm and cut section showed a well circumscribed grey white nodule measuring 4 3 cm. histology sections displayed a well encapsulated tumor with sheets of polygonal cells having clear cytoplasm and centrally placed nucleus. normal thyroid follicles were seen outside the capsule [figure 3 ]. a diagnosis of metastatic rcc to the thyroid was made. on immunohistochemistry, the tumor cells were positive for vimentin and cd10 (focal) and negative for ck-19, thyroglobulin and thyroid transcription factor-1 (ttf-1). patient continues to remain disease free after hemithyroidectomy, with no further evidence of any other metastasis or local recurrence. smear showing polygonal tumor cells with centrally placed nucleus, clear cytoplasm and vascular pattern. inset shows endothelial cells (mgg, 450) cut section of the resected specimen shows a grey white nodule. normal tan brown thyroid tissue is seen at the periphery histological section showing deposits of renal cell carcinoma on the right and thyroid tissue on the left side (h and e, 100) thyroid metastasis range from 1.9 to 24.2%, suggesting that unrecognized metastasis to the thyroid is more common than clinically recognized disease. however, of the clinically recognized metastasis to the thyroid gland, more than 50% of the time the culprit is rcc and the incidence of metastatic rcc to the thyroid is as high as 78%. thus, rcc is by far the most common source of clinically relevant metastasis to the thyroid gland. in the literature, a pre - operative diagnosis of secondary thyroid tumors is difficult due to the rarity, long interval between the onset of renal primary and detection of thyroid metastasis. in the present case, positive medical history of rcc 3 years back and preoperative thyroid fine needle aspiration cytology findings of nests of clear cells aided in establishing a diagnosis of secondary metastatic rcc in the thyroid. development of thyroid mass in a patient previously treated for rcc (or any other tumor), even many years earlier, should arouse suspicion of metastasis. earlier studies have shown statistics exemplifying excellent prognosis for rcc with isolated thyroid metastasis and importance of surgical resection. it is difficult to distinguish metastatic rcc from primary lesions of thyroid, such as anaplastic carcinoma or the clear cell variant of follicular carcinoma. rccs and thyroid follicular epithelial neoplasms with clear cells may have a variety of histologic patterns that make a distinction on morphologic grounds alone difficult. the cells have clear cytoplasm, distinct boundaries and small, compact, dark nuclei. thyroid follicular epithelial tumors with clear cells are rare and include follicular adenoma, follicular carcinoma and papillary carcinoma. the clear cell component within a primary thyroid follicular neoplasm may be the dominant cell type or may represent a minor component of the entire neoplastic proliferation. the presence of clear cells in any thyroid follicular neoplasm does not alter the overall prognosis of that particular tumor type. in contrast with tissue, the cytoplasm is not always optically clear in cytology specimens. immunohistochemical stain for ttf-1 represents a specific marker for tumors originating from follicular cells of thyroid. sonographically guided fine needle aspiration or biopsy could be useful for diagnosing metastasis to the thyroid gland. the spread of rcc to the thyroid appears to be hematogenous, possibly by bypassing the lungs. there is no clear consensus about the choice of surgical procedure (lobectomy or total thyroidectomy), but several studies report that long - term survival can be achieved with total thyroidectomy because of multifocality of the lesions. surgical resection is regarded as the best treatment for metastatic thyroid tumor, especially if primary carcinoma has been resected with no signs of metastasis elsewhere. it has been reported to result in prolonged survival without any evidence of recurrence in 10% patients with isolated thyroid metastasis. rcc is a unique tumor that can present as metastasis to the thyroid years after nephrectomy. a presurgical diagnosis of secondary thyroid tumors is relatively difficult because there are no specific clinical or radiological features. fnac has an indispensible role in preoperative diagnosis and workup in patients presenting with thyroid mass and a medical history of rcc. if metastatic rcc is linked to the thyroid gland, only surgical intervention can be curative.	metastatic thyroid carcinoma is clinically silent and found only at autopsy in most instances. renal cell carcinoma (rcc) is the most common and constitutes 56% of all secondary malignancies. however, preoperative distinction between primary and secondary thyroid neoplasms is often challenging. fine needle aspiration is helpful in establishing a correct preoperative diagnosis. a local surgical resection is curative if prompt preoperative diagnosis is established. we hereby report a case of isolated metastatic rcc to the thyroid in a 65-year - old woman, diagnosed by fine needle aspiration cytology and later confirmed with histopathological examination.
the response of a tumor to ionizing radiation is dependent on several factors both intrinsic and extrinsic to the cancer cells. intrinsic mechanisms of radioresistance include alteration of gene and protein expression resulting in selection of resistant variants. the extrinsic tumor microenvironment varies anisotropically within a mass and is characterized by oxygen depletion, acidosis, glucose deprivation, and high lactate levels [2, 3 ]. hypoxic cells are known to be resistant to the effects of radiation as oxygen is required to fix damage conferred by free radicals created by the ionizing radiation. severely hypoxic cells can have an oxygen enhancement ratio of 2 - 3 ; this means they require 2 - 3 times the radiation dose of well - oxygenated cells for the same level of killing. the tumor microenvironment is shaped by both the metabolic activity of cancer cells and circulation. for growth and survival, tumor cells and stroma secrete proangiogenic factors including fgf, pdgf, and the predominant factor vegf, which result in endothelial cell migration and proliferation. this helps create new vessels often which are poorly functional with sluggish blood flow since vegf causes vessel leakage and is expressed out of proportion to other angiogenic factors. recent studies show that antiangiogenic agents produce modest responses as single agents, but in combination with radiation and chemotherapy consistently improve tumor response. jain explains this seemingly paradoxical effect by proposing the concept of vascular normalization in which high vegf levels produce poorly functional vessels impeding oxygenation and delivery of therapeutics. therefore, inhibition of vegf improves vessel quality, enhancing delivery of chemotherapy and tumor oxygenation, resulting in increased radiation efficacy. pazopanib (gw786034 or votrient, glaxosmithkline) is a second - generation, oral tyrosine kinase inhibitor (tki) with multiple targets including vegfr, pdgfr, c - kit, and fgfr. pazopanib was recently fda approved for the treatment of advanced renal cell carcinoma and soft tissue sarcoma. clinical trials are ongoing in breast cancer, ovarian cancer, thyroid cancer, and cervical cancer. the most common adverse effects are nausea, hypertension, diarrhea, fatigue, vomiting, ast and alt elevation, and hair color changes. compared to other angiogenesis tki, pazopanib shows a lower number of adverse effects that are of low grade when present. this novel molecule has the potential to improve systemic disease and survival for many cancers with minimal toxicity compared to standard therapies. the purpose of the present study was to perform an analysis of acute locoregional (within the irradiated volume) toxicity in patients with breast cancer treated with adjuvant combined modality therapy consisting of pazopanib and rt and to define this toxicity based on the common terminology criteria for adverse events (ctcae, v4.0). after approval by the institutional review board, we identified patients with breast cancer treated with pazopanib through medical records. the acquired data were de - identified according to health insurance portability and accountability act (hipaa) guidelines. these patients were then cross - referenced with the radiation oncology database to determine if radiotherapy was delivered concurrently with respect to pazopanib ; 12 patients were determined to have received concurrent treatment. inclusion criteria included patients with a known diagnosis of breast cancer who were treated with concurrent pazopanib and radiotherapy. a group of control patients were identified and matched 2 : 1 based on age, use of chemotherapy, radiation field design, and radiation dose. data including demographic variables, common comorbid conditions, surgery, concomitant chemotherapy, radiation dose and field design, cancer grade and stage, performance status, vital signs, and laboratory values were extracted. standard baseline evaluation included a complete medical history, physical examination, including performance status, and hematology, and clinical chemistry assessments. patients were evaluated weekly during the course of radiotherapy, 3 - 4 weeks after completion of treatment, and then at 36 month intervals thereafter. to gather information regarding locoregional toxicities, charts were reviewed for presence of the following variables before, during, and after radiotherapy : fatigue, radiation dermatitis, skin hyperpigmentation, skin ulceration, soft tissue fibrosis, nausea, pneumonitis, diarrhea, hypertension, and anorexia. toxicity was scored using the common terminology criteria for adverse events (ctcae, v4.0). in this system, sequelae are graded from mild (grade 1) to fatal (grade 5). patients were considered to have a significant complication if they had a toxicity of grade 3 or higher. in cases in which a complication could have been the result of pazopanib and/or radiation toxicity, it was coded as radiation toxicity unless such symptoms predated the radiation treatment. statistical analysis was performed using paired t - test for continuous variables and a chi - squared or fisher exact test for nominal data when appropriate, with a p value of 0.05 or less indicating significance. a computer program package sas (version 9.1, sas institute, cary, nc) was used for all statistical testing and management of the database. patients were identified to have received concurrently pazopanib and rt (n = 12) with a mean age of 46.8 years (range 3159). patients were treated to their intact breast after breast conserving surgery (n = 5) and to the chest wall after mastectomy (n = 7) ; of these, 11 patients received rt to the regional nodes. matched patients were identified to have received radiation therapy alone (n = 25) with a mean age of 50.2 years (range 3577). patients were stage iii (n = 24) or stage iv (n = 1). there were 9 right - sided breasts and 14 left - sided breasts treated. patients were treated to their intact breast after breast conserving surgery (n = 6) and to the chest wall after mastectomy (n = 19) ; of these, 24 patients received rt to the regional nodes. see table 1 for full details on patient characteristics. preoperatively, pazopanib 800 mg po daily began on day 1 of the first paclitaxel cycle and continuing until 7 days before surgery. postoperatively, pazopanib 800 mg po daily began 46 weeks after surgery and continuing until 6 months after the first postoperative pazopanib dose. all patients were seen weekly during radiotherapy and at 1 or 3 months after completion. all patients (100%) received concurrent pazopanib and rt without delay or treatment breaks during radiation therapy, and there were no treatment - related deaths. no patient (0%) experienced progression of disease while on therapy or received a treatment - related break secondary to adverse side - effects. after completion of radiation therapy, one patient stopped pazopanib a week early due to loss in weight. one patient chose to be taken off pazopanib 2 months after rt due to heightened nausea and fatigue. two patients experienced elevated liver enzymes after being put on pazopanib and was thus taken off it. with a minimum followup of 6 months, 12 patients (100%) are alive and have completed therapy as planned. opposed tangents directed at the intact breast to 5000 cgy followed by a tumor bed boost to a total dose of 6000 cgy in 200 cgy / day fractions were delivered to 11 (30%) patients ; 10 of these patients received treatment to a supraclavicular (sclv) field treated to 4600 cgy in 200 cgy / day fractions prescribed to a depth of 3 cm. twenty - six (70%) patients received opposed tangents directed at the chest wall to 5000 cgy in 200 cgy / day followed by a tumor bed boost to a total dose of 6000 cgy in 200 cgy / day fractions (0.5 cm bolus was used on the chest wall for the initial 2000 cgy) ; a supraclavicular field treated to 4600 cgy in 200 cgy / day prescribed to a depth of 3 cm in 25 patients. for left - sided tumors, the amount of lung and heart shielded was up to the discretion of the treating physician. patients were not treated using intensity modulation, respiratory gating, active - breath hold, or other such techniques. grade 1 or 2 radiation dermatitis was seen in 100% and 84% of pazopanib and rt patients and matched controls, respectively (p = ns). none of the patients receiving pazopanib and rt experienced grade 3 toxicity within the irradiated volume ; three (16%) matched patients experienced a grade 3 skin reaction (p = 0.05). interestingly, grade 1 or 2 hyperpigmentation was seen in 17% p - rt patients and 60% of matched controls (p = 0.005). one (8%) of these two patients also had skin hypopigmentation outside of the treatment field along with grade 1-related hypertension. one patient receiving concurrent pazopanib and rt developed a 1.5 cm area of ulceration (grade 2) in the scar (central boost) at 3 months after completion of rt. she required local wound care and eventually received 40 hyperbaric oxygen treatments which completely resolved the ulceration. there was no other adverse locoregional toxicity attributable to the concurrent use of pazopanib and rt (table 2). no patients receiving rt alone developed skin ulceration, pneumonitis, diarrhea, hypertension, nausea, anorexia, or liver abnormalities ; one patient in the p - rt group developed grade 3 anorexia. in all patients, hemorrhage at or distant to the site of radiotherapy grade iii iv hematologic toxicities were seen in zero patients (0%) during the course of pazopanib and rt. grade 1 or 2 fatigue was seen in 100% and 88% of p - rt patients and matched controls, respectively (p = ns). in preclinical studies, vacsular endothelial growth factor inhibition has been shown to be both a chemosensitizer and a radiosensitizer. a combination of antiangiogenic agents and radiation therapy may improve the therapeutic ratio by improving tumor kill while minimizing toxicities. pazopanib, an oral, angiogenesis inhibitor targeting vegfr, pdgfr, and c - kit, has been studied in numerous types of tumors in the setting of clinical trials. at present, it has received fda approval for the treatment of patients with advanced renal cell carcinoma and advanced soft tissue sarcoma (sts) who have received prior chemotherapy. the most common systemic side - effects associated with pazopanib have been diarrhea, hypertension, hair color change, nausea, fatigue, anorexia, and vomiting, alopecia, chest pain, dysgeusia, dyspepsia, and skin hypopigmentation. preclinical studies in immunocompromised mice indicated considerable dose - dependent tumor growth inhibition in xenografts such as colon, prostate, breast, renal, and lung. inhibition was most prominently seen in renal cell carcinoma xenografts, as 77% growth inhibition occurred with 10 mg / kg / day of pazopanib, with complete prevention of cell growth and multiplication at 100 mg / kg / day (3). an important phase i trial tested 63 patients with advanced - stage and refractory solid tumors for increasing doses of pazopanib (3). a wide range of doses and schedules were used to evaluate optimal dosage and tolerability. pazopanib was well tolerated by most patients, with most adverse events (ae) being of low - grade (1 or 2) and reversible (3). the most commonly reported drug - related aes were hypertension, diarrhea, nausea, anorexia, fatigue, and hair hypopigmentation (3). the most common high - grade ae was hypertension, seen in 29% of patients (3). in the present study, the most common toxicities were fatigue and radiation dermatitis, both of which were related to the radiotherapy. in fact, there was a statistically lower rate of grade 3 dermatitis in patients receiving pazopanib compared to untreated patients. the addition of pazopanib to rt did not seem to increase the occurrence of acute or subacute locoregional toxicities compared to rt alone. interestingly, there was a statistically significant lower rate of hyperpigmentation in patients receiving pazopanib with rt compared to rt alone. a case report by sideras. explored the underlying causes of skin and hair hypopigmentation in an african - american woman treated with pazopanib for thyroid cancer (4) [10, 11 ]. they postulated that given the role of c - kit in melanocyte / pigmented cell proliferation and pdgf - r in melanocyte development, inhibition of c - kit and pdgf - r by pazopanib would result in hypopigmentation. radiation has been shown to modulate c - kit / c - kit ligand system in melanocytes causing an increase in pigmentation. thus it may be postulated that within the treatment field, the inhibitory effect of pazopanib on c - kit outweighs any locoregional effect caused by rt on pigmentation. the side effects caused by pazopanib that were observed in the present study were primarily systemic. these include fatigue, diarrhea, hypertension, nausea, and anorexia. when compared with the our matched patients, those receiving pazopanib reported a higher incidence of diarrhea, hypertension, nausea, and anorexia, but of low - grade toxicity. fatigue occurred with roughly the same rate in both pazopanib and rt (33.3%) and the matched controls (31.6%). only one incident of grade 3 toxicity (anorexia) was reported with pazopanib and rt, and that patient discontinued pazopanib therapy one week early. vasudev and larkin reported a phase iii trial in which the most frequently reported aes were diarrhea, hypertension, nausea, anorexia, and vomiting (5). the most common higher - grade toxicities (3/4) were hypertension (4%) and diarrhea (3%) (5). recent studies may indicate that the frequency of certain toxicities increase as the plasma concentration of pazopanib goes up (5). this was demonstrated in data for diarrhea and hypertension, but was not seen for fatigue, nausea, or vomiting (5). pazopanib has a lower incidence of fatigue than other tkis, in part due to it also showing lower rates of thyroid problems when compared to other tkis (5). however, pazopanib is also associated with hepatotoxicity as are other tkis (5). food and drug administration in the treatment of advanced renal cell carcinoma and soft tissue sarcoma. however, the u.s. fda has issued warnings for pazopanib regarding its association with an increased risk of hepatotoxicity, qt interval prolongation, hemorrhagic events, arterial thrombotic events, hypertension, wound healing, hypothyroidism, and proteinuria. to our knowledge, data on the use of concurrent pazopanib and rt across tumor sites have not been reported in detail. however, pazopanib is being studied in phase ii trials of anaplastic thyroid cancer in combination with paclitaxel and radiation therapy ; in this trial, pazopanib is given concurrently with rt. special attention must be given to those breast cancer patients with liver dysfunction, hypertension, and poor wound healing after surgery before starting targeted pazopanib therapy. thus, it is necessary to fully evaluate the therapeutic ratio of antiangiogenic therapies used in combination with rt for safe use of this approach in the clinical setting. to our knowledge, this is the first study investigating acute locoregional toxicity in the adjuvant setting in breast cancer patients treated with concurrent pazopanib and rt to the intact breast or chest wall and associated nodal regions. further research should explore and focus on efficacy and tolerability of vegf inhibition concurrent with rt. attention must be given to different modes of rt and appropriate pazopanib dosing and sequence studies when used in combination with rt. our results show that when treating a patient 's intact breast, chest wall, or associated nodal regions with rt in the adjuvant setting for breast cancer, concurrent pazopanib and rt do not increase acute locoregional toxicity as compared to matched control patients who receive similar rt treatment without use of pazopanib. with the increasing use of pazopanib	purpose. the purpose of this study was to analyze acute locoregional toxicity in patients with breast cancer receiving concurrent pazopanib and rt. materials and methods. patients with breast cancer who received pazopanib in combination with radiation were identified and matched (2 : 1) to patients with breast cancer who did not receive pazopanib by use of chemotherapy, radiation field design, and radiation dose. toxicity was scored by the common terminology criteria for adverse events and statistical analysis was performed. results. grade 1 or 2 radiation dermatitis was seen in 100% and 84% of pazopanib and rt patients and matched controls respectively (p = ns). none of the patients receiving pazopanib and rt experienced grade 3 toxicity within the irradiated volume ; three (16%) matched patients experienced a grade 3 skin reaction (p = 0.05). interestingly, grade 1 or 2 hyperpigmentation was seen in 17% of pazopanib and rt patients and 60% of matched controls (p = 0.005). conclusion. the addition of concurrent pazopanib and rt when treating the intact breast, chest wall, and associated nodal regions in breast cancer seems to be safe and well tolerated.
breast cancer can metastasize to various organs, including lymph nodes, lung, bone, liver and brain. while less common, metastatic breast carcinoma in gastrointestinal tract has also been reported.1 many of these lesions can appear years after treatment of the primary breast cancer and they can be confused with a second primary. moreover, diagnosis of esophageal stricture resulting from metastatic breast cancer is often difficult, and most cases in the past have been diagnosed at autopsy or surgery.23456 endoscopic biopsies often fails in determining the diagnosis and more invasive procedures may be required in some cases.5 we present a case of breast cancer metastasis to the esophagus in which endoscopic ultrasound - guided fine needle aspiration (eus - fna) established the diagnosis after benign result on endoscopic biopsy. an 80-year - old woman was admitted to our hospital for evaluation of progressive difficulty in swallowing to solids and liquids. her past medical history was significant for locally advanced right breast cancer treated with modified radical mastectomy and adjuvant chemoradiation therapy 3 years earlier. prior to this admission timing, her ascitic fluid was totally removed and showed malignant cells with estrogen receptor expression. considering computed tomography findings with small nodular lesions on the peritoneum, peritoneum carcinomatosis due to recurrent breast cancer was suggestive. serum cancer antigen 27.29 was 5.126 u / ml (normal range ; 0 - 38 u / ml) at the time of admission. distal esophageal stricture was found on upper endoscopy at 35 cm from the incisors extending to esophago - gastric junction at 40 cm with modest resistance to passage of the standard gastroscope (9.8 mm in diameter). 2). biopsy obtained from the esophageal stricture revealed no malignancy. computed tomography showed thickened distal esophagus and proximal stomach wall, mild intrahepatic biliary dilatation, massive ascites and right - sided hydronephrosis (fig. 3). eus with a 12 mhz mini - probe that was passed through the upper endoscope into the stricture was performed. it showed approximately 10 mm thickened esophageal wall disruption of the normal esophageal wall layer pattern (fig. then, the linear echoendoscope was passed to the level of the stricture which also showed thickened esophageal wall consistent with an infiltrating process involving all the layers and penetrating into the adventitia. no extraluminal mass which might cause compression was observed. after confirming the absence of major blood vessels, eus - fna of thickened esophageal wall considering her poor performance status mainly due to inability to eat, chemotherapy was not indicated at that time. therefore, we performed esophageal metallic stent placement and successfully relieved her symptoms. computed tomography showing thickening wall in the distal esophagus (white arrow) as well as the proximal stomach. upper endoscopy showing stricture was found in the lower esophagus starting at 35 cm and extending to 40 cm from the incisors with normal mucosa. endoscopic ultrasound with a 12 mhz mini - probe showed thickened esophageal wall without normal esophageal wall layer pattern. endoscopic ultrasound showing the esophageal wall thickening (white arrow) and eus - guided fine needle aspiration (white arrow head) was done. esophageal metastasis from other primary tumors is uncommon, but breast cancer is one of the most common cancers that can metastasize to the esophagus. autopsy series have shown gastrointestinal metastases in 6%-33% of patients who died of breast cancer.4 esophageal metastasis typically presents with a long interval between the primary breast tumor diagnosis and treatment and its recurrence with esophageal involvement. anderson. reported a mean time of 7.1 years from mastectomy to onset of dysphagia.7 in our patient, symptoms of esophageal metastasis appeared 3 years after the breast cancer diagnosis. the mechanism of esophageal involvement of breast cancer has been controversial, but periesophageal lymph nodes involvement through intra - mammary lymphatic channels has been suggested to cause esophageal obstruction. additionally, in some cases, metastasis may cause intramural tumor deposition deeper to the mucosal layer. for this reason, endoscopic findings can show normal esophageal mucosa in many patients with esophageal stricture as in our case. in our case, eus demonstrated thickened distal esophageal and proximal stomach wall which extended to the adventitia but no extraluminal structures (e.g., lymph node) which might cause compression were detected. because of its intramural growth pattern, metastatic breast cancer to the esophagus often poses challenges in tissue acquisition. in most of the published cases, endoscopic biopsy failed to obtain adequate specimens.8 although there is limited data, eus and eus - fna may be alternative techniques for biopsy - negative malignant esophageal stricture.9 sobel. reported that eus - fna was highly reliable for tissue acquisition in this situation. esophageal wall thickening or subepithelial mass was noted in 5 patients using eus and cytological evaluation of specimens obtained by eus - fna (using 22-g needles) confirmed breast cancer metastasis in 11 of 12 patients.10 therefore, eus - fna should be done if the result may change management. in the present case, decision to place metallic stent was made based on the eus - fna result. in the case of esophageal carcinoma, radiation therapy with or without chemotherapy may improve the stricture itself. metallic stent placement is an alternative for palliation if chemo- or radio - therapy is not done or if the patient does not respond to chemoradiation. on the contrary, the role of radiation therapy for breast cancer metastasis to the esophagus is not established. therefore, symptomatic relief with stent placement may be the first reasonable choice. in conclusion, eus - fna can be an effective method for diagnosis of suspected breast cancer metastases to the esophagus when endoscopic biopsy is negative.	metastatic breast cancer is an uncommon cause of esophageal stricture. we present an 80 year - old woman with past medical history of locally advanced breast cancer who admitted for evaluation of dysphagia. barium swallow (i.g. esophageal fluoroscopy) demon - strated moderate irregular narrowing in the distal thoracic esophagus. endoscopy revealed distal esophageal stricture with normal esophageal mucosa and computed tomography demonstrated thickened wall in the distal esophagus and the proximal stomach. endoscopic biopsy of esophagus revealed no malignancy. thus, we performed endoscopic ultrasound - guide fine needle aspiration (eus - fna) and cytological results were consistent with metastatic breast cancer. diagnosis of malignant esophageal stricture due to metastasis from other primary is often challenging and requires a high index of suspicion. eus - fna is an alternative diagnostic technique in such cases when endoscopic biopsy fails to obtain adequate specimen.
graves ' orbitopathy represents orbit involvement and is clinically relevant in about half of the patients with the graves ' disease. in 3 to 5% of the patients, graves ' disease is an autoimmune disease characterized by the presence of the serum autoantibodies. autoimmune process induces an inflammatory reaction and reactive oxygen species (ross) are among its products. ross are formed as normal metabolic products and are important in normal cellular functioning, but their production can be increased under pathological conditions and cause damage [4, 5 ]. therefore, a large number of antioxidant systems act as protective mechanism. among them are superoxide dismutase which catalyses dismutation of superoxide to peroxide, catalase which catalyses the decomposition of hydrogen peroxide to water and oxygen, while glutathione peroxidise which reduces lipid hidroperoxides while simultaneously oxidizing glutathione. situation in which balance between oxidants and antioxidants is disturbed in favour of the oxidants is termed oxidative stress (os). synthesis of thyroid hormones requires formation of the hydrogen peroxide, a highly reactive oxidant. hydrogen peroxide and oxidized iodine are immediately used in peroxidation reaction that is catalysed by thyroid peroxidase. to protect thyroid cells from reactive oxygen species (ross) peroxiredoxin, glutathione peroxidase, thioredoxin, and catalase are involved in this antioxidant system. peroxiredoxin 5 (prdx5) is expressed in the thyroid, mostly in the cytoplasm. the level of expression is correlated with the functional status of thyroid cells, being higher in multinodular goitres, and even higher in hyperthyroid tissues. some level of oxidative load is necessary for thyroid function and proliferation. in a healthy thyroid, ross are produced in an area that is located at the apical pole of the cell in microvilli, where h2o2 is consumed either during the hormone synthesis or by antioxidant systems. however, th1-induced ros production causes ros accumulation both in the cytoplasm and in nuclei, where it can become toxic. interestingly, in vivo, both the antioxidant n - acetylcysteine (nac) and the anti - inflammatory prostaglandin 15deoxy-12,14-prostaglandin j2 (15dpgj2) protect the thyroid against toxic effects of the os. it seems that nac and 15dpgj2 mainly act on infiltrating inflammatory cells, reducing the extrafollicular ros load. as hydrogen peroxide and iodine this could increase h2o2 production and oxidative load, especially when associated with other environmental factors [13, 14 ]. poncin and coworkers suggested that thyroid interstitial inflammation depends on the balance of the os and the antioxidative defences (aods). in basal, healthy conditions, increase in os balanced by the increase in aod would lead to minimal inflammation, but unopposed increase in os would lead to strong inflammation and cell necrosis. reducing os would lead to inflammation reduction and vice versa [11, 15 ]. abalovich at all found increased markers of os and decrease in markers of aod in erythrocytes of patients with graves ' disease. however, after treatment with radioactive iodine, levels of tert - butyl hydroperoxide initiated chemiluminiscence and superoxide dismutase levels did not normalize. increased markers of os were found in plasma of graves ' disease patients, even when they are rendered euthyroid. levels of os and aod markers were higher, both in plasma and in thyroid tissue in patients whose treatment was shorter than 6 months. however, thyroid hormones, per se, induce os, which is tissue and species specific. it seems that the oxidative stress - induced activation of the nf - kappab pathway might play a role in the autoimmune response in hyperthyroidism [20, 21 ]. therefore, when antioxidant supplementation is added to methimazole, euthyroidism is more rapidly achieved. however, it seems that the level of os is increased in subjects with graves ' ophthalmopathy compared to the other subjects with the graves ' disease. methimazole treatment normalizes markers of oxidative stress in plasma in subject with graves ' disease, but not in subjects with graves ' ophthalmopathy. hyperthyroidism is associated with increased lipid peroxidation products in rat liver and with increased activities of glutathione peroxidase, superoxide dismutase, and catalase in the liver. liver oxidative stress increases quickly after increase of thyroid hormones. in rat kidney and testis, hyperthyroidism is also associated with increased oxidative stress and oxidative damage to lipids and genomic dna in the aortic wall. during hyperthyroidism, there is an increase in myocardial oxidative stress that is associated with lipid peroxidation and protein oxidation. myocardial antioxidant enzyme activities elevation accompanied by protein expression induction occurs after four weeks of hyperthyroidism. it seems that oxidative stress plays an important role in cardiac hypertrophy, by the redox activation of akt1 and jun / fos signaling pathways. redox imbalance due to hyperthyroidism induces adaptation of antioxidant systems, also inducing erk1/2 activation and leading to development of cardiac hypertrophy. it is interesting to note that although long - term thyroxin administration causes cardiac hypertrophy, it is also associated with enhanced tolerance of the myocardium to ischemia and reperfusion. this response may involve the thyroid hormone - induced upregulation of hsp70. in skeletal muscle, hyperthyroidism causes increased oxidative stress associated with oxidative modification in myosin heavy chain causing the decrease in force production. enhanced adipogenesis and overproduction of glycosaminoglycans causes an increase in orbital volume and fibrosis of the extraocular muscles. among the other factors, os is involved in proliferation of orbital fibroblasts. in orbital fibroblasts, obtained from subjects with severe grave orbitopathy, superoxide radicals induce a dose - dependent cellular proliferation. however, superoxide - induced fibroblast proliferation could be prevented by methimazole, the xanthine oxidase inhibitor allopurinol, and nicotinamide [36, 37 ]. in orbital tissue samples, there is increased level of lipid hydroxyperoxide, superoxide dismutase, glutathione peroxidise, and glutathione reductase in graves ' orbitopathy patients, compared to controls. furthermore, there is strong negative correlation between the ophthalmopathy index and glutathione level. il-1 is produced by activated macrophages and is an important mediator of the inflammatory response. adding il-1 to cultures of retroorbital fibroblasts causes an increased oxygen - free radical production in a dose - dependent manner. this is observed both in graves ' and in control cultures. total intracellular superoxide dismutase (sod) however, in graves ' cultures sod activity was increased at rest and less responsive to il-1 stimulation. il-1 was a potent stimulator of glycosaminoglycan (gag) accumulation in both normal and go retroocular fibroblasts. il-1 significantly stimulated the gag synthesis in both normal and graves ' fibroblasts cells in a dose - dependent manner. adding sod and its expression is induced by the environmental stress, such as heat shock, anoxia, and ischemia. hsp72 has cytoprotective effects and functions as a molecular chaperone in protein folding, transport, and degradation. in addition, hsps are potent activators of the innate immune system and they stimulate the production of proinflammatory cytokines. in retroorbital fibroblasts obtained from go patients, both h2o2 and heat stress significantly increased hsp72 expression. antioxidants, methimazole, and ptu reduced h2o2-induced hsp72 expression, and to a lesser degree heat - induced hsp72 expression [4042 ]. oxidative dna damage was found to be significantly elevated in cultured orbital fibroblasts, but only slightly increased in fibroadipose tissues of patients with graves ' orbitopathy. in patients with graves ' orbitopathy, there was significant correlation between tsh receptor antibody levels and 8-hydroxy-2-deoxyguanosine (a biomarker of dna damage) content. the presence of oxidative stress parameters in cultured orbital fibroblasts and its correlation with tsh receptor antibody levels represents a good indication that oxidative stress exerts action in go. the study by tsai. found that the urinary level of 8-ohdg was significantly increased in go patients (1.9-fold compared with normal subjects). this increase was pronounced in patients with active go (2.4-fold compared with normal subjects). moreover, however, this association becomes nonsignificant after adjustment for other parameters, particularly the smoking status. it should be noted that smoker had higher urinary 8-ohdg level than never - smokers, and that smoking was significant factor in multivariate analysis. it is well known, from epidemiological studies, that strong evidence for a causal association between smoking and development of graves ' orbitopathy exists. study by tsai. implies that smoking - induced oxidative stress contributes to the pathogenesis of graves ' orbitopathy. one of the major forms of dna damage induced by os is 7, 8-dihydro-8-oxoguanine, referred in an abbreviated way as 8-oxoguanine (8-oxog). this pathway is initiated by the recognition and excision of the oxidized guanine by a dna glycosylase. in humans, the c to g substitution at position 1245 in exon 7 results in substitution of serine with cysteine in codon 326 has been associated with a reduced capacity to repair oxidative dna damage. they found that cys / cys genotype had a 3.5-fold (95% ci : 2.106.01, p < 0.001) and the cys allele had 1.83-fold (95% ci : 1.432.34, p < 0.001) increase in the risk for developing grave 's disease in their population. the ser326cys polymorphism in hogg1 gene was shown to reduce the hogg1 activity in both in vitro and in vivo studies. as the production of 8-oxog is increased both in retroorbital fibroblasts and in urine of patients with gd and correlates with the disease activity, it could be argued that reduced hogg1 activity causes increased dna damage and increased os making subject more susceptible to development of graves ' orbitopathy [43, 44 ]. treatment of the graves ' disease reduces os both by rendering patients euthyroid and by the direct effect of antithyroid drugs, particularly methimazole, on os. methimazole completely normalized parameters of os in peripheral erythrocytes, while radioactive iodine did not. in cultured fibroblasts other forms of treatment for graves ' disease also influence parameters of os. in euthyroid patients treatment of graves ' ophthalmopathy with oral glucocorticoids it was noted that in patients who had recurrence of go urinary level of 8-ohdg was high. in the study by akarsu. serum levels of serum level malondialdehyde (mda, a product of ros degradation of degrade polyunsaturated lipids) were higher in patients with go, compared to controls and graves ' disease patients without go. on the other hand, level of glutathione (gsh, a nonenzymatic antioxidant) was decreased in go patients. treatment with intravenous or oral methylprednisolone reduced mda level. however, intravenous methylprednisolone induced more rapid therapeutic response and more rapid reduction in mda level (in 4 weeks). twelve weeks after the end of the treatment, clinical activity score and serum level of mda were the same in both methylprednisolone - treated groups. treatment of graves ' disease with antioxidants is based on a premise of role of the os in its ' pathogenesis. a small trial using allopurinol and nicotinamide showed effectiveness of antioxidant treatment of mild and moderately severe graves ' ophthalmopathy. selenium is a trace element and is essential for selenoproteins synthesis where selenium functions as a redox centre. some of selenoproteins like thioredoxin reductase and glutathione peroxidases play the key role in antioxidative defences. previous clinical trials showed some effect of selenium on thyroid autoimmunity. a recent large clinical trial evaluated effect of selenium on mild graves ' ophthalmopathy. patients from several european countries were treated with sodium selenite in a dose of 100 g twice daily. selenium treatment was associated with an improved quality of life and less eye involvement and slowed the progression of graves ' orbitopathy, compared to placebo. evidence from previous studies suggests that oxidative stress plays a role in the pathogenesis of graves ' disease. in vitro and in vivo studies showed that antithyroid drugs and antioxidants influence parameters of oxidative stress both in retroorbital tissue and in the whole organism. however, until recently, all studies were small, nonrandomized, or uncontrolled, and large, controlled study was asked for. now, a large, randomized, controlled study proved that selenium supplementation significantly improves quality of life and reduces ocular involvement in patients with mild graves ' orbitopathy. although it seems that antioxidative therapy will not play a major role in the treatment of graves ' disease, further trials are necessary to define its place as adjunctive therapy, or as the therapy for mild and moderate graves ' ophthalmopathy.	graves ' disease is a most common cause of hyperthyroidism. it is an autoimmune disease, and autoimmune process induces an inflammatory reaction, and reactive oxygen species (ross) are among its products. when balance between oxidants and antioxidants is disturbed, in favour of the oxidants it is termed oxidative stress (os). increased os characterizes graves ' disease. it seems that the level of os is increased in subjects with graves ' ophthalmopathy compared to the other subjects with graves ' disease. among the other factors, os is involved in proliferation of orbital fibroblasts. polymorphism of the 8-oxog dna n - glycosylase 1 (hogg1) involved in repair of the oxidative damaged dna increases in the risk for developing grave 's disease. treatment with glucocorticoids reduces levels of os markers. a recent large clinical trial evaluated effect of selenium on mild graves ' ophthalmopathy. selenium treatment was associated with an improved quality of life and less eye involvement and slowed the progression of graves ' orbitopathy, compared to placebo.
urinary incontinence is a frequent and costly ailment responsible for an alteration in the quality of life, as well as being a handicap. in europe 35% of women after 65 years of age, its impact on quality of life exceeds that of other chronic pathologies such as arterial hypertension, angina pectoris or diabetes. stress urinary incontinence (sui) is the most common type of incontinence in women (more than 80%). its two principal causes are abnormal urethral mobility, because of a support defect, and a sphincteric defect resulting in sphincteric insufficiency. however, perineal re - education, for example, improves incontinence by reducing the number of leaks and thus improves quality of life. however, despite an initial cure rate of 60%, improvements gained from re - education disappear after a number of years. injections of inert material (glutaraldehyde cross - linked collagen, silicone, carbon - coated zirconium beads or hyaluronic acid / dextran copolymer) give mediocre results with less than a 50% success rate at the cost of some minor morbidity [1012 ]. surgical techniques that include colposuspension or tension - free vaginal tape, employed in cases of urethral support defect give a 5-year cure rate of more than 80%[13, 14 ]. in fact, sphincteric insufficiency in women is a significant factor in the failure of surgical treatment for sui [1618 ]. thus, the treatment of persistent or recurrent sui, in spite of good surgical practice, remains problematic and can, in certain cases, necessitate the insertion of an artificial sphincter. the object of our work is to review the pathophysiology of sui in women, as well as to investigate the perspectives offered by the use of stem cells in the treatment of this pathology. the urethral mucosa is surrounded by a sub - mucosa composed of longitudinal collagen and elastin fibres, and occupied by a vascular plexus. surrounding this, there are longitudinal smooth muscle fibres, then circular smooth muscle fibres, all of which are surrounded by the striated sphincter that is composed of circular fibres to which are attached the muscles of the urogenital diaphragm [1922 ]. the sphincter is attached to the pubis by the pubo - urethral ligaments and supported by the anterior vaginal fascia, attached to the tendinous arch of the pelvic fascia and the levator ani. resting continence is assured by the circular smooth muscle component, the slow fibres of the striated urethral sphincter, and by the sub - mucosal vascular plexus [1623 ]. during effort, there is passive transmission of intra - abdominal pressure linked to urethral support, as well as active reflex contraction of the urethral sphincter and the pelvic floor [2427 ]. continence, therefore, requires that there is maintenance of urethral support, mucosal, submucosal and muscular trophicity, as well as neurological control (fig. schematic representation of the peri- and intra - urethral structure in the human female (from). the urodynamic measure of urethral closure pressure is used to assess the quality of the urethral sphincter at rest. urethral closure pressure decreases with age and has been directly linked to the rarefaction of striated urethral muscle cells that occurs with ageing [28, 29 ]. there also exists an inverse correlation between the urethral vascular index, measured by doppler ultrasound, the urethral closure pressure and age. compared to continent women, sphincteric volume measured by ultrasonography is also weaker in women who suffer with sui, particularly when sphincteric insufficiency is also present [32, 33 ]. biochemical studies show that there is a modification in the metabolism of collagen and elastin fibres in the peri - urethral tissue of incontinent women [3440 ]. sui in women is also accompanied by signs of denervation of the urethral sphincter. taking all of this into consideration, the ideal treatment for sui in women would consist, at the urethral level, of : increasing the number of smooth and striated muscle cells, increasing vascularization, increasing the secretion of collagen and elastin in peripheral tissue and increasing neurological innervations. in recent years, the medical profession has moved in a new therapeutic direction, which could satisfy all of the above criteria, through the use of autologous adult stem cells. autologous adult stem cells are increasingly used for the treatment of a number of pathologies. this trend began several years ago with the use of bone marrow stem cells for haematopoietic regeneration following chemotherapy, and is continuing with a large number of clinical trials currently underway for the treatment of various cancers (http://www.clinicaltrials.gov). these cells are also being used in several clinical trials, which include the regeneration of cardiac muscle, lower limb revascularization, as well as many other examples (http://www.clinicaltrials.gov). more recently, stem cells from striated muscle have been used primarily for the regeneration of cardiac muscle, but with mitigated results [42, 43 ] and a few research groups have shown interest in the muscle precursor cells (mpcs) and their potential for the treatment of urinary incontinence. one of the first studies was carried out by yokoyama,. in 2001, in which injections of collagen were compared to those of autologous rat mpcs that had been cultured beforehand in order to amplify the number of cells. results showed that collagen almost completely disappeared at the end of a month, even though the mpc cells were still present. in 2002, yiou,. confirmed these positive mpc results, by their use in mice to repair the urethral sphincter muscle. indeed, the cells were extracted from striated muscle, harvested from the legs of mice, labelled and then re - injected directly into the urethral sphincter, which had undergone prior treatment with a myotoxic substance. in 2003, chancellor continued these studies in a rat model, via the use of an allogenic graft of progenitor muscle cells in which the urethra had been denervated, thus leading to its atrophy. the study demonstrated that mpc cells were capable of restoring muscular contraction 2 weeks after injection into the urethra. given that the denervation model does not reflect the real clinical picture, a year later the same team demonstrated in a rat model of urethral sphincter insufficiency, this time provoked by cauterization, that the same injected cells brought about an improvement in the sphincter leak pressure. moreover, two different labelling techniques allowed the identification of cells injected into urethral striated muscle 2 months after injection. the same year, peyromaure,. demonstrated in rats, that 90 days after injection, mpcs can be identified in the striated muscle layer of the sphincter, but not in the smooth muscle layer. more recently, a study was carried out, again in rats, to demonstrate the distinct effects of the injection of mpcs, fibroblasts, or both types of cells together. this work clearly demonstrated that the injection of mpcs improves the leak pressure as well as the amplitude of sphincter contraction. furthermore, the injection of a large quantity of fibroblasts alone (1 10 cells) caused obstruction of the sphincter, leading to urinary retention. the first clinical study in this field was carried out by strasser,. in 2004, of 63 women with urinary incontinence, 42 of them received an ultrasound guided injection of a mixture of fibroblasts and autologous myoblasts, whereas 21 of them received a collagen injection. after being followed for a year the thickness of the rhabdo - sphincter was greatly increased in women who had received the injection of cells, compared to the group that received the collagen injection (a difference of more than 1 mm). moreover, at the end of a year, 38 of the 42 woman that received the injection of cells were considered to be continent. however, following serious breach of ethical rules, as well as illegal conduction of the clinical trials, the strasser s publication has been retracted by the lancet editor. it is now difficult not to question the entire results of the group concerning this particular protocol. nevertheless, a recently published clinical trial from chancellor,. seems to confirm strasser s results, proving that mpcs are efficient for the treatment of sui. anyway, independent of the results coming from strasser or chancellor, the opportunity of using mpcs or fibroblasts isolated from a striated muscle biopsy is probably suboptimal for a number of other reasons. on the one hand, the collection of cells generally requires a large biopsy of skeletal muscle (between 5 and 30 g), an additional operation, and leaving the patient with a fairly significant scar. on the other hand, the use of these cells only partly satisfies the criteria stated earlier for the use of autologous adult stem cells. in fact, if these cells are indeed capable of increasing the quantity of striated muscle as well as the secretion of collagen (from fibroblasts) at the urethral level, it would appear that they might have difficulty in also restoring the activity of longitudinal and circular smooth muscle fibres, in creating a satisfactory level of revascularization or in improving neurological innervation. finally, and this is without doubt the crucial point of the problem, the small quantity of stem cells harvested does not allow immediate re - injection of these cells. they require cultivation in vitro, which, apart from the practical aspects and the absolute necessity for sterility, raises issues over the potential cost of the technique. moreover, even if, in his studies, strasser used these stem cells with autologous serum for cultivation, the passage number of the cells has not been clearly stated, although this is certainly significantly high because the cells are sometimes cultured for up to 8 weeks ! in the same way, chancellor s team recommend about 10 days of culture, with five to six serial platings, to reach a sufficient amount of muscle cells for re - injection. this then raises the question as to the potential changes that could appear within these cellular populations, as well as the safety implications of their injection, particularly, for example, in relation to the teratogenic risks. it would therefore seem no more risky given our actual level of understanding of stem cells to carry out extemporaneous autologous injections, with cells being harvested and re - injected during the same operation. white fat adipocytes (the most predominant type of fat in adult human beings) are spherical cells, with a diameter of around 100 m, but which can be sometimes more than 200 m. their cytoplasm encloses a bulky, single lipid vacuole (triglycerides), surrounded by a thin cytoplasmic ring containing a golgi apparatus, rough endoplasmic reticulum, smooth endoplasmic reticulum, mitochondria and a flattened nucleus at the periphery of the cell. white adipocytes exist as isolated cells within loose conjunctive tissue and bone marrow or as a collection of cells grouped together to form white adipose tissue. white adipose tissue represents around 15% to 20% of the weight of non - obese adults and up to 50% in obese individuals. in this tissue they are separated by reticulin fibres and an extensive capillary network as well as by amyelinic, sympathetic noradrenergic nerve fibres. adipocytes are grouped in small lobules, visible to the naked eye, separated by fine conjunctive partitions containing fibroblasts, macrophages, mastocytes and collagen fibrils. adipose tissue contains only 40% to 60% mature adipocytes, but is also composed of the stromal vascular fraction (svf). this consists of fibroblasts, macrophages, mastocytes, endothelial cells, haematopoietic cells and preadipocytes. this last cell type is considered to be the precursor of mature adipocytes. once cultured, these cells are called adipose - derived stem cells (ascs). numerous studies have shown the multipotent nature (capable of differentiating into cells of the same germ layer), or even the pluripotent nature (capable of differentiating into cells of another germ layer) of svf or ascs cells, capable of acquiring in vitro, muscular, osseous, chondrocyte, neuronal, epithelial, macrophagic, smooth muscle and even hepatic phenotypes [5562 ]. moreover, a recent study showed that the svf is not made up of unipotent progenitors, but instead is composed of multipotent cells, containing adipogenic, osteogenic, chondrogenic and neurogenic phenotypes. furthermore, recent animal studies have highlighted the potential interest of svf or ascs cells in cell therapy, in particular for mesodermal tissue repair and revascularization [6467 ]. the potential interest of svf cells for the treatment of urinary incontinence in women is further supported by many other characteristics of these cells that are discussed below. firstly, cells from the svf contain a large number of fibroblasts capable of secreting collagen. moreover, the capacity of ascs cells to secrete and to organize an endogenous extracellular matrix with some quite basic stimulation has already been highlighted. lastly, in the absence of adipogenic factors, these cells do not differentiate into adipocytes and possess quite a strong potential for making conjunctive tissue. on the other hand, several studies have clearly shown that mesenchymatous cells from adipose tissue have the potential to differentiate into smooth or striated muscle cells. as far as smooth muscle is concerned, a very convincing study by rodriguez,. showed that in addition to the expression of classic markers of smooth muscle cells (smooth muscle cell - specific actin, smoothelin, calponin, caldesmon, mhc and sm22), ascs are able to produce functional cells, capable of contracting under stimulation with carbachol, followed by relaxation of the cells after around 10 min.. as far as striated muscle is concerned, several studies have reiterated the potential of ascs. they can express specific striated muscle markers (desmin, myod1, myogenin, myogenic regulatory factor 6 and myosin heavy chain) and form multinucleated cells characteristic of myotubules [58, 62 ]. moreover, in rabbit, the injection of cells from adipose tissue into damaged muscle enables the restoration of volume as well as the force of muscular contraction, in a way that is as efficient as when muscle satellite cells are injected. this last point could be considered as being highly significant as far as the use of these cells in the treatment of urinary incontinence is concerned. furthermore, it should be noted that, in our experimental procedure of isolation, at least 70% to 90% of svf cells are positive for the myoblastic marker, cd56 (fig. these percentages represent probably an important argument that could accentuate the potentiality of these cells for the urethral repair. cells from a representative individual donor were stained with monoclonal antibodies directed against cd56 coupled to fitc or against cd34 (beckman coulter, qbend10) coupled to phycoerythrin. experiments have been conducted on four different samples from four different patients which have produced the following ranges of percentages : 7090% (cd56), 4070% (cd56/cd34). svf cells were obtained by digestion of liposucted tissue samples, for 30 min. at 37c in ringer - lactate buffer containing 1.5 mg / ml collagenase (nb5, serva, heidelberg, germany, pz activity 0.175 u / mg). the cell pellet harvested after centrifugation was resuspended and incubated twice for 10 min. in blood lysis buffer to eliminate red blood cells. after centrifugation at 3000 rpm for 3 min., cells were resuspended in ringer lactate buffer. this is supported primarily by the existence of an important cd34 population (between 40% and 70%) within the svf [64, 71 ] ; this marker being present on stem cells, but also on endothelial cells and their precursors. this is largely confirmed by more recent studies that highlight certain endothelial phenotypic characteristics of cells from the svf. results from our laboratory, presented here, demonstrated that a significant proportion of cd34 cells express the endothelial marker, cd31 (from our experiments, 65% to 90%, fig. it should be noted that these proportions are not found by all groups working on the subject, without doubt a result of the cellular extraction protocol and of the enzyme used. moreover, the intravenous injection of mice with cd34, cd31 cells, 24 hrs after ligature of the femoral artery (induced ischemia), led to an increase in blood flux and capillary density in these mice compared to the controls. identical results were obtained by other groups in different animal models [6567, 72 ]. as we could find 10% to 30% of cd31 cells in the cd34 population (fig. 3), it is highly probable that the injection of these cells will lead to a increase of the vascularization in the injected area. cells from a representative individual donor were stained with monoclonal antibodies directed against cd31 coupled to fitc or against cd34 (beckman coulter, qbend10) coupled to phycoerythrin. experiments have been conducted on four different samples from four different patients which have produced the following ranges of percentages : 6080% (cd34), 4060% (cd31+/ cd34), 1030% (cd34/cd31). svf cells were obtained by digestion of liposucted tissue samples, as described in fig. since 2002, safford,. has shown that cells from mice could express markers such as the glial fibrillary acidic protein (gfap), nestin and neuronalnuclei (neun). the existence of these types of markers in human beings was confirmed by zuk, who demonstrated the expression of neuron - specific enolase, neun, and microtubule - associated protein-2. on the other hand, zuk s group did not detect gfap, which may be because this marker is specific to murine cells. indeed, the results of a recent study by lin,. would seem to confirm this thinking as their results seem to point to the same conclusions as the results presented by safford. to date, few studies have been carried out on the use of adipose tissue stem cells for urinary incontinence [7375 ]. rests upon the fact that they used human cells (from lipoaspiration), for re - injection in mice and rats. moreover, the cells injected into the bladder and the urethra were a mixed population of different cell types that were cultivated for few days but not selected beforehand. the authors showed that the human cells (labelled with a fluorescent marker) were still present 12 weeks after injection. moreover, recent results from the same team show that ascs, cultivated in a smooth muscle inductive media and seeded in a poly - lactic - glycolic acid scaffold can increase smooth muscle mass and are able to contract. lastly, another team have demonstrated that injection of human ascs increased the leak point pressure of urethrolysis - rats. in fact, these results are very encouraging for the development of the use of these cells, because in theory they would be capable of reconstituting the smooth muscle of the sphincter, leading to the acquisition of a contraction function, something that has never been demonstrated with the mpcs. in summary, it would seem that the svf cells or ascs of human adipose tissue are completely adapted to the treatment of sui in women, because they seem to satisfy all of the decisive criteria for this type of treatment. indeed, their injection, in principle, could bring about an increase in vascularization and in the number of smooth and striated muscle cells of the urethra, an increase in the secretion of collagen and elastin in peripheral tissue, and perhaps an improvement in neurological innervation, because certain cells could differentiate into neurons. moreover, as with other progenitor cells, svf cells and ascs are a source of many growth factors that could significantly improve urethral function. at present it is unlikely that all of these characteristics could be shown by cells derived from skeletal muscle. furthermore, several other elements could act in favour of the use of svf cells or ascs in the treatment of urinary incontinence. firstly, there is the fact that they are very easily accessible via liposuction, without this posing any particular risk to the patient, as liposuction is probably one of the safest surgical procedures available. then, concerning svf cells, there is the fact that they can be injected directly after being sorted. indeed, this avoids cell culture, and successive passages, which reduces considerably the risk from contamination and mutations, as well as the cost of the technique. the use of svf cells is all the more acceptable as it is also true that few people in today s society are lacking in this tissue ! in relation to this, it is important to underline that the technique for the isolation of svf cells from adipose tissue can have important repercussions on the component cells of the svf after purification. thus, our technique, derived from classical techniques for svf cell isolation, in theory, makes it possible to isolate most of the cells required for the treatment of incontinence, such as fibroblasts, myoblasts (cd56), endothelial cells (cd31 and cd133) and probably precursors of smooth muscle cells (cd141). the fact that tools exist that allow, in a reproducible manner, the isolation of the same cellular types from standardized samples, will enable without any doubt the exponential development of the use of these cells in the years to come.	abstractstress urinary incontinence (sui), the most common type of incontinence in women, is a frequent and costly ailment responsible for an alteration in the quality of life. although medical treatment gives some rather deceiving results, surgical techniques that include colposuspension or tension - free vaginal tape, employed in cases of urethral support defect, give a 5-year cure rate of more than 80%. however, these techniques could lead to complications or recurrence of symptoms. recently, the initiation of urethral cell therapy has been undertaken by doctors and researchers. one principal source of autologous adult stem cells is generally used : muscle precursor cells (mpcs) which are the progenitors of skeletal muscle cells. recently, a few research groups have shown interest in the mpcs and their potential for the treatment of urinary incontinence. however, using mpcs or fibroblasts isolated from a striated muscle biopsy could be questionable on several points. one of them is the in vitro cultivation of cells, which raises issues over the potential cost of the technique. besides, numerous studies have shown the multipotent or even the pluripotent nature of stromal vascular fraction (svf) or adipose - derived stem cells (ascs) from adipose tissue. these cells are capable of acquiring in vitro many different phenotypes. furthermore, recent animal studies have highlighted the potential interest of svf cells or ascs in cell therapy, in particular for mesodermal tissue repair and revascularization. moreover, the potential interest of svf cells or ascs for the treatment of urinary incontinence in women is supported by many other characteristics of these cells that are discussed here. because access to these cells via lipoaspiration is simple, and because they are found in very large numbers in adipose tissue, their future potential as a stem cell reservoir for use in urethral or other types of cell therapy is enormous.
