article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
bevacizumab is thought to normalize tumor vasculature and restore the blood - brain barrier, decreasing contrast enhancement and peritumoral edema. antiangiogenic treatment targeting the vegf pathway using bevacizumab causes a rapid decrease in t1 contrast - enhancing tumor parts, with high radiographic response rates ranging between 3060%. however, in one third of all patients, glioblastomas are more prone to progress as nonenhancing tumor after bevacizumab treatment. recently defined rano (response assessment in neuro - oncology) criteria for glioma progression recommend fluid - attenuated inversion recovery (flair)/t2 hyperintensity on mri as a surrogate for nonenhancing tumor ; however, nonenhancing tumor can be difficult to differentiate from other causes of flair / t2 hyperintensity (e.g., radiation - induced gliosis, peritumoral edema). positron emission tomography using the radiolabeled amino acid o-(2-[f]fluoroethyl)-l - tyrosine (f - fet pet) may offer an improvement of the detection of true, i.e., metabolically active tumor extent of high - grade glioma over and above the information provided by contrast enhancement and flair hyperintensity on mri alone. a 58-year - old patient suffered from aphasia and agitation 4 weeks prior to admission. initial mri revealed a contrast - enhancing, tumor - suspicious lesion in the left temporal lobe, and a biopsy was performed stereotactically. molecular analysis of prognostic factors revealed that the o6-methylguanine methyltransferase promoter (mgmt) was not methylated and isocitrate dehydrogenases 1 and 2 (idh1/idh2) were not mutated. in order to achieve a macroscopically complete tumor resection, a fluorescence - guided resection using 5-aminolevulinic acid (5-ala) after surgery, fractionated external radiation therapy was initiated. within 2 weeks after tumor resection, after stratification for molecular markers, the patient was treated with concomitant radiotherapy up to a dosage of 60 gy, and afterwards with adjuvant bevacizumab every 2 weeks over 8 months. due to a severe allergic reaction, the combination therapy with irinotecan had to be discontinued after the first application. during bevacizumab treatment, clinical controls and follow - up mris in 8- after 8 months of single bevacizumab therapy, hemiparesis of the right side and deterioration of the aphasia occurred. 1b, encircled within black lines) is significantly larger, suggesting signs of nonenhancing tumor progression during bevacizumab treatment [2, 5 ]. to further evaluate the mri results, f - fet pet (fig. metabolically active tumor volume of f - fet pet uptake at a threshold = 1.6 and volume of the hyperintense flair signal were calculated [6, 7 ] (fig. 1d, encircled within white lines ; e) show that the volume of the flair hyperintensity is considerably larger than the metabolically active tumor volume. 1f), the volume of the flair hyperintensity (grey) shows no correspondence in size and spatial configuration to the f - fet pet metabolically active tumor volume. moreover, in comparison to the flair hyperintensity, f - fet uptake at a threshold = 1.6 (red) reveals additional subareas of metabolically active tumor (fig. 1f) in transaxial, coronal, and sagittal orientation. for treatment of tumor recurrence, chemotherapy with dose - intensified temozolomide clinically, chemotherapy response could not be observed ; during follow - up an exacerbation of the aphasia and hemiparesis occurred. due to a severe impairment of the patient 's clinical condition, palliative care was initiated 3 months after tumor recurrence. the differences in mri and f - fet pet might be explained by a complex morphologic heterogeneity of glioblastoma, leading to difficult interpretation of standard mri sequences. there are highly malignant tumor parts with and without contrast enhancement, and, furthermore, t2-based signal hyperintensity is a combination of infiltrating tumor cells, necrotic areas, tumor edema, and treatment - related leukoencephalopathy, e.g., due to radiotherapy. in contrast, f - fet pet shows metabolically active tumor independent of any anatomic or pathophysiologic changes and may therefore reflect tumor extension more accurately than mri. in this context, localization of the f - fet pet metabolically active tumor does not always match the pathological findings seen on mris. for example, in a small group of patients with recurrent high - grade glioma treated with bevacizumab and irinotecan, which partially responded according to rano criteria without response based on f - fet pet imaging findings, tumor progression could be detected earlier by f - fet pet. in summary, during bevacizumab treatment, f - fet pet in addition to contrast - enhanced and flair-/t2-weighted mri might add important information for assessment of tumor recurrence, as compared with standard mri alone. | antiangiogenic treatment using bevacizumab may cause difficulties in distinguishing between antivascular and true antitumor effects when using mri response criteria based on changes of contrast enhancement (i.e., macdonald criteria). furthermore, more precise tumor response assessment criteria (i.e., rano criteria), which incorporate nonenhancing t2/flair sequences into macdonald criteria, may be influenced by other causes of t2/flair hyperintensity (e.g., radiation - induced gliosis). the authors present discrepant mr and [18f]fluoroethyl - l - tyrosine pet imaging findings in a patient with bevacizumab treatment failure. |
nonunion with bone loss of long bones is a challenging problem, requiring serious attention with the rising incidences1 of high - velocity trauma. the conventional treatment options include autograft with non - vascularized fibula strut graft2 and cancellous bone grafting, vascularized bone graft,3 and bone transportation.45 all these techniques are highly demanding, on the part of surgeons as they require high learning curve45 and hospital infrastructure requiring specialized instrumentations3, which emphasize their limitations. very few options remain with the presence of associated significant skin loss or infection where complication and failure rate further increases and solution often lies in amputation. problem further intensifies in the developing countries where facilities and expertise are not readily available and the surgeon has to rely on simple techniques of treatment. this study was performed to analyze the results and outcome of bone reconstruction by induced - membrane technique (masquelet technique)67 and to provide an alternative mode of treatment that is simple, reliable, and reproducible and overall which can reduce sufferings of the patient and burden to the country. this prospective clinical study was performed between november 2010 and february 2013, after clearance from the ethical committee. inclusion criteria were all patients with posttraumatic gap nonunion of diaphysis of tibia with or without infection and with or without accompanying soft tissue defect which required treatment for bone loss after their informed consent. exclusion criteria were patients with neurovascular injury to the limb, patients with bone loss in epiphyseal or metaphyseal region, patients with gap nonunion of etiology other than traumatic in nature, and patients not giving consent for the procedure. nine patients (7 males and 2 females) with an average age of 35.5 years (range 1855 years) were treated during the study period. mode of injury in five patients was high velocity road traffic accident and in four patients was crush injury to leg following the fall of wall over the limb. preoperative assessment of the soft tissue and bony defect and planning for subsequent reconstruction was done in all. infection over the site of bone defect was present in eight patients and in three patients, there was associated large soft tissue defect requiring flap cover during stage i surgery. all patients had undergone an average of 1.7 (range 03) operative procedures before the stage i surgery with an average delay of 9.2 months (range 23 days2 years) from the time of injury and stage i surgery [table 1 ]. clinical details of patients this technique involves 2 surgeries, that is, stage i and stage ii. stage i surgery includes irrigation and debridement of the infected soft tissue and bone, along with fracture stabilization with external fixators. bone cement spacer without antibiotic was then introduced in the bone gap in a semisolid stage and was then moulded to give the shape of the bone [figure 1 ]. the spacer was inserted up to the fibula so as to obtain a larger sleeve of the membrane and thus more space for bone grafting during stage ii surgery [figure 2 ]. also with the presence of soft tissue defect, stage ii surgery was performed after 46 weeks of stage i surgery in the absence of any clinical signs of infection. stage ii surgery included removal of the cement - spacer, with preservation of the induced membrane formed at the spacer surface and filling the bony defect space with morselized iliac crest bone graft [figure 3 ]. peroperative photograph showing stage 1 surgery, the spacer within the bone gap peroperative photograph showing stage 2 surgery after spacer removal the induced membrane is seen peroperative photograph showing stage 2 surgery putting bone grafts within the sleeve of induced membrane at stage i surgery, average bone gap of 5.2 cm (range 3.38.5 cm) was present post debridement. in 3 patients fixators were present before stage i surgery. in 1 patient same fixator was continued, in 2 patient fixators were re - applied for proper flap coverage over the skin defect and in rest fixators were applied during stage 1 surgery. average time gap between stage i and stage ii surgery was 38 days (range 3045 days) in our study. the spacer was always found to be encapsulated by a thick glistening membrane in all patients [figure 2 ]. this induced membrane was not adherent to the underlying cement and bled when incised ; it was mechanically competent and could be reapposed without tension in all patients. the spacer could be removed without much difficulty and without causing any damage to the induced membrane, thus delineating a cavity corresponding to the volume of the retrieved spacer where subsequent morselized bone grafting was done [figure 3 ]. five patients required unilateral iliac crest bone grafting, two patients required bilateral iliac crest bone grafting, whereas one patient required mixture of iliac crest bone grafting with g - bone in a ratio of 1:1. in postoperative period, antibiotics were given for total duration of 6 to 8 weeks, from stage i surgery till the day of stich removal, after stage ii surgery. three weeks intravenous (iv) and 3 weeks oral antibiotics were given according to the report. in cases where infection was suspected after first surgery 3 weeks of iv and 5 weeks oral antibiotics were given, non - remitting infection was present in 1 patient post stage i surgery and in 1 patient post stage ii surgery, which did not subside even after 8 weeks of antibiotic therapy. these 2 patients were excluded from the study and re - debridement with masquelet technique was not performed in them. wound inspection was done on the 4 day and was repeated if required. in cases where soft tissue reconstruction was performed with a flap, viability of the flap was checked in the same evening and on subsequent days through the window over the flap. physiotherapy of the adjacent joints was started from the next postoperative day and non weight bearing walk was started. thus, 7 patients were regularly followed up for an average period of 21.5 months (range 1824 months) post stage ii surgery for assessment of the results. stage i surgery includes irrigation and debridement of the infected soft tissue and bone, along with fracture stabilization with external fixators. bone cement spacer without antibiotic was then introduced in the bone gap in a semisolid stage and was then moulded to give the shape of the bone [figure 1 ]. the spacer was inserted up to the fibula so as to obtain a larger sleeve of the membrane and thus more space for bone grafting during stage ii surgery [figure 2 ]. also with the presence of soft tissue defect, soft tissue reconstruction with skin flap stage ii surgery was performed after 46 weeks of stage i surgery in the absence of any clinical signs of infection. stage ii surgery included removal of the cement - spacer, with preservation of the induced membrane formed at the spacer surface and filling the bony defect space with morselized iliac crest bone graft [figure 3 ]. peroperative photograph showing stage 1 surgery, the spacer within the bone gap peroperative photograph showing stage 2 surgery after spacer removal the induced membrane is seen peroperative photograph showing stage 2 surgery putting bone grafts within the sleeve of induced membrane at stage i surgery, average bone gap of 5.2 cm (range 3.38.5 cm) was present post debridement. in 3 patients fixators were present before stage i surgery. in 1 patient same fixator was continued, in 2 patient fixators were re - applied for proper flap coverage over the skin defect and in rest fixators were applied during stage 1 surgery. average time gap between stage i and stage ii surgery was 38 days (range 3045 days) in our study. the spacer was always found to be encapsulated by a thick glistening membrane in all patients [figure 2 ]. this induced membrane was not adherent to the underlying cement and bled when incised ; it was mechanically competent and could be reapposed without tension in all patients. the spacer could be removed without much difficulty and without causing any damage to the induced membrane, thus delineating a cavity corresponding to the volume of the retrieved spacer where subsequent morselized bone grafting was done [figure 3 ]. five patients required unilateral iliac crest bone grafting, two patients required bilateral iliac crest bone grafting, whereas one patient required mixture of iliac crest bone grafting with g - bone in a ratio of 1:1. in postoperative period, antibiotics were given for total duration of 6 to 8 weeks, from stage i surgery till the day of stich removal, after stage ii surgery. three weeks intravenous (iv) and 3 weeks oral antibiotics were given according to the report. in cases where infection was suspected after first surgery 3 weeks of iv and 5 weeks oral antibiotics were given, non - remitting infection was present in 1 patient post stage i surgery and in 1 patient post stage ii surgery, which did not subside even after 8 weeks of antibiotic therapy. these 2 patients were excluded from the study and re - debridement with masquelet technique was not performed in them. wound inspection was done on the 4 day and was repeated if required. in cases where soft tissue reconstruction was performed with a flap, viability of the flap was checked in the same evening and on subsequent days through the window over the flap. physiotherapy of the adjacent joints was started from the next postoperative day and non weight bearing walk was started. thus, 7 patients were regularly followed up for an average period of 21.5 months (range 1824 months) post stage ii surgery for assessment of the results. radiological and clinical evaluation was done for all patients at every 6 weeks followup for first 6 months and every quarterly thereafter. radiographically successive radiographs showed regular integration and consolidation of the bone graft within themselves placed in the bone gap and with the host bone, at the graft host junction in all patients. the radio opacity of grafted tissues in the bony defect increased continuously with followup duration. clinically union was confirmed with absence of abnormal mobility and absence of pain on weight bearing. radiological union was documented, when graft gets consolidated within themselves in the region of bone gap and unites with the host bone at both the ends. six of the 7 patients (86%) achieved union in an average followup period of 10.5 months (range 813 months). in one patient, bone gap was bridged by the consolidated bone graft but had failed to unite with the host bone at one end. it was later treated as a case of simple nonunion of a bone, 13 months after stage ii surgery with freshening of bone ends, grafting and internal fixation with locked plate. thus, fracture with gap nonunion united solely with this technique in 6 of the 7 patients and in 1 patient, an additional procedure was performed to achieve union [figures 4 and 5 ]. (a) preoperative x - ray anteroposterior and lateral views of leg showing fixation in situ with infected gap nonunion (b) anteroposterior and lateral views of leg post stage 1 surgery where after debridement spacer is applied (c) post stage 2 surgery of same patient where after spacer removal bone grafting is done (d) post stage 2 surgery of same patient after 1 month (e) post stage 2 surgery of same patient after 12 months showing graft consolidation and union (f) post stage 2 surgery of same patient after 17 months showing good graft consolidation and union (g and h) clinical photograph of same patient after 17 months followup showing weight bearing on the limb and good range of movement (a) preoperative x - ray anteroposterior and lateral views showing gap nonunion (b) post stage 1 surgery of same patient showing spacer within the bone gap (c) immediate post stage 2 surgery with spacer removal and bone grafting within the induced membrane sleeve (d) post stage 2 surgery of same patient after 7 months (e) post stage 2 surgery of same patient after 12 months showing good graft consolidation and union (f) post stage 2 surgery of same patient after 18 months showing good graft consolidation and union (g) clinical photograph of the same patient after 17 months showing single stance weight bearing on the affected limb average period of non - weight - bearing was 3.3 months (range 2.54.5 months) post stage ii surgery followed by partial weight - bearing with external fixator support. thereafter external fixator was removed and full weight - bearing walk with brace support was started in an average period of 7 months (range 5.58.5 months). the timing of progression to weight - bearing after the second stage surgery remains arbitrary and is based on clinical examination and followup radiograph. at the latest followup, all 7 patients are walking full weight - bearing without support and can perform their routine activity without any disability. average range of movement at knee was 5100 (range 0140) and at ankle was from 5 dorsiflexion to 30 planterflexion (range 20 dorsiflexion50 planterflexion). an average of 0.5 cm (range 01.5 cm) limb length discrepancy was noted at the latest followup. the satisfaction rate among the patients was excellent as they can manage their routine day - to - day activities without much difficulty during the course of treatment, without any troublesome pain and medication. long term hospital stay was not required and no mandatory repeated followups were required during the treatment. a c masquelet89 first reported a series of reconstructions of long bone gap nonunion in 35 patients between 1986 and 1999 with this technique. as most of his cases were infected, he initially applied bone cement spacer after debridement for infection. if infection was absent post surgery, he performed bone grafting in the region of bone gap. the reason he did not excise the induced membrane during stage ii surgery was to prevent excessive bleeding. he found that polymethyl methacrylate spacer was always found encapsulated with a thick fibrous membrane. similarly in our study, we also observed induced membrane in all patients around the spacer and found sequential consolidation of the bone graft at followup, after stage ii surgery. in original masquelets technique no antibiotic cement was used and he believed that good debridement is the key to control infection. we also did not used antibiotic spacers as it may limit the infection to subclinical level which will then flare after bone grafting in stage 2 surgery. also, with the absence of infection after 4 to 6 weeks of stage i surgery would consider the region sterile for bone grafting. pelissier.,10 after their study on histological and biochemical characteristics of induced membranes in rabbits, added that the induced membrane is richly vascularized by numerous small capillaries and high concentrations of bone morphogenic protein-2 (bmp-2), vascular endothelial growth factor, and transforming growth factor-1 were observed within the induced membrane. he found high concentrations of these osteogenic factors from as early as 4 weeks after stage 1 surgery. in our study, although we could not perform any quantitative assay of these osteogenic factors due to financial constraint, but we found that the bone graft remained viable when placed in such large bone defects, and finally union was achieved in all the cases. the membrane thus functions to prevent soft tissue protrusion in the bone defect site, provides a scaffold for osteoconduction, maintains adequate vascularization, and creates a closed space in which osteogenic cells and substances are retained. roche.11 performed similar study for the management of septic nonunion of long bones, and huffman.12 reported use of this technique in a significant area of bone loss in the mid - foot and both concluded that this two - phase technique provides encouraging results and bone healing was consistently achieved. biau.13 and woon.14 also reported successful management of gap nonunion treated with this two - stage procedure. we have also observed bone union in all 7 patients with this technique in our study. in 2 patients where infection could not be controlled due to failure of proper debridement at stage i surgery re - debridement and masquelet technique was not considered in them, as this was not a very established procedure at the time when we were performing the surgery and we were not very sure of the result. although with good results at the end of our study we recommend the same as the induced membrane technique is a reliable surgery and bone union can be documented regularly. huffman.12 obtained graft from reamer - irrigator - aspirator (ria) technique from ipsilateral femur. many authors have reported the use of bmps with the bone graft in stage ii surgery. we however have used only cancellous bone graft in all patients as described by masquelet. this was because the cancellous graft is easily available from the iliac crest, does not require any specific instrumentation and thus keeps the procedure simple and universal. apard.15 published the use of this surgery using internal fixation that is nailing in posttraumatic tibial gap nonunion. the study concluded that the use of the intramedullary nail facilitates the patient to resume weight - bearing more quickly and avoiding secondary fractures. we followed the original technique of masquelet with the use of external fixator as most of our cases were infected. also, external fixator was easy to continue with the soft tissue reconstruction perfomed simultaneously in stage i surgery. few treatment options are available for limb reconstruction following gap nonunion of long bones which further gets limited if there is associated soft tissue loss and infection. this staged grafting technique67 within the sleeve of induced bio - membrane thus has been described as an alternative potential treatment strategy. this method of treatment being easy, simple and lacks use of any sophisticated instrumentations and investigations further overcomes the challenging problems faced in developing countries such as india, where a lot of patients are being neglected due to financial constraint and lack of adequate expertise required for treatment. also, it provides a treatment option that can overcome the shortcomings and limitations of the available methods of treatment. in our study, no specific preoperative investigations8 are required prior to planning this surgery, it does not require any specialized equipment,9 was performed easily by surgeons with all grades of experiences and no mandatory repeated followups were required after the procedure and thus making it a relatively universal procedure. this technique provides both effective and practical management for the difficult gap nonunions with or without infection and with or without accompanying soft tissue defect. also it is a reliable and reproducible technique where bone union is regularly obtained9 and thus it should be used more commonly and confidently. the main disadvantage of this procedure is that it is a two - stage procedure with the associated risks of secondary anesthesia and hospitalization. other potential disadvantages are limited bone graft to harvest in very young children and the inability to correct residual limb length discrepancy after the surgery. further patient has to remain non weight bearing during the initial treatment period as the large bone gaps were weakly immobilised with external fixators. few limitations of this study are less number of patients included in the study as the procedure is not a very common treatment option, but then we have a long term followup to analyze the result. also in our study, many problems remained to be solved like regarding other methods of fracture stabilization primarily internal fixation, the other types of graft material to be placed within the induced membrane such as cortical autograft\allograft,16\ria17 method, or the use of recombinant human growth factors and the addition of stem cells within the membrane. however, as this technique becomes more widely applied, the answer to these voids may become clearer. this study highlighted that it can provide an effective and practical management of patients with difficult gap nonunion. | background : gap nonunion of long bones is a challenging problem, due to the limitation of conventional reconstructive techniques more so if associated with infection and soft tissue defect. treatment options such as autograft with non - vascularized fibula and cancellous bone graft, vascularized bone graft, and bone transportation are highly demanding on the part of surgeons and hospital setups and have many drawbacks. this study aims to analyze the outcome of patients with wide diaphyseal bone gap treated with induced - membrane technique (masquelet technique).materials and methods : this study included 9 patients (7 males and 2 females), all with tibial bone - gap. eight of the 9 patients were infected and in 3 patients there was associated large soft tissue defect requiring flap cover. this technique is two - stage procedure. stage i surgery included debridement, fracture stabilization, application of spacer between bone ends, and soft tissue reconstruction. stage ii surgery included removal of spacer with preservation of induced membrane formed at spacer surface and filling the bone - gap with morselized iliac crest bone - graft within the membrane sleeve. average bone - gap of 5.2 cm was treated. the spacer was always found to be encapsulated by a thick glistening membrane which did not collapse after its removal. all patients were followed up for an average period of 21.5 months.results:serial radiographs showed regular uptake of autograft and thus consolidation within themselves in the region of bone gap and also with host bone. bone - union was documented in all patients and all patients are walking full weight - bearing without support.conclusions:the study highlights that the technique provide effective and practical management for difficult gap nonunion. it does not require specialized equipment, investigations, and surgery. thus, it provides a reasonable alternative to the developing infrastructures and is a reliable and reproducible technique. |
hormone receptors (hrs) are steroid hormone activated transcription factors which are a part of the nuclear receptor super - family consisting of > 60 members. three hormone receptors, the estrogen receptor (er), the androgen receptor (ar) and glucocorticoid receptor (gr) play an important role in regulating the cellular differentiation tissue development of skin, bone, the brain and the endocrine system (1). many studies (24) have shown that all three of hrs regulates gene expression for many significant phenotypes. dysregulation of any of these hormone signaling pathways is linked to many different types of diseases. for example, malignancy of the er has been associated with endocrine diseases such as breast and prostate cancers, and the action of ers is linked to the growth promotion and invasion of breast cancer cells (5). dysregulation in the production of androgens can affect different organ systems, in which it caused the diseases such as androgen insensitivity syndromes, prostate cancer, hepatocellular carcinomas, acne and male pattern alopecia (6,7). gr activation is often associated with inducing apoptosis in lymphocytes and lymphomas, and paradoxically inhibiting the apoptotic response to several cell stressors including growth factor withdrawal (8) in breast cancer cell lines. hrs modulate the transcription of target genes through hormone activation, and they do so either through (i) direct binding, in which hrs directly bind to hormone response elements ; (ii) indirect binding, where hrs interact with other transcription factors, which instead bind to the dna themselves ; or (iii) co - occurrent binding, where hrs bind with lower affinity to dna binding sequences and interact with other tfs through co - regulators. ars bind to the androgen response element 5-ggaacannntgttct-3 (9), ers bind with the highest affinity to the estrogen response element consensus sequence 5-aggtcannntgacct-3 (10), and grs bind to the glucocorticoid response element 5-gttacannntgttct-3 (11). since hormone receptors are key regulators of growth, differentiation and metabolism in multiple organs, the characterization of the transcriptional regulation of their target genes is quite important. several new high - throughput technologies such as chip - chip (12,13), chip - seq (14,15) and chip - pet (16) are producing a large amount of whole - genome - wide hormone receptor regulatory data, in many different cell types and tissues [see supplementary table s1 for all literature as well as (17) ]. integrating these data into a single resource will allow expedited cross - reference, literature discovery and aid in the validation of novel data. to that end this database mainly contains in vivo binding loci identified from chip - based high - throughput technologies and computationally predicted binding motifs and the cis - regulatory modules for the binding loci. the data visualization focuses on a whole - genome - wide scale rather than traditional promoter regions and is accessed through simple yet expressive data filtering. in the current version of our hrtbldb database, it contains two types of data, (i) in vitro binding elements, which were experimentally verified in vitro to bind one of the three hormone receptors using either emsa or chip assays ; (ii) in vivo binding loci identified from the chip - based high - throughput data using our peak detecting programs fdrpeak (18) for the chip - chip data and belt (x. lan., manuscript in preparation) for the chip - seq data, and binding motifs underneath of the binding loci using our chipmotifs (19) as well as cis - regulatory modules identified by our chipmodules program (20). the database contains the nucleotide sequence for every indexed binding site. for experimentally verified binding sites, the sequence and coordinates given in the paper for which the sequence is not given, the coordinates given in the paper were used to obtain the sequence from the genome specified in the paper. for predicted binding sites, the sequence was taken from the genome used in the database for that species by the predictive algorithm used, after the coordinates from the paper were converted from the genome used in the paper to the version used in the database. for simplicity the human assembly used is hg18, and data was taken from papers in the hg18 and hg17 assemblies : hg17 data was converted to hg18 using ucsc s liftover program. mouse data is in the mm8 assembly, and rat data is in the rn4 assembly. the hrtbldb contains ar, er and gr in vitro data for all three species ; however, all of the in vivo data is human. the total number of different data and sources by hormone receptor is shown in figure 1. figure 1.(a) the number of experimentally confirmed in vitro direct and indirect binding sites in comparison with the high - throughput in vivo binding loci. (b) a summary of the number of publications in the database by hormone receptor and experimental type. (a) the number of experimentally confirmed in vitro direct and indirect binding sites in comparison with the high - throughput in vivo binding loci. (b) a summary of the number of publications in the database by hormone receptor and experimental type. the database is designed to have a close mapping to the real objects that it represents (supplementary data, and the web site http://motif.bmi.ohio-state.edu/hrtbldbabout#schema). one benefit of this is that entries in the database express the natural relationships between their real world counterparts. since the database stores in vivo chip - based data, with computationally predicted binding motifs, and in vitro experimentally verified individual binding motifs, these data were split into two separate entities, binding loci and binding motifs. chip - based experiments produce many larger regions on the chromosome without fine interior details, aside from predicted binding sites ; therefore, these regions are stored in a separate table, loci. both the predicted binding motifs within binding loci and the experimentally verified binding motifs are stored in the binding sites table. each locus and binding site is also associated with an entry in the experiments table which contains the meta - data common to all data from a given resource, reference information for the scientific paper, cell line, hormone receptor, etc. the database supports the separation of all data by species ; however, for speed and efficiency, no meta - data on the species is stored in the database. binding loci have a one - to - many relationship with binding sites : i.e. a locus contains multiple binding sites, but no binding site is a part of more than one locus, if any. overlapping loci from different experiments may share common predicted binding sites ; however, these are represented as separate entities in the database. each binding site is a collection of information about a single predicted or experimentally verified transcription factor binding site. they contain the coordinates, name and the exact sequence of that individual binding site. nearest gene, which is the gene whose 5- or 3-end is nearest to the mid - point of that loci. based on its proximity to this gene they are labeled with a region, which is a short description of its location relative to the gene, such as within gene, 5-promoter, 3-distal, etc. for the details of the distances from the gene that each region represents and how they are calculated, see supplementary data and our web site http://motif.bmi.ohio-state.edu/hrtbldbabout#regions. the publications which were used as data sources are recorded in the experiments table ; however, there is a one - to - many mapping between source publications and experiment entries. each experiment entry represents a combination of a publication, a species, a cell line and an experimental method. if one publication has datasets for which these characteristics differ, there will be one experiment entry for each dataset. all of the data are available for download as either a mysql dump or as collection of tab separated text files, along with the database schema and the queries used to implement the schema, at the web site http://motif.bmi.ohio-state.edu/hrtbldb/downloads. we have developed a data visualization tool, the portable epigenetic regulator framework (pegrf, figure 2) ; it is a comprehensive, highly modular application for the storage of genomic and epigenomic data, data search and graphical display, all over the internet, through a web browser. the graphical rendering is done using the php light - weight regulator visualization tool (plrvt), a module to pegrf which we developed in tandem. both are implemented entirely in the php scripting language and run on a web server. the primary benefits of this approach are that the application is both operating system and database agnostic. this results in pegrf being highly portable across a wide variety of systems, and easily integrated into the existing web presence for many organizations (supplementary data). figure 2.a data flow diagram showing the movement of data from our data sources (publications) through the formatting process, to the system and into the database ; likewise, it shows the movement of input from the user to the system and the resulting output to the user s web browser both as text and through the graphical sub - system, plrvt. a data flow diagram showing the movement of data from our data sources (publications) through the formatting process, to the system and into the database ; likewise, it shows the movement of input from the user to the system and the resulting output to the user s web browser both as text and through the graphical sub - system, plrvt. basic search, is similar to the search engine of ucsc genome browser in that a location on the genome in the format chrx:00009999 is entered to view all data in the database within that region. basic search also supports the display of all data near the transcription start site of a gene searched for by its gene symbol, refseq i d or its genbank gene i d. for example, a search results for the region of chr19:5604709156052091 shows klk3 (psa) gene has both in vitro validated androgen response element and the predicted androgen response element from in vivo chip - chip ar - binding loci in the same location. the more complex search, the experimental types are divides first between in vivo and in vitro techniques. within in vivo, one can further filter the results by the type of in vivo technique used. the results may then be further filtered by the cell line used in the experiment and/or the hormone receptor whose binding was being measured. basic search takes the user directly to a visualization of the target region of the genome and all of the data in the database within that region ; whereas, an advanced search shows a list of all the binding elements that meet the specified criteria which may be browsed and then selected for visualization of the target element and all elements near it. the data visualization is of a region on a chromosome in a single genome assembly. all of the data in the database is shown graphically to give their relative spatial relationships, and all of the details of each element are tabularized below the graphical visualization for further examination or export. this visualization is the only mechanism to display the binding elements spatially near a given element on the chromosome. each data source is given a separate track in the visualization, and the data elements from it are described in detail in a source specific table below the visualization in the order they are displayed. the data visualization also provides a way to visually browse the genome for target data by moving the region being displayed up or down the chromosome and zooming in and out to see more or less data (figure 3). figure 3.screen shots depicting, from back to front, the hrtbldb homepage, the search interface and the visual genome browser. screen shots depicting, from back to front, the hrtbldb homepage, the search interface and the visual genome browser. the hrtbldb is a comprehensive data management system for the aggregation, discovery and analysis of hormone receptor binding sites in the mammalian genomes including human, mouse and rat. given that its primary purpose is to allow other researchers to build upon the information generated by high - throughput experiments, the current version contains 44 673 binding elements with 114 hormone response elements which are verified in in vitro experiments ; 75 binding motifs which occur with a hormone response element and whose co - regulatory action is verified in in vitro experiments ; 18 472 binding loci from in vivo experiments ; and 26 012 computationally predicted binding motifs. the first of several distinguishing features is that hrtbldb is focused on a whole - genome - wide scale of hr regulatory information and classifies the binding sites based on their proximity to genes from refgene databases, such as hg18 refseq, mm8 refseq and rn4 refseq (http://genome.ucsc.edu/). the importance of this feature is that it accommodates new conclusions from the encode consortium (21) that transcription factor binding sites may be located anywhere in the human genome (see the supplementary data and the web site http://motif.bmi.ohio-state.edu/hrtbldbabout#regions for the classification scheme used). the second feature is that we not only collected the binding loci identified from in vivo high - throughput data, but also computationally predicted binding motifs which the tfs could possibly bind to and cis - regulatory modules for co - occurrent binding with other tfs. the third feature is that, to adequately verify the regulatory mechanisms at work on several genes in our database, we included direct and indirect binding patterns from in vitro emsa and chip assay experiments. these patterns show regulatory action along with the reported motifs where available and publication references. for example, cathepsin d (ctsd) is reported to be involved with a direct binding estrogen response element in (22) and an endrogen response element and sp1 indirect binding in (23) ; therefore, this data was added to our database for comparison with in vivo binding data. in summary, the abundance of data in our hrtbldb will hopefully contribute toward the progression of the ongoing investigation in to hr gene regulation and its mechanisms. although we have migrated all the data from our previous ertargetdb (24) into our new database, there are significant differences between two databases : (i) hrtbldb focuses on whole - genome - wide binding sites and visualization ; whereas, ertargetdb only contained promoter regions ; (ii) the new database contains data for three major hormone receptors (er, androgen receptor and gr). it contains binding loci from both in vivo chip - based high - throughput data and in vitro experimentally validated binding motifs from emsa and chip assay ; (iii) it will display all possible binding sites, different types of experiment, hrs and cell lines, in the queried region ; (iv) the visualization is done by a modular binding element visualization tool we developed in tandem, the php light - weight regulator visualization tool (plrvt) and ertargetdb uses the gdvtk tool written in java ; and (v) the internal database schema are different as well in that the hrtbldb is designed to be generic and store many different forms of dna - binding elements for present and future research. we should also point out that our hrtbldb is different from other similar publicly available databases, such as mrbase and nurebase (25), which both contain the chemical and biological properties of hormones and their receptors, focus on all properties of nuclear receptors and their data are manually collected, hence these databases include a limited amount of information, but our database focuses on a subset of hormone receptors and their targets information and uses computational processing to predict additional binding motifs and transcriptional regulatory modules. our software used to make these binding motif predictions are published on genome research, chipmotifs (19) for identified binding motifs as well as chipmodules (20) for identified cis - regulatory modules. ours is different from ergdb (26) and kberg (27) which were developed by the same group. their databases only focus on er responsive genes, and functional classifications, gene expression data. we think chip - based data with direct targets, can help determine transcriptional regulatory networks, therefore we created the hrtbldb. as part of the integrative cancer biology program of the national cancer institute (28), we have developed a chip - seq - based computational method to characterize the epigenetic mechanisms involved in the target genes of the er pathway (j. wu.. we will add epigenetic regulatory data such as dna methylation and histone modification patterns across the loci for these hrs to the database in the future. other hormone receptors data such as the progesterone receptor are also planned to be added to our database in the near future. national institute of health (grants u54ca113001 and r01ca069065). funding for open access charge : department of biomedical informatics, college of medicine, the ohio state university. conflict of interest statement. | three hormone receptors, the estrogen receptor (er), the androgen receptor (ar) and glucocorticoid receptor (gr) play an important role in regulating the cellular differentiation tissue development of skin, bone, the brain and the endocrine system ; therefore, there is a strong scientific need to identify and characterize hormone receptor transcriptional regulation. given that the vast amount of regulatory data for hormone being produced by chip - based high - throughput experiments is widely scattered in disparate, poorly cross - indexed data stores, a flexible platform for organizing and relating these data would provide significant value. we created a data management system called the hormone receptor target binding loci, hrtbldb (http://motif.bmi.ohio-state.edu/hrtbldb), to address this problem. this database contains hormone receptor binding regions (binding loci) from in vivo chip - based high - throughput experiments as well as in silico, computationally predicted, binding motifs and cis - regulatory modules for the co - occurring transcription factor binding motifs, which are within a binding locus. it also contains individual binding sites whose regulatory action has been verified by in vitro experiments. the current version contains 44 673 binding elements with 114 hormone response elements which are verified by in vitro experiments ; 75 binding motifs which occur with a hormone response element and whose co - regulatory action is verified by in vitro experiments ; 18 472 binding loci from in vivo experiments ; and 26 012 computationally predicted binding motifs. |
a 26-year - old male patient presented with a complaint of pain in the lower left molar region (36). the patient also revealed that the pain was persisting for the past 23 months. on intra - oral clinical examination 36 was slightly mobile and painful. an intra - oral periapical radiograph was taken, which revealed the presence of a supernumerary premolar causing pressure resorption of 36 ; orthopantomograph was taken, which revealed that 11 was endodontically treated, and 21 was missing [figure 1 ]. fixed partial denture (fpd) was given in relation to 11, 21, 22 [figure 2 ]. orthopantomogram showing supernumerary premolar there were presence of supernumerary premolars in 2, 3 and 4 quadrants [figure 1 ] and the patient 's chief complaint was in relation to 3 quadrant where the supernumerary premolar was causing pressure resorption of 36 where the distal root was already resorbed, which was causing pain. though the option of extraction of other supernumerary teeth was offered, the patient declined and insisted upon treatment for 36 region only. the treatment plan included oral prophylaxis with oral hygiene instructions followed by extraction of resorbed 36 under local anesthesia [figure 3 ]. lingual self - ligating braces were bonded, and the supernumerary premolar was to be brought into occlusal level of 36 for a functional purpose. replacement of fpd in relation to 11, 21 and 22 with all ceramic bridge for esthetics. intra - oral periapical radiograph showing impacted supernumerary premolar the patient was very co - operative and presented no contra - indications for orthodontic treatment. the patient preferred the braces to be put lingually and not labially on esthetic grounds. lingual self - ligating braces (forestadent-2d) were positioned on the lower cast [figure 4 ] and a transfer tray was fabricated from glue gun. self - ligating brackets from forestadent 2d. bosch pkp ise glue gun, robert bosch gmg h after complete oral prophylaxis, etching with 37% orthophosphoric acid was done, primer was applied, and the brackets were bonded onto the lower teeth [figure 5 ]. the most compelling potential advantage attributed to self - ligating brackets are reduction in the overall treatment and less associated to subjective discomfort. the wire sequence of 0.012 ni - ti lingual arch wire for the initial alignment was given and in between 32 and 41 an open coil spring was given to bring 31 in alignment and arch form [figure 6 ]. lingual appliance in situ open coil spring placed in between 41 and 32 for space opening the supernumerary premolar was surgically exposed, and a composite button was placed [figures 7 and 8 ]. once the lower anterior decrowding and the premolar were brought into occlusion 0.016 titanium molybdenum alloy wire was given for mild correction and for finishing purpose. once the result was achieved [figures 9 and 10 ] the arch wire was removed, and the lingual brackets were debonded. surgical exposure of supernumerary premolar and bonding post operative treatment orthopantomogram post operative treatment photo the bridge on 11.21 and 22 was removed. a 5 mm horizontal groove was given on the lingual surface to assist in confirming a positive seal of the final restoration. a polyvinyl siloxane impression was taken and sent to the lab along with the photographs, opposing model and a bite registration. upon delivery of the final restoration from the laboratory, the resin framework fit, and all ceramic crowns were evaluated on the stone die for proper margin fit and path of seating. to prepare the restoration for bonding the tissue surface of the restoration the tooth preparations were acid etched with 37% orthophosphoric acid gel for 30 s, rinsed and blotted dry. permanent all ceramic crowns [figure 11 ] were cemented to the teeth, to achieve proper esthetics. post operative occlusal photo after treatment class - i canine relationship with coincident midlines, correct tooth positions, and proper alignment were obtained, which helped in improving patents facial balance. the method of tooth extrusion was first described by heithersay, uses the simple physiologic process of normal tooth eruption and applies it clinically to extrude the partially impacted supernumerary premolar. tooth extrusion has been achieved by different methods including labial fixed appliance, modified arch wires, mini - implants, and recently lingual bracket systems. many adult patients now prefer the use of lingual brackets to labial appliance for esthetic reasons. in this case the patient himself showed interest for the treatment only after the option of lingual appliance was given. in this case report, a multidisciplinary approach of resorbed mandibular first molar with extrusion of supernumerary premolar was done using lingual orthodontics (hidden braces) has been put into light. a 26-year - old male patient presented with a complaint of pain in the lower left molar region (36). the patient also revealed that the pain was persisting for the past 23 months. on intra - oral clinical examination 36 was slightly mobile and painful. an intra - oral periapical radiograph was taken, which revealed the presence of a supernumerary premolar causing pressure resorption of 36 ; orthopantomograph was taken, which revealed that 11 was endodontically treated, and 21 was missing [figure 1 ]. fixed partial denture (fpd) was given in relation to 11, 21, 22 [figure 2 ]. orthopantomogram showing supernumerary premolar there were presence of supernumerary premolars in 2, 3 and 4 quadrants [figure 1 ] and the patient 's chief complaint was in relation to 3 quadrant where the supernumerary premolar was causing pressure resorption of 36 where the distal root was already resorbed, which was causing pain. though the option of extraction of other supernumerary teeth was offered, the patient declined and insisted upon treatment for 36 region only. the treatment plan included oral prophylaxis with oral hygiene instructions followed by extraction of resorbed 36 under local anesthesia [figure 3 ]. lingual self - ligating braces were bonded, and the supernumerary premolar was to be brought into occlusal level of 36 for a functional purpose. replacement of fpd in relation to 11, 21 and 22 with all ceramic bridge for esthetics. intra - oral periapical radiograph showing impacted supernumerary premolar the patient was very co - operative and presented no contra - indications for orthodontic treatment. the patient preferred the braces to be put lingually and not labially on esthetic grounds. lingual self - ligating braces (forestadent-2d) were positioned on the lower cast [figure 4 ] and a transfer tray was fabricated from glue gun. self - ligating brackets from forestadent 2d. bosch pkp ise glue gun, robert bosch gmg h after complete oral prophylaxis, etching with 37% orthophosphoric acid was done, primer was applied, and the brackets were bonded onto the lower teeth [figure 5 ]. the most compelling potential advantage attributed to self - ligating brackets are reduction in the overall treatment and less associated to subjective discomfort. the wire sequence of 0.012 ni - ti lingual arch wire for the initial alignment was given and in between 32 and 41 an open coil spring was given to bring 31 in alignment and arch form [figure 6 ]. lingual appliance in situ open coil spring placed in between 41 and 32 for space opening the supernumerary premolar was surgically exposed, and a composite button was placed [figures 7 and 8 ]. once the lower anterior decrowding and the premolar were brought into occlusion 0.016 titanium molybdenum alloy wire was given for mild correction and for finishing purpose. once the result was achieved [figures 9 and 10 ] the arch wire was removed, and the lingual brackets were debonded. surgical exposure of supernumerary premolar and bonding post operative treatment orthopantomogram post operative treatment photo the bridge on 11.21 and 22 was removed. a 5 mm horizontal groove was given on the lingual surface to assist in confirming a positive seal of the final restoration. a polyvinyl siloxane impression was taken and sent to the lab along with the photographs, opposing model and a bite registration. upon delivery of the final restoration from the laboratory, the resin framework fit, and all ceramic crowns were evaluated on the stone die for proper margin fit and path of seating. to prepare the restoration for bonding the tissue surface of the restoration the tooth preparations were acid etched with 37% orthophosphoric acid gel for 30 s, rinsed and blotted dry. permanent all ceramic crowns [figure 11 ] were cemented to the teeth, to achieve proper esthetics. after treatment class - i canine relationship with coincident midlines, correct tooth positions, and proper alignment were obtained, which helped in improving patents facial balance. the method of tooth extrusion was first described by heithersay, uses the simple physiologic process of normal tooth eruption and applies it clinically to extrude the partially impacted supernumerary premolar. tooth extrusion has been achieved by different methods including labial fixed appliance, modified arch wires, mini - implants, and recently lingual bracket systems. many adult patients now prefer the use of lingual brackets to labial appliance for esthetic reasons. in this case the patient himself showed interest for the treatment only after the option of lingual appliance was given. in this case report, a multidisciplinary approach of resorbed mandibular first molar with extrusion of supernumerary premolar was done using lingual orthodontics (hidden braces) has been put into light. as patient 's knowledge about esthetics and function increases, the dentists are challenged to provide services that will encompass the well - being of the whole patient. the creation of esthetic smile with proper phonetics, balance and function, may involve multiple procedures and disciplines. a successful team involves constant discussion, communication and education in order to arrive at a common vision. understanding patients by discussing their desires, concerns and values also enable the team to establish customized treatment planning. | the management of patients with pain in today 's general practice has become a major concern and sometimes this pain is related to some rare causes. a male patient aged 26 years reported with pain in the lower left molar region (36) and then an intra - oral periapical radiograph (iopa), and orthopantomograph was taken. iopa revealed the presence of supernumerary premolar causing pressure and root resorption of 36. also, there was missing 21 and proximal decay in 11. eleven was treated endodontically, and then bridge was done in relation to 11, 21 and 22. lower anterior crowding was also present. the treatment plan was to extract 36 followed by orthodontic extrusion of the supernumerary premolar and also the correction of lower anterior crowding. hidden approach (lingual orthodontics) was used as the patient was insisting upon the braces not being seen outside during the course of the treatment. later all ceramic bridge was done in relation to 11, 21 and 22. orthodontic tooth extrusion techniques offer excellent treatment options for partially impacted tooth. it is a well - documented clinical method for extruding sound tooth material from within the alveolar socket by light forces. the use of lingual technique for forced eruption enhance acceptance of orthodontic treatment by adults. the treatment of a young adult patient illustrates the importance of treatment planning from one discipline to another, communication among team members and the benefits of working together in an interdisciplinary approach |
this hospital, one of two pediatric referral hospitals in cambodia, serves a population of approximately 2.7 million children ages 100 u / ml, total ig > 500 u / ml) evidence of acute infection. all statistical procedures were performed by using spss for windows, version 10.0 (spss inc., fisher s exact test (two - tailed) was used to determine significant difference in the number of boys with encephalitis and diagnosed as having jev compared with girls with the same syndrome and final diagnosis. all statistical procedures were performed by using spss for windows, version 10.0 (spss inc., fisher s exact test (two - tailed) was used to determine significant difference in the number of boys with encephalitis and diagnosed as having jev compared with girls with the same syndrome and final diagnosis. figure 1 shows the rates of hf, encephalitis, and hepatitis per 100 hospital admissions, by month and year. from july 1996 through september 1998, 621 children were admitted with a diagnosis of hf (table 1). of those, 495 were confirmed to have a secondary denv infection by serologic tests ; 14 had primary dengue. figure 2 illustrates the number of confirmed denv patients compared with the total number of patients with hf. cases of hemorrhagic fever (hf), secondary and primary dengue, national pediatric hospital, 19961998. the severity of dhf can be classified into four grades based on two pathophysiologic findings : hemorrhage and shock. in this study, 41 of the 509 total confirmed dengue patients had dhf grade 1 ; 145 patients had dhf grade 2 ; 180 patients had dhf grade 3 ; and 29 patients had dhf grade 4. of the 75 samples tested, 22 were polymerase chain reaction (pcr)-positive for virus. denv-2 was isolated from 14 samples, denv-3 from seven samples, and denv-4 from one sample. the other provinces appeared to have only one circulating dengue serotype, based on the small number of positive samples. during this same period, 50 children were admitted to nph with a diagnosis of encephalitis ; 9 (18%) were due to jev (table 1) and 2 to acute secondary dengue infection. figure 3 illustrates the number of cases of jev, by month and year, compared with the total encephalitis cases. while over twice as many girls as boys had this syndrome, significantly more boys were diagnosed with jev infection (p=0.015). the final outcome for children seen at nph with encephalitis was poor : death or disability occurred in 29 (58%) of the children. total number of cases of encephalitis versus japanese encephalitis, national pediatric hospital, 19961998. twenty - four cases were confirmed to be due to acute hav infection on the basis of elevated hav igm antibodies (table 1). one patient had serologic evidence of acute hepatitis b, and no serologic evidence for hcv or hev infections. figure 4 illustrates the number of hav patients compared with the total number of patients admitted to nph with a clinical diagnosis of hepatitis. of the 24 children hospitalized with hepatitis a, 17 (71%) had onset in july, august, and september. most children admitted to nph came from phnom penh (339 patients) or its adjacent province, kandal (146 patients). total number of cases of hepatitis versus hepatitis a, national pediatric hospital, 19961998. this surveillance was undertaken to characterize the extent of disease in cambodian children with respect to three specific syndromes : hemorrhagic fever, encephalitis, and hepatitis. to our knowledge, this is the first such study conducted in cambodia. as in other southeast asian countries, dhf accounted for a large percentage of hospitalizations and deaths of cambodian children. dengue was confirmed in 82% of children admitted to nph with symptoms that suggested dengue fever. serologic results for the remaining 112 hf cases suggested denv infection in most instances, but lack of a convalescent - phase sample prevented definitive diagnosis. dhf has been reported as a leading cause of hospitalization and death of children throughout asia in 1998 (9). our surveillance shows that in august and september 1998, the hospitalization rate for children with hf exceeded 10 per 100 hospital admissions. similarly, japanese encephalitis has been reported to occur in nearly every country in asia (10). while the disease is presumed to be endemic in cambodia, no laboratory - confirmed data on disease frequency similar to reports elsewhere (11), more cases of jev infection occurred in boys than in girls (six versus three, respectively). transmission of disease is usually seasonal, from late summer to early fall. in our study, 67% of cases were reported from may to october ; the remainder occurred in january or february. hav infection is highly endemic in developing countries that lack adequate clean water and have poor sanitary conditions (12). according to the 1998 cambodian general population census, only 29% of the population has access to safe water (range 23.7%-60.3%) (13). in poorer countries, a seroprevalence study conducted on 200 healthy cambodian children from 1990 through 1991 showed that 97% were positive for anti - hav igg by 15 years of age (5). while hepatitis a is largely considered a subclinical infection in children in thuring s study, it accounted for 32% of acute hepatitis in hospitalized children in our study ; hepatitis a accounted for 55% of the pediatric patients hospitalized with suspected hepatitis. this contrasts with thuring s earlier study, in which 18% of children with acute hepatitis were actively infected with hbv (hbsag positive). however, similar to thuring s study, we saw no evidence of hcv in this population. no indication of acute hepatitis e was found in our study, nor did any of the children admitted to nph with hepatitis have evidence of prior exposure to hev. similar to hepatitis a, hepatitis e is common in countries that lack adequate clean water and in which general sanitation is poor. in southeast asia, epidemics of hev have been reported in myanmar, vietnam, and indonesia (14). in most disease - endemic areas, while clinical attack rates of hepatitis e are reported to be highest in young adults (15 - 40 years), a recent report from india noted anti - hev antibodies in > 60% of children cambodia is surrounded by countries (except thailand) that are endemic for hev ; therefore, the total lack of anti - hev igg in this cambodian population was unexpected. currently, cambodian children are given bcg, polio, diphtheria - tetanus - pertussis, and measles vaccines, although coverage varies throughout the country. instituting childhood hav immunizations could benefit countries that have shown a decrease in age - related hav seroprevalence concomitant with improved socioeconomic development (16,17). while the seroprevalence for hav in thuring s 1991 study approached 100% in children by age 15, no hav seroprevalence data have been gathered since then. further studies are warranted to determine if additional vaccines, such as those for hav and jev, should be added to the nation s immunization program. | surveillance was conducted for three clinical syndromes (hemorrhagic fever, encephalitis, and hepatitis) in cambodian children admitted to the national pediatric hospital in phnom penh from july 1996 through september 1998. acute- and convalescent - phase sera, and cerebrospinal fluid, when applicable, underwent diagnostic evaluation for infections with dengue virus (denv), japanese encephalitis virus (jev), and hepatitis a, b, c, and e viruses. of 621 children admitted with hemorrhagic fever, 499 (80%) were confirmed to have either primary or secondary denv infection. denv rates were as high as 10.6/100 hospital admissions in september 1998. of 50 children with clinical encephalitis, 9 (18%) had serologic evidence of jev infection. forty - four children had clinical hepatitis, most (55%) due to hepatitis a virus (hav). one patient had hepatitis b virus, and no patients had hepatitis c or e. this study identified a large number of children with vaccine - preventable diseases (jev and hav). |
authors do not report any financial or personal links with other persons or organizations, which might affect negatively the content of this publication and/or claim authorship rights to this publication. | authors discuss methods of echocardiographic diagnosis of the pulmonary sling with stenosis and hypoplasia of the left pulmonary artery and patent arterial duct with massive left - to - right shunt, based on a case of the newborn with resistant to treatment heart failure, with initial diagnosis of patent ductus arteriosus, referred to surgical treatment. the optimal echocardiographic views permitting establish diagnosis of the pulmonary sling were suggested. the special attention was paid to high parasternal and suprasternal views visualizing vessels of the upper mediastinum as well as characteristic differences between the normal and pathologic picture. the typical features of the echocardiogram suggesting pulmonary sling, like the lack of the left pulmonary artery in its expected position, and the abnormal branching pattern of the right pulmonary artery were indicated. the greatest diagnostic difficulties in visualization of the abnormal route of the left pulmonary artery were related to the presence of air - containing tissues, like lungs and central airways between the ultrasound probe and area of interest. the other was the masking influence of the large patent arterial duct, that may mimic the left pulmonary artery arising from the pulmonary trunk. the other entities requiring differentiation with sling, like aplasia of the left lung, the direct or indirect aortic origin of the left pulmonary artery, were discussed. the role of other visualization technics, like computed 3d tomography, and magnetic nuclear resonance, as well as direct visualization of central airways with bronchoscopy in establishing precise diagnosis were stressed. |
with the ageing population, increasing numbers of elderly patients who require treatment for coronary artery disease are observed. these elderly patients who have symptoms of angina, or who present with acute coronary syndrome very often need treatment for symptom relief and improved prognosis. the outcome for elderly patients who undergo percutaneous coronary intervention (pci) remains under - presented in published literature, particularly with regard to the clinical outcome of drug - eluting stents (des) versus bare - metal stents (bms). previously published trials have demonstrated the clinical superiority of des in reducing the need for repeat revascularization. despite such clinical benefit, bms usage remains high in this population due to the inability to tolerate prolonged dual anti - platelet therapy. though recent published data demonstrate the feasibility of shortened dual anti - platelet therapy,, the use of bms remains the treatment of choice for elderly patients at high risk of bleeding and who require surgery following pci. this retrospective study aimed to evaluate the clinical outcome for geriatric patients who received either des or bms. the primary clinical endpoints included all - cause mortality, cardiovascular death, myocardial infarction, target lesion revascularization (tlr), stent thrombosis, and bleeding complications. from january 2002 to october 2005, a total of 1,236 consecutive chinese patients with obstructive coronary artery disease underwent elective or early percutaneous coronary intervention (pci) at the grantham hospital, hong kong, a major tertiary referral center specializing in comprehensive medical treatment for adult heart and lung diseases. of these patients, 199 aged 75 years or older were recruited for analysis (mean age, 78.4 3.4 years ; male sex, 64.8%). patients were assigned to either des or bms group according to the stent used during the index procedure. a total of 562 patients who received bms and 674 patients who received a des (317 patients with sirolimus - eluting stents (ses ; cypher, cordis corp., johnson & johnson, warren, nj, usa), and 357 patients with paclitaxel - eluting stents (pes ; taxus express, boston scientific, natick, ma, usa)) were recruited to the study. this was a single - center registry based on the three - year clinical outcome for chinese geriatric patients with obstructive coronary artery disease undergoing elective or early pci at the grantham hospital, hong kong, using a des or bms. patient 's demographic characteristics and procedural data were entered into the grantham hospital cardiovascular interventional services database upon discharge. all patients were followed up in the cardiac clinic at four weeks, 12 weeks, and every three months thereafter. for the present study, clinical data concerning major adverse cardiovascular events during any subsequent hospitalization within the three - year follow - up period were retrieved from the medical records and discharge summaries of our hospital as well as other institutions. patients who were lost to follow - up within the three - year period were contacted by phone. all patients were prescribed aspirin (80 to 300 mg daily) prior to the procedure and indefinitely thereafter. patients also received clopidogrel (an oral loading dose of 300 mg followed by 75 mg daily) before the procedure, continued for a minimum of 1 month in patients who received bms, 3 months in those who received ses, and 6 months in those who received pes. the major clinical outcomes in this study included death from any cause, cardiovascular death, myocardial infarction, need for target lesion revascularization (tlr), and stent thrombosis. death from a cardiovascular cause included death due to acute myocardial infarction, cardiac perforation or tamponade, arrhythmia, a complication of the pci procedure, or any death in which a cardiovascular cause could not be excluded. myocardial infarction (mi) was defined according to the latest consensus on mi definition. target lesion revascularization was defined as any repeat revascularization (percutaneous or surgical) required due to a stenosis > 50% within the stent or within 5 mm proximal or distal to the stented segment. major bleeding was defined as any bleeding, not due to intracranial hemorrhage, which required hospitalization and/or blood transfusion and/or caused a > 2 g / l decrease in hemoglobin level. intracranial hemorrhage was diagnosed in the presence of new onset neurological symptoms with radiological confirmation (computerized axial tomography scan or magnetic resonance imaging), and classified as intra - cerebral, subarachnoid or subdural hemorrhage. statistical comparisons were performed using the student t test or fisher 's exact test, as appropriate. we used kaplan - meier time - to - event analysis with log - rank test to assess the cumulative incidence of events over time and to evaluate differences between the two groups. cox regression analysis was used to evaluate independent predictors of cardiovascular death at three years. from january 2002 to october 2005, a total of 1,236 consecutive chinese patients with obstructive coronary artery disease underwent elective or early percutaneous coronary intervention (pci) at the grantham hospital, hong kong, a major tertiary referral center specializing in comprehensive medical treatment for adult heart and lung diseases. of these patients, 199 aged 75 years or older were recruited for analysis (mean age, 78.4 3.4 years ; male sex, 64.8%). patients were assigned to either des or bms group according to the stent used during the index procedure. a total of 562 patients who received bms and 674 patients who received a des (317 patients with sirolimus - eluting stents (ses ; cypher, cordis corp., johnson & johnson, warren, nj, usa), and 357 patients with paclitaxel - eluting stents (pes ; taxus express, boston scientific, natick, ma, usa)) were recruited to the study. this was a single - center registry based on the three - year clinical outcome for chinese geriatric patients with obstructive coronary artery disease undergoing elective or early pci at the grantham hospital, hong kong, using a des or bms. patient 's demographic characteristics and procedural data were entered into the grantham hospital cardiovascular interventional services database upon discharge. all patients were followed up in the cardiac clinic at four weeks, 12 weeks, and every three months thereafter. for the present study, clinical data concerning major adverse cardiovascular events during any subsequent hospitalization within the three - year follow - up period were retrieved from the medical records and discharge summaries of our hospital as well as other institutions. patients who were lost to follow - up within the three - year period were contacted by phone. all patients were prescribed aspirin (80 to 300 mg daily) prior to the procedure and indefinitely thereafter. patients also received clopidogrel (an oral loading dose of 300 mg followed by 75 mg daily) before the procedure, continued for a minimum of 1 month in patients who received bms, 3 months in those who received ses, and 6 months in those who received pes. the major clinical outcomes in this study included death from any cause, cardiovascular death, myocardial infarction, need for target lesion revascularization (tlr), and stent thrombosis. death from a cardiovascular cause included death due to acute myocardial infarction, cardiac perforation or tamponade, arrhythmia, a complication of the pci procedure, or any death in which a cardiovascular cause could not be excluded. myocardial infarction (mi) was defined according to the latest consensus on mi definition. target lesion revascularization was defined as any repeat revascularization (percutaneous or surgical) required due to a stenosis > 50% within the stent or within 5 mm proximal or distal to the stented segment. major bleeding was defined as any bleeding, not due to intracranial hemorrhage, which required hospitalization and/or blood transfusion and/or caused a > 2 g / l decrease in hemoglobin level. intracranial hemorrhage was diagnosed in the presence of new onset neurological symptoms with radiological confirmation (computerized axial tomography scan or magnetic resonance imaging), and classified as intra - cerebral, subarachnoid or subdural hemorrhage. statistical comparisons were performed using the student t test or fisher 's exact test, as appropriate. we used kaplan - meier time - to - event analysis with log - rank test to assess the cumulative incidence of events over time and to evaluate differences between the two groups. cox regression analysis was used to evaluate independent predictors of cardiovascular death at three years. during the study period, 1,236 consecutive chinese patients with obstructive coronary artery disease underwent pci at the grantham hospital. of these, 199 patients aged 75 years or older were included in this analysis. the mean age was 78.4 3.4 years with a male preponderance (64.8%). one hundred and twelve patients received a des and the remaining 87, a bms. there were no significant differences in age, sex, or cardiovascular risk factors between the two groups, except those who received a des had a higher prevalence of hypertension (80.4% vs. 60.4%, p = 0.01). concerning the index pci, there was no significant difference between the two groups in location of target vessels or number of stents deployed (table 2). bms : bare - metal stent ; cabg : coronary artery bypass graft ; des : drug - eluting stent ; pci : percutaneous coronary intervention. bms : bare - metal stent ; des : drug - eluting stent ; lad : left anterior descending artery ; lcx : left circumflex artery ; lmca : left main coronary artery ; rca : right coronary artery. during the three - year period, no patients were lost on follow - up. as expected, patients who received a des were prescribed a longer mean duration of clopidogrel compared with those who received a bms (230.5 241.6 days vs. 58.3 78.6 days, p < 0.01). table 3 summarizes the cumulative three - year rates of major clinical outcomes for patients who received des and bms. patients who received a des had a lower cumulative three - year rate of all - cause death (6.3% vs. 16.2%, p = 0.03 ; figure 1a), cardiovascular death (3.6% vs. 11.5%, p = 0.03 ; figure 1b), and mi (5.4% vs. 14.9%, p = 0.02 ; figure 1c) than those who received a bms. the higher rate of all - cause death in the bms group was mainly driven by a higher rate of cardiovascular death. the rate of non - cardiovascular deaths was similar for each group (2.6% vs. 4.6%, p = 0.70). cox regression analysis, nonetheless, failed to identify any independent predictor of cardiovascular death at the three - year follow - up. bms : bare - metal stent ; des : drug - eluting stent ; tlr : target lesion revascularization. the cumulative three - year rate for stent thrombosis for patients who received des did not differ significantly to that for patients who received bms (3.6% vs. 2.3%, p = 0.7 ; figure 1d). likewise, the cumulative three - year rate for tlr was similar (6.3% des vs. 4.6% bms, p = 0.61 ; figure 1e). there were 36 instances of bleeding complications (18.1%) during this three - year period : three intracranial hemorrhages (2.7%), 11 major hemorrhages (5.5%), and 22 minor hemorrhages (11.1%). no intracranial hemorrhage, 4 out of 11 (36.4%) major hemorrhages, and 13 out of 35 minor hemorrhages occurred while the patient was taking dual anti - platelet agents. there was no statistically significant difference in the cumulative risk of intracranial hemorrhage, major hemorrhage, or overall event - free survival between patients who received des and bms (figure 1f to h). ami : acute myocardial infarction ; bms : bare - metal stents ; des : drug - eluting stents ; ich : intracranial hemorrhage ; tlr : target lesion revascularization. patients who received a des had a lower cumulative three - year rate of all - cause death (6.3% vs. 16.2%, p = 0.03 ; figure 1a), cardiovascular death (3.6% vs. 11.5%, p = 0.03 ; figure 1b), and mi (5.4% vs. 14.9%, p = 0.02 ; figure 1c) than those who received a bms. the higher rate of all - cause death in the bms group was mainly driven by a higher rate of cardiovascular death. the rate of non - cardiovascular deaths was similar for each group (2.6% vs. 4.6%, p = 0.70). cox regression analysis, nonetheless, failed to identify any independent predictor of cardiovascular death at the three - year follow - up. bms : bare - metal stent ; des : drug - eluting stent ; tlr : target lesion revascularization. the cumulative three - year rate for stent thrombosis for patients who received des did not differ significantly to that for patients who received bms (3.6% vs. 2.3%, p = 0.7 ; figure 1d). likewise, the cumulative three - year rate for tlr was similar (6.3% des vs. 4.6% bms, p = 0.61 ; figure 1e). there were 36 instances of bleeding complications (18.1%) during this three - year period : three intracranial hemorrhages (2.7%), 11 major hemorrhages (5.5%), and 22 minor hemorrhages (11.1%). no intracranial hemorrhage, 4 out of 11 (36.4%) major hemorrhages, and 13 out of 35 minor hemorrhages occurred while the patient was taking dual anti - platelet agents. there was no statistically significant difference in the cumulative risk of intracranial hemorrhage, major hemorrhage, or overall event - free survival between patients who received des and bms (figure 1f to h). ami : acute myocardial infarction ; bms : bare - metal stents ; des : drug - eluting stents ; ich : intracranial hemorrhage ; tlr : target lesion revascularization. landmark trials of des have demonstrated their superiority over bms in reducing the need for repeat revascularization. nonetheless, most of these clinical trials focused on patients of younger age, and elderly patients were very often under - represented. randomized trials with elderly patients, particularly those aged 75 or above, are largely lacking and thus not representative of every - day clinical practice. thus, the choice between des and bms for such patients is very often at the discretion of the surgeon. this retrospective review focuses on the clinical outcome of patients who underwent pci in a non - acute setting utilizing either a des or a bms. while there was no difference in terms of non - cardiovascular death, or need for repeat revascularization, all - cause mortality was less in those who received a des compared with bms (6.3% vs. 16.2%, p = 0.03). this enhanced clinical outcome was largely driven by fewer cardiovascular deaths in the des group (3.6% vs. 11.5%, p = 0.03) and a lower incidence of myocardial infarction compared with the bms group (5.4% vs. 14.9%, p = 0.02). in this study, use of des did not lead to a lower revascularization rate, thus dispelling the belief that des had an anti - stenotic effect. this observation may be due to the more conservative approach in managing elderly patients, particularly in this chinese population. in addition, some events may not have been observed as routine angiographic follow - up was not performed and the need for tlr was symptom - driven only. nevertheless, des implantation did benefit patients at lower risk of mi and associated cardiovascular morbidities and mortalities. in several previously published observational studies, use of des in elderly patients has been associated with lower risk of mortality and mi. bleeding tendency, particularly in elderly patients, has always been a major concern that influences choice of des or bms in a particular patient. no statistically significant difference in the incidence of bleeding complications was observed between the two study groups despite the difference in duration of anti - platelet therapy. this is not surprising given the observational nature of this study and the fact that very often, patients at higher bleeding risk and unable to tolerate a longer duration of anti - platelet therapy were treated with bms and vice versa. the absence of randomization in stent selection might also have affected the bleeding complication result. in our study, first generation dess, namely cypher and taxus stents, were used. the incidence of definite stent thrombosis in first generation des is approximately 0.9% and 1.3% at one and two years, respectively. late and very late stent thrombosis is a known phenomenon with these first generation devices with an annual increment in incidence of around 0.4%. the comparable one and two year incidence in bms has been reported to be around 1.2% and 1.4%. our reported data were similar and at three years, the rate of definite stent thrombosis was 3.6% and 2.3% in the des and bms (p = 0.7) groups, respectively. the trend towards a higher rate of stent thrombosis in the des group may be due to the use of first generation des (these have a slightly higher rate of stent thrombosis compared with the second generation des device that are currently our preferred des). the major limitation of the present study was its observational nature and patients were recruited from a single center, even though our center serves as a high - volume tertiary referral center for treatment of coronary artery disease. though no patient was lost on follow up, the relatively small number of patients recruited may have prevented identification of predictors for cardiovascular death. the study was also not sufficiently powered to compare rates of infrequent clinical events in either group, such as bleeding complications and stent thrombosis. first generation dess were in use at the time of patient recruitment, but have since been replaced by second generation des with a lower incidence of stent thrombosis and a requirement for shorter dual anti - platelet therapy. this single - center registry has demonstrated in chinese geriatric patients, utilizing des in pci was associated with a significant reduction in the three - year cumulative rates of all - cause mortality, largely driven by lower cardiovascular death and rate of myocardial infarction compared with bms. over the three years, there was no statistical difference in the risk of tlr, stent thrombosis or bleeding complications as shown in this study. the major limitation of the present study was its observational nature and patients were recruited from a single center, even though our center serves as a high - volume tertiary referral center for treatment of coronary artery disease. though no patient was lost on follow up, the relatively small number of patients recruited may have prevented identification of predictors for cardiovascular death. the study was also not sufficiently powered to compare rates of infrequent clinical events in either group, such as bleeding complications and stent thrombosis. first generation dess were in use at the time of patient recruitment, but have since been replaced by second generation des with a lower incidence of stent thrombosis and a requirement for shorter dual anti - platelet therapy. this single - center registry has demonstrated in chinese geriatric patients, utilizing des in pci was associated with a significant reduction in the three - year cumulative rates of all - cause mortality, largely driven by lower cardiovascular death and rate of myocardial infarction compared with bms. over the three years, there was no statistical difference in the risk of tlr, stent thrombosis or bleeding complications as shown in this study. | background & objectivelittle is known about the relative efficacies of percutaneous coronary intervention (pci) with drug - eluting stents (des) and bare - metal stents (bms) in elderly patients. the objective of this study was to evaluate the clinical outcome for geriatric patients who received either des or bms.methodsfrom january 2002 to october 2005, 199 consecutive chinese geriatric patients (75 years old) underwent pci with coronary des or bms implantation at our institution. we analyzed the major clinical end points that included all - cause mortality, cardiovascular death, myocardial infarction, target lesion revascularization (tlr), stent thrombosis, and bleeding complications.resultsthe three - year cumulative rates of all - cause mortality, cardiovascular death, and myocardial infarction were significantly lower in the des group (6.3%, 3.6%, 5.4%) compared with the bms group (16.2%, 11.5%, 14.9% ; p < 0.05). no significant differences were found in the three - year cumulative rate for target lesion revascularization (6.3% vs. 4.6%, p = 0.61) or stent thrombosis (3.6% vs. 2.3%, p = 0.70). likewise, there were no statistically significant differences in the cumulative rate for intracranial hemorrhage, or major and minor hemorrhage at three years.conclusionsdes-based pci was associated with a significant reduction in the three - year cumulative rate of all - cause mortality, cardiovascular death, and myocardial infarction compared with bms, without increased risk of tlr, stent thrombosis, or bleeding complications at three years in this group of chinese geriatric patients. |
cancer has been a major area of research for several years and information is now available about how tumor cells evade the immune system of the body, and how they effectively get immortal. chemo- and radio - therapies are currently the main cancer therapies for treatment/ control of the localized as well as invasive cancers. however, new treatment strategies are being studied so that a safer and a more effective cancer therapy may be developed. recent studies have shown that cancer cells in case of several cancer types show high epidermal growth factor (egf) receptor expression on their surface and this is responsible for metastasis as well as self - induced proliferation. besides metastasis, cancer cells induce angiogenesis to obtain nutrition, and to ensure survival and ability to proliferate. based on these findings, attempts are being made to target egf and/ or vegf (vascular endothelium growth factor) receptors in order to reduce the rate of tumor progression, and eventually stop the tumor cells from becoming cancerous. studies have demonstrated reduced cell growth, and degeneration of tumors upon treatment with anti - egf receptor antibodies. however, most studies show positive results in vitro but may fail to be equally effective in vivo. this is possibly due to the interaction between different sub - systems of a body, which play a crucial role in tumor growth and development of cancer but could not be taken into account during in vitro experiments because of the complexity of the system. therefore, it is important to relate the in vitro experiments to the in vivo situations to be able to predict the efficacy of a treatment strategy. various models have been developed to study cancer development and tumor growth [3 - 6 ]. some of these models have studied the tumor growth before it becomes invasive or during the early stages of invasion ; others analyze the stages in tumor development. several models are based on the spheroid model or other related models to analyze the dynamics of antibody - drug therapy. these models consider the diffusion of an antibody - drug into the tumor mass followed by the binding of the antibody to the tumor cell, and subsequent internalization of the antibody - drug complex. however, these models study the dynamics of an individual tumor without considering the effect of other tumors growing simultaneously in the body, i.e. the dynamics of the process as a whole is not considered. thus, the previously developed models give a microscopic picture, which may not be useful in studying the efficacy and design of cancer therapies as the therapies act on a macroscopic scale. the kinetic modeling may be expected to be useful in the identification of the critical parameters that should be targetted in therapy. in addition to that, the requirement for a combination therapy may also be revealed from the kinetic modeling of the complete system. a kinetic model based on interactions between different compartments of a body has been developed. thus, the kinetics of the process has been studied rather than the kinetics of a single entity. the model has thereafter been analyzed using a set of representative parameter values to demonstrate the utility and the applicability of this model. we have also shown how one can study and compare various treatment strategies using the developed kinetic model. cancer starts with a tumor growth, which may be followed by metastasis leading to spreading of the cancerous cells in various regions of the body. these metastasizing cells are carried away to the different regions through bloodstream where they may attach to a tissue and proliferate. however, the tumor cells entering the bloodstream may also be cleared through the body by the immune system or any drug action, or death by apoptosis due to the requirement of the cells to attach to the tissue at a new site and adapt to the new environment. thus, only a very small fraction of cells that escape from a primary tumor survive and initiate a new tumor. cell death and unsuccessful cell attachment are thus taken into account as plasma clearance in the model. tranformed cells are exchanged between a primary tumor and the plasma, which have been treated as two interacting but independent compartments. the cells present in plasma may either be cleared or may attach to another tissue and start growing into a new solid tumor. in order to model the cell growth within solid tumors, population dynamics model has been used, where t0 is the equilibrium tumor cell concentration in the tumor and r is the specific growth rate. however, in physiological situation, t0 may be variable as the tumor cells are able to procure more nutrition by carrying out angiogenesis (assuming no spatial limitations for tumor growth). thus, dttum / dt = rttum(1-ttum / t0) - kf1ttum + kr1tplas... (1) dtplas / dt = kf1ttum - kr1 tplas + n. (- kf2tplas + kr2tnew) - ctplas... (2) dtnew / dt = rtnew(1 - tnew / t0) + kf2tplas - kr2tnew... (3) ttum = cell concentration of the original tumor tplas = cancer cell concentration in the plasma tnew = cell concentration of new and developing tumor n = number of new tumors being developed simultaneously and all kf 's and kr 's are the corresponding rate constants of the steps shown in figure 1. all equations take into account the cell growth, loss into plasma due to metastasis, and attachment of the cells from plasma to the tissue. in the model,,, and these factors represent the effect a specific cancer therapy has on the different parameters. in the absence of any therapy, these factors are all equal to unity as the values are relative to the case when no therapy is being applied. moreover, cells are cleared out by means of immune response and apoptosis due to the inability of cells to attach to the new tissue. for example, by choosing the parameter values for the developing tumor, we can consider the initial stages when it does not metastasize and thereafter after a certain cell concentration, the parameter values may be changed to incorporate metastasis. in fact, once the new tumor has sufficient cell concentration, it can itself be considered as a source tumor and the cancer cell growth reanalyzed. on the other hand, this assumption may be valid if the cell concentration limit for the cell to start metastasizing is orders of magnitude less than the steady state concentration it attains. thus, this kinetic model is of a very general nature and a simplified form of the physiological situation, as there exists a far greater interaction between different compartments than what has been modeled. to study the dynamics of cancer growth, we have used certain representative values for the model parameters as tabulated in table 1. all simulations have been carried out using mathematica 4 (wolfram research). in the graphs this is important as during drug treatment or any other therapy, it is useful to know the concentration profile as a function of time such that different therapies my be compared. representative parameter values used for simulating cancer cell growth. for the simulation of the cancer growth, the drug efficacy parameters have all been taken as one in the absence of any cancer therapy, as mentioned earlier. however, depending on the therapy, different values of,, and have been taken. drug efficacy parameters for simulating different cancer therapies the parameter values are mostly based on some experimental observations for various cancer types. we have taken the potential doubling time (tpot) for the (human) tumor mass under consideration as ten days, though some tumors may have a slower growth rate. it is known that metastasis reduces the effective doubling time such that the observed doubling time may be few weeks to few months. incorporating this information, we obtain the rate constant for metastasis for our model (kf1 and kr2). for the analysis, cells are unable to attach to the endothelial tissue easily, the rate constants for attachment of cells to the existing tumor or to a new tumor has been taken as nearly 1% of the rate of metastasis. based on a metastasis experiment done in mouse model, the initial conditions for the simulations as well as the rate of plasma clearance have been chosen. in the experiments that have been previously carried out, a primary tumor was developed, which has been assumed to have a cell concentration of 3 10 cells/ ml based on in vitro studies as well as the number of cells implanted in the mouse model. thereafter, 2 10 tumor cells were injected into vein, and metastasis of the tumor cells was observed. assuming that tumor cells injected into the plasma at the beginning of the experiment correspond to the steady state cell concentration in the plasma, the rate constant for plasma clearance has been obtained. this may be valid due to the fact that the plasma volume is large, tumors may be localized or may not invade several tissues, and eventually steady state is reached so that the cells released by existing tumor either result in new tumors or are cleared out from the body. the variation in cell concentrations in the existing tumor, and the developing tumor in the absence of any cancer therapy has been shown in figure 2(a). different therapies considered are reduction in cell growth as well as metastasis by egf receptor inhibitors, and reduction in specific growth rate and increase in clearance rate by activating immune response against cancer cells using therapies like adoptive therapy [15 - 22 ]. figures 2(b) and 2(c) depict the cell growth in the presence of the two drug therapies- egfr inhibitors and adoptive therapy respectively. growth of existing tumor and new tumor : a) in the absence of any therapy ; b) egfr inhibitor therapy ; c) adoptive therapy ; and d) antibody - drug therapy. a single the same analysis may be applied to all the existing tumors at any given time to study the kinetics of cancer progression in the absence and the presence of various cancer therapies. cell growth in the absence of any cancer therapy has been depicted in figure 2(a). the existing tumor cells grow and attains a steady - state concentration. at the same time, the tumor cells escape from the primary tumor and form a secondary tumor at a new site. eventually, both the primary as well as the secondary tumors reach the same steady state cell concentration. thereafter, the primary and the secondary tumors can result in formation of new tumors, and thus the cancer spreads to various regions of the body. in case of egfr inhibitor therapy, the effective value of specific growth rate (r) and rate of metastasis (kf1 and kr2) decrease, and this subsequently results in slower tumor growth of the existing as well as the developing tumors (figure 2(b)). however, unless the inhibitor efficacy is sufficient enough to decrease the rate of cell growth to less than the rate of cell clearance from plasma, cancer cells can not be eradicated from the body and the effect is merely to delay the cell growth (which in this case is by a factor of ~4). this extension may be helpful if there is any subsequent and/ or parallel treatment. the reduction in the cell release rate may in fact result in higher steady state cell concentration in the primary tumor thereby, partially or totally overcoming the effect of the reduction in the cell release rate constant. however, if the egfr inhibitor therapy is combined with other treatment(s) that can further reduce the rate of cell growth, then tumor degeneration may be observed. in contrast to anti - egfr treatment, the model predicts that the adoptive therapy may lead to a nearly complete elimination of new as well as existing tumors. the parameters affected by adoptive therapy are r and c, i.e. rate of cell growth decreases and rate of plasma clearance of cells increases, as the immune response destroys the tumor cells in the tumor masses as well as in the plasma. as seen in figure 2(c), a small reduction in specific rate of cell growth and an increase in plasma clearance can result in complete removal of cancer cells from existing tumors in a matter of few months and it also ensures that the new tumor masses are not able to reach the high concentrations. these new tumor masses also degenerate progressively and thus, the cancerous cells are completely eliminated in a few months. since, this form of treatment is relatively fast compared to any combination therapy involving egfr inhibitor therapy, this may even be used for cancers in advanced stages. however, activation of immune response against cancer cells itself is a big challenge. this is so because cancer cells are able to escape immune surveillance by shedding the antigen peptides on their surfaces, and by releasing blocking factors, which can neutralize the nk cells. in this direction, various strategies are being explored like adoptive therapy, dendritic cell vaccine and enhancement of nk cell activity through il-2. one way to overcome this limitation is to activate an immune response against the blocking factors themselves. in that way, all the blocking factors may be neutralized so that the tnf/ il-1 or nk can destroy the cancer cells in the tumor as well as in the plasma. after activating the immune response against the blocking factors, nk cell activity may be enhanced by priming them with il-2 depending on the state of cancer and the nk cell activity. lastly, therapies like antibody therapy with antibody - drug targeted against the cancer cells, and anti - angiogenesis therapy decrease the rate of cell growth keeping rate constant for cell release from the tumor unchanged. in that case, this may be explained by the fact that the balance between cell growth and cell clearance is disturbed and this may result in smaller tumors and/or eradication of tumor masses. the degeneration of tumor mass with antibody therapy assumes that the antibody is accessible to all the tumor cells, which is not the case in physiological situation. in this way, we observe that cancer growth can be modeled by considering the cell growth and metastasis as interaction between various compartments. using this model, various cancer therapies may be compared for their efficacies, and may be focussed to result in a better and an effective therapy. however, we would like to point out that these results are based on the parameter values selected for the analysis and therefore, the true efficacy of a therapy can be realized only after carrying out analysis with the corresponding parameter values. in addition, the results depend on the efficacy of a therapy, i.e. the values of the drug efficacy factors determine the efficacy of a therapy. the actual effect of any therapy will depend on the drug efficacy parameters but from this analysis, we infer that the reduction in specific growth rate of cells is primary, and the rate of cell release from the tumor masses should not be decreased substantially for the success of the treatment strategy. thus, these results should not be taken as a means to accept or reject a therapy, but should rather be used for improving and designing the cancer therapies. cancer growth has been modeled as the growth as an existing tumor and metastasis resulting in interaction between the existing tumor and plasma viewed as two independent but interacting compartments. the cells present in plasma, thereafter attach to another tissue and grow into a new tumor mass. the new tumor mass increases in size due to cell growth and cell uptake from plasma. however, once the cell concentration reaches a steady state concentration, this tumor mass also becomes a source for new tumor masses, i.e. it forms another stage for cancer growth. further, two different cancer therapies- egfr inhibitor therapy and adoptive therapy- were analyzed using this kinetic model. the results point to the importance of targeting the specific growth rate as well as the plasma clearance rate in the system. thus, this model helps study the efficacy of the cancer treatment therapies, and also helps determine the critical factors, which may be targeted. however, these results are strongly dependent on the parameter values, which should be appropriately taken and analyzed for specific case ; but this model is useful in focussing and improving a cancer therapy in order to make it more effective. sj would also like to thank alireza khademhosseini for critical comments during the preparation of the manuscript. | a kinetic model has been developed to study cancer growth. cancer growth has been considered as interaction between various independent but interacting compartments. the model considers cell growth and metastasis resulting in the formation of new tumor masses. using certain representative parameter values, cell growth has been modeled in the absence and the presence of various cancer therapies. based on this analysis, the critical parameters involved in cancer development have been identified. this model may thus be useful in studying and designing a cancer therapy using the data obtained from specific in vitro experiments. |