a paranasal mucocele is usually defined as an accumulation of mucosal secretions into a paranasal sinus with obstruction caused by inflammation, fibrosis, trauma, previous surgery, anatomical abnormality, or a mass lesion such as an osteoma. when the mucocele becomes infected it is called a pyomucocele or pyocele, which contains pus partially or fully in cysts. the clinical manifestation of mucoceles is benign in most cases [5, 6 ]. most mucoceles arise in the frontal and ethmoid sinuses, but intracranial extension is uncommon [3, 5 ]. in this paper, we describe a case of a giant pyomucocele with extension into the anterior cranial fossa 32 years after a primary frontal sinus fracture due to a traffic accident. a 51-year - old woman presenting with left exophthalmos and ophthalmoplegia associated with large swelling over the left orbit and frontal region during the last three months was referred to the department of ophthalmology of hokkaido university hospital. she had a history of a motor vehicle accident that resulted in a frontal sinus fracture when she was 19 years old. at that time she underwent cranioplasty via bifrontal craniotomy. as a result of this accident, she had already lost visual acuity in her right eye. after admission to the department of ophthalmology, an orbital malignant tumor was suspected, and a local biopsy was performed via a left eyebrow incision. her left visual acuity was still normal ; however, upward ocular movements of the left eye were limited. magnetic resonance imaging (mri) on admission to the department of otolaryngology revealed a large mass in the left frontal intracranial region. the posterior margin of the frontal mass was partially surrounded by bony fragments on bone window computed tomography (ct). bone window ct also demonstrated a defect of the posterior wall of the frontal sinus, where the mucocele wall attached to the dura mater, and thinning and inferior depression of the superior orbital roof. we planned for surgical excision of a giant frontal mucocele extending into the anterior cranial fossa. a single use of a draf type iii endoscopic frontal drill - out was technically difficult in this case as the orbit was so displaced that there was high risk for visual loss in her left eye. a combined one - stage external coronal and endoscopic transnasal approach were then performed. during surgery, we used the same coronal skin incision as the previous one and prepared a pericranial flap before the craniotomy. except for the location just under the skin incision line, removal of the outer table of the frontal bone revealed a thin encapsulated cyst containing yellowish pus. while the posterior wall of the capsule was separated from the dura mater, adhesions containing bony fragments were noted between the dura mater and the capsule. after complete removal of the sinus mucosa, frontal sinus drainage (enlargement of the fronto - nasal duct) was achieved by a combined external trans - basal approach and endonasal endoscopic approach. the dura mater over the frontal base was intact and allowed to lie free in the cavity under the cover of the pericranial flap to shield between the epidural space and the paranasal sinus or the nose. the postoperative course was uneventful, and all preoperative signs and symptoms resolved immediately after surgery. they are usually clinically silent and are caused by the loss of drainage properties of the sinus mucosa. mucoceles that result from trauma are mostly due to compromised ventilation, and can occur between 1 and 35 years later in the literature. in our case this suggests the need for long - term follow - up after injury and conscientious anamnesis in suspicious cases. in our opinion, it is good practice to pay attention to post - trauma or postoperative patients with the possibility of mucocele occurring throughout their life. frontal sinus mucocele is a disease that falls between the fields of otolaryngology and neurosurgery. treatment requires removal of the mucocele sac and the offending obstruction with reestablishment of normal sinus drainage. success rates ranging from 78 to 97% have been reported for external approaches, such as trephination, the lynch and modified lynch procedures, and osteoplastic flap techniques with or without frontal sinus obliteration. expansive growth of the frontal sinus mucocele may result in remodeling or destruction of the posterior wall of the frontal sinus. increased intracranial pressure, due to mass effects of the mucocele, the most frequent symptoms of mucocele formation are frontal headache, proptosis, diplopia, nasal congestion, fluid leakage from the nose and swelling over the forehead. a sinus mucocele presents as a non - enhancing, low - attenuation expansile mass on ct. mri demonstrates mucoceles as well - defined, expansile masses with variable signal intensities on t1 and t2 images. these variations in signal intensities depend primarily on the state of hydration, protein content and viscosity of the content of mucocele. in our patient, preoperative ct showed the destruction of the frontal sinus and remodeling of bone in the frontal sinus, and also revealed that the mucocele was directly attached to the dura mater. operatively, the dura mater was very fragile at the points of contact with the mucocele. the safest way to treat a mucocele of this kind is to resect the sinus mucosa completely. this time we performed a standard external approach combined with cranialization of the frontal sinus (removal of posterior wall), removal of mucosa, and wide nasal drainage from the frontal base to the nasal cavity. we consider cranialization and reconstruction of nasofrontal duct through coronal access to be the most appropriate method when the posterior wall of the frontal sinus is remodeled. in most cases, extradural spaces which are formed after surgery become obliterated by the expansion of the frontal lobe within several weeks. in addition, vascularized local flaps are highly effective in preventing contamination of the anterior cranial fossa. for our patient however, when the mucocele is diagnosed in an early pre - invasive stage, the treatment options include minimally invasive surgery and endoscopic treatment, which have considerably less morbidity.	giant mucoceles of the frontal sinus are rare but their recognition is important in the differential diagnosis of proptosis and fronto - orbital lesions. the authors describe a patient with frontal giant mucocele with intracranial as well as orbit and ethmoid sinus involvement. thirty - two years after a frontal sinus fracture, a 51-year - old female presented with headache, and left exophthalmos and ophthalmoplegia. computed tomography and magnetic resonance imaging demonstrated a giant frontal sinus mucocele with extension into the left anterior cranial fossa. the mucocele was treated with a transcranial and endoscopic transnasal approach. the frontal sinus was then cranialized with reconstruction of the posterior wall, and finally a wide nasal drainage was performed. the clinical symptoms disappeared immediately after surgery.
survivin has been implicated in regulation of apoptosis, cell division, and cell cycle both in cancer cells and normal tissues, through caspase - dependent and -independent mechanisms [13 ]. we previously showed that survivin is expressed and growth factor regulated in human cd34 cells [46 ]. antagonizing survivin impairs production of mouse bone marrow hematopoietic progenitor cells in vitro [4, 7 ] and conditional survivin gene deletion in vivo in mice leads to bone marrow ablation as a result of loss of hematopoietic stem and progenitor cells (hspc). in contrast to tight regulation of survivin by hematopoietic growth factors in normal cd34 cells, deregulated expression of survivin is frequently observed in hematological diseases, particularly those associated with hematopoietic stem cell (hsc) expansion. for instance, survivin is aberrantly overexpressed in acute myeloid leukemia [9, 10 ] but downregulated in marrow cells of patients with aplastic anemia where hspc are significantly reduced. we previously reported that itd - flt3 mutations found in ~2530% of patients with acute myeloid leukemia (aml) and strongly associated with poor prognosis [1214 ], increase expression of survivin. survivin mediates aberrant hematopoietic cell proliferation induced by itd - flt3 and regulates development of itd - flt3 acute leukemia, suggesting that antagonizing survivin may provide therapeutic benefit for patients with aml expressing itd - flt3. survivin is the fourth most highly expressed transcript in cancer and is commonly associated with a higher proliferative index, reduced apoptosis, resistance to chemotherapy and increased rate of tumor recurrence in cancer cells, making anti - survivin therapy an attractive strategy in cancer. several anti - survivin preclinical trials in solid tumor models show that disrupting survivin can reduce tumor growth [13 ]. however, studies from our group and others indicate that survivin regulates normal hspc [4, 7, 8 ], suggesting that targeting survivin will likely result in hematopoietic toxicity. therefore, identification of differences in signaling cascades downstream of survivin between normal hspc and cancer stem cells (csc) or leukemia stem cells (lsc) are required to pinpoint targets that can effectively eradicate csc / lsc with little toxicity on hsc. previous reports show that itd - flt3 mutations are present in human lsc and genes expressed in aml stem cells are deregulated. the primary purpose of this study was to identify downstream survivin signaling pathways in lsc that are distinct from normal hsc. using itd - flt3 transformed c - kit, sca-1, and lineage (ksl) cells from conditional survivin knockout mice as surrogates for aml stem cells and littermate controls, we identified a panel of genes that are specifically regulated by survivin in itd - flt3 transformed ksl cells and known to be deregulated in human lsc. the data identify selective signaling pathways downstream of survivin in lsc that are distinct from normal hsc that can be potentially targeted for selective anti - lsc therapy. anti - fc-iii / ii receptor antibody, apc conjugated antimouse c - kit (clone 2b8), biotin - conjugated anti - sca-1 (e13 - 161.7), r - phycoerythrin (pe) conjugated anti - mouse cd3 (clone 143 - 2c11), gr-1 (clone rb6 - 8c5), b220 (clone ra3 - 6b2), mac1 (clone m1/70), ter119 (clone ter119), rat igg2a, rat igg2b, hamster igg, and streptavidin - pe - cy7 were purchased from bd biosciences (san diego, ca). recombinant human flt3 ligand (fl) and thrombopoietin (tpo) were provided by amgen, thousand oaks, ca. recombinant murine stem cell factor (rmscf) was purchased from r&d systems (minneapolis, mn). tamoxifen and 4-hydroxy (4oh) tamoxifen were from sigma - aldrich (st. louis, mo). mice with the survivin gene flanked by loxp sites and a tamoxifen - inducible form of cre (cre - er) were reported previously. all mice were housed in microisolators with continuous access to rodent chow and acidified water. retrovirus transduction of itd - flt3 into mouse bone marrow cells was carried out as described. briefly, bone marrow cells from littermate control survivin or creer - survivin mice were transduced with itd - flt3 (n51) in mscv - ires - egfp vector. seventy - two hours after sequential transduction, the medium was replaced with imdm containing 10% fbs and the cells were incubated for 14 days without growth factors in the presence of 1um of 4oh - tamoxifen to induce survivin gene deletion. viable cells were enumerated using trypan blue exclusion and gfp, c - kit, sca-1, and lineage negative (ksl) cells were sorted on day 14 by facsaria (bd biosciences). survivin and creer - survivin mice were treated with 5 mg tamoxifen (5 mg / mouse i.p.) for 3 consecutive days and allowed to rest for 3 days, and tamoxifen was administered for 3 additional days. fourteen days after the final tamoxifen injection, marrow cells were harvested, stained with anti - cd34, c - kit, sca-1, and lineage markers and cd34 ksl cells isolated by facsaria for mrna microarray analysis. microarray analysis was performed on a fee basis by miltenyi biotec (auburn, ca). briefly, 250 nanograms of each cdna were used as template for cy3 and cy5 labeling which was performed according to miltenyi biotec 's proprietary protocol. equal amounts of labeled cdnas from tamoxifen - treated survivin and creer - survivin mice or those cells expressing itd - flt3 were hybridized overnight (17 hours, 65c) to agilent whole mouse genome oligo microarrays (44 k) according to the manufacturers ' protocol. fluorescence signals of the hybridized microarrays were detected using agilent 's dna microarray scanner (agilent, palo alto, usa). the agilent feature extraction software (fes) was used to read out and process the microarray image files. the software determines feature intensities and ratios (including background subtraction and normalization), rejects outliers, and calculates statistical confidences (p - values). for determination of differential gene expression, fes derived output data files were further analyzed using the rosetta resolver gene expression data analysis system (rosetta biosoftware, seattle, usa). significantly regulated genes were annotated and assigned to functional categories using the david 2008 (the database for annotation, visualization and integrated discovery ; http://david.abcc.ncifcrf.gov/home.jsp) program. functional networks of the genes regulated by survivin was visualized using cytoscape software : http://www.cytoscape.org/. while incubation of marrow cells transduced with wild - type flt3 in imdm containing 10% fbs without hematopoietic any growth factors failed to support ksl proliferation, overexpression of itd - flt3-egfp in primary mouse bone marrow cells results in the ability of ksl cells to proliferate in the same culture condition without additional any hematopoietic growth factors as we reported, indicating that itd - flt3 is sufficient to transform primitive hspc. incubation of itd - flt3 transduced marrow cells derived from creer - survivin mice with 1um 4oh - tamoxifen significantly reduced factor - independent ksl cells on day 14 compared to survivin cells treated in exactly the same manner (figure 1), confirming that survivin is required for factor independent growth of itd - flt3 transformed ksl cells. to investigate the mechanism by which survivin regulates aberrant proliferation of itd - flt3 transformed ksl cells, mrna expression was compared between itd - flt3 transformed survivin and creer - survivin ksl using mrna microarrays. although inhibition of survivin mrna expression in creer - survivin ksl cells by 4oh - tamoxifen was only 50% compared to control, the mrna microarray identified 1,096 transcripts differentially regulated by survivin. these genes were classified based on biological process and molecular function defined by gene ontology term (http://www.geneontology.org/) using david 2008 program (figure 2). representative groups for biological process include phosphate metabolic process, cell cycle, cell division, response to dna damage stimulus, rna biosynthetic process and transcription (figure 2(a), p <.02). ion - binding, nucleotide - binding, dna - binding, and protein kinase activity were the top 4 significantly enriched categories in molecular function defined by gene ontology database (figure 2(b), p <.02). the list of genes classified by biological process and molecular function are listed in supplementary table s1 available at doi:10.1155/2011/946936. the requirement of survivin for the self - renewing capability of itd - flt3 transformed ksl cells or cfu and the presence of itd - flt3 in lsc strongly suggests that survivin is important for lsc fate decisions resulting from deregulated gene expression. we compared 1,096 differentially expressed genes in survivin deleted itd - flt3ksl cells with the existing deregulated gene expression database for human aml stem cells. out of 1,096 genes regulated by survivin in ksl cells transformed by itd - flt3, 137 genes are also listed in the deregulated molecules in human aml stem cells (tables 1(a)1(d)). the relationship between survivin and lsc on the modulation of the gene expression is illustrated in figure 3(a). of the 137 genes identified, 79 genes were downregulated by survivin deletion while 58 genes were upregulated, implying that these genes are conversely increased and decreased by the presence of survivin in lsc (figure 3(a)). in contrast, 92 genes were upregulated and 45 genes were downregulated by lsc. among the 79 genes downregulated genes by survivin deletion, 55 transcripts were upregulated (figure 3(a) and table 1(a)) whereas 24 genes were downregulated by lsc (figure 3(a) and table 1(c)). similarly, out of 58 upregulated transcripts by survivin deletion, 21 genes were downregulated (figure 3(a) and table 1(b)) and 37 genes were upregulated in lsc (figure 3(a) and table 1(d)) (figure 3(a)). next, we classified the 137 genes into functional annotation groups using the david program (p <.05, figure 3(b)). significantly enriched functional groups were annotated as phosphoprotein, nucleus, acetylation, cell cycle, atp binding, regulation of egf signaling pathway, cell adhesion and others. the size of each circle in figure 3(b) represents the number of genes involved in each functional category and the thickness of the line indicates the number of genes shared with any function, suggesting enrichment of the gene groups with functional redundancy. among the molecules most frequently shared within the functional groups similarly, 76 genes upregulated or downregulated both by survivin and lsc (55 + 21 genes shown in figure 1(a)) were functionally classified (figure 3(c)). phosphoprotein, acetylation, dna binding, atp binding and dna replication were significantly enriched. the 1,096 differentially survivin - regulated genes were also searched against the list of genes expressed in mouse hsc. there were 45 genes whose expression was selectively enriched in hsc compared to other populations (table 2). crem, emp1, hmga2, lrrn1, maff, myef2, rps4x, and sos1 listed in hsc database are also deregulated in lsc. we next compared the human lsc associated 137 genes regulated by survivin in itd - flt3ksl cells with differentially regulated genes in normal bone marrow cd34 ksl cells obtained from creer - survivin and control survivin mice following survivin deletion. tamoxifen reduced survivin expression by 10-fold in cd34 ksl cells from creer - survivin mice compared to control survivin in two independent experiments. out of 137 genes, arg2, med25, pmaip1, pola2, ube3b, ephb2 and rab18 were differentially regulated in both itd - flt3ksl cells and normal cd34 kls cells by survivin deletion. in contrast, cenpa, cpd, myef2, nmt2, taf1b and tmpo were downregulated in itd - flt3ksl cells while they were upregulated in normal cd34 ksl cells by survivin deletion. these findings suggest that the 124 genes are regulated by survivin exclusively in itd - flt3ksl cells but not in cd34 ksl cells. the complete list of the genes regulated by survivin in cd34 ksl cells will be reported elsewhere (manuscript in preparation). functional annotation analysis indicates that genes related with dorsoventral axis formation or epidermal growth factor receptor signaling pathway (egfr) are significantly enriched in the shared genes associated with lsc and survivin signaling in kegg database (http://www.genome.jp/kegg/) (p <.03). similarly, genes associated with regulation of egfr signaling pathway are enriched in the gene ontology database (p <.02). our analysis shows that 13 molecules shared by lsc and survivin signaling are mapped on a functional signaling network that connects through the egfr pathway (figure 4). survivin deletion in itd - flt3 transformed ksl cells results in a significant reduction in growth factor - independent proliferation coincident with growth inhibition. our data shows that survivin deletion modulates gene expression of 1,096 genes that are associated with various cellular and metabolic functions. comparison of the 1,096 survivin regulated genes in itd - flt3ksl cells with 3,005 differentially regulated genes in the human aml stem cell database identified 137 shared genes. functional classification of these 137 genes indicates they connect through a functional signaling network associated with egfr signaling pathway and affect various biological and molecular processes. comparison of the 137 survivin - regulated genes in lsc with transcripts regulated by survivin in normal cd34 ksl cells show that 124 genes are regulated by survivin exclusively in itd - flt3ksl cells and not in normal hsc. these data suggest that survivin contributes to deregulation of gene expression in aml stem cells via selective signaling pathways distinct from normal hsc that can be potentially targeted for therapeutic benefit. there is no direct evidence that survivin directly regulates gene transcription ; however, modulation of survivin can clearly affect transcription in cancer cells [2123 ] and transgenic expression of survivin alters the expression of multiple genes in the bladder. the involvement of survivin in transcriptional regulation is consistent with the fact that bir1, a caenorhabditis elegans homologue of survivin, regulates transcription, most likely through histone phosphorylation by aurora kinase. survivin is essential for activation of aurora kinase that phosphorylates histone h3 [26, 27 ], an event required for transcriptional regulation [2830 ] and cytokinesis, suggesting that survivin may regulate transcription via aurora kinase mediated histone h3 phosphorylation. over expression of survivin since microarray analysis was performed on lineage marker negative viable cells that express gfp, c - kit, and sca-1 and survived in culture, it is unlikely that the effects of survivin on gene expression is a consequence of ksl apoptosis, although we can not rule out indirect effects resulting from cell cycle arrest as a consequence of survivin deletion. survivin is known to inhibit caspases 3, 7, and 10 that mediate apoptosis [13 ]. our functional annotation analysis of the genes regulated by survivin indicates that survivin modulates a number of genes that affect multiple biological processes and molecular functions, although inhibition of survivin mrna expression in creer - survivin ksl cells by 4oh - tamoxifen was only 50% compared to control. while incompleteness of the gene deletion may affect the downstream signals, significant reduction of total cell number since survivin deletion induces cell death, the deleted cells are likely no longer present in the culture at the time of cell harvest for analyses, resulting in an underestimate of the efficiency of survivin gene deletion and likely represents survivin expression in cells that have escaped the tamoxifen - induced deletion. the genes affected by survivin deletion were classified into cell cycle, adhesion, dna replication, transcriptional factor binding, acetylation, phosphorylation, and polymerase. these results suggest that survivin can regulate itd - flt3 transformed ksl cell fate independent of its activity as a caspase inhibitor. more importantly, comparison of the 1,096 survivin regulated genes in itd - flt3kls cells with the human aml stem cell database demonstrates that 137 genes (12.4%) modulated by survivin are also deregulated in lscs. functional annotation analysis indicates that genes related to dorsoventral axis formation or epidermal growth factor receptor signaling pathway (egfr) are significantly enriched in the shared genes associated with lsc and survivin signaling, even though the number of molecules detected that associates with egfr signaling is small. egfr signaling activates signaling cascades involved in cell proliferation, such as src, sos, and map - kinases, and is known to be dysregulated in solid tumors [32, 33 ]. our data also indicates that survivin modulates expression of several genes that connect through the egfr signaling pathway (figure 4), suggesting a potential role of egfr signaling downstream of survivin in aml stem cells, despite the fact that egfr is not usually upregulated in aml cells. however, recent studies indicate an antineoplastic effect of an egfr inhibitor in aml via off - target effects [34, 35 ]. thus, our data would support egfr signaling as a candidate pathway for treatment of patients with aml. while survivin is not listed in the lsc database, it is expressed at higher levels in aml cells compared to normal cd34 cells [9, 10 ]. our data clearly show that survivin affects expression of 137 genes associated with lsc and reduces aberrant ksl proliferation induced by itd - flt3. this finding suggests that antagonizing survivin in lsc may normalize expression of the deregulated genes, which in turn can inhibit their aberrant proliferation. since survivin is expressed and regulated in normal cd34 cells [4, 6 ] and antagonizing survivin reduces normal hspc in vivo, it is likely that survivin deletion will affect normal hsc in the patients. although direct comparison of gene expression in in vitro itd - flt3ksl cells with in vivo cd34 ksl cells may not necessarily provide definite differences in survivin signaling between these populations in vivo, we found that 124 out of 137 survivin associated genes shared by itd - flt3ksl cells and human lsc were not regulated in normal cd34 ksl cells by survivin. this disparity of downstream signaling of survivin between normal and transformed hsc may represent as a means of identifying novel therapeutic targets against lsc that would thereby supplant direct survivin disruption which would otherwise toxic to normal hsc. we identified genes regulated by survivin in itd - flt3 transformed ksl cells that are deregulated in human aml stem cells that are distinct from normal hsc. this study will facilitate the identification of specific therapeutic targets downstream of survivin to eradicate lsc without affecting normal hsc.	itd - flt3 mutations are detected in leukemia stem cells (lscs) in acute myeloid leukemia (aml) patients. while antagonizing survivin normalizes itd - flt3-induced acute leukemia, it also impairs hematopoietic stem cell (hsc) function, indicating that identification of differences in signaling pathways downstream of survivin between lsc and hsc are crucial to develop selective survivin - based therapeutic strategies for aml. using a survivin - deletion model, we identified 1,096 genes regulated by survivin in itd - flt3-transformed c - kit+, sca-1 +, and lineageneg (ksl) cells, of which 137 are deregulated in human lsc. of the 137, 124 genes were regulated by survivin exclusively in itd - flt3 + ksl cells but not in normal cd34neg ksl cells. survivin - regulated genes in lsc connect through a network associated with the epidermal growth factor receptor signaling pathway and falls into various functional categories independent of effects on apoptosis. pathways downstream of survivin in lsc that are distinct from hsc can be potentially targeted for selective anti - lsc therapy.
chronic obstructive pulmonary disease (copd) is characterized by persistent airflow limitation, which prevents lungs from collapsing appropriately for efficient oxygen exchange. this chronic airflow limitation is caused by a mixture of small airway disease (obstructive bronchiolitis) and parenchymal destruction (emphysema).1 obstructive bronchiolitis causes air trapping, which, physiologically, is respiratory dead space even when normal pulmonary structure is preserved. emphysematous areas and normal structures that include air - trapping areas are heterogeneously distributed and cause the symptoms associated with copd. precise functional assessments of each lobe are essential to determine copd pathological mechanisms and subtypes, and might also be useful for lobectomy planning for lung cancer, especially for copd patients. to date, the severity and distributions of emphysematous areas have been assessed visually on high - resolution computed tomography (ct) images.26 however, the recent development of three dimensional (3d) ct and computer aided diagnosis (cad) has enabled 3d volumetry in vivo for each pulmonary lobe.712 a few studies that used 3d - ct volumetry of anatomic lobes showed that the distributions of emphysematous areas and pulmonary function test (pft) results were different between the upper lobes and lower lobes.1316 in addition, kundu showed that total lobar volume (tlv) collapsibility indices, which were defined as the simple difference between ct computed inspiration (i) and expiration (e) volumes, (i e), and the relative measure of volume changes, (i e)/i, of lower lobes tended to be highly correlated with pft results, using paired inspiratory and expiratory ct.17 respiration is gas exchange performed through ventilation of normal lung architecture. we hypothesized that the volume collapsibility of normal lobar volume (nlv) would show better correlations with pft results than would the volume collapsibility of tlv and that the difference in nlv collapsibility might affect the difference in pulmonary function between upper and lower lobes. nlv can be measured in little time by eliminating emphysematous area from total lobe.13 the novelty of our study is that we evaluated nlv collapsibility, not tlv collapsibility, which kundu used.17 thus, in the study, we investigated correlations between nlv collapsibility indices of volume for each anatomic lobe and pft results in copd patients, and examined for differences in function between the upper and lower lobes. our study population included 28 patients (26 males and two females ; mean age, 72 years ; age range, 57 to 86 years). we retrospectively investigated patients who were clinically diagnosed with copd and whose raw data of paired inspiratory and expiratory ct examinations was available from september 2010 to september 2012. copd was defined as a ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) of < 70% after inhaling a bronchodilator (beta-2 agonist). patients were excluded if they had a history of lung surgery before their ct examination. subjects were classified based on the five copd severity categories established by global initiative for chronic obstructive lung disease (gold).1 these patients characteristics are summarized in table 1. our institutional review board approved this retrospective study of this cohort, for whom inspiratory and expiratory ct images were acquired (approval number 2013 - 0014). all subjects had previously given their informed consent for using their ct data for future research. all ct images were acquired using a 64-row multidetector ct scanner (aquilion 64 ; toshiba medical systems corp, otawara, tochigi, japan). each subject was scanned from the lung apex to the diaphragm during a breath - hold at end full - inspiration and at end normal - expiration. we used the following parameters : x - ray tube voltage of 120 kvp ; automatic tube current at a maximum of 225 mas ; gantry rotation speed of 0.5 seconds ; and beam collimation of 640.5 mm. thin - section ct images were reconstructed at 0.5 mm thick slices with 0.5 mm intervals, using a standard spatial frequency reconstruction algorithm (fc11). iterative reconstruction algorithms were not available. the digital imaging and communications in medicine (dicom) data from 3d - ct were transferred to a workstation (synapse vincent version 3.1 ; fujifilm medical systems, tokyo, japan). this workstation incorporated a lobar cad system that was demonstrated to precisely measure lobar volumes in a previous study.18 this system automatically extracted right and left lungs, recognized lobar bronchi, and determined the locations of fissures (figure 1). a radiologist with 4 years of experience interpreting chest ct images (mk) verified the results of segmentation by cad and made manual corrections by delineating fissures when the cad system failed to properly identify fissures. the extent of emphysema was estimated using a threshold technique, by quantifying the volume of voxels with an apparent x - ray attenuation value of < 950 hu. we used the same threshold for an inspiratory scan and for an expiratory scan. the volume with low attenuation values, of < 950 hu, in each lobe was defined as the emphysematous lobar volume (elv). we computed four lobar collapsibility indices : tlv(in liters)=tlvitlve,(1) where tlvi is inspiratory tlv and tlve is expiratory tlv ; tlvcr(%)=(1tlve / tlvi)100%,(2) where tlvcr is the tlv collapsibility ratio ; nlv(in liters)=nlvinlve,(3) where nlvi is inspiratory nlv and nlve is expiratory nlv ; and nlvcr(%)=(1nlve / nlvi)100%,(4) where nlvcr is the nlv collapsibility ratio. pulmonary function was determined on the same day as ct images were acquired, using a flow - sensing spirometer (fudac-77 ; fukuda denshi co, ltd, tokyo, japan). pft results included total lung capacity, residual volume, fev1/fvc, fev1 measured as percent predicted (fev1%p), and the ratio of the single - breath diffusion capacity for carbon monoxide to alveolar gas volume, measured as percent predicted (dlco / va%p). results were given as mean standard deviation for tlv, elv, and nlv, for the inspiratory and expiratory phases. these results were compared for whole lung, each lobe, upper lobes, and lower lobes. upper lobes included the right upper lobe (rul), right middle lobe (rml), and left upper lobe (lul). lower lobes included the right lower lobe (rll) and left lower lobe (lll). subsequently, we determined tlv, tlvcr, nlv, and nlvcr for whole lung, each lobe, upper lobes, and lower lobes. pearson correlation coefficients (r) were determined to assess the associations between the pft results and ct - derived indices. statistical analyses were done using excel 2010 (microsoft corp, redmond, wa, usa). a p - value of < 0.05 was considered significant. our study population included 28 patients (26 males and two females ; mean age, 72 years ; age range, 57 to 86 years). we retrospectively investigated patients who were clinically diagnosed with copd and whose raw data of paired inspiratory and expiratory ct examinations was available from september 2010 to september 2012. copd was defined as a ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) of < 70% after inhaling a bronchodilator (beta-2 agonist). patients were excluded if they had a history of lung surgery before their ct examination. subjects were classified based on the five copd severity categories established by global initiative for chronic obstructive lung disease (gold).1 these patients characteristics are summarized in table 1. our institutional review board approved this retrospective study of this cohort, for whom inspiratory and expiratory ct images were acquired (approval number 2013 - 0014). all subjects had previously given their informed consent for using their ct data for future research. all ct images were acquired using a 64-row multidetector ct scanner (aquilion 64 ; toshiba medical systems corp, otawara, tochigi, japan). each subject was scanned from the lung apex to the diaphragm during a breath - hold at end full - inspiration and at end normal - expiration. we used the following parameters : x - ray tube voltage of 120 kvp ; automatic tube current at a maximum of 225 mas ; gantry rotation speed of 0.5 seconds ; and beam collimation of 640.5 mm. thin - section ct images were reconstructed at 0.5 mm thick slices with 0.5 mm intervals, using a standard spatial frequency reconstruction algorithm (fc11). the digital imaging and communications in medicine (dicom) data from 3d - ct were transferred to a workstation (synapse vincent version 3.1 ; fujifilm medical systems, tokyo, japan). this workstation incorporated a lobar cad system that was demonstrated to precisely measure lobar volumes in a previous study.18 this system automatically extracted right and left lungs, recognized lobar bronchi, and determined the locations of fissures (figure 1). a radiologist with 4 years of experience interpreting chest ct images (mk) verified the results of segmentation by cad and made manual corrections by delineating fissures when the cad system failed to properly identify fissures. the extent of emphysema was estimated using a threshold technique, by quantifying the volume of voxels with an apparent x - ray attenuation value of < 950 hu. we used the same threshold for an inspiratory scan and for an expiratory scan. the volume with low attenuation values, of < 950 hu, in each lobe was defined as the emphysematous lobar volume (elv). we computed four lobar collapsibility indices : tlv(in liters)=tlvitlve,(1) where tlvi is inspiratory tlv and tlve is expiratory tlv ; tlvcr(%)=(1tlve / tlvi)100%,(2) where tlvcr is the tlv collapsibility ratio ; nlv(in liters)=nlvinlve,(3) where nlvi is inspiratory nlv and nlve is expiratory nlv ; and nlvcr(%)=(1nlve / nlvi)100%,(4) where nlvcr is the nlv collapsibility ratio. pulmonary function was determined on the same day as ct images were acquired, using a flow - sensing spirometer (fudac-77 ; fukuda denshi co, ltd, tokyo, japan). pft results included total lung capacity, residual volume, fev1/fvc, fev1 measured as percent predicted (fev1%p), and the ratio of the single - breath diffusion capacity for carbon monoxide to alveolar gas volume, measured as percent predicted (dlco / va%p). results were given as mean standard deviation for tlv, elv, and nlv, for the inspiratory and expiratory phases. these results were compared for whole lung, each lobe, upper lobes, and lower lobes. upper lobes included the right upper lobe (rul), right middle lobe (rml), and left upper lobe (lul). lower lobes included the right lower lobe (rll) and left lower lobe (lll). subsequently, we determined tlv, tlvcr, nlv, and nlvcr for whole lung, each lobe, upper lobes, and lower lobes. pearson correlation coefficients (r) were determined to assess the associations between the pft results and ct - derived indices. statistical analyses were done using excel 2010 (microsoft corp, redmond, wa, usa). a p - value of < 0.05 was considered significant. based on gold staging categories, these 28 patients were classified as : stage 1 (n=16) ; stage 2 (n=10) ; and stage 3 (n=2). regarding smoking status, three subjects were current smokers, and 25 were former smokers. table 2 shows the mean values of lobar volumes and collapsibility indices from 3d - ct volumetry. similarly, nlv and nlvcr of lower lobes were larger than those of upper lobes. tlvi for whole lung was strongly correlated with total lung capacity (r=0.90, p<0.0001) and tlve for whole lung with residual volume (r=0.73, p<0.0001). as shown in table 3, nlv for whole lung and nlvcr for whole lung were positively correlated with pft results (r=0.41 to 0.52, all p<0.05), and elv for whole lung both for inspiratory phase and expiratory phase (elvi, e) were negatively correlated with pft results (r=0.62 to 0.38, all p<0.05). in contrast, tlvi, nlvi, e, tlv, and tlvcr for whole lung were not correlated with pft results. tlve for whole lung was correlated with fev1%p but was not correlated with dlco / va%p. tables 4 and 5 summarize the correlations found between pft results and ct - derived indices. fev1%p results were significantly correlated with nlvcr values for rll (r=0.56, p<0.01) and lll (r=0.57, p<0.01). fev1%p results were also significantly correlated with nlv and elvi, e for rll (r=0.41 to 0.47, all p<0.05) and lll (r=0.45 to 0.50, all p<0.05). dlco / va%p results were significantly correlated with nlv and nlvcr values for rul (r=0.56 to 0.59, all p<0.01) and lul (r=0.50 to 0.52, all p<0.01). dlco / va%p results were strongly and negatively correlated with elvi for rul (r=0.68, p<0.001) and lul (r=0.63, p<0.001). we summed the rul, rml, and lul volumes for the upper lobes, and rll and lll volumes for the lower lobes (table 6 and figures 25), in order to clarify their anatomical differences. fev1%p results were significantly and positively correlated with nlvcr values for the lower lobes (r=0.58, p<0.01) (figure 2b), whereas this correlation was not significant for the upper lobes (r=0.37, p=0.05) (figure 2a). fev1%p results were also positively correlated with nlv for the lower lobes (r=0.49, p<0.01) and negatively with elvi, e for the lower lobes (all r=0.44, all p<0.05) (figure 3a and b). in contrast, dlco / va%p results were significantly and positively correlated with nlv and nlvcr values for the upper lobes (r=0.54 and 0.58, respectively, all p<0.01) (figure 4a), whereas this correlation was not significant for the lower lobes (r=0.24 and 0.22, respectively, p=0.22 and 0.26, respectively) (figure 4b). furthermore, dlco / va%p results and elvi, e showed strong negative correlations for the upper lobes (r=0.67 to 0.62, all p<0.001) (figure 5a) and moderate negative correlations for the lower lobes (r=0.49 to 0.46, all p;0.05) (figure 5b). tlvi for whole lung was strongly correlated with total lung capacity (r=0.90, p<0.0001) and tlve for whole lung with residual volume (r=0.73, p<0.0001). as shown in table 3, nlv for whole lung and nlvcr for whole lung were positively correlated with pft results (r=0.41 to 0.52, all p<0.05), and elv for whole lung both for inspiratory phase and expiratory phase (elvi, e) were negatively correlated with pft results (r=0.62 to 0.38, all p<0.05). in contrast, tlvi, nlvi, e, tlv, and tlvcr for whole lung were not correlated with pft results. tlve for whole lung was correlated with fev1%p but was not correlated with dlco / va%p. tables 4 and 5 summarize the correlations found between pft results and ct - derived indices. fev1%p results were significantly correlated with nlvcr values for rll (r=0.56, p<0.01) and lll (r=0.57, p<0.01). fev1%p results were also significantly correlated with nlv and elvi, e for rll (r=0.41 to 0.47, all p<0.05) and lll (r=0.45 to 0.50, all p<0.05). dlco / va%p results were significantly correlated with nlv and nlvcr values for rul (r=0.56 to 0.59, all p<0.01) and lul (r=0.50 to 0.52, all p<0.01). dlco / va%p results were strongly and negatively correlated with elvi for rul (r=0.68, p<0.001) and lul (r=0.63, p<0.001). we summed the rul, rml, and lul volumes for the upper lobes, and rll and lll volumes for the lower lobes (table 6 and figures 25), in order to clarify their anatomical differences. fev1%p results were significantly and positively correlated with nlvcr values for the lower lobes (r=0.58, p<0.01) (figure 2b), whereas this correlation was not significant for the upper lobes (r=0.37, p=0.05) (figure 2a). fev1%p results were also positively correlated with nlv for the lower lobes (r=0.49, p<0.01) and negatively with elvi, e for the lower lobes (all r=0.44, all p<0.05) (figure 3a and b). in contrast, dlco / va%p results were significantly and positively correlated with nlv and nlvcr values for the upper lobes (r=0.54 and 0.58, respectively, all p<0.01) (figure 4a), whereas this correlation was not significant for the lower lobes (r=0.24 and 0.22, respectively, p=0.22 and 0.26, respectively) (figure 4b). furthermore, dlco / va%p results and elvi, e showed strong negative correlations for the upper lobes (r=0.67 to 0.62, all p<0.001) (figure 5a) and moderate negative correlations for the lower lobes (r=0.49 to 0.46, all p;0.05) (figure 5b). the results of the present study demonstrated that pulmonary function might be different between the upper and lower lobes in copd patients. fev1%p results were correlated significantly with lower lobe collapsibility indices, whereas dlco / va%p results were correlated strongly with collapsibility indices and elv values for upper lobes. these functional differences between individual lung lobes may be useful for early detection and for assessing the severity of copd. we showed that fev1%p results measured during forced expiration were more strongly correlated with lower lobe collapsibility indices than with those of upper lobes. matsuo studied the correlation between pft results and lobar nlv, using an inspiratory multiple detector ct scan, and reported that lower lobe volumes were more strongly correlated with fev1 results than were those of upper lobes.13 kundu examined the correlation between pft results and the collapsibility indices of each lobar tlv, using inspiratory and expiratory multiple detector ct scan, and reported that lower lobe volume changes were more strongly correlated with fev1%p than were those of upper lobes.17 these results indicate that lower lobe collapsibility more directly affects fev1. the reason is that the lower lobes can collapse more readily than can the upper lobes during a forced expiration because the intrathoracic pressure is less negative in the lower lung field than in the upper lung field.19 in general, emphysematous areas are found only in the upper lobes at earlier copd disease stages and then, spread to lower lobes as the disease progresses.20 the upper lobe predominant distribution of emphysematous areas and our results explain why fev1 as measured by pft may not detect the very early stage of copd. fev1%p airflow limitation is more influenced by the lower lobes because airway closure begins in the lower lobes while in a sitting or standing position, due to gravitational differences in the lung.21 our result regarding elv was the same as that of saitoh, who studied the correlations between percentage of extent of emphysema in each lobe and pft results in 50 emphysema patients, using helical ct.22 correlations between the dlco / va%p results and collapsibility indices were different between the upper and lower lobes in copd patients. the dlco / va%p results showed stronger positive correlations with upper lobe collapsibility indices than with those of lower lobes. similarly, dlco / va%p results showed strong negative correlations with upper lobe elvi, e. emphysema progression decreases both pulmonary collapsibility and the surface area for gas exchange, and the decrease of the surface area reduces dlco / va%p values. accordingly, elv might be a confounding factor in the correlation of collapsibility indices and dlco / va%p values. we speculated the main reason for our result would be the upper lobe predominant emphysema distribution, and the second reason could be the anatomic differences between each lobe. parr also reported that predominantly apical emphysema was associated with greater impairment of gas exchange than predominantly basal emphysema.23 they suggested the main reason was that subjects with apical emphysema would be unlikely to maintain gas exchange by recruitment of inferior normal lung units because these would already be well perfused, while subjects with basal emphysema could maintain dlco / va through the recruitment of underperfused disease - free lung units in the upper regions. the theory to explain the blood flow redistribution in response to hypoxia.24 in a sitting position, when spirometry is performed, the upper lobes show a low blood flow as compared with the lower lobes, due to gravitational differences within the lung,19 but this gradient of perfusion could be altered by hypoxic pulmonary vasoconstriction. we presumed blood flow redistribution was effective when lower lobes were hypoxic but was nt effective enough when upper lobes were hypoxic since lower lobes would already be well perfused. thus, the gas exchange capability of the upper lobes can be easily impaired if the surface area of the upper lobes decreases because perfusion can not compensate for this. in copd patients, lung cancer is often a complication.2527 the first treatment choice for early stage lung cancer is thoracic surgery.28 postoperative pulmonary function after lobectomy, which is the most commonly performed surgery for lung cancer, depends upon the volume of the residual anatomical lobe.2931 to date, this has been predicted based on the hypothesis that the function of each anatomic lobe is uniform. however, our results showed that the function of each lobe was so different that anatomic information should be added to volumetric information in order to more accurately predict postoperative pulmonary function in copd patients. as it is now, many researchers reported actual postoperative pulmonary function results were better than predicted postoperative values based on numbers of resected subsegments / segments in copd patients and in non - copd subjects.3236 these researchers suggested the reason would be the refractory improvement of remaining lung function by the lung volume reduction effect in copd patients or by the compensatory response. first, it was a retrospective study, and therefore, the sample size was small. as a result, all of the ct scans we analyzed were ordered by respiratory physicians as a workup for copd before inhalant treatment. subsequently, we researched mild to moderate copd patients only and could not compare the result with normal subjects. our selection criteria might have introduced selection bias since, as previously noted, most of our subjects in this study had mild to moderate copd. further investigations will be needed to determine the relationships between pft results and nlv collapsibility indices for severe to very severe copd patients and for normal subjects. a previous report showed low - dose ct could potentially substitute for standard - dose ct on assessments in lobar volume and emphysematous volume.37 now, we use the low - dose ct protocol, for which the exposure dose is about half that of the standard - dose protocol. third, we chose 950 hu as the threshold for emphysematous areas for expiratory ct. wang reported that densitometry of < 930 hu during expiratory ct was similar to densitometry of < 950 hu during inspiratory ct.38 we might have underestimated emphysematous volumes during expiratory ct and nlv collapsibility. however, the ideal threshold for expiratory ct is controversial, and some authors have used 950 hu for expiratory scan, as we did.12,39 so this is a problem that demands further studies. fourth, our subjects were in a sitting position during pft examinations, whereas the subjects were in a supine position during ct image acquisition. petersson reported that gravity redistributed regional ventilation in the upright posture, while the influence was much less in the supine and prone posture.40 compared with that in a sitting position, the ventilation becomes more uniform to the craniocaudal axis, in a supine position. thus, the collapsibility indices estimated in a spine posture might have been overestimated in the upper lobes, while they might have been underestimated in the lower lobes. fifth, we could not evaluate wall thickness of the bronchi, which represents airway inflammation. copd consists of emphysema and obstructive bronchitis, and bronchial wall thickness is significantly correlated with airway obstruction.41 to predict postoperative complications more accurately, additional analysis of the bronchial wall is needed. pulmonary function seemed to be different between the upper and lower lobes in copd patients. the fev1%p results were correlated with nlv collapsibility indices for lower lobes, while the dlco / va%p results were correlated with nlv collapsibility indices and elv for upper lobes. thus, evaluating lobar nlv collapsibility might be useful for estimating pulmonary function in copd patients.	backgroundwe investigated correlations between lung volume collapsibility indices and pulmonary function test (pft) results and assessed lobar differences in chronic obstructive pulmonary disease (copd) patients, using paired inspiratory and expiratory three dimensional (3d) computed tomography (ct) images.methodswe retrospectively assessed 28 copd patients who underwent paired inspiratory and expiratory ct and pft exams on the same day. a computer - aided diagnostic system calculated total lobar volume and emphysematous lobar volume (elv). normal lobar volume (nlv) was determined by subtracting elv from total lobar volume, both for inspiratory phase (nlvi) and for expiratory phase (nlve). we also determined lobar collapsibility indices : nlv collapsibility ratio (nlvcr) (%) = (1 nlve / nlvi) 100%. associations between lobar volumes and pft results, and collapsibility indices and pft results were determined by pearson correlation analysis.resultsnlvcr values were significantly correlated with pft results. forced expiratory volume in 1 second, measured as percent of predicted results (fev1%p) was significantly correlated with nlvcr values for the lower lobes (p<0.01), whereas this correlation was not significant for the upper lobes (p=0.05). fev1%p results were also moderately correlated with inspiratory, expiratory elv (elvi, e) for the lower lobes (p<0.05). in contrast, the ratio of the diffusion capacity for carbon monoxide to alveolar gas volume, measured as percent of predicted (dlco / va%p) results were strongly correlated with elvi for the upper lobes (p<0.001), whereas this correlation with nlvcr values was weaker for upper lobes (p<0.01) and was not significant for the lower lobes (p=0.26).conclusionfev1%p results were correlated with nlv collapsibility indices for lower lobes, whereas dlco / va%p results were correlated with nlv collapsibility indices and elv for upper lobes. thus, evaluating lobar nlv collapsibility might be useful for estimating pulmonary function in copd patients.
allergic rhinitis is characterised by chronic inflammation of the nasal membranes with symptoms including itching, sneezing, nasal congestion and rhinorrhoea. an estimated 1/5 of the population have allergic rhinitis, of which 40% have perennial allergic rhinitis and 40% have seasonal allergic rhinitis (meltzer 2007). allergic rhinitis has been shown to decrease quality of life in patients and places a burden on the health care system (kim 2007). although accepted treatments for allergic rhinitis include antihistamines, decongestants, anticholinergic agents, intranasal cromolyn and leukotriene receptor antagonists, intranasal corticosteroids are the most effective therapy for allergic rhinitis and first - line therapy in guidelines for moderate to severe disease (ratner 2007). intranasal corticosteroids include mometasone furoate, beclomethasone diproprionate, fluticasone propionate, fluticasone furoate, triamcinolone acetonide, budesonide and flunisolide (herman 2007). with the exception of beclomethasone, these agents have been shown to have minimal systemic absorption and side effects and are quickly metabolized to less active metabolites (herman 2007). in many countries, budesonide, fluticasone, mometasone and triamcinolone ciclesonide is a new - generation corticosteroid that has been developed for treatment of asthma and allergic rhinitis (ratner 2006). ciclesonide is administered as an inactive pro - drug and converted to active desisobutyryl - ciclesonide (des - cic) in the upper and lower airways (ratner 2006). in a rat lung model, des - cic had 100-fold greater affinity for the glucocorticoid receptor (gr) than the parent compound (stoeck 2004). human gr binding studies showed the same degree of affinity conversion and furthermore demonstrated that the affinity of des - cic was similar to fluticasone (belvisi 2005). metabolism of ciclesonide to the active form occurs through the activity of carboxylesterases and cholinesterases and has been demonstrated to occur in human nasal epithelial cells in vitro (sato 2007). des - cic undergoes reversible lipid conjugation and may serve as a reservoir of active drug, therefore leading to prolonged drug effect (nave 2005). it seems that the conversion rate of ciclesonide to des - cic is lower in oropharygeal epithelium, which implies a selective activation in respiratory mucosa and therefore an increased corticosteroid effect in the nose (and lung, for the inhaled drug) relative to the oropharynx. this would be expected to lead to reduced steroid - related oropharyngeal and laryngeal side effects (hoarseness, candidiasis) compared to conventional inhaled corticosteroids, and indeed this is seen in clinical studies. local conversion of ciclesonide to the active metabolite coupled with lipid conjugation and very high protein binding (rohatagi 2005) may serve to limit the systemic corticosteroid effects of the drug ; in preclinical studies (in rats) (belvisi 2005), inhaled ciclesonide showed 44-fold reduced potency in inducing adrenal involution and 22-fold in causing femoral plate hypoplasia compared with fluticasone propionate. oral bioavailability was also shown to be lower relative to budesonide (stoeck 2004). formulations of intranasal corticosteroids (incs) contain preservatives to inhibit bacterial growth, and other additives to retard clearance of the drug and maintain appropriate moisture levels. marketing of incs often focuses on differences between products that may be perceived as important in determining prescribing behavior. no adverse effects have been reported with the use of potassium sorbate in incs usage in humans. it does not alter ciliary beat frequency in in vitro studies of cultured human nasal mucosal cells (hofmann 2004). benzalkonium chloride (bkc) is utilized in all other incs ; data on the effect of bkc on nasal mucosa is controversial. in vitro studies have demonstrated ciliotoxicity with bkc (riechelmann 2004), however reviews of in vivo studies (graf 2001 ; marple 2004) have reported no adverse effect on nasal mucociliary clearance or ciliary beat frequency. there has been one report (naclerio 2003) of a decrease in nasal clearance between treatment groups in a 2-week in vivo study of budesonide (no bkc) vs mometasone furoate (contains bkc) nasal spray. most incs (except ciclesonide) contain thixotropic agents such as carboxymethylcellulose to confer high viscosity and delay mucosal clearance. these sprays need to be shaken before use to induce shearing forces to decrease viscosity, hence enabling the spray to be administered as a mist. it is not known whether failure to shake the bottle prior to use impairs nasal mucosal distribution and hence effectiveness. in contrast, ciclesonide is presented to the nasal mucosa in a hypotonic suspension (meltzer 2007). diffusion of water molecules from the hypotonic solution into the nasal mucosa increases viscosity, delays clearance and hence increases local concentration and absorption of ciclesonide into the nasal mucosa. there is no evidence that the delay in mucosal clearance that occurs with a hypotonic solution offers a clinical advantage over isotonic icns formulations containing thixotropic agents. importantly however, in an in vitro study (pujara 1995) hypotonic solutions induced lactate dehydrogenase release from the rat nasal cavity a surrogate marker of cell leaching or cell lysis. ciliary beat frequency does not seem to be impaired in in vitro studies of human nasal mucosa with hypotonic solutions ; however similar studies have not been performed in allergic rhinitis, and importantly, not with ciclesonide. ciclesonide has been shown to be effective for treatment of both seasonal and perennial allergic rhinitis. in a placebo - controlled study of 471 patients ciclesonide 200 g has demonstrated a significant reduction in both instantaneous and reflective morning and evening total nasal symptom scores (tnss) in groups with moderate perennial allergic rhinitis (meltzer 2007). furthermore in a study of 701 patients with moderate seasonal allergic rhinitis, ciclesonide at a dose of 100 g and 200 g has been shown to decrease sum morning and evening reflective tnss ; however the greater dose was associated with a larger improvement in symptom score (ratner 2006). in a placebo - controlled study of 24 patients, ciclesonide has also been shown to increase nasal airflow significantly when measured by anterior rhino - manometry 30% increase after 1 week of ciclesonide 200 g daily (schmidt 1999). in a long - term trial of 663 patients to assess the safety of ciclesonide, there was no evidence of tachyphylaxis (chervinsky 2007). there are few studies directly comparing the efficacy of intranasal corticosteroids, and head to head studies designed to assess efficacy have not been published (herman 2007). of comparison studies published, most have found similar efficacy between incs for allergic rhinitis ; however there is some evidence that budesonide has superior efficacy to fluticasone in the treatment of seasonal allergic rhinitis (herman 2007). it has low systemic bioavailability (< 1%), rapid clearance (elimination half - life of 3.5 hours) and a highly protein bound active metabolite (99%) (nave 2006). these features decrease systemic absorption and hence risk for adverse effects. in one pharmacokinetics study (nave 2006), 48 subjects were randomized to 6 groups with a daily dose of 50, 100, 200 and 400 g (od) and 400 g bid ciclesonide. one subject in the 400 g od and one in the 400 g bid group showed levels of ciclesonide greater than 25 pg / ml the lower limit of quantification (lloq). for des - cic, the majority of samples were below the lloq (10 pg / ml) ; however in the 400 g bd group, 7 out of 324 samples were above 20 pg / ml. also, there was no decrease in serum free cortisol levels compared with placebo and there was maintenance of diurnal variation in cortisol in those treated with ciclesonide. although there was a decrease in urinary free cortisol, the decrease occurred in both the ciclesonide and placebo group with no significant difference between these groups. in a study of 471 patients (meltzer 2007), 238 of which were treated with intranasal ciclesonide 200 g daily and 233 with placebo, adverse effects were reported at a similar rate between ciclesonide and placebo group (102 vs 110). long term data was reported in a 12 month randomised controlled trial of ciclesonide in patients with par greater than 12 years of age (chervinsky 2007). 441 patients were assigned to 200 g ciclesonide daily and 222 were assigned to placebo. reported adverse events were similar in the treatment group and control group (75.1% vs 74.3%) and of similar frequency to those reported for other incs. epistaxis, pharyngolaryngeal pain and sinusitis were higher in the treatment group however there was increased nasopharyngitis and upper respiratory tract infection in the placebo group. all incs result in an increase in the frequency of epistaxis compared with the use of placebo. epistaxis is one of the more common adverse effects encountered clinically and may result in cessation of incs use. duration of use, method of administration, ascertainment criteria and daily dose are important determinants of this adverse effect. ciclesonide at a dose of 200 g once daily for 48 weeks resulted in a rate of epistaxis of 10% compared to 7.2% in the placebo group (sato 2007). in a 6-week trial, this dose was associated with a rate of epistaxis of 7.6% compared to a placebo group of 5.2% (meltzer 2007). the prescribing information for other incs demonstrates an increase in epistaxis over placebo ; however the rates of epistaxis of both groups of subjects for the various incs are much lower than reported for ciclesonide. it is important to note that the prescribing information for fluticasone propionate (flixonase nasal drops) at a dose of 400 g identifies a rate of epistaxis of 19% compared with 4% in the placebo group (in the treatment of sinonasal polyposis). intriguingly, at a dose of fluticasone propionate 400 g bd in another study of nasal polyposis, the rate of epistaxis was only 6%, with a rate of 4% in the placebo group. this illustrates the difficulty in comparing data from one trial to another, even when using the same incs. head to head studies for given indications of use are needed to clarify not only efficacy, but also the relative frequency of the more common adverse events. uncommon adverse events such as septal perforation are likely to be reported only in the post - marketing period. there are no reports of septal perforation with the use of ciclesonide for allergic rhinitis, but any report of epistaxis from a patient using an incs should alert the clinician to the possibility of significant mucosal ulceration / atrophy. the chronic administration of topical steroids is well recognized to result in atrophy of epithelial surfaces, and concern has been expressed that mucosal atrophy might arise with the long - term use of incs ; evidence for this is lacking, yet concern at the possibility of the development of atrophy has possibly resulted in a degree of overcautiousness in dose and duration of treatment with incs. histopathological studies of nasal mucosa before and after long term incs usage has not been reported for ciclesonide, however nasal mucosal biopsies before and after 12 months of mometasone furoate 200 g / day did not reveal any changes of atrophy or epithelial thickness, but showed a reduction of the inflammatory cell infiltrate and a decrease in focal metaplasia (minshall 1998), and biopsies after 2 to 5 years of continuous treatment with budesonide also did not show any deleterious change (pipkorn 1988). further studies at higher doses for all of the incs in a variety of disorders are needed to enable clinicians to confidently use this class of medications to their fullest potential. severe adverse events were found to be increased in the ciclesonide group compared with placebo (13.4% vs 11.7%), but these were not considered to be related to the active medication (chervinsky 2007). importantly, in terms of systemic adverse events, there was no decrease from baseline or significant difference between the two groups in 24-hour urinary cortisol level or morning plasma cortisol levels at 24 or 48 weeks (chervinsky 2007) of ciclesonide 200 g daily. an absence of adrenal suppression has also been reported for budesonide, triamcinolone and mometasone (wilson 1998). importantly, the use of betamethasone nasal drops has been reported to affect growth (daman willems 1994 ; skoner 2000), although the later study did not have age or height controls. no studies have examined growth velocity in children treated with nasal ciclesonide ; however an inhaled dose of 160 mg daily (to treat asthma) in children aged 4 to 11 years did not show any modification of adrenal function (gelfand 2006) or any significant change in growth of children aged 5 to 8 over a period of 1 year (skoner 2008). the possible increase in incidence of cataracts and/or glaucoma in association with the use of intranasal corticosteroids remains controversial. ciclesonide used regularly for 1 year in 318 subjects was not associated with any increase intraocular pressure or cataract development compared with placebo (156 subjects) (chervinsky 2007). considering that allergic rhinitis often occurs in patients with asthma, safety when used in combination with standard asthma therapy is an important consideration. in a randomized, double - blind, placebo- and active - controlled non - inferiority trial, patients aged 18 to 60 years with asthma and sar were commenced on a 10 day run - in period of inhaled beclomethasone dipropionate 320 g twice daily and commenced on a 43 day period of either intranasal ciclesonide 200 g or placebo and at the conclusion of this period were given 2 mg of dexamethasone. fifty - six patients were assigned to ciclesonide and 55 were treated with placebo, and although plasma cortisol (auc024 h) decreased significantly in the 10-day run - in period of inhaled beclomethasone and intranasal placebo, there was no significant suppression between the placebo and the ciclesonide group at the end of the trial period. a decrease in plasma cortisol after being given dexamethasone the day following the completion of the ciclesonide or placebo period demonstrated that further inhibition of the hpa axis was indeed possible (ratner 2007). in a similarly structured study in which asthma was treated with inhaled fluticasone salmeterol 500/50 g, ciclesonide did not add to cortisol suppression (kim 2007). perception of taste, anterior and posterior nasal dripping of spray, and smell are important criteria in patient preference for the use of incs (mahadevia 2004). bkc has an unpleasant bitter taste ; budesonide (which does not contain bkc) was preferred over fluticasone propionate on the basis of taste (shah 2003), and similarly, triamcinolone acetonide was preferred over fluticasone propionate and mometasone furoate (bachert 2002). studies of ciclesonide nasal spray have shown no difference to placebo in parameters of tolerability such as local irritation (meltzer 2007) or discomfort (chervinsky 2007), but taste and smell and other subjective patient preference aspects were not reported. in a meta - analysis of the efficacy of the treatment of allergic rhinitis, incs were shown to have a clear benefit over oral antihistamines in relieving nasal symptoms (weiner 1998). ciclesonide is a novel corticosteroid distinguished by the requirement for conversion from a relatively inactive pro - drug to a potent agent in the mucosa of the target organ, the formation of lipid conjugates leading to prolonged duration of effect, and high protein binding and first - pass metabolism leading to very low systemic absorption when used topically. these features would be expected in theory to increase activity of the drug in the target therapeutic area relative to the areas responsible for adverse effects such as the oropharyngeal mucosa and the systemic circulation. however even if these theoretical advantages were borne out in vivo, it is clear that they are most relevant to the inhalation of corticosteroids to treat asthma, where large doses are delivered to a large area of mucosal epithelium and there is great exposure of the oropharynx during the inhalation procedure. by comparison, when topical corticosteroids are used to treat rhinitis the dose is low and there is minimal exposure of the oropharynx, such that candidiasis is very rare as a side effect even with existing agents. the distinguishing features of the formulation of ciclesonide nasal spray are the hypotonic solution and the use of potassium sorbate (rather than the more common bkc) as a preservative. it is suggested that the former feature may enhance local concentration and absorption, which should increase efficacy. the lack of bkc may reduce ciliary toxicity (although this is controversial) and improve tolerability. although corticosteroids are proven to be more effective than oral antihistamines for the treatment of allergic rhinitis, there is in contrast no convincing evidence that any incs is more effective than any other (waddell 2003). several trials have compared some of the available incs but no published studies have compared ciclesonide with any other incs. the magnitude of effect of ciclesonide has been reported to be comparable to that previously reported for mometasone (ratner 2006). clearly there is a need for head to head studies of the various incs not only to compare efficacy, but also local and systemic adverse effects and nasal tolerability. based on currently available trials there is no evidence that the unique pharmacological features of ciclesonide increase its efficacy in comparison with other available nasal topical corticsteroids, and at this stage it would not seem to offer any clear clinical advantage. trials of other incs have demonstrated efficacy in other related parameters such as ocular symptoms and quality of life ; these are not yet available for ciclesonide. some forms of chronic rhinosinusitis and particularly nasal polyposis are corticosteroid responsive and topical corticosteroids have a demonstrated role in these conditions, but once again this effect has not yet been demonstrated for ciclesonide. it is possible that the maximum efficacy of topical corticosteroids has already been achieved ; in many patients regular use provides major and even total symptom relief. however a significant proportion, particularly those with more complex disease (nasal polyposis, chronic rhinosinusitis), remain symptomatic despite maximal doses of any topical drug. in these cases the limitations to efficacy may have more to do with the system of delivery than the drug. it is known that oral (systemically delivered) corticosteroids can be of major benefit in these conditions (hissaria 2006) but clearly are not safe for long - term treatment. it is possible that different delivery systems such as drops instilled in the head - inverted position may improve efficacy but comparative trials have not been done. in summary, several novel features distinguish ciclesonide from existing incs, including characteristics of the drug itself and of its formulation. although these features may theoretically enhance the safety of the product, there has as yet been no conclusive demonstration that this translates to actual clinically important safety benefit. the theoretical safety advantages of ciclesonide would appear to be more relevant to the treatment of asthma than rhinitis. although there are as yet no direct comparisons of ciclesonide with other incs, there does not appear to be indication from the existing studies that it is likely to be more efficacious than other incs, and there remains doubt about its efficacy in children. issues such as cost effectiveness, patient choice, licensing and regulation as well as ultimate determination of efficacy and safety relative to existing products may eventually determine the place of ciclesonide in the therapeutic armamentarium and in the marketplace.	ciclesonide is a novel corticosteroid which is optimized for topical use. it is a pro - drug which is activated locally in the airway mucosa, lipid - conjugated for local retention, and has very high protein binding in circulation leading to low systemic bioavailability. these characteristics should lead to highly selective activity with reduced local and systemic side effects. it has been established as an inhaled medication for asthma and has also been shown in double - blind trials to be efficacious for the treatment of seasonal and perennial allergic rhinitis. however no data have yet demonstrated superiority over existing nasal topical corticosteroids, either in terms of efficacy or adverse effects, and trials have not yet clearly shown efficacy in rhinitis in children. therefore the place of ciclesonide in the treatment of allergic rhinitis relative to other existing products remains unclear.
transrectal ultrasound (trus)-guided prostate biopsy is a standard procedure for the diagnosis of prostate cancer. rectal bleeding is one of the most common side effects of trus - guided prostate biopsy. the utility of the absorbable hemostatic gelatin sponge for hemostasis in anorectal surgery has been reported (1, 2). while the gelatin sponge can be expected to promote hemostasis in rectal bleeding, there are no studies evaluating its efficacy on hemostasis in transrectal ultrasound - guided prostate biopsy. to clarify the efficacy on hemostasis of the gelatin sponge for rectal bleeding in transrectal ultrasound - guided prostate biopsy in a randomized controlled prospective study. this prospective study was approved by the ethical committee at hiroshima city asa hospital. from october 2011 to november 2012, after informed consent, a total of 278 participants were submitted to a transrectal ultrasound - guided prostate biopsy with an 18g200 mm biopsy needle under local anesthesia (chloride 1% lidocaine in the rectal membrane) by the same surgeon (k.k). for those participants taking antiplatelet agents, the medication was discontinued before the biopsy for an appropriate period until the antiplatelet drug was eliminated from the body, e.g. 14 days for clopidogrel bisulfate and 4 days for warfarin. before the biopsy, all the participants were randomly assigned to two groups by the envelope method ; gelatin sponge (spongostan anal, ethicon, inc., johnson & johnson, usa, figure-1) insertion immediately after the biopsy (group a, n=148) and no insertion (group b, n=130). in both groups, no medical procedures, such as a digital rectal examination (dre), were done. the patients stayed in the hospital at least one day for observation of their postsurgical course by the medical staff, and this 24 hour observation period excluded as much as possible any bias in this study. the hematological value, ipss (international prostate symptom score), qol (quality of life) score, oabss (over active bladder symptom score), and a questionnaire that was composed of 6 items with 5 levels of response (appendix) were evaluated in both groups. figure 1the absorbable hemostatic gelatin sponge (spongostantm anal) made of gelatin is cylindricality - shaped of 3 cm (diameter) x 8 cm. in the center, it has a cylindrical hollow region of 0.8 cm in diameter. when blood was observed on the underwear or in the bedpan after the biopsy, the dre was performed to confirm the degree of bleeding. if attached blood on the dre was marginal and the color was pink or dilute red, we decided that additional measures were unnecessary. if there was considerable attached blood or blood clots, we defined it as significant rectal bleeding. we categorized significant rectal bleeding into two grades for hemostasis management, including mild (slight or moderate bleeding) and severe (profuse bleeding that required endoscopic clipping). when the bleeding was classified as mild, we inserted the gelatin sponge into the participants in either group b or reinserted it into those participants in group a. if the bleeding could not be stopped by this approach, we additionally used index finger pressure for ten minutes or more to promote hemostasis. in the severe cases, those severe cases were given bed rest until the next morning after the prescript hemostatic approach. the difference in background factors between groups a and b was assessed by the unpaired t - test, mann - whitney s u test, and chi - square test. to identify the independent predictive factors for rectal bleeding for all participants, 7 factors, including gelatin sponge insertion, age, psa, prostate volume, antiplatelet drug usage, the number of biopsy samples per procedure, and number of times biopsies were performed, were analyzed by logistic regression analysis. in all analyses, for the 278 participants, the median age, median psa, and median prostate volume were 71y / o (50 - 97), 8.4 ng / dl (1.3 - 4519.7), and 27.4 ml (5.2 - 129.3), respectively. two hundred twenty eight of all participants (82.0%) were biopsied for the first time. in our study, 1 participant (0.4%) received 4 core biopsies, 144 participants (51.8%) received 6 core biopsies, 110 participants (39.6%) received 10 core biopsies, and 23 participants (8.3%) received 12 core biopsies. fifty - five of the participants (19.8%) were taking antiplatelet drugs and were only biopsied after an appropriate washout period. prostate adenocarcinoma was detected in 147 participants (52.9%) and their gleason scores were 6 (18 patients), 7 (56 patients), and 8 (73 patients). table 1participants background and hematological values in groups a and b. group agroup bp - valueparticipants148130 age (year)71 (55 - 97)71 (50 - 89)0.843psa (ng / ml)8.3 (1.3 - 1977.3)8.4 (2.2 - 4519.7)0.548prostate volume (ml)27.4 (5.2 - 129.3)27.4 (10.9 - 105.0)0.676biopsy number of times 1st120108 2nd17140.972 3rd64 4th or more54 number of samples 410 685590.080 105060 121211 detection of carcinoma78670.941antiplatelet drugs34210.202hematological value hb (g / dl)14.21.715.14.40.102 plt (10/l)21.05.522.86.50.061 median valuethe p values were calculated using the t test (age, psa, prostate volume, hematological value), chi - square test (detection of carcinoma, antiplatelet drugs), and mann - whitney s u test (number of times and samples). the p values were calculated using the t test (age, psa, prostate volume, hematological value), chi - square test (detection of carcinoma, antiplatelet drugs), and mann - whitney s u test (number of times and samples). the frequency of major complications after prostate biopsy in all cases was 5.0% (n=14) for rectal bleeding, 33.8% (n=94) for gross hematuria, and 0.7% (n=2) for transitory urinary retention. though the frequency of rectal bleeding in group a was significantly lower that in group b (p=0.029), there was no significant difference between the frequency of gross hematuria and transitory urinary retention between groups a and b (table-2). the number of participants experiencing each grade of rectal bleeding was as follows : 3 mild and 0 severe in group a, and 10 mild and 1 severe in group b, respectively. three cases in group a (100%) and 6 cases in group b (60%) in the mild grade ceased bleeding after reinsertion or insertion of the gelatin sponge. four cases in the mild grade in group b were submitted to finger pressure for 10 minutes before the insertion of the gelatin sponge. nevertheless, 2 of those 4 cases in the mild grade in group b had additional finger pressure for ten minutes to completely stop the bleeding. total (n=278)group a (n=148)group b (n=130)p valuerectal bleeding14 (5.0%)3 (2.0%)11 (8.5%)0.029mild 310 severe 01 gross hematuria94 (33.8%)47 (31.8%)47 (36.2%)0.439urinary retention2 (0.7 %) 1 (0.7%)1 (0.8%)0.926chi - square test there were no significant differences between the 2 groups for the following six factors : age, psa value (ng / ml), prostate volume (ml), taking antiplatelet drugs usage (yes), number of biopsy samples per procedure (10 places vs.<10 places), and number of times of biopsies (2 times vs. first time). the gelatin sponge insertion was the only significantly independent predictive factor that suppressed the rectal bleeding in prostate biopsy as determined by univariable analysis and by multivariate analysis (table-3). univariable analysismultivariable analysis p valueor (95%ci)p valueor (95%ci)gelatin sponge insertion (yes)0.0240.223 (0.061 - 0.821)0.0160.185 (0.047 - 0.732)age (year old)0.7760.989 (0.923 - 1.061)0.9560.998 (0.923 - 1.078)antiplatelet agents (yes)0.3581.755 (0.528 - 5.820)0.1952.416 (0.636 - 9.183)psa (ng / ml)0.3680.975 (0.921 - 1.031)0.4300.973 (0.912 - 1.040)prostate volume (ml)0.3030.982 (0.948 - 1.017)0.2570.976 (0.935 - 1.018)number of times of biopsies (2)0.9470.980 (0.538 - 1.784)0.7911.220 (0.278 - 5.372)number of biopsy samples per procedure (10)0.2152.032 (0.633 - 6.226)0.3161.989 (0.518 - 7.640) the findings in the blood tests before and after prostate biopsy were comparable in 149 cases. there were no significant changes found in the blood tests, including hemoglobin and platelet counts between the two groups before the biopsy (table-1). there were no significant differences in the responses to each item in our questionnaire between group a and group b (q1 ; average score 1.7 vs.1.6, p=0.21, q2 ; average score 1.8 vs.1.7, p=0.41, q3 ; average score 1.6 vs.1.5, p=0.58, q4 ; average score 1.5 vs.1.6, p=0.30, q5 ; average score 1.5 vs.1.4, p=0.26, and q6 ; average score 2.2 vs.2.0, p=0.63), respectively. moreover, there were no significant differences in ipss, oabss, and qol scores before and after biopsy. for the 278 participants, the median age, median psa, and median prostate volume were 71y / o (50 - 97), 8.4 ng / dl (1.3 - 4519.7), and 27.4 ml (5.2 - 129.3), respectively. two hundred twenty eight of all participants (82.0%) were biopsied for the first time. in our study, 1 participant (0.4%) received 4 core biopsies, 144 participants (51.8%) received 6 core biopsies, 110 participants (39.6%) received 10 core biopsies, and 23 participants (8.3%) received 12 core biopsies. fifty - five of the participants (19.8%) were taking antiplatelet drugs and were only biopsied after an appropriate washout period. prostate adenocarcinoma was detected in 147 participants (52.9%) and their gleason scores were 6 (18 patients), 7 (56 patients), and 8 (73 patients). table 1participants background and hematological values in groups a and b. group agroup bp - valueparticipants148130 age (year)71 (55 - 97)71 (50 - 89)0.843psa (ng / ml)8.3 (1.3 - 1977.3)8.4 (2.2 - 4519.7)0.548prostate volume (ml)27.4 (5.2 - 129.3)27.4 (10.9 - 105.0)0.676biopsy number of times 1st120108 2nd17140.972 3rd64 4th or more54 number of samples 410 685590.080 105060 121211 detection of carcinoma78670.941antiplatelet drugs34210.202hematological value hb (g / dl)14.21.715.14.40.102 plt (10/l)21.05.522.86.50.061 median valuethe p values were calculated using the t test (age, psa, prostate volume, hematological value), chi - square test (detection of carcinoma, antiplatelet drugs), and mann - whitney s u test (number of times and samples). the p values were calculated using the t test (age, psa, prostate volume, hematological value), chi - square test (detection of carcinoma, antiplatelet drugs), and mann - whitney s u test (number of times and samples). the frequency of major complications after prostate biopsy in all cases was 5.0% (n=14) for rectal bleeding, 33.8% (n=94) for gross hematuria, and 0.7% (n=2) for transitory urinary retention. though the frequency of rectal bleeding in group a was significantly lower that in group b (p=0.029), there was no significant difference between the frequency of gross hematuria and transitory urinary retention between groups a and b (table-2). the number of participants experiencing each grade of rectal bleeding was as follows : 3 mild and 0 severe in group a, and 10 mild and 1 severe in group b, respectively. three cases in group a (100%) and 6 cases in group b (60%) in the mild grade ceased bleeding after reinsertion or insertion of the gelatin sponge. four cases in the mild grade in group b were submitted to finger pressure for 10 minutes before the insertion of the gelatin sponge. nevertheless, 2 of those 4 cases in the mild grade in group b had additional finger pressure for ten minutes to completely stop the bleeding. total (n=278)group a (n=148)group b (n=130)p valuerectal bleeding14 (5.0%)3 (2.0%)11 (8.5%)0.029mild 310 severe 01 gross hematuria94 (33.8%)47 (31.8%)47 (36.2%)0.439urinary retention2 (0.7 %) 1 (0.7%)1 (0.8%)0.926chi - square test there were no significant differences between the 2 groups for the following six factors : age, psa value (ng / ml), prostate volume (ml), taking antiplatelet drugs usage (yes), number of biopsy samples per procedure (10 places vs.<10 places), and number of times of biopsies (2 times vs. first time). the gelatin sponge insertion was the only significantly independent predictive factor that suppressed the rectal bleeding in prostate biopsy as determined by univariable analysis and by multivariate analysis (table-3). univariable analysismultivariable analysis p valueor (95%ci)p valueor (95%ci)gelatin sponge insertion (yes)0.0240.223 (0.061 - 0.821)0.0160.185 (0.047 - 0.732)age (year old)0.7760.989 (0.923 - 1.061)0.9560.998 (0.923 - 1.078)antiplatelet agents (yes)0.3581.755 (0.528 - 5.820)0.1952.416 (0.636 - 9.183)psa (ng / ml)0.3680.975 (0.921 - 1.031)0.4300.973 (0.912 - 1.040)prostate volume (ml)0.3030.982 (0.948 - 1.017)0.2570.976 (0.935 - 1.018)number of times of biopsies (2)0.9470.980 (0.538 - 1.784)0.7911.220 (0.278 - 5.372)number of biopsy samples per procedure (10)0.2152.032 (0.633 - 6.226)0.3161.989 (0.518 - 7.640) the findings in the blood tests before and after prostate biopsy were comparable in 149 cases. there were no significant changes found in the blood tests, including hemoglobin and platelet counts between the two groups before the biopsy (table-1). there were no significant differences in the responses to each item in our questionnaire between group a and group b (q1 ; average score 1.7 vs.1.6, p=0.21, q2 ; average score 1.8 vs.1.7, p=0.41, q3 ; average score 1.6 vs.1.5, p=0.58, q4 ; average score 1.5 vs.1.6, p=0.30, q5 ; average score 1.5 vs.1.4, p=0.26, and q6 ; average score 2.2 vs.2.0, p=0.63), respectively. moreover, there were no significant differences in ipss, oabss, and qol scores before and after biopsy. to our knowledge, this is the first report to show that the absorbable hemostatic gelatin sponge provides significant hemostasis for rectal bleeding in trus - guided prostate biopsies. based on our results, the immediate insertion of an absorbable hemostatic gelatin sponge can reduce the frequency of rectal bleeding without physical burden for the participants. furthermore, even when rectal bleeding occurs, it can be stopped in many of the cases by only inserting the gelatin sponge (in mild grade participants : 100% of group a and 60% of group b). rectal bleeding in a transrectal prostatic biopsy has an incidence that ranges from 0.9 - 37% (3 - 7), because the definition of rectal bleeding is defined differently depending on the institution where it was performed. based on a large - scale retrospective analysis for 202,065 cases in japan, the incidence of rectal bleeding in transrectal prostatic biopsy was reported as 5.6% (8). though clinically serious bleeding is rare, sometimes rectal bleeding requires hemostasis. to date, many methods for hemostasis have been reported, such as pressure by tampon insertion, urethral catheter placement, condom expansion (9 - 11), and endoscopic clipping at the bleeding points (12), and endoscopic injection of epinephrine and polidocanol in cases of severe bleeding (6). spongostan anal is an absorbable hemostatic gelatin sponge made of neutral purified gelatin (pig origin) with uniform porosity, a cylindrical shape 3 cm (diameter) x 8 cm, and a central hollow region of 0.8 cm in diameter. it has a non - water - soluble property, attaches to the bleeding tissue, and absorbs considerable amounts of blood equal to approximately 35 times the product weight. furthermore, it provides pressure to the bleeding site while conforming to the shape of the anal canal, and platelets are trapped within the pores and form an insoluble fibrin clot that controls bleeding. in addition, after insertion in the anus, the sponge is absorbed and excreted with the stool within 1 - 2 days (13). in the rectal region, there are three veins, including superior, middle, and inferior rectal veins that comprise a dense anastomosis and form the rectal venous plexus. most rectal bleeding in transrectal prostate biopsy is thought to originate in the rectal venous plexus and can be controlled with comparative ease (9). in this study, the gelatin sponge was placed on the needle puncture site located at approximately 3 - 5 cm from the anus. unlike conventional usage, this site was located near the rectal ampulla rather than at the anal canal. the effect of the gelatin sponge on inducing hemostasis in part by pressure is not expected in the rectal ampulla because this site has considerable elasticity though there are individual patient differences. our study suggested that the gelatin sponge when applied to the bleeding site absorbed blood and might provide a hemostatic effect. however, in severe cases and in a few mild cases, the gelatin sponge apparently could not be applied to the bleeding site directly and did not establish hemostasis because the rectal ampulla expanded due to blood retention. the branch of the inferior rectal artery forms a vascular bed among inferior vesical arteries. severe bleeding cases requiring endoscopy may be due to arterial bleeding. in such cases, the gelatin sponge may not work, and thus, endoscopic clipping is necessary as soon as severe bleeding is observed. evaluation of the severity of bleeding was essential for selecting the hemostatic approach, such as whether to use an endoscopic approach, to apply pressure to the site, to insert the gelatin sponge, or to only monitor the bleeding. for those taking antiplatelet drugs, though the bleeding risk was considered low (15, 16), we discontinued the use of these drugs prior to the biopsy in order to exclude that variable. as for other factors, several reports showed that the incidence of complications did not correlate in prostate biopsy when considering the size of the biopsy needle or the number of biopsies (17, 18). in cases of patients with hemorrhoids, they did have a bleeding risk because the rectal venous plexus was enlarged (12). in this study, none of the participants had hemorrhoids in the 14 rectal bleeding cases. this study has some limitations, such as the data being based on a relatively small number of participants and the lack of selection for the best candidates. based on our results, although we demonstrated that the immediate insertion of a gelatin sponge into the rectum after transrectal prostate needle biopsy was probably useful, simple, effective, and safe, it was difficult to prove the true benefit of the gelatin sponge in comparison with other hemostatic procedures. we demonstrate that use of the gelatin sponge for those who have bleeding after a biopsy can be an option. immediate insertion of the absorbable hemostatic gelatin sponge into the rectum after transrectal ultrasound - guided prostate needle biopsy significantly decreases rectal bleeding without increasing patient symptoms, such as pain and a sense of discomfort.	objectives to examine the usefulness of an absorbable hemostatic gelatin sponge for hemostasis after transrectal prostate needle biopsy.subjects and methods the subjects comprised 278 participants who underwent transrectal prostate needle biopsy. they were randomly allocated to the gelatin sponge insertion group (group a : 148 participants) and to the non - insertion group (group b : 130 participants). in group a, the gelatin sponge was inserted into the rectum immediately after biopsy. a biopsy - induced hemorrhage was defined as a case in which a subject complained of bleeding from the rectum, and excretion of blood clots was confirmed. a blood test was performed before and after biopsy, and a questionnaire survey was given after the biopsy.results significantly fewer participants in group a required hemostasis after biopsy compared to group b (3 (2.0%) vs. 11 (8.5%), p=0.029). the results of the blood tests and the responses from the questionnaire did not differ significantly between the two groups. in multivariate analysis, only insertion of a gelatin sponge into the rectum emerged as a significant predictor of hemostasis.conclusion insertion of a gelatin sponge into the rectum after transrectal prostate needle biopsy significantly increases hemostasis without increasing patient symptoms, such as pain and a sense of discomfort.
xp11.2 translocation renal cell carcinoma (trcc), characterized by translocation of the transcription factor e3 (tfe3) gene located on the locus xp11.2, is a rare subtype of trcc. it was recognized as a separate entity in 2004 world health organization classification of kidney tumors. primarily described in children and adolescents, xp11.2 trccs are a group of neoplasms with distinct clinical, histopathological appearance, immunohistochemical, and cytogenetic profile. we report a case of xp11.2 trcc in an 11-year - old male diagnosed based on morphology, immunohistochemistry (ihc) and confirmed by cytogenetics. an 11-year - old male presented with five to six episodes of hematuria and intermittent abdominal pain of 10 days duration. computed tomography of his abdomen revealed a 4 cm 4 cm 3 cm mass involving predominantly the upper pole of the right kidney [figure 1a ]. (a) contrast - enhanced computed tomography abdomen showed a 4 cm 4 cm 3 cm mass involving the upper pole of the right kidney. (b) grossly, the upper pole of the kidney revealed a mass, which was tan yellow and necrotic with cystic areas. (c) microscopically, tumor cells were arranged in papillary configuration (h and e, 40). (d). on high power, the tumor cells had voluminous, clear to eosinophilic cytoplasm, vesicular nuclear chromatin and prominent nucleoli (h and e, 400) on gross examination, the upper pole of the kidney revealed a 4 cm 4 cm 3 cm mass, which on cut section was tan yellow and necrotic with cystic areas [figure 1b ]. the tumor cells had voluminous, clear to eosinophilic cytoplasm, vesicular nuclear chromatin, and prominent nucleoli [figure 1d ]. the nuclear grade corresponded to fuhrman grade 2. however, psammomatous calcifications were not seen. on ihc, these tumor cells were focally positive for cd10, vimentin, and epithelial membrane antigen (ema) but were negative for ck7 and melan - a [figure 2a d ]. fish analysis showed positive tfe3 translocation in 90% of the tumor cells, thus confirming the diagnosis of xp11.2 trcc [figure 3b ]. (a - c) tumor cells showing positivity for cd10, epithelial membrane antigen, and vimentin, respectively (ihc, 400). tumors cells showing negativity for ck7 (ihc, 400) (a) tumor cells showing strong nuclear positivity for transcription factor e3 (ihc, 400). (b) fluorescence in situ hybridization showing positive transcription factor e3 translocation in the tumor cells at 17-months postoperative follow - up, the patient is doing well without any locoregional recurrence. recently recognized as a separate entity in 2004, trcc is a rare neoplasm with distinct clinical and pathological characteristics. xp11.2 trccs occur primarily, but not exclusively, in children and young adults with a strong female predominance. one - third of pediatric renal carcinomas are related to tfe3 translocation accounting for 2040% of pediatric trcc. the incidence of xp11.2 trccs has been reported to be 11.6% of all renal tumors in adults. its actual incidence remains underestimated in india, and only a few case reports are available from india. clinically, xp11.2 trccs usually present as an asymptomatic, painless mass, often identified incidentally during abdominal imaging. grossly, xp11.2 trccs usually have variegated appearance and may mimic conventional clear cell rcc and papillary rcc. microscopically, xp11.2 trccs show papillary or nested architecture in a background of prominent capillary vasculature. ihc typically reveals positivity for cd10 and weak or rare reactivity to cytokeratins (ck7, ae1/ae3), ema, and melanocytic markers such as melan - a. however, the most sensitive and specific immunohistochemical markers for these neoplasms are tfe3 protein and cathepsin k. fish assay and real - time polymerase chain reaction are useful confirmatory tests for tfe3 gene rearrangement. in xp11.2 trccs, because of the genetic rearrangements with one of the five known partner genes described (aspl on 17q25, prcc on 1q21, psf on 1q34, nono on xq12, and cltc on 17q23), there is overexpression of the fusion product. the fusion product is found to contain c - terminal portion of tfe3, which is a member of the microphthalmia - associated transcriptional factor family. children with isolated lymph node metastasis are found to have a favorable short - term prognosis whereas adults often have widespread metastasis at the time of presentation connotes a poor outcome. regardless of the age, a long - term follow - up is recommended as the tumor can metastasize decades after its initial presentation. the current management of xp11.2 trcc is similar to conventional rcc. for localized xp11.2 trcc including patients with positive regional lymph nodes, surgery is the treatment of choice. for patients with hematogenous metastases, the current options are vegfr - targeted therapies and mammalian target of rapamycin inhibitors. our case demonstrates the importance of performing ihc as the distinction of xp11.2 trcc is crucial in determining surveillance protocol and management. cytogenetic analyses for tfe3 gene rearrangement should be done besides the ihc for confirmation of the diagnosis.	xp11.2 translocation renal cell carcinomas (trccs) are a group of neoplasms with distinct clinical, histopathological appearance, immunohistochemical, and cytogenetic profile. we report a case of xp11.2 translocation trcc in an 11-year - old male diagnosed based on immunohistochemistry and fluorescence in situ hybridization.
pleomorphic adenoma (pa) is the most common tumor of the salivary gland. although benign, the rate of recurrence of pa is relatively high (2.532.5%). the recurrent tumors are often multinodular and frequently lack surrounding capsule, thus making surgical management difficult. in the human saliva, up to 26% of the salivary proteins are mucins. mucins are high molecular weight glycoproteins with oligosaccharides attached to amino acids by o - glycosidic linkages. many reviews on their histochemical classification and identification have been put forward to explain the intricacies of mucins. mucins, elaborated by major salivary glands, reveal that a heterogeneous population of mucosubstances exist. numerous alterations of mucin - associated carbohydrates have been detected in neoplastic epithelial tissues and on circulating mucins in patients with gastrointestinal tumors. during the past few years, core proteins for human mucins have been identified and used as tumor markers in different neoplasms. thus this study was executed in an attempt to correlate the clinical, histopathological and histochemical behavior of pa, so as to infer the prognostic implication. twenty - six diagnosed cases of pa of minor salivary glands and five controls of normal minor salivary acini of the hard palate were included in the study. paraffin - embedded blocks were retrieved from the departmental archives, fresh sections were cut and two series of slides were prepared. one series was stained with routine hematoxylin and eosin (h and e) stain, while the other series was stained with combined alcian blue (ab)-periodic acid - schiff (pas) stain (mowry 1956) ; to differentiate between neutral and acidic mucins. relevant clinical findings such as age, sex, site and history of recurrence were noted. h and e stained slides were categorized according to foote and frazell 's (1954) classification. histopathological features such as capsular architecture, epithelial cells and patterns and tumoral stroma were analyzed in each slide and tabulated. the type of histochemical stain, the uniformity and intensity of staining patterns were comparatively analyzed in the epithelial and stromal components as well as in the associated salivary acini, to determine the mucin profile of the neoplasm. all the obtained data were tabulated, compared and correlated to derive at a hypothesis. relevant clinical findings such as age, sex, site and history of recurrence were noted. h and e stained slides were categorized according to foote and frazell 's (1954) classification. histopathological features such as capsular architecture, epithelial cells and patterns and tumoral stroma were analyzed in each slide and tabulated. the type of histochemical stain, the uniformity and intensity of staining patterns were comparatively analyzed in the epithelial and stromal components as well as in the associated salivary acini, to determine the mucin profile of the neoplasm. all the obtained data were tabulated, compared and correlated to derive at a hypothesis. demographics revealed, the most common age group to be affected was 3140 years [table 1 ]. the patients were mostly females (15 cases, representing 57.7%), with a female to male ratio of 1.36:1. distribution of pleomorphic adenomas by age the most common site of involvement was the hard palate (24 cases) ; accounting for 92.3% of the recorded cases [table 2 ]. distribution of pleomorphic adenomas by site based on the proportion of parenchymal and stromal tumoral components, the cases were classified into four subtypes as proposed by foote and frazell [table 3 ]. twelve of the 26 cases were of the type iii pattern (predominantly cellular), accounting for 46.1%. distribution of pleomorphic adenomas based on foote and frazell 's histopathological subtypes the tumor periphery comprised of a capsule completely surrounding the tumor, but with variable thickness. in two cases we noticed tumoral off shoots extending into the capsule [figure 1 ]. photomicrograph showing tumoral off shoots within the capsule of pleomorphic adenoma (h&e stain 100) the most frequent stromal pattern [table 4 ] was myxoid (73.1%). nineteen of the 26 pa revealed a myxoid component but in variable proportion from one case to another. these stromal zones were weakly basophilic, poorly delineated and disposed between the tumoral epithelial structures. the cells within these tumoral zones were undifferentiated mesenchymal cells, stellate in shape and with delicate anastomosis [figure 2 ]. stromal components in pleomorphic adenoma (pa) photomicrograph showing myxoid stroma in pleomorphic adenoma (h&e stain, 100) chondroid tumoral zones were evident in two cases. these areas resembled immature hyaline cartilage with an acidophilic ground substance and few chondroid lacunae with small oval chondroblasts. in two other cases we noticed osteoid [figure 3 ] differentiation of the stromal component. prominent focal areas of a lipomatous stroma were evident in four of the recorded cases. photomicrograph showing osteoid - like matrix / trabecular pattern (alcian blue - periodic acid - schiff (ab - pas) stain, 100) among the morphological patterns of the epithelial component [table 5 ], the ductal pattern predominated (84.6%), followed by sheets / solid patterns (61.5%) and few with trabeculae formation. photomicrograph showing cellular variant of pa (h&e stain, 400) epithelial components in pleomorphic adenoma (pa) plasmacytoid cells were the most commonly found cellular type, predominantly evident in 17 cases (65.4%). eosinophilic, plump spindle shaped cells were seen in 16 cases (61.5%), representing the second most frequent cellular type. foci of squamous cells with keratin pearl formation were seen in 15% of the cases. cuboidal cells, basaloid cells and clear cells were few other cell types that were occasionally seen [table 6 ]. cell types in pleomorphic adenoma (pa) the five controls of palatine minor salivary acini revealed a heterogeneous staining pattern when stained with combined ab - pas stain. the acini took up a blend of magenta and blue color, indicating the presence of both acidic and neutral mucins. photomicrograph showing cellular variant of pa (ab - pas stain, 400) the histochemical staining of pa [table 7 ] revealed pas positive areas within the lumen of ducts indicative of neutral mucins [figure 6 ]. the chondromyxoid areas were ab positive and indicative of acidic mucins [figure 7 ]. histochemical profiles in pleomorphic adenoma (pa) photomicrograph showing cellular variant of pa (ab - pas stain, 400) photomicrograph showing ab positive chondromyxoid areas (ab - pas stain, 100) apparently normal minor salivary acini found in association with the tumor were predominantly ab positive indicative of acidic mucins, unlike their normal counterparts [figure 6 ]. however, the staining pattern varied from one case to another. in few tumors, the acini took up a uniform, homogeneous brilliant blue stain [figure 8 ] ; while in few others, the acini took up a heterogeneous blue and slightly magenta stain [figure 9 ]. a noteworthy observation was that the acini in myxoid tumors expressed a more homogeneous stain, while those in the cellular variants expressed a more heterogeneous stain [table 8 ]. these findings gave an impression that both acidic and neutral mucins are expressed by pa and as tumorigenesis progresses, the mucin profile of mucous salivary acini changes from neutral to acidic. photomicrograph showing mucous acini in myxoid tumors (ab - pas stain, 400) photomicrograph showing mucous acini in cellular tumors (ab - pas stain, 400) histochemical profile of mucous acini in histological subtypes of pleomorphic adenoma (pa) demographics revealed, the most common age group to be affected was 3140 years [table 1 ]. the patients were mostly females (15 cases, representing 57.7%), with a female to male ratio of 1.36:1. distribution of pleomorphic adenomas by age the most common site of involvement was the hard palate (24 cases) ; accounting for 92.3% of the recorded cases [table 2 ]. based on the proportion of parenchymal and stromal tumoral components, the cases were classified into four subtypes as proposed by foote and frazell [table 3 ]. twelve of the 26 cases were of the type iii pattern (predominantly cellular), accounting for 46.1%. distribution of pleomorphic adenomas based on foote and frazell 's histopathological subtypes the tumor periphery comprised of a capsule completely surrounding the tumor, but with variable thickness. in two cases we noticed tumoral off shoots extending into the capsule [figure 1 ]. photomicrograph showing tumoral off shoots within the capsule of pleomorphic adenoma (h&e stain 100) the most frequent stromal pattern [table 4 ] was myxoid (73.1%). nineteen of the 26 pa revealed a myxoid component but in variable proportion from one case to another. these stromal zones were weakly basophilic, poorly delineated and disposed between the tumoral epithelial structures. the cells within these tumoral zones were undifferentiated mesenchymal cells, stellate in shape and with delicate anastomosis [figure 2 ]. stromal components in pleomorphic adenoma (pa) photomicrograph showing myxoid stroma in pleomorphic adenoma (h&e stain, 100) chondroid tumoral zones were evident in two cases. these areas resembled immature hyaline cartilage with an acidophilic ground substance and few chondroid lacunae with small oval chondroblasts. in two other cases we noticed osteoid [figure 3 ] differentiation of the stromal component. prominent focal areas of a lipomatous stroma were evident in four of the recorded cases. photomicrograph showing osteoid - like matrix / trabecular pattern (alcian blue - periodic acid - schiff (ab - pas) stain, 100) among the morphological patterns of the epithelial component [table 5 ], the ductal pattern predominated (84.6%), followed by sheets / solid patterns (61.5%) and few with trabeculae formation. photomicrograph showing cellular variant of pa (h&e stain, 400) epithelial components in pleomorphic adenoma (pa) plasmacytoid cells were the most commonly found cellular type, predominantly evident in 17 cases (65.4%). eosinophilic, plump spindle shaped cells were seen in 16 cases (61.5%), representing the second most frequent cellular type. foci of squamous cells with keratin pearl formation were seen in 15% of the cases. cuboidal cells, basaloid cells and clear cells were few other cell types that were occasionally seen [table 6 ]. the five controls of palatine minor salivary acini revealed a heterogeneous staining pattern when stained with combined ab - pas stain. the acini took up a blend of magenta and blue color, indicating the presence of both acidic and neutral mucins. photomicrograph showing cellular variant of pa (ab - pas stain, 400) the histochemical staining of pa [table 7 ] revealed pas positive areas within the lumen of ducts indicative of neutral mucins [figure 6 ]. the chondromyxoid areas were ab positive and indicative of acidic mucins [figure 7 ]. histochemical profiles in pleomorphic adenoma (pa) photomicrograph showing cellular variant of pa (ab - pas stain, 400) photomicrograph showing ab positive chondromyxoid areas (ab - pas stain, 100) apparently normal minor salivary acini found in association with the tumor were predominantly ab positive indicative of acidic mucins, unlike their normal counterparts [figure 6 ]. however, the staining pattern varied from one case to another. in few tumors, the acini took up a uniform, homogeneous brilliant blue stain [figure 8 ] ; while in few others, the acini took up a heterogeneous blue and slightly magenta stain [figure 9 ]. a noteworthy observation was that the acini in myxoid tumors expressed a more homogeneous stain, while those in the cellular variants expressed a more heterogeneous stain [table 8 ]. these findings gave an impression that both acidic and neutral mucins are expressed by pa and as tumorigenesis progresses, the mucin profile of mucous salivary acini changes from neutral to acidic. photomicrograph showing mucous acini in myxoid tumors (ab - pas stain, 400) photomicrograph showing mucous acini in cellular tumors (ab - pas stain, 400) histochemical profile of mucous acini in histological subtypes of pleomorphic adenoma (pa) in this study, 92.3% of pa developed in the minor salivary glands of the palate. a marked female predominance of 57.7% was recorded. in various studies conducted, the universal agreement is that, the most common sites of involvement of minor salivary glands are hard palate, upper lip and buccal mucosa. this presentation is due to the distribution and arrangement of minor salivary tissues of the palate. the tumors were in close proximity to the overlying mucosa. in two cases, both with a myxoid rich stroma, tumoral off shoots into the capsule however, no signs of atypia were detected in these extensions. in pa of the major glands and in predominantly mucoid variants, the capsule is generally incomplete with tumoral extensions into the surrounding tissues. the extensions beyond the capsule without nucleocytoplasmic atypia are not interpreted as a sign of malignancy. according to the relative proportion between stromal and epithelial component of these tumors, 46.2% were of type iii, 27% were of type iv, 19.2% were of type ii and 7.7% were of type i. foote and frazell first submitted such histopathological classification of pa in 1954. seifert., proposed similar findings in 1976. according to these authors, type i comprised of principally myxoid variant, type ii comprised of myxoid and cellular variant, type iii comprised of predominantly cellular variant and type iv comprised of an extremely cellular variant. pa of the major salivary glands generally belong to the type i or ii categories while the minor salivary gland tumors are more cellular in nature. this distinction has no therapeutic significance but helps emphasize the broad morphological spectrum possible within this neoplasm. observations made in this study, revealed the great diversity of morphological aspects in minor salivary gland tumors. the most common stromal type was the myxoid type, encountered in 19 cases and accounting for 73.1%. histochemically, the prevalence of neutral mucins within the ductal lumens and acid mucopolysaccharides in the myxoid areas were appreciated. review data referring to type of mucins produced in pa, have specified the existence of two types of mucins. one of epithelial origin, with a high content of neutral glycoproteins and one of mesenchymal origin, rich in sulfated and non - sulfated glycosaminoglycans. zhao., in a study concerning glycosaminoglycans localization in pa reveals that both epithelial and mesenchymal - like tissues contain glycosaminoglycans. it is suggested that the glycosaminoglycans in pa are mainly produced by non - luminal cells and influence the proliferation, secretory activity and shape of tumor cells, thus contributing to the morphological diversity of this tumor. in two cases, a chondroid differentiation surrounded by a myxoid stroma these areas reflected the presence of acid mucopolysaccharides, histochemically. according to aigner and colleagues, the chondroblastic cells, derived from stellate cells of the myxoid areas, through mucopolysaccharides synthesis developed cartilaginous areas in the pas. four cases revealed considerable adipose tissue amidst the tumor mass, which could be either a result of herniation of adipose from the surrounding stroma or as a result of metaplasia. in the current study, seven of the 26 (26.9%) ellis., related that these cells appear to be in transition from one form to another. additionally, in pa, plasmacytoid cells seem to originate from luminal rather than myoepithelial cells. this feature is more prominent in mixed tumors of minor salivary glands than in those arising from the major glands. squamous cells organized in abrupt islands and areas of keratin in whorls, microcysts or irregular masses were found in the solid cellular zones or in proximity to the myxoid areas. mucins are composed of a number of chemical substances which differ chemically, depending on the cell from which they are derived. epithelial mucins, include neutral mucins and acidic mucins (sulfo- and sialomucins) ; while the connective tissue mucins show acid mucosubstances like chondroitin sulfates, keratin sulfates, hyaluronic acids and dermatan sulfates. by using different combination of stains mucin profiles in developing fetal salivary glands revealed their role in maturation and maintenance of the ductal network. the mucous acini of the sublingual and the submandibular glands showed a varied heterogeneity with the ab - pas stains. the present study was in concordance with these features, with respect to the normal mucous acini of the hard palate. in apparently normal acini in relation to the tumor ; however, the histochemical profile revealed the predominant presence of acidic mucins. an important role of mucins is recognized in cancer development and invasion. like normal epithelial tissue, cancer cells use mucins to control the environment, regulate differentiation and proliferation and enhance invasive and metastatic properties. histochemistry of salivary gland tumors depicts the presence of mucosubstances, but does not comment on the refined and detailed constituents of those mucosubstances nor does it emphasize on the prognosis or longevity of the neoplastic diseases based on the mucin pattern which has been secreted. there have been no views on the different gradations of the tumor based on pure histochemical analysis. in the current study on pas, the ductal lumens revealed strong pas positivity, while the chondromyxoid areas showed strong ab positivity with the ab - pas stain. this was in accordance with the study done by azzopardi and smith (1959) who conducted a survey on 100 cases of salivary gland tumors. the grading of the tumors based on the mucin production was also noted in the gastrointestinal tract. the inference drawn from the study on the gastrointestinal tumors, is that they generally show sulfomucin predominance and as the differentiation of the tumour increases, the sulfated mucin content decreases with significant increase in the neutral mucin content. the evidence that malignant transformation develops through a sequence of changes with gradual loss of cellular differentiation and the reappearance of the fetal phenotype can also be implicated in salivary gland tumors. a hypothesis derived at from this study could be that the myxoid variants express more acidic mucins due to lack of differentiation ; hence, have a higher recurrence rate and poorer prognosis. whether the change in mucin expression causes the malignant transformation or this study demonstrated the great diversity of morphological aspects of the stroma in pas of the minor salivary gland. the neoplastic myoepithelial cells differentiate to stellate cells, which produce the myxoid matrix and then further differentiate to chondroblastic cells, which via mucopolysaccharide synthesis develop cartilaginous areas. we also noted the change in mucin profile from neutral mucins to acidic mucins as the neoplasm progresses. the future scope of this study lies in studying the true nature of fetal mucins and its role in tumorigenesis. a larger sample size needs to be assessed in order to hypothesize the prognostic implications. histochemistry of malignant tumors and its correlation to benign tumors would further highlight the role of mucins in tumorigenesis. finally, an attempt should be made to classify these tumors based on their histochemical profile. a detailed clinical, histopathological and histochemical analysis in salivary gland tumors will provide a better insight to the pathophysiology of the disease, tumor differentiation and prognostic implications.	background : pleomorphic adenoma (pa) accounts for 4574% of all the salivary gland neoplasms, of which 4070% are present in minor salivary glands. studies have depicted variations in histological typing and classification of these tumors. its pleomorphism is attributed to the cytological differentiations of the epithelial components and the diverse stromal components. biochemical investigations of saliva have revealed mucins to be its main component. mucins reflect in their composition, the functional state of the mucosa, both in health and disease. many reviews on histochemical classification and identification have been put forward to explain the intricacies of mucins ; however, no attempts have been made to classify salivary gland tumors based on their mucin profiles and assess its prognostic significance. thus, this study was executed to analyze the clinical, histopathological and histochemical behavior of pa of minor salivary glands and decipher a correlation.materials and methods : twenty - six diagnosed cases of pa of minor salivary glands and five controls of normal minor salivary glands of the hard palate were included in the study. blocks were retrieved, sectioned and stained with hematoxylin and eosin (h and e) stain as well as combined alcian blue (ab)-periodic acid - schiff (pas) stains.results:the stained slides revealed an array of epithelial and stromal patterns and varying heterogeneity of mucin expression of normal and neoplastic minor salivary glands.conclusion:the study elucidated the role of mucins in tumorigenesis and its prognostic implications.
accurate diagnosis of essential thrombocythemia (et) is normally accomplished by applying either the recently updated british committee for standards in haematology (bcsh) guidelines or the world health organization (who) criteria. the who classification places considerably more weight on bone marrow (bm) morphology as a major diagnostic criterion, which contrasts to the bcsh guidelines that are mainly focused on an exclusion of the other subtypes of myeloproliferative neoplasm (mpn) or myelodysplastic syndromes (mds). consequently, the first set of bcsh diagnostic criteria (a1a3) allows et diagnosis without bm biopsy examination by the following criteria : a1-sustained platelet count > 450 10/l ; a2-presence of an acquired pathogenetic mutation ; a3-no other myeloid malignancy, especially polycythemia vera (pv), primary myelofibrosis (pmf), chronic myeloid leukemia or mds. however, performance of a bm biopsy is included in the second set of the bcsh criteria (a1+a3a5). in addition to the threshold value of the platelet count (a1) and exclusion of another myeloid malignancy (a3), these criteria require no reactive cause for thrombocytosis and normal iron stores (a4) and also bm morphology (a5) as diagnostic feature (bm aspirate and trephine biopsy showing increased megakaryocyte numbers displaying a spectrum of morphology with predominantly large megakaryocytes with hyperlobulated nuclei and abundant cytoplasm. performance of a bm biopsy is recommended in cases where there are atypical features, if a change in management is planned during the course of treatment (such as change of cytoreductive therapy), or if transformation into myelofibrosis is suspected. in this context, the challenging differentiation of et from major subtypes of mpn with presenting thrombocytosis is needed, and it is clinically important to be defined correctly already at diagnosis. this concerns particularly pv that is excluded according to the bcsh by revealing a normal hematocrit (hct) in an iron - replete patient and pmf. following the bcsh criteria, pmf is defined as showing a significant bm fibrosis and palpable splenomegaly, blood film abnormalities (circulating progenitors and tear - drop cells) or unexplained anemia consistent with overt myelofibrosis with myeloid metaplasia (mmm). conversely, the prodromal stages, that is, prefibrotic pmf (prepmf), which often present with conspicuous thrombocytosis but fail to meet the diagnostic signs and symptoms characterizing mmm, have to be addressed in context with mpn. further, clinically, it is well known that a small fraction of pv patients may present initially with hemoglobin (hb) and hct levels that do not fulfill the 2008 threshold criteria, but a platelet count that is within bcsh- and who - defined et criteria, thus mimicking phenotypically et at onset. the aim of this study was to investigate the clinical presentation and prognostic relevance of bm morphology for et diagnosis by comparing those criteria as defined by the who classification with the first set (a1a3) of the original and 2014 updated bcsh criteria that do not include bm evaluation. a clinico - pathological database currently including 626 patients who were diagnosed and treated for mpn was created by clinicians and hematopathologists in the departments of hematology and clinical pathology at the medical university of vienna, austria. currently, the associated institutions are centers located in vienna, graz, wels and linz. eligibility criteria for entry into this database include diagnosis between 1982 and 2015 with suspected mpn, well - documented clinical follow - up and mutation status (table 1). mutation analysis included allele - specific polymerase chain reaction techniques to screen for janus kinase 2 (jak2), calreticulin exon 9 (calr) and myeloproliferative leukemia virus oncogene (mpl) mutations. a further essential aspect for entry was the availability of representative, initial, treatment - naive bm biopsies (hematoxylin - eosin staining and silver impregnation after gomori). iron stores were assessed either by clinical parameters (serum ferritin, mean corpuscular volume of red blood cells) and/or special staining (prussian blue) of smears. the latter were also used in a very few cases with borderline to slight anemia to exclude mds with ring sideroblasts, that is, refractory anemia with ring sideroblasts associated with marked thrombocytosis (rars - t). in cooperation with the local hematopathologists, bm biopsies were centrally re - reviewed under a multi - headed microscope by three of the authors (jt, lm, c b - sch) who were blinded to initial data (except for age and gender) at entry and outcome. final diagnosis according to the 2008 who criteria was made based on the histopathology review and clinical data. for the purpose of the present study, we selected all patients with a sustained platelet count 450 10/l, no evidence for a reactive cause for thrombocytosis and normal iron stores and bcr - abl1 negativity. we then applied the who - defined et criteria including bm biopsy evaluation as major diagnostic criterion, and the first set of the 2014 updated bcsh criteria for et (a1a3) that require no bm biopsy examination to these patients. the who criteria consist of a platelet count 450 10/l, bm biopsy examination, the exclusion of other myeloid neoplasm, and the presence of a clonal marker or the exclusion of reactive thrombocytosis. the first set of the bcsh guidelines (a1a3) allow diagnosis of et with the presence of a platelet count 450 10/l, the presence of an acquired pathogenic mutation (for example, jak2, calr or mpl) and no other mpn or mds. these two cohorts were compared regarding their presenting clinico - pathological findings, prognosis and adverse events during follow - up. the diagnosis of post - et myelofibrosis was made using the iwg - mrt criteria and corresponding clinical and morphological features. g / dl from baseline hb level), increase in splenomegaly either of newly palpable splenomegaly or > 5 cm from baseline, overt leuko - erythroblastosis or anisopoikilocytosis with tear - drop erythrocytes, and an overt grade 2/3 reticulin / collagen bm fibrosis in sequential bm biopsies consistent with manifest mmm. cytoreductive drugs included predominantly hydroxyurea, anagrelide and interferon - alpha or, very rarely, busulphan, pipobroman, p32 or other cytoreductive agents (for details, see table 2). many patients received more than one drug during treatment ; however, only minor differences could be ascertained between who- versus bcsh - confirmed et. antithrombotic therapy with low - dose aspirin was applied in 160 patients of the who - confirmed et and 189 patients of the bcsh - defined et cohort. statistical analysis regarded disease - relevant parameters considered at diagnosis. survival curves were calculated using the kaplan meier method, differences in survival were assessed using the log - rank test. the study protocol was approved by institutional research ethics committee of the medical university of vienna, and written informed consent was obtained from all patients in accordance with the declaration of helsinki. from our austrian mpn database, which at present includes 626 patients, we recruited 232 (37.1%) cases that according to the who criteria were diagnosed as et and fulfilled the other eligibility criteria, whereas 238 (38.0%) patients met the bcsh criteria a1a3. patients that had a follow - up of 90% largely depending on study design (all subtypes of mpn, inclusion of control cases with reactive changes, restriction to single bm features or only et versus pmf, blinded evaluation or consideration of clinical data). contrasting these supportive findings, several groups failed to reproduce the who diagnostic guidelines, likely because of improper application of guidelines and/or small biopsy specimens. although the second set of et diagnostic criteria (a1+a3a5) by the bcsh includes bm morphology, it fails to recognize the other hematopoietic cell lineages besides megakaryocytes and fibers (a5 bm aspirate and trephine biopsy showing increased megakaryocyte numbers displaying a spectrum of morphology with predominantly large megakaryocytes with hyperlobulated nuclei and abundant cytoplasm. although the corresponding description in the text is more detailed, the statement that reticulin is generally not increased (grade 02 in a four - graded scheme or grade 0 in a three - graded scheme) may be the source of confusion. it applies only to score 0/3 but does not fully equal score 02/4, which is consistent with a minor increase. in overt pmf, reticulin fibrosis is explicitly defined as being increased (grade 2/3 or grade 3/4) and may be accompanied by overt collagen and/or new bone formation. patients with prepmf, however, present most frequently with thrombocytosis and normal or only minor accumulation of bm reticulin (score 02/4 or 01/3), and are probably not fully recognized by the bcsh and thus presumably regarded as et. this shortcoming is likely to be responsible for the adverse events and unfavorable outcome of this cohort. however, if the second set of diagnostic criteria by the bcsh (a1+a3a5), including bm aspirate and trephine biopsy examination, would have been regarded, it can not be ruled out that a number of cases may have been recognized as being not consistent with et. the finding of a small group of 16 (~7%) pv patients in the bcsh group diagnosed according to the corresponding exclusion criteria and presenting with a normal hct and no evidence of iron depletion is not surprising and underscores the proposal to the who to enter bm morphology as a major diagnostic criterion for pv. persuasive evidence has been provided that in patients not meeting the required hct thresholds for the diagnosis of pv according to the bcsh, the diagnosis of so - called masked pv can be established, and that in this context bm morphology has an important role. determination of jak2/calr mutation status alone, without bm morphology examination, is not sufficient to differentiate pv from jak2-mutant et. it has been demonstrated that hct threshold values in these patients were significantly higher than in jak2-positive et revealing a best cutoff for discrimination at 49% in males and 48% in females. moreover, many of these patients developed signs and symptoms (raising hct / hb levels and need for phlebotomies) of overt pv during follow - up. the distinction of who - et and prepmf, specifically concerning clinical presentation, bleeding events and prognosis, has been shown to be of high clinical relevance. in a multicenter study on 1104 patients, barbui. validated the clinical relevance of a strict adherence to the who criteria, in particular bm morphology in the diagnosis of et. they provided important information on presenting hematological features, disease complications and survival in et versus prepmf. contrasting these findings, a recent study on a small cohort of 20 young patients (age between 16 and 40 years) with prepmf versus 197 patients with who - defined et failed to confirm these differences and questioned the central role of histological diagnosis for the clinical management and prognostication in young prepmf / et patients. in this context, a conflicting opinion exists whether the differentiation between who - defined et and prepmf has an impact on treatment modalities in these two entities. although an only thromboreductive treatment or treatment with low - dose aspirin in who - confirmed et may be successful in the prevention of thromboembolic and hemorrhagic complications, a more aggressive treatment approach using hydroxyurea seems necessary in bcsh - diagnosed et to prevent thrombosis and transformation to overt myelofibrosis. this suggests that bcsh - defined et diagnosed by the first set of criteria (a1a3) includes a considerable fraction of misclassified patients with a more aggressive mpn, very similar to prepmf. this is also reflected by the presence of splenomegaly and elevated serum lactate dehydrogenase levels in our bcsh cohort, which are both features of who - classified prepmf. this entity is usually associated with an elevated white blood cell count, which constitutes a major risk factor for arterial thrombosis, increased bleeding tendency, transformation to overt myelofibrosis and a shorter survival. in conclusion, accurate diagnosis of who mandates a scrutinized examination of bm biopsy specimens as key feature. classification schemes that fail to or do not precisely regard this postulate will end up with a heterogeneous, inadequately defined cohort of patients impairing an appropriate clinical management.	essential thrombocythemia (et) is currently diagnosed either by the british committee of standards in haematology (bcsh) criteria that are predominantly based on exclusion and not necessarily on bone marrow (bm) morphology, or the world health organization (who) criteria that require bm examination as essential criterion. we studied the morphological and clinical features in patients diagnosed according either to the bcsh (n=238) or the who guidelines (n=232). the bcsh - defined et cohort was re - evaluated by applying the who classification. at presentation, patients of the bcsh group showed significantly higher values of serum lactate dehydrogenase and had palpable splenomegaly more frequently. following the who criteria, the re - evaluation of the bcsh - diagnosed et cohort displayed a heterogeneous population with 141 (59.2%) et, 77 (32.4%) prefibrotic primary myelofibrosis (prepmf), 16 (6.7%) polycythemia vera and 4 (1.7%) primary myelofibrosis. contrasting who - confirmed et, the bcsh cohort revealed a significant worsening of fibrosis - free survival and prognosis. as demonstrated by the clinical data and different outcomes between who - diagnosed et and prepmf, these adverse features were generated by the inadvertent inclusion of prepmf to the bcsh group. taken together, the diagnosis of et without a scrutinized examination of bm biopsy specimens will generate a heterogeneous cohort of patients impairing an appropriate clinical management.