ectopic thyroid is a developmental anomaly of the thyroid gland in which thyroid tissue is present at sites other than its normal location in the neck. it is usually uncommon to have multiple locations of ectopic thyroid tissue (ett) present simultaneously. though ett can manifest at any age it is mostly noted at adolescence. about 65 - 80% of cases manifesting with ett are females. lingual thyroid is the most common ectopic location for the thyroid accounting for 90% of cases. it is very rare to have two ectopic foci of thyroid tissue simultaneously and only a very few cases of dual ectopy have been reported in the world literature. we report a case of dual thyroid ectopy, wherein 99 m - technetium (tc) pertechnatate hybrid single - photon emission computed tomography / computed tomography (spect / ct) played an important role in demonstrating multiple ectopia of the thyroid gland. the present case report is about a 10-year - old girl who presented with anterior midline neck swelling since 6 months, which was gradually increasing in size. on evaluation, she was found to have hypothyroidism without evidence of growth retardation. on local examination, a swelling 2 2 cm size, cystic, well - defined with a smooth surface neither compressible nor reducible was palpated just below the hyoid bone, which was moving up with protrusion of tongue and with deglutition, but was not trans - illuminant. serum biochemistry revealed t3 = 86 ng / dl (normal, 70 - 200 ng / dl), t4 = 4.3 g / dl (normal, 4.5 - 12.5 g / dl) and thyroid - stimulating hormone level of 27 iu / ml (normal, 0.5 - 4.7 iu / ml). with a provisional diagnosis of sub - hyoid thyroglossal cyst, patient was referred for a technetium thyroid scan to rule out functioning thyroid tissue in the cyst. tc - pertechnatate thyroid scan revealed a midline focus of tracer uptake corresponding to the palpable neck swelling suggestive of ectopic functioning thyroid tissue. in addition, a small linear streak of tracer activity was seen to extend superiorly [figure 1 ] from the ett in the neck. spect / ct of the neck revealed ett on the right side of the thyroid cartilage, in the sub - hyoid location ; in addition to this another ectopic rest of thyroid tissue was noted in the midline floor of the mouth. tracer was also seen to extend along a tract, which was well - appreciated on sagittal section [figure 2 ]. 99m - technetium - pertechnatate thyroid scan anterior (a) and lateral (b) view revealing a midline focus of tracer uptake corresponding to the palpable neck swelling suggestive of ectopic functioning thyroid tissue. in addition, a small linear streak of tracer activity was seen to extend superiorly (a - arrow) computed tomography (ct) and hybrid single photon emission computed tomography / ct images of the neck revealing ectopic thyroid tissue on the right side of the thyroid cartilage, in the sub - hyoid location (a and b ; arrow) and in the midline floor of the mouth (c and d ; broken arrow). furthermore, tracer was seen to extend along a tract which was well appreciated in sagittal images (e and f) its original position is marked by the foramen caecum at the junction of anterior two - thirds and posterior one - third of the tongue. an evagination appears between the first and second pharyngeal pouch at 4 weeks of gestational age which lengthens to form a tube and descends inferiorly and anteriorly to pass anterior to the hyoid bone and forms the lateral lobes of the thyroid. the pathway from the pharynx to the anterior neck is marked by the thyroglossal duct. hybrid spect / ct may be useful in accurate localization of ectopic thyroid rests and to differentiate from other causes of midline cervical masses. in our case report, planar thyroid scintigraphy showed single ectopic thyroid at the sub - hyoid location but on hybrid spect / ct, we found dual ectopia along the thyroglossal tract. in evaluating thyroid ectopy, spect / ct may thus have an incremental value over planer scintigraphy for accurate localization of ectopic thyroid rests which may influence patient management. | ectopic thyroid tissue (ett) refers to the presence of thyroid tissue in locations other than the normal anterior neck region between the second and fourth tracheal cartilages. multiple ectopia of the thyroid is extremely rare. here we report a case of 10-year - old girl with anterior midline neck swelling and hypothyroidism with dual ectopia of thyroid gland without orthotopic thyroid gland. planar 99 m - technetium pertechnatate scan identified ett corresponding to the palpable neck swelling. single photon emission computed tomography / computed tomography (spect / ct) demonstrated ett in two locations, one corresponding to the palpable mass and another in the in the sublingual location. this case thus demonstrates the important role of hybrid spect / ct in the identification of dual ectopia along the thyroglossal tract. |
materials the vla-4-specific ligand (1416) 4-((n-2-methylphenyl)ureido)-phenylacetyl - l - leucyl - l - aspartyl - l - valyl - l - prolyl - l - alanyl - l - alanyl - l - lysine (ldv - containing small molecule) and its fitc - conjugated analog (ldv - fitc) were synthesized at commonwealth biotechnologies. mouse anti - human cd29, huts-21(pe), pe mouse anti - human cd49d (4-integrin subunit, pe) clone 9f10, isotype control (mouse igg2a pe) clone g155178, isotype control (mouse igg1 pe) clone mopc-21 were purchased from bd biosciences and used according to the manufacturer 's instructions. mouse anti - human cd29, clone huts-4, was purchased from millipore corp. simply cellular anti - mouse igg microspheres were purchased from bangs laboratories, inc. stock peptide solutions were prepared in dmso at concentrations 1000-fold higher than the final concentration. usually, 1 l of stock solution was added to 1 ml of cell suspension yielding a final dmso concentration of 0.1%. cell lines and transfectant construct the human histiocytic lymphoma cell line u937 was purchased from atcc. site - directed mutants of the fpr (non - desensitizing mutant of fpr st) in u937 cells were prepared as described (17) and were a gift of dr. high receptor expressing cells were selected using the moflo flow cytometer (dakocytomation). cells were grown at 37 c in a humidified atmosphere of 5% co2 and 95% air in rpmi 1640 (supplemented with 2 mm l - glutamine, 100 units / ml penicillin, 100 g / ml streptomycin, 10 mm hepes, ph 7.4, and 10% heat - inactivated fetal bovine serum). cells were then harvested and resuspended in 1 ml of hepes buffer (110 mm nacl, 10 mm kcl, 10 mm glucose, 1 mm mgcl2, 1.5 mm cacl2, and 30 mm hepes, ph 7.4) containing 0.1% human serum albumin and stored on ice. the buffer was depleted of lipopolysaccharide by affinity chromatography over polymyxin b sepharose (detoxigel ; pierce). cells were counted using the coulter multisizer / z2 analyzer (beckman coulter). for experiments, cells were suspended in the same hepes buffer at 10 cells / ml and warmed to 37 c for 10 min before real - time binding experiments (see below). cell surface staining u937 cells were suspended in the hepes buffer (see above), 1 10 cells / ml, and 100-l aliquots (10 cells) were incubated on ice for 30 min with 20 l of antibodies. next, cells were washed with 1 ml of hepes buffer, resuspended in 300500 l of buffer, and analyzed by flow cytometry. to maintain gpcr signaling and vla-4 conformational change, binding of huts-21 antibodies the ability of a flow cytometer to discriminate between free and bound fluorescent ligand in a homogeneous assay was used to determine binding kinetics of mabs in real time (18). cells (10 cells / ml) removed from ice were warmed in hepes buffer containing 0.1% human serum albumin for 10 min at 37 c. flow cytometric data were acquired continuously for up to 1024 s at 37 c, whereas the samples were stirred continuously at 300 rpm with a5 2-mm magnetic stir bar (bel - art products). first, samples were analyzed for 30120 s to establish a base line for unstained cells marked on figures as autofluorescence. next, the tube was removed, huts-21 mabs (20 l/1 ml of cells) were added, and acquisition was re - established, creating a 510-s gap in the time course. for real - time activation experiments, different stimuli (fmlff, at saturating concentration (100 nm final), ldv at different concentrations) were added after 60120 s. then, acquisition was re - established, and data were acquired continuously for up to 1024 s. for long term kinetic measurements, the tube was removed and incubated at 37 c, whereas the samples were stirred continuously. next, single point measurements were taken at different time points, collecting 5,00010,000 events (see fig. the resulting data were converted to mean channel fluorescence (mcf) versus time using fcsquery software developed by dr. calibration of surface markers expression of integrin molecules was measured with fluorescent mabs and quantified by comparison with a standard curve generated with simply cellular anti - mouse igg microspheres (bangs laboratories) stained in parallel with the same mab according to manufacturer instructions. this produces an estimate of the antibody binding capacity (abc) that corresponds to the total number of mab binding sites / cell. curve fits and statistics were performed using graphpad prism version 4.00 for windows, graphpad software, san diego, ca. homology modeling was used to build two models of the human vla-4 (open and closed conformation) to generate three - dimensional structures for vla-4 multiple conformational states, which recently have been visualized for iib3 integrin using electron microscopy and x - ray crystallography (1921). the crystal structure of v3 in complex with cyclo(rgdf[nme]v) ligand (protein data bank code 1l5 g) (22, 23) was used as a template to build a three - dimensional model for human vla-4 integrin in the bent closed conformation. because 1l5 g structure does not offer any structural information regarding egf-1 and egf-2, we have modeled these pieces based on egf-3 and egf-4 fragments and inserted them between the hybrid and egf-3 domains. the three - dimensional model for vla-4 with open headpiece was built using the crystal structure of iib3 integrin (protein data bank code 1txv) as a template (21). the integrin subunit sequences were first aligned by applying the default parameters of t - coffee package (24, 25), and then they were manually adjusted to align important residues and to avoid insertions or deletions in the conserved regions. the final alignments were submitted for automatic modeling to the swiss - model server (2628), and the resulting models were minimized using the biopolymer module from sybyl software suite (sybyl 7.3, tripos international). as we expected, by overlapping the headpiece of the two 41 models, we observed no significant differences between orientations of the -propeller in either 4 subunits. the major structural modification found is the sliding of 7-helix and the swing - out of the hybrid domain in the 1-subunit. to generate in the next step the intermediate states in equilibrium between known conformational structures of 41, we used both 1-subunits in open and closed conformation and only the 4-subunit modeled according to the v integrin. inside - out activation through fpr or cxcr4 does not result in significant huts-21 epitope exposure in the absence of integrin ligand binding of huts-21 is often presented as a way to assess activation status of 1 integrins (2931). for several years we have systematically studied the regulation of vla-4 affinity and conformation using a model system, which consists of u937 cells transfected with a non - desensitizing mutant of fpr (st). all serines and threonines in c - terminal part of this receptor were mutated, and therefore, the receptor can not be phosphorylated, desensitized, and internalized (32). on resting cells the majority of integrin molecules exhibit a low affinity bent conformation. after activation by formyl peptide, the affinity state is up - regulated, and rapid molecule unbending (extension) can also be detected using a fluorescence resonance energy transfer - based assay. this activated state persists for more than 2530 min because of the lack of receptor desensitization (4, 14, 16, 33). we took advantage of this well characterized model system to study how huts-21 would report this persistent activated state. 1a, fmlff bar). in a parallel experiment with fluorescent ldv ligand, using the same batch of u937 cells, we detected rapid affinity up - regulation (data not shown and refs. the addition of ldv - containing ligand at a saturating concentration induced significant huts-21 binding in the absence of activation (fig. quantitatively, the value of fluorescence attributed to specific binding of huts after fmlff treatment was less than 10% that of the value for the ligand induced conformational change (fig. no significant binding of huts-21 after cell treatment with sdf-1 was detected (data not shown). thus, activation of u937 cells through a non - desensitizing gpcr or cxcr4 in the absence of ligand was insufficient to induce full exposure of huts-21 epitope. next, to study the kinetics of epitope exposure, we performed a real - time analysis of huts-21 binding. this is possible because a flow cytometer can discriminate between free and bound ligand without a wash step (18). the addition of huts-21 to u937 cells in real - time resulted in a very rapid nonspecific huts-21 binding, which was unchanged during the next 5060 min (see the dmso line in fig. 1, b and c). this result indicates that without additional activation no spontaneous huts-21 epitope exposure can be detected. the addition of saturating amounts of formyl peptide and ldv ligand resulted in a rapid exposure of the epitope and induced antibody binding (fig. moreover, the ratio between mcf values for ldv - stimulated cells versus fmlff stimulation attributed to the specific binding of huts after a long incubation in real - time binding assay without the wash step (428/31 = 13.8) was very similar to the ratio determined in a regular antibody binding assay that includes a wash step (42.3/3.2 = 13.2). thus, two different assays provide very similar results. figure 1.binding of huts-21 antibodies to u937 cells stably transfected with a non - desensitizing mutant of fpr. a, cells were incubated for 40 min at 37 c in the presence of isotype control or huts-21 antibody and different activation stimuli : dmso (control), fmlff (100 nm), ldv (1 m). next, cells were washed, and red fluorescence was measured (fl2) ; see experimental procedures for details. cells were treated with huts-21 mabs, dmso (vehicle), ldv (1 m), or fmlff (100 nm). the addition of huts-21 antibodies (first arrow) resulted in a rapid nonspecific binding of antibodies. without ligand addition the addition of a saturating amount of the ldv ligand (second arrow) led to progressive antibody binding over a long time. cell activation by fmlff did not significantly affect binding in the absence of the ligand. c, the same experiment as shown on a panel b, extended for a longer time. the area corresponding to a panel b (continuous acquisition) is indicated by gray shading on panel c. d, kinetics of huts-21 epitope exposure after cell activation through fpr. average binding rates of mcf change (measured in mcf per second) were calculated for each 30-s time interval and plotted on fig. 1d (right y axis) together with a line showing huts-21 binding (left y axis, analogous to fmlff line on fig. 1, b and c). binding of huts-21 antibodies to u937 cells stably transfected with a non - desensitizing mutant of fpr. a, cells were incubated for 40 min at 37 c in the presence of isotype control or huts-21 antibody and different activation stimuli : dmso (control), fmlff (100 nm), ldv (1 m). next, cells were washed, and red fluorescence was measured (fl2) ; see experimental procedures for details. cells were treated with huts-21 mabs, dmso (vehicle), ldv (1 m), or fmlff (100 nm). the addition of huts-21 antibodies (first arrow) resulted in a rapid nonspecific binding of antibodies. without ligand addition the addition of a saturating amount of the ldv ligand (second arrow) led to progressive antibody binding over a long time. cell activation by fmlff did not significantly affect binding in the absence of the ligand. c, the same experiment as shown on a panel b, extended for a longer time. the area corresponding to a panel b (continuous acquisition) is indicated by gray shading on panel c. d, kinetics of huts-21 epitope exposure after cell activation through fpr. average binding rates of mcf change (measured in mcf per second) were calculated for each 30-s time interval and plotted on fig. 1d (right y axis) together with a line showing huts-21 binding (left y axis, analogous to fmlff line on fig. 1, b and c). figure 2.ldv concentration - dependent binding of huts-21 to resting cells (without fpr activation). a, kinetics of real - time binding of huts-21 antibodies to u937 cells. the addition of huts-21 antibodies (first arrow) resulted in rapid nonspecific binding of antibodies. the addition of increasing amounts of ldv ligand resulted in the different rates of antibody binding (compare slopes after ldv additions). cells were incubated with the indicated concentrations of ldv in the presence of an excess of huts-21 mabs and washed, and mcf was measured. the data were fitted using the sigmoidal dose - response equation with variable slope using graphpad prism software (the hillslope was found to be 1). ldv concentration - dependent binding of huts-21 to resting cells (without fpr activation). a, kinetics of real - time binding of huts-21 antibodies to u937 cells. the addition of huts-21 antibodies (first arrow) resulted in rapid nonspecific binding of antibodies. the addition of increasing amounts of ldv ligand resulted in the different rates of antibody binding (compare slopes after ldv additions). cells were incubated with the indicated concentrations of ldv in the presence of an excess of huts-21 mabs and washed, and mcf was measured. the data were fitted using the sigmoidal dose - response equation with variable slope using graphpad prism software (the hillslope was found to be 1). a representative experiment of three independent experiments is shown. to study the kinetics of epitope exposure after fpr activation, we calculated absolute rates of huts-21 binding after the addition of fmlff. the rate of huts binding reached its maximal value during the first 30 s after fmlff addition. thus, these data indicate that huts-21 epitope is only exposed in the first 4 min after inside - out signaling was initiated by the addition of gpcr ligand. this result was not anticipated because cells are transfected with a non - desensitizing mutant of fpr, and the vla-4 receptor is reported to maintain a high affinity unbent conformation for at least 2030 min after the addition of fmlff (4, 7, 1416). thus, in the absence of the integrin ligand, the huts-21 epitope is exposed for a very short period of time after cell activation. the data suggest that the occupancy of the ligand binding site rather than inside - out activation per se is necessary for huts-21 epitope exposure. occupancy of the ligand binding site in the absence of integrin activation is sufficient to induce huts epitope exposure to find out how occupancy of the ligand binding site affects huts-21 binding, we have studied huts-21 binding at different concentrations of ldv ligand (fig. the addition of different concentrations of ldv resulted in a different rates of huts-21 binding (fig. long term incubation of u937 cells with a large excess of huts-21 in the presence of different concentrations of ldv (fig. the ec50 for huts-21 binding in this case (ec50 = 11.4 nm) is identical to a previously published kd for binding of ldv - fitc to resting u937 cells (kd 12 nm) (14). thus, in the absence of cell activation, ldv to the vla-4 integrin induces huts-21 epitope exposure detected by huts-21 binding. because the ec50 for huts-21 binding induced by the binding of ldv is equivalent to the kd for ligand binding in the absence of huts-21, these data also confirm that binding of huts-21 to the 1-integrin subunit had no effect upon affinity of ldv ligand binding. figure 3.estimation of number of huts-21 and anti - cd49d (9f10, anti 4-integrin) mabs binding sites on u937 cells. cells were incubated with isotype control, huts-21, or 9f10 (see the experimental procedures for details). a, histograms for cell autofluorescence and isotype control (g155178, isotype control for huts-21). c, calibration curve generated using simply cellular anti - mouse igg microspheres for huts-21 mabs. d, histograms for cell autofluorescence and isotype control (mopc-21, isotype control for 9f10). f, calibration curve generated using simply cellular anti - mouse igg microspheres for 9f10 (anti - cd49d) mabs. equations and calculated abcs are shown in panels c and f. the difference in the abc values for huts-21 and cd49d was not statistically significant. estimation of number of huts-21 and anti - cd49d (9f10, anti 4-integrin) mabs binding sites on u937 cells. cells were incubated with isotype control, huts-21, or 9f10 (see the experimental procedures for details). a, histograms for cell autofluorescence and isotype control c, calibration curve generated using simply cellular anti - mouse igg microspheres for huts-21 mabs. d, histograms for cell autofluorescence and isotype control (mopc-21, isotype control for 9f10). f, calibration curve generated using simply cellular anti - mouse igg microspheres for 9f10 (anti - cd49d) mabs. equations and calculated abcs are shown in panels c and f. the difference in the abc values for huts-21 and cd49d was not statistically significant. induction of huts-21 epitope by ldv ligand can be also observed on ice (data not shown), suggesting that no intracellular signaling is involved in this type of conformational change. mechanically induces a series of conformational changes (for example, see fig. the number of bound huts-21 corresponds to the total number of cd49d binding sites next, to quantify the number huts-21 binding sites on u937 cells, we used quantum simply cellular beads (bangs laboratories) to calibrate antibody binding. cells were saturated with huts-21 in the presence of a saturating amount of ldv ligand (1 m) (fig. this resulted in two calibration lines that were used to estimate abcs (fig. the data showed that the numbers of bound huts-21 (abc 164,000) and anti - cd49d (abc 179,000) were very similar, indicating that essentially every vla-4 molecule can adopt a conformation with exposed huts-21 epitope after ldv ligand binding. as shown previously, the number of vla-4 molecules detected on u937 cells is similar to the number of fluorescent ldv - fitc molecules bound to u937 cells (14). therefore, the number of vla-4 sites with bound huts-21 corresponds to the number of sites occupied by the ligand. the rate of huts-21 binding can be used to determine integrin affinity state according to our data, binding of huts-21 can be described in the following simple model, (eq. 1)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}\;\;l+r\begin{matrix}k_{+1}\\ { \longleftrightarrow}\\ k_{-1}\end{matrix}lr\;\;\end{equation}\end{document } (eq. 2)\documentclass[10pt]{article } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{pmc } \usepackage[euler]{upgreek } \pagestyle{empty } \oddsidemargin -1.0 in \begin{document } \begin{equation}\;\;lr+huts\begin{matrix}k_{+2}\\ { \rightarrow}\\ \end{matrix}(lr{\cdot}huts)\;\;\end{equation}\end{document } where l is the concentration of ldv ligand, r is the concentration of vla-4 receptor, and lr is the concentration of ligand - receptor complex. huts is the concentration of huts antibodies, and lrhuts is the concentration of huts bound to ligand - occupied vla-4. because flow cytometers have the ability to discriminate between free and bound fluorescent ligand in a homogeneous assay (18), mcf is proportional to lrhuts. in the absence of ldv ligand, no ligand receptor complex is formed, and therefore, no binding of huts-21 is observed (fig. 1, b and c, dmso line). the addition of different concentrations of ldv results in the formation of the ligand - receptor complex, and this is reflected in the different rates of huts-21 binding (figs. because binding of a large antibody molecule is limited by diffusion, antibody binding is slow compared with the binding of a small ldv molecule. also on this time scale binding of antibodies is virtually irreversible (equation 2). the ligand equilibration time (and approach to equilibrium) is determined by its dissociation rate constant (k-1). for the ldv ligand, k-1 varies from 0.10.06 s for the resting state to 0.020.01 s for fmlff - activated state (14, 15). therefore, for these affinity states (resting and fmlff activated) equilibrium is reached within a few minutes after ligand addition (see refs. 14 and 15 for real - time ldv - fitc binding kinetics). binding of huts-21 on this time scale is very far from equilibrium (see fig. 1c), and therefore, binding of huts is represented by a series of straight lines (figs. thus, under these conditions, the binding rate of huts-21 is determined by the amount of lr at each time (equations 1 and 2). therefore, the observed rate of huts-21 binding (the slope of the line, figs. 2a and 4a) is proportional to the concentration of ligand receptor complex at each time. figure 4.kinetics of real - time binding of huts-21 antibodies to u937 cells, transfected with a non - desensitizing mutant of formyl peptide receptor. a, cells were treated with 100 nm of fmlff (activated) or dmso (vehicle) 5 min before the start of the experiment. the addition of huts-21 antibodies (first arrow) resulted in a rapid nonspecific binding of the antibody. this induced binding of mabs and resulted in different rates of antibody binding (compare slopes after ldv additions). b, absolute rates huts-21 binding (slopes of lines between sequential ldv additions calculated from panel a) plotted versus concentration of ldv in solution. the fit to the data was done using the sigmoidal dose - response equation with variable slope using graphpad prism software. difference in ec50 values for resting and activated cells indicated the affinity change for ldv binding. a representative experiment of three independent experiments is shown. c, the slopes of the lines between sequential ldv additions, calculated from panel a, are plotted versus the fraction of vla-4 occupied by ldv. the fraction of vla-4 occupied by ldv was calculated using the one - site binding equation (y = 100 ldv / kd + ldv, where y is % of sites occupied, ldv is ldv concentration, and kd is a previously published dissociation constant for resting and fmlff activated states). d, the change in the rates of huts-21 binding can be seen in real - time. cells pretreated with huts-21 antibodies (first arrow) were treated with a very high saturating concentration of ldv (10 m, second arrow). next, cells were activated by fmlff. control samples (dmso) are also shown. despite the fact that vla-4 is completely saturated by ldv (10 m is 1000-fold higher than kd), the change in the slope of the line indicating huts-21 binding can be detected. kinetics of real - time binding of huts-21 antibodies to u937 cells, transfected with a non - desensitizing mutant of formyl peptide receptor. a, cells were treated with 100 nm of fmlff (activated) or dmso (vehicle) 5 min before the start of the experiment. the addition of huts-21 antibodies (first arrow) resulted in a rapid nonspecific binding of the antibody. this induced binding of mabs and resulted in different rates of antibody binding (compare slopes after ldv additions). b, absolute rates huts-21 binding (slopes of lines between sequential ldv additions calculated from panel a) plotted versus concentration of ldv in solution. the fit to the data was done using the sigmoidal dose - response equation with variable slope using graphpad prism software. difference in ec50 values for resting and activated cells indicated the affinity change for ldv binding. c, the slopes of the lines between sequential ldv additions, calculated from panel a, are plotted versus the fraction of vla-4 occupied by ldv. the fraction of vla-4 occupied by ldv was calculated using the one - site binding equation (y = 100 ldv / kd + ldv, where y is % of sites occupied, ldv is ldv concentration, and kd is a previously published dissociation constant for resting and fmlff activated states). d, the change in the rates of huts-21 binding can be seen in real - time. cells pretreated with huts-21 antibodies (first arrow) were treated with a very high saturating concentration of ldv (10 m, second arrow). next, cells were activated by fmlff. control samples (dmso) are also shown. despite the fact that vla-4 is completely saturated by ldv (10 m is 1000-fold higher than kd), the change in the slope of the line indicating huts-21 binding can be detected. consecutive addition of increasing amounts of ldv ligand resulted in different rates of huts-21 binding (fig. for each ldv concentration (between ldv additions) absolute rates of huts-21 binding were determined by fitting to the linear regression equation. next, the slope of each line was plotted versus ldv concentration for every time interval (see fig. this resulted in a sigmoidal dose - response curve that shows the relationship between the concentration of exposed huts-21 epitope and the concentration of ldv in solution. experiments were performed without significant ligand depletion, because the total concentration of vla-4 receptors in solution was < 0.3 nm (170,000 molecules / cell (fig. both ec50 values for the resting and fmlff - activated cells were comparable with previously published kd values for the binding of ldv - fitc to u937 cells (14, 15). thus, binding of the ligand depends upon its concentration and the affinity of the vla-4 receptor (activation state of the integrin). a combination of these two factors determines (lr) (see equations 1 and 2) and thereby drives huts-21 binding. the rate of huts-21 binding appears to be related to inside - out activation through fpr a thorough examination of antibody binding rates revealed another intriguing phenomenon. absolute rates of huts-21 binding to u937 cells activated by fmlff were faster than the binding rates for the resting cells at the same fraction of ligand occupied receptors (fig. 1d because fmlff was added 5 min before the start of the experiment (see the legend to fig. no significant binding huts-21 was detected in the absence and at low concentration of ldv ligand. the initial slope after the addition of huts-21 was horizontal for up to 300 s (see fig. an increase in the rate of huts-21 binding can be also seen in real - time under the condition that vla-4 was completely saturated with ldv ligand (fig. the ldv ligand concentration in this experiment was 10 m, which is about 1000-fold higher than the kd for ldv binding at this affinity state (kd 12 nm (14)). the simplest interpretation is that the activation of integrin through gpcr results in a conformational change which increases the rate of huts-21 binding. as shown previously, inside - out activation of integrins results in up - regulation of ligand binding affinity and unbending (extension) of the integrin molecule. the affinity change and unbending represent two different conformational changes that are regulated independently by different signaling pathways (4). thus, we propose that an increase in the rate of huts-21 binding could be attributed to the unbending (extension) of the molecule induced by inside - out activation. it is also possible that inside - out activation would increase the probability of a hybrid domain movement (for example, by changing the overall flexibility of the molecule) and thereby augment the overall concentration of the exposed epitope in solution. other possibilities include a conformational change that is not related to the extension of the molecule. figure 5.detection of high affinity state of vla-4 using huts-21 antibodies. a, simulation of ldv binding for two affinity states of vla-4 performed using a sigmoidal dose - response binding equation (y = 1/(1 + 10), where y is receptor occupancy, and x is the log of ldv concentration). the maximal difference receptor occupancy for low and high affinity states was determined by subtracting the resting curve from the activated curve on a point by point basis. the maximal difference was observed at log -8.5 = 3.2 nm of ldv in solution. the arrow indicates additional binding of ldv ligand at 3.2 nm from low affinity receptor state (point 1) to a high affinity receptor state (point 2). b, experimental data showing additional binding of huts-21 antibodies induced by fmlff activation in the presence of 3.2 nm ldv. histograms for cell autofluorescence, isotype control, low affinity state (ldv + dmso), and high affinity state (ldv + fmlff) are shown. each histogram represents a mean of three independent determinations (n = 3). a representative experiment of three independent experiments detection of high affinity state of vla-4 using huts-21 antibodies. a, simulation of ldv binding for two affinity states of vla-4 performed using a sigmoidal dose - response binding equation (y = 1/(1 + 10), where y is receptor occupancy, and x is the log of ldv concentration). the maximal difference receptor occupancy for low and high affinity states was determined by subtracting the resting curve from the activated curve on a point by point basis. the maximal difference was observed at log -8.5 = 3.2 nm of ldv in solution. the arrow indicates additional binding of ldv ligand at 3.2 nm from low affinity receptor state (point 1) to a high affinity receptor state (point 2). b, experimental data showing additional binding of huts-21 antibodies induced by fmlff activation in the presence of 3.2 nm ldv. histograms for cell autofluorescence, isotype control, low affinity state (ldv + dmso), and high affinity state (ldv + fmlff) are shown. each histogram represents a mean of three independent determinations (n = 3). next, to test the proposition that an increase in the rate of huts-21 binding is related to integrin unbending (extension), we treated cells with phorbol ester (pma). previously, we showed that this type of activation results in the high affinity state of the vla-4 ligand binding pocket, which occurred without molecule unbending (extension) (see fig. 2 in ref. no significant change in the rate of huts-21 binding was detected after cells were activated with pma in experiments analogous to fig. this also supports the idea that integrin extension facilitates huts-21 binding and, thus, increases the binding rate. huts-21 can be used to detect the activated (high affinity) state of vla-4previously we established a simple method for the detection of vla-4 affinity change in real time on live cells (14). a transition from low to high affinity state leads to additional binding of the ldv - fitc probe if cells were preincubated with the ligand at concentrations below the kd for the low affinity state and above the kd for the high affinity state. in the case of a fluorescent ligand this additional binding can be detected using a conventional flow cytometer in a homogeneous assay (4, 14, 15). our present data show that binding of huts-21 antibodies can be used as a reporter of a ligand - occupied receptor (see fig. therefore, detection of the high affinity state of vla-4 can be performed with an unlabeled ligand and huts-21. to determine the concentration where the biggest difference in the ligand binding after activation will be observed, we generated two theoretical binding curves (fig. next, we have determined that at 3.2 nm (log -8.5) vla-4 receptor occupancy would increase from 0.24 to 0.76 after the affinity change (arrow, fig. the experiment, where huts-21 binding occurred in the presence of 3.2 nm ldv, showed a significant difference between resting and fmlff - activated cells (fig. thus, in the presence of properly chosen concentration of the ligand (3.2 nm for ldv), binding of huts-21 is also sensitive to cellular activation status. binding of huts-21 may be complicated if the assay is performed in the presence of serum containing soluble integrin ligands. in our experiments the addition of heat - inactivated fetal bovine serum induced a dose - dependent binding of huts-21 without any additional activation. activation through the fpr resulted in a larger signal (data not shown). in a thoroughly characterized model system, using the conformationally sensitive mab huts-21, a vla-4-specific ligand with known affinity and binding kinetics, we studied the effect of inside - out activation upon huts-21 epitope exposure on live cells in real time. we also investigated how the occupancy of the ligand binding pocket affected vla-4 conformation at different affinity states. we found that (i) in the absence of ligand, activation by fpr or cxcr4 did not result in a significant exposure of the huts-21 epitope, (ii) ligand binding alone was sufficient to instantaneously induce huts-21 epitope exposure, (iii) quantitatively the number of ligand - occupied receptors was similar to the number of bound huts-21, and (iv) binding of huts-21 was determined by the affinity state of vla-4 receptor and the concentration of the ligand. binding of huts-21 reports the high affinity - activated state of the vla-4 only in the presence of properly chosen ligand concentration. taken together with previously published data this suggests that affinity state and huts-21 epitope exposure are regulated through different mechanisms. on this basis exposure of huts epitope and integrin conformational changes huts is a group of three mabs (huts-4, huts-7, and huts-21) that recognize overlapping epitopes on 1-integrin subunit (cd29) mapped to 355425-amino acid - residue 1-integrin polypeptide. binding of these mabs also was shown to be functionally identical, e.g. they exhibited the same binding pattern upon integrin activation using different activation stimuli (egta, divalent ions, and temperature dependence) (10). the sequence 355425 lies within the 1-subunit hybrid domain, and huts-4 epitope was fine - mapped to ser, glu, and lys (34). because of the proximity of the hybrid domain to the -propeller of the integrin -subunit, the huts-4 epitope can be masked, thereby preventing mab binding. a conformational change that involves a movement of 7 helix and outward swing (also called swing - out) of the hybrid domain is argued to be necessary for the epitope exposure (see fig. 7 in ref. commercially available huts-21 mabs, which have a similar to huts-4 binding pattern before and after cell activation and cross - compete with huts-4 mabs (ref. this suggests that huts-4 and huts-21 epitopes are very close, and therefore, these antibodies detect similar types of conformational changes. inside - out activation of integrin and hybrid domain swing - out according to arnaout. (9), two existing models of integrin inside - out activation (switchblade model and deadbolt model) imply different roles for the hybrid domain swing - out. the switchblade model puts forward the idea that the structure with a swung - out hybrid domain represents a high (or at least intermediate) affinity state. swinging away the hybrid domain pulls on the c - terminal -helix of i - like domain (a domain). this converts the low affinity binding pocket to the high affinity state (see fig. 12a in ref. thus, according to the switchblade model, the hybrid domain swing - out is necessary for integrin conformational activation. the deadbolt model proposes that the hybrid domain swing - out is an attribute of the outside - in signaling pathway. it is argued that binding of the ligand by itself rather than a conformational change induced by inside - out signaling pathway provides the energy required for a swing - out motion (9). activation of u937 cells through a non - desensitizing mutant of fpr results in the high affinity state of the vla-4 ligand binding pocket, which persists for more than 1000 s (4, 14, 33). in this case the absence of a major huts-21 epitope exposure suggests that hybrid domain swing - out is not directly related to the induction of the high affinity state. given that it is impossible to measure ligand affinity in the absence of the ligand itself, this conclusion is debatable. however, the current paradigm implies that the high affinity state of the integrin binding pocket is generated as a result of conformational changes in response to inside - out activation and exists before the ligand binding (9, 19, 36). moreover, in previous work, no ligand - induced affinity changes were detected in our model system in response to ldv probe binding alone. thus, our data suggest that after inside - out activation through gpcr, vla-4 assumes a high affinity conformation with the huts-21 epitope remaining hidden. moreover, incubation of u937 cells with different ldv ligand concentrations showed that huts-21 binding reflects ligand binding affinity (ec50 values for huts-21 binding are identical to the kd values for ldv ligand binding for both resting and fpr activated states (14, 15)). taken together these data suggest that the affinity state and huts-21 epitope exposure are regulated independently (fig. however, the affinity state of the ligand binding pocket directly affects ligand binding, which can be reflected in huts-21 epitope exposure. thus, the data oppose the idea that the conformation with exposed hybrid domain represents the activated high affinity state and support the ligand - induced, potentially outside - in role of a hybrid domain swing. three - dimensional structures for vla-4 multiple conformational states have been generated as described under experimental procedures by combining the integrin structural information existent in protein data bank and relevant literature data (21, 22). the integrin head is colored in red, the upper legs are in blue, and the lower legs are in green. in the model ser, glu, and lys, which represent huts epitope (34), are shown by purple space fill. the vla-4 bent closed conformation is modeled based on crystal structure of v3 integrin (structure a). structure a represents a bent low affinity state (resting state), having the huts-21 epitope unexposed (purple spheres). as in the template, the n termini of and subunits are set into an ovoid - like arrangement from which two parallel tails come out. because the crystal structure does not offer any structural information regarding egf - domains, no egf domains are shown on a and a (see the experimental procedures for details). the conformational change induced by the occupancy of the ligand pocket (structure b) first, the 1 structure built based on the 3 open headpiece was translated into the structure a coordinate system. by overlapping the 1l5 g (closed bent conformation) and 1txv (open conformation) structures, we found that the distance between c termini domains of and subunits is 15, and the distance between and knees these constraints were used to build the bent open conformation of vla-4 (structure b). this structure has the outward swing of the hybrid domain, which causes the exposure of huts-21 epitope and represents the low affinity state of the integrin. the unbent conformation with closed and open headpiece (structure c and d, respectively) have been obtained by adjusting the torsion angles at the knees of 4 and 1 subunits in a and b structures. in these operations the upper and lower legs of each subunit were considered as two rigid systems. all final conformations have been minimized with the biopolymer module from sybyl (sybyl 7.3, tripos international). three - dimensional structures for vla-4 multiple conformational states have been generated as described under experimental procedures by combining the integrin structural information existent in protein data bank and relevant literature data (21, 22). the integrin head is colored in red, the upper legs are in blue, and the lower legs are in green. in the model ser, glu, and lys, which represent huts epitope (34), are shown by purple space fill. the vla-4 bent closed conformation is modeled based on crystal structure of v3 integrin (structure a). structure a represents a bent low affinity state (resting state), having the huts-21 epitope unexposed (purple spheres). as in the template, the n termini of and subunits are set into an ovoid - like arrangement from which two parallel tails come out. because the crystal structure does not offer any structural information regarding egf - domains, no egf domains are shown on a and a (see the experimental procedures for details). the conformational change induced by the occupancy of the ligand pocket (structure b) first, the 1 structure built based on the 3 open headpiece was translated into the structure a coordinate system. by overlapping the 1l5 g (closed bent conformation) and 1txv (open conformation) structures, we found that the distance between c termini domains of and subunits is 15, and the distance between and knees is 70. these constraints were used to build the bent open conformation of vla-4 (structure b). this structure has the outward swing of the hybrid domain, which causes the exposure of huts-21 epitope and represents the low affinity state of the integrin. the unbent conformation with closed and open headpiece (structure c and d, respectively) have been obtained by adjusting the torsion angles at the knees of 4 and 1 subunits in a and b structures. in these operations the upper and lower legs of each subunit were considered as two rigid systems. all final conformations have been minimized with the biopolymer module from sybyl (sybyl 7.3, tripos international). activation of vla-4 and relationship between affinity, swing - out of the hybrid domain, and unbending for a number of years we have studied regulation of vla-4 conformational activation. we developed methods for monitoring affinity changes and molecular unbending in real - time on live cells. here, we used the same cells and ligand to study huts-21 epitope exposure. at this point we can combine current data with previously published observations to describe the emerging relationship between different vla-4 conformational states (fig. 6). we found that binding of ldv ligand does not cause vla-4 molecule unbending or at least full (maximal) unbending. this conclusion is based upon the data obtained in a fluorescence resonance energy transfer - based extension assay. in the presence of a high concentration of ldv - fitc (100 nm), an unquenching of the fluorescence resonance energy transfer signal, which is interpreted as molecular unbending, can be detected after activation thorough several gpcrs, mn, reducing agents, ca ionophore, etc. the low affinity state of vla-4 (or at least the lowest affinity state that we have ever seen) can be detected on resting u937 cells even in the presence of a saturating amount of ldv ligand. the affinity can be up - regulated by more than 2 orders of magnitude using different activating agents (14). also, in the presence of 100 nm ldv, 91% of the total number of vla-4 molecules was occupied by huts-21 (fig. these data suggest that the bent low affinity conformation with exposed huts-21 epitope may exist on resting cells in the presence of saturating concentration of the ligand (fig. quantitatively, the pma induced state is similar to the state induced by the fpr (inside - out) signaling pathway. however, the absence of fluorescence resonance energy transfer signal change and slow initial rate of cell aggregation suggest that no molecular unbending occurred after pma activation (see figs. 2 and 9 in ref. 4). similarly to the activation through fpr or cxcr4, treatment of u937 with pma without ldv ligand present did not result in any significant exposure of huts-21 epitope (data not shown). thus, the high affinity bent conformation can exist without hybrid domain swing - out (fig. this conformation is tentatively shown as identical to the resting low affinity bent conformation (fig. however, structural features which represent this high affinity, unliganded bent conformation after cell activation by phorbol esters remain unidentified. inside - out activation induces the high affinity and unbent (extended) state of vla-4 (4, 14, 16, 33). however, without ligand present, inside - out activation did not result in a major exposure of the huts-21 epitope (fig. 1). an unbent high affinity state without hybrid domain swing - out is a plausible representation (fig. because cell activation before the addition of the ligand facilitates enhanced huts-21 binding (fig. 4), it is possible that the unbent conformation with exposed huts-21 epitope (fig. 6d) results in more favorable antibody binding than the bent conformation (fig. these data suggest several different and completely independent regulation mechanisms for integrin affinity state, unbending, and exposure of the huts-21 epitope. for affinity state and unbending, these result from two related but different inside - out signaling pathways (4) ; for the hybrid domain swing - out, it is a conformational change related to the occupancy of the ligand binding pocket. binding of huts-21 reflects a ligand induced binding site. whereas we previously identified four potential states (low affinity bent, high affinity extended, low affinity extended, high affinity bent), the addition of ligand, which induces the hybrid domain swing - out, leads to the possibility of eight distinct physiological integrin states. | integrins are heterodimeric adhesion receptors that regulate immune cell adhesion. integrin - dependent adhesion is controlled by multiple conformational states that include states with different affinity to the ligand, states with various degrees of molecule unbending, and others. affinity change and molecule unbending play major roles in the regulation of cell adhesion. the relationship between different conformational states of the integrin is unclear. here we have used conformationally sensitive antibodies and a small ldv - containing ligand to study the role of the inside - out signaling through formyl peptide receptor and cxcr4 in the regulation of 41 integrin conformation. we found that in the absence of ligand, activation by formyl peptide or sdf-1 did not result in a significant exposure of huts-21 epitope. occupancy of the ligand binding pocket without cell activation was sufficient to induce epitope exposure. ec50 for huts-21 binding in the presence of ldv was identical to a previously reported ligand equilibrium dissociation constant at rest and after activation. furthermore, the rate of huts-21 binding was also related to the vla-4 activation state even at saturating ligand concentration. we propose that the unbending of the integrin molecule after guanine nucleotide - binding protein - coupled receptor - induced signaling accounts for the enhanced rate of huts-21 binding. taken together, current results support the existence of multiple conformational states independently regulated by both inside - out signaling and ligand binding. our data suggest that vla-4 integrin hybrid domain movement does not depend on the affinity state of the ligand binding pocket. |