in the last 2 decades, gastroesophageal reflux disease (gerd)-induced reflux laryngitis has become a familiar finding in ear, nose, and throat symptoms. the proportion of chronic laryngitis (cl) in whole patients visiting to otolaryngology clinics in america was about 10%. therefore, acid suppression therapy is usually prescribed to these patients under the presupposition that gerd is related with signs and symptoms of cl. it has been revealed that acid suppression improves associated upper esophageal and the gastroesophageal reflux and laryngeal symptoms, for instance, hoarseness and chronic cough. nevertheless, their efficacy in patients with suspected gerd - related cl has not been definite. gerd - related extraesophageal complications can be controlled efficiently by surgery with a significantly better response than with medicine therapy. we proceeded this meta - analysis to explore an estimate of the overall efficacy of acid suppression treatment (including medicine therapy and surgery therapy) in suspected gerd - related cl. this is a study of meta - analysis, so that, ethical approval was not necessary. we proceeded a systematic literature search in pubmed, web of knowledge, and embase for english language article published up till march 2016 by relevant keywords and combinations such as proton pump inhibitor, antireflux therapy, any proton pumps / antagonists & inhibitors, h (+) -k (+) -exchanging atpase / antagonists & inhibitors, rabeprazole, histamine h2 antagonists, pantaprazole, esomeprazole, omeprazole, lansaprazole, and laryngitis, pharyngitis, reflux laryngitis, posterior laryngitis, reflux laryngopharyngitis, reflux pharyngitis, laryngopharyngeal reflux (lpr), gastropharyngeal reflux (gpr). we performed this study according to the guidelines of prisma (preferred reporting items for systematic reviews and meta - analyses). suspected gerd - related cl was defined by the occurrence of 1 of the following symptoms : hoarseness, globus sensation, excessive phlegm, frequent throat clearing, chronic cough, and the presence of gerd - attributed signs of laryngitis on laryngoscopy - containing erythema, edema, pachydermia, granuloma, or contact ulcer. adults aged 18 years of age or older with suspected gerd - related cl were entitled for this study. the data were collected from every eligible article : first author 's surname, publication year, country of origin, methods of diagnosis of gerd, and methods of acid suppression therapy separately. we abstracted the proportion of patients who described 50% decrease in laryngeal symptoms compared with baseline. exclusion criteria were the following : case reports, review reports, studies not printed in english language ; multiple reports providing outcomes from the same research ; cohort reports ; and animal researches. the effect size (es), which is the oor (%) and 95% confidence interval (95% ci), was assessed for every report. the pooled evaluation of the merged percentage was gotten by the laid and dersimonian method in the random effect model. moreover, we quantified the effect of heterogeneity using i = 100% (q df)/q. a significant i statistic (i > 50%) or q statistic (p 50%) or q statistic (p 8 week), response to acid suppression therapy was higher in reports with longer duration of therapy (orr : 70% [95% ci : 55% 85% ] vs. orr : 57% [95% ci : 48%65% ]) (table 2). no publication bias was obvious in meta - analyses of the association between gerd - related cl and orr of acid suppression treatment, on the basis of egger regression test and begg rank correlation test (egger test, p = 0.073 ; begg test, p = 0.165) (fig. there were 253 potential - related reports recognized with the titles, key words, and abstracts. there were 54 potentially related full - text studies retrieved for more in - depth assessment after taking out the unrelated reports by assessment of abstract and title. all patients experienced laryngoscopic assessment to make the diagnosis of suspected gerd - related cl with symptoms, for instance, edema, granuloma, erythema, pachydermia, and/or cobblestone pattern, especially in posterior larynx. ambulatory ph monitoring was carried out in every report, several patients also experienced esophagogastroduodenoscopy and esophageal manometry before enrollment ; the primary sources of recruitment of patients in most studies were otolaryngology clinics. as is shown in table 1, 21 reports were involved in the meta - analysis, and the characteristics of the involved reports are displayed. totally, 2864 patients who suspected gerd - related cl were considered in this meta - analysis. three studies chose surgical treatment, and the remainder of the studies chose acid suppression medicine treatment. the duration of proton pump inhibitors (ppis) treatment ranged from 4 to108 weeks. twenty - one reports that contained a total of 2864 patients were available to assess the orr of acid suppression therapy (including medicine therapy and surgery therapy) in suspected gerd - related cl. a random - effect model was used on account of significant heterogeneity (i = 97.1%, p 8 week), response to acid suppression therapy was higher in reports with longer duration of therapy (orr : 70% [95% ci : 55% 85% ] vs. orr : 57% [95% ci : 48%65% ]) (table 2). no publication bias was obvious in meta - analyses of the association between gerd - related cl and orr of acid suppression treatment, on the basis of egger regression test and begg rank correlation test (egger test, p = 0.073 ; begg test, p = 0.165) (fig. this research is the first study of meta - analysis offering available data on the efficacy of acid suppression therapy in gerd - related cl. our study confirms formerly published outcomes for orr in gerd - related cl treated with acid suppression, with orr of up to 66%. it is well known that the base for the cure of gerd - related cl in ent is 8 to 12 weeks double - dose ppi. nevertheless, placebo - controlled studies showed that ppi therapy is no better than placebo in relieving gerd - related laryngopharyngeal symptoms. the assumption for the comparatively poor ppis response in the researches is a possible selection bias for the reason that gerd diagnosis was not depended on ph - metric standards at all times. some reports have presented that about 64% to 86% of healthy people could be discovered with laryngeal abnormalities indicative of a laryngeal reflux. therefore, esophageal 24-hour ph watching is required to notarize gerd, particularly as the therapeutic test has not been confirmed for the duration of the ent clinical situation. el - serag reported that the only predictors of fine effect to ppi were characterized when pathological acid exposure before treatment. moreover, it is perhaps owing to the point that some patients whose laryngeal symptoms were not caused by gerd would weaken the total study populations leading to reduced power to discover a difference between placebo and ppis. there is a popular belief that the result of surgical treatment for reflux is best in typical reflux symptom patients. people with typical reflux symptoms and atypical throat symptoms had a good effect undergoing fundoplication ; the result of these patients was similar to that of the bigger group experiencing fundoplication for typical reflux indications without throat discomfort. farrell assessed the orr in people with typical against atypical symptoms (hoarseness, cough, asthma, and chest pain) after fundoplication. the authors showed that 99% of primarily reflux symptom patients were improved ; in addition, 87% patients were entirely cured postoperatively. so demonstrated that the treatment of laparoscopic fundoplication had effect on 93% of typical reflux symptoms patients, whereas only 56% atypical symptom patients improved after surgery. the orr for laryngeal, epigastric / chest pain, and pulmonary was 78%, 48%, and 58%, respectively. our previous study also indicated that compared to studies of patients with medicine therapeutic method (orr : 64% [95% ci : 50%77% ]), the effect in the pooled results of patients with surgery therapeutic method was better (orr : 80% [95% ci : 67%93% ]) (table 2). first, the heterogeneity in this research is high, which might be rooted in statistical and clinical heterogeneity ; the cause might be that the trials are from different districts and the definition of these indicators was not united. second, a publication bias might lead to the probability of a systematic difference between larger and smaller reports ; to be exact, small research possibly overestimated the effects of acid suppression therapy in terms of orr. third, comparisons of orr were hard because of absence of general agreement on the accurate characterization of result and randomization. last, the reports involved in this study were only printed in english, signifying that a possible language bias occurred. this meta - analysis showed that the overall 1 rate of acid suppression therapy (including medicine therapy and surgery therapy) in suspected gerd - related cl is 66% and there was an increase in effect in the pooled outcomes for the reports of patients who underwent surgery therapeutic method (orr : 80%) relative to studies of patients with medicine therapeutic method (orr : 64%) ; moreover, response to acid suppression therapy was superior to the reports with longer period of therapy (orr : 70% vs. 57%).	abstractbackground : this research aims to assess the response to acid suppression therapy in gastroesophageal reflux disease (gerd)-related chronic laryngitis (cl).methods : data were extracted from web of knowledge, embase, and pubmed for english language article published up to march 2016. pooled overall response rate (orr) rates were evaluated to determine acid suppression treatment efficacy. random effects model was used with standard approaches to sensitivity analysis, quality assessment, heterogeneity, and exploration of publication bias.results:pooled data from 21 reports (n = 2864, antireflux medicine : 2741 ; antireflux surgery : 123, study duration 4108 week) were analyzed. with the random - effect model, the orr was 66% (95% confidence interval [ci ] 54%78%). the orrs were 80% for antireflux surgery (95% ci 67%93%, 3 studies, 123 patients), whereas 64% for antireflux medicine (95% ci 50%77%, 18 studies, 2741 patients), and the orr was 70% (95% ci 55%85%, 15 reports, 2731 patients) for > 8 weeks therapy duration, whereas 57% (95% ci 48%65%, 6 reports, 133 patients) for 8 weeks duration of therapy.conclusions:acid suppression seems to be an effective therapy for gerd - related cl. there was an increase in effect among patients with surgery therapeutic method and longer therapy duration.
steroidal neuromuscular blocking agents (nmbas), such as rocuronium, are widely used in clinical anesthesia and emergency medicine to facilitate endotracheal intubation and artificial ventilation and to allow surgical access to body cavities (hunter 1995). although the use of nmbas has significantly reduced the incidence of laryngopharyngeal lesions due to endotracheal intubation, their use is still associated with higher morbidity and mortality compared with anesthetic techniques that do not use nmbas (pedersen 1992 ; shorten 1993 ; mencke 2003). this is mainly attributable to the development of postoperative residual neuromuscular blockade, resulting in hypoventilation, airway obstruction, and hypoxia (pedersen 1992 ; shorten 1993). reversal of neuromuscular blockade is important for the acceleration of patient recovery and prevention of postoperative residual neuromuscular blockade, and reduces the incidence of severe morbidity and mortality associated with anesthesia management (arbous 2005). at present, the reversal of neuromuscular blockade is achieved by the administration of cholinesterase inhibitors (neostigmine, edrophonium, or pyridostigmine) (osmer 1996). importantly, cholinesterase inhibitors have a number of undesirable side - effects (bradycardia, bronchoconstriction, hypersalivation, abdominal cramps and nausea and vomiting) (van vlymen and parlow 1997) which can be counteracted by co - administration of muscarinic antagonists (atropine or glycopyrrolate) (osmer 1996 ; van vlymen and parlow 1997). however, muscarinic antagonists also have side - effects (blurred vision, dry mouth, and tachycardia) (van vlymen and parlow 1997 ; zhang 2003). furthermore, due to their mechanism of action, cholinesterase inhibitors are not capable of reversing deeper levels of neuromuscular blockade (booij 2002 ; zhang 2003). return of muscle paralysis after apparent reversal of neuromuscular block by cholinesterase inhibitors, recurarization, is another limitation of the currently used reversal strategy. thus, there is clearly a clinical need for a new reversal agent, with minimal side - effects and the capability to reverse neuromuscular blockade effectively, independently of its depth. sugammadex is the first selective relaxant binding agent (srba) and has been designed to reverse the steroidal neuromuscular blocking drug rocuronium (booij 2002 ; bom 2002 ; de boer 2006a). sugammadex, per-6-(2-carboxyethylthio)-per-6-deoxy--cyclodextrin sodium salt (figure 1), is a synthetic -cyclodextrin (cd) derivative designed to bind selectively to the steroidal nmba molecule (booij 2002 ; bom 2002 ; de boer 2006a). cyclodextrins, a group of cyclic oligosaccharides, are ring - shaped molecules with lipophilic inner cavities and hydrophilic outer surfaces that form complexes by inclusion of specific guest molecules, such as steroids (bom 2002 ; challa 2005). structurally, they consist of either 6 (-cds), 7 (-cds), or 8 (-cds) glucose units and each type has its own characteristics (challa 2005). cds are highly water soluble, particularly -cds compared with - and -cds and are also biologically well tolerated (bom 2002). chemically modified cds have been used in the clinic to increase the stability, solubility, and bioavailability of an encapsulated drug, thereby delivering the required dose of the drug to the appropriate target sites (bom 2002). the use of a modified cd to reverse a rocuronium - induced neuromuscular blockade, by removing rocuronium from the effector site, thus represents a paradigm shift from current methodology. encapsulation of the rocuronium molecule by sugammadex results in a rapid decrease in free rocuronium in the plasma and subsequently at the nicotinic receptor at the motor endplate (figure 2). after encapsulation, rocuronium is not available to bind to the nicotinic receptor in the neuromuscular junction. this promotes the liberation of acetylcholine receptors, and muscle activity reappears (bom 2002 ; epemolu 2003). this new concept of reversal of neuromuscular block induced by rocuronium (or vecuronium) led to impressive results in animal and phase 1 and 2 studies. sugammadex is currently in phase 3 clinical studies and may be commercially available by 2008. the efficacy of sugammadex as a reversal agent was evaluated using different animal models (mouse, guinea pig, cat, and rhesus monkeys). in vitro studies by miller and bom (2001), in the isolated mouse hemidiaphragm, showed that sugammadex effectively reversed a 90% neuromuscular block induced by the steroidal nmbas agents rocuronium, rapacuronium (no longer commercially available), vecuronium, and pancuronium. most efficient reversal was seen in the rocuronium - treated group followed by a neuromuscular block induced by rapacuronium, vecuronium, and pancuronium. however, sugammadex was not effective against the non - steroidal nmbas mivacurium, atracurium and succinylcholine (miller and bom 2001). these findings were confirmed by mason and bom (2001) who performed in vivo experiments in guinea pig. in this study guinea pigs were treated with steroidal and non - steroidal nmbas to induce a 90% neuromuscular block. the time of spontaneous recovery from this neuromuscular block was compared with the recovery time of the same neuromuscular block after the administration of 1.0 mg / kg sugammadex. the results showed that sugammadex caused a rapid reversal of neuromuscular block induced by steroidal nmbas. the injection of sugammadex did not cause significant changes in heart rate or blood pressure. in this study, they confirmed and extended earlier findings that sugammadex was not effective in reversing neuromuscular block induced by non - steroidal nmbas. this confirms that the size of the cyclodextrin cavity is too small to accommodate the bulky molecules of mivacurium and atracurium. another study by hope and colleagues evaluated the effects of sugammadex on rocuronium - induced steady - state neuromuscular block of the tibialis muscle of the anesthetized cat (hope and bom 2003). a neuromuscular block of 90% was rapidly reversed by 1.0 mg / kg sugammadex, without significant changes in heart rate and blood pressure and again no signs of residual blockade or recurarization were reported. epemolu (2002) found in experiments in guinea pigs that the high affinity of sugammadex for rocuronium results in a concentration gradient between the free rocuronium molecules in the tissue compartment, including the effect compartment (neuromuscular junction) and the central compartment (plasma). as result of this concentration gradient free rocuronium molecules will return to the central compartment and are encapsulated by unsaturated sugammadex. due to this process rocuronium is less available at the effect site, the neuromuscular junction and in turn muscle activity will return. de boer (2006a) evaluated the capability of nine cd derivatives (one -cd and eight -cds of increasing molecular weight) to reverse a constant neuromuscular block of 90% induced by rocuronium. the ability of these cd derivatives to reverse neuromuscular block was compared with the reversal of the same neuromuscular block by the commonly used combination of neostigmine and atropine. the results of these experiments showed that two of the -cd derivatives (org 26148 and org 25969, sugammadex) caused a rapid and effective reversal of rocuronium - induced neuromuscular block versus spontaneous recovery without signs of residual blockade or recurarization. both these cd derivatives were also significantly faster and more efficient compared with reversal by the currently used combination of neostigmine and atropine. there were no observable side - effects or significant effects on blood pressure or heart rate caused by any of the nine synthetic cd derivatives. in contrast, in the experiments with neostigmine atropine combination, two of the four animals showed abdominal discomfort (retching) and mean arterial pressure and heart increased significantly to more than 10% of the baseline values in two of the four experiments. this study in rhesus monkeys confirmed earlier findings in in vitro studies that the potency of natural -, -, and -cds to reverse neuromuscular block induced by rocuronium correlates with their cavity sizes, resulting in a clear measurable effect for -cds (bom 2002 ; de boer 2006a). the best fit for cavity size can be improved by adding side chains to the molecules. the electric charge distribution in these side chains interacting with the charges in the guest molecule results in even greater affinity. a rapid and effective reversal of 90% rocuronium - induced neuromuscular block could be achieved without signs of residual blockade or recurarization. however, little data about the reversal of profound neuromuscular block induced by rocuronium are available. the only study available on profound neuromuscular block was reported by bom : they showed that a 10 ed90 dose of rocuronium can be reversed by sugammadex in guinea pigs (bom 2001). de boer and colleagues designed a study to determine the feasibility of reversal of rocuronium - induced profound neuromuscular block in rhesus monkeys (de boer 2006b). a profound neuromuscular block was induced by injection of a 500 g / kg dose of rocuronium (100 g / kg resulted in a mean neuromuscular block of 93%). one minute after the administration of rocuronium, either 1.0 or 2.5 mg / kg sugammadex or saline (placebo) was injected. the results of this study showed a significant reversal of profound rocuronium - induced neuromuscular block after a dose of 2.5 mg / kg sugammadex and a partial reversal after 1.0 mg / kg sugammadex. sugammadex - rocuronium complexes are highly hydrophilic, and it has been demonstrated that sugammadex is excreted rapidly and dose dependently in urine of anesthetized guinea pigs (epemolu 2002). bom (2003) designed a study to determine the influence of renal impairment on the reversibility of rocuronium - induced neuromuscular block by sugammadex. this study showed that the effectiveness of sugammadex in reversal of neuromuscular block was not affected by cessation of renal blood flow. furthermore acid - base imbalances were also studied to evaluate the effectiveness in changed circumstances (mason 2002). the effectiveness of sugammadex was not affected by changes in ph in anesthetized guinea pigs. the first human exposure of sugammadex was reported by gijsenbergh (2005). twenty - nine healthy male volunteers received either sugammadex or placebo. in the first part of the study19 subjects received sugammadex up to 8.0 mg / kg without administration of a neuromuscular blocking agent. in the second part of this study the subjects were anesthetized and received an intubation dose of 0.6 mg / kg rocuronium or placebo. this was followed by a single bolus injection of sugammadex (0.18.0 mg / kg) or placebo. a dose of sugammadex of 8.0 mg / kg resulted in a recovery time to a train - of - four ratio of 0.9 (normal neuromuscular function) of 1 minute compared with 52 minutes for placebo. there were no adverse events and sugammadex was well tolerated in doses up to 8.0 mg / kg. shields (2006) studied sugammadex for reversal of prolonged (> 2 hours) rocuronium - induced neuromuscular block. thirty patients were anesthetised and received rocuronium 0.6 mg / kg as an initial dose followed by increments to maintain a deep block. neuromuscular monitoring was carried out using acceleromyography, in the train - of - four mode. after at least 2 hours of neuromuscular block, at recovery of the second twitch of the train - of - four, the patients received either sugammadex in a dose of 0.56.0 mg / kg or placebo. the results showed a dose - related decrease in recovery time to a normal neuromuscular function (train - of - four ratio 0.9) within 2 minutes. the conclusion of this study was that the effective dose to reverse a deep and prolonged rocuromium - induced neuromuscular block appears to be 24 mg / kg. sorgenfrei (2006) investigated the dose - response, safety, and pharmacokinetics of sugammadex in a dose up to 4.0 mg / kg in reversing neuromuscular block induced by 0.6 mg / kg rocuronium. sugammadex decreased the reversal time in a dose - dependent manner from 21.0 minutes in the placebo group to 1.1 minute in the 4.0 mg / kg sugammadex dose group. two patients experienced hypotension after the administration of 2.0 and 3.0 mg / kg sugammadex. reversal of high dose rocuronium (1.0 mg / kg) by sugammadex at 3 and 15 minutes after the administration of rocuronium was evaluated in a study by khunl - bradey (2005). the patients were treated with either placebo or sugammadex in a dose up to 16.0 mg / kg. this study showed that a profound rocuronium - induced neuromuscular block was on average reversed within 2.5 minutes for a dose of 8.0 mg / kg sugammadex or higher. another study investigated the efficacy of sugammadex in reversing rocuronium - induced neuromuscular block with either sevoflurane or propofol maintenance anesthesia (vanacker 2005). after 2.0 mg / kg sugammadex, recovery to a normal neuromuscular function was equivalent under propofol and sevoflurane maintenance anesthesia. a multicenter dose - finding and safety study performed by de boer (2005) investigated the reversal or rocuronium - induced neuromuscular block by sugammadex at 5 min after the administration of rocuronium. after a high dose rocuronium (1.2 mg / kg) for intubation, the patients received either placebo or sugammadex in a dose op to 16.0 mg / kg 5 minutes after the injection of rocuronium. a dose of sugammadex of 16.0 mg / kg resulted in a recovery time of less than 2 minutes compared with 122 minutes for placebo. sugammadex caused a dose - dependent, fast, and efficient reversal of profound rocuronium - induced neuromuscular block. evaluation of safety data indicates that sugammadex was well tolerated at doses up to 16.0 mg / kg. suy (2007) evaluated the dose - response relationship of sugammadex for the reversal of rocuronium and vecuronium - induced neuromuscular block. thirty - nine patients received 0.6 mg / kg rocuronium and 40 received 0.1 mg / g vecuronium. both groups were treated with either placebo or up to 8.0 mg / g sugammadex at reappearance of the second twitch of the train - of - four ratio. again, a normal neuromuscular function was the primary end - point of this study. sugammadex showed a fast and effective recovery after a rocuronium and vecuronium - induced neuromuscular block. no adverse events related to sugammadex were reported and sugammadex showed a good safety profile. a multicenter study further evaluated the efficacy of sugammadex in reversing profound neuromuscular block induced by 1.2 mg / kg rocuronium (rex 2005). randomly at 3 or 15 minutes after the injection of rocuronium, sugammadex was administered in doses up to 16.0 mg / g. a dose - dependent time to recovery to a normal neuromuscular function only one adverse event was reported possibly related to sugammadex (qt - prolongation). reversal of rocuronium - induced neuromuscular block by sugammadex was compared with the reversal of the currently used combination of cholinesterase inhibitors and muscarinic acetylcholine receptor antagonists, neostigmine - glycopyrrolate, and edrophonium - atropine. the reversal of rocuronium - induced neuromuscular block by sugammadex was more rapid and efficient compared with neostigmine - glycopyrrolate and edrophonium - atropine. treatment with sugammadex was also associated with fewer side - effects frequently reported after reversal with cholinesterase inhibitors. the results of recent studies demonstrate that sugammadex is effective for reversal of rocuronium- and vecuronium - induced neuromuscular block without apparent side - effects. this is in contrast to the currently available cholinesterase inhibitors used to reverse neuromuscular block, which are ineffective even against profound neuromuscular block and have a number of undesirable side - effects. rocuronium complexes are highly hydrophilic and it has been demonstrated that sugammadex is excreted in a rapid and dose - dependent manner in urine, resulting in a complete elimination from the body. although sugammadex - induced reversal is tolerated in patients with renal disease, the fate of the sugammadex - rocuronium / vecuronium complex remains unclear. the ability of sugammadex to reverse rocuronium- and vecuronium - induced neuromuscular block may have major implications for routine anesthetic practice. once sugammadex becomes commercially available, anesthesiologists will be capable of maintaining the desired depth of neuromuscular block at any time, thereby assuring optimal surgical conditions. it has been speculated that sugammadex might also be used to rapidly terminate the effects of rocuronium in the dangerous and feared can not intubate, can not ventilate situation, and that it could improve the suitability of rocuronium rapid sequence induction techniques. the mechanism by which sugammadex encapsulates rocuronium and vecuronium appears to be superior to currently used neuromuscular block reversal strategies in terms of speed, efficacy, incidence of residual neuromuscular block and recurarization, and side - effects.	steroidal neuromuscular blocking agents (nmbas), such as rocuronium, are widely used in clinical anesthesia and emergency medicine to facilitate endotracheal intubation and artificial ventilation and to allow surgical access to body cavities. reversal of neuromuscular blockade is important for the acceleration of patient recovery and prevention of postoperative residual neuromuscular blockade and reduces the incidence of severe morbidity and mortality associated with anesthesia management. sugammadex is the first selective relaxant binding agent (srba) and has been designed to reverse the steroidal neuromuscular blocking drug rocuronium. encapsulation of the rocuronium molecule by sugammadex results in a rapid decrease in free rocuronium in the plasma and subsequently at the nicotinic receptor at the motor endplate. after encapsulation, rocuronium is not available to bind to the nicotinic receptor in the neuromuscular junction. this promotes the liberation of acetylcholine receptors, and muscle activity reappears. this new concept of reversal of neuromuscular block induced by rocuronium (or vecuronium) led to impressive results in animal and phase 1 and 2 studies. sugammadex is currently in phase 3 clinical studies and may be commercially available by 2008.
	this study aimed to characterize the knowledge of evidence - based dentistry (ebd) among dental faculty members in the city of bhopal in central india. a cross - sectional questionnaire was administered at two dental colleges in bhopal city. all dental faculty members who were present on the day of the study and who agreed to participate were included in the study. a total of 50 dental faculty members returned the questionnaire. six likert - type questions were asked, and the percentages of various responses were used for analysis. sixteen faculty members (32.0%) strongly agreed that ebd is a process of making decisions based on scientifically proven evidence. fifteen faculty members (30.0%) strongly disagreed or disagreed with the item stating that the best and quickest way to find evidence is by reading textbooks or asking experienced colleagues. thirteen faculty members (26.0%) strongly agreed that ebd allows dentists to improve their scientific knowledge and clinical skills. it is recommended that ebd be included in undergraduate and postgraduate curricula and in intensive continuing dental education programs that are conducted for dental faculty members.
since 2006, the amd has promoted a continuous quality improvement initiative called amd annals. in this context, amd identified a set of indicators to be used for benchmarking activities (9,10). quality indicators include process measures evaluating diagnostic, preventive, and therapeutic procedures performed by the participating centers and outcome indicators measuring favorable and unfavorable modifications in patient health status. furthermore, the use of antidiabetic, antihypertensive, and lipid - lowering drugs is evaluated. centers share the same software for data extraction from electronic medical records. data are collected annually in a standardized format (amd data file) and centrally analyzed anonymously. the entire project is conducted without allocation of extra resources or financial incentives but simply through a physician - led effort, made possible by the commitment of the specialists involved. process measures are expressed as percentages of patients monitored at least once during the previous 12 months for the following parameters : hba1c, blood pressure (bp), lipid profile (ldl - c or total and hdl - c and triglycerides), renal function, foot examination, and eye examination. intermediate outcome measures include the proportion of patients with satisfactory values as well as the percentage of those with unacceptably high values. outcomes are considered satisfactory if hba1c levels are 7.0% (53 mmol / mol), bp values are 8.0%, bp values 140/90 mmhg, ldl - c levels 130 mg / dl, bmi 30 kg / m, presence of micro / macroalbuminuria, and glomerular filtration rate (gfr) 60 ml / min. seven indicators of treatment intensity / appropriateness were also measured to take into consideration the use of pharmacological treatments in relation to the achievement of the targets : no insulin despite hba1c > 9.0%, (> 75 mmol / mol), no lipid - lowering agents despite ldl - c 130 mg / dl, no antihypertensive treatments despite bp 140/90 mmhg, no ace - i and/or angiotensin receptor blockers (arbs) despite micro / macroalbuminuria, hba1c > 9.0% (> 75 mmol / mol) in spite of insulin treatment, ldl - c 130 mg / dl in spite of lipid - lowering treatment, and bp 140/90 mmhg in spite of antihypertensive treatment. finally, a quality - of - care summary score (q score) was calculated. the q score has been developed and validated in two previous studies (14,15). it is based on a combination of process and outcome indicators relative to hba1c, bp, ldl - c, and microalbuminuria. the score ranges between 0 and 40 ; the higher the score, the better the quality of care. previous studies (14,15) documented that the risk of developing a new cardiovascular event was 80% higher in patients with a score 25. only patients with a diagnosis of type 2 diabetes were selected. in cases of multiple records collected during the year for the same patient, the denominators for the different quality indicators vary according to the availability of the information in the index year (fig. because normal ranges for glycated hemoglobin varied among the different centers, to allow direct comparison, the percentage change with respect to the upper normal value (actual value / upper normal limit) was estimated and multiplied by 6.0. microalbuminuria was defined as albumin excretion rate 20 g / min, albumin - creatinine ratio > 2.5 (men) or > 3.5 (women) mg / mmol, or microalbuminuria > 30 mg / l. gfr was calculated with the modification of diet in renal disease (mdrd) formula (16). patient characteristics and quality indicators according to sex were described as mean and sd or frequencies. between - group statistical tests were not applied ; in fact, due to the large sample size, even trivial differences reached statistical significance. to take into consideration unbalanced characteristics of the two sexes, the likelihood of women as compared with men (reference class) to be monitored for specific clinical parameters, to reach specific clinical outcomes, and to be treated with specific classes of drugs has been investigated through multilevel logistic regression analyses, adjusted for age, diabetes duration, bmi, and, in a separate model, clustering effect ; the participating diabetes outpatient clinics accounted for the clusters. analyses were performed on the whole sample as well as in two different age - groups, i.e., 8.0%, bp values 140/90 mmhg, ldl - c levels 130 mg / dl, bmi 30 kg / m, presence of micro / macroalbuminuria, and glomerular filtration rate (gfr) 60 ml / min. seven indicators of treatment intensity / appropriateness were also measured to take into consideration the use of pharmacological treatments in relation to the achievement of the targets : no insulin despite hba1c > 9.0%, (> 75 mmol / mol), no lipid - lowering agents despite ldl - c 130 mg / dl, no antihypertensive treatments despite bp 140/90 mmhg, no ace - i and/or angiotensin receptor blockers (arbs) despite micro / macroalbuminuria, hba1c > 9.0% (> 75 mmol / mol) in spite of insulin treatment, ldl - c 130 mg / dl in spite of lipid - lowering treatment, and bp 140/90 mmhg in spite of antihypertensive treatment. finally, a quality - of - care summary score (q score) was calculated. the q score has been developed and validated in two previous studies (14,15). it is based on a combination of process and outcome indicators relative to hba1c, bp, ldl - c, and microalbuminuria. the score ranges between 0 and 40 ; the higher the score, the better the quality of care. previous studies (14,15) documented that the risk of developing a new cardiovascular event was 80% higher in patients with a score 25. only patients with a diagnosis of type 2 diabetes were selected. in cases of multiple records collected during the year for the same patient, the denominators for the different quality indicators vary according to the availability of the information in the index year (fig. because normal ranges for glycated hemoglobin varied among the different centers, to allow direct comparison, the percentage change with respect to the upper normal value (actual value / upper normal limit) was estimated and multiplied by 6.0. microalbuminuria was defined as albumin excretion rate 20 g / min, albumin - creatinine ratio > 2.5 (men) or > 3.5 (women) mg / mmol, or microalbuminuria > 30 mg / l. gfr was calculated with the modification of diet in renal disease (mdrd) formula (16). patient characteristics and quality indicators according to sex were described as mean and sd or frequencies. between - group statistical tests were not applied ; in fact, due to the large sample size, even trivial differences reached statistical significance. to take into consideration unbalanced characteristics of the two sexes, the likelihood of women as compared with men (reference class) to be monitored for specific clinical parameters, to reach specific clinical outcomes, and to be treated with specific classes of drugs has been investigated through multilevel logistic regression analyses, adjusted for age, diabetes duration, bmi, and, in a separate model, clustering effect ; the participating diabetes outpatient clinics accounted for the clusters. analyses were performed on the whole sample as well as in two different age - groups, i.e., 75 years of age), had a slightly higher diabetes duration (11.1 9.8 vs. 10.0 9.1 years), and were more obese (average bmi 29.2 4.6 kg / m in men vs. 30.2 5.9 kg / m in women). similar proportions of women and men were treated with insulin, lipid - lowering agents, and antihypertensive drugs (table 1) ; when evaluating the different classes of drugs and their combinations, no difference was found (supplementary table 1), except for a wider use of diuretics in women than in men (35.9 vs. 27.6%, respectively). the analyses by age class showed similar patterns in individuals below and over 75 years of age (table 1). patient characteristics according to sex all process indicators were slightly but systematically more favorable in men than in women. adjustment for patient case mix and clustering attenuated sex differences ; despite that, women still showed a lower likelihood to be monitored for diabetes complications, particularly foot and eye complications. as for intermediate outcomes, the proportion of individuals reaching satisfactory hba1c, ldl - c, bp, and bmi values was systematically lower for women than for men. adjustment for patient case mix and clustering effect confirms that women were 14% less likely than men to reach the hba1c target, 27% less likely to reach the ldl - c target, and 20% less likely to reach the bmi target. on the other hand, the likelihood of reaching the bp target was slightly higher in women than in men. fully adjusted models show that women were 11% more likely than men to have hba1c levels > 8.0% (> 64 mmol / mol), 41% more likely to have ldl - c levels 130 mg / dl, 50% more likely to have a bmi 30 kg / m, and 32% more likely to have a gfr 60 ml / min. on the other hand the likelihood of not being treated with insulin in the presence of elevated hba1c values or with antihypertensive agents in the presence of elevated bp values was lower in women than in men, whereas no sex difference emerged in the use of lipid - lowering drugs in the presence of elevated ldl - c levels. women had a 10% higher probability than men of not being treated with ace - i or arbs in the presence of micro / macroalbuminuria. women also showed a 14% higher likelihood of having hba1c levels > 9.0% (> 75 mmol / mol) despite insulin treatment and a 42% higher likelihood of having ldl - c levels 130 mg / dl despite lipid - lowering treatment (table 2). quality indicators of diabetes care according to sex the analysis of overall quality of care, as summarized by the q score, shows that women had a 17% greater likelihood of having a score 25 as compared with men. the contribution of between - center variability was substantial for process measures and moderate for intermediate outcomes, as documented by intraclass correlations (table 2). finally, we examined the between - center variability in the proportion of men and women reaching the desired therapeutic targets (fig. the percentage of men reaching the ldl - c target was higher than in women, with differences exceeding 5% in most of the centers. similarly, the proportion of patients reaching the hba1c target was in favor of men in the vast majority of the centers. as for the bp target, no clear trend in favor of men or women emerged. intercenter variability in the percentage difference of men and women achieving the main clinical therapeutic targets. (a high - quality color representation of this figure is available in the online issue.) supplementary table 2 reports the results of the analyses performed separately in individuals below and over 75 years of age. these analyses show that sex disparities are more pronounced in older people, particularly with reference to the attainment of hba1c and bp targets. in fact, elderly women were 27% less likely than men to reach an hba1c level 7.0% (or 0.73 [95% ci 0.710.75 ]) and 17% less likely to reach a bp target < 130/80 mmhg (0.83 [0.790.87 ]). data from amd annals show that in italy, despite equity of access to specialist care and universal coverage of health care costs, sex disparities are still present. between - sex differences in the prevalence and treatment of cardiovascular risk factors are less pronounced in italy than in other countries, not only those where cultural barriers or deprivation can be responsible for lower levels of care provided to women (18,19) but also in other european countries (20,21) or in the u.s. (2224). in spain, data from electronic databases of primary care showed a slightly better metabolic control in women than in men, in contrast with amd annals, although bp and lipid control were in favor of men (10). in the context of a pay - for - performance initiative in the u.k., women were 13% less likely to be monitored for hba1c, bp, lipid profile, and smoking and 25% less likely to reach the recommended therapeutic target than men, although no major differences in metabolic control were detected (11). in the vast majority of studies, women were less likely to reach the recommended targets as well as receive treatment and monitoring. constantly, the wider gap was related to the lipid target ; women had higher ldl - c levels than men and were less likely to be receiving lipid - lowering therapy (25,26). in fact, it is alarming that the likelihood to reach specific clinical outcomes is systematically unfavorable for women as compared with men. the likelihood of receiving poorer quality of care is partly reduced but remains consistently higher for women, even after taking into consideration the baseline differences in patient characteristics (especially the higher proportion of elderly patients, a longer diabetes duration, and the higher bmi in women) and the effect of clustering. to this respect, our study confirms that not taking patient case mix and clustering effect into consideration may lead to biased results (27,28). on the other hand, when the analyses were performed separately in individuals below and over 75 years of age, sex disparities were still documented in younger people and were further increased in elderly patients. our findings do not seem to be explained by a lower propensity of physicians to treat women. in fact, the proportion of women treated with insulin, statins, or antihypertensive agents was equal or even greater than that of men. also, women were more likely than men to be treated with insulin and antihypertensive agents and equally likely to be treated with lipid - lowering drugs in the presence of elevated values. the greater difficulty in reaching the targets can be related to the use of a lower aggressive approach (i.e., prescription of lower doses), poorer compliance of women, or between - sex physiopathological differences. for example, data on sex differences in carbohydrate metabolism showed that during submaximal endurance exercise, women oxidize more lipid and less carbohydrate as metabolic substrates than men (29). in addition, prior research demonstrated the existence of sex differences in drug responses, due to differences in pharmacodynamics and pharmacokinetics (30). on this issue, a study documented that statin therapy after an acute myocardial infarction is associated with reduced rates of all - cause and cardiac mortality, but the degree of risk reduction is lower for women than for men (31). sex - specific differences in the pharmacokinetics and pharmacodynamics of drugs are still unclear (32). another element calling for possible intrinsic physiopathological sex differences is the impairment in the renal function that follows different pathways with a higher prevalence of microalbuminuria in men and more frequently reduced gfr in women (33), as also documented in our study. apart from biomedical differences, the documented differences could also be explained in terms of behavioral factors. nevertheless, in the amd benchmarking network for clinical and humanistic outcomes in diabetes (bench - d) study (34), women showed a higher prevalence of depression, as documented by a two times higher likelihood than men of being in the lowest quartile of the who-5 well - being index score ; the study also showed that lower levels of psychological well - being were associated with lower levels of satisfaction with treatment, diabetes empowerment, and self - care attitudes and with a worse perception of barriers to medication. recently, a new conceptual model has been developed to explain sex differences in health : neither exclusively biomedical explanations nor exclusively social explanations. the model intends to bridge and integrate these dichotomous perspectives as the key to establishing new policies to increase opportunities and provide incentives for pursuing health (35). the existence of mixed mechanisms is also suggested in our study by the analysis of between - center variability. for ldl - c, in almost all the centers (233 out of 236), the proportion of men reaching the target was higher than that of women. such a systematic difference can hardly be explained by the attitudes of the physicians or the patients, and the existence of pathophysiological differences between sexes may play an important role. on the other hand, for the attainment of the hba1c, men were more likely than women to reach the target of 7.0% in 80% of the centers (190 out of 236 centers), thus suggesting the existence of a mixed effect of physiological mechanisms and attitudes. as for bp targets, the direction and magnitude of the between - center difference was variable, thus suggesting that different physician- and patient - related factors, rather than physiopathology, may play a crucial role. the main strengths are the sample size and the data source, which are largely representative of the quality of diabetes care provided to both sexes in italy. a limitation is that we missed information on drug doses, sociodemographic and socioeconomic characteristics, and micro- and macrovascular diabetes complications, which could aid in understanding the reasons for the results obtained. also, our findings refer to patients attending specialist centers and can not be generalized to patients cared for by general practitioners. in conclusion, our data strongly suggest that the greater difficulty in reaching ldl - c targets in women is mainly related to pathophysiological factors, whereas patient and physician attitudes can play an important role in other process measures and outcomes. these findings underline the need for diversifying the care and specializing the support provided to men and women based on sociodemographic, clinical, and psychological characteristics. the regular evaluation of quality - of - care indicators with initiatives such as the amd annals is the first fundamental step to identify the main areas of interventions and monitor the desirable increase in equity during the time.	objectiveto investigate the quality of type 2 diabetes care according to sex.research design and methodsclinical data collected during the year 2009 were extracted from electronic medical records ; quality - of - care indicators were evaluated. multilevel logistic regression analysis was applied to estimate the likelihood of women versus men to be monitored for selected parameters, to reach clinical outcomes, and to be treated with specific classes of drugs. the intercenter variability in the proportion of men and women achieving the targets was also investigated.resultsoverall, 415,294 patients from 236 diabetes outpatient centers were evaluated, of whom 188,125 (45.3%) were women and 227,169 (54.7%) were men. women were 14% more likely than men to have hba1c > 9.0% in spite of insulin treatment (odds ratio 1.14 [95% ci 1.101.17 ]), 42% more likely to have ldl cholesterol (ldl - c) 130 mg / dl (1.42 [1.381.46 ]) in spite of lipid - lowering treatment, and 50% more likely to have bmi 30 kg / m2 (1.50 [1.501.54 ]). women were less likely to be monitored for foot and eye complications. in 99% of centers, the percentage of men reaching the ldl - c target was higher than in women, the proportion of patients reaching the hba1c target was in favor of men in 80% of the centers, and no differences emerged for blood pressure.conclusionswomen show a poorer quality of diabetes care than men. the attainment of the ldl - c target seems to be mainly related to pathophysiological factors, whereas patient and physician attitudes can play an important role in other process measures and outcomes.
the study was approved by the institutional review board (no.14 - 5995-bo) and conforms to the principles of the declaration of helsinki. written informed consent was obtained from all volunteers. twenty nonsmoking healthy volunteers (10 men/10 women) were recruited between october 2014 and july 2015. they had no history of disease or any medication other than oral contraceptives in women. ripc was performed between 8 and 10 ante meridiem independently from the day of the week. the ripc - maneuver consisted of 3 cycles of 5 min upper - limb ischemia / inflation of a blood pressure cuff to 200 mm hg and reperfusion / deflation for 5 min. venous blood samples from the contralateral arm were obtained before ripc (baseline) and at 5 min, 30 min, 1 h, 6 h, 1 day, and daily thereafter until 7 days at the same time of day (figure 1). the blood was collected in heparinized tubes (s - monovette 9 ml lh, sarstedt ag & co., nmbrecht, germany) and immediately centrifuged (multifuge 3sr, heraeus, hanau, germany) at 800 g for 20 min at 4c. the plasma was separated and stored at 80c until use. to assess the cardioprotective effect of humoral factor(s) released after ripc from humans, mice (c57bl6/j ; age : 8 to 12 weeks ; weight : 20 to 30 g) were purchased from harlan laboratories, inc. (horst, the netherlands) and from charles river laboratories (sulzfeld, germany). the protocol was approved by the governmental animal care and use committee and conforms to the position of the american heart association on research animal use, adopted by the american heart association on november 11, 1984. after cervical dislocation, 200 iu of heparin (heparin - natrium-25000-ratiopharm, ratiopharm gmbh, ulm, germany) was intraperitoneally injected, and hearts were excised. within 2 min hearts were cannulated (mouse heart cannula, hugo sachs elektronik, march - hugstetten, germany) under a stereomicroscope (ls 6000ic, beckman coulter, krefeld, germany) through the aorta in cold 0.9% nacl solution and mounted on a langendorff apparatus. at a constant pressure of 100 mm hg, hearts were perfused with modified krebs - henseleit buffer, containing (in mmol / l) 118 nacl (applichem gmbh, darmstadt, germany), 4.7 kcl, 1.64 mgso4 7 h2o (merck, darmstadt, germany), 1.18 kh2po4 (merck, darmstadt, germany), 2.00 na - pyruvate, 5.55 glucose, 24.88 nahco3 (applichem gmbh, darmstadt, germany), and 2.5 mmol / l cacl2. the perfusate was filtered through a 0.45 m filter (filter type hwap, merck, darmstadt, germany), oxygenated and equilibrated to 37c before use. a water - filled balloon made out of saran wrap (toppits, cofresco frischhalteprodukte gmbh & co. kg, minden, germany) was inserted through the mitral valve into the left ventricular cavity and connected to a pressure transducer (dpt-6000, pvb codan, forstinning, germany) to allow continuous monitoring of left ventricular pressure. the left ventricular end - diastolic pressure was initially set to 5 to 15 mm hg, and hearts were paced at a constant rate of 500 beats / min (dpt-6000, pvb codan, forstinning, germany) through a metallic clamp connected to the cannula and a metallic needle inserted into the right auricle (figure 1). plasma (4 ml) was defrozen and centrifuged at 4.500 g for 10 min at 4c. the supernatant was placed in a 12 to 14 kda dialysis tubing (spectrapor, spectrum europe b.v., breda, the netherlands) and dialyzed for 24 h at 4c against a 20-fold volume of modified krebs - henseleit buffer. dialysates were adjusted to 2.5 mmol / l cacl2 and 24.88 mmol / l nahco3, filtered (5 m chromafil xtra pes-500/25, macherey - nagel gmbh & co. kg, dren, germany), oxygenated and equilibrated to 37c before use (figure 1). after a stabilization period of 20 min, hearts were perfused with dialysate for 15 min, followed by 5 min of wash - out with krebs - henseleit buffer to avoid adherence of proteins from a stagnant dialysate to the langendorff apparatus or the coronary circulation during its occlusion. the hearts were subjected to 20 min global zero - flow ischemia and 120 min reperfusion with krebs - henseleit buffer. peak and end - diastolic left ventricular pressure and coronary flow (ts410 ultraschall flowmeter, transonic systems inc., ithaca, new york) were continuously recorded (labchart 8, labchart, adinstruments pty ltd, oxford, united kingdom). hearts with a left ventricular developed pressure (lvdp) 5 ml / min after the stabilization period were discarded. the median lvdp and coronary flow of all hearts perfused with dialysates of human plasma obtained at the same time point after the ripc maneuver were calculated for every minute. lvdp and coronary flow of hearts perfused with baseline - dialysates and of hearts perfused with post - ripc - dialysates were compared at the end of stabilization (20 min), during perfusion with dialysate (35 min), just before ischemia (40 min), at the end of ischemia (60 min), at 15 min and 30 min of reperfusion (75 min and 90 min of the protocol, respectively) (supplemental figures 1 and 2). after 120 min reperfusion, hearts were frozen at 20c for 30 min and cut into 1 mm thick slices (approximately 5 slices per heart). the slices were immersed in 2,3,5-triphenyltetrazolium chloride (ttc) solution (1% (w / v) dissolved in phosphate buffer, consisting of 77.4% (v / v) 0.1 mol / l na2hpo4 and 22.6% (v / v) 0.1 mol / l nah2po4), and incubated in a water bath at 37c for 5 min. after photographing, the slices were quickly frozen in liquid nitrogen and stored at 80c for later analysis by western blot. areas of viable tissue (red) and necrotic tissue (white) were measured by computerized planimetry (imagej 1.48v, national institutes of health, bethesda, maryland). infarct size was calculated as percentage of left and right ventricular (lv+rv) mass (% of lv+rv). investigators performing infarct size quantification were blinded for western blot analyses and vice versa, and all were blinded for the experimental protocols. proteins of murine myocardium were solubilized ; protein lysates were electrophoretically separated on pre - casted sodium dodecyl sulfate - polyacrylamide electrophoresis gels we used 30 g total protein for the detection of signal transducer and activator of transcription 3 (stat3) and extracellular - regulated kinase (erk) 1/2 and 50 g for the detection of stat5 and protein kinase b (akt). pstat3tyrosine705 (mouse, monoclonal), pstat5tyrosine694 (rabbit, monoclonal), paktserine473, perk1/2threonine202/tyrosine204 (rabbit, polyclonal)all from cell signaling technology, inc. (danvers, massachusetts) directed against the phosphorylated forms of stat3, stat5, akt, and erk1/2. (danvers, massachusetts), immunoreactive signals were detected by chemiluminescence (supersignal west femto, thermo fisher scientific, rockford, illinois) using a charge - coupled device camera (chemocam intas, gttingen, germany) and quantified with labimage1d (intas, gttingen, germany). membranes were reprobed for detection of the respective total form of each protein stat3 (rabbit, monoclonal), stat5, akt, erk1/2 (rabbit, polyclonal)all from cell signaling technology, inc. (danvers, massachusetts). immunoreactivities of phosphorylated proteins were normalized to those of the total form of the respective protein. further investigation of the safe pathway was performed by inhibition of stat3 using stattic (stattic, tocris bioscience, bristol, england) 35, 36. plasma from 7 volunteers taken at 3 time points was tested for this in vitro inhibition of the safe pathway : baseline, 30 min and 6 days after ripc. stattic was dissolved in dimethylsulfoxide and added to the krebs - henseleit buffer at a final concentration of 10 mol / l and a final dilution of dimethylsulfoxide of 1:10.000. after stabilization for 20 min, mouse hearts were pre - treated with stattic - containing krebs - henseleit buffer for 20 min, followed by perfusion with human dialysate. during wash - out and reperfusion, plain krebs - henseleit buffer was used again. after ttc staining the slices of the hearts were immunoblotted to verify successful stat3 inhibition. most western blot data failed normality and equal variance test, therefore all continuous variables are presented as median and interquartile range (iqr) and categorical variables as frequencies and percentages. comparisons were made between hearts perfused with dialysates of plasma obtained at baseline and hearts perfused with dialysates of plasma obtained at the pre - defined time points after ripc. statistical analysis was performed using friedman repeated measures analysis of variance on ranks with post hoc dunn s method. all statistical analyses were performed using spss software (sigmastat 3.5, spss, chicago, illinois). perfusion with dialysates of human plasma obtained at baseline resulted in an infarct size of 39% of lv+rv (iqr : 36% to 42%). perfusion with dialysates of human plasma obtained within the pre - specified time points between 5 min and 6 days after ripc reduced infarct size in comparison to that with baseline dialysate (figure 2). dialysates of plasma obtained 5 min after ripc reduced infarct size to 28% of lv+rv (iqr : 22% to 35%), and minimal infarct size was observed with dialysates of plasma obtained 2 days after ripc (i.e., 18% of lv+rv [iqr : 13% to 27% ]. while dialysates of human plasma obtained 6 days after the ripc maneuver still reduced infarct size to 24% of lv+rv (iqr : 18% to 27%), dialysates of plasma obtained 7 days after the ripc maneuver did not (i.e., infarct size was 32% of lv+rv [iqr : 22% to 37% ]) (figure 2). lvdp was significantly improved at 15 min reperfusion by post - ripc - dialysates compared to baseline - dialysate, while coronary flow was not different at any time point (figure 3, supplemental figures 1 and 2). in murine myocardium dialysates of plasma obtained after ripc induced an increase of stat3 phosphorylation over that with baseline - dialysate (p = 0.01) (figure 4a). the phosphorylation of stat5 (p = 0.07) showed a similar tendency, while phosphorylation of akt (p = 0.76) and erk1/2 (p = 0.38) was not affected (figures 4b to 4d). examples of western blot membranes and the respective chemiluminescence signals are displayed in the supplemental appendix for each protein (supplemental figure 3). infarct size reduction and stat3 activation were abolished by stattic (figure 5). infarct sizes of hearts perfused with dialysates of plasma obtained 30 min after ripc were increased by pre - treatment with stattic (19% of lv+rv [iqr : 16% to 29% ] to 45% of lv+rv [iqr : 41% to 46% ], p < 0.05) (figure 5a). the same was true for hearts perfused with dialysates of plasma obtained 6 days after ripc (25% of lv+rv [iqr : 23% to 29% ] to 40% of lv+rv [iqr : 38% to 45% ], p < 0.05) (figure 5a). stattic had no influence on infarct size per se (42% of lv+rv [iqr : 40% to 43% ] vs. 39% of lv+rv [iqr : 34% to 48% ], p = ns) (figure 5a). the efficacy of stat3 inhibition by stattic was verified by the reduced stat3 phosphorylation at baseline, 30 min, and 6 days after ripc (pstat3/total stat3 : 1.02 [iqr : 0.87 to 1.12 ] to 0.45 [iqr : 0.40 to 0.54 ], 0.94 [iqr : 0.90 to 1.04 ] to 0.37 [iqr : 0.31 to 0.44 ], and 0.95 [iqr : 0.78 to 1.11 ] to 0.42 [iqr : 0.35 to 0.51 ], respectively) (figure 5b). original western blot results and the respective chemiluminescence signals are displayed in the supplemental appendix (supplemental figure 5). the present study characterized the kinetics and identified a signal transduction property of humoral factor(s) after a single ripc - maneuver in healthy volunteers. the dialysate of human plasma obtained at 5 min and thereafter until at least 6 days after the ripc - maneuver was transferred to a langendorff - perfused mouse heart where it reduced infarct size from global ischemia / reperfusion through stat3 activation. the release of a circulating factor with a rapid onset of cardioprotection in the bioassay heart of the present study is consistent with prior experimental and clinical studies, which revealed evidence for protection with an interval of only 5 to 10 min between the ripc stimulus and the injurious event 22, 23, 37, 38. the continuous presence of a circulating factor that provides cardioprotection in the bioassay mouse heart in the present study is again consistent with prior experimental and clinical studies, which revealed evidence of long - lasting protection 24, 26, 27, 39 for up to 1 week after the ripc stimulus (28). in contrast to our present study, however, these studies could not distinguish between a long - lasting presence of a circulating factor or a long - lasting protective effect in the target organ. given the dilution of the circulating factor that we had to use for technical reasons to perfuse the mouse heart with a dialysate, the appearance of a circulating factor which initiates protection may even be faster and last longer than we observed. however, we can not distinguish whether we are dealing with the rapid and continuous release of a factor with a short half - life or a rapid release of a factor with a long half - life. also, we have no information whether we are dealing with a single factor or a combination of factors. in the present study, we have not investigated potential candidate molecules nitrite (17), stromal cell derived factor-1 (18), and microrna-144 (19)in the dialysate. however, with a pore size of 5 nm of the dialysis tubing, exosomes that also contribute to protection by ripc (40) are excluded, unless they have released their protective molecules during the dialysis procedure. in murine myocardium cardioprotection by local ischemic conditioning is associated with the activation of akt, stat3, and stat5 31, 32, 35, 41 ; ripc in mice has been shown to be associated with the activation of erk1/2, akt, and stat3 42, 43. apparently, in our present study the humoral factor(s) obtained from healthy volunteers after a single ripc maneuver activated only stat3 significantly whereas akt and erk1/2 were not activated and stat5 only nonsignificantly. the stat3 activation was causal for infarct size reduction since stattic abrogated the protection. although not significant, the trend for an activation of stat5 is noteworthy because stat5 is the only signaling protein, which has so far been demonstrated to be activated by ripc in human tissue (44). the activation of stat3 points to members of the cytokine and/or the growth hormone family as potential circulating ripc transfer factor(s), as both cytokines and growth hormones classically activate the stat3 and also the stat5 pathway 29, 45, 46. however, the causal role of stat3 in the rapid infarct size reduction (within 30 min) precludes a role of stat3 as a transcription factor, which in turn may interact with other cardioprotective transcription factors such as hypoxia - inducible factors 47, 48, for the present study. the causal role of stat3 is rather attributable to better mitochondrial function, as we have shown before in protocols of ischemic post - conditioning 35, 36. we used a saline - perfused langendorff heart preparation with all its limitations, including the development of edema. the human factor(s) in the present study were obtained from healthy volunteers but protection and its signal transduction were only identified after inter - species transfer in the isolated mouse heart. the humoral factor(s) may be different in kinetics and properties in patients with cardiovascular disease, confounding co - morbidities and comedications. also, the signal transduction and the protective effect may be quantitatively and qualitatively different in the diseased human than the healthy mouse heart (13). a single ripc maneuver in healthy volunteers induces release of 1 or more cardioprotective, dialyzable, humoral factors that circulate already after 5 min and for up to 6 days. these factors reduce infarct size through stat3 activation in the mouse heart.perspectivescompetency in medical knowledge : ripc protects against myocardial ischemia / reperfusion injury in animal studies and clinical proof - of - concept trials. recent large - scaled, randomized trials did not confirm protection by ripc in patients undergoing cardiac surgery, possibly because of confounding comorbidities and medications. the definition of basic characteristics of ripc - induced cardioprotection in healthy volunteers may help to design future clinical trials.translational outlook 1 : the kinetics and signaling of cardioprotection by ripc must be better defined.translational outlook 2 : identification of the transfer factor(s) is mandatory for its potential use as a therapeutic agent. competency in medical knowledge : ripc protects against myocardial ischemia / reperfusion injury in animal studies and clinical proof - of - concept trials. recent large - scaled, randomized trials did not confirm protection by ripc in patients undergoing cardiac surgery, possibly because of confounding comorbidities and medications. the definition of basic characteristics of ripc - induced cardioprotection in healthy volunteers may help to design future clinical trials. translational outlook 1 : the kinetics and signaling of cardioprotection by ripc must be better defined. translational outlook 2 : identification of the transfer factor(s) is mandatory for its potential use as a therapeutic agent.	summaryalthough remote ischemic pre - conditioning (ripc) reduced infarct size in animal experiments and proof - of - concept clinical trials, recent phase iii trials failed to confirm cardioprotection during cardiac surgery. here, we characterized the kinetic properties of humoral factors that are released after ripc, as well as the signal transduction pathways that were responsible for cardioprotection in an ex vivo model of global ischemia reperfusion injury. venous blood from 20 healthy volunteers was collected at baseline and 5 min, 30 min, 1 h, 6 h, and daily from 1 to 7 days after ripc (3 5/5 min upper - limb ischemia / reperfusion). plasma - dialysates (cut - off : 12 to 14 kda ; dilution : 1:20) were infused into langendorff - perfused mouse hearts subjected to 20/120 min global ischemia / reperfusion. infarct size and phosphorylation of signal transducer and activator of transcription (stat)3, stat5, extracellular - regulated kinase 1/2 and protein kinase b were determined. in a subgroup of plasma - dialysates, an inhibitor of stat3 (stattic) was used in mouse hearts. perfusion with baseline - dialysate resulted in an infarct size of 39% of ventricular mass (interquartile range : 36% to 42%). perfusion with dialysates obtained 5 min to 6 days after ripc significantly reduced infarct size by 50% and increased stat3 phosphorylation beyond that with baseline - dialysate. inhibition of stat3 abrogated these effects. these results suggest that ripc induces the release of cardioprotective, dialyzable factor(s) within 5 min, and that circulate for up to 6 days. stat3 is activated in murine myocardium by ripc - induced human humoral factors and is causally involved in cardioprotection.
this is a retrospective cohort study pertaining to medicare claims among inpatients and outpatients during 2010. medicare is a us government sponsored health insurance program for us residents aged 65 years and older, for younger patients with disabilities and those with end - stage renal disease or amyotrophic lateral sclerosis. a 5% random sample of all medicare claims were obtained from the denominator files provided by the centers for medicare and medicaid services. the 5% sample was created based on selecting records with 05, 20, 45, 70, or 95 in positions 8 and 9 of the health insurance claim number. for inclusion in this cohort patients had a diagnosis code for nafld [the international classification of diseases, ninth revision (icd-9) codes of 571.8 as nafld without mention of alcohol or 571.9 as unspecified chronic liver disease ]. further, patients had to have at least 12 months (or until death) of continuous enrollment in medicare part a and b. patients were excluded if they had other chronic liver diseases without nafld [070 viral hepatitis ; 155.0 and 155.2 hcc ; 155.2 cholangiocarcinoma ; 275.0 disorders or iron metabolism ; 570 acute and subacute necrosis of liver ; 571.0 alcoholic liver disease ; 571.1 acute alcoholic hepatitis ; 571.2 alcoholic cirrhosis of liver ; 571.3 alcoholic liver damage, unspecified ; 571.4 chronic hepatitis (including 571.42 autoimmune hepatitis) ; 571.6 biliary cirrhosis ; 573.3 toxic hepatitis ; 573.8 hepatoptosis ], cancer codes 140 to 209, human immunodeficiency virus infection code 042, or renal disorders (582 chronic glomerulonephritis code ; 585 chronic kidney disease ; 586 renal failure ; v42.0 kidney transplant ; v45.1 renal dialysis ; v56 encounter for dialysis and dialysis catheter care) ; or incurred a negative charge. for more details on inpatient inclusion see figure 1 and for outpatient see figure 2. icd-9 code for health conditions were considered to be always present if they were coded at least once. the total provider payments were calculated as the sum of medicare reimbursement amount plus the primary insurance payment plus the beneficiary - paid amounts (copay and deductibles). for the time - varying variables, for example, total health care charges vary by claim, so we created a variable for each beneficiary representing annual total health care charges for each claim : further, an average annual charge was calculated by dividing annual total charges by annual total health care visits. the following variables were available : the following 7 diagnoses were also considered covariates and were identified using any of the up to 10 listed icd codes : (1) hepatic cirrhosis was identified by icd-9 code 571.5 as hepatic cirrhosis without mention of alcohol ; (2) decompensated cirrhosis (dcc) codes 789.5 as ascites, 567.23 as spontaneous bacterial peritonitis, 456.0 as esophageal varices with bleeding, 456.2 as esophageal varices in disease classified elsewhere, code underlying cause are cirrhosis of liver and portal hypertension, and 572.2 as hepatic encephalopathy ; (3) cardiovascular disease (cvd) codes 410, 412 as myocardial infarction, 398.91, 402.01, 402.11, 402.91, 404.01, 404.03, 404.11, 404.13, 404.91, 404.93, 425.4 - 425.9, 428 as congestive heart failure, 093.0, 437.3, 440, 441, 443.1 - 443.9, 447.1, 557.1, 557.9, 43.4 as peripheral vascular disease, 362.34, 430 - 438 as cerebrovascular disease ; (4) diabetes code 250 ; (5) hypertension codes 401 - 405 ; (6) hyperlipidemia codes 272.0 - 272.2, and 272.4 ; and (7) obesity codes 278.00, 278.01, v85.3, v85.4. study characteristics are presented with interquartile ranges (iqrs) for continuous variables or proportions for categorical variables. descriptive characteristics were compared between nafld with compensated cirrhosis (cc) and dcc by t test for numerical variables and tests for categorical variables. log - linked -generalized regression was used to generate coefficients with p - values for each highly skewed outcome variables. to separately describe the amount of increases and decreases in annual total charges / payments associated with a unit change in the explanatory variable for inpatient care cohort and in outpatient care cohort,, we analyzed the causes of hospitalizations among patients with nafld, according to the presence or absence of cirrhosis. in order to minimize a misclassification bias, we further narrowed the inpatient population to patients with nafld, where nafld was primary, secondary or tertiary diagnosis, and analyzed the leading causes of hospitalization again. finally, using the primary icd-9 diagnosis code, we selected the following conditions : nafld, nonalcoholic hepatic cirrhosis, hepatic encephalopathy, portal hypertension, esophageal varices with / without bleeding, ascites, and spontaneous bacterial peritonitis as nafld - related inpatient / outpatient utilization. this is a retrospective cohort study pertaining to medicare claims among inpatients and outpatients during 2010. medicare is a us government sponsored health insurance program for us residents aged 65 years and older, for younger patients with disabilities and those with end - stage renal disease or amyotrophic lateral sclerosis. a 5% random sample of all medicare claims were obtained from the denominator files provided by the centers for medicare and medicaid services. the 5% sample was created based on selecting records with 05, 20, 45, 70, or 95 in positions 8 and 9 of the health insurance claim number. for inclusion in this cohort patients had a diagnosis code for nafld [the international classification of diseases, ninth revision (icd-9) codes of 571.8 as nafld without mention of alcohol or 571.9 as unspecified chronic liver disease ]. further, patients had to have at least 12 months (or until death) of continuous enrollment in medicare part a and b. patients were excluded if they had other chronic liver diseases without nafld [070 viral hepatitis ; 155.0 and 155.2 hcc ; 155.2 cholangiocarcinoma ; 275.0 disorders or iron metabolism ; 570 acute and subacute necrosis of liver ; 571.0 alcoholic liver disease ; 571.1 acute alcoholic hepatitis ; 571.2 alcoholic cirrhosis of liver ; 571.3 alcoholic liver damage, unspecified ; 571.4 chronic hepatitis (including 571.42 autoimmune hepatitis) ; 571.6 biliary cirrhosis ; 573.3 toxic hepatitis ; 573.8 hepatoptosis ], cancer codes 140 to 209, human immunodeficiency virus infection code 042, or renal disorders (582 chronic glomerulonephritis code ; 585 chronic kidney disease ; 586 renal failure ; v42.0 kidney transplant ; v45.1 renal dialysis ; v56 encounter for dialysis and dialysis catheter care) ; or incurred a negative charge. for more details on inpatient inclusion see figure 1 and for outpatient see figure 2. icd-9 code for health conditions were considered to be always present if they were coded at least once. the total provider payments were calculated as the sum of medicare reimbursement amount plus the primary insurance payment plus the beneficiary - paid amounts (copay and deductibles). for the time - varying variables, for example, total health care charges vary by claim, so we created a variable for each beneficiary representing annual total health care charges for each claim : further, an average annual charge was calculated by dividing annual total charges by annual total health care visits. the following variables were available : the following 7 diagnoses were also considered covariates and were identified using any of the up to 10 listed icd codes : (1) hepatic cirrhosis was identified by icd-9 code 571.5 as hepatic cirrhosis without mention of alcohol ; (2) decompensated cirrhosis (dcc) codes 789.5 as ascites, 567.23 as spontaneous bacterial peritonitis, 456.0 as esophageal varices with bleeding, 456.2 as esophageal varices in disease classified elsewhere, code underlying cause are cirrhosis of liver and portal hypertension, and 572.2 as hepatic encephalopathy ; (3) cardiovascular disease (cvd) codes 410, 412 as myocardial infarction, 398.91, 402.01, 402.11, 402.91, 404.01, 404.03, 404.11, 404.13, 404.91, 404.93, 425.4 - 425.9, 428 as congestive heart failure, 093.0, 437.3, 440, 441, 443.1 - 443.9, 447.1, 557.1, 557.9, 43.4 as peripheral vascular disease, 362.34, 430 - 438 as cerebrovascular disease ; (4) diabetes code 250 ; (5) hypertension codes 401 - 405 ; (6) hyperlipidemia codes 272.0 - 272.2, and 272.4 ; and (7) obesity codes 278.00, 278.01, v85.3, v85.4. study characteristics are presented with interquartile ranges (iqrs) for continuous variables or proportions for categorical variables. descriptive characteristics were compared between nafld with compensated cirrhosis (cc) and dcc by t test for numerical variables and tests for categorical variables. log - linked -generalized regression was used to generate coefficients with p - values for each highly skewed outcome variables. to separately describe the amount of increases and decreases in annual total charges / payments associated with a unit change in the explanatory variable for inpatient care cohort and in outpatient care cohort,, we analyzed the causes of hospitalizations among patients with nafld, according to the presence or absence of cirrhosis. in order to minimize a misclassification bias, we further narrowed the inpatient population to patients with nafld, where nafld was primary, secondary or tertiary diagnosis, and analyzed the leading causes of hospitalization again. finally, using the primary icd-9 diagnosis code, we selected the following conditions : nafld, nonalcoholic hepatic cirrhosis, hepatic encephalopathy, portal hypertension, esophageal varices with / without bleeding, ascites, and spontaneous bacterial peritonitis as nafld - related inpatient / outpatient utilization. after applying strict inclusion and exclusion criteria, between january 1, 2010 and december 31, 2010, we were able to include 976 nafld patients who received care in the inpatient setting while 4742 nafld patients sought care in the outpatient setting (figs. 1 and 2). overall, approximately 87% were white, 36% were male, and nearly 30% had cvd or metabolic syndrome conditions (dm, hypertension, hyperlipidemia) (table 1). of the entire nafld cohort, characteristics of study by cirrhosis status, inpatient and outpatient medicare, 2010 among nafld inpatients, the median annual total hospital charges were $ 36,289 (iqr : $ 18,359-$71,225 ] (table 1). as expected, total charges for the nafld patients without cirrhosis were significantly lower than those for nafld patients with cirrhosis ($ 33,863 vs. $ 61,151 ; p 50% increase in inpatients charges and payments, and > 60% in the outpatient setting. in addition to cvd, our study also confirmed the close association of nafld with metabolic syndrome components and obesity. in fact, among nafld patients with cc, > 65% had hypertension and nearly 60% had diabetes. similar to cvd, in multivariate analysis, presence of these comorbidities was found to increase inpatient and outpatient charges and payments in different rates. obesity was another factor for increased resource utilization increasing total outpatient charges and payments by > 50%. in fact, as a future projection, finkelstein reported that obesity prevalence will be 42% in the year 2030 and if it remained at 2010 levels, nearly $ 440 billion in medical expenditures would be saved in the next 2 decades. these findings are in agreement with the study by ghamar chehreh, 30 showing the average treatment cost of nafld patients with obesity and hypertension was higher than for treatment of nafld patients without metabolic conditions first, because of lack of accessibility of recent data, we utilized inpatient and outpatient data for the year 2010 only. by limiting the study period to a year, we were unable to make estimations about the changing pattern of the economic burden of nafld, as noted in other publications.18,31 second, although charges and payments for procedures, imaging and other costs were included in the total amounts, we were unable to itemize individual amounts of these procedures among cirrhotic and noncirrhotic nafld patients. also, as this was a retrospective study on medicare database, we could not determine if patients utilized any type of healthcare plan other than medicare, which may have changed our findings. finally, we used icd-9 coding and a very strict criteria to select our study cohort. although this approach assured us that we have only patients with nafld, it certainly may have underestimated the number of nafld patients with medicare. in summary, nafld is associated with a significant economic burden to medicare. presence of dc due to nafld is associated with more resource utilization compared with cc and noncirrhotic nafld patients. it can be suggested that as long as the prevalence of obesity and nafld continue to grow, this economic burden of nafld on medicare expenditures will continue to rise.	background : nonalcoholic fatty liver disease (nafld) is one of the leading causes of chronic liver disease worldwide with tremendous clinical burden. the economic burden of nafld is not well studied.goal:to assess the economic burden of nafld.study:medicare beneficiaries (january 1, 2010 to december 31, 2010) with nafld diagnosis by international classification of diseases, ninth revision codes in the absence of other liver diseases were selected. inpatient and outpatient resource utilization parameters were total charges and total provider payments. nafld patients with compensated cirrhosis (cc) were compared with decompensated cirrhosis (dc).results : a total of 976 inpatients and 4742 outpatients with nafld were included87% were white, 36% male, 30% had cardiovascular disease (cvd) or metabolic syndrome conditions, and 12% had cirrhosis. for inpatients, median total hospital charge was $ 36,289. nafld patients with cirrhosis had higher charges and payments than noncirrhotic nafld patients ($ 61,151 vs. $ 33,863 and $ 18,804 vs. $ 10,146, p<0.001). compared with cc, nafld patients with dc had higher charges and payments (p<0.02). for outpatients, median total charge was $ 9,011. nafld patients with cirrhosis had higher charges and payments than noncirrhotic nafld patients ($ 12,049 vs. $ 8,830 and $ 2,586 vs. $ 1,734, p<0.001). compared with cc, dc patients had higher total charges ($ 15,187 vs. $ 10,379, p=0.04). in multivariate analysis, variables associated with increased inpatient resource utilization were inpatient mortality, dc, and cvd ; for outpatients, having cvd, obesity, and hypertension (all p<0.001).conclusions : nafld is associated with significant economic burden to medicare. presence of cirrhosis and cvd are associated with increased resource utilization.
the cuatro cienegas basin (ccb), in mexico, has been described as an important biodiversity reservoir within the chihuahuan desert. the basin consists of a small (< 840 km) intermontane valley that contains different water systems. most of the aquatic habitats are ephemeral, not permanent or subject to marked seasonal fluctuations. moreover, most aquatic systems in the area are extremely oligotrophic due to the almost negligible phosphorous levels. despite this, ccb is one of only two north american desert ecosystems characterized by high levels of species endemism including vertebrates, invertebrates [1, 3 ], and more recently a considerable list of microbes either bentonic, planktonic, or part of stromatolites and microbial mats [47 ]. using culture - independent approaches, gammaproteobacteria in ccb appears as a dominant group in the aquatic environments [4, 8 ]. within proteobacteria, pseudomonas is itself a dominant group, with ample distribution and new endemic lineages or species described within the basin [5, 9 ], as well as a clear dominance in some microbial mats. the unusual levels of biodiversity and endemism have led to describe ccb as well as either a time machine or a microbial galapagos [1, 4, 11 ] and have made it priority for conservation efforts by (comisin nacional para el conocimiento y uso de la biodiversidad) conabio, the world wildlife fund (wwf), the ramsar convention on wetlands and man, and the biosphere (mab)/unesco. previous studies in ccb have sought to describe the unusual levels of microbial diversity across environmental or geographic gradients [6, 12, 13 ], as well as to understand the evolutionary and ecological origins of the observed diversity [4, 10, 14, 15 ]. however, nothing has been done to characterize bacterial diversity across seasons, despite (1) the existence of analytical models that indicate that seasonal fluctuation can influence the origin and maintenance of diversity and (2) the marked seasonality in many of the aquatic systems in the basin [1, 17 ]. to evaluate the changes in microbial diversity associated with seasonality in water systems of ccb, we characterize, for the first time, microbial diversity across seasons in one of the seasonally variable freshwater systems (desiccation lagoon). the studied system is relatively small, and evidence exists of the strong influence that its seasonal environmental changes have in genetic variation of fish. within this context, we analyzed a fraction of total microbial diversity, the culturable pseudomonas populations, and hypothesize that seasonal variation of microbial populations should track seasonal changes of the desiccation lagoon. we statistically show that taxonomic identity of isolates is not independent of the sampling season, and that winter and summer populations are different. in addition to the genetic description of populations, we show exploratory measures of growth rates at different temperatures, suggesting physiological differences between populations. altogether, the results indicate seasonal changes in diversity of free - living aquatic pseudomonas populations from ccb. we chose a seasonal aquatic ecosystem within ccb subject to marked fluctuations of chemical and physical parameters across seasons temperature being one of them, as shown in figure 1(b) (038c range ;). the site is locally known as laguna grande (lg), and is located in the hydrological system of churince on the western side of ccb (figure 1(a)). temperature was measured hourly over approximately two - week intervals at two sites (lg1 and lg3) using ibutton temperature sensors (maxim integrated, dallas, tx, usa). laguna grande : lg1 (2650.830n, 10209.335w), lg2 (2651.199n, 10209.009w), lg3 (2651.146n, 10208.964w), and lg4 (2651.222n, 10209.040w). at a single time point, there were not significant temperature differences between sampling sites (figure 1 and), the multiple site sampling per time point was done to cover as much area as possible. temperature variation was mostly through seasons, with temperatures reaching lows close to 0c and highs close to 40c (figure 1 ;). samples were taken in summer (august 2003 and 2005) and winter (january 2004 and 2005). no further sampling was possible since 2006 because overexploitation of ccb aquifer associated with agricultural practices dried out the aquatic environment of laguna grande. triplicate samples of 15 ml of water were taken from surface water (1520 cm depth) at each of the four samples sites using sterile bd falcon vials (bd biosciences, ma, usa). each replicate sample was plated in triplicate by spreading 200 l of each vial. culture plates contained gsp culture media (pseudomonas - aeromonas selective agar base) : 10.0 (g l) sodium l(+) glutamate, 20.0 (g l) soluble starch, 2.0 (g l) potassium dihydrogen phosphate, 0.5 (g l) magnesium sulfate, 0.36 (g l) phenol red, and 12.0 (g l) agar - agar. strains that belong to the genus aeromonas degrade the starch and produce acid, causing change in color (red to yellow). strains that belong to the genus pseudomonas did not produce acid ; therefore, we selected the colonies that did not decolorize the media into yellow. colonies were purified by subculturing on the same medium and maintained at 80c in gsp media and 15% (w / v) glycerol. dna was extracted by using dneasy blood and tissue kit (qiagen, ca, usa) according to the manufacturer 's instructions. repetitive extragenic palindromic pcr (rep - pcr) genomic fingerprinting of the isolates was carried out with a box - a1r primer (5-ctacggcaaggcgacgctgacg-3) according to the protocol of. the following pcr conditions were used : 7 min at 95c, followed by 30 cycles of 94c for 1 min, 53c for 1 min, 65c for 8 min, and a final extension at 65c for 8 min. pcr products were analyzed on 1.5% (w / v) agarose gels containing 0.5x tae - buffer (200 mm trisacetate, 0.5 mm edta, ph 8). the electrophoresis was performed for 5 hours at 180 mv (5 v cm). a 1-kb plus dna size ladder (invitrogen) was run at both sides and in the central lane of each gel. gel images were digitized with a charge - couple device video camera (gel logic 100, kodak) and stored on disk as tiff files. these digitized images were converted, normalized with the abovementioned dna size markers, and analyzed with gelcompar software (version 4.0 ; applied maths, kortrijk, belgium). the rolling disk background subtraction method was applied. to analyse box - pcr patterns, similarity matrices of whole densitometric curves of the gel tracks were calculated by using the pair - wise pearson 's product - moment correlation coefficient (r value of 1 is equivalent to 100% similarity). this approach compares the whole densitometric curves of the fingerprints [21, 22 ]. cluster analyses of similarity matrices were performed by the unweighted pair group method using arithmetic averages (upgma). we performed a cluster analysis of all dna ladders to choose a similarity value to define isolates belonging to a same group of genotypes. we chose one isolate per genotype (as defined by rep - pcr analysis and determined by having at least 90% similarity in banding patterns) to obtain the 16s rdna sequence. previous studies have shown that clones with very similar box - pcr fingerprints (r values of more than 0.8) had identical 16s rrna gene sequences. the 16s rrna gene was amplified using the 27f and 1492r primers under conditions described previously in 100 l final volume. the pcr products were purified using the qiaquick gel extraction kit (qiagen, hilden, germany). for sequencing the 16s rrna gene (ca. 1450 bp) primers 27f, 357r, 530r, 530f, 790f, 981r, and 1492r were used. the sequencing reaction had a total volume of 15 l consisting of 2 l big dye terminator sequencing buffer (applied biosystems, foster city, ca, usa), 1.6 m primer, and 5 l - purified amplified product. the amplification conditions were as follows : one cycle of 5 min at 95c, and 45 cycles of 10 s at 95c, 10 s at 50c and 4 min at 60c. the 16s rrna gene sequences obtained have been submitted to the genbank database under accession numbers eu791282 and fj976048-fj976083. the blast 2.0.6 algorithm of genbank and the similarity_rank tool of the ribosomal database project ii (rdp - ii) were employed to search for closest matches found in the rdp - ii and genbank. model generator (version 0.84,) was used to determine the optimal nucleotide substitution model. neighbor - joining (nj) algorithm was used to generate a genealogy as implemented in paup (version 4.0,), by using the gtr evolutionary model with gamma correction 0.40 and 1500 bootstrap replicates for all sequences. as an exploratory approach towards potential differences in physiological responses of winter and summer populations, growth curves at different temperatures were constructed, and maximum growth rates determined for a subset of isolates. the criteria for assembling this subset looked for a fair representation of genotype diversity at the individual level, as well as the inclusion of isolates that were obtained at different sampling dates and belong to the observed dominant lineages (p. otitidis and p. cuatrocienegasensis). by applying these criteria, the subset resulted in 6 genotypes of winter samples (p. cuatrocienegasensis) and 11 genotypes of summer samples (p. otitidis). we determined individual maximum growth rates at 5 different temperatures (28, 32, 26, 40, and 44c), likely experienced in summer time, and ran the experiments in triplicate. a biotek synergy microplate reader (synergy 2 multi - mode microplate reader model, biotek) was used to measure optical density of individual cultures every 10 min. optical density measures were then used to construct growth curves and determine maximum growth rates. we calculated the index g / n, where g is the number of isolates with the same box - banding patterns and n the total number of isolates. the shannon index of diversity was calculated using the formula : h = (g / n)ln(g / n). the abundance of each genotype was calculated as the number of isolates in each genotypic group divided by total number of isolates. to determine how sampling effort affected these estimates, rarefaction curves were constructed comparing the number of isolates versus number of observed genotypes using ecosim (version 7.72). given the small sample size, and in order to evaluate diversity differences between summer and winter populations correcting for this, we constructed rarefaction curves for the abundance of phylotypes (lineages) using ecosim (version 7.72). we also estimated the actual number of lineages (phylotypes) that may be present in the sample, by the calculation of a nonparametric chao1 richness estimator using estimates 8.2.0 [33, 34 ]. to statistically determine the existence of two populations (summer and winter), we constructed a contingency table with the frequencies of lineages for the different sampling seasons and used a g test to evaluate the significance of our frequency distribution of lineages. finally, we performed a generalization of fisher 's exact test as using the fisher test routine as provided in the r statistical package, using the simulate p value = true flag. differences in growth rates at different temperatures were observed between summer and winter populations (p. cuatrocienegasensis and p. otitidis, resp.). to evaluate the statistical significance of these differences we performed a one - way analysis of variance as implemented in the r statistical package, using the function one - way test. to characterize the diversity of natural pseudomonas isolates and its changes associated with seasonality in a ccb water system, we sampled a desiccation lagoon subject to marked seasonal fluctuations. cultures were obtained from surface water samples in four sampling events (two summers, two winters). individual isolates (70) were genotyped and temporal structure of the total sample analyzed. genotypic diversity was measured through genomic fingerprinting for each isolate using box - pcr technique, which permits the identification of individual clones, and each unique pattern was considered a different genotype. we chose a similarity value of 90% or more to indicate strains of the same (or very similar) genotype. very similar or identical banding patterns have been demonstrated to have the same genotype and identical 16s rrna gene sequences. we identified 9 genotypes (15 isolates) from august 2003, 7 genotypes (31 isolates) from january 2004, 7 genotypes (12 isolates) from january 2005, and 12 genotypes (12 isolates) from august 2005. the genotypic diversity calculated for the total sample (70 pseudomonas isolates) and all estimates derived from this sample it has been said that the standard diversity description of the sample indicates that shannon index (h) is 3.14. additional analyses include the observation that genotypic diversity was heterogeneously distributed in the different samples. in january 2004, we observed the lowest diversity (g / n = 0.22) and the highest number of isolates having the same genotypic pattern (12 strains having the same genotype). while, in august 2005, we observed the highest diversity with 12 isolates out of 12 unique genotypes (g / n = 1). all genotypes were found to be unique to one sample occasion (figure 2). even when we applied a cutoff value of 80% to define clusters, the majority of genotypes (92.9%) were collected only once, except for two genotypes that included isolates from different sampling occasions. rarefaction analysis showed that more sampling is needed to gain confidence on the genotype diversity present (data not shown). thus, these observations are only suggestive of not reoccurrence of genotypes from year to year. phylogenetic diversity was defined by the identification of species or lineages as unique 16s rdna sequences. to determine the seasonal structure of lineages, the neighbor - joining genealogy of 16s rdna sequences represents an estimate of the phylogenetic relationship of the 35 genotypes identified by box - pcr and is shown in figure 3. using a 97% sequence similarity cutoff for the 16s rdna sequences, the data revealed two numerically dominant clusters. the first cluster (8 sequences representing 24 strains of the total sample) is closely related to p. cuatrocienegasensis and was isolated exclusively in winter samples (january 2004 and january 2005), while the second cluster (15 sequences representing 21 strains of the total sample) is closely related to p. otitidis and was isolated exclusively in summer samples (august 2003 and august 2005). the seasonal reappearance of phylotypes, identified by 16s rdna sequences, was not observed at the box - pcr fingerprinting level, since all the patterns were different from one sample occasion to the other (figure 2). these results show that there is seasonal reoccurrence of specific lineages in this site, but the populations that define them have different genotypic composition from one year to the next. we also analyzed the possibility that the two distinct populations (summer and winter) were not statistically different in terms of the observed diversity, by correcting for sampling size using rarefaction curves. the resulting curves show sampling saturation and that the two populations truly differ in diversity levels (figure 4). in accordance with rarefaction results, chao1 richness indices show that the observed number of lineages will not change significantly with more sampling (table 1). additionally, we performed a generalized fisher 's test and a g test of independence. fisher 's test was done to evaluate the statistical significance of a seasonal effect on the distribution of phylotypes, as based upon a contingency table. we observed a strongly statistically significant result (p = 0.0004998), indicating that the probability of observing the particular arrangement of lineages / seasons by chance is extremely small. the g test was done to evaluate the association of phylotypes to sampling seasons and indicated that the probability of finding a particular phylotype is highly dependent on the season (g = 108.92 ; df = 24 ; p = 8.6 10). these results indicate that the observed seasonal distribution of lineages is statistically significant and is not likely due to random events. finally, we explored the possibility that p. cuatrocienegasenesis and p. otitidis populations may differ in their maximum growth rates at different temperatures that can be experienced during summer time (28, 32, 36, 40, and 44c). we observed that, on average, differences between populations are statistically significant only at 40c, where p. otitidis summer lineage grows faster than p. cuatrocienegasensis winter lineage (figure 5). in ccb there is an extraordinary microbial biodiversity, and each site seems to be unique [57, 14, 3739 ]. as in other places, even if the diversity is high, most of it remains unreachable by traditional culture approaches. some culturable groups such as pseudomonas, bacillus, exiguobacterium, and other firmicutes [6, 13 ] are an exception. we have found these groups being in high numbers in clone libraries and metagenomes from environmental samples [38, 39 ] and also have been able to culture them in the laboratory. the microbial diversity information from ccb comes mainly from the study of water systems and ponds, most of which are subject to seasonal fluctuations, and nothing is known of the biodiversity changes that occur associated with these environmental cycles. the present study is part of this exploration focusing on the genus pseudomonas and seasonality. box - pcr fingerprint analysis and 16s rdna sequences of all the unique box - pcr genotypes were used to determine the temporal structure of the sampled populations. our results revealed that half of the total number of genotypes were unique (g / n = 0.5). this diversity value is relatively low in comparison with reported values for escherichia coli (g / n = 0.73 ;). however, undersampling, shown by rarefaction curves (data not shown), calls for caution in the interpretation of diversity calculations atat the genotype level. characterization of the phylogenetic diversity leads to the finding of seasonal structure of two numerically dominant lineages : p. cuatrocienegasensis and p. otitidis. although diversity may be underestimated at the genotype level due to reduced sample size, we were able to test statistically the correlation between genetic structure and seasonality with a g test of independence, a generalized fisher test, through sampling size correction via rarefaction curves analysis, and by the estimation of the expected richness with nonparametric richness estimator chao1. g test of independence and generalized fisher test indicate that phylotype (species or lineage) identity is not independent of sampling season (g = 108.92 ; df = 24 ; p = 8.6 10) and that probability of observing the particular arrangement of lineages / seasons by chance is extremely small (p = 0.0004998). rarefaction curves of winter and summer populations showed differentiation between the two and a saturation of diversity for summer samples, giving evidence that both populations differ significantly in their diversity levels (figure 4). finally, expected richness indices (chao1) do not deviate significantly from the observed number of lineages (table 1). altogether, these tests indicate that in fact winter and summer populations are statistically different both in their composition and in their diversity levels. using restriction fragment length polymorphism (rflp) of leaves samples taken monthly over 3-year period, they found seasonal reappearance of long - term survival ribotypes. in our study, although we were able to discern a seasonal pattern on lineage composition, the factors causing this pattern are more difficult to determine unambiguously. one obvious factor that can be involved in the maintenance of different populations across seasons is temperature. as an attempt to examine this hypothesis, we measured maximum growth rates of the most abundant lineages (p. otitidis and p. cuatrocienegasensis) at different temperatures. as expected, p. otitidis grew faster than p. cuatrocienegasensis at high temperatures, but this differential growth was only statistically significant at 40c. this result provides a clue that temperature can be a relevant environmental factor affecting growth and persistence of isolates, the presented growth rate experiments are far from definitive and must be interpreted with caution, as laboratory conditions invariably differ from the environment in multiple ways beyond that being investigated, besides the fact that other environmental parameters that can be associated with temperature changes need to be investigated as well. nonetheless, these experiments give a good perspective of what can be further done to investigate the factors involved in the observed genetic structure associated with seasonality. we consider that detailed investigation of the physiological responses over a wider temperature range, using more lineages and do measurements with competing isolates, is needed to advance knowledge into the causes of the observed genetic structure of the studied populations. another potential explanation for the observed seasonal pattern can be found in the documented transition of certain bacteria into a dormancy state triggered by unfavourable environmental conditions such as oxygen and temperature stress or resource limitation. a recent study by jones and lennon demonstrates that only some taxa of the total bacterial community in various lakes were in an active state, and the rest were in a dormant state triggered by environmental stress. although members of the genus pseudomonas do not form spores, they could enter reversible states of reduced metabolic activity described as viable but nonculturable (vbnc). thus, a dormancy / vbnc state could explain the observed seasonal pattern, without excluding other ecological mechanisms (i.e., adaptation). this possibility is one of the limitations that culture - dependent - techniques can have when characterizing microbial diversity. however, several culture - independent techniques have found similar patterns suggesting that the seasonal shifts and reoccurrences of bacterial populations or microbial functional groups occur in the bacterial aquatic communities and, therefore, are not an artefact of the culture - dependent techniques or microbiological procedures [46, 47 ]. research in ccb aquatic habitats, including other culturable and nonculturable groups, has recently been published or soon to be [12, 38 ] that will contribute to determine the generality of the observations here presented. while we found that lineages or phylotypes (16s rdna sequences) are seasonally recurrent, genotypes (isolate fingerprints) within each lineage are not, leading to a different genotype composition each year. despite that undersampling was verified at the genotype level (rarefaction), correcting for sample size at the lineage level, it still gave evidence of differences between summer and winter samples (figure 4 ; table 1). looking at seasonality on phylotype composition and taking cautiously genotypic composition (fingerprints), we see three possible explanations for our observations : (1) selection associated with seasonality, (2) neutral or stochastic fixation of different genotypes or lineages each season, and (3) artefact due to limited sample size at each sampling date. given the strong association of phylotypes to sampling season, the selection - mediated possibility is favoured over a purely stochastic explanation. the fact that we do not recover identical fingerprint patterns is debatable due to undersampling and can not be interpreted as evidence of selective sweeps, or simple rapid diversification of bacteria after each seasonal change unless more isolates are analyzed. are present in low numbers ; however, this will not necessarily contradict the possibility of seasonal selection acting as an ecological process occurring. we showed that the simultaneous utilization of phylogenetic markers and genomic fingerprinting can be used to characterize diversity changes across seasons, and to formulate hypotheses about the potential mechanisms that structure populations. future experiments that include more phylogenetic groups, larger samples, over extended periods of time, and in controlled laboratory conditions will be necessary to test these hypotheses and further investigate the role of seasonality in the maintenance of lineage (or species) diversity and bacterial diversification in ccb. the results presented here are the first temporal characterization of the biological composition and dynamics of microorganisms at the ccb study site. the strong correlation of seasonality with the lineage composition contributes with information to formulate future experiments that test hypothesis on the mechanisms involved in the origins and maintenance of microbial diversity in the area.	cuatro cienegas basin (ccb) is a biodiversity reservoir within the chihuahuan desert that includes several water systems subject to marked seasonality. while several studies have focused on biodiversity inventories, this is the first study that describes seasonal changes in diversity within the basin. we sampled pseudomonas populations from a seasonally variable water system at four different sampling dates (august 2003, january 2004, january 2005, and august 2005). a total of 70 pseudomonas isolates across seasons were obtained, genotyped by fingerprinting (box - pcr), and taxonomically characterized by 16s rdna sequencing. we found 35 unique genotypes, and two numerically dominant lineages (16s rdna sequences) that made up 64% of the sample : p. cuatrocienegasensis and p. otitidis. we did not recover genotypes across seasons, but lineages reoccurred across seasons ; p. cuatrocienegasensis was isolated exclusively in winter, while p. otitidis was only recovered in summer. we statistically show that taxonomic identity of isolates is not independent of the sampling season, and that winter and summer populations are different. in addition to the genetic description of populations, we show exploratory measures of growth rates at different temperatures, suggesting physiological differences between populations. altogether, the results indicate seasonal changes in diversity of free - living aquatic pseudomonas populations from ccb.
preeclampsia is a potentially serious condition of pregnancy that covers almost 10% of pregnancies in the developing countries. the exact etiology of this disease is still unknown but several pathophysiological mechanisms have been suggested for preeclampsia. these include endothelial dysfunction, inflammatory pathway, oxidative stress, activation of thrombosis, and the renin - angiotensin system. various genetic and environmental factors have been known that contribute in pathogenesis of this disorder. ward and lindheimer reported an incident risk of 20 to 40 percent for daughters of preeclamptic mothers, 11 to 37 percent for sisters of preeclamptic women, and 22 to 47 percent in twin studies for preeclampsia. several studies have tried to demonstrate or refute the role of rennin angiotensin system genes as candidates for the development of preeclampsia. the circulating renin - angiotensin system (ras) is an important pathway that regulates blood pressure and electrolyte balance. in low blood pressure and low circulating sodium chloride, the renin enzyme synthesized by juxtaglomerular cells of the afferent renal arterioles of kidney and released in blood. renin cleaves angiotensinogen, to angiotensin-1 (ang i), a ten - amino - acid peptide. ang i is an inactive peptide but is cleaved by angiotensin - converting enzyme (ace) to the biologically active angiotensin - ii (8 amino acid). the angiotensin converting enzyme (ace ; ec 3.4.15.1) is a dipeptidyl carboxypeptidase that is encoded by the ace gene. ang ii exerts most of its effects via the activation of at1 receptors which are expressed in vascular smooth muscle cells and adrenal glands, among others. therefore we investigated the relationship of two common polymorphisms of the rennin - angiotensin system : intron 16 of the ace gene on chromosome 17 and the a - to - c polymorphism in the 3 untranslated region at nucleotide 1166 of the at2r1 gene on chromosome 3. this cross - sectional study was performed in 125 preeclamptic pregnant women and 132 healthy pregnant women from january 2008 to february 2010. at the time of admission, after written consent a verbal interview was conducted to determine maternal age, gestational age, gravidity, birth weight, family history of preeclampsia, history of preeclampsia in previous pregnancies, and ethnicity. preeclampsia was defined as increased blood pressure (140 mmhg systolic or 90 mmhg diastolic on 2 or more measurements at least 6 h apart) and with significant proteinuria 0.3 g/24 h or +1 on a urine dipstick in a woman after 20 weeks of gestation. blood pressure was taken with the patient in an upright position, after a 10-minute rest period with a mercury sphygmomanometer. the right arm was used for the measurement, and it was placed in a horizontal position at heart level. one hundred thirty seven normotensive pregnant volunteers were randomly recruited from the obstetrics ward of ali - ebne - abitaleb hospital who did not have any evidence of previous medical illness. genomic dna was extracted from peripheral blood leukocytes by dna isolation kit (roche, germany). two oligonucleotide primers, forward : 5-ctg gag agc cac tcc cat cct ttc t-3 and reverse : 5-ggg acg tgg cca tca cat tcg tca g-3 based on the flanking sequences of the insertion / deletion region on the intron 16 of ace gene were used to amplify the corresponding dna fragments by polymerase chain reaction (pcr). the reaction was performed in a 25-l final volume and contained 25 pmol of each primer, 0.1 mmol of each deoxynucleoside triphosphate (fermentas, lithuania), 1 u taq dna polymerase (fermentas, lithuania), 50 mmol / l kcl, 1.5 mmol / l mgcl2, 10 mmol / l tris - hcl (ph = 8.3), and 200 ng of genomic dna according to the protocol as previously described except for the annealing step which was at 60c. the pcr products of two alleles of 490 and 190 bp were electrophoresed in 2% agarose gels and visualized by ethidium bromide staining. due to the d allele in heterozygous samples which are preferably proliferated, every sample demonstrated to have dd genotype depending on a second, independent pcr amplification with a major pair known as an addition which is particular sequence described before. the feedback produced a 335-bp amplicon just in the existence of an i allele and no product in homozygous for dd. for detection of a1166c polymorphism of the angiotensin ii receptor at1, two oligonucleotide primers (forward) 5-aat gct tgt agc caa agt cac ct-3 and (reverse) 5-ggc ttt gct ttg tct tgt tg-3 were used for amplification the corresponding dna fragment by the polymerase chain reaction. the reaction was performed in a 25-l final volume and contained 30 pmol of each primer, 0.1 mmol of each deoxynucleoside triphosphate (fermentas, lithuania), 1 u taq dna polymerase (fermentas, lithuania), 50 mmol / l kcl, 2.5 mmol / l mgcl2, 10 mmol / l tris - hcl (ph = 8.3), and 250 ng of genomic dna according to the following protocol : initial denaturation at 94c for 5 min ; 35 cycles of denaturation at 94c for 30 sec, annealing at 57c for 30 sec, and extension at 72c for 1 min and 30 sec ; and final extension at 72c for 5 min. the 856 pb pcr fragments were digested with dde1 restriction enzyme (fermentas, lithuania) for 16 h at 37c. the wild - type allele (a allele) has one dde1 cleavage site and digested to 600 and 256 bp fragments, whereas the mutant allele (c allele) has two dde1 cleavage site and 256 bp fragment is cleaved to 146 and 110 bp fragments too. digested samples were separated by electrophoresis on a 2% agarose gel and visualized by ethidium bromide staining. the differences between groups were examined by test or an independent student 's t - test whenever appropriate. the frequencies of the alleles and genotypes were compared between patients and control groups by the test when appropriate. the odds ratio (or) and 95% confidence intervals (ci) were also estimated. the test was used for deviation of genotype distribution from hardy - weinberg equilibrium. logistic regression analysis was employed to determine the relations of gene polymorphisms and other risk factors with preeclampsia. for the case control study, 125 preeclamptic women and 132 healthy pregnant women were enrolled the clinical and biochemical parameters of the controls and preeclamptic subjects are shown in table 1. there was no significant difference between two groups for maternal age and family history of preeclampsia. as expected gestational age was significantly lower and systolic and diastolic blood pressure, primiparity, and history of preeclampsia were significantly higher in preeclamptic women. although birth weight was lower in preeclamptic women, the difference was not significant. the frequencies of ethnic groups (persian, balooch, and afghan) were significantly different between preeclamptic women and controls (p = 0.03) and the risk of preeclampsia was twofold in afghan women in contrast to persian and balooch women (or, 2 [95% ci, 1.1 to 3.8 ] ; p = 0.01). among the preeclamptic women, 20% had early onset preeclampsia and 80% had late onset preeclampsia, also the frequency of severe and mild preeclampsia was 76% and 24%, respectively. allele frequencies of i / d polymorphism of ace and a1166c polymorphism of angiotensin ii type-1 receptor polymorphism were in hardy weinberg equilibrium in preeclampsia group however control subjects are in hardy - weinberg disequilibrium for both polymorphisms (p = 0.004 and p = 0.02, resp.). the distribution of genotype and allele frequencies of i / d polymorphism of angiotensin - converting enzyme and a1166c polymorphism of angiotensin ii type-1 receptor (at1r) gene were compared between preeclamptic patients and controls (table 2). the frequencies of ii, i d, and dd genotypes were 14.5, 51.5, and 34 percent in preeclamptic patients and 35, 37, and 38 in healthy pregnant women, respectively. the risk of preeclampsia was 3.2-fold in pregnant women with d allele (id+dd) in contrast to control women without d allele (or, 3.2 [95% ci, 1.1 to 3.8 ] ; p = 0.01). the genotype frequencies for the control and preeclamptic women being 87, 12, and 1% and 89, 9, and 2% for the aa, ac, and cc genotypes, respectively. only three subjects with the cc genotype were identified : two control subject and one subject with preeclampsia. the c allele frequencies of the at1r gene were 0.07 and 0.06 in control subjects and preeclamptic women, respectively. we did not find any correlation between ace and at1r gene polymorphisms and the onset and severity of preeclampsia. also we did not observe any differences in ace and at1r gene polymorphisms in different races too. there were no significant difference in blood pressure levels (sbp and dbp) between the subjects with the different genotypes of ace i / d polymorphism. multiple regression analysis, revealed that afghan race, history of preeclampsia, gravity, and presence of d allele were independent risk factors of preeclampsia (table 3). preeclampsia is a multifactorial disorder that results from the interaction of multiple environmental and genetic factors. the precise cause of preeclampsia has not been determined but numerous and extensive analysis in animal models and human studies have been performed to find the relation of environmental and genetic factors with this disorder. several studies identified various candidate genes involved in high blood pressure of pregnancy and preeclampsia. special attention has been paid to study on genes of the rennin - angiotensin system (ras) because the synthesis of angiotensin ii. angiotensin converting enzyme converts inactive angiotensin i to vasoactive angiotensin ii, therefore this enzyme is an important member of ras and plays a key role in blood pressure regulation and electrolyte balance. plasma ace activity has been associated with the insertion / deletion (i / d) polymorphism in intron 16 of the ace gene. there is evidence that dd genotype is associated with higher plasma ace levels, whereas ii genotype is associated with lower ace levels and i d genotype with middle levels. the reason for the higher ace activity in the d allele has assumed that the i allele has a sequence like to a silencer sequence. therefore we investigated the relationship of preeclampsia to two common polymorphisms of the rennin - angiotensin system : intron 16 i / d polymorphism of the ace gene on chromosome 17 and the a - to - c polymorphism in the 3-untranslated region at nucleotide 1166 of the at2r1 gene on chromosome 3 [9, 14 ]. in the present study we found that the ace gene i / d genotype and allele frequencies were different between two groups and d and in women with d allele (di+dd), the risk of preeclampsia was 3.2-fold (or, 3.2 [95% ci, 1.7 to 5.9 ] ; p = 0.0001). the results of our study are consistent with some but not all previous studies of ace i / d polymorphism and preeclampsia in other countries. zhu. and zhou. in two different studies reported the association of ace i / d polymorphism and preeclampsia in chinese women and grdl. and choi. reported the association of ace genotypes with preeclampsia in turkey and korea too [13, 1517 ]. found that ace gene i / d polymorphism were associated with the severe proteinuria and renal dysfunction seen in preeclampsia and preeclamptic patients carrying the d allele may be susceptible to renal dysfunction in china. showed a significant association between d allele frequency and risk of recurrent preeclampsia and preterm delivery before 34 weeks of pregnancy in croatia. reported that, the distribution of ace genotypes was different in preeclamptic women and controls in italy. they confirmed this result in mild preeclampsia, whereas no significance was found in severe preeclampsia. they suggest that different factors may lead to mild and severe preeclampsia and ace polymorphism playing a more important role in the mild form. also velloso. suggested that the ace dd genotype may be used as a marker for susceptibility to preeclampsia in brazil, whereas benedetto. revealed that the synergic effect of ace i / d and other polymorphisms of renin - angiotensin system and enos may be a risk factor for preeclampsia. in contrast several studies in different countries did not support the hypothesis about the association between ace i / d polymorphism and preeclampsia. kobashi. in japan showed no association between angiotensin - converting enzyme polymorphism and preeclampsia. revealed a null association between the ace - i / d variant and preeclampsia risk in colombia too. in a recent study aggarwal. did not find any association between ace gene polymorphism and hypertensive disorders of pregnancy in north india. medica. performed a systematic research on 10 case - control studies about intron 16 i / d polymorphism of ace gene - containing 1121 patients and 1361 controls. when they compared homozygous carriers of d variant plus i d heterozygotes (dd+id) versus homozygous carriers of i variant (ii), the odds ratio was 1.11 (95% ci ;.91, 1.36). whereas when they compared homozygous d variant carriers (d / d) versus heterozygous plus homozygous i variant (i d + ii) individuals (recessive model), the odds ratio was or 1.51 (95% ci 1.17, 1.94) ; therefore they reported that single ace i / d polymorphism did not have a major effect on preeclampsia, but statistical significance was demonstrated when the polymorphism was considered under the recessive model. the results of present study showed the relation of this polymorphism with preeclampsia in dominant model. this discrepancy in different studies is common and is due to different races, study volume, preeclampsia criteria, and other factors, however considering meta analysis study, it is more probable that the small study volume is the most important reason of this discrepancy. in this study, we found no evidence of association between the polymorphic variants, the at2r1 gene, and preeclampsia. the c allele frequency of the at1r gene was 0.06 and 0.07 in control subjects and preeclamptic women, respectively. li. reported that the frequency of genotypes of the at1r gene was similar in preeclampsia and normal pregnancy. but hu. reported that the frequency of variants (ac, cc) of a1166c polymorphism of at1r gene in pregnancy - induced hypertension (pih) (20.5%) was significantly higher than that of control subjects (7.4%). revealed that presence of a1166c polymorphism is a risk factor for the development of pih too. in an other study bouba. found that the women with preeclampsia and tt genotype of angiotensinogen had more frequently the dd genotype of ace or the 1166c allele of at1r than the control group and reported a significant interaction between the genes. we also did not find any significant difference in rare allele 's frequency of polymorphisms between three ethnic groups (persian, balooch, and afghan), but we observed high prevalence of preeclampsia in afghan women (or = 2 95% ci : 1.13.8). because ethnicity have an important role in association studies, further studies with large samples must be done especially on afghan pregnant women in these polymorphisms and other gene polymorphisms too. in conclusion, we observed the association between i / d polymorphism of ace gene and preeclampsia, but no relation was found between a1166c polymorphism of at1r gene and preeclampsia. we found that afghan race, history of preeclampsia ; gravity and presence of d allele were independent risk factors of preeclampsia.	some evidence suggests that a variety of genetic factors contributed in pathogenesis of the preeclampsia. the aim of this study was to assess the association between the angiotensin - converting enzyme (ace) i / d and angiotensin ii type1 receptor a1166c polymorphisms with preeclampsia. this study was performed in 125 preeclamptic pregnant women and 132 controls. the i / d polymorphism of the ace gene was assessed by polymerase chain reaction and the a1166c polymorphism of the at1r gene was determined by restriction fragment length polymorphism. the genotype and allele frequencies of i / d polymorphism differed between two groups. the risk of preeclampsia was 3.2-fold in pregnant women with d allele (or, 3.2 [95% ci, 1.1 to 3.8 ] ; p = 0.01). the distribution of the at1r gene a1166c polymorphism was similar in affected and control groups. our results supported that presence of the i / d polymorphism of ace gene is a marker for the increased risk of preeclampsia.