klebsiella pneumoniae (kp) producing carbapenemase has been associated with serious infections and high mortality. the optimal antimicrobial therapy for carbapenem - resistant klebsiella pneumoniae (cr - kp) is not well established. we describe a case of a patient with septic shock due to cr - kp bloodstream infections (bsi) who was successfully treated with a high dose association of amikacin and imipenem combined with continuous venovenous hemodiafiltration (cvvhdf). our patient was a 58-year - old man, with hypertension and diabetes mellitus, admitted to the intensive care unit (icu) for septic shock of unknown origin occurring thirteen days after a coronary artery bypass grafting and mitral valve replacement. renal function deteriorated but creatinine clearance remained higher than 40 ml / min with preserved urine output. he was febrile (39.5 c) and he had a central venous catheter (cvc) in the internal jugular site since 6 days. the following specimens for culture were obtained : (1) the distal 45 cm of the tip after cvc removal. (2) two blood samples, drawn from the catheter and a peripheral vein. (the absence of sternal instability and data from the computed tomography (ct) scan made the diagnosis of mediastinitis improbable. transthoracic and transesophageal echocardiography were then performed and have not shown any valvular abnormality (vegetations, dysfunction, etc.). empirical antibiotic treatment with a combination of vancomycin (30 mg / kg every 24 h adapted to plasma concentration), imipenem (0.5 g every 8 h) and colistin (3 10 iu every 12 h), was initiated. the patient 's clinical condition worsened despite this treatment. the complementary tests performed to find the focus of infection showed klebsiella pneumoniae (kp) isolated from the catheter culture and from two blood samples, drawn from the catheter before removal and from a peripheral vein. the kp was intermediate to amikacin (mic = 16 g / ml) and was resistant to all other antibiotics including imipenem (mic = 4 g / ml), colistin (mic = 16 g / ml) and tigecycline (mic = 4 g / ml) according to the clinical and laboratory standards institute (clsi) published in 2011. standard pcr and sequencing were used to identify genes encoding carbapenemases (blandm, blavim, blaimp, blakpc and blaoxa-48), extended - spectrum -lactamases (blatem, blactx - m and blashv) and plasmid - mediated ampc (blacit, blafox, blamox, bladha, blaebc and blaacc). pcr amplification and sequencing verified the presence of blaoxa-48, blavim-2, blacmy-2 and blashv-1 genes. vancomycin and colistin were stopped and antimicrobial treatment was therefore changed to amikacin, given at a dose of 30 mg / kg (2.5 g) in a 30 min infusion and the dose of imipenem was increased to 1 g every 6 h despite patient 's altered renal function (creatinine clearance = 25 ml / min). to avoid amikacin nephrotoxicity and to allow the use of high doses of imipenem, continuous venovenous hemodiafiltration (cvvhdf) (blood flow, 200 ml / h ; dialysate, 1000 ml / h ; ultrafiltrate, 2000 ml / h) was initiated 1 h after the start of the amikacin infusion and continued thereafter. amikacin was administrated daily with the same regimen as cvvhdf. by daily monitoring of peak level (obtained 30 min after the end of the infusion), the dose of amikacin was increased progressively to reach 60 mg / kg (5 g) resulting in optimal peaks. values of c - reactive protein (crp), procalcitonin and leukocytes decreased during treatment and continued to decrease in the following days. the patient was discharged from the intensive care unit (icu) four days after the end of therapy. an audiometric test was performed and excluded any ototoxicity of high - dose amikacin in our patient. infections due to this organism are associated with high therapeutic failure and mortality rates of at least 50%,. the limited number of agents available for the treatment of cr - kp presents a tremendous challenge to clinicians. colistin, constitutes now a first - line regimen for treatment of infection caused cr - kp. with the increased use of colistin, emergence of colistin resistance several recent studies have supported the role of combination therapy for treating cr - kp infections. in a cohort of 41 patients with cr - kp bacteremia, the use of combination therapy was associated with improved 28-day mortality. in a review of published case series and case reports of treatment of klebsiella pneumoniae carbapenemase (kpc) infections, lee and burgess report a total of 30 cases received an aminoglycoside, 20% (6/30) of cases as monotherapy and 80% (24/30) as combination therapy. there was no significant difference in treatment failure rates between those who received aminoglycoside monotherapy compared to combination therapy (0% vs. 17% ; p = 0.6). interestingly, all six cases who received aminoglycoside monotherapy reported success : three cases were treated for bsis, two cases were treated for utis, and one case was treated for a respiratory infection. a recent study demonstrated that aminoglycosides, when active in vitro, were associated with a significantly higher rate of microbiologic clearance of carbapenem - resistant k. pneumoniae in the urine compared to polymyxin b or tigecycline. of the patients who received aminoglycoside - based combination therapy, the most common treatment was amikacin plus colistin, followed by aminoglycoside plus a carbapenem. aminoglycosides are eliminated by the kidneys, and the potential for renal toxicity has largely limited the use of these drugs. renal uptake of amikacin by tubular cells is a saturable mechanism when drug concentrations exceed 15 g / ml. in our case the use of high - dose amikacin to treat pathogens with a mic of 16 g / ml would have resulted in drug accumulation with deleterious effects on renal recovery and in delaying following injections. thus, we used cvvhdf to improve extrarenal clearance of the drug. in our patient, this strategy resulted in high peak concentrations, with increased antimicrobial efficacy, and a rapid decrease in drug levels below the threshold of toxicity. in conclusion, the use of high dose combination of imipenem and amikacin seems to have a survival benefit in treating carbapenem - resistant klebsiella pneumoniae bloodstream infection. the use of cvvdhf could prevent the development of nephrotoxicity related to the amikacin accumulation and increase the antimicrobial activity by allowing daily drug administration. | we describe a case of 58-year - old man with septic shock due to carbapenem - resistant klebsiella pneumoniae (cr - kp) bloodstream infections (bsi) who was successfully treated with a high dose association of amikacin and imipenem combined with continuous venovenous hemodiafiltration (cvvhdf).a klebsiella pneumoniae (kp) was isolated from the catheter culture and from two blood samples, drawn from the catheter before removal and from a peripheral vein. the kp was intermediate to amikacin (mic = 16 g / ml) and was resistant to all other antibiotics including imipenem (mic = 4 g / ml), colistin (mic = 16 g / ml) and tigecycline (mic = 4 g / ml) according to the clinical and laboratory standards institute (clsi) published in 2011. pcr amplification and sequencing verified the presence of blaoxa-48, blavim-2, blacmy-2 and blashv-1 genes.amikacin was given at a dose of 30 mg / kg (2.5 g) in a 30 min infusion and the dose of imipenem was increased to 1 g every 6 h despite patient 's altered renal function (creatinine clearance = 25 ml / min). to avoid amikacin nephrotoxicity and to allow the use of high doses of imipenem, continuous venovenous hemodiafiltration (cvvhdf) (blood flow, 200 ml / h ; dialysate, 1000 ml / h ; ultrafiltrate, 2000 ml / h) was initiated 1 h after the start of the amikacin infusion and continued thereafter.the patient improved hemodynamically and norepinephrine was stopped five days after antibiotherapy adaptation. |
patients with bilateral temporal bone fractures that run through the otic capsule may lose their hearing. the present paper describes a case of cochlear implantation after a bilateral temporal bone fracture causing bilateral profound hearing loss and ossification of one cochlea. however, attempted surgery on the left ear failed due to ossification of the cochlea. a subsequent postoperative ct scan showed patency of the right cochlea and the patient was successfully implanted on that side at a second stage. a 52 year - old male with bilateral deafness and right facial nerve palsy presented to our clinic. the patient who was referred for consideration of cochlear implantation had a history of head injury 8 months before. an initial ct scan 2 months following his injury showed a transverse temporal bone fracture on the right side and a longitudinal one on the left side. the left ear was chosen for implantation as the injury was less severe on that side. right transverse fracture (black arrow) and left longitudinal fracture (white arrow) preoperative scan demonstrating patency of both cochlea when surgery was attempted, cochleostomy revealed complete obliteration of the scala tympani. efforts to insert the electrode through the scala vestibuli were also unsuccessful. the procedure was abandoned and a subsequent high resolution ct scan showed complete ossification of the left cochlea and but a patent cochlea on the right (fig. 3 and 4). twenty days following the initial attempt, a right cochlear implantation was successfully performed. following mapping, programming, and aural rehabilitation, the patient was able to understand speech and use the telephone. longitudinal fractures begin in the squamous part of the temporal bone, extend through the external auditory canal, across the middle ear, and terminate near the carotid canal. transverse temporal bone fractures extend across the petrous ridge, with the fracture beginning in the posterior fossa and crossing the otic capsule into the middle ear space. furthermore the fracture might allow communication between the subarachnoid space and the middle ear, increasing the risk of meningitis or involve the internal auditory meatus, causing possible damage to the cochlear nerve. there are few reports in the english literature of successful cochlear implantation in patients with deafness from temporal bone fractures (1 - 3). histopathological studies of temporal bone fractures reveal a variety of injuries such as complete destruction of the organ of corti and stria vascularis, loss of hair and ganglion cells, hemorrhage into the cochlear duct, and labyrinthitis ossificans (3,4). as reported by nadol (5) a number of ganglion cells may survive in temporal bone fractures. nadol reports an average survival of only a third of the ganglion cell population after temporal bone fractures. however, there is no strong evidence in literature showing a correlation between ganglion cell counts and auditory function after cochlear implantation. (6) although fractures of the otic capsule usually heal by fibrosis, sometimes they may be complicated by cochlear osteoneogenesis and result in ossification of the cochlea. the most frequent site of ossification is the basal turn of the scala tympani (2,3). in such cases successful electrode insertion has been achieved by drilling out the obliterated portion of the basal turn (2) or by performing a partial labyrinthectomy to gain access to the round window and allow electrode insertion (7). postoperative results in these patients were comparable to those with a conventional scala tympani insertion. in addition, the sooner the implantation was performed, the greater the possibilities for a successful insertion, as there is less time for ossification (1). the exact time of ossification of the cochlea following a temporal bone fracture is not known. as illustrated in our case, it is best to obtain temporal bone imaging immediately prior to implantation to rule out labyrithitis ossificans or other abnormalities, especially when there has been a long time delay between injury and surgery. in our case the initial ct scan failed to demonstrate ossification of the cochlea, showing patency of both cochleas. according to siedman (9) ct scan may miss up to 22% of cases of cochlear luminal obstruction, subsequently found at surgery. in addition, as reported in literature mri scan (t2-weighted images) is becoming an increasingly significant imaging modality in investigating cochlear patency. its role in differentiating between cochlear fluid, fibrosis or bone formation is under evaluation in a number of centers. with t2-weighted image it is possible to assess the cochlea, the semicircular canals, the internal acoustic meatus and the cerebello - pontine angle. as shown by laszig the detection of the absence of fluid seems to be a more sensitive method for determining patency of the cochlea (10). temporal bone fractures may lead to ossification of the cochlea and implantation must therefore be performed as soon as possible following injury. both hrct and mri scans are required to assess patency of the cochlea, involvement of the internal auditory meatus or possible communication between the subarachnoid space and the middle ear. in cases of bilateral fractures, implantation is best avoided on the site of transverse fracture, due to the possibility of direct intracranial communication and risk of meningitis. | patients with bilateral temporal bone fractures frequently suffer profound hearing loss. these patients may benefit from cochlear implantation. displaced fracture lines and ossification of the cochlea might complicate insertion of the electrode array. in the present paper we present a case of a failed cochlear implantation due to ossification of the cochlea, followed by a successful one on the opposite side in a patient who sustained bilateral temporal bone fractures. preoperative imaging may identify these factors, help guide the appropriate surgical approach and choose which side to implant. we aim to highlight the necessity of imaging and discuss the reliability of computed tomography (ct) scanning in predicting cochlear patency in cases of temporal bone fracture. possible management options in the case of complex cochlear implantation are also described. |
toxic epidermal necrolysis (ten) is a life - threatening cutaneous reaction associated with 30% mortality1). numerous medications have been implicated as causes of ten, the most frequently associated drugs include aromatic anticonvulsants, sulfonamide antibiotics, allopurinol, oxicam nonsteroidal anti - inflammatory drugs, and nevirapine2). diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full - thickness epidermal necrolysis due to extensive keratinocyte apoptosis3). it is used for different types of epilepsy and also effective in treating and preventing bipolar depression. the risk of ten with combination lamotrigine and valproate is greater than with monotherapy4). ten is rare disease with incidence of approximately 1.9 cases per million inhabitants annually based on all cases reported to the food and drug administration (fda) adverse effect reporting system databases in the usa6), and is also rare disease in korea7). we report a case of ten in a child that occurred after addition of lamotrigine to the valproic acid treatment, and who was diagnosed clinically and pathologically. an 11-year - old girl was hospitalized for erythematous maculopapular rash with an itching sensation over the entire body with fever, conjunctival injection, eye wax, and oral ulceration. the patient had experience tic disorder since the age of 8 years, and had been diagnosed with major depressive disorder about 7 months previously. the patient was initially treated with fluoxetin, valproate, risperidone, and aripiprazole in psychiatric clinic. however, because of inadequate control, lamotrigine (25 mg / day) was added to the regimen about 3 weeks before hospitalization. after 2 weeks use of lamotrigine, the patient developed an erythematous rash, starting from the face and gradually spreading over the whole body. the patient transfered to soonchunhyang university hospital with a diffuse, confluent erythema, which covered over 90% of the total body surface area, conjunctival injection, eye wax, vesicle, and clot on lips and oral ulceration (fig. 1). the patient also had a fever and skin tenderness, and could not eat properly because of oral pain. during the hospitalization, 2). hemorrhagic crust on the lip was aggravated and nikolsky 's sign was positive. laboratory examination revealed normal complete blood count and serum biochemistry, normal erythrocyte sedimentation rate, and elevated c - reactive protein (7.56 mg / dl). skin biopsy revealed necrotic keratinocyte in the epidermis with spongiosis and exocytosis, and lymphohistiocytic infiltration in the upper dermis, which suggested ten (fig. consultations with a dermatologist, a plastic surgeon, a psychiatrist, an ophthalmologist and an otorhinolaryngologist were conducted. we stopped all the psychiatric medications and started intravenous (iv) antibiotics, suspecting secondary infection, intravenous immunoglobulin (ivig;1.5 gm / kg / day for 3 days)8), and other conservative management including iv hydration, aseptic dressing, topical ointment, nasal irrigation using normal saline, oral humidification, and eye drops. after a week of hospitalization, the tic symptom recurred 2 weeks after we stopped the psychiatric medication, so we used aripiprazole. after 19 days of hospitalization, the lesion became much improved and the patient was discharged. although several theories exist, the innate immune system is now favored as a significant contributor to the initiation and propagation of this devastating reaction9). ten is heralded by the abrupt onset of fever ; systemic toxicity ; a generalized, dusky, and erythematous rash ; bullae ; separation of large sheets of epidermis from the dermis ; purulent conjunctivitis ; and mucositis of the mouth and genital area2). in our case, complete death of the epidermis leads to sloughing similar to that seen in large burns. stevens - johnson syndrome (sjs) affects < 10% of the body surface, whereas involvement of 10%-30% of body surface area is called sjs / ten overlap10). the estimated mortality rate for sjs is approximately 10%, while that for ten is as high as 45%, with death mainly due to sepsis and hemodynamic failure11). the prompt withdrawal of the suspected drug, fluid and electrolyte replacement, and topical wound care are the first line therapies. the role of immunosuppressants, despite some success, is not well defined and is not considered as a standard. on the contrary, good results are reported in terms of decreasing mortality and morbidity or improving clinical conditions of the use of human ivig13). although some studies have shown no benefit from ivig, the wealth of clinical experience supporting its therapeutic value can not be dismissed. ivig has minimal toxicities and, considering the gravity of the condition being dealt with, the risk / benefit ratio is quite favorable14). we started iv antibiotics and other conservative treatment at first, and on the day 2 of hospitalization commenced ivig treatment because of aggravated skin lesion. we used ivig for 3 days, and continued conservative treatment including aseptic dressing and topical ointment. concomitant use of valproic acid with lamotrigine significantly increases the risk for development of adverse cutaneous reactions15). valproic acid interacts with lamotrigine metabolism, leading to a reduced total clearance, and therefore to an increased elimination half - life of lamotrigine, resulting in higher serum concentrations16). children aged 2 - 12 years taking concomitant valproate and lamotrigine should be initiated at a dosage of 0.2 mg / kg once daily for the first two weeks, followed by 0.5 mg / kg once daily for the next 2 weeks, and increased thereafter by 0.5 - 1 mg / kg every other week to a maximum of 200 mg / day17). unfortunately, in our case the patient initiated at the dosage of 25 mg (0.75 mg / kg) once daily. it would be important, if lamotrigine is added to valproic acid treatment, to initiate at a low dose and then increase slowly. the use of lamotrigine in psychiatry has increased significantly after its approval by the fda. therefore not only pediatricians but also psychiatric clinicians should keep the strict dose regimen when they use lamotrigine especially in children. | toxic epidermal necrolysis is an unpredictable and severe adverse drug reaction. in toxic epidermal necrolysis, epidermal damage appears to result from keratinocyte apoptosis. this condition is triggered by many factors, principally drugs such as antiepileptic medications, antibiotics (particularly sulfonamide), nonsteroidal anti - inflammatory drugs, allopurinol, and nevirapine. lamotrigine has been reported potentially cause serious cutaneous reactions, and concomitant use of valproic acid with lamotrigine significantly increases this risk. we describe a case of an 11-year - old girl with tic and major depressive disorders who developed toxic epidermal necrolysis after treatment with lamotrigine, and who was diagnosed both clinically and pathologically. children are more susceptible to lamotrigine - induced rash than adults, and risk of serious rash can be lessened by strict adherence to dosing guidelines. unfortunately, in our case, the patient was administered a higher dose than the required regimen. therefore, clinicians should strictly adhere to the dose regimen when using lamotrigine, especially in children. |
he presented his own struggle with the disease and cases of patients whose rigorous diet had led to a medical condition in a book called health food junkies.1,2 orthorexia is not included in the current classifications of physical, mental, or behavioral disorders (international statistical classification of diseases and related health problems - 10th edition and diagnostic and statistical manual of mental disorders - 5th edition). in literature, it is recognized as an eating disorder, an obsessive compulsive spectrum disorder, or a somatoform disorder.3 some studies indicate common clinical features of orthorexia and eating disorders, particularly anorexia nervosa,4 while other studies point to the link between the symptoms of orthorexia nervosa and obsessive compulsive disorder.5 the relationship between obsessive compulsive disorder and orthorexia nervosa has not been sufficiently examined ; nevertheless, both disorders are characterized by burdensome obsessions and repetitive activities. however, it is difficult to determine whether obsessive thinking about the selection of diet products causes suffering among patients affected by the disease or nutrition - related activities are performed to reduce anxiety. according to bratman, people characterized by orthorexia behavior are proud of their diet and do not consider themselves sick.6,7 in 2003, national eating disorders association published official information about orthorexia, emphasizing the need to conduct further research in this area.6 the modification of lifestyle, including a diet, is often caused by willingness to improve one s physical fitness or avoid diseases affecting modern society. the change of a diet may also be caused by ailments of the digestive system or by an allergy. in the beginning, an individual reduces or avoids consumption of products perceived as unhealthy or harmful for the human body. further products are eliminated over time and ultimately, the diet consists of only such items that are considered the healthiest and safest. one can speak about orthorexia when everyday activities are subordinated to planning, buying, and preparing meals, according to an applied diet.68 the prevalence of orthorexia appears to be higher among vegans, fruitarians, or raw foodists, as well as among people engaged in the animal welfare organizations and supporters of organic and/or non - genetically - modified food production.6,7 the individuals characterized by orthorexia are more common among physically active people, as well as individuals trying to lose weight or maintain a slim figure promoted in the mass media.6,7 according to the existing studies, the predisposing factors of orthorexia are an improper attitude toward food, an obsessive compulsive disorder, and values of body mass index (bmi) exceeding the norm.9 the studies also indicate a lower level of education.9 people who have earlier been diagnosed with an eating disorder tend to develop orthorexia more often.10 so far, no uniform diagnostic criteria have been established nor there has been a tool for making medical diagnosis. nonetheless, the three following questionnaires have been developed to evaluate orthorexia nervosa : the orthorexia self - test,2 the orto-15 test,5 and the eating habits questionnaire.11 the issue of excessive preoccupation with healthy food deserves further exploration ; therefore, the aim of our research is to analyze eating behavior in the context of the assessment of the risk of occurrence of orthorexia. the field of this study involves health behaviors that may increase the risk of orthorexia. hypothesis is that frequent consumption of meals, paying particular attention to the calorific value, and qualitative composition of food constitute an evidence of behavior that may indicate orthorexia disorder. ultimately, 981 of them (both men and women) were qualified for further analysis, whereas the remaining 19 were excluded because of incomplete questionnaire responses. approval for this study was obtained from the ethics committee of the medical university of warsaw. an author - developed questionnaire consisting of 22 questions, including one open question, was used in the study. the questionnaire examined health behavior, with a particular focus on nutritional behavior, in the context of the risk of orthorexia. the questionnaire was created on the basis of a review of the most recent scientific literature concerning this issue. the existing questionnaires, including standardized questionnaires in english, were analyzed. the author - developed questionnaire used in this study the vocabulary used to formulate questions and answers is transparent and harmonized, which translates into high communicativeness of the questionnaire. while constructing answer choices, particular attention was paid to the fact that answers to one question should not overlap and be included in each other. referring to the recommendations of apanowicz,12 special attention was paid to the necessity of rational approach to the verification of answers, because there are almost always doubts about the objectivity and honesty of responses. thus, it was necessary to keep a certain perspective while interpreting the results and drawing conclusions.12 the adopted indicator describing nutritional behavior of respondents was the coexistence of chosen options of responses to the three questions : 1) how many meals do you eat during a day ? 2) do you pay attention to the calorific value of a meal ? and 3) the hypothesis that 1) frequent consumption of meals, 2) paying particular attention to the calorific value, and 3) qualitative composition of food constitute an evidence of behavior that may indicate orthorexia disorder was adopted. to assess the correlation between these 3-dimensions defining nutritional behavior of respondents, advanced log - linear modeling for nominal variables was used.13 the results of the questionnaire have been correlated with the following demographic variables : gender, age, field of study, and the size of the place of residence. in this study, the correlation between variables was estimated on the basis of nonparametric pearson test, and for correlations, the strength of association was assessed by calculating v cramer coefficient. in addition, the aforementioned model was completed by a fourth variable, which comprised individual responses to the subsequent questions of the questionnaire. in total, a log - linear analysis was carried out for 15 different models. each of them was assessed in terms of the degree of correlation between the variables using the statistics. the software package statistica version 12.5 (statsoft inc.) was used for all calculations under the license of warsaw medical university. the default (a priori) level of statistical significance for all analyses was assumed as =0.05. the results of the questionnaire have been correlated with the following demographic variables : gender, age, field of study, and the size of the place of residence. in this study, the correlation between variables was estimated on the basis of nonparametric pearson test, and for correlations, the strength of association was assessed by calculating v cramer coefficient. in addition, the aforementioned model was completed by a fourth variable, which comprised individual responses to the subsequent questions of the questionnaire. in total, a log - linear analysis was carried out for 15 different models. each of them was assessed in terms of the degree of correlation between the variables using the statistics. the software package statistica version 12.5 (statsoft inc.) was used for all calculations under the license of warsaw medical university. the default (a priori) level of statistical significance for all analyses was assumed as =0.05. the analyzed groups differ in terms of number of meals (p 3 h each day on planning their diet in comparison with people who eat only 12 meals per day (table 2). only 17.6% of respondents declared that they do most often eat meals in a company of someone, whereas 45.3% indicated that there is no rule. there was no correlation between gender, age, field of study, place of birth, and eating meals in the company of someone (in all cases p>0.05). almost half of the respondents do not know the energy value of their meals (48.4%). women pay attention to the energy value more often than men (p 3 h per day on diet planning does not depend on any of the examined variables (age, gender, field of study, and place of birth ; p>0.05). it should be noted, however, that women indicated fruits as a basis of the nutrition pyramid significantly more often than men (51.7% versus 36.3%, p0.05). this study shows that men drink alcohol more often than women (36.3% versus 22.7% indicate drinking alcohol often, p=0.002, =15.200, v cramra = 0.123). smoking can reduce appetite.15 the nicotine increases metabolism, which in turn may increase the burning of calories. in this study, men smoke cigarettes more often than women (23.2% versus 15.1% indicated smoking often, p=0.039, =8.342, v cramra = 0.091). students of humanistic and economic faculties admit often that they smoke more than the students of scientific and technological studies and medical faculties (19.2% versus 18.3% versus 15.3% versus 8.7% ; p=0.035, =17.978, v cramra = 0.077). apart from proper nutrition, physical activity it plays an important role in preventing and treating many diseases, including the increasing problem of obesity. low physical activity is considered to be one of the causes for increasing mortality due to cardiovascular diseases and neoplasms.16 however, there are no differences in terms of the physical activity between the examined groups (p>0.05). nevertheless, the results of the presented studies do not indicate any significant correlation between the declared frequency of undertaking physical activity and the respondents age (spearman s rank correlation coefficient = 0.04, p>0.05). whereas students of humanistic as well as scientific and technological faculties exercise every day more often (6.4% and 5.3%) than students of economic (2.3%) and medical studies (2.5% ; p=0.021, =9.531, v cramra = 0.081). almost half of the examined students were on a slimming diet in the past, of which only 21.1% were on a diet once, 43.3% for two or three times, and 37.7% for four times or more. women follow a slimming diet more often than men (20.3% versus 5.8% indicated > 4 attempts of losing weight ; p0.05). out of the respondents who were asked about the meaning of the term orthorexia, 71% answered that they did not know this term. the remaining 29% of the respondents, who most frequently declared the knowledge of the term correctly, stated that it is an obsession with healthy nutrition or a disorder characterized by an excessive preoccupation with eating food believed to be healthy. among them, 14 people incorrectly indicated orthorexia as a term describing an aversion to eating ; that is, anorexia, a fear of gaining weight or an addiction to slimming diets. the knowledge of the meaning of the term orthorexia does not depend on any of the analyzed demographic variables (p>0.05). the most popular sources enumerated by students include forums, blogs, social networking sites, and so on. a large number of respondents also pointed out family or acquaintances. to a lesser degree, nutrition information is obtained from a doctor, a dietician, or another health care practitioner (table 5). this may cause misinformation of the whole society, thereby leading to the dissemination of incorrect information concerning balanced eating habits. students most often pointed out an individual s personality, influence of the mass media, and influence of peers as the main causes of eating disorders. the fewest people indicated that gender influences the causing of disorders. yet, only a small percentage of students (1.8%) stated that they lack knowledge on this topic. other causes of developing eating disorders, such as stress, sedentary lifestyle, lack of time, large accessibility of ready - to - eat and processed food, overeating, mental diseases, not - enough physical activity or insufficient knowledge about healthy nutrition, and awareness of one s own body, were indicated. orthorexia constitutes a relatively new problem, which explains the insufficient knowledge about this phenomenon. not many empirical studies concerning its course, characteristics, and prevalence have been conducted so far. the epidemiology is still unknown due to inconsistent data from literature and a small number of scientific studies. the world health organization recognized nutrition and diet17 as one of the basic health determinants. such a determinant is also the quality of food connected with its contamination with preservatives, food colors, or other chemical substances used for production and preservation. people with orthorexia pay excessive attention to the quality of consumed food ; they also rather do not eat unhealthy food. such persons spend most of their time searching for food products and preparing them according to the technique that he / she considers the healthiest. for a person suffering from orthorexia, the most important factor during consuming meals is its qualitative composition (an appropriate balance between nutrients and their optimal composition ; for example, cis and trans isomers, complete and incomplete proteins, simple and complex carbohydrates). sufferers prepare meals with the best - possible qualitative composition. they do not eat anything of foreign origin, unless they learn the detailed qualitative composition of a given meal. this may lead to social isolation of an individual with orthorexia. in this study, students who responded that they always and usually pay attention to the qualitative composition of products and always and usually spend > 3 h per day on planning their diet similar results were achieved by fidan who diagnosed the prevalence rate of orthorexia in a group of medical students as 1.9%.4 higher values were achieved by donini who diagnosed the prevalence of orthorexia in case of 6.9% of respondents.5 kinzl (using bratman test) diagnosed orthorexia among female dieticians in 12.8% of the sample.18 however, he emphasized that a state close to orthorexia was present among 34.9% of the sample. such results may indicate the need to put more emphasis on observing health behavior of the aforementioned groups in terms of risk of orthorexia. paradoxically, in such cases, exceptional medical knowledge and willingness to protect one s health become a starting point for developing this disorder. the research of donini indicated that the prevalence rate was higher among men when compared with women. the study of fidan also revealed higher prevalence rate among men.4 the author - developed questionnaire did not demonstrate any significant differences regarding gender, similar to that of the research of bagci bosi among medical residents.5,19 the study of brytek - matera also demonstrated lack of differences in regard to gender.20 the discrepancies in the results of the cited studies demonstrate a need to undertake further scientific initiatives to examine this phenomenon in more detail. moreover, it should be noted that international literature confirms the thesis about an increased level of risk of developing orthorexia in medical professions ; such data are provided by dos santos alvarenga in brazil or energin in turkey.21,22 an analysis of the available literature proves that orthorexia is a worldwide problem ; a growing interest in health, in particular in the developed and developing countries, caused a new disorder. it is worth pointing out that the adapted versions of orto-15 questionnaire were developed in hungary, portugal, and poland. as far as the risk groups are concerned, the occurrence of orthorexia was also analyzed among athletes.23 they are a part of the population that pays particular attention to health and as such are more prone to develop such disorder.18 this is consistent with the result of the author s study, as well as with the aforementioned research of kinzl and donini.5 it confirms the thesis about the need to pay greater attention to the possible symptoms of orthorexia in specific population groups. the studies revealed also a correlation between orthorexia, consumption, and distorted perception of own body.24,25 the treatment of orthorexia demands a multidisciplinary team consisting of psychotherapists and dieticians. a balanced diet should be the basis of such treatment. at the beginning of treatment an individual suffering from orthorexia should also realize that he / she has a problem concerning eating behavior, understand that the quality of food consumed is not the only factor which determines health, and learn to eat without falling into an obsession. experts recommend a treatment consisting of cognitive behavioral therapy combined with selective serotonin reuptake inhibitors (such as sertraline, fluoxetine, and paroxetine). working with the immediate environment of patients and promoting nutrition education are also essential components of the therapy.1 it is also worth pointing out that unlike other patients with eating disorders, patients suffering from orthorexia tend to respond to treatment better because of their concerns about their health and self - care.1 due to insufficient information about orthorexia, further research is essential to determine the characteristics of high - risk groups. taking into account the growing interest in a healthy lifestyle, the problem of orthorexia in the public space needs to be addressed, including developing targeted activities of primary and secondary prevention.. medical staff, especially primary care physicians and nurses, should obtain the necessary training / education to be able to diagnose this disorder. this study demonstrates health behaviors increasing the risk of orthorexia with respect to social and demographic data. the obtained results indicate the direction to conduct further studies concerning the conditions of the occurrence of orthorexia. | orthorexia is recognized as an eating disorder, an obsessive compulsive spectrum disorder, or a somatoform disorder. the aim of our research was to analyze nutritional behaviors for the assessment of the risk of orthorexia. the authors developed a questionnaire in which 981 respondents participated and used it as a research method. both men and women ate mostly 45 meals per day (46.30% women versus 34.74% men) ; however, more men than women ate 12 meals daily (18.95% men versus 7.9% women). both place of birth and field of study did not differ in terms of the number of meals. moreover, it was observed that the number of meals per day was correlated with the declared time spent on planning a diet. people who ate over 3 meals per day more often indicates that they spent > 3 h per day on planning their diet in comparison with people who ate only 12 meals. only 17.6% of the respondents declared that they most often ate meals in a company of someone, whereas 45.3% indicated that there was no rule. the remaining 37.1% of the respondents most often consumed their meals alone. almost twice as many men as women never paid attention to the qualitative composition of nutrition. women followed a slimming diet more often than men (20.3% versus 5.8%) and this indicated > 4 attempts of losing weight. around one - third of all the respondents suffered or suffer from eating disorders. owing to insufficient information on orthorexia, it is essential to conduct further research to determine the characteristics of high - risk groups. taking the growing interest in a healthy lifestyle into account, there is a need to address the problem of orthorexia in the public space. |
angiotensin ii (ang ii) receptors are a class of g - protein - coupled receptors that exist in four subtypes : at1r at4r. the angiotensin ii type 1 receptor (at1r) is mainly expressed in vascular smooth muscle cells (vsmcs), endothelial cells, and myocardial fibroblasts and as such plays a prominent role in regulating the cardiovascular system. ang ii can activate the at1r, thereby increasing vascular tension, causing vasoconstriction, and increasing the force of cardiac muscular contractions. however, excessive activation of at1r can cause cardiovascular pathologies such as hypertension, vascular injury, arrhythmia, and myocardial hypertrophy. preeclampsia is a serious type of pregnancy - induced hypertension that clinically manifests itself in the form of high blood pressure and proteinuria after 20 weeks of pregnancy. numerous studies have reported that excessive at1r activation is an important mechanism underlying the occurrence and development of preeclampsia. angiotensin ii 1 type autoantibodies (at1-aa) are agonists of at1r that can cause excessive activation by interacting with the second extracellular loop of the at1r (at1r - ecii), thereby causing high blood pressure and proteinuria, which are the typical signs and symptoms of preeclampsia in pregnant rats. these findings suggest that at1-aa may play an important role in the pathology of preeclampsia. therefore, evaluating the functions of at1-aa and its underlying mechanisms and targets has become a major research focus. however, obtaining enough highly purified at1-aa to establish animal models has been a considerable problem, as to date only limited amounts of antisera from clinical patients with preeclampsia have been isolated. to study the pathophysiological roles of at1-aa, it is important to establish a more simple and productive method for the preparation of these autoantibodies. in the present study, we prepared a mouse - derived antibody against the at1r - ecii (at1-mab) using monoclonal antibody technology. then, we identified the biological activities of at1-mab and compared them to at1-aa purified from preeclamptic patients. this research is aim to find a simple and effective way to gain at1-mab to study at1-aa positive disease, so as to provide basis for clinical treatment. our experiments were approved by the institutional animal care and use committee of capital medical university (beijing, china) and conformed to the guiding principles in the use and care of animals published by the national institutes of health (nih publication number 85 - 23, revised 1996). animals were provided by vital river, license : scxk (beijing), 2012 - 0001. before the experiments, healthy, 12-week - old balb / c mice (n = 60 ; 45 females, 15 males ; body weight, 1820 g) were used for preparation of ascites (vehicle group : n = 10, hybridomas (10) group : n = 10, females), isolated vascular ring experiment (n = 20 ; 15 females, 5 males), and experiments in vivo (n = 20 ; 10 females, 10 males), and 03-day - old newborn wistar rats (n = 30 ; weight, 46 g) were used for neonatal rat cardiomyocytes beat frequency experiment. they were given pentobarbital sodium (150 mg / kg) by intraperitoneal injection (ip) to reduce anxiety for surgical anesthesia. once the experiment was completed, all balb / c mice were euthanized by decapitation at the guillotine (a physical method was suggested by avma guidelines on euthanasia). six preeclampsia women were recruited from the taiyuan central hospital (taiyuan, shanxi province, china) (table 1). this research protocol was approved by the ethics committee for the protection of human subjects of taiyuan central hospital. before serum was collected, 10 ml fasting blood samples were collected from these six subjects through cubital veins and stand at room temperature for 1 hour and then centrifuged at 3000 rpm for 15 min. the sera were isolated and stored at 20c for purification of at1-aa over protein g affinity column (sweden). peptides against the human at1r - ecii antigen epitope (murine and human at1r - ecii share 92% homology, supplementary figure 1 (see supplementary material available online at http://dx.doi.org/10.1155/2016/1858252)) were synthesized (i - h - r - n - v - f - f - i - e - n - t - n - i - t - v - c - a - f - h - y - e - s - q - n - s - t ; genbank aab34644.1) at 98% purity. the peptides coupled to keyhole limpet hemocyanin (klh) protein were used as immunogens, and those coupled to bovine serum albumin (bsa) were used as the control. this peptide was used as an antigen to immunize the mice to prepare sera containing high titers of polyclonal antibodies, and then the cells were fused to generate the hybridoma cell lines (beijing b&m biotech co., ltd.). in total, 40 strains of monoclonal hybridoma cell lines were generated, and the 5 strains that secreted the highest titers of at1-mab in the cell culture supernatant were identified by biotin - avidin enzyme - linked immunosorbent assay (ba - elisa). (1) for thawing, the hybridomas were quickly placed in a cryotube at 37c in a constant - temperature water bath, transferred to 10 ml roswell park memorial institute (rpmi) 1640 medium (hyclone, china), and centrifuged at 3000 rpm for 10 min at 4c after mixing, after which the supernatant was removed. (2) for culturing, the cells were grown in rpmi supplemented with 10% fetal bovine serum (gibco, usa). after 24 h, the supernatant was removed and fresh culture medium was added to the cells. (3) for subculturing, cells in logarithmic growth phase were cultured for about 3 days until 8090% confluency, after which the supernatant was collected and frozen at 20c until purification. the remaining cells were also collected and used for ascites preparation. (4) for cryopreservation and storage of cells, half - adherent cells were centrifuged at 1000 rpm for 5 min. then, the supernatant was removed and the cells were cryopreserved in fetal bovine serum : rpmi : dimethyl sulfoxide (dmso) at a ratio of 5 : 4 : 1. (1) extraction of at1-mab from hybridoma culture supernatant : the proteins in the hybridoma culture supernatant were concentrated at a ratio of 5 : 1 and filtered using a 0.45 m filter, and the igg of the hybridoma culture supernatant was purified over a protein g affinity column. (2) extraction of at1-mab from mouse ascites : incomplete freund 's adjuvant (0.02 ml / g, sigma, st. louis, mo, usa) was injected into the abdominal cavity of all balb / c mice. three days later, 1 101 10 hybridomas suspended in 0.4 ml phosphate - buffered saline (pbs) were introduced into mouse abdominal cavity by ip injection with a 1 ml syringe. ascites formation was observed by weighed and abdominal shape at every week, ascites fluid was collected in the second week, and the supernatant was collected after centrifugation at 1000 rpm for 5 min and diluted in pbs and affinity purified with immobilized protein g. and all mice were euthanized by decapitation at the 4th week, when they can not generate much more ascites. (1) the purified antibodies were resolved on a 15% sodium dodecyl sulfate - polyacrylamide gel electrophoresis (sds - page) gel, and the gel was stained with coomassie brilliant blue. (2) the specificity of the antibodies purified from the hybridoma culture supernatant and mouse ascites was determined by ba - elisa, with the wavelength of detection set at 405 nm to provide the optical density (od) (spectra max plus ; molecular devices, sunnyvale, ca) : p / n = (positive od blank od)/(negative od blank od) ; p / n > 2.1 was identified as the positive sample ; p / the procedure is as follows : 1 g / ml at1r - ecii peptide dissolved in na2co3 solution (0.1 mol / l, ph 11.0) was coated in 96-well microtiter plates and incubated overnight at 4c. the wells were saturated with 1% pmt buffer (1% (w / v) bovine serum albumin, 0.1% (v / v) tween 20 in phosphate - buffered saline (pbs - t), ph 7.4) at 37c for 1 h. after washing the plates with pbs - t for 3 times, 5 l samples diluted in 45 l pmt were added to the plates and incubated at 37c for 1.5 h. after 3 times ' washing, biotinylated rabbit anti - mouse igg antibodies and biotinylated goat anti - human igg antibodies (1 : 4500 dilutions in pmt ; zhong shan jin qiao, beijing, china) were added to the wells and incubated at 37c for 1 h. after 3 times ' washing, the streptavidin - peroxidase conjugate (1 : 3000, vector, ca) was added to the wells and incubated at 37c for 1 h. finally, 2,2-azino - di(3-ethylbenzothiazoline) sulfonic acid- (abts-) h2o2 (roche, basel, switzerland) substrate buffer was applied and reacted in the dark at 37c for 0.5 h. (1) for the cultivation of primary neonatal rat myocardial cells, we rapidly removed hearts from 03-day - old newborn wistar rats into pbs, cut them into pieces, and washed away the blood cells for 2 - 3 times with pbs. 35 mg trypsin and 25 mg collagenase type ii were dissolved in 30 ml pbs. these digestive enzymes were filtered by 0.22 m filters and then stand at 37c. the heart tissue was added into 5 ml beaker and digested in 3 ml enzyme solution for 35 min with sustained shaking at 37c. the supernatant was aspirated into low - glucose dulbecco 's modified eagle 's medium (dmem) with 10% fetal bovine serum to terminate digestion. finally, the cells were centrifuged through a 200-mesh filter and centrifuged at 1000 rpm for 5 min and placed in 10 cm dish. after 2 hours, the supernatant was aspirated and packed in 6-well plates, the adherent cells were fibroblast cells. after culturing for 5 days, the beat of the myocardial cells was observed under a microscope. the at1r blocker valsartan (sigma, y0001132) and at2r blocker pd123319 (sigma, p186) were added to the myocardial cell culture medium. after 10 minutes, purified at1-mab was added to the culture medium, and the beat frequency of the myocardial cells was recorded. (2) for isolated vascular ring technology, the sodium pentobarbital was used for surgical anesthesia before isolating aortic rings from the mice. the mice were euthanized by decapitation after thoracic aortas were isolated immediately, and a 2 mm vascular ring was removed and affixed to an internal system-610 m multi myograph bath sensor (danish myo technology a / s inc., denmark). the bath contained 5 ml hydroxyethyl piperazine ethanesulfonic acid 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (hepes ; 144 mm nacl, 5.8 mm kcl, 1.2 mm mgcl2n6h2o, 2.5 mm cacl2, 11.1 mm glucose, and 5 mm hepes) solution (ph, 7.387.40) into which a 95% o2/5% co2 gas mixture was continually bubbled. we allowed a 1 h equilibration period before the start of the experiment, and the hepes solution was replaced every 15 min. using the vascular ring transducer system, hepes buffer containing 60 mm potassium (144 mm nacl, 60 mm kcl, 1.2 mm mgcl2n6h2o, 2.5 mm cacl2, 11.1 mm glucose, and 5 mm hepes ; ph, 7.387.40) was used for a precontracted vasoactive test. the contractile responses of the vascular rings (tension) to different drugs were defined as a percentage of average contractile intensity to kcl (kcl% = detected drugs/kcl 100%). (3) the tail - cuff method was used to measure blood pressure in mice, and the position of the mouse was fixed by using a mouse holder maintained on a 37c hot plate, while a small mouse tail blood flow sensor was placed at the mouse tail root ; we then waited until the heart rate stabilized at approximately 375 beats / min. after the blood began to flow smoothly and steadily, we measured systolic blood pressure five times per animal using software of noninvasive automated sphygmomanometer (japan) and recorded the mean overall blood pressure. using spss 16.0 (chicago, il, usa) for statistical analysis, between - group comparisons were performed with t - tests, and comparisons among groups were performed with one - way anova, followed by tukey 's post hoc test (p 0.05 ; n = 6). mol / l) was added first, the vasoconstriction caused by at1-mab could not be blocked (figure 4(e), 28.93% 10.04% versus 3.72% 2.26% for negative igg ; p < 0.05 ; n = 6). these results demonstrate that at1-mab exerts its biological functions by activating the at1r, but not the at2r. twelve - week - old healthy adult females and males were caged together, and ultrasonography showed successful pregnancy. on the 13th day of gestation, at1-mab (20 g / g) was injected into the pregnant mice through the tail vein, and an equal dose of normal saline was injected into the mice in the control group (control group, figure 5(a) ; at1-mab group, figure 5(b)). the content of the at1-mab in pregnant mice sera was tested on days 14, 16, and 18 of gestation. the levels of at1-mab began to rise from the 14th day of gestation and were maintained to the 18th day (od on day 14 of gestation : 0.27 0.05 versus 0.12 0.02 for saline ; day 16 of gestation, 0.26 0.05 versus 0.14 0.016 for saline ; day 18 of gestation, 0.25 0.03 versus 0.13 0.02 for saline ; p < 0.05 ; n = 6 ; figure 5(c)). on alternate days the systolic blood pressures of at1-mab - positive pregnant mice were significantly higher than those of mice in the control group on days 14, 16, and 18 of gestation (118.46 5.82 versus 92.94 7.64 mmhg for saline on day 14 of gestation : 129.78 8.92 versus 98.08 10.81 for saline on day 16 of gestation ; and 137.69 4.73 versus 97.10 9.17 for saline on day 18 of gestation ; p < 0.05 ; n = 6 ; figure 5(d)). a large number of studies have identified at1-aa as a harmful factor that exists in several diseases associated with cardiovascular disturbances, especially in patients with preeclampsia. it plays an agonistic role by specifically interacting with at1r - ecii. however, other unknown pathological mechanisms of at1-aa action need to be further explored. obtaining at1-aa is the primary goal in establishing at1-aa - positive animal model and studying the pathological significance of and mechanisms underlying this antibody in diseases such as preeclampsia. currently, isolating antibody from the sera of preeclamptic patients is a basic approach to obtaining at1-aa ; however, it is crucial to acquire other sources of at1-aa because of the limited availability of clinical patients ' sera, collection difficulties, and large losses when purification is not timely. active immunization is an alternate method for obtaining at1-aa, which involve mixing synthetic at1r - ecii with incomplete freund 's adjuvant to retrieve the antigen and injecting it into the animals by subcutaneous injection with a booster injection administered at 2-week intervals. therefore, active immunization requires a relatively long time and a large dose of antigen peptides. therefore, it is important to obtain at1-mab with high potency and specificity to allow the study of the pathologic roles of at1-aa. the synthetic peptide at1r - ecii was used to actively immunize balb / c mice through subcutaneous injection, and then single b lymphocytes capable of secreting at1-mab were hybridized with unlimited proliferating myeloma cells to obtain hybrid cells that could be immortalized and secrete at1-mab. the hybridomas were selected using elisa, and at1-mab was extracted from mouse ascites after hybridomas were inoculated into balb / c mice for 2 weeks. our results showed that at1-mab can be extracted from hybridoma supernatants and mouse ascites, the content of at1-mab purified from mouse ascites was higher than that purified from the hybridoma supernatant, and the at1-mab purified from mouse ascites belongs to the igg immunoglobulin class. additionally, compared to extracting at1-mab from hybridoma supernatants, extracting at1-mab from mouse ascites is of higher potency and less cost. numerous studies have shown that there are a variety of g - protein - coupled receptors, including at1r, on the surface of mouse vascular endothelial cells and smooth muscle cells, as well as on neonatal rat cardiomyocytes. ang ii, an endogenous agonist of the at1r, binds to at1r and causes a positive inotropic effect, such as the increased beat frequency of cardiomyocytes and induction of vasoconstriction. therefore, after the specificity of the at1-mab purified from mouse ascites was confirmed, neonatal rat cardiomyocyte experiments and isolated vascular ring technology were used to evaluate the biological activity of at1-mab. when at1-mab was added to the culture medium of neonatal rat cardiomyocytes, the beat frequencies of cardiomyocytes were significantly increased, similar to the effect of at1-aa isolated from patients ' sera. when the at1r blocker valsartan was added to the medium first, the cell surface receptors were blocked by blocking the effect of at1-mab on beat frequency in rat neonatal cardiomyocytes ; the at2r blocker pd123319 did not have a blocking effect. furthermore, similar to at1-aa purified from patients ' sera, at1-mab purified from mouse ascites caused observable vasoconstriction in mouse thoracic aorta. if the at1r blocker valsartan was added prior to giving at1-mab treatment in the isolated vascular ring, vasoconstriction was completely blocked, whereas the at2r blocker pd123319 did not block the effect. all of the above observations demonstrate that at1-mab purified from mouse ascites does not bind to at2r but rather specifically activates at1r, thereby exerting its agonist - like biological effects. in addition, compared to the instantaneous vasoconstrictor effect caused by ang ii, at1-mab and at1-aa caused continued contraction in mouse thoracic aorta, which suggests that activation of at1r without desensitization may be an important mechanism whereby at1-aa produces pathological and damaging effects. additional studies are required to further explore this putative mechanism. finally, to confirm that at1-mab plays a biological role in vivo, we injected at1-mab into balb / c mice via the tail vein on the 13th day of gestation. researchers demonstrated that the half - life of clinically sourced at1-aa is about 10 days, so that the at1-aa can be retained in the body for a long period, and thus mouse blood pressure may also be maintained at a high level after at1-aa injection. in addition, when pregnant mice were given an injection of at1-mab purified from ascites, blood pressure on day 14 of gestation was increased and continued until the end of the experiment. this suggests that at1-mab extracted from ascites simulated patient - derived antibodies both in vitro and in vivo. in summary, we prepared at1-mab with high specificity, high concentration, and biological activity by inoculating hybridomas that secrete at1-mab into the mouse abdominal cavity (figure 6). preparation of at1-mab is required to establish at1-aa - positive animal models and will be a useful tool for the research of clinical diseases that manifest a high titer of at1-aa, such as preeclampsia. | the current study was to prepare a mouse - derived antibody against the angiotensin ii type 1 receptor (at1-mab) based on monoclonal antibody technology, to provide a foundation for research on at1-aa - positive diseases. balb / c mice were actively immunized with the second extracellular loop of the angiotensin ii type 1 receptor (at1r - ecii). then, mouse spleen lymphocytes were fused with myeloma cells and monoclonal hybridomas that secreted at1-mab were generated and cultured, after which those in logarithmic - phase were injected into the abdominal cavity of mice to retrieve the ascites. highly purified at1-mab was isolated from mouse ascites after injection with 1 107 hybridomas. a greater amount of at1-mab was purified from mouse ascites compared to the cell supernatant of hybridomas. at1-mab purified from mouse ascites constricted the thoracic aorta of mice and increased the beat frequency of neonatal rat myocardial cells via the at1r, identical to the effects of at1-aa extracted from patients ' sera. murine blood pressure increased after intravenous injection of at1-mab via the tail vein. high purity and good biological activity of at1-mab can be obtained from mouse ascites after intraperitoneal injection of monoclonal hybridomas that secrete at1-mab. these data provide a simple tool for studying at1-aa - positive diseases. |