the epidemiology and diagnostic aspects of tuberculous lymphadenitis differ according to geographic region and the burden of tb and hiv infection. globally however, the rate is not similar across all who regions. in the africa region tuberculous lymphadenitis (or tuberculous adenitis) is a chronic specific granulomatous inflammation of the lymph node with caseation necrosis, caused by infection with mycobacterium tuberculosis or mycobacterium bovis [5, 6 ]. poverty levels are high with a gross national income per capita of less than two thousand dollars. the country has a high burden of tuberculosis (tb) with an estimated 50,000 incident cases during 2009, when the estimated prevalence was 209 cases per 100,000 of the population. the estimated adult hiv prevalence of 1.5% remains lower than that of its african neighbours to the south and a report from 2002 suggested 4% of tuberculosis patients were coinfected with hiv. however, there is a lack of studies screened tuberculous lymphadenitis reported from sudan, in general and kordofan state in particular ; thus, one of the aims of the present study was to find out the incidence of tuberculous lymphadenitis in kordofan state. amyloidosis is a disease characterized by an extracellular deposition of the fibrous protein either involving multiple organ systems (systemic amyloidosis) or restricted to a single - tissue site (localized amyloidosis) [9, 10 ]. the disease nomenclature is based on the precursors of the amyloid fibrils for which at least 28 different proteins have been identified [1113 ]. the diagnosis of amyloidosis is based on the demonstration of amyloid fibrils in a tissue biopsy. in al amyloidosis, the presence of a monoclonal immunoglobulin can usually be demonstrated in serum or urine samples. the symptoms of amyloidosis arise in the critical organs where amyloid accumulates, including the heart, kidney, liver, and peripheral nerves. staining of tissue with congo red shows the characteristic red staining of amyloid in normal light but apple green birefringence under polarized light microscopy, which remains the gold standard for diagnosis. later electron microscopy demonstrated that amyloid was a fibrous protein with a unique cross pattern on x - ray diffraction [16, 17 ]. the amyloidoses are thus a heterogeneous group of disorders related by the deposition of proteins that share a remarkably similar and stable core structure of sheets. therefore, in the present study we screened biopsies obtained from patients with lymphadenopathy for the presence of amyloid materials using congo red histochemical method. this is a retrospective study to screen patients with enlarged ln for the presence of amyloid materials and mycobacterium tuberculosis. the study was conducted in el - obied, sudan, during the period from 2010 to 2011. one hundred and three ln biopsies were retrieved from previously referred ln biopsies (during the period from 2008 to 2011), for histopathology. the specimens were fixed in 10% formalin and then processed by tissue processing machine using a schedule adopting 24-hour scheduling. of the 3 sections, each one was stained with haematoxylin and eosin procedure (h&e), the second with zeil - neilson (zn), and the third with congo red. those showing histopathological pattern containing giant cells + granuloma + caseation were considered as strong evidence for diagnosis of tb lymphadenitis. the study was submitted and approved by the department research board of faculty of medicine and medical science, university of kordofan, el - obied, sudan, and histopathology laboratory at el - obied regional laboratory. for all statistical analyses, the spss (version 10) was used. in this study 103 samples obtained from patients with enlarged lns were retrospectively investigated for the presence of tuberculosis and amyloidosis. their ages ranged from 13 to 65 years with a mean age of 33 years old. of the 103 patients, tuberculosis was diagnosed in 35/103 (34%). out of the 35 positive cases, 16/35 (45.7%) were males and 19/35 (54.3%) were females. according to histopathological diagnosis, the great majority of tuberculosis cases were diagnosed as having caseous necrosis representing 29/35 (82.5%), followed by fibrosis, follicular hyperplasia, and sinus hyperplasia, constituting 2/35 (5.7%) for each, as indicated in figure 1. in regard to age, most positive cases were identified among age range 3140 years constituting 13/35 followed by 2030, 4150, < 20, and 50 +, representing, 11, 6, 3, and 2, respectively, as indicated in figure 2. out of the 103 patients, amyloidosis was diagnosed in 9/103 (8.7%). out of the 9 positive cases, 2/9 (22.2%) were males and 7/9 (77.8%) were females. according to histopathological diagnosis, the great majority of amyloidosis cases were diagnosed as having caseous necrosis representing 5/9 (55.5%), followed by fibrosis, sinus hyperplasia, and lymphoma, constituting 2/9 (22.2%), 1/9 (11.1%), and (11.1%), respectively, as indicated in figure 1. notably, the 5 positive caseous necrosis cases were also found positive for tuberculosis. in regard to age, most positive cases were identified among age range 2130 years constituting 4/9 followed by 3140, 4150, < 20, and 50 +, representing, 3, 1, 1, and 0, respectively, as indicated in figure 2. tuberculosis (tb) is one of the most common causes of mortality from an infectious disease, and it represents alarming challenges to global health. extrapulmonary tb is a major health problem, since it is difficult to diagnose and to monitor its treatment. the highest proportion was reported from cambodia (34.2%) and the lowest from china (0.69%). what is more is that the extra pulmonary tb is established in 1034% of non - hiv cases, whereas it occurs in 5070% of patients coinfected with hiv. in this study the diagnosis of tb lymphadenitis was established when histopathological section from the biopsy showed characteristics of tb or positive zn stain. in fact this measurement suffers from misdiagnosis with other inflammatory conditions that may give similar histopathological picture. although zeil - neelsen (zn) stain and even fluorescence have low sensitivity, their combined use may confirm the diagnosis of tb lymphadenitis when the molecular diagnosis is unaffordable or non - available. however, most available data regarding tb is referring to pulmonary tb and there is a lack of data regarding prevalence of tb lymphadenitis from sudan. the prevalence of tb in sudan was 209 cases per 100,000 of the population and 50,000 incident cases during 2009. the estimated adult hiv prevalence of 1.5% remains lower than that of its african neighbors to the south and a report from 2002 suggested 4% of tuberculosis patients were coinfected with hiv. in a study from sudan to determine whether mycobacterium tuberculosis infection spreads through the blood to different lymph - node groups in patients with tuberculous lymphadenitis, the presence of m. tuberculosis dna correlated strongly to multiple lymph - node involvement [or (odds ratio) = 96.7, 95% confidence interval (ci) 9.01,039 ] and to caseating - granulomatous and predominantly necrotic cytomorphological categories [or = 70, 95% confidence interval (ci) 7.0703 ]. of the 52 enrolled patients, 30/52 (57.7%) were with fnac diagnosis of tuberculous lymphadenitis and positive pcr for m. tuberculosis complex, it is higher than the incidence of tb lymphadenitis as reported in the present study. 57 patients biopsies were taken and stained by h and e. about 94.6% of the cytology shows positive result for tb. studied females were more than males (m : f = 1 : 1.2), which was similar to our findings. however, incidence of tb lymphadenitis in el - obied is high. implementation of tb control programs in poor and limited resources regions like el - obied is highly recommended. amyloidosis is a heterogeneous disease caused by deposition of amyloid fibrils in organs progressively replacing their original cells. what is worse is that no any incidence data are available and most survival data are limited to specialist clinics. there are limited data on the incidence of amyloidosis probably because of the rarity and heterogeneity of the condition. the widely global exchanged studies were those reports by kyle and coworkers ; they found that the incidence for al amyloidosis in united states was 9 per million person - years. another larger study included amyloidosis cases for years 2001 to 2008, a total of 949 patients were identified, giving an incidence of 8.29 per million person - years. however, there is a complete absence of data regarding amyloidosis from sudan, and this might be the first report in this context. the present study helps to fill in the gap of data regarding the incidence of amyloidosis. the advantages include generally awareness in a country of limited access to medical services of low diagnostic standards a recent study has shown that the incidence of amyloidosis in sub - saharan africa ranges from 0.28 to 0.57% in autopsy series. al amyloidosis is found in 21 to 34% of amyloidosis cases, half of them due to myeloma. one of the major limitations in this study was the use of congo red only in identification of amyloid materials, which does not identify the different types. the use of immunohistochemistry for the positive cases might be useful, since it can provide some information about the dominant amyloid type. to the best of our knowledge, this is the first report about amyloidosis from sudan. however, the relationship between amyloidosis and tuberculosis was well established [26, 27 ]. amyloidosis (aa) can occur secondary to several infectious, inflammatory, and malignant conditions and is caused by the degradation of the acute - phase protein that is produced in response to inflammatory conditions [28, 29 ]. common causative infections include tb, bronchiectasis, osteomyelitis, and leprosy [30, 31 ]. further studies will allow a better assessment of the characteristics of amyloidosis in sudan in general and el - obied in particular.	objectives. to determine the incidence of tuberculous lymphadenitis and amyloidosis in enlarged lymph nodes (ln). methodology. a retrospective study was carried out in the department of pathology at the faculty of medicine, university of kordofan, during one - year period. the study included a group of 103 patients with lymphadenopathy. results. of the 103 cases with enlarged neck nodes, 35 (34%) had tuberculous lymphadenitis. sixteen (46%) cases were males and 19 (54%) cases were females. out of the 103 patients, amyloidosis was diagnosed in 9/103 (8.7%). out of the 9 positive cases, 2/9 (22.2%) were males and 7/9 (77.8%) were females. conclusion. there is high incidence of tuberculous lymphadenitis in patients with enlarged ln in developing countries like north sudan. amyloidosis should not be ignored when investigating enlarged ln.
tropical parasitic diseases result in > 1 million deaths annually (who, 2008). the lack of vaccines and safe and efficacious drugs that are not hampered by parasite drug resistance is driving the search for new therapies. targeting regulatory processes essential for parasite growth and development, such as protein acetylation (andrews., 2012a, 2012b ; kelly., 2012) and methylation (malmquist., 2012 ; sundriyal., 2014), represents a promising starting point for identifying new anti - parasitic drugs. this strategy has been used successfully for other diseases, such as certain types of cancer, where inhibitors that target lysine deacetylase enzymes (histone deacetylase (hdac) inhibitors) have been approved for clinical use (grant. hdac inhibitors are also under investigation for parasitic diseases such as malaria, trypanosomiasis, schistosomiasis and leishmaniasis (murray., 2001 ; ingram and horn, 2002 ; mai., 2009 ; dubois., 2009 ; patil., 2010 ; wang., 2010 ; alonso and serra, 2012 ; andrews. hdac inhibitors target eukaryotic hdac enzymes which work together with histone acetyltransferases (hats) to reversibly modify the acetylation state of histone and non - histone proteins (khan and la thangue, 2012). as a consequence, these enzymes regulate chromatin structure and gene expression (de ruijter., 2003) and other important cellular processes such as cell cycle regulation and apoptosis (khan and la thangue, 2012). in human cells, 18 hdacs have been identified (reviewed in (mariadason, 2008)) and classified according to their co - factor dependency on either zinc or nad and sequence homology to yeast proteins (reviewed in (xu., 2007)). in plasmodium falciparum, five hdac encoding genes have been annotated (plasmodb gene ids : pf3d7_0925700 (pfhdac1), pf3d7_345 1472200 (pfhdac2), pf3d7_1008000 (pfhdac3 ; pfhda2 (coleman., 2014)), pf3d7_1328800 (pfsir2a), and pf3d7_1451400 (pfsir2b) (aurrecoechea., 2009)). three of the proteins / predicted proteins encoded by these genes have homology to class i (pfhdac1) and ii (pfhdac2 and 3) mammalian hdacs, while the remaining two are class iii hdacs, or silent information regulator 2 (sir2) proteins. pfsir2a and b are not essential to the growth and development of asexual intraerythrocytic p. falciparum parasites (freitas - junior. while less is known about the class i / ii hdac homologues, knock - down of pfhdac3 (pfhda2) inhibits asexual - stage growth and development (coleman., 2014). in t. b. brucei, four putative class i / ii hdac orthologues (tbdac 14) have been identified, with tbdac1 and 3 being essential in bloodstream forms of the parasite (ingram and horn, 2002). the crucial role these enzymes play in modulating the acetylation state of histone proteins and gene expression (xu., 2007) several experimental hdac inhibitors have shown promising activity in vitro (50% inhibitory concentrations (ic50) 0.010.3 m) and in vivo against plasmodium parasites, with some showing high selectivity for the parasite versus mammalian cells (reviewed in (andrews., 2012b)). in contrast, only limited literature is available in regards to hdac inhibitor activity against trypanosomes, with all compounds examined to date appearing non - selective (ingram and horn, 2002 ; sheader., 2004 ; wang., 2010 ; alonso and serra, 2012 ; kelly., 2012 ; carrillo., 2015). in this study we adopted a piggyback approach (nwaka and hudson, 2006) to extend these findings, focussing on four hdac inhibitors (fig. vorinostat (saha ; sigma aldrich, usa), romidepsin (fk228 ; selleck chemicals, usa), and belinostat (beleodaq ; spectrum pharmaceuticals, inc., usa) have been approved for the clinical treatment of cutaneous or peripheral t - cell lymphoma (grant., 2007 ; prince and dickinson, 2012 ; thompson, 2014) and are undergoing clinical trials for various other cancers, including prostate and epithelial ovarian cancers (garcia - manero., 2008 ; modesitt., 2008 ; molife., 2010 ; coiffier., vorinostat and belinostat are hydroxamate - based pan - inhibitors of class i and ii mammalian hdacs (grant., 2007 ; steele., 2011), while romidepsin is a cyclic tetrapeptide pro - drug (sandor., 2002 ; byrd., 2005) and has some hdac isoenzyme - selectivity for class i mammalian hdacs (prince and dickinson, 2012). panobinostat (lbh-589 ; selleck chemicals, usa) is a hydroxamate - based pan - hdac inhibitor that acts on class i, ii and iv hdacs (prince., 2009). panobinostat has recently been approved for combination therapy use in certain patients with multiple myeloma (garnock - jones, 2015) and is also being investigated for acute lymphocytic leukaemia and prostate cancer (giles., 2006 ; rathkopf., 2010). while vorinostat and panobinostat have previously been shown to inhibit the in vitro growth of p. falciparum (ic50 150 nm and 20 nm, respectively (patel., 2009)), romidepsin and belinostat have not previously been examined for anti - malarial activity. panobinostat and belinostat have been shown to inhibit t. b. brucei growth (ic50 1.6 m and 2.2 m, respectively (carrillo., 2015)), however the activity of vorinostat and romidepsin have not been reported against this parasite species. to compare the in vitro anti - proliferative activities of these compounds against plasmodium and trypanosoma parasites and to begin to determine whether they have differential effects in parasites, we also profiled them for their effect on p. falciparum deacetylase inhibition and in situ hyperacetylation. suberoylanilide hydroxamic acid (saha ; sigma aldrich, usa) and chloroquine (chloroquine diphosphate salt ; sigma aldrich, usa) were prepared as 10 mm stock solutions in 100% dmso. belinostat (pxd101), romidepsin (fk228) and panobinostat (lbh589) were purchased from selleck chemicals and prepared as 20 mm stock solutions in 100% dmso. pentamidine, diminazene aceturate and puromycin were all purchased from sigma aldrich and 0.16, 9.7 and 9.2 mm stock solutions prepared in 100% dmso. 1988) parasites were cultured in vitro with o + human erythrocytes in rpmi 1640 (life technologies) containing 10% heat inactivated human serum and 50 mg / l hypoxanthine. parasites were cultured at 37 c in 5% o2 and 5% co2 in n2.in vitro growth inhibition assays were assessed using the [h ] hypoxanthine incorporation method, essentially as previously described (andrews., 2008). briefly, synchronous ring - stage p. falciparum parasitized erythrocytes (0.25% parasitemia and 2.5% haematocrit) were incubated in 96-well plates with serial dilutions of test compounds or controls (concentrations starting from 0.5 to 2.5 m) for 48 h at 37 c in parasite gas mixture (5% o2, 5% co2, and 90% n2). following addition of [h ] hypoxanthine (0.5 ci / well) plates were incubated as above for a further 24 h. assays were stopped by freezing at 20 c. [h]-hypoxanthine incorporation was determined by harvesting cells onto glass fibre filter mats and counting using a perkin elmer / wallac trilux 1450 microbeta scintillation counter. percent inhibition of growth was compared to vehicle controls (0.5% dmso) and 50% inhibitory concentrations calculated using linear interpolation of inhibition curves. assays were carried out in triplicate wells, on three separate occasions with data presented as mean ic50 (standard deviation [sd ]). chloroquine and vorinostat were used in each assay as positive controls and an unpaired two - tailed t test was used for statistical analysis of differences in ic50s. t. b. brucei 427 bloodstream trypanosomes were cultured in vitro at 37 c in 5% co2 with hm1 - 9 medium supplemented with 10% foetal bovine serum (fbs ; thermo scientific). compound activity was assessed using an alamar blue viability assay, as previously described (sykes and avery, 2009). briefly, logarithmic phase t. b. brucei parasites (1200 cells / ml) were added to 384-well microtitre plates and incubated for 24 h at 37 c in 5% co2. parasites were subsequently exposed to serial dilutions of test compounds at concentrations ranging from 20.84 to 0.021 m. following incubation for 48 h at 37 c in 5% co2, 10 l of 0.49 mm resazurin (sigma aldrich, usa) prepared in hmi-9 media + 10% fcs was added to assay plates and incubated for a further 2 h at 37 c in 5% co2 followed by 22 h at room temperature. assay plates were read at 535 nm excitation/590 nm emission on an envision multiplate reader (perkinelmer, usa). t. b. brucei, the cause causative agent of trypanosomiasis in cattle, closely resembles human infective trypanosoma species and was used as a model for these studies. neonatal foreskin fibroblast (nff) cells were cultured in rpmi 1640 media supplemented with 10% foetal calf serum and 1% penicillin / streptomycin (life technologies, usa). cells were seeded into 96 well plates (3000/well) and incubated for 24 h at 37 c in 5% co2. cells were then treated with compounds in a 2-fold dilution series with starting drug concentrations ranging from 200 m to 10 nm. after 72 h drug exposure media was removed and plates were washed with pbs, 50 l of 0.4% sulforhodamine b (sigma aldrich, usa) was added for 1 h prior to washing 3 times with 1% acetic acid. after tapping dry 100 l 10 mm tris base (unbuffered, ph > 9) assay results were read at = 564 nm in a synergy 2 plate reader (biotek). chloroquine and vorinostat were used in each assay as positive controls and an unpaired two - tailed t test was used for statistical analysis. hek293 cells were cultured in vitro in dmem medium supplemented with 10% fbs (life technologies) at 37 c in 5% co2. cells (72,727 cells / ml) were seeded in 384-well microtitre plates and incubated for 24 h at 37 c in 5% co2 before being exposed to serial dilutions of test compounds at concentrations ranging from 41.68 to 0.021 m for 48 h at 37 c in 5% co2. following drug exposure, 10 l of 0.49 mm resazurin (sigma aldrich) prepared in dmem media + 10% fcs was added to assay plates and incubated for 5 h at 37 c in 5% co2 and then for 19 h at room temperature. assay plates were read at = 535 nm excitation/590 nm emission on an envision multiplate reader (perkinelmer, usa). puromycin was included in each assay as a positive control and an unpaired two - tailed t test was used for statistical analysis. synchronous trophozoite - stage 3d7 parasites (35% parasitemia, 5% haematocrit) were incubated with 3 ic50 concentrations of test compounds or controls for 3 h in a six - well plate. controls included vehicle only (0.05% dmso), chloroquine as a negative control and vorinostat as a positive hdac inhibitor control. following centrifugation, parasite pellets were washed extensively with 1 pbs to remove haemoglobin and the washed pellets resuspended in 1 sds - page loading dye. following heat denaturation at 94 c, proteins were analysed by sds - page and western blot. proteins were transferred to pvdf membrane and western blotting carried out using odyssey blocking buffer (li - cor biosciences) according to the manufacturer 's instructions. anti - tetra - acetyl histone h4 (1:2000 dilution), anti - acetyl histone h3 lysine 9 (1:1000 dilution) and anti - acetyl histone h3 n - terminus (1:500 dilution) primary antibodies (millipore) were used with irdye 680 goat anti - rabbit secondary antibody (1:10,000 dilution) (li - cor biosciences). anti - rap2 (1:1000 dilution) primary antibody was used with irdye 800cw goat anti - mouse secondary antibody (1:10,000 dilution) (li - cor biosciences) as a loading control. anti-(pan) acetyl lysine (k103) monoclonal antibody (1:1000 dilution) (cell signalling technology) was used with irdye 800cw goat anti - mouse secondary antibody (li - cor biosciences). all primary antibodies were incubated with the pvdf membranes overnight at 4 c, followed by secondary antibody incubation at room temperature for 45 min. membranes were imaged using odyssey classic (li - cor biosciences). following analysis with the first antibody, pvdf membranes were stripped at room temperature for 1 h in 25 mm glycine, 1% sds, ph 2. complete stripping was confirmed by imaging on an odyssey classic (li - cor biosciences). membranes were then re - probed with anti - rap2 primary antibody as a loading control, with analysis as above. each sample was normalised to its respective rap2 loading control probed and detected on the same membrane, and results expressed as the fold change in relative density compared to the dmso vehicle control (with the control set to one). nuclear extracts were prepared from trophozoite stage p. falciparum 3d7 parasites using a nuclear protein extraction kit (merck millipore), according to the manufacturer 's instructions. nuclear extracts, and recombinant pfhdac1 (sigma aldrich) were assessed in deacetylase activity assays. nuclear extracts (0.3 mg / ml) were incubated with different concentrations (5000.05 nm) of vorinostat, belinostat, panobinostat, romidepsin or trichostatin a (tsa ; as an hdac inhibitor control) in 96-well plates. for the pfhdac1 deacetylase assays, pfhdac1 (32 ng / ml) was incubated with 1 m vorinostat, belinostat, panobinostat, romidepsin, tsa or vehicle only (0.5% dmso) in 96-well plates. ac - rgk(ac)-amc fluorogenic peptide substrate (r&d systems) was added to each well and samples incubated at 37 c for 1 h. activator solution was then added, and samples incubated at room temperature for a further 10 min. plates were then read in a synergy 2 plate reader (biotek ; excitation : 350380 nm, emission : 440460 nm) within 60 min. hela nuclear extracts (266.6 g / ml) incubated with and without 1 m tsa served as an assay control. three independent assays were carried out for the 3d7 nuclear extract deacetylase assay and results are expressed as mean percent inhibition (standard error of the mean [sem ]). 50% inhibitory concentrations were calculated using linear interpolation of inhibition curves with data presented as mean ic50 (sd). two independent assays, each in duplicate, were carried out for the pfhdac1 deacetylase assay with results expressed as percent inhibition of pfhdac1 enzymatic activity (sd) compared to dmso vehicle controls. the in vitro activity of hdac inhibitors was assessed against two protozoan parasite species ; drug sensitive (3d7) and drug resistant (dd2) asexual p. falciparum parasites and bloodstream form t. b. brucei 427 parasites. romidepsin and belinostat displayed nanomolar range activity against 3d7 and dd2 p. falciparum lines (table 1 ; ic50 0.05) and significantly lower for belinostat versus vorinostat (p = 0.01). the ic50 's of these compounds were, however, significantly higher than those of panobinostat (p 1.3-fold increase in acetylation signal compared to the control (calculated as relative density, normalised to a loading control present on the same membrane), with romidepsin showing the greatest effect on acetylation detected using the anti-(tetra) acetyl h4 antibody (2.4-fold increase compared to control ; fig. in contrast, hyperacetylation was observed for all hdac inhibitors using an antibody that recognises acetylation of the histone h3 lysine 9 residue (fig. this antibody also appears to have some cross - reactivity, likely with another histone form. vorinostat and romidepsin caused a 56 -fold increase in the hyperacetylation using anti - histone h3 lysine 9 antibody as compared with the vehicle control. in addition, all hdac inhibitors, except panobinostat, caused hyperacetylation using an antibody that recognises h3 n - terminal acetylation (fig. vorinostat caused a 6-fold increase in acetylation using anti - n - terminal h3 antibody compared to the vehicle control. all hdac inhibitors also caused hyperacetylation of a non - histone protein of 8090 kda detected using an antibody that recognises pan - acetyl lysine residues, giving a 1227 -fold increase in relative density compared to the control (fig. together these data indicate that all four hdac inhibitors hyperacetylate both histone and non - histone proteins in p. falciparum, although there do appear to be differences in the levels of acetylation observed for different histones. to confirm that these hdac inhibitors target p. falciparum hdac activity, their capacity to inhibit deacetylase activity of p. falciparum nuclear extracts and recombinant pfhdac1 was assessed utilizing ac - rgk(ac)-amc fluorogenic peptide substrate (r&d systems ; fig. 4 and table 2). all hdac inhibitors, including the hydroxamate hdac inhibitor assay control tsa, inhibited deacetylase activity of parasite nuclear extracts and recombinant pfhdac1. the calculated ic50 of tsa, panobinostat and romidepsin was 10-fold selectivity for gametocytes compared to the mammalian cell line hepg2 (sun., 2014). together with data presented here, this suggests that these two compounds can target both asexual and gametocyte intraerythrocytic stage parasites. this also supports our own recent finding that vorinostat and tsa target early (ic50 1.41 m and 0.09 m, respectively) and late (ic50 0.81 m and 0.07 m, respectively) stage gametocytes (trenholme., 2014). combined with studies showing that exoerythrocytic (liver stage) plasmodium parasites are also sensitive to certain hdac inhibitors (sumanadasa., 2012 ; hansen., 2014b), these data indicate that hdac inhibitors are a promising class of compounds with broad - stage anti - plasmodial activity. like the control hdac inhibitor vorinostat (si = 2746 ; table 1), belinostat and panobinostat were found to have modest selectivity for p. falciparum compared with the mammalian cell lines examined (si = 1140 and 218, respectively ; table 1). in comparison to the control antimalarial drug chloroquine (si 6124839 : table 1) this level of selectivity is low, comparable to an early stage drug - lead. although we are not proposing that these anti - cancer hdac inhibitors be used for malaria therapy per se, it is interesting to note that the activity of the compounds was within or below the clinically relevant range (fig. 2). this is promising in terms of future development of more potent and parasite - selective compounds that may have improved pharmacokinetic profiles suited to malaria therapy. thus the piggyback approach has had value here in providing new clues to hdac inhibitor drug development for malaria based on existing hdac - targeting anti - cancer drugs. in contrast to the findings for p. falciparum, romidepsin, the only cyclic tetrapeptide examined in this study, was also the only hdac inhibitor with sub - micromolar activity against t. b. brucei bloodstream parasite forms (ic50 0.035 m ; table 1). unfortunately, this compound exhibited no parasite - specific selectivity (si = < 1 ; table 1). belinostat, panobinostat and vorinostat were also found to be non - selective for t. b. brucei parasites when compared with activity against normal mammalian cells (table 1). while other studies examining the activity and selectivity of hdac inhibitors against trypanosoma parasites are limited, they are generally in line with data from the present study with compounds tested to date all having poor selectivity for this parasite species. the cyclic tetrapeptide hdac inhibitor apicidin has previously been shown to have poor and non - selective activity against trypanosoma brucei parasites (murray., 2001), a lack of selectivity also being observed for p. falciparum (darkin - rattray., 1996). the only other hdac inhibitors tested to date, experimental hydroxamate - derived compounds with sub-m activity against bloodstream t. b. brucei 427 also inhibited hdacs in mammalian cells (hela) with similar potency, although comments on whole cell selectivity can not be made as normal mammalian cell proliferation was not investigated (kelly., 2012). in addition to investigating the growth inhibitory activity of hdac inhibitors against p. falciparum, in this study we also profiled their action on the parasite using three different approaches examination of in situ hyperacetylation changes in response to compound exposure (fig. 3), inhibition of p. falciparum nuclear protein lysates, and inhibition of recombinant pfhdac1 (table 2). these studies were not conducted with trypanosoma parasites because, unlike p. falciparum which contains canonical histones that are highly conserved with those of other eukaryotes (as well as four variants ; (miao., 2006)), t. brucei histones are divergent, in particular at their posttranslationally modified n - termini (strahl and allis, 2000 ; alsford and horn, 2004 ; mandava., 2007). this means that commercial acetyl lysine antibodies, which cross - react with p. falciparum canonical histones, can not be used for t. brucei. in in situ hyperacetylation assays with p. falciparum parasites, belinostat, panobinostat and romidepsin were shown to hyperacetylate both histone and non - histone proteins, consistent with previous data for other hdac inhibitors including vorinostat and sb939 (sumanadasa., 2012 ; hansen., 2014a). all four hdac inhibitors caused hyperacetylation of a 80 kda protein when probed with an antibody that is pan - reactive for acetylated lysines. we have previously shown that this protein is hyperacetylated by saha, sb939 and other hydroxamates (sumanadasa., 2012). although not yet identified, the protein may be p. falciparum heat shock protein 90 (pfhsp90) based on data showing that this protein is detected in parasite lysate complexes treated with tsa and probed with the same antibody (pallavi., 2010). vorinostat, belinostat and romidepsin all appeared to have similar profiles in hyperacetylating proteins detected by histone h3 and h4 antibodies, with vorinostat causing the greatest effect using anti - histone h3 antibody (6-fold increase in density compared to the control). acetylation detected by anti-(tetra) acetyl histone h4 antibodies on the other hand was affected most by romidepsin, which resulted in a 2.4-fold increase in relative density. interestingly panobinostat was the only hdac inhibitor that did not show hyperacetylation using both histone h3 and h4 antibodies in the western blot analysis. panobinostat was found to cause hyperacetylation using an anti - histone h3 lysine 9 antibody, but did not increase acetylation as detected by anti - histone h3 n - terminus antibody or anti-(tetra) acetyl h4 antibody. it may be that this compound acts differently to the other hdacs, however although all compounds were tested at 3 ic50 concentrations to try to normalize effects, subtle differences in compound uptake and target access also need to be considered. overall these data, which represent the first study aimed at trying to detect differences in acetylation profiles in p. falciparum in response to hdac inhibitors, indicate that there may be compound - specific differences in hdac inhibitor action, possibly due to the targeting of different pfhdac isoforms. as discussed in greater detail below, additional studies will be required as there may also be differences in uptake and targeting of compounds and this may also impact on mechanistic effects. all of the hdac inhibitors examined in this study were shown to inhibit deacetylase activity in p. falciparum nuclear extracts prepared from trophozoite - stage parasites. the highest inhibition was seen for romidepsin (table 2 ; ic50 0.9 nm). tsa and panobinostat displayed similar potencies with ic50s 34 nm for nuclear extract deacetylase inhibition. vorinostat and belinostat had the highest p. falciparum nuclear extract deacetylase ic50s (table 2 ; 335.5 nm and 214.7 nm, respectively), 55394 -fold higher than those of romidepsin, tsa, and panobinostat. similar levels of enzyme inhibition have previously been reported for these two compounds against different human hdac isoforms (hdac1, 2, 3, 4, 6, 7, 8 and 9) (khan., 2008). however, unlike this study where similar p. falciparum growth inhibition was obtained (table 1), in proliferation inhibition studies with mammalian cells, belinostat has been shown to be up to 11-fold more active than vorinostat (khan., 2008 ; andrews. 2013). while it is tempting to try to correlate the nuclear extract deacetylase inhibition data with the p. falciparum growth inhibition data generated in this study, differences in compound uptake, access to cellular targets following uptake, drug stability, and variations in off - target effects will impact activity and make these direct comparisons difficult. a major limitation of the study of p. falciparum hdacs is the lack of availability of recombinant hdac enzymes. only one p. falciparum hdac enzyme is currently available, pfhdac1, and its use is compromised by high cost and poor purity. given these limitations the hdac inhibitors examined in this study were tested for activity against recombinant pfhdac1, but at a single concentration. data generated showed that all compounds inhibited pfhdac1 by at least 50% when tested at 1 m (table 2). as discussed above, vorinostat and panobinostat have previously been shown to inhibit recombinant pfhdac1 enzymatic activity with ic50 59 nm and 1.8 nm, respectively (patel., 2009). these data indicate that this enzyme may be a target in p. falciparum parasites. however, as other pfhdac isoforms are not presently available, it remains to be determined whether other hdacs are also targeted, or differentially targeted, by the different compounds. likewise, while the presence of pfhdac1 was confirmed in nuclear lysates by western blot (data not shown) using a polyclonal anti - pfhdac1 antibody (trenholme., 2014), antibodies to the other class i / ii hdacs are not yet available so we do not know which hdac isozymes are expressed in nuclear extracts or their relative abundance. in summary, this study reveals that four hdac inhibitors clinically approved for the treatment of cancer have dose - dependent anti - parasitic activity against plasmodium and trypanosoma parasites, causative agents of malaria and trypanosomiasis. although the profile of the inhibitors examined in this study, in particular their relatively low selectivity for parasites versus mammalian cells, does not support their use clinically for malaria or trypanosomiasis, our data do indicate that they may be useful starting points for further development of new compounds that may have more suitable anti - parasitic profiles. in particular, it seems that alternative approaches need to be taken to identify more parasite - selective compounds. hdac inhibitor mode of action studies are currently limited by reagent availability, however, these studies are a high priority if the activity of this class of inhibitors is to be exploited for malaria and other parasite species. in this paper we also present intriguing data that suggests there are differences in how different hdac inhibitors target hdac enzymes in malaria parasites and that they may target different hdac isoforms differentially. this raises the exciting possibility of the identification of isoenzyme selective anti - malarial hdac inhibitors and their development into both stage - specific and pan - stage inhibitors of malaria parasites.	histone deacetylase (hdac) enzymes work together with histone acetyltransferases (hats) to reversibly acetylate both histone and non - histone proteins. as a result, these enzymes are involved in regulating chromatin structure and gene expression as well as other important cellular processes. hdacs are validated drug targets for some types of cancer, with four hdac inhibitors clinically approved. however, they are also showing promise as novel drug targets for other indications, including malaria and other parasitic diseases. in this study the in vitro activity of four anti - cancer hdac inhibitors was examined against parasites that cause malaria and trypanosomiasis. three of these inhibitors, suberoylanilide hydroxamic acid (saha ; vorinostat), romidepsin (istodax) and belinostat (beleodaq), are clinically approved for the treatment of t - cell lymphoma, while the fourth, panobinostat, has recently been approved for combination therapy use in certain patients with multiple myeloma. all hdac inhibitors were found to inhibit the growth of asexual - stage plasmodium falciparum malaria parasites in the nanomolar range (ic50 10200 nm), while only romidepsin was active at sub-m concentrations against bloodstream form trypanosoma brucei brucei parasites (ic50 35 nm). the compounds were found to have some selectivity for malaria parasites compared with mammalian cells, but were not selective for trypanosome parasites versus mammalian cells. all compounds caused hyperacetylation of histone and non - histone proteins in p. falciparum asexual stage parasites and inhibited deacetylase activity in p. falciparum nuclear extracts in addition to recombinant pfhdac1 activity. p. falciparum histone hyperacetylation data indicate that hdac inhibitors may differentially affect the acetylation profiles of histone h3 and h4.
table s1. breeds and sra numbers for the control whole genome sequences. click here for additional data file.	a 10monthold spayed female cane corso dog was evaluated after a 2month history of progressive blindness, ataxia, and lethargy. neurologic examination abnormalities indicated a multifocal lesion with primarily cerebral and cerebellar signs. clinical worsening resulted in humane euthanasia. on necropsy, there was marked astrogliosis throughout white matter tracts of the cerebrum, most prominently in the corpus callosum. in the cerebral cortex and midbrain, most neurons contained large amounts of autofluorescent storage material in the perinuclear area of the cells. cerebellar storage material was present in the purkinje cells, granular cell layer, and perinuclear regions of neurons in the deep nuclei. neuronal ceroid lipofuscinosis (ncl) was diagnosed. whole genome sequencing identified a ppt1c.124 + 1g > a splice donor mutation. this nonreference assembly allele was homozygous in the affected dog, has not previously been reported in dbsnp, and was absent from the whole genome sequences of 45 control dogs and 31 unaffected cane corsos. our findings indicate a novel mutation causing the cln1 form of ncl in a previously unreported dog breed. a canine model for cln1 disease could provide an opportunity for therapeutic advancement, benefiting both humans and dogs with this disorder.
synovial sarcoma (ss) is an uncommon mesenchymal malignancy that comprises of approximately 10% of all soft tissue sarcomas (1). only two cases of ss arising from the thyroid gland have been reported in the english literature (2, 3). a 72-year - old woman presented with a three - month history of rapid - growing mass in the lower anterior neck. she had been diagnosed with a benign cystic thyroid nodule 7 years previously, for which she underwent percutaneous alcohol injection a year later. her past medical history included diabetes mellitus for fifteen years, managed by oral hypoglycemic agents. physical examination revealed a 6 cm, firm, fixed, and non - tender mass in the lower anterior neck, with no mass was palpable in either lateral neck region. ultrasound scan showed a 65 cm - sized, heterogeneously hypoechoic nodule with internal calcification in the left lobe of the thyroid gland. computed tomography (ct) scan revealed a large, low - attenuating mass replacing the left thyroid gland extending to the level of the hyoid bone superiorly and superior mediastinum inferiorly with possible invasion to the trachea. the mass displaced the trachea to the right and anteriorly, and the internal jugular vein laterally, while compressing the lumen (fig. esophagogram showed extrinsic compression but no direct invasion to the esophagus. under the impression of thyroid carcinoma, we planned to perform total thyroidectomy with tracheal resection and end - to - end anastomosis, which would be converted to an incisional biopsy and tracheotomy if the frozen biopsy showed anaplastic carcinoma. two weeks after the initial visit, and two days before the planned operation, the patient presented to an emergency room due to dyspnea. 1b), while chest ct scan revealed multiple variable sized nodular lesions in both lung fields, suggestive of lung metastasis (fig. in view of the findings, total thyroidectomy with tracheal fenestration was performed for the purpose of biopsy and palliation. intraoperatively, the main foci of the tumor within the thyroid gland was found to be infiltrating to the surrounding thyroid tissue and was firmly attached to the internal jugular vein, esophagus and trachea, as well as exerted intraluminal extension to the trachea. histologically, the tumor was consisted of fascicles and sheets of dense, uniform, relatively small ovoid neoplastic cells. immunohistochemical staining for cd 99 was strongly positive while negative for cytokeratin, desmin, s-100, cd 31, cd 34, and epithelial membrane antigene (ema). molecular genetic analysis of the syt / ssx fusion gene transcript was positive, confirming the diagnosis of ss. however, she failed to return for follow - up following discharged, and died 2 months after the operation due to unknown causes. ss is a pleuripotential mesenchymal malignant tumor that comprises of 10% of all soft tissue sarcoma. most ss arise in the extremities, near the large joints, but do not originate from synovial tissues. therefore, they can also occur in any other anatomical location, including the head and neck, abdominal wall, and the thoracic cavity (4). ss arising in the head and neck account for 10% of all ss, and mostly occurs in the hypopharynx and retropharynx (1). only 2 cases of ss originating from the thyroid gland have been reported in the english literature (2, 3). for example, a growing neck mass is often associated with signs of compression, dysphagia, and hoarseness (5). our patient experienced a rapidly growing anterior neck mass with signs of airway compression and left vocal cord paralysis. with regard to the origin of ss in our case, after reviewing the clinical and pathologic findings of the patient 's tumor, we concluded that the tumor originated from the thyroid gland, rather than from the adjacent or distant organs. in cases of ss originating from other neck regions, the main tumor foci are usually situated around their local regions, distinct from the thyroid gland (6). in our case, however, imaging studies and intraoperative findings showed that the tumor had replaced the surrounding thyroid tissue and extended to the adjacent structures, including the internal jugular vein, the esophagus, and trachea. it is impossible to define the tissue of origin of this tumor more precisely, due to near complete involvement of the thyroid gland and prior injection of alcohol to the thyroid nodule had destroyed the thyroid parenchyma. ss typically affects adolescents and young adults. less than 10% of ss patients is over 60 years old (4). the age of the two previously reported primary thyroid ss patients was 60, suggestive that ss of the thyroid gland tends to develop at an older age, in contrast to ss that originate from other locations (2). according to histologic findings biphasic ss is consisted of spindle and epitheloid cells which rarely causes diagnostic difficulties. on the other hand, monophasic ss should be distinguished from other spindle cell sarcomas, such as leimyosarcoma, rhabdomyosarcoma, fibrosarcoma, and malignant peripheral nerve sheath tumor (mpnst) (7, 8). differential diagnoses should also include carcinosarcoma or spindle epithelial tumor with thymus - like differentiation (settle) (1). our case showed an atypical histologic pattern comprised of short spindle cells surrounded by collagenous matrix, which rendered it difficult to distinguish from other spindle cell malignancies. typically, ss reacts positively to epithelial markers (ema, cytokeratin), and negatively to non - epithelial markers such as cd 34. the expression of epithelial markers is observed in some cases of mpnst, anaplastic carcinoma and carcinosarcoma (1, 8). the expression of s-100 protein and cd 99 is observed in some cases of ss. bcl-2 is widely expressed in the spindle cells, which helps differentiation from other spindle cell tumors (5). in our case, the tumor showed more conflicting results, reacting positively only to cd 99 and negatively to ema, cytokeratin, desmin, and cd34. however, molecular study for syt / ssx fusion transcript - the most accurate diagnostic method - confirmed ss. both classical and molecular analyses therefore represent particularly useful diagnostic techniques that help avoid diagnostic confusion. the primary treatment of ss is wide surgical excision to obtain tumor - free margins, because most soft tissue malignancies tend to extend along the fascia. however, this can not always be accomplished in the head and neck region because of the tumor 's proximity to vital structures. chemotherapy based on ifosfamide may also be considered as adjuvant treatment or for the treatment of recurrent tumor (1). as described in previous and the current reports, ss arising from the thyroid gland tends to be infiltrative and aggressive, necessitating early and comprehensive treatment (2). in summary, primary ss arising from the thyroid gland is extremely rare, and thus, the clinical course remains unclear. in our case, histologic findings were not typical of ss and the detection of syt - ssx fusion gene transcript was very helpful for diagnosis. our case resembled anaplastic thyroid carcinoma with extensive local invasion, rapid progression, and early distant metastasis. because of the aggressive nature of this tumor, early diagnosis and comprehensive treatment including wide resection and adjuvant chemoradiation is required.	primary synovial sarcoma of the thyroid is an extremely rare condition which has only been reported twice in the literature. we herein report a case of highly aggressive and rapidly lethal primary synovial sarcoma of the thyroid. a 72-year - old woman presented with extensive local invasion, rapid progression, and early distant metastasis secondary to primary thyroid synovial sarcoma. the tumor exhibited an atypical histologic and immunohistochemical staining pattern. detection of syt / ssx fusion transcript confirmed the diagnosis of synovial sarcoma. due to the aggressive nature of primary synovial sarcoma of the thyroid gland, early diagnosis and comprehensive treatment including wide resection and postoperative chemoradiation is required.
we have recently demonstrated that, in chronically haemodialysed patients (chp), the vascular accesses determine significant changes in the upper limb native arteries ' stiffness. more precisely, arterial stiffness values measured in the arterial pathway of the upper limb where the vascular access was constructed were lower than those measured in its contralateral limb with intact arteries (i.e., without vascular access). changes in arterial diameter and blood flow associated with the vascular access construction and maturation have been pointed out as factors related with arterial stiffness variations in the upper limbs where a vascular access was performed. then, theoretically, there could be differences in the carotid - brachial pathway stiffness between patients with arteriovenous fistulae (avf) in the upper arm and those with vascular access in the forearm ; with high stiffness reduction when the avf is constructed in the upper arm. in addition, taking into account the gender dependence of arterial stiffness variations and vascular access performance [2, 3 ], it would be important to explore possible vascular biomechanical differences between male and female chp. findings regarding gender - associated differences in arterial response to vascular access construction could contribute to understand gender differences in the avf patency rates [2, 3 ]. native vessels are the conduits of first choice in performing vascular accesses for haemodialysis, arterial reconstruction, and bypassing. however, in chp, native vessels are often damaged or not available ; therefore, the only current alternative is expanded polytetrafluoroethylene (eptfe) prostheses. this choice is very far from the ideal solution because of their poor patency rates [4, 5 ]. in this context, there is great interest in developing unconventional vascular substitutes to be used employed in the construction of vascular accesses in chp. intimal hyperplasia stenosis in the native vessel - vascular substitute anastomotic region is the achilles ' heel for most vascular accesses in chp. it is determined, among other factors, by native vessel - vascular substitute biomechanical mismatch (bm). hence, the vascular substitute should have similar mechanical properties to those of the chp native vessels [79 ]. we have previously demonstrated that cryopreservation procedures preserve the mechanical properties of fresh human muscular and elastic arteries and veins [1012 ] ; therefore, fresh or cryopreserved vessels could be used as an alternative in vascular access construction, resulting in bm improvement. furthermore, we have demonstrated that bm between an upper limb native artery and a vascular substitute can be minimized by selecting the most adequate type of vascular homograft. homografts have been used in by - pass and va construction [1417 ] ; nonetheless, the selection of the most appropriate homograft capable to minimize the bm in chp upper limbs should be evaluated, taking into account gender and previous vascular access placement. the purposes of this work were to evaluate, in chp if vascular access position (upper arm or forearm) is associated with variations in upper limb arterial stiffness, the potential gender - associated differences in arterial stiffness changes related to the vascular access position, and, if the vascular substitute of choice, in terms of its bm with respect to native arteries, depends on (a) previous vascular access location and (b) chp gender. patients gave written agreement for noninvasive studies and documented consent was obtained for the vascular homograft procurement from deceased human multiorgan donors according to no. pulse wave velocity (pwv) was measured in 38 (18 males and 20 females) ambulatory patients (age : 53 17 years old) who had avf for haemodialysis in the upper limbs, at upper arm (n = 18), and forearm (n = 20) level. the term upper limb was used to define the anatomic region between the shoulder and the wrist joints. the terms upper arm and forearm were used to define the part of the upper limb between the shoulder and the elbow joints, and between the elbow and the wrist joints, respectively. haemodialysis was performed in the morning three times a week during 4 to 5 hours, on standard bicarbonate bath. patients had been submitted to renal function substitutive therapy for 66 56 months (table 1). in all cases, clinical data (heart rate, brachial blood pressure, weight, age, height, hip, and waist perimeter) were obtained by the same observer previous to the pwv measurements. body mass index (bmi) and waist - to - hip ratio were calculated for all patients. the carotid - femoral and right and left carotid - brachial pwv measurements were performed in a stable environment, as in previous works [1, 13 ]. the carotid - femoral pwv, a predictor of cardiovascular events, was measured to characterize the aortic stiffness in our patients and to compare the obtained values with those expected in healthy people [18, 19 ]. the carotid - brachial pwv is not a predictor of cardiovascular events, but it is a technique widely used to noninvasively characterize the upper limb arterial stiffness. pwv measurements were performed using two high - fidelity strain gauges mechanotransducers (motorola mpx 2050, motorola inc., corporate 1303 e. algonquin road, schaumburg, il 60196, usa) connected to an electronic signal amplifier device. both mechano - transducers were simultaneously positioned on the skin over the carotid - femoral or carotid - brachial arteries. signals from the same arterial pathway were acquired and analysed using software developed in our laboratory, which calculates the time delay between instantaneous arterial pulse waves. the time delay between the femoral and carotid waveforms or between the carotid and brachial waveforms (pulse transit time) then, using time delay data and the distance between the sensors, the arterial pathway pwv was calculated. in all patients, according to the methodology previously described by our group, several pwv measurements were obtained from a single continuous recording that included at least ten cardiac cycles. finally, blood was drawn from each patient and routine chemical analyses were performed to quantify haematocrit, haemoglobin, serum albumin, serum creatinine, calcium, phosphate, parathyroid hormone (pth), urea, total cholesterol, hdl and ldl cholesterol, and triglycerides (table 1). serum creatinine was measured by the modified kinetic jaffe reaction and recalibrated in order to calculate the estimated glomerular filtration rate (egfr) using the modification of diet in renal disease (mdrd) study formula : (1)egfr = 186(serum creatinine [mgdl])1.154 we included both biological (i.e., vascular homografts) and synthetic (i.e., eptfe) vascular substitutes. we obtained vascular segments (5 cm in length) from 10 deceased human multiorgan donors aged 31 5 years : saphenous vein, femoral (muscular homograft), carotid (elastic homograft), and brachial (transitional homograft) arteries. exclusion criteria agreed with the international atomic energy agency (international standards for tissue banks), the american association for tissue bank, and the european association for tissue bank. in vitro dynamic analyses were performed in homografts and in 6 eptfe (gore - tex vascular graft, w. l. gore & associates, inc., flagstaff, az, usa) segments (5 to 6 cm in length). all conduits were mounted in a mock circulation loop and were maintained, immersed in, and perfused with tyrode 's solution (37c, ph = 7.4, oxygenated) in a specimen chamber. the mock circulation loop consisted of polyethylene tubing, with fluid circulation powered by a pneumatic pump (jarvik model 5, kolff medical inc., salt lake city, ut, usa) that allowed pressure value and waveform adjustments. intraluminal pressure was measured with a solid - state transducer (1200 hz frequency response, knigsberg instruments, inc., the segments ' external diameter was measured with ultrasonic crystals (5 mhz, 2 mm diameter). the ultrasonic signal transit time, obtained during the experiment, was converted into distance by means of a sonomicrometer (triton technology inc. as in previous works [1013, 17, 21 ], taking into account the speed of sound in biological tissues and in experimental media used in arterial in vitro studies, and considering our experimental conditions (i.e., temperature, vascular smooth muscle reactivity), we assumed a sound speed of 1580 m / s [22, 23 ]. after being placed in the specimen chamber the simulated haemodynamic conditions mimicked those of the chp included in the study, ensuring isofrequency and isobaric comparisons among groups. during each experimental session, pressure and diameter signals were measured under dynamic conditions, displayed in real time, digitised every 5 ms, and stored for offline analysis. all recorded samples included at least twenty consecutive beats. at the end of each experiment, in order to calculate the conduit strain, a recording of the nonpressured midwall radius (r0) was computed as the radius at 0 mmhg. afterwards, segments were weighed and instantaneous wall thickness (h) was calculated as (2)h = reri, where re and ri are the external and internal radius, respectively. the internal radius (ri) was calculated as : (3)ri = re2vl, where l is the in vivo length, and v is the conduit volume, calculated using the segment weight and assuming a tissue density () of 1.06 gcm. pwv was calculated using the moens - korteweg equation : (4)pwv = einch2r, where einc is the incremental elastic modulus and r is the midwall radius. in order to determine einc, values of the conduit strain () and circumferential stress () were calculated as (5)=rr0, (6)=2p(reri)2re2ri21r2, where r0 is the non - pressured midwall radius obtained as described above and p is the intraluminal pressure. finally, the stress - strain loop was constructed in all cases ; this allowed us to obtain the - purely elastic relationship, using the hysteresis - elimination method. einc was calculated as (7)einc=0.75dd, where d/d is the first derivative of respect to. finally, the chp native artery - vascular substitute biomechanical mismatch (bm), expressed as a percentage, was calculated as [12, 13 ] (8)bm = pwvchppwvvascular substitutepwvchp+pwvvascular substitute100. the bm values range between 100 and 100. a null bm (bm = 0) represents an optimal coupling or matching (i.e., vascular substitute and native vascular pathway with identical biomechanical behaviour), while values far from 0 indicate increasing mismatch. a negative value indicates that the vascular substitute is stiffer than the native vascular pathway ; a positive value indicates that the native vascular pathway is stiffer than the vascular substitute. the statistical software used was the spss 17.0 (chicago, il, usa). both noninvasive and in vitro studies, performed according to the methodology described above, provided high quality biological wave recordings. no technical mistakes occurred during data acquisition. as was expected, the studied chp showed an increased aortic stiffness level, evidenced by a higher carotid - femoral pwv than the expected for age and blood pressure - matched healthy european [24, 25 ] or south - american subjects. there were not significant carotid - femoral pwv differences across the groups (table 1). patients with the vascular access for haemodialysis in the forearm and those with the vascular access in the upper arm showed nonsignificant differences in terms of age, height, weight, and waist and hip perimeters (table 1). similarly, with the exception of pth levels, there were no differences between the groups regarding biochemical, and haemodynamic parameters (table 1). there were not significant differences in egfr levels across the groups (table 1). gender comparison of clinical characteristics, biomechanical parameters, and arterial pressure values showed only significant differences (p < 0.05) in terms of height, haematocrit, pth, and haemoglobin levels (table 1). regardless of the vascular access location (upper arm or forearm), the carotid - brachial pwv was lower in the upper limb with the vascular access (p < 0.05) than in the contralateral one (i.e., the limb with intact arteries). when avf was performed in the forearm, a statistically significant difference was observed between contralateral upper limbs (10.50 0.47 versus 11.30 0.36 m / s) ; a similar finding was confirmed when the avf was constructed in the upper arm (9.60 0.61 versus 11.30 0.78 m / s) (figure 1(a)). the mentioned differences were greater (p < 0.05) in chp with the avf in the upper arm than in those with the vascular access in the forearm (17.00 5.18% versus 7.10 2.29%) (figure 2(a)). the carotid - brachial pwv measured in intact upper limbs (i.e., without avf) of chp described above was similar, regardless of whether the avf was performed in the upper arm (11.30 0.78 m / s) or in the forearm (11.30 0.36 m / s) (figure 1(a)). when considering gender in the vascular stiffness analysis, it was observed that both male and female chps with vascular accesses in the upper arm exhibited lower pwv values (p < 0.05) in the limb with the avf than in its contralateral intact limb (figure 1(b)). more precisely, in females, pwv values obtained in the carotid brachial pathway where the avf was performed were lower (p < 0.05) than in the contralateral intact limb (10.00 0.67 versus 10.60 0.57 m / s) ; similar findings were observed in males (8.70 1.29 versus 12.60 2.09 m / s) (figure 1(b)). the mentioned differences were greater in males than in females (29.60 9.36% versus 9.50 4.15%) (figure 2(b)). human brachial artery homografts ensured the best bm values with native vessels (table 2), regardless of gender and vascular access location. moreover, bm values are better in females than in males with avf performed in the upper arm. on the other hand, eptfe prostheses showed the worst bm values. analysing the biological alternatives included in table 2, we observed that the same graft can show very different values of bm. when comparing the native vessel - homograft bm values obtained in the limb with the avf with those of the limb with intact arteries, there were differences (p < 0.05) regardless if the avf was performed in the upper arm or in the forearm. saphenous vein and femoral and brachial artery homografts showed lower values of bm with respect to native vessels when the avf was performed at the forearm level than those measured when the vascular access was constructed in the upper arm (p < 0.05), see table 2(a). on the other hand, when using carotid artery homografts, the opposite result was obtained (p < 0.05) (table 2(a)). finally, differences in native artery - homograft bm were found between males and females, regardless of avf location (table 2). we have recently demonstrated that in chp, arterial stiffness values measured in the arterial pathway of the upper limb where the vascular access was constructed were lower than those measured in its contralateral limb with intact arteries (i.e., without vascular access). continuing our project, and using the same data set previously employed, and new original clinical and experimental data and records, in this work we analyse the carotid - brachial arterial stiffness considering the vascular access location (upper arm or forearm levels), and we analyse potential gender - related differences. first, the reduction in the carotid - brachial pwv was greater in upper limbs with the vascular access located in the upper arm. second, carotid - brachial pwv reduction in upper limbs with vascular access was evidenced in males and females chp. when the avf was constructed in the upper arm, third, independently of the avf location (i.e., upper arm or forearm), the vascular homograft that ensured the best bm was the brachial artery. fourth, the native vessel - vascular substitute bm showed significant differences, depending on the gender and the upper limb considered (intact or submitted to avf construction). in fact, at present, the carotid - femoral pwv is considered the gold standard technique to evaluate the regional aortic stiffness using non - invasive methods. furthermore, in haemodialysed patients, carotid - femoral pwv is a valuable mortality predictor [2730 ]. then, considering its clinical meaning and that pwv is a simple, non - invasive, robust and reproducible method to evaluate arterial stiffness, in this work we selected the use of pwv to determine both the aortic (carotid - femoral pwv) and the upper limb arteries (carotid - brachial pwv) stiffness. as it was expected, in chp, carotid - femoral pwv levels were higher than the levels reported to evidence arterial subclinical alterations [2426 ]. in this study serum pth levels were elevated (as is common in chp), and differences in pth levels were found among groups (table 1). however, no association was found between pth levels and carotid - femoral or carotid - brachial pwv values. then, differences in pth levels could not explain differences in carotid - brachial pwv reported in our work. this finding agrees with previous works, in which no association was found between serum pth levels and aortic stiffness or risk of death or cardiovascular events [31, 32 ]. avf have shown a beneficial impact on aortic stiffness ; this improvement would be greater in patients with increased pwv before vascular access construction. additionally, a reduction in the carotid - brachial stiffness in upper limbs with avf has been described. in the first case, the arterial stiffness improvement has been associated to a blood pressure reduction ; in the second case, it would be due to an arterial diameter increase, associated with avf maturation. in the present study we found that the carotid - brachial pwv reduction was greater in patients with the avf performed in the upper arm than in those with the avf in the forearm. therefore, we hypothesised that this reduction in arterial stiffness associated with the existence of a vascular access could result in an increase in arterial conduit and buffering function and a reduction in left ventricle afterload. however, the analysis of the differences in the arterial stiffness reduction in terms of arterial function and cardiac afterload changes and their meanings was beyond this work 's scope. stiffness differences between limbs with the avf in the upper arm and those with the vascular access in the forearm could be related with anatomical factors since the brachial artery diameter is the highest among upper limb arteries. this is an important issue since the arterial wall 's intrinsic properties (i.e., the elastic modulus) and the vessel 's geometrical parameters (i.e., diameter) are main determinants of the pwv (3). furthermore, the increase in diameter in vessels used in the avf construction constitutes an important issue in the vascular access maturation process. the avf maturation and patency rates are lower in female than in male haemodialysed patients [2, 3, 34 ]. several studies have pointed out that the lesser maturation rate in females would be due to the smaller diameter of vessels in females, but factors other than vessel geometry could also be involved in the maturation outcomes [2, 3, 34 ]. the differences regarding avf evolution described above could be related to the gender dependence of age effects on arterial wall properties of upper limbs. in 2000, a population study demonstrated that brachial artery diameter increase, with age in females than in males. additionally, brachial artery compliance values did not decrease with age, on the contrary, a significant increase was observed in females, while among the male population no changes were observed. according to our results, the differences in the carotid - brachial pwv between upper limbs with and without avf were significantly higher in males than in females. this original finding was observed only when the vascular access was performed in the upper arm. the relationship between gender differences in the vascular biomechanical behaviour and in the avf evolution should be analysed. regarding this, it has been stated that avf maturation needs compliant vessels that can dilate in response to blood flow increase. therefore, gender differences in vascular access construction - associated changes in arterial stiffness could contribute to the gender differences in the avf evolution. as a consequence of the findings reported in the present study, further analyses should be performed in order to determine the clinical relevance of vascular biomechanical properties to predict the avf outcome. more specifically, vascular stiffness analysis should be included in studies on the low performance of vascular accesses in females. furthermore, a longitudinal study including pwv measurements before and after vascular access construction could contribute to improve the knowledge of the avf maturation process. gender and location of the vascular access (i.e., upper arm or forearm) differences could be the origin of previously reported findings, in which the authors pointed out that forearm avf have low success rate in chronically haemodialysed females. when analysing the carotid - brachial pwv changes in hemodialysed subjects, at least three factors should be considered for an adequate interpretation of our results. at least in theory, the fistulas / ptfe grafts maturation could influence pwv values, since changes in avf or grafts blood flow impedance associated with the maturation process could modify the upper limb local hemodynamic conditions. for instance, changes in local haemodynamic conditions could determine changes in the shear - stress applied to the endothelial layer, which could modify the arterial wall biomechanics through changes in the vascular smooth muscle tone. taking into account this, looking for stable conditions, in our work the non - invasive studies were always done in mature avf. second and related with that stated above, it is noteworthy that our patients ' average length on renal replacement therapy was 66 months. this time could differ (being higher or lower) with the mean survival length on hemodialysis in other centres and/or countries. then, the characteristics of our chp could differ from those of other chp groups, which should be considered at the time of extrapolating our results to other patients. then, future works should be developed to assess the potential association between the subjects ' characteristics and/or the hemodialysis length and the vascular changes in chp. according to our results, in chp, the location of the vascular access would result in differences in arterial stiffness evaluated through pwv measurements in the carotid - brachial pathway. in addition, as previously stated, the bm between the native vessels and the vascular substitute to be used in the vascular access construction could depend on (a) gender, (b) the evaluated limb (with or without a va), and (c) location of the previous vascular access. nonetheless, our results show that the brachial artery homograft would be the best vascular substitute of choice, in terms of bm improvement. prostheses made out of eptfe are widely used as a second choice in peripheral vascular surgeries, among them, vascular access construction. however, it is well known that eptfe vascular accesses have poor long - term outcomes. this could be attributed to the intimal hyperplasia development, associated, among other factors, to the native vessel - eptfe high bm. we have found that, independently of chp gender and arterial level in which the vascular access was constructed, eptfe prostheses always determined high bm levels. therefore, if vascular homografts were used instead of eptfe in the vascular access construction, the bm could be significantly diminished. further research should be undertaken in order to evaluate the clinical meaning of the findings reported in this work. we conclude that in chp the carotid - brachial pwv reduction was greater in patients with the avf performed in the upper arm than in those with the avf in the forearm. additionally, when the avf was constructed at upper arm level, the arterial stiffness reduction was greater in males than in females. finally, the native vessel - vascular substitute bm could be minimized considering : (a) the histological type of vascular homograft, (b) chp gender, (c) vascular access location (i.e., upper arm or forearm), and (d) existence of a previous vascular access.	purpose. to evaluate in chronically haemodialysed patients (chps), if : (1) the vascular access (va) position (upper arm or forearm) is associated with differential changes in upper limb arterial stiffness ; (2) differences in arterial stiffness exist between genders associated with the va ; (3) the vascular substitute (vs) of choice, in biomechanical terms, depends on the previous va location and chp gender. methods. 38 chps (18 males ; va in upper arm : 18) were studied. left and right carotid - brachial pulse wave velocity (pwvc - b) was measured. in in vitro studies, pwv was obtained in eptfe prostheses and in several arterial and venous homografts obtained from donors. the biomechanical mismatch (bm) between chp native vessel (nv) and vs was calculated. results / conclusions. pwvc - b in upper limbs with va was lower than in the intact contralateral limbs (p < 0.05), and differences were higher (p < 0.05) when the va was performed in the upper arm. differences between pwvc - b in upper limbs with va (in the upper arm) with respect to intact upper limbs were higher (p < 0.05) in males. independently of the region in which the va was performed, the homograft that ensured the minimal bm was the brachial artery. the bm was highly dependent on gender and the location in the upper limb in which the va was performed.