growth and weight disorders of children are rising to become a global concern in both developed and developing countries ; hence, these disorders are subjected to careful scrutiny in recent decades. indeed, obesity is substantially a gateway disorder which leads to numerous chronic diseases and is known to be associated with increased morbidity and mortality, therefore, it is solely known as a public health burden. weight disorders, such as obesity, are firmly accompanied with short - term as well as long - term complications while it is affecting children and adolescents. furthermore, behavioral and biological risk factors which are associated with childhood chronic diseases later could be able to influence adulthood health determinants as well as notable morbidity and mortality they lead to. for example, childhood overweight, not only correlates with adulthood atherosclerosis, hyperinsulinemia and hypertension, but also psychosocial problems. moreover, adolescence is a critical period for developing weight disorders like obesity and childhood obesity has been known itself as a predictor of the adulthood overweight. however, during the recent years, children overweight and obesity have doubled in developed and developing countries. some of these countries (such as iran) have faced diminished physical activities and higher fat intake due to not only rapid process of urbanization, industrialization, and nutritional transition, but also lifestyle changes, which have been implemented during past decades. while the high prevalence of overweight and obesity is established in adult population of developing countries, corresponding data on this issue and its related social variation among children and adolescents are still sparse. malnutrition and undernutrition of children have imposed double burden of nutritional disorders due to emerging epidemiologic and demographic transition besides overweight disorders in developing countries. nonetheless, children weight disorders are not still considered as health priority at national level in developing countries which might be partly explained by the lack of cohesive data from large scale population based studies in these countries and limited existing data on obesity prevalence based on optimum definitions for children of developing countries. iranian national studies implemented on childhood obesity demonstrated that its prevalence in metropolitan areas was high, whereas this result was not found in other regions. however, for better verification of national health priorities this study aims to determine prevalence of different weight categories based on measured anthropometric indicators of body mass index (bmi) amongst a sample of children and adolescent students in isfahan province (one of the largest provinces in iran). this survey was implemented in accordance with center for disease control and prevention (cdc) growth charts and cut - offs. furthermore, isfahan school students were categorized and compared on the base of living area, age and gender variables. the present survey was a cross - sectional study conducted from september 2009 to march 2010 on a sample of 4700 children being from 5 to 15 years old. these individuals were students of either primary schools or junior high schools in isfahan province (one of the largest provinces of iran), whereas those who did not settle in isfahan province and immigrants were excluded. students were selected using multistage random cluster sampling and bunches were selected in accordance with student population of different towns of isfahan province as well as total number of student population in each of the educational levels (either primary or junior high school). in fact, 2867 and 1833 individuals were selected from primary schools and junior high schools, respectively, while samples were collected in rural and urban areas proportionally (16.4% and 83.6% respectively). after providing an explanation of the procedure, obtaining informed consent, bmi as the most common and routinely used measure for child obesity was measured (by 0.2 scale interval), while individuals were barefoot and lightly dressed. a team of healthcare professionals was trained to conduct the study and all instruments, which include beam scale and nonstretch tape fixed to a flat vertical wall, were standardized and calibrated. the study team recorded age and a number of demographic characteristics ; then data were analyzed by spss 18 software, (version 18, spss inc., bmi cut - offs provided by the cdc were used for the classification of the pupils as underweight (< 5 percentile), normal (584 percentile), overweight (8594 percentile) and obese (95 percentile). the status of mentioned categories was compared in 3 steps according to gender, educational level, and living area. in addition, weight - for - age and stature - for - age estates were also compared while cdc growth charts smoothed percentile curves were applied. the study protocol was approved by the ethics committee of the isfahan university of medical sciences. participation in this study was voluntary while information was collected anonymously, and the outcomes were used for research purposes. this cross - sectional study was performed on a sample of 4700 (2349 females and 2351 males) students of either primary school (70%) or junior high school (30%) aged 915 years. eighty - four percent (3923 students) of participants were from urban areas while the rest 16% (768 participants) settled in rural regions table 1 showed distribution of students in terms of gender and living area. the prevalence of underweight, normal weight, overweight, and obesity among the participants is described in table 2 in percentage. the overall prevalence of underweight, overweight and obesity was 13.9, 10.4 and 5.7%, respectively. almost 70% of pupils had bmis in normal range ; however, obesity and underweight categories were higher in boys and girls, respectively (p = 0.040). in addition, urban students had a prominent higher tendency towards obesity and overweight while rural ones showed a higher prevalence of underweight (p < 0.001). there was not any association between educational level and bmi differences among understudied pupils (p = 0.093). distribution of students in terms of gender and living area prevalence of underweight, overweight, and obesity among participants according to gender, age, and educational level the majority of the students (almost 75%) showed the normal proportion of weight to age index. to elaborate, one - third of the pupils showed some degrees of mild malnutrition, in spite of the fact that severe malnutrition was venial among the students. in fact, neither gender nor educational level showed any association with malnutrition, yet rural participants showed significantly higher malnutrition prevalence in comparison to their urban counterparts (p < 0.001). on the other hand, the majority of the population (96.7%) demonstrated normal proportion of stature to age, even though a small proportion of them (3%) showed degrees of short stature. neither gender nor place of the living had any association with stature ; still, educational level and nutritional state were poorer in students of junior high schools (p = 0.033). the prevalence of malnutrition is presented in accordance with the proportion of weight - for - age and stature - for - age indices in table 3. prevalence of malnutrition states according to weight - for - age and stature - for - age indices among participants according to the findings of the present study, the overall prevalence of overweight and obesity was 10.4 and 5.7%, respectively, in children aged 915 years in isfahan. in a study, in the west of iran, the prevalence of obesity in schoolchildren aged 712 years was reported to be 9.9%. in another study on 1000 school children of the same age conducted in the north of iran, the prevalence of obesity and overweight was claimed to be 5.8% and 12.3%, respectively, which did not differ from this study. however, the prevalence of overweight differed greatly in the other parts of the world. for example, krassas. demonstrated that the prevalence of overweight and obesity in greek students aging from 6 to17 years was 22.2% and 4.1%, respectively ; in addition, similar results were found for overweight and obesity in costa rican students (34.5% and 26.2%, respectively, which are higher than what we reported. on the contrary, the prevalence of children and adolescents overweight in india and turkey was similar to ours. these differences could be attributed to ethnic, genetic, lifestyle, and environmental variations. furthermore, different methods and definitions of obesity and underweight as well as various reference values of the studies could cause result 's dissimilarities. as with the study of hajian - tilaki., the overall prevalence of overweight and obesity was higher than underweight, which corroborates the fact that not only middle eastern but also asian countries are challenging childhood overweight and obesity. in the present survey, boys were also shown to have significantly higher prevalence of obesity in comparison to girls, yet, the prevalence of underweight was vice versa. some studies have shown such a higher obesity tendency in male children and adolescents, while boys and girls were shown to be similar in some other or prevalence of obesity was higher in girls in comparison to boys. it seems that different nutritional behaviors and physical activity of males and females in different cultures, as well as different study methods and definition of underweight, obesity, and overweight in various studies. while in our and previous studies, the prevalence of short stature did not differ significantly between two genders, pakistani girls showed higher stature. furthermore, in a study conducted in south africa, the prevalence of short stature among 1014 years girls and boys were 23.7% and 26.7% in rural areas and 11.6% and 17.1% in urban regions respectively. the mentioned study showed the highest prevalence of malnutrition, according to short stature, among boys and children in rural areas. however, our study showed a poorer state of stature - for - age in junior high school pupils in comparison with their elementary school counterparts ; still, living area did not affect pupil 's stature. in general, in our study, the prevalence of short stature was nearly 3%, which is considerably lower than the corresponding values reported by similar studies. in addition, in our study, weight for age index was just significantly affected by living area. indeed, nutritional status of urban students was better in comparison with rural ones due to lower socioeconomic status in the countryside. although in some of the other studies on iranian children, boys were more susceptible to gain higher weight - for - age values, weight for age indices were not affected by gender variable in the present study. there is an increasing trend of childhood obesity and overweight as well as short stature among isfahan schoolchildren. thus, not only consecutive collection of bmi data in different age groups and genders is indispensable, but also crucial interventions preventing serious national health problems are not negligible. thus, revision of national health strategies focusing on groups of children who need more education or interventions should not be neglected. | background : present study aimed to evaluate the prevalence of grades of nutritional status comprising underweight, normal weight, overweight, and obesity as well as other measurable anthropometric indicators of body mass index (bmi) in regard to gender, educational level, and living area among students settled in isfahan province.methods:this cross - sectional study was conducted on a sample of 4700 individuals (2349 females and 2351 males) being from 9 to 15 years old, while they were students of either primary school or junior high school. random cluster method was applied in both urban (84%) and rural (16%) areas of isfahan province. bmi values were measured and then categorized using reference growth charts from the centers for disease control and prevention (cdc 2000). weight - for - age and stature - for - age indices were assessed as well in accordance with cdc growth charts.results:the overall prevalence of underweight, overweight, and obesity was 13.9, 10.4, and 5.7%, respectively. boys and students of urban areas showed a higher tendency of obesity and overweight in comparison with girls and rural students respectively. furthermore, rural students had poorer status in both weight - for - age and stature - for - age indices. in addition, educational level was the only statistically efficacious factor.conclusions:this study and previous ones demonstrated that children and adolescents nutritional status, which strongly affect general health status of individuals, should receive more exquisite attention. |
infections due to the protozoa from the genus leishmania still constitute a major public health problem worldwide. patients suffer from all clinical forms of the disease, without a specific vaccine or a safe and effective treatment. interleukin-10 was implicated on t cell unresponsiveness observed in visceral leishmaniasis (vl) patients infected with l. donovani. cutaneous leishmaniasis (cl) is believed to present an unbalanced th1/th2 response during its acute phase with clinical resolution being an ifn--dependent event, whereas lesion progression and therapeutic failure are related to il-10 overproduction [26 ]. the reduction of il-10 levels using neutralizing anti - il-10 or anti - il-10r monoclonal antibodies (mab) might be useful as immunotherapeutic adjuvants immunotherapies to prevent or treat experimental infections by many pathogens by favoring the production of ifn- and tnf-. anti - il-10 mabs when added to cell cultures restored the proliferative response of peripheral blood mononuclear cells (pbmc) from a vl patient and increased the ifn- production by cd4cd25 t cells cocultured with intralesional treg cells of l. guyanensis infected cl patients. furthermore, pbmc from unexposed subjects showed an increase on ifn-, tgf-, and reactive nitrogen production when cultured in presence of leishmania antigens and anti - il-10 mab. all these data suggest that new cl vaccines and therapies should involve an il-10-neutralizing strategy. considering that ifn--dependent responses are essential anti - leishmania defense mechanisms and that their magnitude is modulated by il-10, the evaluation of any product of the ifn- signaling cascade, such as cxcl10, rather than the cytokine alone, would improve data interpretation of how successful this network is modulated in cl patients. our results suggest that partial il-10 neutralization using anti - hil-10 mab is able to reduce th2 profile and increase protective ifn--related response in peripheral pbmc from subjects living in areas where leishmania braziliensis (lb) is endemic. for this study, 18 male individuals were selected from a previously characterized cl endemic area located in buerarema village, bahia state, brazil. the groups consisted of 6 patients with active lesions (acl), 6 patients with chemotherapeutically healed lesions (hcl), and 6 asymptomatic uninfected endemic area subjects (asymptomatic). the mean age of these individuals was 33, 39, and 35 years, respectively. the evolution time of the lesions in the acl group was between 1 and 2 months, while hcl group presented healed lesions with more than 1 year. all individuals, including asymptomatic ones, lived for at least 22 years in the area, without any migratory event within this period. the acl and hcl patients were treated with meglumine antimoniate following brazilian ministry of health procedures, as previously described. peripheral blood mononuclear cells (pbmc) were isolated by ficoll - paque centrifugation (pharmacia, uppsala, sweden), at 400 g, 20 min at room temperature, washed three times in rpmi medium (gibco, grand island, ny), and suspended in dmem medium (gibco), supplemented with 50 m 2-mercaptoethanol, 2 mm l - glutamine (gibco), 40 g / ml gentamicin, and 5% fetal calf serum (gibco). cell cultures (2 10 cells / well) were stimulated with 5 g / ml whole soluble lb antigens in presence or not of 10 g / ml of anti - human il-10 monoclonal antibody (anti - hil-10 mab) (r&d systems, mab217, clone 23738) for 24 h at 37c, 5% co2. cytokines (il-10, il-4, and tnf-) and cxcl10 levels were measured by elisa using pair - matched antibodies (pharmingen, san diego, ca) as described. briefly, 96-well elisa microplates (nunc, denmark) were sensitized overnight with 100 l of 1 g / ml specific monoclonal antibody (mabtech, usa, and pharmingen, usa). the plates were then washed with pbs 0.05% tween-20 (sigma) and incubated with 2% bovine serum albumin (bsa ; sigma) in pbs. plates were incubated overnight with 100 l of 1 : 2 dilutions of culture supernatants in 2% bsa - pbs or with recombinant human cytokine (pharmingen). then, 1 g / ml of appropriate biotinylated anti - cytokine monoclonal antibody was added (mabtech and pharmingen) for 2 h at 37c, followed by washing and incubation with alkaline phosphatase - conjugated streptavidin for 2 h at 37c. finally, absorbance was read at 405 nm in a microplate reader (biorad, usa). comparison of cytokines and chemokine production among groups of patients was performed by kruskal - wallis followed by dunn 's post hoc test. statistical significance adopted p < 0.05. the equation used for data analysis was(1)cytokine detected in aglb+ail10 supernatantcy aglb w1 cytokine detected in aglb supernatant cytokine detected in aglb supernatant1100. the potential use of anti - il-10 blocking mab was tested in pbmc from individuals living in an endemic area of cutaneous leishmaniasis. as shown in figure 1, there was only a partial blockade of the anti - il-10 mab used indicated by the remaining il-10 detection in all groups. decreased il-4 levels were observed in cultures from all studied subjects, while decreased tnf- production was observed in healed and asymptomatic individuals only. patients with active lesions, however, presented a concomitant increase in tnf- and in cxcl10 after il-10 blockade. the percentage of inhibition of cytokine production in lb - stimulated pbmc cocultured in the presence of anti - il-10 mab was also evaluated (figure 1(e)). interestingly, anti - il-10 mab induced an overall decrease of il-10, il-4, tnf-, and to a lesser extent cxcl10 production by cells from all subjects. patients with active lesions were less affected by the il-10 blockade, showing increased capacity of cytokine production in this condition. moreover, cxcl10 production by healed patients and il-4 production by cells from asymptomatic individuals showed not to be modulated by il-10 blockade. strategies focusing on the control of the cytokine milieu are really important in combating many infectious and noninfectious diseases. one of the most immunomodulatory cytokines to be elected for such control is il-10. it is produced by different cell types with effects that vary from the activation to the downregulation of many cell types depending on cellular conditions and activation status. one important aspect of the il-10 biology is that this cytokine is able to modulate immunological responses of both th1 and th2 patterns. effective cellular immune response and clearance of leishmania infection in humans have shown to be dependent on th1 cytokines like tnf- and ifn-, while parasite persistence and disease establishment are favored by il-4 and il-10 overproduction [16 ]. it is noteworthy that the control of the il-10 production would bring new insights to the therapy of both cutaneous and visceral forms of the disease especially in those cases where parasites present drug resistance or when patients display low tolerance to therapy. however, few data is available on the effect of il-10 neutralization in human leishmaniasis. in vl form of the disease, the administration of an anti - il-10 mab to pbmc cultures restored the unresponsiveness of t cell proliferation against leishmania antigens in one patient. more recently, a similar neutralization strategy in cultures of splenic aspirate cells from vl patients promoted a decrease in the number of amastigotes concomitantly with an increased production of ifn- and tnf-. moreover, pbmc from unexposed subjects produced higher levels of ifn-, tgf-, and reactive nitrogen species when cultured in the presence of leishmania antigens and anti - il-10 mab. in cutaneous leishmaniasis, the only existing data is a recent report on which the addition of an anti - il-10 mab abrogated the in vitro modulatory effect of intralesional cd4cd25foxp3 treg cells and promoted an increase in ifn- production by effector t cells from l. guyanensis infected individuals. recent data suggested that human ifn--producing cd4 t cells seem to be essential for inducing parasite killing by macrophages, in vitro. these cells lost their activity after anti - ifn- mab addition to the culture. on the other hand, cd8 t cells have been associated with tissue damage, local necrosis, and lesion progression in cl patients and infected mice [10, 11 ]. in both papers, the cytolytic activity of cd8 t cells observed in cl patients seems not to be directed against parasite killing but to tissue destruction. inhibition of ifn- in the cell cultures did not modulate the cytolytic activity of cd8 t cells but increased the infection index of cocultured macrophages infected with l. braziliensis. these data suggest that cd4 t cells are the main sources of anti - leishmania ifn--dependent protective immune responses, which indicates that increasing the activity of th1 cell population would function as an important strategy in cl therapy. the importance of il-10 in modulating the cytolytic activity of cd8 t cells in human leishmaniasis is unclear. interestingly, our data showing the partial neutralization of the il-10 production in pbmc was divergent among habitants from the same area where cl is endemic. infected individuals were still able to respond to the il-10 neutralization by producing near to basal levels of cytokines as observed in the anti - leishmania t cell response. decreased cxcl10 modulation observed here indicates that ifn--dependent responses could be restored in these individuals and would ensure disease recovery, parasite control, and a better prognosis. in contrast, there was a limited downmodulation on tnf- production in acl group in response to anti - il-10 mab. this result would be considered as a drawback of the potential therapeutic administration of anti - il-10 mabs to cl patients. strong evidence suggests that excessive proinflammatory responses, especially those mediated by tnf-, lead to tissue damage and mucosal commitment in american tegumentary leishmaniasis [1215 ]. in this context, the adoption of therapeutic strategies aiming at the complete depletion of il-10-dependent response should not be the best option for treating cl patients. overall decrease on cytokine production observed in uninfected individuals suggests that the adoption of this strategy is only effective on susceptible individuals whose immune response tends to be th2-biased and modulated by il-10 [4, 6 ]. though limited to a small number of subjects, our work reinforces the idea that an unbalanced immunomodulatory response might be detrimental for successful cl treatment and lesion healing in l. braziliensis infection [4, 6, 1316 ]. as discussed here, our data complements previous studies on il-10 blockade strategy in human leishmania infection. considering the host - parasite interplay, independently on the clinical form of the disease, a partial blockade of the il-10 would favour parasite clearance, lesion healing, and the establishment of an effective anti - leishmania immune response. in human cl, our work is the first to adopt this strategy in l. braziliensis infection, which complements the previous data on il-10 blockade in l. guyanensis infection. traditionally, it has been shown that vl patients treated with a combination of recombinant human inf- and pentavalent antimony had an increased successful rate and better disease recovery [17, 18 ]. in cl, the immunotherapeutic approaches already adopted were based mostly on the administration of killed or pasteurized leishmania parasites alone or in addition to bcg showing elevated treatment efficacy and lesion healing. one work adopted the administration of gm - csf to a small number of patients showing a 100% cure of cl lesions. collectively, these data suggest that studies about new potential immunotherapies should be performed for both vl and cl treatments. here, we explore, for the first time, the potential role of il-10 blockade in humans infected with l. braziliensis and bring some perspectives on the generation of new immunotherapies for cutaneous leishmaniasis. | interleukin-10 overproduction has been associated with worse prognosis in human cutaneous leishmaniasis, while ifn--dependent responses are associated with parasite killing and host protection. innovative strategies are needed to overcome therapeutic failure observed in endemic areas. the use of monoclonal antibody - based immunotherapy targeting il-10 cytokine was evaluated here. partial il-10 blockade in leishmania braziliensis whole soluble antigen - stimulated cells from endemic area cl patients with active or healed lesions and asymptomatic controls was evaluated. overall decrease in il-10, il-4, and tnf- production was observed in all groups of subjects. only patients with active lesions still produced some levels of tnf- after anti - il-10 stimulation in association with leishmania antigens. moreover, this strategy showed limited modulatory effects on ifn--dependent chemokine cxcl10 production. results suggest the potential immunotherapeutic use of partial il-10 blockade in localized cutaneous leishmaniasis. |
aneurysms of the sinus of valsalva are rare cardiac anomalies that may be congenital or, in rare cases, acquired, and most commonly involve the right coronary sinus (90%).1)2)3)4) congenital aneurysms are often caused by weakness at the junction of the aortic media and the annulus fibrosus.3) the acquired forms are caused by infection, degenerative disease or thoracic trauma. although the majority of unruptured aneurysms do not produce symptoms of cardiac dysfunction until aneurysm rupture occurs, there have been a few reported cases in which patients with an unruptured aneurysm of the sinus of valsalva presented with exertional dyspnea due to right ventricular outflow tract (rvot) obstruction.5)6) we report the case of a patient who presented with exertional dyspnea and was found to have an unruptured aneurysm of the sinus of valsalva causing significant rvot obstruction. a 66-year - old man with a medical history of hypertension and type 2 diabetes presented at our cardiology clinic with a 3-year history of worsening dyspnea on exertion (new york heart association class i - ii). on admission, blood pressure was 132/62 mm hg, pulse rate was 80/min, body temperature was 36.7 and respiratory rate was 22/min. a systolic ejection murmur, grade iii / iv, was heard at the second and third intercostal spaces along the left sternal border. b - type natriuretic peptide was 450 ng / ml. laboratory findings were unremarkable except for mild proteinuria on urinalysis. on transthoracic echocardiography, the left ventricular ejection fraction was 55% with normal wall motion, and mild diastolic dysfunction was present (e / a ratio 0.8 deceleration time 250 msec). transthoracic two - dimensional (2d) and three - dimensional (3d) echocardiography revealed a 1.353.0 cm unruptured aneurysm of the right sinus of valsalva protruding into the rvot (fig. color doppler echocardiography showed turbulent flow acceleration around the aneurysm, but did not indicate left to right shunt flow (fig. continuous wave doppler demonstrated that the peak velocity at the level of the aneurysm was 3.38 m / s, and the calculated peak pressure gradient was 46 mm hg (fig. as mentioned above, transesophageal echocardiography revealed aneurysm ; however, further cardiac abnormalities were not identified. on contrast echocardiography, subcostal images demonstrated a significant border between the body of the aneurysm and the chamber of the right ventricle upon administration of intravenous echo contrast (fig. 64-slice multidetector computed tomography (mdct) showed the presence of an eccentric, lobulated, 3.5 cm aneurysm protruding into the rvot, with the upper lobulated part located just below the pulmonary valve and the digital - shaped lower part obstructing the rvot (fig. aneurysms of the sinus of valsalva are rare cardiac abnormalities that may be congenital or acquired. congenital aneurysms, which are more common than the acquired varieties, slowly progress without symptoms of cardiac dysfunction until aneurysm rupture occurs. however, in rare cases, unruptured congenital aneurysms may produce symptoms of cardiac dysfunction due to rvot obstruction. in our case, the patient was asymptomatic during his adolescence and most of his adulthood and had no history of risk factors for acquired aneurysm. moreover, he had experienced progressively - worsening exertional dyspnea over the course of 3 years. therefore, we regarded the etiology of his condition to be a congenital unruptured aneurysm of the right sinus of valsalva. we then came to the conclusion that his symptoms may have been due to the slowly progressive nature of congenital aneurysms, which eventually led to significant rvot obstruction. in this case, the patient was diagnosed with an unruptured aneurysm of the sinus of valsalva using transthoracic 2d echocardiography, transthoracic 3d echocardiography, transesophageal echocardiography, contrast echocardiography and 64-slice mdct. al - though transthoracic 2d echocardiography is the initial diagnostic tool typically used to detect aneurysms of the sinus of valsalva4)7) and is sufficient to confirm diagnosis, in the present case, it was difficult to determine the shape of the aneurysm and neighboring st - ructures. therefore, 64-slice mdct and real - time 3d echocardiography were used to evaluate the anatomy of this aneurysm and to demonstrate the mechanism of rvot obstruction. in addition, contrast echocardiography is a useful tool for detecting aneurysms through differentiation of the border between the body of aneurysm and the chamber of the right ventricle. for patients with unruptured aneurysms of the sinus of valsalva, symptoms of cardiac dysfunction are important indications for tr - eatment.2)3)8) however, whether asymptomatic patients with unruptured aneurysms require surgical intervention remains a controversial issue. nevertheless, if unruptured aneurysms show progressive enlargement on serial evaluation, surgical intervention is needed. this patient was found to have an unruptured aneurysm arising from the right coronary sinus. we determined that his exertional dyspnea was attributable to rvot obstruction by an unruptured aneurysm of the right sinus of valsalva, as all other causes were ruled out. surgical repair could be an appropriate treatment for aneurysms exhibiting progressive enlargement and the potential for rupture. | a 66-year - old man presented with exertional dyspnea. he was found to have an unruptured aneurysm of the right sinus of valsalva causing significant right ventricular outflow obstruction. this aneurysm was diagnosed by transthoracic two - dimensional echocardiography, transthoracic three - dimensional echocardiography, transesophageal echocardiography, contrast echocardiography and 64-slice multidetector cardiac computed tomography. because unruptured aneurysms of the sinus of valsalva are rarely symptomatic, they can be difficult to detect. however, the unruptured aneurysm of the right sinus of valsalva in this case caused significant right ventricular outflow tract obstruction, resulting in exertional dyspnea. |
the fission yeast schizosaccharomyces pombe (s. pombe) has become a popular tool for analyzing heterologous gpcr due to the tractability of genetic and biochemical manipulation [14 ]. most yeast systems for the studying of gpcr signaling use reporter constructs to provide readouts for transcription from signal - dependent promoters and are used for clinical and pharmaceutical studies, for example, a drug screening, due to similarities between the yeast mating response pathway and human gpcr signal transduction pathways. the fission yeast has two haploid mating - cell types : p cells and m cells. under nutrition depletion, the cells cease to divide with the camp cascade and conjugate with cells of the opposite mating type to form diploid zygotes. the conjugation between the two mating types is controlled by diffusible peptide pheromones, p - factor and m - factor. pheromones are defined as chemical substances that mediate communication between individuals of the same species. mating type - specific pheromones are secreted from cells and are sensed by cells of the opposite mating type [6, 7 ]. for example, p - factor released from p cells binds to its receptor, mam2 on m cells, and stimulates m cells for mating. the two types of the fission yeast pheromone receptors belong to g protein - coupled receptors (gpcrs), the largest family of transmembrane receptors. the receptors with seventransmembrane domains are coupled with a heterotrimeric g protein complex and are responsible for transmitting extracellular signals to intracellular responses by stimuli of pheromones. the receptors undergo a conformational change from an inactive form to an active form upon pheromone binding. the active receptors induce g subunit gpa1 to facilitate gdp to gtp exchange and the dissociation of g from the g protein complex. the g subunit with gtp then interacts with downstream effectors to engage signaling cascades including the map kinase pathway. since the invention of the atomic force microscope (afm) by binnig., it has become a powerful tool to study biological samples not only for imaging at the molecular level but also for measuring their mechanical properties [915 ]. as an afm tip makes direct contact with the sample, the physical properties as well as the topography of the surface can be examined. for example, interaction force between single molecules can be measured under physiological conditions [1621 ]. for these measurements, the afm tip modified with specific ligands the tip retraction then induces stretching of the complex molecules followed by forced dissociation of the complex. this technique has already permitted us to quantify unbinding forces of numerous ligand - receptor pairs, either on an artificial surface or on the surface of living cells. in this study, we investigated the interaction between p - factor and mam2 by both afm and the reporter assay. our study showed that p - factor had specific interaction with mam2 and was able to induce the signal transduction pathway. the removal of leu at c terminal of p - factor by carboxypeptidase sxa2 was reported to result in an inactivation of p - factor function. our study showed that p - factor lacking c - terminal leu had no ability to bind mam2 or induce the signal transduction pathway. the customized peptides were obtained from operon co., ltd., (tokyo, japan). each peptide was prepared as a stock solution of 1 mm in milli - q water and stored at 80c. coupling of peptides to afm si3n4 tips (omcl - tr400psa, olympus, tokyo, japan ; nominal value 0.02 n / m) was done using a heterobifunctional polyethylene glycol (peg) linker as shown in figure 1(a) [23, 24 ]. the afm tips were cleaned in a uv ozone cleaner (uv / ozone procleaner, bioforce nanosciences inc., ia, usa) under ultraviolet light and exposed for 2 h to aptes (3-aminopropyl triethoxysilane) vapors in a 2-liter desiccator filled with argon and containing 30 l of aptes and 10 l of n, n - diisopropylethylamine (sigma - aldrich, tokyo, japan). the tips were then kept for up to 3 days in an argon - filled atmosphere until use. amino - group bearing tips were incubated for 60 min with 1 mg / ml of n - hydroxy - succinimide ester - peg - maleimide (nhs - peg - mal, 3400 da, nektar therapeutics, huntsville, al) in pbs (phosphate - buffered saline). the final binding step was achieved by a reaction between the linker maleimide end and cysteine residues of peptides. the tips were incubated with each peptide (final concentration of 1 m) in pbs for 30 min and then were abundantly washed with pbs to remove unbound peptides. force measurements were carried out at room temperature with an nvb-100 afm (olympus, inc., tokyo, japan) which was set on an inverted optical microscope (ix70, olympus, inc., the modified afm tips were placed on the nitrogen starved cell surface, and force curve measurements were executed on different positions with a scan speed of around 1.74 m / s and using a relative trigger of 2040 nm on the cantilever deflection (figure 1(b)). the force curves from about 1024 positions (32 32) were recorded in each experimental condition to make a histogram of the rupture force in force curves. in the inhibition experiments, the force measurements were performed in an experimental buffer with free p - factor (final concentration of 1 m). to calibrate the response of the cantilever deflection signal as a function of piezoelectrics, standard force curve measurements were carried out on a bottom of the dish, and the spring constant of the cantilever was calibrated by the thermal vibration method. two s. pombe strains used in this study (hsxa2 > gfp pmam3g / pal7 and hmam2::ura4 sxa2 > gfp pmam3g / pal7) were derived from arc010 (hleu1 - 32 ura4-d18). the s. pombe cells were grown in yes (0.5% yeast extract, 3% glucose and sp supplements), yes 10 (0.5% yeast extract, 3% glucose and sp supplements, 10 g / ml g418 sulfate), emm (edinburgh minimal medium, sunrise science product), or ycb (yeast carbon base, becton, dickinson and company, franklin lakes, nj, usa). transformants were plated onto mma (minimal medium agar, sunrise science product) or mma supplemented with 1.25% leucine (120 l / plate). to select for the ura4 cells, transformants were plated onto the yes plates containing 0.1% 5-fluoroorotic acid (yes - foa). the sxa2 genes were replaced with green fluorescent protein (gfp) by standard homologous recombination method. the first fragment, the target gene (including upstream, open reading frame, and downstream sequences), was amplified from an s. pombe genomic dna using primers x1, 2 (sxa2) introducing noti restriction site. the sxa2 fragment was ligated into the multicloning site of pta2 vector (toyobo co., ltd., the second fragment : gfp - coding sequence was amplified from a monster green fluorescent protein phmgfp vector (promega, madison, wi, usa) using primers g1, 2. the third fragment : ura4 gene and 200 bp downstream of the target gene were amplified from an s. pombe genomic dna using primers u1, 2 and x1, 2 (sxa2) introducing xbai restriction site. after the fragments were digested by xbai, they were ligated and performed pcr using primers x5, u2 (sxa2). then three fragments were simultaneously ligated with in - fusion advantage pcr cloning kit (clontech, palo alto, ca, usa), resulting in replacing gfp vector. the resulting plasmid was treated with noti, and subsequently used to transform s. pombe strain using a lithium acetate method. the plates were incubated at 32c, and, after 2 - 3 days, positive colonies were selected. then correctly transformed cells were plated onto yes - foa plates to remove the ura4 marker. after 2 days, positive colonies were selected and checked by pcr. next, we introduced an additional reporter to make the cells more susceptible to p - factor. the second reporter system expressed gfp under the control of mam3 gene, which was expressed depending on pheromone p - factor. three fragments named mam3p, and gfp and ptl2m5-p were amplified by pcr using kod - plus - neo. the fragment mam3p including mam3 upstream region from 1,047 to 1 was amplified from an s. pombe genomic dna using m31 and m32 primers, each introducing ecori and bsai restriction site. the fragment gfp was gfp - coding sequence from phmgfp vector using g3 and g4 primers introducing bsai and xbai restriction site. the fragment ptl2m5-p containing no hcmv promoter region was amplified from ptl2m5 (asahi glass co., ltd. then, three fragments were treated with proper restriction enzymes and simultaneously ligated with ligation - convenience kit (nippon gene, japan). the pmam3 g was transformed into sxa2::gfp strain with pal7 vector following the above method. colonies were selected by yes10 medium containing 10 g / ml of g418 three times. all dna fragments used for the plasmid construction were amplified by pcr using the kod - plus - neo (toyobo) in accordance with the supplier 's instructions. the mam2 open reading frame was replaced with 1.8 kb ura4 fragment by standard homologous recombination method. three fragments named mam2up, and mam2dw and 1.8 kb ura4 were amplified by pcr from the s. pombe genomic dna. the fragment mam2up including mam2 upstream position 1,067 to 1 relative to mam2 atg was amplified using mu1 and mu2 primers introducing bsai restriction site. the fragment mam2dw including mam2 downstream position + 1,048 to + 2,055 relative to mam2 atg was amplified using md1 and md2 primers introducing bsai restriction site. the fragment 1.8 kb ura4 position 643 to + 1,230 relative to mam2 atg was amplified using ur1 and ur2 primers introducing aari restriction site. then, we prepared the fragment containing puc ori. and km gene of psl6z digested with noti. the plasmid was treated with noti and subsequently used to transform s. pombe strain using the lithium acetate method. the plates were incubated at 32c, and, after 3 days, positive colonies were selected. to check for correct integration reporter strains were grown in yes10 media at 32c for 2436 h and were inoculated into 5 ml of the fresh yes10 media. after having been washed twice with sterile water, cells were transferred to ycb media at od600 of 1.0 for nitrogen starvation. the cells were incubated at 30c for 2 h and used for afm study and mam2 signaling assay. for the signaling assay (figure 1(c)), 1 ml aliquots of cells were transferred to 24-well microplate containing 1 l of peptide solution (final concentration of 1 m). after incubation at 30c for 20 h, the cells were washed three times with pbs and resuspended in the same volume of pbs. fluorescence intensity of gfp was measured by a fluorescence spectrophotometer (hitachi f-3010, japan). the cells expressing gfp were excited at 491 nm, and fluorescence emission was detected at 515 nm. a force - volume mode of afm was carried out to examine specific interactions between pheromone and pheromone receptor. using the afm tip cross - linked with p - factor derivatives via a heterobifunctional peg linker, 1024 afm force curves were then obtained over different spots on mam2 + strain cells expressing pheromone receptors. although most of retraction curves (around 90%) showed no interaction (figure 2(a), upper curve), some retraction curves presented a downward deflection abruptly ending with a force jump (figure 2(a), others). since the peg linker used to attach the peptide to the afm tip has a total length of 30 nm, only events occurring after 30 nm extension were considered valid interaction events and were included into further analyses. the distribution of unbinding force is shown in figure 2(b). to verify the specificity of the unbinding force, force curves were also obtained in the presence of 1 m - free p - factor where specific interaction was expected to be inhibited. ranging from 100 to 160 pn, 122 interaction peaks (11.9%) were detected without free p - factor while 33 unbinding events (3.2%) were detected with free p - factor. the number of events clearly decreased and the unbinding probability fell to 3.2 from 11.9%. next, we carried out force curve measurements to examine interaction force between the afm tip modified with p - factor and mam2 strain cells expressing no pheromone receptors, and between the afm tip modified with p - factorleu and mam2 + strain cells. when mam2 strain cells were used for force curve measurements with p - factor - modified tips, the unbinding probabilities were not affected with or without free p - factor, showing 2.7% without free p - factor and 2.9% with free p - factor (figure 3(a)). when the afm tip was modified with truncated p - factor derivative lacking c - terminal leu, which was reported to have no p - factor function, the specific interaction was not observed, and the unbinding probabilities were almost the same with (3.5%) or without (3.1%) free p - factor (figure 3(b)). from these three kinds of force curve measurements, the unbinding forces observed in the first force curve measurement were supposed to be caused by the specific interaction between p - factor and its receptor. to examine the interaction of mam2 with p - factor derivatives with a method other than afm binding of p - factor to mam2 on the cell surface activates the intracellular signaling pathway that leads to the expression of the genes necessary to bring about cell fusion. replacing the response genes with a reporter construct, such as gfp, provides a simple readout for signaling. the interaction of mam2 and p - factor was investigated in an s. pombe strain containing sxa2 > gfp pmam3g / pal7 reporter constructs. the expression of gfp in response to p - factor is monitored with a fluorescence spectrophotometer (figure 4). when 1 m p - factor was added to the mam2 + strain cells, fluorescence intensity of the cells at 515 nm increased, which indicated that gfp was produced in the response of the cells to p - factor (figure 4(a)). the addition of cysteine at n - terminal of p - factor slightly affect its ability to induce the signal transduction pathway. since the mam2 + strain cells showed no response against 1 m c - p - factorleu, this peptide was not able to induce the signal transduction pathway. the mam2 strain cells (sxa2 > gfp pmam3g / pal7, mam2) showed no response with the addition of any peptides including p - factor (figure 4(b)). without mam2, the specific interaction was only observed by afm study under the condition in which the reporter assay showed the positive result. we examined here the interaction between p - factor and mam2 by both afm and the reporter assay. the unbinding force was calculated to be around 120 pn at probe speed of 1.74 m / s. p - factor derivative having no specific interaction to mam2 by afm did not activate mam2-specific signaling pathway. this yeast - based method combined afm, and the reporter assay will be available for the signaling study of heterologous gpcrs and screening of their ligands. | interaction between p - factor, a peptide pheromone composed of 23 amino acid residues, and its pheromone receptor, mam2, on the cell surface of the fission yeast schizosaccharomyces pombe was examined by an atomic force microscope (afm). an afm tip was modified with p - factor derivatives to perform force curve measurements. the specific interaction force between p - factor and mam2 was calculated to be around 120 pn at a probe speed of 1.74 m / s. when the afm tip was modified with truncated p - factor derivative lacking c - terminal leu, the specific interaction between the tip and the cell surface was not observed. these results were also confirmed with an assay system using a green fluorescent protein (gfp) reporter gene to monitor the activation level of signal transduction following the interaction of mam2 with p - factor. |
mirnas are a group of short, about 22 nucleotides long, non - coding rnas. mirna genes are situated within the introns or exons of coding genes or in intergenic regions. some mirnas are encoded as a single mirna, others as multiple mirnas creating clusters. the biogenesis of mirnas is still not clear, but generally two different pathways of mirna biogenesis are distinguished : the canonical one is a two - stage process occurring in the nucleus and cytoplasm, where immature forms of mirna hairpins are transformed to about 22 nt duplexes by drosha and dicer enzymes. one of the duplex strands, called the guide strand, is incorporated into the risc complex, and mirna in this complex can bind with the 3'utr region of target mrna [39 ]. some data suggest that the second strand, mirna, can also take part in the regulation of gene expression [10, 11 ]. regulation of gene expression is the function of mirnas and is connected with two mechanisms of blocking protein translation : i) repression of mrna translation or ii) cleavage of mrna. these small rnas are associated with the cell cycle, apoptosis, proliferation, differentiation, metabolic pathways and cell response to various types of stress [1318 ]. the relationship of mirnas between important cellular processes and disturbance of mirna expression, biogenesis, and function in cancer makes these small molecules one of the most studied nowadays. the human lethal-7 (let-7) family plays a critical role in regulation of development and carcinogenesis. the family contains 13 members located in 9 different loci on chromosomes 3, 9 - 12, 19, 21, 22 and x (fig. they are located individually or as clusters, which can contain only let-7 members or also other mirnas. clusters are the result of vertebrate - specific genome duplications, which enable correct biogenesis of mirnas and also precise regulation of them. all members of the family are highly sequence - similar and share a common nucleotide motif named the seed region, which is a crucial component for target recognition by risc [46 ]. characterization of let-7 family : a) genomic localization of its members ; arrows show exact localization of mirna within chromosome ; b) sequence similarity and c) structure of let-7a-1/let-7f-1/let-7d cluster. data obtained from genbank (ncbi) and mirbase databases let-7d is one of the members of this family. it is situated within the let-7a-1/let-7f-1/let-7d cluster, which is located in the human genome in region b on chromosome 9q22.3. the cluster with a 10 kb upstream promoter encodes a single polycistronic transcript with 3 members, which constitute about 24% of all let-7 precursors. binding of myc protein to non - canonical e - box 3 causes inhibition of transcription, whereas binding to canonical e - box 2 enhances this process (fig. binding to e - boxes depends on the cancerous or non - cancerous cell character and ratio of myc and max in the nucleus. the post - transcriptional regulation of let-7 mirnas is carried out on lin28 and lin28b. lin28 binds to pree elements of the mirna transcript and blocks pri - let-7 processing by drosha and pre - let-7 by dicer. furthermore, lin28 can recruit a terminal uridylyl transferase which adds uridine to pre - mirna and causes its decay. lin28 is associated with aggressive forms of cancer and causes down - regulation of let-7 mirnas, especially the let-7f precursor [19, 21, 22 ]. let-7d may be similarly regulated by an androgen effect in prostate cancer and by pdgf in glioblastoma and ovarian cancer. it is possible that, like in nematode worms, regulation of let-7 is controlled by let-7 itself. mature let-7 with its effector protein, argonaute, as mirisc can bind to pri - let-7 [25, 26 ]. the mature let-7 family members are the most abundant among all mirnas in the cell and they are regulated by different transcriptional and post - transcriptional mechanisms. the characteristic feature of mirnas from one family is sharing an identical seed sequence (fig. moreover, nucleotide changes in the pre - let-7 precursor make its stem fully complementary, whereby it functions as sirna [27, 28 ]. there is a lack of comprehensive studies describing targets for all let-7 members and explaining whether all members regulate the same genes. here, we focus on let-7d, which has only a few experimentally proven targets. k - ras, n - ras and h - ras mrnas contain let-7 binding sites in 3'utr sequences [29, 30 ]. inhibition of k - ras mrna by let-7d causes greater accumulation of cells in g1 than in g2/m phase of the cell cycle whereby cell proliferation is reduced. myc expression is inhibited by let-7d, whereas myc inhibits some members of the let-7 family. moreover, the inhibitory function of myc is shared with lin28, which is involved in induced pluripotent stem cell (ips) and tumor initiating cell (tic) formation [19, 21, 29 ]. let-7 can reduce myc protein expression directly by binding to its 3'utr or indirect by depletion of imp-1, which in turn destabilizes myc mrna. this oncogene can skip let-7 regulation by loss of its let-7 binding sites, causing over - expression of this protein and leading to tumor formation. moreover, hmga2 mrna in some cases is a more sensitive target of let-7 than ras. the group of genes regulated by let-7d also includes cell - cycle genes such as cdc25a, cdk6 and cyclin d1. the microarray analysis of gene expression in cells with let-7b over - expression indicates down - regulation of genes associated with cell cycle and division (cyclins, cell division cycle proteins, kinase - associated proteins) as well as genes coding for dna synthesis and dna replication. surprisingly, let-7b causes inhibition of expression of both proven and putative tumor suppressor genes and the cell cycle checkpoint genes. on the other hand, let-7b up - regulates some genes such as the cdk inhibitor b2, max and cyclin g2, so it can act as a tumor suppressor. let-7c and let-7 g regulate bcl - xl an anti - apoptotic member of the bcl family. let-7d is presumable engaged in dicer protein regulation and lack of it causes over - expression of this enzyme and proliferation of cancer cells in the oral cavity. pbx3, dmt1 and caspase-3 [37, 38 ] are also indicated as let-7d targets. the long list of let-7 family targets, their functions and relation with cancer have been reviewed by barh. taking into consideration only the seed region, let-7d should regulate the same targets as other family members. some evidence suggests that mirnas from the same precursor target different genes, which are involved in different cellular processes. the gene targeting is made more complicated by the existence of 3 and 5 variants of one mirna (isomirs) created by drosha and/or dicer enzymes. the 3 end of mirnas can be modified by exoribonucleases as well as nucleotidyltransferases, and rna editing can cause modification of the seed region. all of these events produce different variants of one mature mirna, which could have different targeting properties [2, 40 ]. the inhibition of proteins depends largely on the cell genetic background, and let-7 members might cause different degrees of translation inhibition and mrna instability depending on target genes [32, 33 ]. moreover, some mirnas probably can not only inhibit but also up - regulate protein levels. there is still a lack of precise knowledge about let-7 targets as well as full understanding of let-7 family members function. some of the targets of let-7d predicted by tarbase (diana tools) and mirdb have been shown in table 1a and for let-7d in table 1b. the analysis reveals over 300 target genes for let-7d-5p and 40 for let-7d-3p. predicted target genes for : a) let-7d-5p and b) for let-7d-3p (let-7d). target scores equal to and over 0.8 (for a) and 0.7 (for b) have been choosen as criteria for let-7d targets ; target score taken from tarbase half of the known mirna genes are located close to or inside chromosomes regions, which are usually mutated in cancer, known as fragile sites and cancer - associated genome regions [42, 43 ]. single mirna can function in cancer as a tumor suppressor or oncogene (oncomir), or have dual function. down - regulation of suppressor mirnas and up - regulation of oncomirs is linked to initiation of proliferation, invasion, angiogenesis and metastasis of tumor [4449 ]. let-7d is involved in regulation of many important genes, as described in the previous section, so it is not surprising that it has a significant role in cancer. it is believed that members of the let-7 family act as tumor suppressor mirnas and regulate expression of many oncogenes by both direct and indirect pathways. expression levels of let-7 family members are significantly low in human cancers, but in some cases high expression levels are indicated. the mechanism of this phenomenon is still not clear, but it is probably connected with complex let-7 family transcription and post - transcription regulations, genes copy number of let-7 members and epigenetic modulations [50, 51 ]. it has been proven that deletion of some let-7 mirnas or let-7 clusters is cancer - type dependent. the expression of let-7d is deregulated in cancers such as pancreatic, prostate, primary pigmented nodular adrenal dysplasia, head and neck, ovarian, breast, bladder, kidney and retinoblastoma [28, 39, 5254 ]. the implications of the let-7 family in cancer are multifaceted due to regulation of the cell cycle, proliferation, and apoptosis pathways, as described above. moreover, the let-7 family has an influence on differentiation, epithelial - to - mesenchymal transition (emt) and tic formation [5557 ]. over - expression of let-7d causes cell differentiation and changes in cell phenotype in vitro. the proliferation of neural stem cells has been suppressed and cell migration in mouse brain has been observed. the other studies showed, that fibroblasts are less mesenchymal - like and more similar to epithelial cells. in this case let-7d partly changed cell phenotype, probably by affecting hmga2, slug, id1 and id2, but did not influence twist and snail [59, 60 ]. on the other hand, inhibition of let-7d upregulates hmga2 and some markers characteristic for mesenchymal cells. moreover, let-7d seems to be under direct transcriptional regulation of transforming growth factor (tgf-). let-7d functions as a switch between emt and met (mesenchymal - epithelial transition) processes and regulates the tic cell population. the tics are a small fraction of tumor cells displaying the capacity for self - renewal and differentiation into new cancer cells. the let-7 family is down - regulated by post - transcriptional mechanisms in tics and up - regulated during the differentiation process. in the group of let-7 oncofetal genes suppressed in most adult tissues but activated in various forms of cancer are hmga2 (promotes self - renewal of stem cells), imp-1 (stabilizes some rnas such as c - myc and protects them from degradation), lin28/lin28b (responsible for pluripotency), ras and myc. down - regulation of let-7d in head and neck squamous cell carcinoma lines activated twist and snail expression, whereas up - regulation of let-7d reversed the phenotype. it is proven that the let-7 family has a significant role in cancer biology, but it is not explained whether disturbance of let-7 mirna expression causes cancer transformation or these disturbances are caused by cancerous changes in the cell. it is also not clear why, in some cancer, expression of let-7 members is down- or up - regulated. some independent studies regarding the same cancer type indicated both possibilities : for example, let-7d is indicated as up- as well as down - regulated in prostate cancer. sometimes let-7 profiling is much more complicated, because in the same cancer patient group, cases with low, unchanged and high let-7 expression can be found. it is accepted that let-7 mirnas are suppressors, and this statement is supported by many observations and experimental studies. however, we can also find evidence for the oncogenic role of some let-7s as a result of targeting caspase-3 [37, 38 ] and bax mrnas [63, 64 ]. is it possible to definitely say what is the exact role of let-7 family members in cancer : suppressor or oncogene or maybe both of them ? what affects the role of let-7 mirnas in cancer cells ? studies have shown dual behavior of the let-7 family after irradiation mirnas of this family can be up- or down - regulated [65, 66 ]. the behavior of let-7 members (like other mirnas) depends on dose, time after irradiation, source of oxidative stress and genetic background of the cell [6769 ]. for example, in two glioblastoma cell lines, with different dna - pk activity, that let-7 members (including let-7d) are mostly up - regulated in that cell line which is more radioresistant. in contrast, in lung cancer cell lines let-7 members (including let-7d) are mostly down - regulated. it has been shown that c - myc or n - ras alone increases radiation sensitivity, whereas together they increase radioresistance. down - regulation of let-7 family members depends on the dose and may be regulated directly by p53 as well as indirectly by atm protein. the let-7 family seems to be a critical factor for the cellular response to oxidative stress and is potentially involved in protection against radiation cytotoxicity. in contrast, over - expression of let-7a causes decreased k - ras expression and radiosensitization of cells. the ras protein is regulated through the lin28-let-7 network. the let-7 family 's impact on radiosensitivity over - expression of let-7 affects the ras oncogene and genes associated with dna damage repair : rad51, rad21, fancd2 and cdc25. the let-7 family is up - regulated in irradiated cells as opposed to bystander cells, in which most of these mirnas are repressed. some authors report that peaks of up- or down - regulation are found at 4 hours after irradiation, at the time of the most active dna repair processes. most of the mirnas return to their baseline levels after 24 hours [68, 69, 74 ]. changes of mirnas after irradiation can be a result of cell protection causing increased expression of genes responsible for dna repair and decreased levels of pro - apoptotic genes. however, it is possible that mirnas in irradiated cells tend to return to levels of genes changed after stress. nonetheless, the exact regulatory mechanisms and role of mirnas in response to irradiation still remain unclear. the direct influence of let-7c and let-7 g is based on targeting 3'utr of bcl - xl, which leads to its decrease in human hepatocellular carcinoma. up - regulation of let-7 sensitizes cells to sorafenib by targeting mci-1, a member of the bcl-2 anti - apoptotic family. another direct effect of let-7 (let-7a and let-7d) is connected with inhibition of caspase-3. two independent studies reported that let-7 has a complementary seed sequence to 3'utr of caspase-3 mrna [37, 38 ]. the regulation by let-7 refers to the caspase-3 only but not to caspase-8 or -9. in this case, over - expression of let-7a reduces sensitivity of cells to agents such as doxorubicin, paclitaxel or interferon. in this context, let-7 acts as an oncomir instead of a suppressor mirna. the high let-7a expression and paclitaxel treatment however, let-7a may synergistically interact with platinum drugs by inhibition of dna repair systems such as brca1. in this context, high expression of let-7a supports the platinum effect. the indirect influence of let-7 g via imp1 stabilizes mrna of mdr-1. the mdr-1 (abcb1) gene, a member of atp binding cassette transporters (abc transporter family), encodes the membrane transporter p - glycoprotein responsible for multidrug resistance. the regulator of mirna biogenesis lin28 is up - regulated in breast cancer cells which are resistant to paclitaxel. as mentioned above, lin28 causes down - regulation of let-7a and let-7b and induces expression of p21 and rb. over - expression of lin28 is characteristic for tics, local relapse and metastasis of cancer. restoring let-7 expression increases sensitivity to paclitaxel. in head and neck cancers, over - expression of let-7d and let-7a reduces chemoresistance by depletion of tics with aldh+ phenotype and sensitizes to cisplatin and 5-fu [55, 78 ]. in sum, there is limited knowledge about the role of let-7d in the cell response to radiation and chemotherapeutic drugs. the exact function is not determined, and potentially let-7d may function like other members of the let-7 family by targeting the same pathways. the members of the let-7 family are connected with many features of cancer and could be applied as diagnostic, predictive and prognostic biomarkers. let-7d alone or together with other genes may be used for cancer profiling and serve as a diagnostic marker. these data suggest that the level of let-7 expression is not a universal marker of tumor aggressiveness. even so, changes in let-7 still seem to be a marker of cancer transformation and progression and enable cancer to be distinguished from normal tissue and different pathological types of tumor. the use of mirna seems to be a more sensitive tool than the currently used histopathological methods. it has been shown that modification of let-7d level caused changes in cell line resistance to cisplatin and 5-fu. however, analysis of let-7a levels in ovarian cancer patients can be used as a predictive marker. combined treatment, platinum with paclitaxel, is more beneficial for patients with low let-7a expression. a combined low level of let-7d and mir-205 is a poor prognostic marker in head and neck cancer patients, and it seems to be independent of anatomical site, tumor size, treatment and hpv status. similarly, ovarian cancer patients with a low combined score of hmga2 and let-7d have better prognosis than the group with a high hmga2/let-7d ratio. likewise, assessment of let-7d expression can be used as a predictor of recurrence risk for hepatocellular carcinoma. in contrast to this, pancreatic cancer patients with a high level of let-7d in plasma have the worst prognosis, but the authors of the study normalized the results to mir-16, which is a poor normalizing factor. the diagnostics tends to use biomarkers which can be simply achieved from the patients at any time during treatment. circulating mirnas from whole blood or serum can be used as non - invasive biomarkers for hematological malignancies and solid tumor detection [86, 87 ]. however, the use of a combination of let-7d / let-7g / let-7i as normalization control for circulating mirnas is supposed to be a more reliable solution than commonly used reference genes. restoration of a member or members of the let-7 family in cancer cells is a new promising gene therapy. restoration of let-7d should inhibit cancer proliferation and metastasis, deplete tics and sensitize to chemo- and radiotherapy. the delivery of anti- or mirnas is based on viral and non - viral vehicles [8993 ]. some preclinical and clinical studies with let-7 members are currently in progress [9496 ]. the application of mirnas in cancer therapy may prove to be superior to sirnas or shrnas because interfering mirna (mirnai) modifies overlapping targets containing complementary regions to the seed sequence of mirna in a natural way. the eventual off - target effect and toxicity caused by mirna are mild or negligible [98, 99 ]. even though mirnas are among the most analyzed molecules nowadays, the let-7 family still seems to be mysterious. the family contains 13 members with almost identical sequences and ability to regulate different targets. the behavior of let-7 members can depend on their activity, genetic cell context or tumor microenvironment. they are deregulated in various cancers by different mechanisms, and their function is not fully defined. the members may display different functions in the same cell and sometimes can behave as a suppressor or an oncogene. many studies have shown that the let-7 family is implicated in proliferation, invasion, angiogenesis and tumor metastasis, can change cell phenotype through the emt process, and regulates tic populations. multifaceted let-7 modulates cancer response to radio- and chemotherapy. however, there is a lack of comprehensive studies about all members. knowledge about the role of individual members, such as let-7d, is based on assumptions and comparisons to other members of the family. the potential of the family probably can be used for early cancer diagnostics, prediction, treatment personalization and new therapeutic mirna technology in the future, but firstly, we should reveal the secrets about all members of the let-7 family. | mirnas belong to a class of small non - coding rnas which can modulate gene expression. disturbances in their expression and function may cause cancer formation, progression and cell response to various types of stress. the let-7 family is one of the most studied groups of mirnas. the family contains 13 members with similar sequences and a wide spectrum of target genes. in this paper, we mostly focus on one member of the family let-7d. this mirna is dysregulated in many types of cancers. it can be over- or down - expressed, and it acts as a tumor suppressor or oncogene. it regulates various genes such as lin28, c - myc, k - ras, hmga2 and imp-1. moreover, let-7d has a significant impact on epithelial - to - mesenchymal transition (emt) and formation of cancer initiating cells which are resistant to irradiation and chemical exposure and responsible for cancer metastasis. let-7d can serve as a prognostic and predictive marker for personalization of the treatment. let-7d is a small rna with great power, but in different cell genetic backgrounds it acts in different ways, which makes this molecule still mysterious. |
osseointegrated dental implants have become increasingly important in the field of oral rehabilitation1 with many studies reporting up to 99% the long - term success of dental implants.234 however, many reports assessing the prosthetic complications of implants showed that screw loosening, screw fracture, and implant mid - body fracture occur commonly, especially in single crowns which do not distribute the bite force to other implants.5678 during the past years, manufacturers have developed different types of implant - abutment connections to achieve implant stability and strength. for a successful implantation, it is essential that the implant assembly has enough strength to resist the stress in the oral cavity and transmit forces to the bone ; other requirements are biocompatibility of components, correct diagnosis, and appropriate surgical and prosthodontic procedures for implant placement. thus, for an implant assembly to withstand the bite force in patients, the properties of the material and type of connection of the implant system should be considered. in addition, the stress exerted on the functional prosthesis should not exceed the fracture resistance of the implant assembly.910 usually, mechanical failures of implant occur more from repeatable fatigue that lowers load than fracture strength of implant. however, static fracture of implants from overload also occurs frequently, due to factors such as clenching habit, hard food, and premature contact resulting from failure of occlusal adjustment.1112 in addition, for the ethnic group which enjoys chewing hard or coarse food than tender vegetables or meats, the enough strength of the implant assemblies is important to prevent mechanical failure because the stress applied to implant prosthesis after intraoral insertion was influenced by dietary habits. these days, the primary materials used for implant fixtures and abutments is commercially pure titanium, grade 2 and grade 4, the screw is usually made from a titanium alloy classified as titanium grade 5 (ti-6al-4v). titanium grade 4 has the highest mechanical strength of all unalloyed ti. despite the relatively lower mechanical strength of titanium grade 2, the manufactures using this material have insisted that it is less brittle, and the elasticity and flexibility are beneficial in clinical situations. they have also suggested that implant of ti grade 2 can be made resistant to local forces by using a greater amount of material to compensate for its lower mechanical strength. the effects of differences in the design of the implant - abutment connection on the mechanical stability have been evaluated in various in vitro studies. however, few studies have considered the properties of the material used as well as the design of the implant connection. in addition, in studies comparing materials, zirconia and titanium have been compared as abutment materials131415 rather than comparing different grades of titanium. furthermore, manufacturers tend to claim that their own systems are superior to those of their competitors, but they do not provide specific data on the complications and types of failure of their systems. the purpose of this study was to evaluate the stability of implant abutment assemblies made of different titanium grades and using different connections by measuring the compressive load at yield corresponding to yield strength, and the fracture point, and to analyze the failure characteristics of different implant systems under static overloading in order to anticipate the failures that may occur in clinical situations. the experimental models were prepared by combining different connections in macrogeometry (external hexagon, internal hexagon, morse tapered) and different materials (titanium grade 2 and 4), yielding six implant systems (table 1). for internal connection types of titanium grade 4, group it4s (straumann bone level, institute straumann ag, waldenburg, switzerland), group it4d (dentium superline, dentium, co., ltd., korea), and group it4n (neobiotech cmi is, neobiotech, co., ltd. group it2 (dentsply xive s, dentsply friadent, mannheim, germany) was used for an internal connection type of titanium grade 2. for the morse tapered connection of titanium grade 2 group mt2 (ankylos c / x, friadent gmbh, mannheim, germany) was used, and for the external connection type with titanium grade 4 group et4 (neobiotech cmi eb, neobiotech, co., ltd. the components of each system were selected based on sizes as close to 4.0 mm for the fixture neck diameter, and 12 mm for the fixture length. abutments were fixed to the fixtures by the corresponding screws, with the torque given by the manufacturer (table 1), and retightened 10 minutes later with the same torque.161718 hemispherical crowns made of cobalt chromium alloy were manufactured using computer - aided design / computer - assisted manufacturing (etkon, etkon ag, grfeling, germany) and were seated onto the abutments with dual cure resin cement (rely x unicem, 3 m espe, st. ten implant fixtures of each group were embedded in acrylic resin (unifast trad, gc corporation, tokyo, japan), which has an elastic modulus similar to bone, according to iso 14801 (dentistry - fatigue test for dental implants) (fig. following this norm, the vertical distance from the acrylic resin surface representing the bone level to implant shoulder was 3-mm for simulating bone resorption, and the distance to the center of the hemisphere was standardized at 11 mm. the fixtures were then clamped in a jig with a 30 angle between the implant axis and the force direction. the static load was applied using a universal testing machine (electro plus e3000, instron, norwood, ma, usa) with a crosshead speed of 1 mm / min (fig. displacement curves were recorded until visible fracture of the implant assembly was observed, or a decrease of 20% in the fracture strength in cases with no obvious fracture.14 yield strength (offset 0.2%) and fracture strength were determined from the chart (table 2), after the movements of the abutments were recorded (table 3). after the static load test, the failed samples were polished with # 500 to # 4000 grit sic abrasive papers and aluminum oxide particles until the centers of the longitudinal sections were exposed. images of these sections were taken with the digital microscope (sometech, ims - d-345, korea). the longitudinal section of group it4d that had a visible screw fracture in the digital microscopic view, and the cross - section of fractured screw in group it2 that was loaded until the implant assembly completely fractured were observed with the scanning electron microscope (s-2300, hitachi, co., ltd., japan) to analyze the failure characteristics. the mean values of yield and fracture strength, and their standard deviations, are presented in table 2. one - way analysis of variance (anova) and student 's t - test with the level of significance at p =.05 (spss12.0, spss software corp., chicago, il, usa) were used. the mean values and standard deviations of yield and fracture strength for each system are presented in table 2 and multiple comparisons are presented in fig. 2 and fig. the specimens in group it4s had the highest values for both yield strength and fracture strength, whereas those in group it2 had the lowest values. there was no significant difference in the yield and fracture strength between the specimens in group it4n and group et4, which were made by the same manufacturer (neobiotech, co., ltd. there was no significant difference in yield strength between group it4d and group it4n, which have similar internal connection designs and use ti grade 4. yield and fracture strength differed significantly between group mt2 and group it2, although they used the same titanium grade 2 material. permanent deformation of the fixtures occurred in all specimens except for those in group mt2, and was mostly observed around the neck of the fixtures (fig. 4). specifically in specimens of group et4, deformation occurred in the middle of the fixture. specimens in group it4s had a longer joint depth and an apparently more stable implant - abutment connection than the specimens in the other groups. implant fixtures, abutments, and screws were bent in the area of decreased abutment wall thickness at its center. in specimens of group it4d, we observed no deformation of the abutments and only partial fractures of the screws. the fracture zone was observed at the junctions of the unthreaded and threaded parts of the abutment screws after fixture deformation. in specimens of group it4n, we observed screw bending with deformation of the fixture at the end of the union of abutment and screw on the fixture inner surface. unlike the specimens in the other groups, the fixtures of the specimens in group mt2 had few variations. deformation in the abutment structure usually occurred at the area with the smallest diameter. in specimens of group it2, there was a distinct vertical gap between the fixture and abutment, suggesting abutment mobility. the movement of failed abutments was not observed after the static load test in any groups except group it2. interestingly, in specimens of group et4, deformation of the fixtures was observed below the bone level, whereas the deformation of fixtures in specimens of other groups was mostly seen above the bone level or at the bone level. in the cross sectional view of the fractured screw in group it2, typical marks indicating the direction of crack propagation were evident (fig. the average physiological bite force is in a range of 50 n to almost 400 n in natural dentition19, but it was reported that some patients had very high magnitude bite force from 1200 n to 2000 n.192021 so the strength and load bearing capacity of implant is an important property for successful implant restoration, especially to the patient with ability to produce high magnitude bite force. static fracture occurs when the applied load exceeds the fracture strength, and this type of fracture is closely related to overload. strong bite force, premature contact, the habit of teeth clenching, eating coarse and hard food, etc. are recognized risk factors for clinical conditions that cause implant failure.1112 this study was not a test of materials, but an investigation of implant components functioning together as a whole system.9 therefore, the strength was expressed in newtons, not in mpa as is usual in testing of materials. in the load - displacement curve obtained using this study, yield strength is represented by the point when irreversible plastic deformation of the implant assembly was initiated. the peak value of the curve represents the fracture strength, the ability to withstand the overload until the implant system is destroyed by external force.22 it is also known as flexural strength or bending strength,1323 beyond this point, permanent implant failure occurs. there were significant differences in the yield and fracture strength against static load among each groups of the implant system in this study (fig. it was observed that the yield strength of specimens in five groups except for those in group it2 was acceptable in a clinical situation because they had a higher or similar value of yield strength compared to average maximum bite force. exceptionally, the yield strength of group it2 was much lower than average maximum bite force. although the fixture of group it2 has an approximately 0.2 mm smaller diameter than any of the other groups (table 1), this group should be carefully selected when it was placed in patient who is expected to have high bite force and recommended using the fixture with larger diameter. in this study, we suggested that the reason for obtaining the highest yield and fracture strength in specimens of group it4s was the relatively long internal connection of about 4.2 mm joint depth with strong material property of ti grade 4 (table 1). many studies reported that longer joint length of abutment - fixture connection were advantageous with respect to longevity and fracture strength.2425262728 fracture strength differed significantly between the specimens in group it4d and group it4n despite a similar connection interface. this may have been affected by differences of microstructure of components and the technology of material manufacture. generally, implant fixture - abutment connections are divided into external and internal, although they can be further classified based on the tapered degree or the locking index. many studies performed with fatigue stress2526293031 have reported that an internal connection has a superior yield strength and stability to those of an external connection. they claimed that the lateral forces are better distributed to conical interface of internal connection whereas the short height of the hexagon in external connection could not provide enough resistance for lateral force and the bending moments were transmitted to the fastening screw. however, this study, performed without fatigue stress, did not present the lowest mean values of yield and fracture strength in group et4, which have a short external - hex with a butt joint connection. in addition, specimens in group it4n (internal hex connection) and group et4 (external hex connection), produced by the same manufacturer but had different connections, did not differ significantly in yield and fracture strength. we could presume that the reason of this is the implant assemblies used in this study kept holding the initial settling force between the thread parts without preload loss because it did n't receive extrinsic stress, thus the strength of systems themselves had been measured. specimens in group mt2 (morse tapered connection) and group it2 (internal connection), which were both made with ti grade 2, differed in both yield and fracture strength. it could be suggested that the thick wall of the fixture based on the ' platform switching concept ' in group mt2 resulted in significantly higher values and led to fewer instances of fixture deformation.32 the deformation of the implant assembly (fig. 4) in the internal connection groups was generally observed above or at the bone level near the fixture neck. specimens in groups it4d and it4n which have similar connection interfaces displayed similar types of deformation. specimens in group et4 as external connection, the abutment - fixturescrew assembly was firmly combined one unit, and deformation had occurred in the middle of the fixture at the end of the inserted screw. only in group it4d, partial fracture of the screw occurred at the junction between the unthreaded and threaded portions of the screw (fig. this was in contrast to previous studies3334 reporting that screw failure occurred below the screw head or the threaded part of the screw. we could suggest that this different result may be due to difference in the amount of preload loss by external forces in threaded part when screw failure occurred. the groups made with ti grade 2 (groups it2 and mt2) showed more bending rather than fractures in failure characteristics as the manufacturer clamed in this study. in sem fractography of cross sections of the fractured screws in group it2 (fig. 5), we observed compression curl,35 indicating that the fracture originated on the tensile side, and a strong flexure phenomenon occurred prior to complete failure as a characteristic of ti grade 2. the feature of curved lip marks in a compression curl results from a travelling crack that changes direction when it enters into a compression field.35 figure 5 illustrates both a rough surface and a smooth surface, characteristics of ductile failure and brittle failure.36 however, we may suppose that brittle failure occurred without significant plastic deformation because the smooth surface occupied more than half of the area. this study involved a small number of specimens and did not completely reproduce the intraoral condition. future studies might include representing complex masticatory movements within a wet environment to obtain realistic intraoral conditions. the result of this study did not suggest that one implant system is superior to another, but it provides an advisable knowledge for patients who are exposed to the overload. the internal connection design is not the only factor which provides enough resistance to static overloading. the property of titanium grades as material of the implant assembly is also important and has to be considered to avoid mechanical failure of an implant by overloading. a larger diameter implant should be selected when using a system made of ti grade 2 for preventing implant failure. | purposethe purpose of this study was to evaluate the resistance to deformation under static overloading by measuring yield and fracture strength, and to analyze the failure characteristics of implant assemblies made of different titanium grades and connections.materials and methodssix groups of implant assemblies were fabricated according to iso 14801 (n=10). these consisted of the combinations of 3 platform connections (external, internal, and morse tapered) and 2 materials (titanium grade 2 and titanium grade 4). yield strength and fracture strength were evaluated with a computer - controlled universal testing machine, and failed implant assemblies were classified and analyzed by optical microscopy. the data were analyzed using the one - way analysis of variance (anova) and student 's t - test with the level of significance at p=.05.resultsthe group it4s had the significantly highest values and group it2 the lowest, for both yield strength and fracture strength. groups it4n and et4 had similar yield and fracture strengths despite having different connection designs. group mt2 and group it2 had significant differences in yield and fracture strength although they were made by the same material as titanium grade 2. the implant system of the similar fixture - abutment interfaces and the same materials showed the similar characteristics of deformation.conclusiona longer internal connection and titanium grade 4 of the implant system is advantageous for static overloading condition. however, it is not only the connection design that affects the stability. the strength of the titanium grade as material is also important since it affects the implant stability. when using the implant system made of titanium grade 2, a larger diameter fixture should be selected in order to provide enough strength to withstand overloading. |
autoimmune uveitis of noninfectious origin is a vision - threatening disease that affects 115.3 per 100,000 people and accounts for 2.810% of all cases of blindness in the united states. corticosteroids are the first line of therapy for patients with autoimmune uveitis. however, long - term use of corticosteroids is associated with serious systemic and ocular adverse effects. also, there are subtypes of autoimmune uveitis that are refractory to steroids. for these reasons, efforts are being made to develop new therapies for autoimmune uveitis by modulating immune responses underlying the pathogenesis of uveitis. the pathogenesis of autoimmune uveitis is traditionally regarded as th1-mediated [3, 4 ]. however, th17 cell is recently identified as a novel subset of t cells that contributes to the development of autoimmune diseases including uveitis [3, 4 ]. stromal progenitors of mesodermal cells, referred to as mesenchymal stem cells or multipotent mesenchymal stromal cells (mscs), have the remarkable capacity to protect tissues from various immune - mediated diseases. studies demonstrate that mscs exert immunosuppressive functions by modulating th1, th2, or th17 immune responses, by inhibiting t cell proliferation, or by generating regulatory t (treg) cells [57 ]. also, clinical trials are in progress to capitalize on the immunomodulatory effects of mscs for treatment of patients with autoimmune diseases such as multiple sclerosis, crohn 's disease, type 1 diabetes, systemic lupus erythematous, or systemic sclerosis. in this study, we investigated whether an intraperitoneal (ip) administration of human bone marrow - derived mscs (hmscs) might prevent development of experimental autoimmune uveitis (eau) in mice, a model for human autoimmune uveitis. six - week - old female b6 mice (c57bl/6j) were purchased from orient bio inc. (seongnam, korea) and maintained in a specific pathogen - free environment with continuously available water and food. animals were treated in strict accordance with the arvo statement for the use of animals in ophthalmic and vision research. the experimental protocols were approved by the institutional animal care and use committee of seoul national university biomedical research institute. human bone marrow - derived mscs were obtained from the center for the preparation and distribution of adult stem cells (http://medicine.tamhsc.edu/irm/msc-distribution.html) that supplies standardized preparations of mscs enriched for early progenitor cells to over 300 laboratories under the auspices of an nih / ncrr grant (p40 rr 17447 - 06). the cells consistently differentiated into three lineages in culture, were negative for hematopoietic markers (cd34, cd36, cd117, and cd45), and were positive for mesenchymal markers cd29 (95%), cd44 (> 93%), cd49c (99%), cd49f (> 70%), cd59 (> 99%), cd90 (> 99%), cd105 (> 99%), and cd166 (> 99%). the cells were cultured in complete culture medium with 16% fbs until 70% confluence was reached and harvested with 0.25% trypsin/1 mm edta at 37c for 2 min. after washing, the cells were resuspended in balanced salt solution (bss ; biowhittaker, walkersville, md) at a concentration of 10,000 cells/l for injection in vivo. eau was induced in mice by subcutaneous injection into a footpad of 250 g human interphotoreceptor retinoid binding protein (irbp) peptide 120, gpthlfqpslvldmakvlld (20 mg / ml ; peptron, daejeon, korea), that was emulsified in complete freund adjuvant (sigma, saint louis, mo) containing mycobacterium tuberculosis (2.5 mg / ml ; bd difco, franklin lakes, nj). simultaneously, the mice received 0.7 g pertussis toxin (300 l ; sigma) intraperitoneally. immediately after immunization, either 1 10 hmscs in 100 l bss or bss (100 l) alone was injected intraperitoneally. on days 7, 14, and 21 after immunization, mice were humanely killed, and eyeballs, inguinal and popliteal lns were collected for further assays. serial 4 m thick sections were cut and stained with either hematoxylin / eosin or tunel (terminal deoxynucleotidyl transferase dutp nick end labeling) as the manufacturer 's protocol (chemicon international, temecula, ca). the morphologic features of the retina were examined, and histological disease scores were assessed by two independent observes (joo youn oh and tae wan kim) in a blinded manner on a scale of 0 to 4 using the criteria previously defined by caspi. the proportions of th1, th17, t, and treg cells were determined by measuring ifn-, il-17, tcr, or cd25 and foxp3-expressing cd4 cells using flow cytometry. in addition, the population of il-10 expressing cells was determined by staining the cells with cd4, cd25, foxp3, cd19, b220, cd11b, cd11c, and il-10. to collect cell suspensions, popliteal or inguinal nodes (lns) were placed and minced between the frosted ends of two glass slides in rpmi media containing 10% fbs and 1% penicillin - streptomycin. the cells were immunostained with the following fluorescence - conjugated anti - mouse antibodies : cd4, cd25, foxp3, ifn-, tcr, cd19, b220, cd11b, cd11c, il-10 (ebioscience, san diego, ca), and il-17a (bd pharmingen, san diego, ca). for intracellular staining, the cells were stimulated for 4 h with 50 ng / ml phorbol myristate acetate and 1 g / ml ionomycin in the presence of golgiplug (bd pharmingen). the cells were then assayed for fluorescence using a facscanto flow cytometer (bd biosciences, mountain view, ca). the gate was set on cd4 or cd19 cell population, and further analysis of surface or intracellular markers was done within this gate. lns were lysed in rna isolation reagent (rna bee, tel - test inc., friendswood, tx) and homogenized using a sonicator (ultrasonic processor, cole parmer instruments, vernon hills, il). total rna was extracted using rneasy mini kit (qiagen, valencia, ca) and used to synthesize double - stranded cdna by reverse transcription (superscript iii, invitrogen, carlsbad, ca). real - time amplification was performed using taqman universal pcr master mix (applied biosystems, carlsbad, ca). an 18 s rrna probe (taqman gene expression assays i d, hs03003631_g1) was used for normalization of gene expression. for all the pcr probe sets, taqman gene expression assay kits were purchased from applied biosystems : il-1 (mm00434228_m1), il-6 (mm00446190_m1), ifn- (mm01168134_m1) il-17a (mm00439618_m1), il-10 (mm00439614_m1), tgf- (mm01178820_m1), il-12a (mm00434165_m1), and il-23 (mm01160011_g1), and human gapdh (hs02758991_g1). for protein extraction, eyeballs were cut into small pieces and lysed in pro - prep protein extraction solution (intron biotechnology, seongnam, korea). after centrifugation at 12,000 rpm for 20 min, the supernatant was collected and assayed for ifn- by elisa according to the manufacturer 's protocol (duoset ; r & d systems, minneapolis, mn). values were compared between the groups using the one - way anova (spss 12.0, chicago, il) or student 's t test and shown as the mean value standard error (sem). eau was induced in mice by subcutaneous injection of irbp in a footpad on day 0. simultaneously, either hmscs (1 10 cells / mouse) or bss was injected intraperitoneally. on days 7, 14, and 21, the mice were humanely killed, and eyeballs and draining lns (dlns) were collected for assays (figure 1(a)). elisa showed that the level of the proinflammatory cytokine ifn- was markedly increased in the eyeball on day 14 and significantly reduced by treatment with hmscs (figure 1(b)). histology demonstrated that the retinal structure including the photoreceptor layer was severely disorganized with massive infiltration of inflammatory cells in the vitreous cavity and in the retina of bss - treated eau mice on day 21 (histological score 2.13 0.31, figures 1(c) and 1(d)). in contrast, the retinal architecture was almost completely preserved with few inflammatory cells in hmscs - treated mice on day 21 (histological score 0.25 0.14, figures 1(c) and 1(d)). similarly, tunel staining indicated the presence of many dead cells in the photoreceptor layer in bss - treated eau mice on day 21, while there were few tunel - positive cells in mice treated with hmscs (figure 1(e)). to determine whether hmscs suppressed the intraocular inflammation by direct contact, we evaluated the presence of hmscs in the eye by real - time rt - pcr assays for human - specific gapdh. however, we did not detect any amplification of human gapdh, indicating that hmscs were not present in the eye on days 7, 14, or 21 after ip injection. therefore, the data clearly indicated that a single ip injection of hmscs at the time of immunization prevented the development of eau and protected the retina from inflammation - mediated damage. we next investigated whether the tissue - protective effects of hmscs might be due to the influence of hmscs on the development of th1, th17, or t cells that are pathogenic effectors in uveitis [3, 4 ]. time course study showed that the percentage of ifn--expressing cd4 cells, il-17a - expressing cd4 cells, and tcr - expressing cd4 cells was significantly increased in popliteal and inguinal lns of eau mice on day 7 and decreased thereafter to baseline levels (figure 2, supplemental figure 1 (see supplemental figure 1 available online at http://dx.doi.org/10.1155/2014/624640)). treatment with hmscs significantly reduced the percentage of th1 and th17 cells in popliteal and inguinal lns on day 7 (figure 2). consistently, the levels of il-17a and ifn- transcripts were significantly reduced by hmscs, compared to the bss - treated controls (figure 3(a)). however, the percentage of t cells was not affected by hmsc treatment (supplemental figure 1). in order to determine whether hmscs inhibited th1 or th17 cell generation by suppressing the production of th1- or th17-polarizing cytokines, we further measured the levels of il-1, il-6, il-12a, il-23, and tgf- which are the cytokines that drive the development of th1 and th17 cells [1012 ]. however, hmscs did not reduce the levels of il-1, il-6, il-12a, il-23, and tgf- in dlns (figures 3(b)3(d)). of note, hmscs significantly increased the level of il-10, an immunoregulatory cytokine that suppresses th1/th17 immune responses (figure 3(b)). to identify the il-10-expressing cell population, we examined cd4, cd19, b220, cd11b, or cd11c cells in dlns for il-10 expression. we found that the percentage of il-10b220cd19 cells was markedly increased in popliteal lns of hmscs - treated eau mice on day 7, compared to bss - treated eau mice (figures 4(a) and 4(b)). however, il-10 expression was not increased in cd4, cd11b, or cd11c cells (data not shown). also, hmscs did not increase the percentage of cd4cd25foxp3 treg cells in popliteal or inguinal lns at all examined time - points (supplemental figures 2(a) and 2(b)). time course indicated that cd4cd25foxp3 cells initially increased in popliteal and inguinal lns on day 7 after eau induction and gradually decreased to baseline on days 14 and 21. on the contrary, cd4cd25foxp3 cells initially decreased in the spleen on day 7 and increased thereafter until day 21. the hmscs significantly suppressed an increase of cd4cd25foxp3 cells in the spleen on days 14 and 21 (supplemental figure 2(c)), reflecting that hmscs might suppress early inflammation that is required for initial treg expansion. time course study revealed that th1 and th17 cells increased in dlns after eau immunization, and then the levels of proinflammatory cytokines markedly increased in the eyes. a single ip administration of hmscs at the time of immunization significantly decreased th1 or th17 cells in dlns and increased il10b220cd19 cells on day 7. as a result, ocular inflammation was markedly repressed, and the retina was almost completely protected from damage. therefore, our data suggest that hmscs ameliorate autoimmune uveitis by suppressing the th1/th17 immune responses. there are several possibilities that account for the mechanisms of hmscs in repressing the th1/th17 immune responses. one is that hmscs may directly inhibit differentiation or expansion of th1/th17 cells. in support of this hypothesis, previous reports demonstrated that mscs suppressed t cell proliferation and inhibited differentiation of nave cd4 t cells into th1 or th17 cells [1318 ]. however, it is unclear in vivo whether enough number of systemically administered hmscs reaches peripheral lns or injured tissues to exert direct inhibitory effects on t cells. this is likely because a single administration of mscs that are short - lived has long - term effects in the host as shown in our study. in fact, a number of previous studies showed that mscs induced treg cells [18, 19 ], switched microglia or macrophages toward anti - inflammatory or tissue - repairing phenotypes [2022 ], or promoted generation of regulatory or tolerogenic dendritic cells [2325 ]. consistent with these reports, we found that the level of il-10, an immunoregulatory cytokine that suppresses th1/th17 immune responses [26, 27 ], was markedly upregulated in dlns of mice treated with hmscs. among the examined cell populations (cd4, cd19, cd11b, and cd11c cells), il10-expressing b220cd19 cells were dramatically increased. il-10-producing b cells are known to be critical for suppression of autoimmune diseases, although b cells are both pathogenic and protective in autoimmune diseases. given that the effects of mscs on b cells have been rarely studied so far, further characterization of il10-expressing b220cd19 cells as a potential regulatory b cell subset [29, 30 ] would provide a mechanistic insight into the immunomodulatory mechanism of hmscs. since the therapeutic efficacy of mscs was first reported in experimental autoimmune encephalitis, there have been efforts to use mscs for treating a variety of autoimmune diseases such as autoimmune arthritis, autoimmune myocarditis, or sjgren 's syndrome [5, 8, 16, 17, 19 ]. when it comes to autoimmune uveitis, two studies recently demonstrated that mscs attenuated eau in mice and rats. tasso. reported that a single ip injection of syngeneic mouse mscs at the time of immunization almost completely reduced the incidence and severity of disease in mice with eau induced by irbp injection. they found that the percentage of cd4cd25foxp3 cells was significantly higher in the spleen in msc - treated eau mice than in untreated controls. another study by zhang. reported that an intravenous administration of syngeneic or allogeneic rat mscs strikingly reduced the severity of eau induced by irbp in rats. mscs were effective when the cells were administered before the onset or at the peak of disease, but not after disease stabilization. they additionally found that the levels of il-2, il-17, and ifn- were lower in supernatants of t lymphocytes isolated from eau mice treated with mscs, compared to t lymphocytes from untreated eau mice. however, either study did not directly evaluate the effects of mscs on th1 and th17 cells in dlns in vivo as in our study. mouse mscs undergo spontaneous transformation during expansion in culture and occasionally become tumorigenic in the same manner as mouse fibroblasts [3436 ]. for instance, indolamine 2, 3-dioxygenase (ido) is involved in the immunosuppressive activity of human mscs, whereas inducible nitric oxide synthase (inos) mediated the immunosuppressive activity of mouse mscs. therefore we used hmscs for this study in order to evaluate clinical efficacy of hmscs and their mechanism(s) as a potential treatment of autoimmune uveitis in humans. as a result, we found that the number of th1 and th17 cells was markedly reduced by hmscs and il10b220cd19 cells, not classical cd4cd25foxp3 treg cells, were increased by hmscs. further studies using a specific depletion of il-10 production from b cells would be necessary to determine whether il-10-producing b cells are a main mediator of hmscs in suppressing eau. in conclusion, our data demonstrate that systemic administration of hmscs almost completely prevented the development of eau by suppressing th1/th17 immune responses and protected the retina from immune - mediated damage. the results provide a further rationale for the use of hmscs to treat a variety of autoimmune or immune - mediated diseases involving the eye and other organs that are driven by excessive th1/th17 immune responses. | autoimmune uveitis is one of the leading causes of blindness. we here investigated whether intraperitoneal administration of human mesenchymal stem / stromal cells (hmscs) might prevent development of experimental autoimmune uveitis (eau) in mice. time course study showed that the number of ifn-- or il-17-expressing cd4 + t cells was increased in draining lymph nodes (dlns) on the postimmunization day 7 and decreased thereafter. the retinal structure was severely disrupted on day 21. an intraperitoneal injection of hmscs at the time of immunization protected the retina from damage and suppressed the levels of proinflammatory cytokines in the eye. analysis of dlns on day 7 showed that hmscs decreased the number of th1 and th17 cells. the hmscs did not reduce the levels of il-1, il-6, il-12, and il-23 which are the cytokines that drive th1/th17 differentiation. also, hmscs did not induce cd4+cd25+foxp3 + cells. however, hmscs increased the level of an immunoregulatory cytokine il-10 and the population of il-10-expressing b220+cd19 + cells. together, data demonstrate that hmscs attenuate eau by suppressing th1/th17 cells and induce il-10-expressing b220+cd19 + cells. our results support suggestions that hmscs may offer a therapy for autoimmune diseases mediated by th1/th17 responses. |