kommerell s diverticulum (kd) is a rare condition consisting of both an aneurysm of the thoracic aorta and an aneurysmal orifice of an aberrant subclavian artery. it corresponds to a conical dilatation at the origin of the aberrant vessel and is therefore also known as lusoria diverticulum, remnant diverticulum or lusoria root,,. originally, burckhard f. kommerell reported an aortic diverticulum in a patient having a left aortic arch with an aberrant right subclavian artery in 1936. basically, there are three types of aortic arch diverticulum:the diverticulum at the left aortic arch with aberrant right subclavian artery (more frequently : 0.5%2.0% of the population);the diverticulum at the right aortic arch with anomalous origin of the left subclavian artery (0.05%0.1%);the aortic diverticulum at the aortic - ductal junction,,. the diverticulum at the left aortic arch with aberrant right subclavian artery (more frequently : 0.5%2.0% of the population) ; the diverticulum at the right aortic arch with anomalous origin of the left subclavian artery (0.05%0.1%) ; the aortic diverticulum at the aortic - ductal junction,,. our purpose is to show the case of an asymptomatic patient with complete thrombosis of the prevertebral portion of an aberrant right subclavian artery, progressive kd thrombosis, and reverse ipsilateral vertebral artery flow that was detected by multidetector computed tomography (mdct) imaging performed for lung cancer staging before and after the beginning of chemotherapy, and subsequently confirmed by a color doppler ultrasound examination. a 70-year - old caucasian woman with biopsy proven non - small cell lung carcinoma (nsclc) underwent a contrast - enhanced whole body mdct examination for cancer staging. mdct findings showed a left aortic arch with a kd, an autonomous origin of the left vertebral artery from the aortic arch, and origin of both common carotid arteries from a short common trunk. an aberrant (lusory) right subclavian artery stemmed from the kd and was completely thrombosed at its origin as well (fig. 1). the patient received chemotherapy, and a follow - up mdct examination performed two months later showed complete thrombosis of the kd extended to the prevertebral portion of the right subclavian artery. the right vertebral artery was patent as well as the post - vertebral portion of the ipsilateral subclavian artery, suggesting retrograde vertebral flow due to subclavian steal phenomenon (fig. a doppler ultrasound examination was performed some days later for hemodynamic assessment, confirming reverse flow in the right vertebral artery compared with the left side (fig. the patient had never complained of any symptoms related to subclavian steal syndrome or tracheo - esophageal compression, and laboratory tests did not reveal any pre - existing hematologic disorders potentially favoring a pro - thrombotic condition. the embryological development of the aorta begins during the second week of gestation and is completed by the seventh week. between the fourth and fifth weeks of embryonic life, blood leaves the heart by a single vessel (i.e. the truncus arteriosus), which divides into two branches named the ventral and dorsal aortae, respectively. the ventral aortae are connected with the dorsal aortae by six branchial vessels, called aortic arches. these latter are numbered from cephalad to caudal and normally develop into the thoracic aorta and its branches. in particular, the first and the second pair contribute to the formation of the maxillary and external carotid arteries and of the stapedial arteries, respectively. the proximal segments of the third pair form the common carotid arteries. together with segments from the dorsal aortae, the distal portions contribute to the development of the internal carotid arteries. the left arch of the fourth pair forms the segment of normal left aortic arch between the left common carotid and subclavian arteries. the right fourth arch forms the proximal right subclavian artery, whereas the distal right subclavian artery is derived from a portion of the right seventh intersegmental artery. the fifth arches are both reabsorbed, and the sixth arches form the pulmonary artery and the ductus arteriosus (fig. if the left fourth arch disappears and the right one persists, a right aortic arch develops, whereas if both arches persist, they form a double arch or a vascular ring encircling the trachea and oesophagus,. edwards hypothesis is useful to understand the various aortic arch anomalies,,,. according to this theory, the double aortic arch with the ductus arteriosus is located on each side (thus surrounding the trachea and the oesophagus) and the descending aorta lies in the midline. the common carotid and subclavian arteries on each side stem from the ipsilateral aortic arch. the normal aortic arch is formed by interruption of the dorsal segment of the right aortic arch distally from the right subclavian artery to the descending aorta and regression of the right ductus arteriosus (fig., aortic arch anomalies can be classified into the following three types:type i : the left arch is interrupted between the descending aorta and left subclavian artery. this arch branching pattern is the mirror image of the conventional branching pattern of the normal left aortic arch;type ii : the interruption occurs between the left common carotid and subclavian artery;type iii : the interruption takes place proximal and distal to the left subclavian artery, which is therefore isolated and may be connected either to the pulmonary artery by the ductus arteriosus or to the left vertebral artery,,,,. type i : the left arch is interrupted between the descending aorta and left subclavian artery. this arch branching pattern is the mirror image of the conventional branching pattern of the normal left aortic arch ; type ii : the interruption occurs between the left common carotid and subclavian artery ; type iii : the interruption takes place proximal and distal to the left subclavian artery, which is therefore isolated and may be connected either to the pulmonary artery by the ductus arteriosus or to the left vertebral artery,,,,. among the aforementioned conditions, type ii right aortic arch with an aberrant left subclavian artery an aberrant left subclavian artery arises either as the last branch of the right - sided aortic arch or from an aortic diverticulum, such as the kd, which results from reabsorption of the left fourth aortic arch proximal to the origin of the left subclavian artery. kd dilatation may increase the risk of aneurysm rupture, and recent histopathological studies have revealed a high prevalence of cystic medial necrosis in the kd wall, potentially accounting for the increased risk of kd dissection and rupture,. moreover, kd aneurysm may result in compression of the surrounding mediastinal structures (especially the trachea and the esophagus), causing symptoms such as dysphagia, dyspnea, stridor, wheezing, cough, recurrent pneumonia, obstructive emphysema, or chest pain,,. the most severe issues in the course of aneurysms are their higher propensity to acute rupture with increasing aneurysm size, and especially in the case of aneurysms of the supra - aortic vessels, the risk of hemodynamic impairment with distal hypoperfusion or embolization due to thrombosis of the aneurysm lumen. clinical and imaging diagnoses focus on the reduction of morbidity and mortality associated with such risks, yet aneurysmal disease may often go undetected due to lack of symptoms unless imaging procedures spanning the upper chest are performed for diagnosis or follow - up of concurrent disease,,,. our patient showed a kd associated with a type ii left sided aortic arch variant, and to our knowledge, this is the first report to date of a thrombosed prevertebral right lusory artery associated with a progressively thrombosed kd, detected by both mdct and color doppler ultrasound in a patient with no history of ischemic symptoms or swallowing disorders. unfortunately, the patient had not received any prior imaging tests that might have been useful to date the onset of her right prevertebral lusory artery thrombosis. reported a similar case of aberrant right subclavian artery originating from a thrombosed kd in an 87-year - old male patient with prostate cancer and history of swallowing difficulties and stagnation of saliva, in whom secondary subclavian steal syndrome was suspected based on the anatomical finding of opacification of the ipsilateral vertebral artery on mdct images, but not confirmed functionally by a doppler ultrasound examination as in our own case. in analogy with this case, the hematologic workup revealed no pre - existing coagulation disorders, and the fact that progressive thrombosis of the kd occurred between the baseline and post - chemotherapy mdct examinations may raise the suspicion that a pro - thrombotic state may have occurred either as a paraneoplastic syndrome due to the underlying nsclc or as a side effect of chemotherapy. surgical indications for the kd have not been established systematically because of its rareness. nonetheless, early surgical treatment of the kd is recommended because of the risk of aneurysm rupture, and usually entails resection of the diverticulum and reimplantation of the aberrant subclavian artery into the aorta. however, the type of surgical procedure depends on the patient s age and relationship between the kd and the surrounding tissues, and especially in elderly or other frail patients (in whom open surgery is associated with a higher mortality and the risk of neurological complications), hybrid techniques tend to be preferred, such as endovascular occlusion followed by open revascularization,,. in the specific case of our patient, anticoagulation therapy was started and no vascular treatments have been performed so far, due to the lack of kd - related symptoms and to the underlying lung cancer with brain metastasis (as shown by staging mdct examinations). from a diagnostic standpoint, the excellent spatial and contrast resolution and the panoramicity afforded by modern mdct technology allow an accurate evaluation of the aneurysm size and intraluminal thrombosis, patency and course of the thoracic aorta and subclavian vessels, presence of collateral pathways via the vertebral circulation, and relationship with the neighboring nonvascular structures, thus providing the key elements for diagnosis and potential treatment planning,.	kommerell s diverticulum (kd) is defined as a bulbous dilatation of the origin of an aberrant subclavian artery due to a remnant of the left fourth aortic arch. we report the case of an asymptomatic woman in whom progressive thrombosis of the kd extending to the prevertebral tract of an aberrant right subclavian artery was detected at multidetector computed tomography imaging for lung cancer staging performed before and after the beginning of chemotherapy. reversed blood flow in the ipsilateral vertebral artery due to subclavian steal phenomenon was also observed by color doppler ultrasound examination.
parkinson s disease (pd) is frequently associated with vasomotor symptoms such as distal cold limbs or sensitivity to cold, estimated to occur in 40 - 50% of patients. cold limbs usually occur in the winter and are often accompanied by pain, potentially causing difficulty in walking or standing. we describe two patients with pd who had severe coldness of the lower limbs (col) in the summer. for example bradykinesia, right - dominant rigidity in all four limbs, and right - hand resting tremor developed in october 2010, and these parkinsonian features responded to treatment with levodopa. in october 2011, he presented with painful numbness in his legs, and walking became difficult. the dose of levodopa was gradually increased to 500 mg / day, and treatment with selegiline (7.5 mg / day) was started subsequently. the patient had received levodopa and selegiline in stable doses for 17 months. in september 2013, he had visual hallucinations of insects, and in december he showed wearing - off with painful muscle tightness in the lower limbs. the muscle tightness was present at rest and when moving his legs, and he shouted out it hurts. the score on the unified parkinson s disease rating scale (updrs), part iii was 63. zonisamide was initiated (25 mg / day), and in january 2014 the dose was increased to 50 mg / day. in early april, the severity of both the muscle tightness and pain decreased, and he became able to walk alone. the score on updrs, part iii had decreased to 32. in late april, the painful tightness recurred, especially in the evening, and he could walk only in the morning. rotigotine (4.5 mg / day) was started in addition to levodopa (500 mg / day), selegiline (7.5 mg / day), and zonisamide (50 mg / day). the dose of rotigotine was increased to 9 mg / day in may and to 18 mg / day in june. the off - periods were markedly reduced to 2 hours per day. in the summer of 2014, his family noticed that everyday he wore overlapping multiple shirts, used electric blankets, or switched on the floor heating, which was not tolerable by his family, because he felt that his legs were too cold and painful. when the col was accompanied by pain, he could not stand, walk, or turn over during sleep. in late august, we asked the patient whether the severity of the painful col had changed after increasing the dosage of rotigotine, and he responded that the severity had decreased and that warming his legs was more effective. however, painful coldness was evident after the evening. at this time, the score on updrs, part iii was 21. in 2004, an 80-year - old woman had bradykinesia, resting hand tremor, and rigidity of the right limbs, which responded to treatment with levodopa. in january 2009, wearing - off developed, and pergolide (500 g / day) was started. in january 2011, she noticed tightness and pain in her upper limbs. in april, the patient was given levodopa (500 mg / day) and pergolide (500 g / day), but off - periods were prolonged, and treatment with entacapone was begun in october. subsequently, the dose was increased to 600 mg / day. in march 2012, the tightness and pain extended to her legs, and muscle cramps were often present in her legs. in april 2012, she noticed col and tightness persisting for several hours before taking antiparkinsonian medications. she was given levodopa (300 mg / day), entacapone (600 mg / day), and pergolide (500 g / day). ropinirole was started, and the dose of pergolide was increased to 750 g / day. in february 2014, the dose of extended - release ropinirole was increased (8 mg / day). in early april, rotigotine (4.5 mg / day) was begun because the patient had difficulty walking since severe col had developed, leading to prolonged off - periods. in late april, she still wore many pairs of socks and put hot packs into the socks. the dose of rotigotine was increased to 18 mg / day. in august, the pain disappeared, and to avoid coldness, patients warmed their limbs in the summer by actions that were usually not done in the summer, such as using heating appliances. zonisamide or entacapone was initiated or the dose was increased within 12 months before col, but the duration of col was prolonged. the coldness was likely to mildly respond to dopamine agonists, but not enough to satisfy these patients. in the winter of the year when patients had col in the summer, both patients took actions similar to those in the summer to avoid coldness. the coldness caused difficulty in waking. to avoid coldness, patients warmed their limbs in the summer by actions that were usually not done in the summer, such as using heating appliances. zonisamide or entacapone was initiated or the dose was increased within 12 months before col, but the duration of col was prolonged. the coldness was likely to mildly respond to dopamine agonists, but not enough to satisfy these patients. in the winter of the year when patients had col in the summer, both patients took actions similar to those in the summer to avoid coldness. information on the interval between the start of anti - parkinsonian treatment and the onset of col was not provided in previous reports on patients with pd. long - term dopaminergic treatment may not directly elicit, but might be prerequisite to the development of col, as well as psychosis or hallucinations. central autonomic or peripheral autonomic impairment has been suggested to participate in the mechanism of vasomotor abnormalities such as distal col in pd. recently, one study assessing skin sympathetic nerve activity in pd patients with col showed that the skin blood circulation was decreased by prolonged vasoconstriction, and denervation hypersensitivity of adrenergic receptors in cutaneous blood vessels might lead to vasoconstriction. a histological study of skin specimens in patients with pd demonstrated decreased autonomic innervation of cutaneous vessels. thermoregulatory central autonomic failure has been shown to be caused by lesions in the hypothalamus. such peripheral and central autonomic impairment may be major causative factors for col. in our patients, reduced sympathetic nerve activity associated with muscle tightness might also attribute to col. in a previous study, 8 of 13 patients with pd who had col were treated with pergolide or an ergoline - based dopamine agonist, and there was no significant difference in measured data, including recovery time, between patients with and those without col. however, detailed information was not reported. similarly, dopamine agonists were used to treat col in our patients, but their effectiveness was limited. severe col can occur in summertime and can be intolerable or unpleasant ; col can worsen disability. treatment with a dopamine agonist did not sufficiently decrease the severity of col. in table 1 are reported the characteristics of the two patients with parkinson s disease who had severe coldness of the lower limbs.	parkinson s disease (pd) is frequently associated with vasomotor symptoms such as distal cold limbs or sensitivity to cold. coldness of the lower limbs (col) usually occurs in winter and is often accompanied by pain, potentially causing difficulty in walking or standing. a standard dopaminergic treatment for such symptoms is yet to be established. we describe two patients with pd, who had severe col during summer. for example, the patients wore many pairs of socks or used heating appliances in the summer. severe col can occur in summertime and can be intolerable or unpleasant, since it can worsen disability. the treatment with a dopamine agonist did not sufficiently decrease the severity of col.
the term pulse granuloma (pg) (pulse is defined as edible seeds of leguminous crops, such as peas, beans, and lentils), has been applied to the foreign body reaction to vegetable material. it is a distinct oral entity characterized as a foreign body reaction occurring either centrally or peripherally. occasionally, the lesions occur in the wall of the cyst, most common being inflammatory odontogenic cyst. however, a similar condition described as pg is usually observed in lungs and alimentary tract, usually in infants and severely debilitated persons. the term oral pulse granuloma (opg) is used for the lesions occurring in the oral cavity.. the granulomas may assume different histologic characteristics, possibly related to the length of time in the tissue (evolution) and location. several terminologies are used in the literature to describe this entity such as chronic mandibular periostitis, giant cell hyaline angiopathy (gcha), hyaline bodies and giant cells associated with a radicular cyst, pg, oral vegetable granuloma (ovg), hyaline ring granuloma (hrg), food - induced granuloma, and oral pulse or hyaline ring granuloma (ophrg). a 59-year - old female patient reported with a growth in the upper left back teeth region from 25 to 28, since 3 months. it was small in size initially and increased to present size with a dull aching pain. extraoral examination revealed a diffuse swelling present on the left side of the face extending superiorly from the inferior border of the orbit till the line joining the tragus to left corner of the mouth. the skin over the swelling was stretched, and facial asymmetry noted [figure 1 ]. on palpation swelling was nontender, firm in consistency ; skin over the swelling was pinchable. on intraoral examination, dental findings include the several teeth missing, root stumps w.r.t 28, 37, 46, decayed 11, 21, 22, 34, gingival recession in relation to anterior teeth, pockets in relation to posterior teeth, tooth mobility w.r.t 11, 26, 27, 31, 41, 47, with presence of spacing, stains, and calculus. on intraoral lesional finding consists of an oval, nodular, lobulated, smooth contoured pedunculated growth on the upper left gingiva, and extending and obliterating the buccal vestibule. growth was measuring approximately 3 cm 4 cm and was extending from 24 to 28 teeth region anteroposteriorly, superiorly from the buccal vestibule till the line of occlusion [figure 2 ]. provisionally, the case was diagnosed as benign or reactive growth on the gingiva of the left maxilla. differential diagnoses considered were gingival fibroma, pyogenic granuloma, peripheral ossifying fibroma, peripheral giant cell granuloma, and peripheral odontogenic tumors. orthopantomograph revealed a periapical radiolucency w.r.t 21, 22, 23 with a sclerotic rim indicating periapical pathology and a radiolucency w.r.t 26 region [figure 3 ]. intraoral periapical radiograph revealed radiolucency interdentally between 25 and 26 and in the periapical region of 26 [figure 4 ]. excision of proliferative growth, extraction of 25, 26, 27, 28 (root stumps) along with curettage of periapical region w.r.t 26 was done under general anesthesia with reconstruction with buccal pad fat and buccal flap advancement [figure 5 ]. extraoral examination shows a diffuse swelling on the left side of the face intraoral examination reveals a pedunculated growth on the upper left gingiva, obliterating the buccal vestibule oral pulse granuloma reveals a periapical radiolucency w.r.t 21, 22, 23 with a sclerotic rim indicating periapical pathology and a radiolucency w.r.t 26 region intraoral periapical radiograph reveals radiolucency interdentally w.r.t 25, 26 and in the periapical region of 26 intraoperative photograph shows surgical excision of the growth along with extraction of teeth the gross specimen and cut surface of the proliferative growth microscopic examination revealed discontinuous stratified squamous parakertinized atrophic epithelium with areas of ulceration covered with fibrinopurulent membrane. beneath, the ulceration stroma was edematous and showed numerous capillaries, dense collection of acute and chronic inflammatory cells, and dispersed multinucleated giant cells. eosinophilic hyaline material with hyaline ring (hr) surrounded by lymphocytes, macrophages, and giant cells were evident inducing a foreign body granulomatous response. homogenous brownish structures (inclusion of vegetable matter) associated with giant cell reaction in focal sites along with multiple hrgs were noted [figure 10 ]. deep computed tomography stroma showed interlacing fascicles of fibroblasts and collagen fibers with diffuse inflammatory infiltrate. histochemical staining with periodic schiff stain demonstrated vegetable matter stained as pale eosinophilic, double - layered refractile membranes with granulomatous reaction encasing them along with hrg [figures 11 and 12 ]. deep connective tissue stroma shows multiple granulomas (h and e, 4) photomicrograph shows eosinophilic hyaline material with hyaline ring surrounded by macrophages and giant cells (arrow). hyaline material in some area shows retractile basophilic material () (h and e, 10) photomicrographs show multinucleated giant cells of varying sizes. few giant cells show engulfed retractile foreign matter (h and e, 10) photomicrographs reveal multiple periodic schiff stain (pas) positive hyaline ring granulomas and homogenous brownish structures associated with giant cell reaction (pas, 10) inset shows refractile vegetable material with giant cell response (arrow) photomicrograph shows vegetable matter stained pale eosinophilic, double layered retractile membranes with a granulomatous reaction encasing them (periodic schiff stain, 40) based on clinical and histopathological features, the present case was concluded as ophrg in a reactive gingival growth, secondary to implantation of food particles of plant origin, through the periodontal pockets due to severe interdental bone loss. the histopathological features of opg described in the literature are alike, irrespective of the clinical presentations. constant features are the presence of structureless hrs or amorphous hyaline masses lying within a fibrous connective tissue stroma. the hyaline material can appear as homogenous, eosinophilic material may be spherical, ovoid, irregular bodies surrounded by fibroblasts, inflammatory cells, and giant cells as illustrated in figures 810. occasionally, there may be the presence of small calcified basophilic bodies within the amorphous hyaline material as noted in figure 8. opg is a histopathological diagnosis for localized lesion resulting from the implantation of food particles of plant origin. it often occurs in the posterior regions of edentulous mandible in association with a full denture but it may also be found in periapical areas of grossly decayed teeth or retained roots and teeth with a history of endodontic therapy, associated with impacted lower third molar teeth with history of pericoronitis, in postextraction tissue reaction or as part of a cyst wall where there has been a communication with oral cavity or as a complication of periodontal surgery or associated with deep periodontal pockets due to compromised periodontal health as in this case. dunlap and barker were among the first authors to evaluate this entity and considered it to be an acute vasculitis, naming it gcha. some investigators consider hrs as degenerated collagen fibers or fibrosed extravasated proteins of unknown origin. chou. proposed the descriptive term hrg, which seems more suitable and also avoids misunderstanding. two theories for etiopathogenesis have been proposed : (i) the origin of the hrs is due to a foreign material (pulse and legumes) having penetrated the oral mucosa or gastrointestinal tract and lungs (exogenous theory) and (ii) the rings are due to hyaline degenerative changes in walls of blood vessels (endogenous theory). adkins considered the lesion to be a foreign body granuloma, with hyaline material being the foreign body. philipsen and reichart have mentioned in their review that the foreign body reaction is due to legume cells, which contain starch, and also that legume parenchymatous cells in various stages of breakdown are as a result of the disruption by cooking and attempted degradation by host phagocytic cells, which produced the ring - like structures seen in the oral lesions. gueiros., have reported the classification of the hrs as inclusion of cooked vegetable particles, calling it pgs. other terms such as ovg and legume associated lesion, also addressed its vegetable origin. the pathogenesis of opg has also been evaluated by inducing its formation in animal models. talacko and radden hypothesized that once the food gains access to tissues ; it is rapidly digested and altered by the host responses. the cellulose moiety of plant foods is indigestible and persists in the form of hyaline material, inciting a chronic granulomatous response. harrison and martin supported the theory of a vegetable nature of the hrs on the basis of ultrastructural investigation., concluded that oral lesions are caused by traumatic implantation of vegetable particles in an extraction socket or oral ulcer with cellulose being responsible for granuloma formation. once a granulomatous response has occurred, chronic exposure to inflammatory enzymes probably modifies the morphological aspects of the hrs without compromising its anti - genic potential. the hrs were identified as structures originating from fragments of pulses, and the above lesion is thereafter termed ophrg. investigators have stated that histologically implanted lentils, peas, and navy beans showed the characteristic features of pgs encountered in human beings. the remaining vegetable substances failed to show the large, compartmentalized ovoid structures seen with pulses as depicted in the figures 11 and 12. photomicrograph reveals periodic schiff stain - positive hyaline ring and vegetable matter stained pale eosinophilic, double layered retractile membranes with a granulomatous reaction (pas, 40) table 1 summarizes 35 publications where the data related to the source of origin, location and diagnosis of 208 cases with ophrgs has been tabulated and reviewed. including a total of 173 patients ophrgs that were reviewed by philipsen and reichart, those reported from 1971 to 2008. 28 reports favor an exogenous origin, where food particles of plant or vegetable have been considered as source origin in 26 reports. in five publications, endogenous origin has been favored by three reports, and those authors have concluded their cases as gcha. regarding the location of the lesion, the mandibular edentulous ridge has been the frequently encountered site followed by wall of cyst approximately in 90 cases. among cysts, most frequently ophrg are demonstrated in inflammatory odontogenic cyst either residual cyst or periapical cyst. periapical area, extraction socket, and pericoronitis associated with the impacted tooth were the other sites to be reported. reports that support exogenous origin have concluded the diagnosis as either chronic periostitis or hrg or opg or ophrg. brief review of ophrg reported in the literature (1971 - 2014) related to the origin, location, and diagnosis the present case is unique because such a clinical form has not been cited in the literature. in a review by chou. of the remaining 11 patients, seven had a history of a deep periodontal pocket, trauma, or surgery. three lesions were found in the wall of odontogenic cysts and one below the root of a resorbed primary tooth. most reports that include histopathologic descriptions of ophrg comment upon hrs as the main histomorphologic findings. however, other vegetable parts like the pericarp which is pigmented and may mimic the cuticle or mouth apparatus of the maggot are hardly ever mentioned. oral myiasis has occasionally been reported in the literature, involving the lip, the palate, the floor of the mouth, or the periodontal areas. the presence of round cells (albumin cells) with distinct cell walls, pigmented cover structure (pericarp) which are birefringent [figure 10 ] and hrs are indicative of ophrg ; present case shows all these features thus excluding oral myiasis. the recurrence of ophrg is rare and if recurs it is probably due to incomplete excision. maintenance of oral hygiene is very important to avoid embedding of vegetable matter into the extraction socket during the healing phase, or through grossly decayed teeth and into deep periodontal pockets. oral pulse or hyaline ring granuloma are rare but is a well - described entity with distinct histopathology. ophrg has distinct histopathological aspects from pg of the lungs and gut as starch cells are often absent, and giant cells may be scant. this case report was presented to emphasize the occurrence of ophrg in reactive gingival growth, which is mainly due to implantation of food particles into the periodontium due to compromised periodontal health and poor oral hygiene. the cellulose moiety of plant foods is in contrast to the starch component indigestible and persists in the human tissues in the form of hyaline material, inciting a chronic granulomatous response.	pulse or hyaline ring granulomas are rare but are well - defined oral and extraoral lesions due to implantation of the cellulose moiety of plant foods in contrast starch components. a unique form as reactive gingival growth showing histologic features of oral pulse or hyaline ring granuloma (ophrg) which had resulted from implantation of food particles of plant or vegetable origin into the periodontium has been illustrated. such a presentation is attributable to compromised periodontal health and poor oral hygiene favoring the implantation of food particles has been described here along with a literature update on ophrg.
cell culture five human cancer cell lines, i.e. gastric cancer cell line mkn28, breast cancer cell line mcf-7, prostate cancer cell line lncap, colon cancer cell line dld1, and pancreatic cancer cell line miapaca2, were maintained at 37 c in rpmi 1640 or dulbecco 's modified eagle 's medium supplemented with 10% heat - inactivated fetal bovine serum and 1% glutamine in a 5% co2 atmosphere. tissue specimens a total of 17 gastric cancer specimens (stage ia, 3 ; ib, 4 ; ii, 2 ; iiia, 3 ; iiib, 2 ; and iv, 3 ; 8 intestinal - type adenocarcinomas and 9 diffuse - type adenocarcinomas) and corresponding non - neoplastic gastric mucosa were studied. the specimens were obtained from 8 males and 9 females (mean age 62.8 years ; range 5277 years) by surgical resection at the national cancer hospital east and were immediately frozen in liquid nitrogen and stored at -80 c until examined. the histological diagnosis was confirmed by microscopic analysis of a section of each frozen specimen before dna extraction. the institutional review board of the national cancer center approved all protocols after obtaining the patients ' consent. all clinicopathological data were according to the tnm classification (uicc) and obtained from the clinical and pathology records. rna interference two different 21-nucleotides duplex sirnas for ezh2 and one negative control sirna were synthesized by ambion (ezh2 ; sirna i d 107417 and 214022). twenty - four hours after plating, the cells were transfected with ezh2 sirna or control sirna using the dharmafect transfection reagent (dharmacon) according to the manufacturer 's instructions. at various time points after transfection, cells were harvested and subjected to several assays, including real - time pcr and western blotting analysis. rna isolation and real - time rt - pcr total rna from the five different cell lines was isolated with trizol reagent (invitrogen) and reverse transcribed to cdna with exscript rt reagent (takara). real - time rt - pcr was carried out with specific primers for ezh2 and runx3 and smart cycler (cepheid, sunnyvale, ca). real - time fluorescence monitoring of the pcr products was performed with sybr green i fluorescent dye (takara). the expression levels of specific genes are reported as ratios of expression of gapdh in the same master reaction. the pcr primer pairs (5 to 3) used for each gene were : ezh2, ccctgacctctgtcttacttgtgga and acgtcagatggtgccagcaata ; runx3, tctgtaaggcccaaagtgggta and acctcagcatgacaatatgtcacaa ; gapdh, gcaccgtcaaggctgagaac and atggtggtgaagacgccagt. chromatin immunoprecipitation (chip) assay the chip assay was performed as previously described (23). the pcr conditions for the runx3 gene promoter were applied with the following two primer pairs (5 to 3) : chip primer 1, tgtcccgggatcctcttct and tagagacgttggtgcggaaat and chip primer 2, ctctctgctctcccctcaaaac and ggaccgtggttacatgcgtaa. these primer sets were designed to encompass the transcriptional start site of runx3 variant 2 in the cpg island. the antibodies used were ezh2 antibody and dimethyl h3 (lys) antibody, purchased from abcam inc., and hdac1 antibody and trimethyl h3 (lys) antibody, purchased from upstate. individual chip assays were repeated at least twice to confirm the reproducibility of the pcr - based experiment. preliminary pcr were performed to determine the optimal pcr conditions to assure linear amplification of dna. pcr products were electrophoresed on a 6% polyacrylamide gel, stained with ethidium bromide, and photographed. to measure the levels of ezh2, hdac1, and histone methylation (k9 and k27) in each immunoprecipitate, the ratios were calculated by measuring the intensity of the pcr product in immunoprecipitated dna versus input dna (total chromatin) amplified by pcr in a linear range. the ratios were calculated by performing a dna 1000 assay with the agilent 2100 bioanalyzer and using dna chips for electrophoresis (agilent technologies). the myt1 (myelin transcription factor 1) gene was used as a positive control to validate each chip assay. the myt1 gene has been found to be a target gene of ezh2 (24). genomic dna from the five cancer cell lines and the 17 gastric cancer specimens and corresponding non - neoplastic gastric mucosa was extracted with a dneasy tissue kit (qiagen). analysis of the methylation status of genomic dna bisulfite treatment of the dna for the methylation assays was performed as previously described (25). methylation of runx3 was determined by a methylation - specific polymerase chain reaction (msp). briefly, 2 l of bisulfite - treated dna was used as the pcr template, and primer sets specific for methylated and unmethylated alleles were used. the msp primers for runx3 used in this study have been described previously (7). the pcr products from the methylated and unmethylated reactions were electrophoresed on 6% polyacrylamide gels and visualized by ethidium bromide staining. cells grown on coverslips were fixed with 3% paraformaldehyde in phosphate - buffered saline and processed for immunofluorescence. rabbit antibody against ezh2 (1:125) (zymed laboratories) and mouse antibody against runx3 (1 g / ml) (r36e9) (26) were used. the donkey secondary antibody was anti - rabbit igg - alexa fluor 488, and the goat secondary antibody was anti - mouse igg - alexa fluor 546 (molecular probes). cells were examined with a zeiss lsm5 pascal microscope and nuclear contour ratios were computed. figure 1.restoration of runx3 mrna levels after knockdown of ezh2 in five cancer cell lines, mkn28, mcf-7, lncap, dld1, and miapaca2. a, the level of ezh2 mrna after knockdown by sirna transfection and the restored level of runx3 mrna expression were quantified by real - time rt - pcr. b, the restored runx3 mrna levels in mkn28 cells were analyzed by rt - pcr and visualized by electrophoresis on 6% polyacrylamide gel. restoration of runx3 mrna levels after knockdown of ezh2 in five cancer cell lines, mkn28, mcf-7, lncap, dld1, and miapaca2. a, the level of ezh2 mrna after knockdown by sirna transfection and the restored level of runx3 mrna expression were quantified by real - time rt - pcr. b, the restored runx3 mrna levels in mkn28 cells were analyzed by rt - pcr and visualized by electrophoresis on 6% polyacrylamide gel. western blot analysis cells were lysed with whole cell lysis buffer (50 mm hepes, 150 mm nacl, 1.5 mm mgcl2, 0.5 mm edta, 10% glycerol, 1% triton x-100, 10 mm sodium fluoride, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride), and then frozen at -80 c and thawed three times to rupture the cell membranes. samples of the lysates were incubated for 30 min on ice to lyse the nuclei and then centrifuged at 8900 g. the protein concentration of each sample was determined by a standard bradford assay. equal amounts of protein (20 g) from each cell line were subjected to western blot analysis. the probing antibodies were ezh2 antibody (1:1000) (bd transduction laboratories), runx3 antibody (1 g / ml) (r35g4) (26), histone h3 antibody (0.5 g / ml) (upstate), and -actin antibody (1:50) (santa cruz biotechnology). cell treatment with trichostatin a (tsa) and 5-aza - dc preliminary experiments were performed to determine the maximum concentration tolerated of tsa and 5-aza - dc by each cell line, and tsa concentrations in the 330 nm to 5 m range and 5-aza - dc concentrations in the 800 nm to 1 m range were optimal for the cancer cell lines. tsa concentrations of 330 nm were used for mcf-7 and miapaca2 cells, 1 m for lncap and dld1 cells, and 5 m for mkn28 cells, and the 5-aza - dc concentrations used were 800 nm for mcf-7 cells and 1 m for mkn28, lncap, dld1, and miapaca2 cells. cells were seeded at low density in a 35-mm tissue culture dish and incubated at 37 c for a total of 72 h. cells were incubated for 24 h prior to treatment with the chemicals. mock treatment with an identical volume of absolute ethanol or water was used as a control. the 5-aza - dc was added after 24 h of incubation and cells were incubated for 48 h after it was added. tsa was added to the medium after 24 h of incubation, and cells were incubated with tsa for 48 h. when 5-aza - dc and tsa were both added, they were added after incubation for 24 h, and cells were incubated for 48 h. the culture medium was exchanged every 24 h for 5-aza - dc, tsa, and the combined treatment. cell proliferation assay the five cancer cell lines were transfected with ezh2 sirna or control sirna 48 h before the cell proliferation assay. the cell proliferation assay was started by seeding the cells at a density of 1.0 10 per dish. the assay was subsequently processed by incubating the cells at 37 c in a tissue culture incubator for 72, 96, 120, and 144 h after transfection, and counting the cells to plot a cell growth curve. immunohistochemistry the same 17 gastric adenocarcinoma specimens as used for msp analysis were used for immunohistochemical analysis. immunohistochemistry for ezh2 (1:25) (bd transduction laboratories) and runx3 (1 g / ml) (r36e9) (26) was performed on formalin - fixed, paraffin - embedded tissue sections by steam heat - induced or microwave - induced epitope retrieval and with the dako envision detection system. specimens were scored negative for overexpression of ezh2 when 020% of the cells were positive, and positive for overexpression when > 21% cells were positive. specimens were scored positive for runx3 expression and negative. for runx3 expression, specimens were also evaluated with the localization of runx3 expression, nucleus or cytoplasm. inhibitory effect of ezh2 on runx3 gene expression to determine whether ezh2 is a negative modulator of runx3 gene expression in the five cancer cell lines, i.e. gastric cancer line mkn28, breast cancer line mcf-7, prostate cancer line lncap, colon cancer line dld1, and pancreatic cancer line miapaca2, ezh2 mrna was suppressed with ezh2 sirna in all five cancer cell lines, in which runx3 is silenced (7, 11, 12, 27, 28). the results of rt - pcr showed significantly decreased levels of ezh2 mrna in all five cancer cell lines within 4896 h after transfection with ezh2 sirna (the percentage of ezh2 mrna expression level by ezh2 sirna transfection to that by control sirna transfection ; mkn28, 31.6% ; mcf-7, 25.7% ; lncap, 31.5% ; dld1, 50.0% ; miapaca2, 47.0%) (fig. a marked decrease in ezh2 protein level in all five cancer cell lines was observed by western blot 96 h after transfection (data not shown), an increased level of runx3 mrna was in every line. real - time rt - pcr was performed to quantitatively measure the restored runx3 mrna expression level after knockdown of ezh2 (fig. runx3 mrna had increased from 3.5 to 10.4-fold after ezh2 knockdown in the cancer cell lines (mkn28, 4.7-fold ; mcf-7, 6.1-fold ; lncap, 10.4-fold ; dld1, 4.1-fold ; miapaca2, 3.5-fold) (fig. j). however, the transcriptional expression level of gapdh mrna was unchanged in all five cancer cell lines after ezh2 knockdown, suggesting that gapdh is not a target of ezh2 (data not shown). by non - real - time rt - pcr, restoration of runx3 figure 2.restoration of runx3 mrna in gastric and breast cancer cell lines (mkn28 and mcf-7) after ezh2 knockdown accompanied by chromatin remodeling with no change of dna methylation status in the promoter region of runx3 gene. a, a and b, chip assay was performed by using the dna - protein complex isolated from mkn28 and mcf-7 cells transfected with ezh2 sirna for 96 h and immunoprecipitated with various antibodies, including ezh2 antibody, h3k27me3 antibody (h3-lys trimethylation), hdac1 antibody, and h3k9me2 antibody (h3-lys dimethylation). the two primer sets for chip assay were designated chip primer set 1 (a) and chip primer set 2 (b). the pcr products of each immunoprecipitated dna and input dna were visualized by electrophoresis on a 6% polyacrylamide gel. the number under each gel is the ratio of immunoprecipitated dna to input dna quantified (a, antibody ; b, no antibody ; c, input). c, the myt1 gene, which is known to be a target of ezh2, was used to validate chip assays in the present study. b, msp analyses of the dna of the five cancer cell lines transfected with ezh2 sirna or negative control sirna, using primer sets that specifically amplify either methylated dna(m) or unmethylated dna (u). control templates from human genomic placenta dna treated or untreated with sssi methylase are shown. restoration of runx3 mrna in gastric and breast cancer cell lines (mkn28 and mcf-7) after ezh2 knockdown accompanied by chromatin remodeling with no change of dna methylation status in the promoter region of runx3 gene. a, a and b, chip assay was performed by using the dna - protein complex isolated from mkn28 and mcf-7 cells transfected with ezh2 sirna for 96 h and immunoprecipitated with various antibodies, including ezh2 antibody, h3k27me3 antibody (h3-lys trimethylation), hdac1 antibody, and h3k9me2 antibody (h3-lys dimethylation). the two primer sets for chip assay were designated chip primer set 1 (a) and chip primer set 2 (b). the pcr products of each immunoprecipitated dna and input dna were visualized by electrophoresis on a 6% polyacrylamide gel. the number under each gel is the ratio of immunoprecipitated dna to input dna quantified (a, antibody ; b, no antibody ; c, input). c, the myt1 gene, which is known to be a target of ezh2, was used to validate chip assays in the present study. b, msp analyses of the dna of the five cancer cell lines transfected with ezh2 sirna or negative control sirna, using primer sets that specifically amplify either methylated dna(m) or unmethylated dna (u). control templates from human genomic placenta dna treated or untreated with sssi methylase are shown. chip assay to demonstrate a direct interaction between the ezh2 complex and promoter region of the runx3 gene, a chip assay was performed using the same mkn28 and mcf-7 cells. two pcr primer sets that spanned the transcriptional start site were used to monitor binding of ezh2 to the promoter that drives expression of runx3 mrna and was up - regulated after loss of ezh2. the myt1 gene was used as a positive control to validate each chip assay (25). the chip assay revealed ezh2 binding to the runx3 promoter region in the control mkn28 and mcf-7 cells (fig. 2a, a and b), and the amount of the ezh2 recruited to the promoter region of runx3 was inversely correlated with the runx3 mrna expression levels in both cell lines. the level of h3-lys trimethylation in the runx3 promoter was significantly reduced in mkn28 and mcf-7 cells transfected with ezh2 sirna, and the decrease in h3-lys trimethylation was inversely correlated with the increase in expression of the runx3 gene. the amount of hdac1 bound to the runx3 promoter was also significantly reduced in mkn28 and mcf-7 cells transfected with ezh2 sirna, and the decrease in hdac1 was inversely correlated with an increase in expression of the runx3 gene, suggesting that ezh2 forms a transcriptional repressive complex with hdac1. a decreased level of h3-lys dimethylation was also detected in mkn28 cells transfected with ezh2 sirna in comparison with mkn28 cells transfected with control sirna, suggesting that h3-lys status may also be involved in modulation of the runx3 gene promoter activity by ezh2. based on all of the above findings, we concluded that runx3 gene silencing in cancer cells is mediated by ezh2 increasing the h3-lys methylation level. 2a, c, shows that the binding levels of ezh2 and h3k27me3 (h3-lys trimethylation) in the myt1 promoter region, which is known to be a target of ezh2 (25), clearly decreased after knockdown of ezh2, suggesting the chip assay was valid. the means and standard deviations of chip experiments for each antibody were shown as diagrams (supplemental fig. figure 3.restoration of runx3 expression in five cancer cell lines after treatment with 5-aza - dc, tsa, or a combination of 5-aza - dc and tsa. runx3 expression in the five lines was evaluated by quantitative real - time rt - pcr. a, mkn28 ; b, mcf-7 ; c, lncap ; d, dld1, and e, miapaca2. the concentrations of 5-aza - dc and tsa to which the mcf-7 line was exposed were the same as used by lau. vehicle, no treatment control ; aza, 5-aza - dc ; a+t, combination of 5-aza - dc and tsa. restoration of runx3 expression in five cancer cell lines after treatment with 5-aza - dc, tsa, or a combination of 5-aza - dc and tsa. runx3 expression in the five lines was evaluated by quantitative real - time rt - pcr. a, mkn28 ; b, mcf-7 ; c, lncap ; d, dld1, and e, miapaca2. the concentrations of 5-aza - dc and tsa to which the mcf-7 line was exposed were the same as used by lau. vehicle, no treatment control ; aza, 5-aza - dc ; a+t, combination of 5-aza - dc and tsa. msp analysis as previously reported, hypermethylation in the runx3 promoter region was observed in all five cancer cell lines in the absence of runx3 expression (fig. we then investigated whether the status of dna methylation in the runx3 promoter region changed after knockdown of ezh2 and resulted in restoration of runx3 gene expression. although runx3 was up - regulated after ezh2 sirna transfection, as shown in fig. 2b the msp analysis showed no decrease in dna methylation of the runx3 promoter region. hypermethylation of the promoter of the runx3 gene occurred before and after ezh2 sirna transfection in all five cancer cell lines examined. dna hypermethylation in the promoter region is known to be associated with silencing of the runx3 gene, however, the above findings suggest that histone modification by ezh2 also played an important role in the regulation of runx3 in all five cancer cell lines. cell treatment with tsa and 5-aza - dc to determine the relative contribution of dna methylation and histone deacetylation to runx3 silencing, we investigated the effect of a demethylating agent, 5-aza-2-deoxycytidine (5-aza - dc), and a histone deacetylase inhibitor, tsa, in all five cancer cell lines. real - time rt - pcr showed that exposure to 5-aza - dc resulted in less restoration of runx3 expression than exposure to tsa in four of the cancer cell lines, the exception being the miapaca2 line (fig. e), but msp analysis showed hypermethylation of cpg in all five cancer cell lines (fig. although the histone deacetylase inhibitor tsa alone was sufficient to strongly restore runx3 expression (fig. e), the combination of dna demethylation and inhibition of histone deacetylation restored runx3 expression synergistically (fig. in other words, the effect of histone deacetylation on runx3 transcriptional repression was greater than that of dna methylation, except in cell line miapaca2. thus, both histone deacetylation and dna methylation play a synergistic role in silencing runx3 expression. neither 5-aza - dc nor tsa changed the ezh2 expression levels in any of the cancer cell lines (data not shown). as stated above, the chip assay showed that down - regulation of ezh2 by sirna transfection reversed the binding of hdac1 to the promoter region of runx3, which is restoration of runx3 expression. these findings could explain why knockdown of ezh2 by sirna transfection was capable of restoring runx3 expression. knockdown of ezh2-induced runx3 protein expression in gastric cancer cells to determine whether ezh2 down - regulates the runx3 protein, we used immunofluorescence to investigate whether a decrease in the ezh2 protein level would restore runx3 protein expression. a western blot analysis in the mkn28 cells following knockdown of ezh2 by sirna transfection showed that runx3 protein was significantly up - regulated (fig. 4a). immunofluorescence staining confirmed that expression of the runx3 protein had been restored in both the nucleus and cytoplasm (fig. 4b), and this finding demonstrated that ezh2 overexpression down - regulates runx3 protein in cancer cells. figure 4.knockdown of ezh2-restored runx3 expression and decreased cell proliferation by the cancer cell lines. a, runx3 re - expression in mkn28 cells was detected by western blot analysis at 96 h after ezh2 knockdown. b, the nuclear and cytoplasmic distribution of runx3 was restored in mkn28 cells transfected with ezh2 sirna (ezh2, green ; runx3, red). c, 48 h after transfection with ezh2 sirna or control sirna, cells were re - seeded in new dishes at a density of 1.0 10 cells and counted. a, mkn28 ; b, mcf-7 ; c, lncap ; d, dld1 ; e, miapaca2. knockdown of ezh2-restored runx3 expression and decreased cell proliferation by the cancer cell lines. a, runx3 re - expression in mkn28 cells was detected by western blot analysis at 96 h after ezh2 knockdown. b, the nuclear and cytoplasmic distribution of runx3 was restored in mkn28 cells transfected with ezh2 sirna (ezh2, green ; runx3, red). c, 48 h after transfection with ezh2 sirna or control sirna, cells were re - seeded in new dishes at a density of 1.0 10 cells and counted. a, mkn28 ; b, mcf-7 ; c, lncap ; d, dld1 ; e, miapaca2. ezh2 knockdown had an effect on cancer cell proliferation at least part of the tumor suppressor activity of runx3 is thought to be associated with its ability to induce p21 expression (21). loss of runx3 is thought to play a critical role in the process of tumor cell proliferation, and because ezh2 down - regulates runx3 expression, we investigated the effect of ezh2 on cell proliferation by testing the growth inhibitory effect of ezh2 sirna in all five cancer cell lines, gastric cancer, breast cancer, prostate cancer, colon cancer, and pancreatic cancer lines. at 48 h after transfection with ezh2 sirna or control sirna, 4c, cell growth started 24 h after re - seeding (72 h after transfection), and there was significantly less cell growth by the ezh2 sirna - treated cells than by the control cells (fig. ezh2 overexpression also correlated with loss of runx3 in gastric adenocarcinoma tissue because ezh2 overexpression correlated with loss of runx3 expression in all five cancer cell lines examined in this study and hdac1-mediated histone modification by ezh2 acted synergistically with dna methylation in the promoter region to silence runx3 expression, we investigated cancer tissue specimens for such a correlation to determine whether this repressive synergism would silence runx3 expression in a clinicopathologically relevant context (fig. 5, a c). to determine whether the runx3 silencing pathway by ezh2 exists in vivo, immunohistochemical staining was used to examine 17 gastric adenocarcinomas and adjacent non - cancerous gastric mucosa for dna methylation in the runx3 promoter, overexpression of ezh2 protein, and runx3 expression. to test for dna methylation and/or histone modification by ezh overexpression, we investigated individual cases with gastric cancer in vivo. the msp analysis showed dna hypermethylation in 64.7% (11/17) of the gastric adenocarcinomas (fig. immunohistochemical staining showed a slight difference in the distribution of runx3-positive cells in the fundic gland and pyloric gland portions. in the fundic gland portion, runx3-positive cells were observed mainly in a deeper zone of the fundic glands, corresponding to chief cells morphologically. a slight amount of runx3 protein was also detected in the surface epithelial cells in the gastric pits. in the pyloric gland portion, scattered runx3-positive cells were observed in the lower half of the antral mucosa near the generative zone. in contrast to the surrounding non - cancerous epithelial cells, weak to moderate cytoplasmic and/or nuclear positivity was observed in the gastric cancer cells in some of the specimens (5/17, 29.4%). ezh2 is normally expressed in the neck region of the gastric foveolae, which is the proliferative zone for gastric mucosa (data not shown) and in the germinal center follicular lymphocytes (fig. the percentage of specimens that showed overexpression of ezh2 (described as positive in table 1) according to the results of immunohistochemical staining was 82.3% (14/17). interestingly, all (case numbers 13, 15, and 17) of three specimens with dna methylation in the promoter of runx3 and negativity for ezh2 overexpression showed runx3 expression (fig. on the other hand, four (case numbers 2, 5, 6, and 8) of five specimens without both runx3 expression and dna methylation in the promoter of runx3 showed ezh2 overexpression (fig. this suggests that the loss of runx3 expression is mediated by histone methylation at lys by ezh2 overexpression in vivo. moreover, no dna methylation or ezh2 overexpression was observed in one specimen (case number 15) showed runx3 expression. these results seem to mean that the effects on runx3 expression described above are not limited to cultured cells but occur in vivo as well. however, runx3 expression was detected in one specimen (case number 7) despite the presence of both dna methylation and ezh2 overexpression. this finding seems to suggest the existence of an unknown mechanism of runx3 repression and further study will be necessary. table 1relationship between runx3 methylation, overexpression of ezh2 protein, and loss of runx3 protein in gastric cancer tissuecase no.agegenderhistologyptpnpmptnmmsp-runx3ezh2runx3runx3-localization 1 61 m sig t1 n0 m0 ia methylated positive negative 2 52 f tub t3 n1 m0 iiia unmethylated positive negative 3 74 f tub t3 n1 m0 iiia methylated positive negative 4 55 f por t3 n2 m0 iiib methylated positive negative 5 57 f por t4 n1 m0 iv unmethylated positive negative 6 58 m por t1 n1 m0 ib unmethylated positive negative 7 75 m tub t1 n0 m0 ia methylated positive positive c 8 54 f sig t1 n1 m0 ib unmethylated positive negative 9 65 m sig t2a n0 m0 ib methylated positive negative 10 77 m tub t2a n1 m0 ii methylated positive negative 11 58 f tub t1 n0 m0 ia unmethylated positive positive c 12 60 m tub t2b n3 m0 iv methylated positive negative 13 66 f por t2b n1 m0 ii methylated negative positive n and c 14 68 f por t2b n0 m0 ib methylated positive negative 15 66 m tub t3 n2 m0 iiib unmethylated negative positive n and c 16 65 f tub t2b n2 m0 iiia methylated positive negative 17 57 m por t1 n0 m1 iv methylated negative positive c ahistology : sig, signet - ring cell carcinoma ; tub, tubular adenocarcinoma ; por, poorly differentiated adenocarcinomabmethylation status of runx3 by methylation - specific pcr (msp)cezh2 overexpression was evaluated by immunohistochemical stainingdrunx3 expression was evaluated by immunohistochemical stainingerunx3 protein was localized in nucleus (n) or / and cytoplasm (c) relationship between runx3 methylation, overexpression of ezh2 protein, and loss of runx3 protein in gastric cancer tissue histology : sig, signet - ring cell carcinoma ; tub, tubular adenocarcinoma ; por, poorly differentiated adenocarcinoma methylation status of runx3 by methylation - specific pcr (msp) ezh2 overexpression was evaluated by immunohistochemical staining runx3 expression was evaluated by immunohistochemical staining runx3 protein was localized in nucleus (n) or / and cytoplasm (c) figure 5.dna methylation of the runx3 promoter, and expression of ezh2 protein and runx3 protein detected by immunohistochemical staining in tissue specimens from 17 gastric cancers. a, dna methylation of the runx3 promoter was detected by msp analysis in 11 of the 17 specimens (64.7%). primer sets that specifically amplified either methylated dna (m) or unmethylated dna (u) were the same as used in the msp analysis of the five cancer cell lines in fig. n, non - cancerous tissue ; t, tumor tissue. ma, 200- and 300-bp dna ladder markers. b and c, histological appearance of the gastric cancer stained with h&e (hematoxylin and eosin) and immunohistochemically for ezh2 and runx3. immunohistochemical stainings for ezh2 and runx3 proteins were performed using two continuous thin tissue sections to show the inverse correlation of expression of ezh2 and runx3 proteins in individual cancer cells. the areas of cancer tissue surrounded by square boxes were magnified to show the expression or repression of ezh2 protein and runx3 protein of individual cancer cells. in b (case number 13), ezh2 is normally expressed in the germinal center follicular lymphocytes, whereas runx3 is normally expressed in the lymphocytes. in b (case number 13), dna methylation in the runx3 promoter was detected in msp analysis (a), but runx3 expression is observed in gastric cancer cells. on the other hand, in c (case number 2), loss of runx3 is observed in gastric cancer cells, but no dna methylation of the promoter region was detected in msp analysis (a). dna methylation of the runx3 promoter, and expression of ezh2 protein and runx3 protein detected by immunohistochemical staining in tissue specimens from 17 gastric cancers. a, dna methylation of the runx3 promoter was detected by msp analysis in 11 of the 17 specimens (64.7%). primer sets that specifically amplified either methylated dna (m) or unmethylated dna (u) were the same as used in the msp analysis of the five cancer cell lines in fig. n, non - cancerous tissue ; t, tumor tissue. ma, 200- and 300-bp dna ladder markers. b and c, histological appearance of the gastric cancer stained with h&e (hematoxylin and eosin) and immunohistochemically for ezh2 and runx3. immunohistochemical stainings for ezh2 and runx3 proteins were performed using two continuous thin tissue sections to show the inverse correlation of expression of ezh2 and runx3 proteins in individual cancer cells. the areas of cancer tissue surrounded by square boxes were magnified to show the expression or repression of ezh2 protein and runx3 protein of individual cancer cells. in b (case number 13), ezh2 is normally expressed in the germinal center follicular lymphocytes, whereas runx3 is normally expressed in the lymphocytes. in b (case number 13), dna methylation in the runx3 promoter was detected in msp analysis (a), but runx3 expression is observed in gastric cancer cells. on the other hand, in c (case number 2), loss of runx3 is observed in gastric cancer cells, but no dna methylation of the promoter region was detected in msp analysis (a). the polycomb group (pcg) protein ezh2, a histone methyltransferase and component of the prc2 complex, is the product of a well known oncogene and a marker of poor prognosis in various cancers, including prostate cancer and breast cancer (18, 19). the mechanism underlying ezh2 overexpression associated with poor prognosis and the target genes down - regulated by ezh2, which lead to oncogenic activity, are still unknown. the mechanism of regulation of runx3 by ezh2 reported above may shed some light on the mechanism underlying ezh2 overexpression. polycomb target genes are often silenced by histone deacetylation and dna methylation of cpg islands (30), and this is explained by the ability of pcg proteins to bind histone deacetylases and recruit dna methyltransferases. we used tsa, a cell permeable inhibitor of histone deacetylases, to investigate whether expression of the runx3 gene is also controlled by histone deacetylation, and exposure of the five cancer cell lines to tsa for 48 h actually resulted in a 2.526.2-fold increase in the runx3 transcript level (fig., these findings strongly indicate that the runx3 gene is also silenced by histone deacetylation. to test in detail, we performed chip experiments with antibodies against hdac1. after transfection with control sirna, both regions of the runx3 promoter examined were bound to hdac1 in the mkn28 and mcf-7 cell lines (fig. 2a), both of whose runx3 transcript levels were restored only by tsa treatment for 48 h. by contrast, after transfection of these two cancer cell lines with ezh2 sirna, less hdac1 was bound to both regions of the runx3 promoter examined when runx3 expression was restored (fig. this suggests that down - regulation of runx3 may be mediated by both h3k27 trimethylation by ezh2 and histone deacetylation by hdac1. a previous study also showed restoration of both runx3 transcript and runx3 protein levels in breast cancer cell lines including mcf-7, t47d, and mda - mb-231 by tsa alone (27). moreover, the results of our study showed that ezh2 and hdac1 act synergistically to down - regulate runx3 expression. hypermethylation of runx3 had been found to be common in many types of cancer cell lines and to correlate with loss of runx3 expression, and in the present study we found that 5-aza - dc, an inhibitor of dna methyltransferase, promoted expression of the runx3 gene in five cancer cell lines by 1.510.9-fold (fig. e), indicating that dna methylation also contributed to the repression of runx3. a comparison between dna methylation and hdac1 binding (histone deacetylation) to determine which was more effective in repressing runx3 showed that the level of runx3 transcript restoration by tsa was much greater than by 5-aza - dc in four of the cancer cell lines, the exception being the miapaca2 line (fig. e). in our study, ezh2 knockdown by transient sirna transfection restored the runx3 transcript level 3.510.4-fold without any change in the dna methylation status of the runx3 promoter region (fig. this finding indicates that histone modification by ezh2 plays a key role in down - regulation of runx3, in addition to dna methylation in the promoter. ezh2 expression has been proposed as a marker of invasion and aggressive tumors (18, 19, 31), and experimental data have indicated a role of ezh2 in cell cycle regulation and proliferation. for example, disruption of ezh2 expression retards cell proliferation and induces cell cycle arrest at the g2-m transition (16), and overexpression of ezh2 in cultured mouse embryonic fibroblasts has been found to shorten the g1 phase of the cell cycle and lead to accumulation of cells in the s phase (17). a significant association between ezh2 and tumor cell proliferation, as estimated in human tumor tissue by ki-67 expression and mitotic count, was recently demonstrated in clinical specimens including specimens of cutaneous melanoma and cancers of the endometrium, prostate, and breast (32). by contrast, runx3 up - regulates p21, an important factor in cyclin - dependent kinase inhibition and cell cycle control (21). it was suggested that down - regulation of runx3 by ezh2 overexpression shown in the present study may be one pathway by which ezh2 affects tumor cell proliferation. in summary, in this study, we showed that increased expression of ezh2 results in h3k27 trimethylation of the runx3 gene, indicating that runx3 is a novel ezh2 target gene. the identification of runx3 as an ezh2 target gene can support an influence of ezh2 overexpression on increasing tumor cell proliferation. our findings suggest that specific inhibitors of ezh2 may be useful in the treatment of several types of cancers because such inhibitors are expected to reverse the down - regulation of the tumor suppressor runx3.	overexpression of enhancer of zeste homologue 2 (ezh2) occurs in various malignancies and is associated with a poor prognosis, especially because of increased cancer cell proliferation. in this study we found an inverse correlation between ezh2 and runx3 gene expression in five cancer cell lines, i.e. gastric, breast, prostate, colon, and pancreatic cancer cell lines. chromatin immunoprecipitation assay showed an association between ezh2 bound to the runx3 gene promoter, and trimethylated histone h3 at lysine 27, and hdac1 (histone deacetylase 1) bound to the runx3 gene promoter in cancer cells. rna interference - mediated knockdown of ezh2 resulted in a decrease in h3k27 trimethylation and unbound hdac1 and an increase in expression of the runx3 gene. restoration of runx3 expression was not associated with any change in dna methylation status in the runx3 promoter region. runx3 was repressed by histone deacetylation and hypermethylation of a cpg island in the promoter region and restored by trichostatin a or / and 5-aza-2-deoxycytidine. immunofluorescence staining confirmed restoration of expression of the runx3 protein after knockdown of ezh2 and its restoration resulted in decreased cell proliferation. in vivo, an inverse relationship between expression of the ezh2 and runx3 proteins was observed at the individual cell level in gastric cancer patients in the absence of dna methylation in the runx3 promoter region. the results showed that runx3 is a target for repression by ezh2 and indicated an underlying mechanism of the functional role of ezh2 overexpression on cancer cell proliferation.