detection of cyclic - di - adenosine monophosphate (c - di - amp), a bacterial second messenger, by the host cytoplasmic surveillance pathway (csp) is known to elicit type i interferon responses critical for antimicrobial defense13. however, the mechanisms and role of c - di - amp signaling in mycobacterium tuberculosis virulence remain unclear. here we show that resistance to tuberculosis (tb) requires csp - mediated detection of c - di - amp produced by m. tuberculosis and that levels of c - di - amp modulate the fate of infection. we found that a di - adenylate cyclase (disa or daca)4 over - expressing m. tuberculosis strain that secretes excess c - di - amp activates the interferon regulatory factor (irf) pathway with enhanced levels of ifn-, elicits increased macrophage autophagy, and exhibits significant attenuation in mice. we show that c - di - amp - mediated ifn- induction during m. tuberculosis infection requires stimulator of interferon genes (sting)5-signaling. we observed that c - di - amp induction of ifn- is independent of the cytosolic nucleic acid receptor cyclic - gmp - amp (cgamp) synthase (cgas)67, but cgas nevertheless contributes substantially to the overall ifn- response to m. tuberculosis infection. in sum, our results reveal c - di - amp to be a key mycobacterial pathogen associated molecular pattern (pamp) driving host type i ifn responses and autophagy. these findings suggest that modulating the levels of this small molecule may lead to novel immunotherapeutic strategies against tb. |
|
sdf-1 belongs to a complex group of chemokines, which are small molecules involved in the regulation of inflammation and migration of cells. there are more than 50 different chemokines and more than 20 receptors that have been cloned. there frequently exists significant promiscuity in the binding of several of these chemokines to multiple receptors, albeit with variable affinity and different responses. sdf-1 is unique in this regard as it only binds to its principal receptor, termed cxcr4, and to a recently identified second receptor cxcr7. sdf-1 and cxcr4 are also unique with regard to their importance for embryonic development, with knockout of either one resulting in fetal lethality. the sdf-1/cxcr4 axis regulates trafficking of stem cells during development, in homeostasis, inflammation, and in regeneration. intracellular signaling of sdf-1 via cxcr4 occurs via g - protein - activated downstream pathways, which includes ras, phosphatidylinositol 3-kinase, janus kinase / signal transducers and activators of transcription signaling, activation of transcription factors, as well as linkage to the cytoskeletal system that promotes cell migration. the major biological effects of sdf-1 include the induction of motility, chemotactic responses, cell adhesion, and increased adhesion to vascular cellular adhesion molecule-1, intercellular adhesion molecule-1, and fibrinogen, induction of metalloproteinases and angiopoietic factors, as well as proliferation and cell survival. sdf-1 and cxcr4 expressions are regulated by transcription factors including hypoxia - inducible factor-1 and nuclear factor-b. hypoxia - inducible factor-1 stabilization leads to upregulation of sdf-1 through binding to promoter sites, whereas the von hippel - lindau protein negatively regulates sdf-1 expression. sdf-1 has been shown to be upregulated in myocardial infarction, limb ischemia, toxic liver damage, excessive bleeding, total body irradiation, and tissue damage related to chemotherapy. cxcr4 is expressed on hematopoietic stem cells, endothelial progenitor cells, neural stem cells, primordial germ cells, liver oval cells, skeletal muscle satellite cells, embryonic stem cells, and cancer stem cells. it is furthermore expressed on subgroups of neutrophiles, monocytes, b cells, and t cells. accordingly, cxcr4 is one of the major receptors that regulates trafficking of hematopoietic stem cells and progenitor cells. furthermore, cxcr4 is involved in the regulation of angiogenesis, in part through recruitment of endothelial progenitor cells, and is important in trafficking of tissue stem cells, as well as guiding cxcr4-positive cells during embryogenesis, development, and tissue regeneration. in cancer knockout of cxcr4 results in death in utero due to hematopoietic and cardiac defects, as well as changes in brain development. the sdf-1/cxcr4 axis facilitates tumor cells access to cellular niches such as those in the bone marrow, where it mediates survival and directly stimulates growth of neoplastic cells in a paracrine manner. sdf-1 has been shown to be a prognostic marker in acute myelogenous leukemia and in breast cancer, and it is involved in the establishment of the cancer stem - like cell niche. there is limited knowledge regarding the involvement of the sdf-1/cxcr4 axis in the development and homeostasis of the normal kidney, although one report showed sdf-1 expression in the developing kidney. therefore, our group investigated the expression pattern and functions of the sdf-1/cxcr4 system in the normal kidney, as well as after ischemia / reperfusion - induced aki. sdf-1 is expressed in the normal kidney mostly by distal tubular cells in the cortex, as determined by in situ hybridization, immunohistochemistry, and enzyme - linked immunosorbent assay. cxcr4 expression in the kidney is of similar distribution to that of sdf-1. within 24 h of induction of ischemia / reperfusion aki, all kidney regions show robust expression of sdf-1 and cxcr4, indicating significant, injury - induced upregulation of both. this was demonstrated using real - time quantitative reverse transcriptase - polymerase chain reaction and enzyme - linked immunosorbent assay. in vitro studies with adenosine 5 triphosphate depletion of primary, proximal tubular kidney cells in culture showed upregulation of sdf-1 mrna as early as 90 min after chemically induced homing assays demonstrated the importance of the sdf-1/cxcr4 axis in cell migration toward injured kidney cells, which was abrogated by neutralizing anti - cxcr4 antibodies. plasma sdf-1 gradient, characterized after aki by plasma levels of sdf-1 that significantly exceeded those present in the bone marrow. this chemokine pattern resulted in the mobilization, from the bone marrow, of cxcr4-expressing progenitor cells into circulation and their recruitment into the injured kidney. in summary, our data show that renal sdf-1 is an important mediator of homing and migration of cxcr4-positive cells toward the injured kidney. furthermore, these data indicate that sdf-1 is a major factor involved in kidney repair through recruitment of cells involved in regeneration, including endothelial progenitor cells, as well as administered stem and other progenitor cells. | both the homing of hematopoietic stem cells (hscs) to the bone marrow and their engraftment in recipients of bone marrow transplants are primarily mediated by the chemokine stromal - derived factor-1 (sdf-1) or cxcl12, which activates cxcr4, its cognate receptor on hscs. we showed that the recruitment and temporary attachment of cxcr4-expressing cells, such as hscs and a fraction of mesenchymal stem cells (mscs), to the kidney, following ischemia / reperfusion acute kidney injury, are similarly mediated by robustly upregulated sdf-1 in the kidney, indicating that such organ injury appears to lead to the transient expression of a facultative stem cell niche. this sdf-1 response of the injured kidney facilitates both the mobilization from the bone marrow and homing of precursor cells, and other cxcr4-expressing cells such as administered mscs, to the kidney, where they aid in its protection and repair. similar responses have been observed subsequent to the injury of other solid organs such as the heart, liver, and brain. |
its universal incidence is reckoned to be 260 million people every year with an increase rate of 6% (1). these people will need hemodialysis (hd), peritoneal dialysis or kidney transplant to continue their lives (2). there were 12500 patients under hemodialysis in iran in 2006 (3). in spite of drastic advances in medical technology, the mortality rate of these patients has shown no meaningful decrease during the past 20 years and has been stabilized at 18% annually (4). the principle of hemodialysis involves the clearance of solutes across a semi - permeable membrane through diffusion and ultrafiltration mechanisms. the utilized membranes are classified into two main groups : low - flux, which is based on using dialyzers with low permeability for water (5) ; and high - flux, non - celluloses membrane with increased permeability, which is capable of removing moderate - sized molecules between 10000 to 15000 dalton, including many of the inflammatory proteins, microglobulin and lipoproteins (6). some studies have suggested that highflux membrane improves the removal of moderate - sized molecules such as lipid profiles or homocysteine (7, 8) while other studies have concluded it has no significant impact on these molecules such as homocysteine levels (9). because of incomplete removal of uremic toxins, 90% of hemodialysis patients reveal symptoms of pathologic amyloidosis caused by microglobulin after five years of dialysis (10). one of the most influential reasons to continue a certain treatment is the degree of its impact on the targeted disease ; while, the inadequacy of dialysis has been recognized as a major reason for the mortality rate of the hemodialysis patients (11). if the efficiency of hemodialysis is not adequate, the level of blood toxins and the clinical symptoms of the patient are not controlled, which lead to either an increase in the duration of each dialysis session or the frequency of necessary dialysis per week. this will consequently increase the mortality and morbidity of the patients and the cost of dialysis (12, 13). there are a number of factors, which influence the adequacy of the dialysis, such as the time of dialysis, the dialysate flow rate, the surface of dialyzer, and the blood flow rate. however, the employments of many of these factors are considered impossible, because they are neither beneficial, nor feasible. for example, increasing the duration of the dialysis over four hours is beyond the patient 's tolerance and will increase the cost of dialysis to a large extent. furthermore, increasing the dialysate flow rate do not have a significant effect on the adequacy of the dialysis (14). with regard to the available capacity of the dialysis centers across the country and the increasing need for further facilities, it is clinically wise to limit the amount and time of dialysis to an optimal level. therefore, reaching to certain level of dialysis adequacy is crucial, and it has led researchers to conduct some projects to obtain this adequacy. in spite of the emphasis on the employment of high - flux permeable membrane in the available research literature (15) and according to the crucial importance of using these membranes and the emphasis of the national kidney association of iran on the necessity of these permeable membranes (16), there are still many wards utilizing low - flux permeable membranes (17). the contradictory results of the current published data prompted us to design this clinical trial study. this study was performed to compare the efficiency of low - flux versus high - flux membranes in patients who referred to dialysis center of the shahid beheshti hospital in hamadan city. sample size was calculated based on a previous study in which house. (18) have studied the effect of highflux vs. lowflux hemodialysis on homocysteine and lipids. then 21 patients was estimated to be needed in each group based on the following parameters (=0.20, =0.05, 1 (variance of homocysteine in highflux group) = 1.925, 2 (variance of homocysteine in lowflux group) = 1.675, 1 - 2 (mean predialysis homocysteine in highflux group minus mean predialysis homocysteine in lowflux group) = 2 (18). however, 40 patients were selected for more accuracy. from 114 patients who assessed for eligibility, 74 patients excluded because of not having the inclusion criteria (n = 32), occurrence of exclusion criteria (n = 22) or declined to participate (n = 20). inclusion criteria were as follows : participants ' age between18 to 60 years, dialysis treatment for at least 6 months with conventional hd, using fistula or graft as vascular access, at least twice 4-hour dialysis session per week, consciousness for participation in study, hemoglobin 9 mg / dl, interdialytic weight gain less than 3 kg, not having any neoplasia. exclusion criteria were as follows : hypotension (systolic bp 90 mm hg), acute clinical conditions (myocardial infarction, congestive heart failure, stroke, recent surgery, or severe sepsis) during the study, any vascular access dysfunction, discontinuation of dialysis less than 4 hours, reduction in patient s consciousness, patient s restlessness and agitation, severe nausea and vomiting during dialysis, starting other treatments. during the research, the dialyzer was fixed and 500 ml / min bicarbonate solution was used as dialysate. the amount of food and liquid taken for each participant throughout the study were the same and controlled. in the first stage, all participants underwent dialysis two sessions per week in accordance with the guidelines of adequacy and efficiency of dialysis (16) by utilizing low - flux membrane (fr5 made by the soha co., iran) ; then, they attended another two sessions of dialysis in the following week by utilizing the highflux membrane (fr50, made by soha co., iran). the members of the second group were treated similarly except that they attended the dialysis with the utilization of high - flux followed by the low - flux membrane based on the guidelines of the adequacy and efficiency of dialysis provided (19). blood samples were taken in the second dialysis session of each stage ; the first sample was taken in the onset of dialysis from the arterial line (before dialysis sample) and the second sample was taken from the arterial line at the end of the dialysis session after 2 minutes and decreasing the blood flow rate to 80 ml / min (after dialysis sample). the samples were labeled and sent to the laboratory to determine the level of bun. the lab process and the technician in - charge for all samples were the same. the urea reduction ratio (urr) and the kt / v were utilized to investigate the adequacy of dialysis. in kt / v measure, k stands for the dialyzer clearance (ml / min), t stands for the time of dialysis (min), and v, the bottom part of the fraction, is the distribution of urea, which is equal to total body water (19). to determine the adequacy of the hemodialysis based on the kt / v, the daugirdas formula was used (spkt / v = -ln(r- 0.008t) + (4 + 3.5r) uf). in this formula, ln stands for the natural logarithm, r is equal to the ratio of blood urea nitrogen pre - dialysis and post - dialysis. uf is the ultrafiltration per liter and t is the time of dialysis per hour. urr is estimated based on this formula : urr = (urea pre - dialysis - urea post - dialysis)/urea pre - dialysis x100 (20 - 22). data were collected by a questionnaire for demographic data (age, gender, interdialytic weight gain, kind of vascular access, dialysis history, etc.) and a checklist to record the bun before and after dialysis, dialysis session time, blood flow rate, dialysate flow rate, and the ultrafiltration rate. the research council and the human research ethics committee of hamadan university of medical sciences approved the study protocol and its ethical considerations (d / p/16/35/9/794). to begin the study, the researcher explained the study process to the patients, and they signed a written informed consent. the patients were also assured about data confidentiality, safeness of the study, and their right of not to participate. we also observed all ethical issues in accordance with the last version of the helsinki declaration. data were analyzed using spss version 13 and descriptive statistics (frequency, percentage mean and standard deviation) and inferential statistics (t test for comparison of kt / v, urr and bun in high - flux and low - flux membranes and paired - t test for comparison of pre - dialysis and post - dialysis bun in high - flux and low - flux membranes). the dialysis adequacy was classified into three groups : inadequate dialysis (kt / v 0.89, or urr 0.60) ; relatively adequate dialysis (kt / v = 0.90 to 1.29 or urr = 0.61 to 0.70) ; and the totally adequate dialysis (kt / v 1.3, or urr 0.70). in the first stage, all participants underwent dialysis two sessions per week in accordance with the guidelines of adequacy and efficiency of dialysis (16) by utilizing low - flux membrane (fr5 made by the soha co., iran) ; then, they attended another two sessions of dialysis in the following week by utilizing the highflux membrane (fr50, made by soha co., iran). the members of the second group were treated similarly except that they attended the dialysis with the utilization of high - flux followed by the low - flux membrane based on the guidelines of the adequacy and efficiency of dialysis provided (19). blood samples were taken in the second dialysis session of each stage ; the first sample was taken in the onset of dialysis from the arterial line (before dialysis sample) and the second sample was taken from the arterial line at the end of the dialysis session after 2 minutes and decreasing the blood flow rate to 80 ml / min (after dialysis sample). the samples were labeled and sent to the laboratory to determine the level of bun. the lab process and the technician in - charge for all samples were the same. the urea reduction ratio (urr) and the kt / v were utilized to investigate the adequacy of dialysis. in kt / v measure, k stands for the dialyzer clearance (ml / min), t stands for the time of dialysis (min), and v, the bottom part of the fraction, is the distribution of urea, which is equal to total body water (19). to determine the adequacy of the hemodialysis based on the kt / v, the daugirdas formula was used (spkt / v = -ln(r- 0.008t) + (4 + 3.5r) uf). in this formula, ln stands for the natural logarithm, r is equal to the ratio of blood urea nitrogen pre - dialysis and post - dialysis. uf is the ultrafiltration per liter and t is the time of dialysis per hour. urr is estimated based on this formula : urr = (urea pre - dialysis - urea post - dialysis)/urea pre - dialysis x100 (20 - 22). data were collected by a questionnaire for demographic data (age, gender, interdialytic weight gain, kind of vascular access, dialysis history, etc.) and a checklist to record the bun before and after dialysis, dialysis session time, blood flow rate, dialysate flow rate, and the ultrafiltration rate. the research council and the human research ethics committee of hamadan university of medical sciences approved the study protocol and its ethical considerations (d / p/16/35/9/794). to begin the study, the researcher explained the study process to the patients, and they signed a written informed consent. the patients were also assured about data confidentiality, safeness of the study, and their right of not to participate. we also observed all ethical issues in accordance with the last version of the helsinki declaration. data were analyzed using spss version 13 and descriptive statistics (frequency, percentage mean and standard deviation) and inferential statistics (t test for comparison of kt / v, urr and bun in high - flux and low - flux membranes and paired - t test for comparison of pre - dialysis and post - dialysis bun in high - flux and low - flux membranes). the dialysis adequacy was classified into three groups : inadequate dialysis (kt / v 0.89, or urr 0.60) ; relatively adequate dialysis (kt / v = 0.90 to 1.29 or urr = 0.61 to 0.70) ; and the totally adequate dialysis (kt / v 1.3, or urr 0.70). most of participants (67.5%) were male with the mean of 47.56 10.79 years old, 87.5% of the participants used fistula for dialysis. eighty - five percent of the participants were living in urban areas, and forty percent had dialysis history for a period of three to four years. the blood flow rate was between 220 - 300 ml / min with a mean of 271 18.91 ml / min (table 1). the mean blood urea nitrogen (bun) before low - flux dialysis was 93.90 20.51 mg / dl, which reduced at the end of the dialysis to 36.87 13.16 mg / dl. furthermore, the mean of the bun before high - flux dialysis was 95.32 19.69 mg / dl, which reduced to 32.35 8.83 mg / dl at the end of dialysis, which was statistically significant (p 1.2). furthermore, the mean of urr was 47.84% and 90% of participants (45 patients) had urr index less than the minimum standard level (65%). because of the unacceptable quality of dialysis in most patients, they recommended periodical evaluation of the quality of dialysis as well as conducting comprehensive studies in order to determine viable methods to improve the adequacy of dialysis (29). malekmakan. found that only 32.1% of renal failure patients achieve the optimal kt / v level and have recommended using advanced dialyzers (30). in our research, however, the low - flux group revealed % 35 of adequate dialysis of kt / v > 1.2 and in the high - flux group over 60% of patients had kt / v > 1.2. these findings confirm the crucial importance of high - flux membranes in achieving the requirement of optimal dialysis. other iranian research findings revealed inadequacy of dialysis in most centers across the country, such as the study of raiesifar. the mean of kt / v was 0.9 0.21 and the inadequacy of dialysis was 97.8 % (31). taziki and kashi reported the inadequacy of dialysis in sari, iran, by using low - flux membranes and 58% of patients had kt / v less than 1 (32). another study in birjand, iran, with participation of 50 patients showed that 70% of the patients had kt / v 0.9 to 1.2, and 66% of patients had urr between 61% to 70% (30). in our research, in low - flux membrane the mean of kt / v was 1.1 0.32 and the ratio of inadequacy was 20%, also another 20% of the participants had kt / v less than 1, and 55% of them showed urr more than 60%. for the high - flux membrane, the mean of kt / v was 1.27 0.28, and the inadequacy was seen in 10% of patients, also % 17.5 of patients had kt / v less than 1, and 72% of patients had urr 60%. the mean of kt / v in studies conducted in the usa, and japan was 1.30 0.29 and 1.30 0.2, respectively (31, 32). other studies, revealed that 60% to 80% of patients had kt / v equal to or more than 1.2 (33). these values were higher than the values in our country as presented in the literature, showing the inefficient strategies in iranian dialysis centers. one of the reasons which significantly contributes to the observed efficiency and adequacy of dialysis in developed countries, is the more use of high - flux membranes ; while, in our country mostly used low - flux membranes in dialysis centers, and the patients do not ask for them due to their unfamiliarity or carelessness. among the other reasons of the low quality of dialysis in iran compared to the developed countries, are the vascular access problems (recirculation), the duration of the dialysis session, and the lack of sufficient number of dialyzers (30), the blood flow rate, the blood sampling method for determining the bun, insufficient surface of the membranes and the type of membranes (12). suitable setting and priming of membranes and hemodialysis set and removing the air from them as well as using high - flux membranes or low - flux membranes (with suitable size) could increase the dialysis adequacy. moreover, due to the characteristics of these membranes in removing the middle size and large size molecules such as microglobulin, using high - flux membranes thus allows improved removal of a wider spectrum of uremic toxins which may improve the quality of life of patients on chronic hemodialysis. according to the result of this study, using these high - flux membranes in other dialysis centers it is recommended that further studies on comparison of high - flux and low - flux membranes be performed in longer periods.(34 - 36) | background : inadequacy of dialysis is one of the main causes of death in hemodialysis patients. some studies have suggested that highflux membrane improves the removal of moderate - sized molecules while other studies indicate no significant effect on them.objectives:this study aimed to investigate the dialysis efficacy of low - flux versus high - flux membranes in hemodialysis patients.patients and methods : forty hemodialysis patients participated in this cross - over clinical trial. two sessions of low - flux and high - flux membrane dialysis were performed consecutively, in the first and second stage of the trial. in both stages, blood samples before and after the dialysis were taken and sent to the laboratory for assessment. blood urea nitrogen (bun), kt / v and the urea reduction ratio (urr) indexes were used to determine dialysis efficacy. data were analyzed using t test and paired t test.results:the mean kt / v was 1.27 0.28 in high - flux and 1.10 0.32 in low - flux membrane which, these differences were statistically significant (p = 0.017). the mean of urr was 0.65 0.09 in high - flux and 0.61 0.14 in low - flux membrane, which these differences were not statistically significant (p = 0.221).conclusions : the high - flux membrane had better dialysis adequacy, so we suggest using high - flux membrane in hemodialysis centers. |
as explained in the vignette, the abstract is an important part of the publication of a randomised, controlled trial (rct). in 2008, the consort group published a statement on reporting rcts in journal and conference abstracts, see table 1.table 1items to include when reporting of randomised trials in journal or conference abstracts itemdescriptiontitleidentification of the study as randomisedauthorscontact details for the corresponding authortrial designdescription of the trial design (e.g. parallel, cluster, non - inferiority)methods participantseligibility criteria for participants and the settings in which the data were collected interventionsinterventions intended for each group objectivespecific objective or hypothesis outcomeclearly defined primary outcome for this report randomisationhow participants were allocated to interventions blinding (masking)whether or not participants, care givers and those assessing the outcomes were blinded to group assignmentresults numbers randomisednumber of participants randomised to each group recruitmenttrial status numbers analysednumber of participants analysed in each group outcomefor the primary outcome, a result for each group and the estimated effect size and its precisionharmsimportant adverse events or side effectsconclusionsgeneral interpretation of the resultstrial registrationregistration number and name of trial registerfundingsource of fundingfor conference abstracts items to include when reporting of randomised trials in journal or conference abstracts for conference abstracts i therefore wanted to investigate whether this consort statement has had an impact on the literature on rcts in migraine and headache treatment. the years 2009 and 2010 were chosen as the appropriate years to evaluate this question. the consort statement for abstract is very demanding (see table 1) and i therefore chose to review only the most important efficacy items (in italics in table 1). the three headache journals, cephalalgia, headache and journal of headache and pain, were hand - searched twice for rcts in 2009 and 2010. in addition, pubmed was searched for rcts in other journals in 2009 and 2010 with the search terms : migraine, treatment and clinical trial as well as headache, treatment and clinical trial. the abstracts were rated for the presence of numbers in each treatment group or total number of patients, percentage response or absolute values for response, p values, absolute effect size (percentage responding in active treatment group minus percentage responding in control group) and 95% confidence intervals (95% ci) for absolute effect size (see tables 2, 3 and 4).table 2presentation in abstracts concerning efficacy in double - blind, randomised, controlled trials (rcts) in cephalalgia in 2009 and 2010referencesnumbers in each group (total number of patients)% response or absolute values (av)p valueseffect size95% ci for effect size2010 37/37/38 (1677)+ 42 co+ 343/347++ 88/42++ (117)++ 30 coav+ 347/358av+ 341/338av+ (27)2009 (859)+ (410)av+ (95)av+ 1135/846++ 58/65av+++ 40 coav+co crossoverpooled results of 2 rctstable 3presentation in abstracts concerning efficacy in double - blind, rcts in headache in 2009 and 2010referencesnumbers in each group (total number of patients)% response or absolute values (av)p valueseffect size95% ci for effect size2010 177/169++ 688/696av+ 99/96++ (52)2009 19/17++ (179)av+ 153/153++ 121 co++++ (283)++ (180)av+ (69)++ (323)++ (60)++co crossovertable 4presentation in abstracts concerning efficacy in double - blind, rcts in other (non - headache) journals in 2009 and 2010referencesnumbers in each group (total number of patients)% response or absolute values (av)p valueseffect size95% ci for effect size2010 133 coav+ 46 coav+++ 53/55/55/65av++ (196)av++ 82/82++++ (66)av++ (265)++2009 117/381/371/365+ 29/49av+ (127)av+ 31 co+ 311/310+ 172/159av+++ + 35/35/33+ 50/50co crossovermean and 95% ci for changes from baseline presentation in abstracts concerning efficacy in double - blind, randomised, controlled trials (rcts) in cephalalgia in 2009 and 2010 pooled results of 2 rcts presentation in abstracts concerning efficacy in double - blind, rcts in headache in 2009 and 2010 presentation in abstracts concerning efficacy in double - blind, rcts in other (non - headache) journals in 2009 and 2010 mean and 95% ci for changes from baseline in cephalalgia, 17 abstracts on rcts (table 2) [218 ] and in headache 13 abstracts on rcts were found (table 3) [1931 ]. in the journal of headache and pain, only one rct was found (an rct on deep brain stimulation in 11 patients with chronic cluster headache). in the other (non - headache) journals, i found 16 abstracts of rcts on headache and migraine [3247 ]. the number of patients in each rct varied from 27 to 1,981 with a median of 180 subjects. percentage response or absolute values for response were reported in 35 of 46 abstracts (tables 2, 3, 4) and p values were reported in 33 of 43 abstracts (tables 2, 3, 4). in contrast, effect size and its precision (95% ci) were only reported in the abstract of one rct in cephalalgia and headache. in other (non - headache) journals, effect size with 95% ci was presented in five abstracts [3437, 44 ] (table 4). the number of patients treated in each rct varied from relatively small crossover trials (minimum, n = 27 trials was, however, a parallel - group trial) to very large parallel - group trials (maximum, n = 1981). the median was 180 patients, most likely a reasonable number. in eight papers on rcts, there was no mention in the abstract of response either in percentages or in absolute values [24, 12, 22, 40, 46, 48 ]. one was a very large rct in which 1,677 patients were treated for > 1 attack and 1,263 were treated for all 4 attacks. based on attack i data, telcagepant 140 and 280 mg were significantly (p < 0.001) more effective than placebo for 2-h pain freedom and six other efficacy measures. in the other rct (n = 1,234) with different doses of telcagepant and placebo, only p values (p these abstracts would not have been made much longer by reporting the responses, e.g. 24 and 25% 2-h pain freedom for telcagepant versus 10 and 11% pain freedom for placebo [3, 39 ]. p values are traditionally used in reporting the results of rcts and were used in most abstracts. these p values can, however, be very small if in a very large rct there is a small but clinically insignificant difference between two treatments. there is generally little reporting of effect size and its precision, which was only presented in seven abstracts [17, 26, 34, 3638, 45 ]. effect size (active minus control) in percentages or absolute value, with 95% confidence intervals (ci), is the clinically relevant measure. it is also useful in negative rcts where 95% ci (and not p values) gives the precision of the comparability. reporting of outcome measures in the abstracts of the 43 papers is thus not optimal when compared with the consort statement for reporting in abstracts. in the latest consort statement from 2010, for efficacy measures with binary outcomes it is recommended that both absolute and relative effect sizes should be presented with an estimate of the precision such as 95% ci [48, 49 ]. the relative risk (active / placebo) is 1.5 (25%/10%) for pain freedom at 2 h for telcagepant 280 mg and the odds ratio is 3.0. one should be content with reporting effect size and its precision in abstracts of rcts on migraine and headache. for example, the effect size for telcagepant 280 mg for pain freedom at 2 h should be reported as 15 with 95% ci : 1019%. in conclusion, the consort statement from 2008 on reporting rct in abstracts has only had a minor impact on the headache literature in 2009 and 2010. | a consort statement on the content of abstracts of randomised, controlled trials (rcts) was published in 2008. i therefore reviewed the abstracts from 2009 to 2010 published on rcts in cephalalgia, headache and other (non - headache) journals. the following items were reviewed : number of patients, reporting of response either in percentages or absolute values, the use of p values, and effect size with its precision. the latter was recommended in the consort statement. a total of 46 abstracts were reviewed and effect size with 95% confidence intervals was only reported in seven abstracts. the influence of the consort statement on reporting in abstracts has so far only had a limited influence on the headache literature. |
root canal preparation is known as one of the most important steps in root canal therapy. this step comprises pulp tissue removal, cleaning, shaping, and decontamination of root canals with endodontic instruments and irrigating solutions. a primary reason for unsuccessful endodontic treatment is believed to be failure to eliminate potential irritants such as microorganisms, microbial by - products, and pulpal tissues from the root canal system. absolute chemo - mechanical preparation of the root canal system is a requisite for a successful endodontic treatment. even when endodontic instruments do not overpass the apical foramen, nearly all preparation techniques tend to extrude dentinal flakes, pulpal tissue residues, necrotic tissues, microorganisms and irrigants through the apical foramen into the periapical region [611 ]. a relation has been shown between apically extruded materials and periradicular inflammation and development of post - operative pain and flare - ups [1214 ]. studies performed on the context of apical extrusion revealed that techniques using up and down strokes extrude more debris apically than techniques which use instruments in a rotational manner ; hence motor - driven instruments are associated with rather less extrusion than custom hand filing methods. numerous studies reported the use of rotary niti instruments to be effective in reducing post - endodontic pain compared to hand instruments [1722 ]. another study found no significant difference in frequency of post - endodontic pain between patients treated with rotary and hand instruments. another study found the variability in post - endodontic pain to be related to the instrumentation techniques. many researchers reported no significant difference in post - endodontic pain following single or multiple visits [2530 ]. some studies reported higher frequency of post - endodontic pain following multiple visits, while some others reported higher frequency of pain following single - visit treatments [3336 ]. the cross - section of mtwo files is an italic s with two cutting edges and a non - cutting tip. also, mtwo is designed with minimum radial contact plus large and deep flutes, which permit continuous upward shifting of dentin chips. various studies have been done to evaluate pain after root canal preparation with a diversity of instruments and techniques [1724 ] ; however, seemingly few have examined mtwo instruments in this regard. the purpose of this study was to compare single visit post - endodontic pain using mtwo (niti) rotary and hand k - file instruments. this randomized controlled clinical trial was registered at the iranian registry of clinical trials (irct) with registration number irct2014031216973n1. ethical committee approved the study (grant#305121), and written informed consent was obtained from all patients who referred to the department of endodontics, faculty of dentistry, babol university of medical sciences and participated in this study. the inclusion criteria were teeth with a single root canal requiring root canal therapy because of symptomatic irreversible pulpitis with moderate to severe pain (vas 4 - 10). the exclusion criteria were teeth with acute apical periodontitis, teeth with necrotic pulp and patients presenting with abscess or cellulitis. in addition, patients who took medications up to six hours prior to the treatment were excluded from the study. sixty teeth in 53 patients between 17 to 52 years were selected and randomly (by picking envelopes containing letters and numbers) assigned into two groups, each containing 30 teeth. in group a, the root canals were prepared with mtwo rotary files (vdw, munich, germany). in group b, the root canals were prepared with hand k - files (mani, tochigi, japan) using manual step - back method. initially, 1.5 ml of 2% lidocaine with 1:80,000 epinephrine (darou pakhsh, tehran, iran) was used as local anesthetic agent. alternately, 3% mepivacaine (inibsa, barcelona, spain) was used in cases for whom, the use of vasoconstrictor was contraindicated. the estimated working length was measured using iso k#15 file on the preoperative periapical radiograph. group a (mtwo rotary group) : initially, a gliding path was created to the canal using # 15 k - file and the working length was confirmed by taking a periapical radiograph.afterwards, mtwo files (vdw, munich, germany) were used with the single length technique [37,38, 39 ] in the following sequence : 15/.05, 20/.06, 25/.06, 30/.05, 35/.04, 40/.04, and 25/.07. the single length technique was performed so that each instrument was gradually reached to working length using brushing movement and without pressure. as soon as the working length was reached, the instrument was changed with the next one in sequence. the rotary files were mounted on and handled by endo - mate dt micromotor (nsk, tochigi, japan) with speed and torque control and auto - reverse function. when the preset torque level was exceeded, the auto - reverse function was activated automatically in order to keep instrument from locking. subsequently, the gates - glidden drills (mani, tochigi, japan) were used in a step - back manner with the following sequence : # 2, # 3 and # 4 for coronal flaring. group b (hand k - file group) : the root canals were cleaned to a master apical file size # 40 and the subsequent files were used in step - back manner, so that the first file right after the master apical file was used 0.51 mm short of the working length, and the following files were utilized each 0.51 mm short of the previous. meanwhile, recapitalization was achieved by taking the master apical file to the working length between the shaping files. normal saline (0.9% sodium chloride, darou pakhsh, tehran, iran) was used for irrigation in both groups. finally, the root canals were dried with paper cones (gapadent, tian jin, china) and obturated with standardized gutta - percha cones (gapadent, tian jin, china) and ah26 sealer (dentsply detrey, konstanz, germany) with lateral condensation technique. after the treatment, the patients were instructed to quantify pain intensity at four, eight, 12 and 24 hours on a vas scale, and return after 24 hours for assessment. ibuprofen was prescribed for pain relief every four - six hours (to a maximum dose of 3200 mg / day). as a substitute, those who suffered from gastrointestinal conditions were advised to take acetaminophen (to a maximum dose of 4000 mg / day). the patients in this study were not aware of the type of treatment method they received ; thus this was a single - blind study. the acquired data from the two groups were analyzed using spss 17 software applying chi - square test to compare pain incidence, mann - whitney u test to compare pain incidence with respect to severity, and student s t - test to compare the mean pain intensity. out of 72 participants who received root canal treatment, nine patients did not return for assessment, six patients left incomplete data, and four were excluded for some other reasons. eventually, the data were collected from 60 cases. the mean (sd) age was 32.510.6 years for the rotary group and 30.810.1 years for the hand k - file group. a total of 18 patients did not have pain after the treatment ; out of which, 17 were from the rotary group (56.7%), and one was from the hand k - file group (3.3%). the difference in the incidence of postoperative pain between the two groups was significant (p<0.001 ; table 2, fig. 1). the pain scores (vas) reported by patients (values are presented as mean sd) acquired by mann - whitney u test p0 : preoperative pain ; p4 : pain after 4 hours ; p8 : pain after 8 hours ; p12 : pain after 12 hours ; p24 : pain after 24 hours incidence of post - endodontic pain within 24 hours, and the frequency (%) of post - treatment analgesic use acquired by mann - whitney u test ; experiencing pain at least at one assessment time point ; the mean pain intensity based on vas scores (p0 : preoperative pain ; p4 : pain after 4 hours ; p8 : pain after 8 hours ; p12 : pain after 12 hours ; p24 : pain after 24 hours ; : p<0.05 ; : p<0.01 ; : p<0.001) our results showed that root canal preparation with niti rotary instruments was associated with less postoperative pain as compared to hand instruments. it is remarkable that only four patients in the rotary group felt the need to take analgesics after the treatment (13.3%), as opposed to 17 in the hand k - file group (56.7%) ; nevertheless, the pain incidence in the hand k - file group was higher. the results of our study were similar to the findings of al - jabreen. in his study on maxillary central incisors, he used three different instrumentation techniques to assess postoperative pain : stainless steel k - files with step - back technique, profile 0.0429% series and profile gt system both using crown - down pressure - less technique. the incidence of postoperative pain within the first 48 hours in the step - back group was significantly higher compared to that in profile 0.0429 and profile gt groups, without any significant difference between profile 0.0429 and gt groups. they used profile ni - ti rotary and hand kflexofile to examine the effect of using niti rotary instruments on postoperative pain. the incidence of postoperative pain in the hand group was higher and this difference was statistically significant ; however their study was done on molar teeth with pulpal and/or periapical involvement, as opposed to our study on single - canal teeth with pulpal involvement only. they performed a study to compare postoperative pain after vital pulp root canal preparation with k3 nickel - titanium rotary instruments and hand instruments. what they found was high incidence of postoperative pain in stainless steel hand k - file group (55.84%), against 29.76% in k3 rotary group.. failed to find any significant difference in pain incidence between patients treated with protaper rotary and those treated with manual step - back technique. however, such contradictory findings could be because of including patients with merely moderate pain (vas 4 - 6) as opposed to our study including patients with moderate to severe pain (vas 4 - 10) ; as the greater the preoperative pain, the greater the postoperative pain [31,4043 ]. moreover, they assessed pain after 48 hours in one single vas. nonetheless, in the current study, it was notable that the mean preoperative pain intensity in hand group was relatively higher than that in rotary group (fig. 1), and this could be responsible for higher levels of postoperative pain and intensity in the hand group to some extent, according to the concept mentioned above. we limited our postoperative pain assessment intervals to 24 hours because the highest degree of pain is often experienced in the first 24 hours, and after 48 hours the level of pain significantly subsides. we excluded the teeth with necrotic pulp since they usually demand more aggressive instrumentation and cleaning, which conceivably induce more pain. we excluded the teeth with acute apical periodontitis as well, since tenderness on percussion deceives patient s perception of post - endodontic pain and misleads the results. all instrumentation techniques are accompanied by extrusion of root canal contents into the periapical region. studies revealed that rotary systems could reduce the amount of extrusion of debris, since the flutes of these instruments tend to pull debris back towards the orifice [4651 ]. oppositely in the manual step - back method, the file acts as a piston in the apical one - third tending to plunge debris through the apical foramen, leaving not enough space to expel it coronally ; thus, it is more likely to cause inflammation and pain. as far as the limitations of this study permitted, we tried to choose the most suitable inclusion and exclusion criteria, and eliminate the confounding factors as much as possible. thus, we believe that minimizing the apical extrusion of debris should be a fundamental goal in endodontic treatment, leading to less complications such as pain. hence, we recommend using instruments and techniques, which result in less extrusion. use of mtwo (niti) rotary system for preparing root canals caused less post - endodontic pain as compared to hand k - files ; however, further research is needed in this respect. | objectives : pain is an unpleasant outcome of endodontic treatment that can be unbearable to patients. instrumentation techniques may affect the frequency and intensity of post - endodontic pain. this study aimed to compare single visit post endodontic pain using mtwo (niti) rotary and hand k - file instruments.materials and methods : in this randomized controlled trial, 60 teeth with symptomatic irreversible pulpitis in 53 patients were selected and randomly assigned into two groups of 30 teeth. in group a, the root canals were prepared with mtwo (niti) rotary instruments. in group b, the root canals were prepared with hand k - file instruments. pain assessment was implemented using visual analog scale (vas) at four, eight, 12 and 24 hours after treatment. the acquired data were analyzed using chi - square, mann - whitney u and student s t - test (p<0.05).results : patients treated with rotary instruments experienced significantly less post - endodontic pain than those treated with hand instruments (p<0.001).conclusions : the use of mtwo (niti) rotary instruments in root canal preparation contributed to lower incidence of postoperative pain than hand k - files. |