the functioning of intracellular compartments requires numerous soluble proteins to be recruited from the cytosol to specific organelles or vesicles. the principal landmarks used in eukaryotes are the phosophoinositide lipids and the small gtpases of the arf and rab families (di paolo and de camilli, 2006 ; gillingham and munro, 2007 ; pfeffer, 2013). of these three families, the largest is the rabs of which at least twenty were apparently present in the last common ancestor of all eukaryotes (klpper., 2012). this expanded to over 30 families in early metazoan evolution, and later genome duplications in vertebrates generated closely related paralogs to bring the total in humans to 66. the importance of rabs is also reflected in mutations in several being linked to disease and by their being modified by intracellular pathogens to subvert membrane traffic (hutagalung and novick, 2011 ; stenmark, 2009). rabs function by cycling between an inactive guanosine diphosphate (gdp)-bound state and an active guanosine triphosphate (gtp)-bound state that is stably associated with membranes as it can not be recognized for extraction by the rab chaperone gdp - displacement inhibitor (gdi). rab effector proteins bind only to the gtp - bound state and so are recruited to only those membranes on which the rab is active. the activation of rabs by exchange of gdp for gtp is directed by specific guanine nucleotide exchange factors (gefs), with the rabs being then inactivated by specific gtpase activator proteins (gaps). the mechanisms by which the gefs and gaps act together to control the distribution of rabs is only starting to emerge, but both targeting and local activation seem likely to be important (barr, 2013 ; palamidessi., 2013). most gefs and gaps are peripheral membrane proteins and, in some cases, have been found to be recruited by other rabs, raising the possibility that a network of negative and positive interactions between rabs sets up the spatial organization of subcellular compartments (hutagalung and novick, 2011). the investigation of the function of individual rabs has been driven by the identification of the effectors that they recruit to membranes. most effectors have been identified by yeast - two hybrid screens or affinity chromatography of cytosol using forms of the rabs that carry mutations that lock them in a gtp - bound state. known effectors include tethering factors that link organelles and vesicles prior to homotypic or heterotypic fusion, linkers for the motor proteins that direct organelle movement, and regulators of rabs and other gtpases or lipid species (hutagalung and novick, 2011 ; pfeffer, 2013). thus, a picture has emerged of rabs directing membrane traffic but also serving as landmarks for other proteins that need to reside on a particular compartment or vesicle. however, for many rabs, there are few, if any, effectors known, and indeed the function of many rabs remains unclear, including several of those conserved since the emergence of eukaryotes. thus, the identification of more rab effectors could reveal much about the organization of membrane traffic and the regulation of rabs themselves. in addition, it has the potential to identify organelle specific proteins, as the peripheral membrane proteins that are recruited by rabs are likely to become dissociated during the fractionation procedures used to purify organelles biochemically. affinity chromatography can identify many effectors simultaneously with the benefit that those in stable complexes should be isolated with their normal binding partners. this approach has been applied with great success to rab5, but attempts to apply it in parallel to larger sets of human rabs have had more limited success (christoforidis., 1999 ; kanno., 2010). our studies in drosophila on the binding of rabs to golgi coiled - coil proteins indicated that affinity chromatography could work well with drosophila rabs (sinka., 2008). drosophila have the advantage that they have a simpler set of rabs than humans do, as they lack the expansion to families of paralogs that occurred during the evolution of vertebrates (klpper., 2012 ; zhang. nonetheless, they have close homologs of most human rabs (and only a few rabs that are insect specific), and many key events in membrane traffic appear well conserved between humans and flies. therefore, we present here the outcome of parallel affinity purifications using a comprehensive set of rabs from drosophila. for a large subset of these rabs in addition, we found dozens of proteins that showed similarly specific interactions, including known components of vesicle traffic, but also other proteins including those lacking a known function. we present here the entire data set, as well as validation of over 20 of the previously unreported interactions. drosophila melanogaster has 27 rabs, of which 23 have at least one mammalian ortholog, with these mammalian orthologs representing 50 of the 66 human rabs (figures s1a and s1b available online). all 23 drosophila rabs that have a mammalian ortholog were expressed as fusions to glutathione s - transferase (gst) with the ql mutation that is known in several rabs to stabilize the gtp - bound form (hyvola., 2006 ; li and stahl, 1993). they were coupled to glutathione sepharose for affinity chromatography of lysates of drosophila s2 cells, a widely used cell line thought to be from a macrophage - like lineage (figure 1a). s2 cells were lysed in the detergent chaps, and the clarified lysate was applied to each gst - rab column. the gel lanes above the gst - rab (4550 kda) were cut into sections and digested with trypsin, and peptides were sequenced by tandem mass spectrometry (table s1). to investigate the effectiveness of this approach, we examined the results for rab5, the major rab on early endosomes and the one that probably has the best characterized set of effectors from mammalian studies (christoforidis., 1999). a variety of methods can be used to analyze mass spectrometry outputs from parallel isolations. perhaps the simplest is to compare across all the baits the total number of tandem mass spectra that match peptides from a given protein (referred to here as spectral counts). figure 1b plots the spectral counts for all proteins associated with gst - rab5 against their counts from the material bound to gst alone (data appear in table s1a). most of the proteins that have high spectral counts with rab5 and none with gst alone are drosophila orthologs of known rab5 effectors or are proteins that have not been reported to bind rab5 but are known to be involved in endosomal function (discussed later). in contrast, typical nonspecific binders such as heat shock proteins and elongation factors showed similar spectral counts in both samples. comparison of spectral counts to published mrna expression data for the corresponding proteins revealed that known rab5 effectors and endosomal proteins were expressed at much lower levels than the nonspecific binders, implying that they had been enriched to a much greater extent by rab5, consistent with their being specific interactors (figure 1c). since we examined many rabs in parallel, our data also indicate the degree to which an interaction is specific to one particular rab. comparing the spectral counts for the proteins bound to rab5 with those from other rab columns showed that, for the known effectors and early endosomal proteins, few, if any, peptides were found in the eluates from other rabs (figure 1d). we used the s score from the comppass platform, which gives greater weight to interactions seen with fewer baits (sowa., 2009). the s score worked well to promote known rab5 effectors in the rankings, along with some of the known endosomal proteins (figure 1e and table s1b). during optimization of cell lysis, we found that nonspecific binding of proteins from inside organelles could be reduced by lysing cells without detergent, with detergent only being added in the washes of the column. we thus generated a second data set using this approach, analyzing proteins both above and below the gst - rab following gel separation, and also obtained a good yield of known rab5 effectors (figure 1f and table s2). although the data were cleaner, some known effectors were lost or reduced, which appeared, in at least some cases, to be due to poor solubilization in the absence of detergent (data not shown). rab3, rab8, rab27, rab32, and rab40 were also included in this second data set but either expressed poorly or showed few specific effectors (table s2), but for all other rabs, we used the results from both data sets in our analysis (see table s3 for the combined data). studies on mammalian rab5 have identified numerous effectors, and we found many of these in both data sets. these include drosophila orthologs of rabankyrin-5, rabaptin-5, rabex-5, rabenosyn-5, huntingtin, kif13a, vps34, and ccz1. in addition to known rab5 effectors, we found several proteins whose mammalian orthologs are localized to endosomes but whose rab5 association has not been reported. these include uhrf1bp1 (cg34126 in drosophila), hook, and its binding partners aktip (cbx) and fam160a2 (cg3558) (otto., 2010 ; in addition, we found orthologs of mammalian proteins linked to endosomal function but whose localization has not been investigated. these include lethal giant discs (cc2d1a / b in humans), cg11490 (rab7 gap tbc1d15/17), and all three of the uncharacterized novel (as described by collinet., 2010) proteins that were reported to affect endosome morphology when knocked down in a genome - wide rnai screen (cg6607/ccdc128, cg9986/c12orf4, and the tbc domain rab gap cg4041/tbck ; collinet., 2010). finally, there were some conserved proteins that have no known function, such as rodgi and cg8270, the drosophila ortholog of human c18orf8. most of the rab columns, including rab5, bound gdi, the protein that extracts gdp - bound rabs from membranes. this likely reflects incomplete gtp loading of the columns and thus highlights the fact that rab - specific interactors will include true effectors and, potentially, some proteins that prefer the gdp - bound state. to test whether the aforementioned proteins are likely to represent rab5 effectors, i.e., preferentially bind rab5-gtp, we selected cg6607 (ccdc128) and cg11490 (tbc1d15/17). both were expressed in s2 cells as gfp fusions, and affinity chromatography showed that they preferentially bound to gtp - bound rab5, with cg6607 also colocalizing with rab5 in s2 cells (figures 1 g and 1h). in addition, antibodies to endogenous hook confirmed it to be specifically enriched on the rab5 column (figure s1c). taken together, these results show that our approach has successfully identified many bona fide rab5 effectors, including some not previously reported. this suggested that we would find effectors for at least some of the other rabs, so we examined the sets of proteins found associated with each rab. rab2 is widely conserved in evolution, being present in mammals, plants, and protozoa. it has been lost from a few organisms, including budding yeasts, and its role is not entirely clear. it is found on the golgi apparatus and has been proposed to have a role in er - to - golgi traffic or in the formation of secretory granules (edwards., 2009 ; short. deletion of rab2 from c. elegans perturbs secretory granule formation and the maturation of phagosomes, suggesting a role in the endocytic pathway (guo. these include golgin-45, and ica-69 a bar domain protein (short., 2001). their function is unknown, but c. elegans ica-69 is also required for the formation of secretory granules (edwards., 2009). rab2 has also been reported to bind to the golgi coiled - coil protein complex gm130/p115 (short., 2001), and our previous studies found that drosophila rab2 binds to further golgins, gmap, dgcc88, dgcc185, and dgolgin-245 (sinka., 2008). five of these seven known effectors showed highly specific interactions with rab2 in both sets of conditions, and a sixth, dgolgin-245, was found in one set (figure 2a). the exception is ica-69 (cg10566), whose mrna is expressed at the lowest levels in s2 cells, being primarily expressed in the nervous system. in addition, many other proteins bound specifically to the rab2 column, including those with a role in membrane traffic and others previously uncharacterized. both sets of conditions produced subunits of the hops complex that is found on endosomal membranes and acts in membrane tethering and fusion. in yeast, a second complex called corvet shares four subunits with hops, with each complex having additional unique subunits. corvet binds to yeast rab5 via a corvet - specific subunit, vps8, but nothing has been reported about rab interactions in metazoans or even whether the subunits form this pair of complexes (balderhaar and ungermann, 2013). notably, four of the shared subunits were also found with rab5 using detergent lysis conditions. however, the pattern of additional subunits was not the same for the two rabs. vps39 and vps41 were only found with rab2, while vps8 was found only with rab5 (figure 2b). strikingly, the rab2 subunit set corresponds to those found in hops rather than corvet, indicating that the two distinct tethering complexes found in yeast are conserved in metazoans and that hops interacts with rab2 while corvet interacts with rab5. of the two hops - specific subunits, the largest number of spectra was found with vps39, and so it seemed a good candidate to interact with gtp - bound rab2, and this was confirmed by yeast two - hybrid and in vitro binding (figures 2c and s2a s2c). an interaction between golgi - localized rab2 and an endosomal tether may seem surprising, but it provides a possible explanation for the effects of rab2 deletion on phagocytosis in c. elegans (guo., 2010). notably, although rab2 was on the golgi when expressed in s2 cells, when it was expressed as a gtp - locked form (rab2q65l), we observed large swollen structures which colocalized with the late endosomal marker rab7 (figure 2d). the rab2q65l could recruit rab2 effectors to these structures, including vps39, and we were able to use this to map the interaction to the n - terminal region predicted to form a -propeller (figures 2e, s2d, and s2e). we speculate that rab2 can traffic on carriers from golgi to endosomal structures, with gtp hydrolysis being required for its release from endosomes. the dynein adaptor bicaudald (bicd) is a known effector for rab6 (short., the interaction with rab2 was gtp specific, suggesting that rab2 also contributes to the recruitment of minus - end - directed motors to the golgi (figure 2f). bicd also showed gtp - dependent binding to rab30 and to the rab2 relative rab39 (discussed later). several uncharacterized proteins were found enriched in the rab2 eluate and could be confirmed as effectors : cg4925 is the drosophila ortholog of human c10orf118 with both proteins predicted to be primarily coiled - coil (figure 3a). it bound the gtp form of rab2 by affinity chromatography and yeast two - hybrid, via the c - terminal 200 residues (figures 3b, s3a, and s3b). epitope - tagged cg4925 localized to the trans - golgi in s2 cells and relocalized to the enlarged endosomes induced by overexpression of rab2q65l (figures 3c and 3d). the mammalian protein is also on the golgi and binds rab2 and the golgi via its c - terminal region (figures 3e and s3c). given that extensive coiled - coils and c - terminal attachment via a g protein are typical for the golgin coiled - coil proteins, we propose that this protein is named golgin-104/dgolgin-104 in humans and flies. cg9590 is the drosophila ortholog of fam114a1/2, two closely related human proteins of unknown function. screening a panel of rabs by yeast - two hybrid showed binding to rab2 and a weaker interaction with rab14 (figures s3d and s3e). gfp - tagged cg9590 localized to the golgi in s2 cells and bound the gtp - form of rab2 and, more weakly, rab14 by chromatography (figures 3f and 3 g). it did not relocalize to the rab2q65l - induced swollen endosomes, suggesting that its membrane recruitment is stabilized by additional interactions (figure 3 g). gfp - tagged human fam114a1 and fam114a2 were also golgi localized (figure 3h ; data not shown). cg32485 is a member of the cral - trio (or sec14) family that binds lipids and other hydrophobic molecules. a rab2-gtp - specific interaction was confirmed by affinity chromatography and yeast two - hybrid interactions (figures 3i and s3f), and a gfp - tagged form of the protein showed faint but reproducible golgi staining (figure 3j). investigating every protein enriched on the rab2 column was beyond our scope, but for those looking at the list of unconfirmed interactions, we would highlight cg15523 (drosophila vps13b), the tbc domain rab gap cg5337 (drosophila tbc1d16), and the beach - domain family member mauve (cg42863) as all binding rab2 in both data sets and being known components of membrane traffic. rab4 is widely conserved in evolution but has been lost in various lineages including budding yeasts. it is localized to endosomes and is proposed to play a role in recycling back to the surface. the best characterized rab4 effector is rufy1 (or rabip4), one of three closely related paralogs (cormont., 2001). cg31064, the drosophila ortholog of these proteins, showed a strong and highly specific interaction with rab4 under both lysis conditions (which we confirmed to be gtp - specific using a gfp - tagged cg31064), indicating that the rab4-gtp was functional (figures 4a and 4b). in addition to cg31064, there were several other proteins that were specific to rab4 that have not previously been reported to be effectors. most striking were vps51, vps52, and vps53, three subunits of the garp tethering complex that is found on the golgi and involved in retrograde traffic from endosomes (bonifacino and hierro, 2011). these were found with or without detergent, and we were able to confirm that garp subunit binding is gtp specific (figure 4b). we also examined a garp subunit (vps53) in mammalian cells and found that it could be relocated to endosomes by overexpression of rab4 (figure 4c). in addition to vps51 - 53, garp in mammals, worms, and yeast contains a fourth subunit, vps54. this protein is present in drosophila and is expressed in s2 cells, but it was only observed in the rab4 eluate in one data set and at a low level. however, we noticed that, in both data sets, there was a high scoring protein recovered at a level similar to that of vps51 - 53 called cg4996, with the four proteins also showing an interaction with rab14. cg4996 has not been previously characterized, but we noticed that it is distantly related to vps54 over much of its length (figure s4). gfp - tagged cg4996 colocalized with rab4 in s2 cells and interacted with garp subunits by coprecipitation (figures 4d and 4e). these results suggest that the garp complex exists in a second version in which vps54 is replaced by cg4996, with the result that it can now interact with rab4. cg4996 is conserved from humans (ccdc132) to plants and protozoa, indicating that this is an ancient divergence. other rab4-specific proteins were not characterized, but the higher hits include synaptojanin, a lipid phosphatase involved in endocytosis, and cg43367, the drosophila ortholog of the human beach domain proteins nbeal1 and nbeal2, which have a role in the formation of lysosome - related organelles. localized to the trans - golgi, it is involved in retrograde traffic from endosomes and possibly exit from the trans - golgi network and retrograde trafficking from golgi to er. known rab6 effectors include the dynein adaptor bicaudald ; the lipid phosphatase ocrl1 ; the golgins tmf1, golgin-97, gcc88, and gcc185 ; the putative rab gef dennd5 ; and gorab / scyl1bp1 (hutagalung and novick, 2011). drosophila orthologs of five of these proteins were found associated with high specificity to the rab6 column, being bicd, cg3573 (ocrl1), cg33052 (gorab), dgolgin-97, and dgcc88 (figure 5a). the rab6 column also bound specifically other components of membrane traffic and some proteins whose function is less clear. cg8578 is the drosophila ortholog of two human proteins (lrrfip1/lrrfip2), with all three proteins predicted to be coiled - coil over much of their length (figure 5b). lrrfip1/2 have been reported to have a regulatory role in toll - like receptor signaling, although their function is unknown (dai., 2009). a gfp - tagged form expressed in s2 cells showed robust gtp - specific binding to rab6 and was localized to the golgi apparatus (figures 5c and s5a). cg11727 is the drosophila ortholog of the rab gap evi5 (and its paralog evi5l) that has been reported to act on rab11 and, possibly, other rabs (westlake., 2007). a gfp - tagged form of cg11727 expressed in s2 cells bound to rab6-gtp (figure 5d). since the protein contains a tbc rab gap domain, it was possible that this was responsible for the interaction with rab6. however, rab6-gtp binds to the c - terminal coiled - coil region of the protein (figures 5e and 5f), and this c - terminal region was sufficient for golgi localization (figure 5 g). we also observed an interaction with rab14 in the detergent lysate, which we could confirm, but in vitro binding to the c terminus was less pronounced, and in s2 cells, gfp - evi5 was not directed to rab14-coated endosomes (figures 5e and 5f ; figure s5b). this indicates that the rab11 gap, cg11727/evi5, is an effector of rab6 and, possibly, rab14 ; hence, it appears to be another example of crosstalk between rabs (grosshans., 2006). the trapp complex is found on the golgi apparatus and is an exchange factor for rab1 and, potentially, rab11. it has a core of six to seven small subunits plus several additional large subunits, and in metazoans, it exists in at least two versions that have different sets of large subunits (bassik., eight trapp subunits showed highly specific rab6 binding from detergent - free lysate, being six of the seven core subunits and both of the larger subunits that define trappii (trappc9 and trappc10) but none of the four trappiii - specific subunits (bassik., 2013). in addition, the detergent data set contained all three of the trappii subunits larger than the 45 kda size minimum for these data. of the other rab6-specific interactors, fat facets was found in both data sets and is a deubiquitinase that acts on a golgi - localized coat adaptor (lqfr, drosophila clint1) and whose mammalian ortholog fam / usp9x has been reported to be golgi localized (lee., 2009 ; murray., the drosophila orthologs of the membrane traffic component vps13d (cg32113), the inpp5f phosphoinositide phosphatase (cg7956), and some subunits of the retromer complex were also found in both data sets. rab7 is conserved in most eukaryotes and is localized to late endosomes. a duplication event during the emergence of metazoans created rab9, which is also on endosomes. previously reported effectors of rab7 include the dynein adaptor rilp and the two related proteins plekhm1 and rubicon (tabata., 2010). of these, drosophila plekhm1 (cg6613) was found in both data sets, and rubicon (cg12772) was found in one, suggesting that the gst - rab7 was functional, and we confirmed that the interaction with cg6613 was gtp specific (figures s5c and s5d). there were not many other high - scoring hits shared by both data sets, although one was cg12132 (c11.1), a heat repeat protein with several mammalian paralogs of unknown function. a gfp - tagged form of cg12132 localized to both the golgi and rab7-positive late endosomes, but not early endosomes (figure 5h), and we could detect a gtp - specific interaction by yeast two - hybrid, although not by affinity chromatography (data not shown). the putative rab7 interactors that we did not test include drosophila orthologs of spg11 and spg15, human spastic paraplegia proteins that form a complex on late endosomes (hirst., 2013). a range of proteins showed specific binding to the rab9 column (figure s5e). these did not include the two reported rab9 effectors (sgsm1/2) that have clear drosophila orthologs (cg1695/cg32506), although these are primarily expressed in the nervous system and not in s2 cells. however, we did observe that the golgi coiled - coil protein dgm130 bound rab9 in addition to rab2 and rab30, whose binding had been previously reported (sinka., 2008). this interaction could be confirmed as gtp specific using both affinity chromatography and yeast two - hybrid and was mapped to a central region of the protein (figures 5i and s5f). of the interactors not investigated, perhaps of most note is cg14299, which bound to both rab7 and rab9. this is the drosophila ortholog of epg-5, a protein involved in autophagy and endocytosis in c. elegans and mammals (zhao., 2013). in addition, rab9 showed specific binding to the drosophila orthologs of munc13 - 4 (cg11819), the lipid phosphatases inpp4a / b (cg42271), and the rab5 gap sgsm3 (cg12241) and shared with rab6 an association with two members of the vps13 family, which has an unknown role in endosomal function. rab18 is conserved from humans to plants and is absent from only a few species, including a subset of budding yeasts. its function is enigmatic, with evidence for both a location to lipid droplets and a role in traffic in the er - golgi circuit, but no effectors have been reported (dejgaard., 2008 ; ozeki. mutation of the single rab18 gene in humans causes the recessive developmental disorder warburg micro syndrome (bem., 2011). two other warburg genes, rab3gap1 and rab3gap2, encode the two subunits of rab3gap, which was reported to act on rab3 but has recently been shown to be a gef for rab18 (gerondopoulos., several proteins bound with high specificity to rab18 (figure 6a). these include subunits of the dsl1 complex (or nrz in mammals), which is localized to er membranes and tethers and then fuses vesicles returning from the golgi (civril., 2010 ; these subunits (zw10, rod, zwilch, rint1, and syntaxin-18) were only recovered from the detergent lysate, consistent with syntaxin-18 being a snare with a transmembrane domain. the only subunits not detected were two further snares, which are below the 45 kda minimum of this data set. antisera against two nrz subunits confirmed the interaction with rab18 and showed it to be gtp specific (figure 6b). in s2 cells, red fluorescent protein (rfp)-rab18 colocalized with er and early golgi, and with gfp - tagged zw10 (figures s6a and s6b). these results suggest that rab18 may assist the tethering of copi - coated vesicles to the er. in mammalian cells, rab18 localizes to the er and golgi, but when overexpressed, it accumulates on lipid droplets (ozeki., 2005). when we overexpressed rab18 in mammalian cells, the endogenous nrz subunits shifted from a diffuse distribution to being clustered around lipid droplets (figures 6c and s6c). in addition, when human rab18 was used for affinity chromatography of human cell lysates, subunits of nrz were among the most abundant proteins showing gtp - specific binding (figure s6d). the physiological relevance of overexpressed rab18 being on lipid droplets is unclear, but these data at least indicate that its interaction with nrz is relevant to mammalian cells and would explain why overexpression of rab18 induces an association between lipid droplets and er (ozeki., 2005). we also observed in both data sets an interaction between the putative rab gap cg8449 (tbc1d5) and both rab18 and rab6. the substrate of this gap is unknown, but both rabs showed a gtp - specific interaction by in vitro binding, and when overexpressed, they increased the recruitment of gfp - tbc1d5 to the golgi (figures 6d and 6e). the detergent data contained lrrk, the drosophila ortholog of human lrrk2, the most common genetic determinant of parkinson s disease (dodson., 2012). the role of this protein is unclear, but we could confirm a gtp - specific interaction with rab18 (figure 6f). finally, spartin, the drosophila ortholog of the protein encoded by the spastic paraplegia gene spg20 was rab18 specific in both data sets, and we confirmed that this interaction was gtp dependent (figure 6f). notably, one of the several roles proposed for spartin is a function on lipid droplets (renvois., 2012). these include cg31935, the drosophila ortholog of the rab3gap catalytic subunit whose human mutation causes the same warburg syndrome as rab18 mutations. this showed binding to rab5 and rab18 under both sets of conditions, and its regulatory subunit (cg7061/rab3-gap) was found with the same rabs in one data set ; human orthologs of both proteins bound specifically to human rab18-gtp (figure s6d). rab19 emerged in metazoans as an expansion from rab1, and humans have two paralogs, rab19 and rab43, with the latter implicated in traffic between endosomes and golgi but lacking known effectors. we found that pollux (plx) gave high specificity rab19 binding in both data sets (figure s6e). plx is the drosophila ortholog of the related human rab gaps tbc1d1 and tbc1d4/as160 that regulate the insulin - controlled traffic of the glucose transporter glut4 and have been linked to obesity (bogan, 2012). gfp - tagged plx localizes to the golgi along with rab19 in s2 cells, and the interaction with rab19 was gtp specific by affinity chromatography (figures 6 g and 6h). it is on the golgi, but its precise role is unclear (kelly., 2012). we previously found that drosophila rab30 binds to the golgins dgcc88, dgolgin-97, dgolgin-245, and dgm130 (sinka., 2008). of these four, three were high - specificity hits under both sets of conditions (along with p115, the binding partner of gm130), indicating that gst - rab30 was functional (figure 7a). in addition to these known hits, we found in both data sets ik2, one of two drosophila orthologs of the mammalian ib kinases that act in nf-b signaling (dubin - bar., 2008). ik2 forms a complex with spn - f, and both proteins have been reported to have a punctate distribution in s2 cells (dubin - bar., 2008), which we confirmed corresponds to the golgi apparatus (figure s7). rab30 interactors from the detergent lysate included the dynein adaptor bicd (that also binds rab6 and rab2) and all eight subunits of the exocyst complex that mediates tethering of golgi - derived vesicles at the plasma membrane, and we confirmed that both interactions were gtp specific (figure 7b). further rab30-specific hits that remain to be investigated include cg5168, the drosophila ortholog of wdfy1/2 that play a role in endocytosis ; cg7324, the ortholog of the mammalian tbc1d8/9 rab gaps ; cg7852, the dennd5 rab gef ; and all four subunits of the garp complex (but not cg4996, the vps54-like protein described earlier for rab4). it has two paralogs in humans, with rab39a being linked to caspase function, but its role in membrane traffic is unclear (becker., 2009). the top hit with drosophila rab39 was unc-104, the drosophila ortholog of the kinesin-3 kif1a (figure 7c). we noticed that the third hit was cg17360, a member of the plekhm family, of which a mammalian member recruits kinesin-1 to lysosomes (rosa - ferreira and munro, 2011). in vitro binding assays revealed gtp - dependent binding of gfp - cg17360 to rab39 regardless of whether unc-104 was coexpressed, whereas overexpressed unc-104 only bound efficiently when gfp - cg17360 was also expressed (figure 7d). in s2 cells, exogenous cg17360 localized with rab39 on the golgi and induced the golgi accumulation of unc-104 (figure 7e). these results indicate that cg17360 acts as a linker to recruit unc-104 to golgi membranes or golgi - derived carriers. cargos for long - range transport can move bidirectionally, and the dynein adaptor bicd was also present in the rab39 eluate and showed a gtp - specific interaction like that for rab2 and rab6 (figures 2f and 7f). we also found a high score for the protein ema, mutations in which cause defects in endosomal function, with variants in the mammalian ortholog clec16a being linked to several autoimmune diseases (hakonarson. ema associated with gst - rab39 in a gtp - dependent manner (figure 7f), and gfp - tagged ema was found on both the golgi and late endosomes in s2 cells. identification of the effectors of rabs is key to understanding cellular organization, and our results show that parallel affinity chromatography can do this effectively. we have found and validated interaction partners for 11 rabs, and for rab11, we found specific interactions with known effectors (drip11 and nuf). a further two rabs showed strong and specific interactions with membrane traffic machinery that we did not validate because of a lack of suitable reagents : rab26 with the spastic paraplegia proteins spg11 and spg15 (also found with rab7), and rab35 with the rab gef sbf (sbf1/2 in humans). for the remaining nine rabs, the lack of obvious specific interactions may have had several causes. in many cases, the recombinant rabs may have been inactive, as they expressed with poor yield (rab8, rab10, rab21, rab23, rab27, rab32, and rab40). in other cases, such as rab3, the rab is expressed predominantly in brain and at only very low levels in s2 cells (jin., 2012 ; figure s1b), so it is possible that their effectors are absent from s2 cells. one advantage of seeking effectors using affinity chromatography rather than yeast two - hybrid screens is that it allows isolation of intact protein complexes, and, in some cases, it may be that no one individual subunit can bind the rab in isolation. this provides the opportunity to detect many, if not all, of the subunits of a complex rather than just that which binds the rab, as illustrated for multisubunit tethering complexes in figure 8a. the pattern of subunits isolated can reveal variants of particular complexes, such as our demonstration of garpii and providing evidence for corvet and hops coexisting in metazoans as well as yeast. however, a further consequence is that a protein that binds to a particular rab column may not bind directly but instead via one of the other specific interactors, such as our finding of cg17360 acting as a linker between rab39 and the kinesin unc-104. for a rab whose function is unknown, the set of effectors should give a strong indication of the rab 's in vivo role. for instance, for rab18, there are seemingly discrepant data for a role in the early golgi or on lipid droplets (dejgaard., 2008 ; ozeki., 2005) the binding of rab18 to the dsl1/nrz tethering complex would be consistent with retrograde traffic from early golgi to er, but rab18 also interacted with spartin, a protein linked to lipid droplet function, suggesting that rab18 may have a role in tethering multiple structures to the er. another example is rab2, which bound a range of golgi proteins, consistent with previous studies, but also bound the hops complex that mediates tethering and fusion to endosomes (peplowska., 2007). this suggests that, at least in some cell types, rab2 is on carriers coming from the golgi that fuse with endosomal compartments, hence providing an explanation for rab2 acting on phagosomes in addition to the golgi (guo., 2010). in yeast, the hops complex binds to ypt7 (balderhaar and ungermann, 2013), but we found only weak binding of two subunits to its ortholog rab7 (figure 8a). however, rab2 is conserved in many eukaryotes but lost in budding yeasts, with the same being true for arl8, another gtpase reported to bind to hops in metazoans (garg., 2011). therefore, it may be that, in the absence of these two gtpases, hops in yeast has become more reliant on binding rab7/ypt7. the types of protein that we found as validated interactors are consistent with the general trends seen among the rab effectors found in previous studies of individual rabs (hutagalung and novick, 2011 ; pfeffer, 2013 ; stenmark, 2009). the large number of vesicle tethers is consistent with the notion that rabs direct the initial contacts between transport carriers and their target organelle and, hence, are key determinants of the specificity of membrane traffic (yu and hughson, 2010). we also found interactions between rabs and various rab gaps and gefs. in some cases, these may be due to the rab being recognized as a substrate, but at least in one case, we were able to show that the interaction is gtp dependent and outside of the regulatory domain (rab6 binding to the ortholog of the rab11 gap evi5). in addition, specific interactions were found with regulators of phosophoinositides, molecules that share with rabs the function of recruiting specific proteins to organelles (di paolo and de camilli, 2006). tethers, motors, and identity regulators are not the only classes of effector found in previous studies ; consistent with this, we also found specific interactions with protein kinases and phosphatases. further studies will be required to determine if such signaling molecules regulate membrane traffic or other organelle - specific processes. notably, several of the previously unreported interactions that we found involved drosophila orthologs of human proteins linked to disease (figure 8b). some of these disease proteins have unclear functions, such as lrrk, huntingtin, spartin, and clec16a, and investigation of their rab interactions should, at the very least, reveal their cellular sites of action and so provide clues as to their in vivo roles. it is likely that parallel affinity chromatography could be further improved by advances in protein expression, affinity chromatography, and mass spectrometric analysis. even our current approach has provided a high yield of informative interactions ; thus, it seems likely that future application to other cell types and species will reveal much about the organization of membrane traffic and how the basic themes are varied to generate the diverse cell types of multicellular organisms. gtp - locked forms of drosophila rab proteins were expressed in e. coli as fusions to gst and coupled to glutathione sepharose beads. the rabs contained the q l mutations that stabilize members of this family in the gtp - bound state (hyvola. cell lysates were prepared from drosophila s2 cells using the detergent chaps or by dounce homogenization without detergent. after clarification, the lysates were applied to the gst - rab columns, and after washing and elution, the bound proteins were separated by sds - page. tryptic peptides obtained by in - gel digestion were identified using sequencing by tandem mass spectrometry. the proteins bound to different rabs were compared using spectral counts to give an approximate measure of abundance. to score the significance of interactors, we used the s score from the comppass platform (sowa., 2009). the s score assigns more confidence to proteins that interact with fewer baits (in this case, fewer rabs) and is, thus, a measure of specificity. for each rab, the bound proteins were ranked by the highest s score they showed with either chaps - based lysis or detergent - free lysis, and the data were displayed using the bubble blot function in microsoft excel. selected components of membrane traffic or proteins of unknown function were chosen for validation based on the availability of antibodies to the endogenous proteins or of full - length cdnas that could be tagged and expressed from plasmids transfected into cells. these reagents were used for localization studies in cells or to test binding to gdp- and gtp - locked forms of rabs using small - scale affinity chromatography. some cdnas were used for yeast two - hybrid analysis against a panel of drosophila rabs (sinka.,	summarythe rab gtpases recruit peripheral membrane proteins to intracellular organelles. these rab effectors typically mediate the motility of organelles and vesicles and contribute to the specificity of membrane traffic. however, for many rabs, few, if any, effectors have been identified ; hence, their role remains unclear. to identify rab effectors, we used a comprehensive set of drosophila rabs for affinity chromatography followed by mass spectrometry to identify the proteins bound to each rab. for many rabs, this revealed specific interactions with drosophila orthologs of known effectors. in addition, we found numerous rab - specific interactions with known components of membrane traffic as well as with diverse proteins not previously linked to organelles or having no known function. we confirm over 25 interactions for rab2, rab4, rab5, rab6, rab7, rab9, rab18, rab19, rab30, and rab39. these include tethering complexes, coiled - coiled proteins, motor linkers, rab regulators, and several proteins linked to human disease.
vitamin a deficiency is common in the developing world but has historically been rare in developed countries. despite this, a small number of patients with psychiatric conditions such as autism, food phobia and anorexia nervosa have been diagnosed with hypovitaminosis a related to food faddism [2, 3, 4, 5, 6, 7, 8, 9, 10 ]. we describe the cases of 2 teenage patients with a background of moderate autistic spectrum disorder who were diagnosed with a multivitamin deficiency, including vitamin a. their ophthalmic and systemic manifestations resolved with vitamin replacement therapy. a 14-year - old boy was admitted to the emergency department of a pediatric hospital complaining of bilaterally decreased visual acuity for 5 days and a persistent rash on the upper limbs for 10 weeks. his psychiatric history included a moderate autism spectrum disorder diagnosed at the age of 2, necessitating dedicated schooling. at presentation, the optic discs were mildly swollen bilaterally, and no relative afferent pupillary defect was recorded. the child was noted to have an increased bmi, and a follicular, erythematous rash was present, affecting predominantly the extensor surface of the upper limbs (fig. the initial differential diagnosis included optic neuritis and herpes zoster, given the vesicular appearance of the rash. the child was admitted and treated with intravenous methylprednisolone as well as intravenous acyclovir by the admitting team. mri and ct of the brain and the orbits as well as a lumbar puncture were performed, all of which were within normal limits. flash and pattern - reversal visual evoked responses were performed monocularly in each eye, and responses were within the normal range. two days after admission, the patient was seen by the ophthalmology team and was found to have a left relative afferent pupillary defect, bilaterally swollen optic discs and a featureless, dry conjunctiva with bitot 's spots (fig. his vitamin a level was undetectable (< 0.1 ng / ml), the vitamin b12 level was borderline (150 pg / ml), and the vitamin d level was found to be insufficient (32 ng / ml). an electroretinogram (erg) showed a marked attenuation of a and b waves in rod - isolated sequences (fig. 3), even though the patient did not describe nyctalopia and the parents denied observing any behavior suggestive of night blindness. single flash and 30-hz cone - isolated responses remained normal. on further questioning, the mother of the teenager attested to his severely restricted diet consisting almost entirely of bread and fried potatoes. a diagnosis of hypovitaminosis a was made with the presence of xerophthalmia, retinopathy and phrynoderma, a characteristic rash (fig. vitamin replacement therapy was commenced with daily oral vitamin a supplementation of 25,000 iu per day (vitasorb a, biocare, birmingham, uk), and an attempt to increase dietary vitamin intake. one month later, the phrynoderma had resolved, leaving pale, follicular scarring (fig. a 13-year - old boy, diagnosed with a moderate autistic spectrum disorder, attended the outpatient department with a 6-week history of bilateral decreased visual acuity, redness of the eyes, light sensitivity and an inability to keep his eyes open. he was commenced on a trial of topical steroids and lubricants with an initial diagnosis of severe adenoviral infection. a conjunctival biopsy was diffusely abnormal, with squamous metaplasia of the conjunctival epithelium, submucosal inflammation and marked keratinization (fig. serum vitamin a and d levels were obtained and showed an insufficient vitamin d level (< 15 ng / ml) and an undetectable level of vitamin a. a malabsorptive cause was eliminated, and the patient 's diet was found to be severely restricted. oral vitamin supplementation was commenced and an improvement was noted almost immediately, with the complete resolution of his symptoms within 1 week. vitamin a deficiency is a leading cause of childhood blindness worldwide, though historically rare in developed countries. it has been reported in the psychiatric literature that it can be related to food faddism in cases of autism [2, 3, 4, 5, 6, 7, 8 ] and eating disorders [9, 10 ], often related to a restricted diet, high in fried potatoes. there are also reports of this deficiency due to malabsorption from gastric bypass surgery, primary biliary cirrhosis and chronic giardiasis. there is a possibility that we may see increasing numbers of patients with hypovitaminosis a related to alcoholic liver disease in years to come. there have been 7 cases of vitamin a deficiency in autistic children reported in the literature since 1993 (table 1). ocular manifestations of vitamin a deficiency in this cohort include xerophthalmia, corneal ulceration, retinal pigment epithelial changes and optic atrophy. bitot 's spots are a pathognomonic sign of vitamin a deficiency and indicate conjunctival xerosis with a deposition of keratin in the conjunctival epithelium. the severity of the corneal disease in some cases warrants penetrating keratoplasty, for example that of steinemann and christiansen. yellow flecks at the level of the retinal pigment epithelium were reported by steinemann and christiansen. although no erg was performed prior to replacement with vitamin a, scotopic and photopic erg were within normal limits after treatment. report the case of an autistic child developing bilateral optic atrophy secondary to vitamin a deficiency. although 2 patients in this group reported nyctalopia, the rod - predominant retinopathy recorded in our patient has not previously been demonstrated on erg. interestingly, although our patient did display a rod retinopathy, which responded to vitamin a replacement, there was no evidence of any difficulty with night vision. we also note the parents description of a general decline in behavior in both patients, which was ameliorated by vitamin replacement therapy. it is unclear whether this change in behavior is related to the patients experience of their symptoms or a cognitive deficit secondary to malnutrition. the world health organization (who) recommendations for the treatment of vitamin a deficiency in the context of xerophthalmia advise an initial, immediate oil - based oral dose of 200,000 iu, followed by the same dose on days 2 and 14. this must be supplemented by 4-to 6-monthly doses of 200,000 iu. toad skin in greek, is a papular perifollicular eruption caused by follicular hyperkeratosis, which is historically linked to vitamin a deficiency. it was first reported by lucius nicholls in 1933, who observed the characteristic rash in malnourished african laborers. other dermatological manifestations of vitamin a deficiency include blepharitis, noted in our first patient, and cheilitis. in conclusion, although vitamin deficiencies in children are rare in developed societies, a low threshold for vitamin level testing should be undertaken in autistic spectrum disorder cases, highlighting the importance of enquiring about dietary habits. if vitamin deficiency is found, patients should also be investigated for malabsorption and hepatic pathology. it should also be emphasized that appropriate counseling of the patients parents, particularly with regard to a healthy diet and continued supplementation of vitamins, is essential to prevent a recurrence of hypovitaminosis.	we describe the cases of 2 autistic children with ophthalmic and systemic manifestations of vitamin a deficiency due to food faddism. although vitamin a deficiency is common in the developing world, reports in developed societies are rare. our patients presented over a 1-year period. the patients were 14 and 13 years old at the time of presentation and were both found to have marked features of vitamin a deficiency related to unusual dietary habits. anterior segment signs of xerophthalmia were present in both patients. in addition, patient 1 showed evidence of a rod - predominant retinopathy, which resolved with vitamin a supplementation. due to its rare occurrence, hypovitaminosis a must be highlighted and anticipated in this cohort.
leiomyomas are rare tumors that can arise anywhere in the gastrointestinal (gi) tract although they occur most frequently in the stomach, jejunum, or ileum.1 these tumors are quite rare in children ; only case reports or short case series are found in the literature.2 3 4 these tumors are often asymptomatic but can also present with an abdominal mass, obstruction, intussusception, volvulus, gi bleeding, or abdominal pain and should be resected if symptomatic. here, we present the rare case of a 16-year - old female patient with a gastric leiomyoma with an unusual immunohistochemical staining pattern. we used a method of laparoscopic - assisted endoscopic resection to completely excise the mass. a 16-year - old previously healthy female patient (weight, 67.5 kg ; height, 172 cm) presented to the emergency department after experiencing dizziness followed by syncope. upon arrival, she had an episode of hematemesis. further questioning revealed that the patient had two episodes of melena 24 hours before presentation. laboratory studies obtained in the emergency department were remarkable for hemoglobin of 7.4 g / dl. she was seen by the gastroenterology service and underwent nasogastric lavage, which was notable for blood clots. the patient was transfused one unit of packed red blood cells and admitted for further work up. on hospital day number 1, she underwent upper intestinal endoscopy ; a large gastric polypoid lesion was identified in the fundus / cardia region of the stomach. the polyp was approximately 2 3 cm and had a small 3 mm ulceration without evidence of active bleeding. a superficial biopsy of the polyp was obtained endoscopically, however, this was found to contain only normal mucosa on permanent section. the mass was very close to the gastroesophageal junction (gej), making surgical excision difficult, likely requiring excision of the gej. our team was faced with the dilemma of how to approach diagnosis and resection for this patient. given the possibility of benign pathology with the large morbidity of gej resection, we devised a plan to proceed with laparoscopic - assisted endoscopic resection of the polyp. with this approach, we felt we would be able to obtain a tissue diagnosis and resect the mass with minimum morbidity, while also acknowledging the risk of incomplete mass excision and need for second procedure pending pathology results. for this reason, after consultation with the family, she was scheduled for a laparoscopic - assisted endoscopic resection of the polyp approximately 2 weeks after her initial presentation. the procedure began with laparoscopic exploration of the gej and localization of the mass (camera, 5 mm 30 degree karl storz hd, karl storz, tuttlingen, germany, placed at the umbilicus). two 5-mm ports (mini step trocars, covidien plc, dublin, ireland) and one liver retractor (articulating circle retractor, 5 mm, 40 cm, snowden - pencer, waukegan, illinois, united states) were placed to visualize the proximal stomach. the mass was palpated with the laparoscopic instruments and was felt to be approximately 3 cm in diameter directly adjacent to the gej. the endoscope was then inserted and the mass was visualized near the gej with possible extension into the lower esophageal mucosa (fig. 1). the mass was successfully removed endoscopically using electrocautery and enucleation, utilizing the laparoscopic instruments to provide counter pressure and traction. given the location of the tumor so close to the gej, the laparoscopic instruments were critical to help position the mass for optimal endoscopic resection. the additional benefit of the laparoscopic assistance was real - time monitoring for evidence of gastric perforation. no gastric perforation occurred. despite the technical difficulty of the procedure given the location of the mass adjacent to the gej, the mass appeared to be completely resected endoscopically. the area was then fulgurated to remove any remaining tumor. pathologic evaluation of the specimen showed that the polyp had very low cellularity, with morphologic, immunohistochemical, and ultrastructural features supporting smooth muscle differentiation (fig. there was diffuse strong positivity for smooth muscle actin (sma) and desmin, both consistent with benign gastric leiomyoma. interestingly, the sample also contained foci of cells positive for cd117 and dog1 (discovered on gastrointestinal stromal tumor 1 [gist-1 ]), both markers typically expressed more diffusely in gastrointestinal stromal tumors (gists). the cells form haphazard fascicles and have abundant eosinophilic cytoplasm with cigar - shaped nuclei., there was no evidence of residual tumor and only normal mucosa present on biopsy specimens. we present the case of an adolescent girl with a large, symptomatic, bleeding mass near the gej resulting in anemia requiring blood transfusion. this unusual mass presented a management dilemma for our groups as we wanted to avoid the morbidity associated with an open resection given that this was likely a benign mass in a young patient. collaboration between the pediatric surgeons and gastroenterologists lead to development of a plan for laparoscopic - assisted endoscopic resection of the mass. consideration was given to the possibility of a laparoscopic wedge resection however this was not felt to be feasible given the location of the mass. not knowing the pathologic classification of the tumor at the time of surgery further added to the importance of complete removal and development of a comprehensive and collaborative approach. previous groups have reported the benefits of endoscopic - assisted laparoscopic resection of gastric tumors,5 6 7 8 however the previously described procedures involved a gastrotomy to ensure complete tumor resection. our approach was unique, in that we were able to successfully excise the entire mass without creating a gastrotomy. as a result, other groups have previously reported success with total endoscopic resection of gastric leiomyomas.9 10 in our case, we were able to utilize a minimally invasive approach to successfully resect the mass, with the associated benefits to the patient. this technique can be used to address other benign masses located near the gej. neither the location of the tumor, the approach to resection, nor its immunohistochemical characteristics were usual in this patient. gastric leiomyoma is a rare finding, particularly in pediatric patients, and in this case the pathologic differential diagnosis of leiomyoma versus gist was raised. the histopathologic features including low cellularity and cytologic characteristics were most consistent with a leiomyoma, although focal expression of dog1 and cd117 raised initial consideration of a low - grade gist. two immunohistochemical markers that have been used to help in making the distinction between gists and tumors of smooth muscle cell origin are cd117 (kit) and dog1.11 12 activating mutations of kit lead to overexpression of the kit protein (cd117), which can be identified by immunohistochemical staining. mutations in the kit gene are found in up to 96% of gists,13 and cd117 expression is reported in 93% of gists.14 dog1 protein is expressed in 80 to 96% of gists, and dual expression of both cd117 and dog1 can accurately identify 99% of gists.13 because the tumor had a histologic appearance more consistent with a smooth muscle cell tumor, diffuse strong positivity for sma, but only focal cd117 and dog1 expression, the tumor was determined to be a gastric leiomyoma. the immunohistochemical pattern of cd117 and dog1 expression in this case demonstrates the overlap and potential diagnostic difficulty between these two tumor classes. this case underscores the importance of integration of all pathologic features, and that diagnosis of gist should not be based on immunohistochemical features alone. the pattern of expression of these markers (focal vs. diffuse) although this patient was diagnosed with a benign gastric leiomyoma, the overlapping immunohistochemical features with gist raised clinical concern that she could be at increased risk of tumor recurrence or more aggressive behavior. kit protein (cd117) is a receptor tyrosine kinase whose overexpression in gists leads to tumor progression and appears to drive neoplastic growth.15 in light of focal cd117 expression in this tumor, we elected to manage this patient with close follow - up to monitor for tumor recurrence. she has already undergone repeat endoscopy with no evidence of tumor recurrence 6 months following resection. had this tumor been diagnosed as a gist, the patient would have likely required repeat operative intervention for complete tumor excision. although wedge or segmental resection with complete tumor removal is acceptable for gist tumors, the rate of recurrence for tumors located at the gej remains high (42% in one series).16 for this reason, wedge resection is not recommended for tumors greater than 3 cm located at the gej, instead these patients often require laparotomy and esophageal reconstruction.1 we present a combined laparoscopic and endoscopic approach to tumor resection, which successfully was applied to remove all visible tumor present in the fundus / cardia of the stomach. in addition, these tumors may be difficult to distinguish from gists because of similar immunohistochemical markers. this patient will require close long - term follow - up to detect tumor recurrence or malignant degeneration.	leiomyomas are infrequent benign intestinal tumors that can arise at any age and location within the gastrointestinal (gi) tract. these tumors can cause symptoms including abdominal pain, obstruction, intussusception, volvulus, gi bleeding, or a mass and should be resected if symptomatic. open surgical resection is considered the standard for removing these tumors. however, recent improvements in endoscopic and laparoscopic equipment have made it possible to utilize minimally invasive techniques of tumor removal including complete endoscopic resection or endoscopic - assisted laparoscopic resection. we present the case of an adolescent female with a large mass located at the gastroesophageal junction (gej) causing gi bleeding. given the location of the mass near the gej and the morbidity associated with surgical resection, we performed laparoscopic - assisted complete endoscopic resection of tumor. in addition, this tumor had an unusual immunohistochemical - staining pattern, with focal expression of markers more often seen in gi stromal tumors, elucidating a gray area between these two tumor classes with potential implications for patient follow - up. laparoscopic - assisted endoscopic resection of benign tumors is a useful technique that can be employed to facilitate resection of mucosal and subserosal masses near the gej with minimal morbidity.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.