in radiotherapy, since its inception, the objective has always been to deliver maximum dose to the target volume homogeneously, while avoiding dose to the normal surrounding structures. progress made in last few decades in medical imaging and dosimetric software has allowed us to achieve this objective by visualization of the spatial dose distribution within the target volumes. as a result of these developments, various treatment plans can now be easily and rapidly obtained for the same patient. the dose distribution in these plans can then be visualized in the form of dose - volume histograms (dvhs) and isodose lines, to define parameters like maximum dose (dmax), minimum dose (dmin), mean dose (dmean) and modal dose delivered to each volume of interest. unfortunately, the large volume of data contained in these histograms, lines and curves may complicate the problem rather than simplifying it. this makes it desirable to have a tool that can integrate this data in a simpler way to quantitatively assess the quality of the treatment plan options. by using such a tool we can make a choice in favor of a plan which provides maximum tumor coverage homogeneously and protects healthy tissues at the same time. the homogeneity index (hi) and the conformity index (ci) are two such tools for treatment plan analysis in conformal radiotherapy. the concept of hi was developed as an extension of section - by - section dosimetric analysis of treatment plans. in 1993, the radiation therapy oncology group (rtog) proposed guidelines for routine evaluation of stereotactic radiotherapy (srt) plans based on several parameters and hi was described as, hirtog = imax / ri, where, imax = maximum isodose in the target, and ri = reference isodose. if the hi was 2, treatment was considered to comply with the protocol, if this index was between 2 to 2.5, it was considered as minor violation, but if the index exceeded 2.5, the violation of the protocol was considered to be major, but might nevertheless considered acceptable. certain other definitions were later described, for example hi = d5/d95 ; where d5 = minimum dose in 5% of the planning target volume (ptv), indicating the maximum dose, and d95 = minimum dose in 95% of the ptv, indicating the minimum dose. the lower (closer to one) the index, the better is the dose homogeneity. a more descriptive formula is hi = d2-d98/dp100 ; where d2 = minimum dose to 2% of the target volume indicating the maximum dose, d98 = minimum dose to the 98% of the target volume, indicating the minimum dose and dp = prescribed dose. the reason for choosing d98 and d2, to represent the minimum and maximum dose, is that the calculation of true minimum or maximum dose is sensitive to the dose - calculation parameters, such as grid size and grid placement, and the high dose gradient is common in intensity modulated radio - therapy (imrt). this is the reason for choosing the maximum or minimum dose in a volume (d2, d98 etc.) rather than at a point. thus, in all definitions, hi basically indicates the ratio between the maximum and minimum dose in the target volume and the lower value indicates a more homogenous dose distribution within this volume. although, various definitions and formulae have been described in literature by various authors and organizations, none has been described as ideal or near ideal for calculating hi. moreover, less emphasis has been given to this parameter as compared to other treatment planning parameters. for example ; several combined indices for evaluating dose coverage, conformity, and dose gradient together have been suggested in the past but, none of these incorporate dose homogeneity as their component.[59 ] in addition, there is a paucity of data in literature regarding the factors that influence hi and the extent of such influence. a search for these factors can enhance our understanding regarding hi, which will allow us to better analyze the spatial dose distribution in our treatment plans. this in turn, will help us to find the means by which we can improve upon our treatment plans in future. in the present study, we reviewed various definitions / formulae of hi that have been described in literature.[14 ] we have used these formulae to calculate the hi of each patient and have tried to analyze the concordance level between values of hi obtained with each formula. we also analyzed the association between the hi and the prescribed dose, volume of the target, and location of target in the body. we performed a review of 99 patients treated for tumors located in different regions (locations) of the body. all the plans were created according to the clinical protocol followed in the department without any deviation. a ct (computed tomography) scan based radiographic volume data set was used for the definition of target volumes, organs at risk, and other structures of interest. the target volumes like gross tumor volume (gtv), clinical target volume (ctv) and ptv were defined as per their definitions in international commission on radiation units and measurements (icru) report 50. the treating radiation oncologist determined the target volumes and the treatment dose. in most cases, the planning was done with the following aims : minimum dose greater than or equal to 95% and the maximum dose less than or equal to 107% of the prescribed dose. this point dose was also the prescribed dose, resulting in a dose variation across the target from 95% to 107% of the prescription dose in most cases. the target volume selected for calculating the hi was ptv. in cases, where two or more target volumes were present, the primary / larger target volume was selected for analysis. the leaf edge to ptv distance (target margin) was kept 7 mm in all cases. the dvh of each plan was generated and it was evaluated by radiation oncologist along with medical physicist until an acceptable plan was obtained. formula a : d5/d95 ; where d5 = minimum dose in 5% of the target volume and d95 = minimum dose in 95% of the target volume. formula b : dmax / dmin ; where dmax and dmin represent the maximum and minimum point dose in the target volume, respectively. this formula has not been used in literature but it represents the classical definition of hi i.e., the ratio of maximum and minimum dose. it may not be technically correct to use this formula in practice as the doses may be very high or very low, if only point doses are considered. formula c : d1d98/dp 100 ; where d1 and d98 are the minimum dose in 1% and 98% of the target volume and dp is the prescribed dose. this is the formula used for calculating hi in our department which is a slight modification of the formula (d1 instead of d2 making it more sensitive) described by wu,. formula d : d5d95/dp100 ; where d5 and d95 are the minimum dose in 5% and 95% of the target volume and dp is the prescribed dose. formula e : dmax / dp ; where dmax is the maximum point dose and dp is the prescribed dose to the target volume i.e., the prescription isodose line chosen to cover the margin of the tumor. this was first described by rtog and the ideal value is 1. the patients were then divided into five groups, based on the prescribed dose for treatment, volume of target and the location of the target. the data was then analyzed to find out the relationship between hi and various parameters like prescribed dose, target volume and location of the target (ctv or ptv). the data was compiled using microsoft excel software and mean and median values of hi were calculated using statistical methods. pearsons chi - square test (spss vs 16.02) was used to test the association between the mean value of hi calculated by a particular formula and the prescribed dose, volume of target and the location of target in the body. the same test was performed separately for each group using one formula at a time. these patients received radiation for different diagnoses including head and neck carcinomas (46.4%), brain tumours (15.1%) and other malignancies. most of the patients i.e., 95.9% were treated with radical intent while others were treated for palliation. patient 's characteristics the minimum, maximum, mean and median value of hi was calculated using different formulae (a, b, c, d and e) for all the patients collectively, as shown in table 2. since it was a retrospective study, few of the values (d5 or d95) required for calculating hi thus, formulae a and d could be applied in 67 and 66 patients, respectively. values of hi calculated using different formulae analysis of minimum hi (best homogeneity) by all formulae revealed that, four (a, c, d, e) out of five formulae showed this value in the same patient. the patient was a case of carcinoma prostate (pelvis) with prescription dose of 2414 cgy (centigray) for a boost volume of 268.2 cc. the same trend however, could not be observed while analyzing the maximum value of hi in similar manner. the dose prescription varied from 1600 cgy to 7000 cgy. the overall mean and median prescribed dose was 4304 cgy and 4500 cgy, respectively. this large variation is explained by the fact that many patients were planned for imrt boost (following the initial treatment with conventional or 3-dimensional conformal radiotherapy) or palliative radiation requiring lesser dose. the patients were divided into five groups according to prescribed dose and mean hi for each group was calculated using formulae a to e. the resulting values of hi are shown in table 3. values of hi according to the dose prescribed for treatment according to dose, the lowest values of hi (best homogeneity) were seen in the group receiving highest dose i.e., 6000 cgy or more, by all the formulae. similarly, the highest values of hi were seen in first two groups i.e., 4000 cgy or less. this again shows the high level of agreement between various formulae and suggests a trend towards improved hi as the prescribed dose increases. when analysed statistically, significant difference in hi was found between the group using formulae a, c and d. the other formulae could not reach a significant value. when target volume data was analyzed, volume of the target varied from 84.2 cc to 2247 cc, with a mean and median value of 476.2 cc and 360 cc, respectively. the patients were divided into five groups according to the volume of targets and mean hi for each group was calculated using formula a to e [table 4 ]. values of hi according to the target volume when analyzed in detail, the lowest values (best homogeneity) of hi by all the formulae were seen in group having the lowest target volume i.e., 400 cc or less. on the other hand, the highest hi was seen in last two groups (1201 cc or more) by all formulae except formula b. this indicates a reasonable level of agreement or concordance between different formulae except formula b. this observation suggests a trend towards worsening of hi as the target volume increases. when this observation was statistically analysed, no statistically significant difference in hi was found between the groups with different target volume. when divided into groups depending on the location of the target in the body, the maximum number of patients (49.5%) were in the head and neck group (49.5%), followed by pelvis (17.1%) and others. the exact distribution of patients according to location and the mean values of hi using various formulae are shown in table 5. values of hi according to the location of the target the brain cases were found to have the highest value by all the formulae. in contrast, the best hi was observed in cases of abdomen (formula a, d) and thorax (b, c, e). the value of hi in head and neck and pelvic tumors were lying in - between. this shows the level of agreement among various formulae used for calculating hi. on statistical analysis, no statistically significant association was found between the location of the target in the body and the hi. hi is a good indicator of pattern of dose distribution in a target volume but it is still unclear that what are the factors influencing this index. in literature, few studies have been done correlating treatment parameters like target location or target volume with treatment plan indicators like hi or ci. knoos., in their evaluation of radiation conformity index (rci) found a better conformity for cases with pelvic tumors as compared to those of lung and advanced breast cancer cases. the same authors found improvement in the value of rci with increasing volume of ptv in breast cancer group but no such correlation between the rci and volume of ptv similarly, wu. found that esophageal and lung cancer cases were easier to conform than the nasopharyngeal and prostate cancers. collins., studied the relationship of variables like shape, size and complexity of skull base tumors with parameters like new ci, hi, and percentage tumor coverage using cyberknife radiosurgery system. they found that these radiosurgical parameters using cyberknife were independent of these tumor variables. in another study, to evaluate the association of conformity distance index with the size and shape of the target volume, wu. found that both volume and shape complexity can have significant effects on conformity values they found that conformity indices tend to have inferior values for smaller or more complex targets as compared to those with larger volumes or simpler shapes. all these studies were more focused on analyzing the conformity rather than homogeneity indices. in our analysis, we have focused ourselves to the hi and found a trend towards improved homogeneity as the target volume reduces and vice - verse. in our analysis, the reason for this trend is the fact that in cases with lower prescribed dose ; even a slight variation of dose across the target volume became significant in relation to the prescribed dose. an important point is the fact that formula b did not show any significant correlation with dose as this does not take into account the prescribed dose unlike formula c, d, and e which seems to be more sensitive to the change in the dose values. thus, the formulae which consider the prescribed dose seem to be more sensitive while calculating hi. in our study, best hi was found in thoracic and abdominal cases while inferior values were seen in brain tumors. these finding may be a reflection of various other factors rather than the mere location of the target. since, in our study, the prescribed dose was lower in case of brain lesions as in many cases it was the imrt boost, the inferior hi could be a reflection of the lower prescribed doses. the radiation oncologist, while evaluating a plan has to consider clinical, biologic, geometric, dosimetric and radiologic parameters at the same time, which is an essential but complex and time consuming process. as described above, hi can facilitate by providing an objective measure of the homogeneity, which is an important quality indicator for a plan. often, radiation oncologist is provided with various plans for the same patients and making a choice becomes difficult in the absence of objective parameters. hi along with other indicators can be used to choose the best plan among available options., the dosimetric studies of ellipsoid phantoms have shown that the cyberknife radiosurgical system has the best homogeneity within the target volume as compared to other radiosurgical devices like gamma knife, linear accelerator based stereotactic radiosurgery systems with multiple arcs or imrt. thus, it can serve as a guide for development of future strategies, technology and treatment protocols. treatment planning parameters like homogeneity index can be assessed much earlier to guide the quality of a plan. the multiple indices proposed in the literature, as well as the difficulty in their interpretation, raise a number of issues regarding the utility and credibility of this tool. moreover, there is limited information regarding possible correlation between clinical data and these theoretical parameters. theoretically, improvements in the homogeneity or conformity should improve local control and decrease complications but there are no studies till date which suggest that the plans with a better hi are associated with a better clinical outcome as compared to those plans with inferior hi. chang. in their study suggested that improved dose homogeneity and a staged treatment regimen may improve hearing preservation in patients receiving srs for acoustic neuroma. at the present time, only geometric and dosimetric data is incorporated while calculating or analyzing these indices. since various radiobiological parameters like tumor control probability (tcp) and normal tissue complication probability (ntcp) and equivalent uniform dose (eud) have been incorporated in the treatment planning systems, there is a need to incorporate them in defining hi. recent studies have suggested that somewhat greater dose heterogeneity in target volumes is expected by using biological cost functions for treatment planning. integration of these probabilistic data in calculation of quality indicators will allow us in selection of a treatment plan on the basis of radiobiologic characteristics of the target tissues rather than merely the physical doses and volumes. planning indicators like hi depend upon the particular formula which is being used for its calculation. for example, when comparing different treatment plans or different irradiation techniques, it is important to use the same formula. it is emphasized to clearly specify the target volume, to which the homogeneity index corresponds, because depending on the choice of tumor volume (ctv or ptv) and the margins used, the results can vary considerably, leading to erroneous conclusions. in our study, we have considered ptv in all the cases. it is not always justified to try for achieving the ideal value of hi at any cost. tumors containing heterogeneous group of cell population may benefit by delivering higher dose to the areas where there is increased density of malignant cells or there are pockets containing resistant cells. non - homogenous dose with higher central dose may improve local control in such cases ; however, this increased local control come with increased risk of complications. in certain cases, while we try to achieve homogeneity within the target volume at any cost, the system tends to dump the extra dose (hot spot) outside the target to improve the hi, which may prove detrimental. in cases such as srs, in which the target may lie in very close proximity to a critical organ or nerve (acoustic neuroma), very high hot spots outside the ptv potentially increases the risk of complication. the importance of dose homogeneity in biologically optimized imrt plans is controversial because if eventually the plan quality is judged by predicted biological outcome, it may no longer be required to keep the dose to target volumes as homogeneous as possible at all cost. moreover, dosimetric priorities are not the same for benign and malignant lesions. in benign lesions, heterogeneity may be acceptable in order to save the critical structure lying close to the target volume. thus, hi should not be seen as a tool which can replace the utility of checking the plan slice by slice for detecting and unreasonable high or low dose points. it should only be used once a satisfactory plan has been achieved on the basis of dose gradients and dose distribution along the treatment volumes and normal structures. a value of less than 2.0 (rtog / formula e) is felt to balance the risk of local failure and neurologic injury (rtog guidelines). although in our study no limitation was placed on the target volume or location of tumor in the close proximity to critical structures, a value of less than 2.0 was achieved in majority of the cases. the radiation oncologist, while evaluating a plan has to consider clinical, biologic, geometric, dosimetric and radiologic parameters at the same time, which is an essential but complex and time consuming process. as described above, hi can facilitate by providing an objective measure of the homogeneity, which is an important quality indicator for a plan. often, radiation oncologist is provided with various plans for the same patients and making a choice becomes difficult in the absence of objective parameters. hi along with other indicators can be used to choose the best plan among available options. for example, the dosimetric studies of ellipsoid phantoms have shown that the cyberknife radiosurgical system has the best homogeneity within the target volume as compared to other radiosurgical devices like gamma knife, linear accelerator based stereotactic radiosurgery systems with multiple arcs or imrt. thus, it can serve as a guide for development of future strategies, technology and treatment protocols. treatment planning parameters like homogeneity index can be assessed much earlier to guide the quality of a plan. the multiple indices proposed in the literature, as well as the difficulty in their interpretation, raise a number of issues regarding the utility and credibility of this tool. moreover, there is limited information regarding possible correlation between clinical data and these theoretical parameters. theoretically, improvements in the homogeneity or conformity should improve local control and decrease complications but there are no studies till date which suggest that the plans with a better hi are associated with a better clinical outcome as compared to those plans with inferior hi. chang. in their study suggested that improved dose homogeneity and a staged treatment regimen may improve hearing preservation in patients receiving srs for acoustic neuroma. at the present time, only geometric and dosimetric data is incorporated while calculating or analyzing these indices. since various radiobiological parameters like tumor control probability (tcp) and normal tissue complication probability (ntcp) and equivalent uniform dose (eud) have been incorporated in the treatment planning systems, there is a need to incorporate them in defining hi. recent studies have suggested that somewhat greater dose heterogeneity in target volumes is expected by using biological cost functions for treatment planning. integration of these probabilistic data in calculation of quality indicators will allow us in selection of a treatment plan on the basis of radiobiologic characteristics of the target tissues rather than merely the physical doses and volumes. planning indicators like hi depend upon the particular formula which is being used for its calculation. so, attention is required while calculating it. for example, when comparing different treatment plans or different irradiation techniques, it is important to use the same formula. it is emphasized to clearly specify the target volume, to which the homogeneity index corresponds, because depending on the choice of tumor volume (ctv or ptv) and the margins used, the results can vary considerably, leading to erroneous conclusions. in our study, we have considered ptv in all the cases. it is not always justified to try for achieving the ideal value of hi at any cost. tumors containing heterogeneous group of cell population may benefit by delivering higher dose to the areas where there is increased density of malignant cells or there are pockets containing resistant cells. non - homogenous dose with higher central dose may improve local control in such cases ; however, this increased local control come with increased risk of complications. in certain cases, while we try to achieve homogeneity within the target volume at any cost, the system tends to dump the extra dose (hot spot) outside the target to improve the hi, which may prove detrimental. in cases such as srs, in which the target may lie in very close proximity to a critical organ or nerve (acoustic neuroma), very high hot spots outside the ptv potentially increases the risk of complication. the importance of dose homogeneity in biologically optimized imrt plans is controversial because if eventually the plan quality is judged by predicted biological outcome, it may no longer be required to keep the dose to target volumes as homogeneous as possible at all cost. moreover, dosimetric priorities are not the same for benign and malignant lesions. in benign lesions, heterogeneity may be acceptable in order to save the critical structure lying close to the target volume. thus, hi should not be seen as a tool which can replace the utility of checking the plan slice by slice for detecting and unreasonable high or low dose points. it should only be used once a satisfactory plan has been achieved on the basis of dose gradients and dose distribution along the treatment volumes and normal structures. a value of less than 2.0 (rtog / formula e) is felt to balance the risk of local failure and neurologic injury (rtog guidelines). although in our study no limitation was placed on the target volume or location of tumor in the close proximity to critical structures, a value of less than 2.0 was achieved in majority of the cases. our analysis shows a reasonably high level of agreement or concordance between different formulae used for calculating the hi. this holds more significance for the formulae which accounts for the prescribed dose in denominator. it suggests that any of the described formulae may be used to calculate the hi for a particular case, provided the mentioned factors are kept in mind. statistically, although the study suggested that the hi index is independent of the location and the treatment volume, the trend towards an improved hi in cases with higher prescribed dose warrants further studies, with large number of patients, which may throw some more light in proving or refuting such type of association. moreover, prospective studies with a long follow up may establish relationship between these parameters and clinical outcomes. the literature review also suggests that although the hi is a good indicator of the quality of a plan, the analyses of dvhs and ct sections still remains an integral part of treatment plan evaluation till the ideal hi is discovered. | homogeneity index (hi) is an objective tool to analyz the uniformity of dose distribution in the target volume. various formulae have been described in literature for its calculation but there is paucity of data regarding the ideal formula and the factors affecting this index. this study was undertaken to analyze hi in our patients using various formulae and to find out the co - relation between hi and prescribed dose, target volume and target location. a retrospective review of 99 patients was performed. hi was calculated using five different formulae (a - e). the patients were divided in five groups each, based on prescribed dose, target volume and target location and mean hi of each group was analysed to find the co - relation between these factors and hi. when there were multiple target volumes the primary target volume was studied. the statistical calculation was done using spss version 16.0. ninety nine patients were found evaluable with 75 males and 24 females. ninety five patients were treated with radical intent and four with palliative intent. the sites treated were head and neck (46.4%), pelvis (17.1%), brain (15.1%), abdomen (12.1%), and thorax (6.1%). the mean prescribed dose was 4304 cgy (centigray) and the mean target volume was 476.2 cc. the mean value of hi was 1.21, 2.08, 30.13, 21.51 and 1.27 with different formulae. there was considerable agreement between hi calculated using various formulae specially the formulae considering prescribed dose (c, d). on statistical analysis, there was no significant co - relation between the location and volume of target but there was a trend toward better hi with increasing prescribed dose. future studies with more number of patients can confirm our results. |
patients with primary oag and healthy subjects included in this study were recruited from the diagnostic innovations in glaucoma study (digs) and african descent and glaucoma evaluation study (adages). the multicenter adages includes participants from the hamilton glaucoma center at the department of ophthalmology, university of california - san diego ; the new york eye and ear infirmary ; and the department of ophthalmology, university of alabama at birmingham. the diagnostic innovations in glaucoma study includes participants recruited at the university of california - san diego. all the methods adhered to the tenets of the declaration of helsinki and to the health insurance portability and accountability act. the institutional review boards at the university of california - san diego, new york eye and ear infirmary, and university of alabama at birmingham approved the methods. the african descent and glaucoma evaluation study and digs are registered as cohort clinical trials (http://www.clinicaltrials.gov, identifiers nct00221923 and nct00221897, september 14, 2005). methodological details of digs and adages have been described previously. in brief, for glaucoma subjects, inclusion criteria were 20/40 or better best - corrected visual acuity at baseline, spherical refraction within 5.0 diopters (d), cylinder correction within 3.0 d, open angles on gonioscopy, and at least two consecutive and reliable standard automated perimetry vf examinations with either a pattern standard deviation (psd) or a glaucoma hemifield test (ght) result outside the 99% normal limits. exclusion criteria were eyes with coexisting retinal disease and eyes with nonglaucomatous optic neuropathy. for healthy subjects, inclusion criteria were 20/40 or better best - corrected visual acuity, spherical refraction within 5.0 d, cylinder correction within 3.0 d, iop < 22 mm hg with no history of elevated iop, and at least two reliable normal vfs, defined as a psd within 95% confidence limits and a ght result within normal limits. all subjects underwent an annual comprehensive ophthalmologic examination including review of medical history, best - corrected visual acuity, slit - lamp biomicroscopy, dilated funduscopic examination, and stereoscopic optic disc photography. semiannual examination included intraocular pressure (iop), sd - oct imaging (sd - oct circular scan, sd - oct onh cube scan, sd - oct onh radial scan, and sd - oct macular cube scan), and vf testing. in this report, we included three groups of participants. the first group was composed of 35 eyes of 35 advanced - glaucoma patients (vf md 21 db) followed for an average of 3.5 0.9 years. all eyes were followed at approximately 6-month intervals with vf and oct testing and were required to have a minimum of three vfs and three octs during follow - up for inclusion in this study (number of tests ranged from three to eight). the stable glaucoma group of consisted of 50 eyes from 27 early-, moderate-, and advanced - glaucoma patients with five serial oct exams imaged every week for 5 weeks. we assume that in this short follow - up period, glaucoma changes are not likely to occur. these stable glaucoma eyes were used to train the bkds onh volume change method to reduce the likelihood that changes due to measurement variability would be classified as progression due to glaucoma. a third group of 46 eyes from 30 healthy subjects followed for an average of 2.8 0.4 years was used to estimate the aging effects. all eyes were followed at approximately 6-month intervals with vf and oct testing and had an average of six tests acquired during follow - up (test range was 410). healthy participants were recruited from the general population through advertisement, from referring practices, and from the staff and employees from the shiley eye institute, university of california, san diego. each subject was required to have at least one good - quality spectralis sd - oct (heidelberg engineering inc., heidelberg, germany) circular scan, sd - oct onh cube scan, sd - oct onh radial scan, and sd - oct macular cube scan acquired on the same day. spectralis oct uses a dual - beam sd oct, a confocal laser - scanning ophthalmoscope with a wavelength of 870 nm, and an infrared reference image to obtain images of ocular microstructures. spectralis oct incorporates a real - time eye - tracking system that couples confocal laser - scanning ophthalmoscope and sd oct scanners to adjust for eye movements and to ensure that the same location of the retina is scanned over time. the image acquisition protocols included (1) high - resolution rnfl circle scan, which consists of 1536 a - scan points from a 3.45-mm circle centered on the optic disc, (2) high - resolution cube scan centered on the optic disc (73 b - scans with 768 a - scans each), (3) enhanced depth imaging (edi) scan centered on the optic disc (48 b - scans with 1024 a - scans each), and (4) high - resolution cubic scan centered on the fovea (73 b - scans with 768 a - scans each). quality assessment of oct scans was evaluated by imaging data evaluation and assessment (idea) center experienced examiners masked to the subject 's results of the other tests. raw 3d sd - oct images were exported to a numerical computing language (matlab ; mathworks, natick, ma, usa). the san diego automated layer segmentation algorithm (salsa) was used to automatically segment (1) the bruch 's membrane opening (bmo) and the internal limiting membrane (ilm) on each onh radial scan to calculate the mrw defined as the shortest distance from bmo to ilm, and (2) the macular gcipl from the macular cube scan. the spectralis built - in segmentation algorithm was used to segment the cprnfl from the circular scan. briefly, we assumed that each b - scan consists of several interretinal layers (e.g., the bruch 's membrane [bm ] layer, the retinal nerve fiber layer [rnfl ]). because the interretinal layers have different thicknesses, each layer can be defined by a curve modeling its skeleton and a filter or set of filters modeling its thickness. to segment the different layers, it is sufficient to estimate their skeletons and the hyperparameters of the filters. in this study, we are interested only in the segmentation of the bm, ilm layers in the onh scans, and rnfl and ipl layers in the macular scans. in order to build connected skeletons, we considered an object - oriented approach rather than the voxel - oriented approach. therefore, short segments (20 voxels in our case) are added to or deleted from the current configuration depending on their state (connected or not). note that shorter segments have been considered in the termination of the skeletons for better estimation accuracy. the estimation of the model parameters and hyperparameters are addressed using a monte carlo markov chain. for the bmo identification, once we estimated the bm layer separately in each of the 48 b - scans, we utilized the whole 3d volume to estimate the bmo points to take into account the planarity of the bmo points. our aim is to properly integrate the elliptical shape of the bmo curve and to rely only on the reliable bmo points in the estimation scheme. note that our aim is not to fit an ellipse to the data but to use the elliptical shape as a bayesian an elegant way to address this task is to use the inverse artificial neural network ann - pca to model the elliptical shape of the bmo curve. the bayesian - kernel detection scheme is a bayesian - based approach that uses change in the 3d onh volume scans to classify an eye as nonprogressing or progressing. raw 3d sd - oct onh cube scans were exported to a numerical computing language (matlab, mathworks). the bayesian - kernel detection scheme was used to estimate glaucoma progression from onh cube scans. we formulated the detection of glaucomatous change between baseline image and follow - up images as a missing data problem. markov random field model (mrf) prior was used to model the spatial dependency of changed voxels. once the change detection map was estimated, we used a kernel - based classifier for glaucoma progression detection. as prior knowledge or an agreed - upon gold standard for detection of progression in advanced glaucoma is not available, we used a one - class classifier trained only on the nonprogressing 50 stable glaucoma eyes and 36 healthy eyes. the svdd enables us to distinguish between targets (nonprogressing eyes) and outliers (progressing eyes) by defining a closed boundary around the target data. as done previously, we included two features as input for the svdd based on a glaucoma - related region of interest of the baseline image that generally consists of the rnfl, neuoretinal rim, and prelamina tissue of the onh identified using salsa. follow - up images were automatically registered by the instrument to the baseline image to detect change over time at specific locations in the region of interest. please note that retinal layer segmentation of the follow - up images is not required. the two features identified in the region of interest are the number of voxels detected as changed, and the ratio image intensity between the baseline and follow - up scans of changed voxels. an eye was defined as progressing if (1) macular gcipl, mrw, or crnfl loss was significantly (p < 0.05) different from zero and faster than the 5th percentile of the healthy group or (2) 3d onh volume bkds change was classified as progressing utilizing both the healthy group and stable glaucoma group in the one - class svdd classification method. descriptive statistics were used to compare demographic characteristics by group (healthy and glaucoma subjects). tests were used to compare categorical variables, and t - tests were used to compare continuous variables. mixed effects models were used to calculate the mean rates of change (slopes) for global cprnfl thickness, global mrw thickness, and global macular gcipl thickness loss from baseline. models included group (healthy versus glaucoma), time, and the interaction term group time. the model was adjusted for age, and the correlation between eyes was accounted for in the model. statistical analysis was performed using sas, version 9.2 (sas institute, cary, nc, usa). patients with primary oag and healthy subjects included in this study were recruited from the diagnostic innovations in glaucoma study (digs) and african descent and glaucoma evaluation study (adages). the multicenter adages includes participants from the hamilton glaucoma center at the department of ophthalmology, university of california - san diego ; the new york eye and ear infirmary ; and the department of ophthalmology, university of alabama at birmingham. the diagnostic innovations in glaucoma study includes participants recruited at the university of california - san diego. all the methods adhered to the tenets of the declaration of helsinki and to the health insurance portability and accountability act. the institutional review boards at the university of california - san diego, new york eye and ear infirmary, and university of alabama at birmingham approved the methods. the african descent and glaucoma evaluation study and digs are registered as cohort clinical trials (http://www.clinicaltrials.gov, identifiers nct00221923 and nct00221897, september 14, 2005). methodological details of digs and adages have been described previously. in brief, for glaucoma subjects, inclusion criteria were 20/40 or better best - corrected visual acuity at baseline, spherical refraction within 5.0 diopters (d), cylinder correction within 3.0 d, open angles on gonioscopy, and at least two consecutive and reliable standard automated perimetry vf examinations with either a pattern standard deviation (psd) or a glaucoma hemifield test (ght) result outside the 99% normal limits. exclusion criteria were eyes with coexisting retinal disease and eyes with nonglaucomatous optic neuropathy. for healthy subjects, inclusion criteria were 20/40 or better best - corrected visual acuity, spherical refraction within 5.0 d, cylinder correction within 3.0 d, iop < 22 mm hg with no history of elevated iop, and at least two reliable normal vfs, defined as a psd within 95% confidence limits and a ght result within normal limits. all subjects underwent an annual comprehensive ophthalmologic examination including review of medical history, best - corrected visual acuity, slit - lamp biomicroscopy, dilated funduscopic examination, and stereoscopic optic disc photography. semiannual examination included intraocular pressure (iop), sd - oct imaging (sd - oct circular scan, sd - oct onh cube scan, sd - oct onh radial scan, and sd - oct macular cube scan), and vf testing. in this report, we included three groups of participants. the first group was composed of 35 eyes of 35 advanced - glaucoma patients (vf md 21 db) followed for an average of 3.5 0.9 years. all eyes were followed at approximately 6-month intervals with vf and oct testing and were required to have a minimum of three vfs and three octs during follow - up for inclusion in this study (number of tests ranged from three to eight). the stable glaucoma group of consisted of 50 eyes from 27 early-, moderate-, and advanced - glaucoma patients with five serial oct exams imaged every week for 5 weeks. we assume that in this short follow - up period, glaucoma changes are not likely to occur. these stable glaucoma eyes were used to train the bkds onh volume change method to reduce the likelihood that changes due to measurement variability would be classified as progression due to glaucoma. a third group of 46 eyes from 30 healthy subjects followed for an average of 2.8 0.4 years was used to estimate the aging effects. all eyes were followed at approximately 6-month intervals with vf and oct testing and had an average of six tests acquired during follow - up (test range was 410). healthy participants were recruited from the general population through advertisement, from referring practices, and from the staff and employees from the shiley eye institute, university of california, san diego. each subject was required to have at least one good - quality spectralis sd - oct (heidelberg engineering inc., heidelberg, germany) circular scan, sd - oct onh cube scan, sd - oct onh radial scan, and sd - oct macular cube scan acquired on the same day. spectralis oct uses a dual - beam sd oct, a confocal laser - scanning ophthalmoscope with a wavelength of 870 nm, and an infrared reference image to obtain images of ocular microstructures. spectralis oct incorporates a real - time eye - tracking system that couples confocal laser - scanning ophthalmoscope and sd oct scanners to adjust for eye movements and to ensure that the same location of the retina is scanned over time. the image acquisition protocols included (1) high - resolution rnfl circle scan, which consists of 1536 a - scan points from a 3.45-mm circle centered on the optic disc, (2) high - resolution cube scan centered on the optic disc (73 b - scans with 768 a - scans each), (3) enhanced depth imaging (edi) scan centered on the optic disc (48 b - scans with 1024 a - scans each), and (4) high - resolution cubic scan centered on the fovea (73 b - scans with 768 a - scans each). quality assessment of oct scans was evaluated by imaging data evaluation and assessment (idea) center experienced examiners masked to the subject 's results of the other tests. raw 3d sd - oct images were exported to a numerical computing language (matlab ; mathworks, natick, ma, usa). the san diego automated layer segmentation algorithm (salsa) was used to automatically segment (1) the bruch 's membrane opening (bmo) and the internal limiting membrane (ilm) on each onh radial scan to calculate the mrw defined as the shortest distance from bmo to ilm, and (2) the macular gcipl from the macular cube scan. the spectralis built - in segmentation algorithm was used to segment the cprnfl from the circular scan. briefly, we assumed that each b - scan consists of several interretinal layers (e.g., the bruch 's membrane [bm ] layer, the retinal nerve fiber layer [rnfl ]). because the interretinal layers have different thicknesses, each layer can be defined by a curve modeling its skeleton and a filter or set of filters modeling its thickness. to segment the different layers, it is sufficient to estimate their skeletons and the hyperparameters of the filters. in this study, we are interested only in the segmentation of the bm, ilm layers in the onh scans, and rnfl and ipl layers in the macular scans. in order to build connected skeletons, we considered an object - oriented approach rather than the voxel - oriented approach. therefore, short segments (20 voxels in our case) are added to or deleted from the current configuration depending on their state (connected or not). note that shorter segments have been considered in the termination of the skeletons for better estimation accuracy. the estimation of the model parameters and hyperparameters are addressed using a monte carlo markov chain. for the bmo identification, once we estimated the bm layer separately in each of the 48 b - scans, we utilized the whole 3d volume to estimate the bmo points to take into account the planarity of the bmo points. our aim is to properly integrate the elliptical shape of the bmo curve and to rely only on the reliable bmo points in the estimation scheme. note that our aim is not to fit an ellipse to the data but to use the elliptical shape as a bayesian an elegant way to address this task is to use the inverse artificial neural network ann - pca to model the elliptical shape of the bmo curve. the bayesian - kernel detection scheme is a bayesian - based approach that uses change in the 3d onh volume scans to classify an eye as nonprogressing or progressing. raw 3d sd - oct onh cube scans were exported to a numerical computing language (matlab, mathworks). the bayesian - kernel detection scheme was used to estimate glaucoma progression from onh cube scans. we formulated the detection of glaucomatous change between baseline image and follow - up images as a missing data problem. markov random field model (mrf) prior was used to model the spatial dependency of changed voxels. once the change detection map was estimated, we used a kernel - based classifier for glaucoma progression detection. as prior knowledge or an agreed - upon gold standard for detection of progression in advanced glaucoma is not available, we used a one - class classifier trained only on the nonprogressing 50 stable glaucoma eyes and 36 healthy eyes. the svdd enables us to distinguish between targets (nonprogressing eyes) and outliers (progressing eyes) by defining a closed boundary around the target data. as done previously, we included two features as input for the svdd based on a glaucoma - related region of interest of the baseline image that generally consists of the rnfl, neuoretinal rim, and prelamina tissue of the onh identified using salsa. follow - up images were automatically registered by the instrument to the baseline image to detect change over time at specific locations in the region of interest. please note that retinal layer segmentation of the follow - up images is not required. the two features identified in the region of interest are the number of voxels detected as changed, and the ratio image intensity between the baseline and follow - up scans of changed voxels. an eye was defined as progressing if (1) macular gcipl, mrw, or crnfl loss was significantly (p < 0.05) different from zero and faster than the 5th percentile of the healthy group or (2) 3d onh volume bkds change was classified as progressing utilizing both the healthy group and stable glaucoma group in the one - class svdd classification method. descriptive statistics were used to compare demographic characteristics by group (healthy and glaucoma subjects). tests were used to compare categorical variables, and t - tests were used to compare continuous variables. mixed effects models were used to calculate the mean rates of change (slopes) for global cprnfl thickness, global mrw thickness, and global macular gcipl thickness loss from baseline. models included group (healthy versus glaucoma), time, and the interaction term group time. the model was adjusted for age, and the correlation between eyes was accounted for in the model. statistical analysis was performed using sas, version 9.2 (sas institute, cary, nc, usa). the study included 35 eyes of 35 glaucoma patients with very advanced glaucoma, 50 eyes from 27 stable glaucoma, and 46 eyes from 30 healthy subjects. a summary of the demographic variables and measurements at baseline of each group is shown in table 1. glaucoma patients were significantly older (p < 0.001) and had worse vf md (p < 0.001) and longer follow - up (p < 0.001) than healthy subjects. the advanced - glaucoma and the healthy eye groups were similar with respect to sex (p = 0.74), axial length (p = 0.65), and disc area (p = 0.57). baseline characteristics of study subjects baseline global cprnfl thickness derived from the circular scan, global mrw thickness derived from the onh radial scan, and macular gcipl thickness derived from the entire macular cube sd - oct scan measurements in healthy and advanced - glaucoma eyes are presented in table 2. healthy eyes had thicker baseline cprnfl, mrw, and macular gcipl when compared to glaucoma eyes. baseline global cprnfl, mrw, and macular gcipl measurements by group rates of global cprnfl, mrw, and macular gcipl thickness loss in healthy and advanced - glaucoma eyes are presented in figure 1 and table 3. in healthy eyes, mean rates (p value) of cprnfl, mrw, and macular gcipl were 0.32 m / y (p < 0.001), 1.41 m / y (p < 0.001), and 0.11 m / y (p < 0.001), respectively. in advanced - glaucoma eyes, the mean rates of cprnfl, mrw, and macular gcipl change were 0.08 m / y (p = 0.39), 0.29 m / y (p = 0.43), and 0.18 m / y (p < 0.02), respectively. there was no statistically significant difference between the mean rate of loss of cprnfl and mrw in advanced - glaucoma eyes and healthy eyes (p = 0.44 and p = 0.58). the mean rate of macular gcipl loss tended to be larger in advanced - glaucoma eyes than in healthy eyes, but the difference in mean rates between the two groups was not statistically significant (p = 0.12). distribution of the mean rates of change of circumpapillary retinal nerve fiber layer (cprnfl), minimum rim width (mrw), and macular ganglion cell inner plexiform layer (gcipl) thickness in healthy and advanced - glaucoma eyes. rates of global cprnfl, mrw, macular gcipl, and vf md loss by group by the structural measurement rate of change criterion, the number of identified progressing glaucoma eyes was 2 (5%) using cprnfl, 4 (11%) using the mrw, and 11 (31%) using the macular gcipl. table 4 presents baseline global cprnfl, mrw, macular gcipl, and vf md measurements by study group ; table 5 presents the mean rates of global cprnfl, mrw, macular gcipl, and vf md loss by study group. no significant difference was found between the vf md baseline measurement and md mean rate of change of the 11 eyes that progressed based on the macular gcipl criteria and 24 eyes that did not progress (p = 0.34, p = 0.2, respectively). however, mean macular gcipl thickness tended to be larger in the 11 eyes that progressed compared to the eyes that did not (p = 0.09). there was no significant difference in cprnfl and mrw thickness and mean rate of change between the 11 progressing eyes based on gcipl and the eyes that did not progress (p = 0.39, p = 0.43 and p = 0.37, p = 0.58, respectively). figure 2 shows the cprnfl, mrw, macular gcipl thickness, and vf of an eye identified as progressing by cprnfl, mrw, and macular gcipl. figure 3 shows the cprnfl, mrw, macular gcipl thickness, and vf of an eye with progression detected only by macular gcipl. baseline global cprnfl, mrw, macular gcipl, and vf md measurements by group rate of global cprnfl, mrw, macular gcipl, and vf md loss by group top row : circumpapillary retinal nerve fiber layer (cprnfl), minimum rim width (mrw), bottom row : macular ganglion cell inner plexiform layer (gcipl) thickness, and 24 - 2 visual field in one eye detected as glaucoma progressing by cprnfl, mrw, and macular gcipl (md vf = 22.3). top row : circumpapillary retinal nerve fiber layer (cprnfl), minimum rim width (mrw), bottom row : macular ganglion cell inner plexiform layer (gcipl) thickness, and 24 - 2 visual field in one eye detected as glaucoma progressing by only macular gcipl (md vf = 28.46). using the 3d whole - volume bkds method, the number of progressing glaucoma eyes identified was 13 (31%). among the 13 progressing eyes detected by the 3d whole - volume bkds, 7 eyes were also identified by macular gcipl, 3 eyes by mrw, and 1 eye by cprnfl. using the 3d whole - volume bkds method, no significant difference was found between the vf md baseline measurement and md rate of change of the 13 eyes that progressed based on the bkds and 22 eyes that did not progress (p = 0.11, p = 0.3, respectively). the gcipl mean rate of change was significantly faster in bkds progressing eyes than nonprogressing eyes (p = 0.03). there was no significant difference in baseline cprnfl and mrw thickness and mean rate of change between the 13 bkds progressing eyes and 22 nonprogressing eyes (p = 0.72, p = 0.84 and p = 0.48 and p = 71, respectively). baseline global cprnfl thickness derived from the circular scan, global mrw thickness derived from the onh radial scan, and macular gcipl thickness derived from the entire macular cube sd - oct scan measurements in healthy and advanced - glaucoma eyes are presented in table 2. healthy eyes had thicker baseline cprnfl, mrw, and macular gcipl when compared to glaucoma eyes. baseline global cprnfl, mrw, and macular gcipl measurements by group rates of global cprnfl, mrw, and macular gcipl thickness loss in healthy and advanced - glaucoma eyes are presented in figure 1 and table 3. in healthy eyes, mean rates (p value) of cprnfl, mrw, and macular gcipl were 0.32 m / y (p < 0.001), 1.41 m / y (p < 0.001), and 0.11 m / y (p < 0.001), respectively. in advanced - glaucoma eyes, the mean rates of cprnfl, mrw, and macular gcipl change were 0.08 m / y (p = 0.39), 0.29 m / y (p = 0.43), and 0.18 m / y (p < 0.02), respectively. there was no statistically significant difference between the mean rate of loss of cprnfl and mrw in advanced - glaucoma eyes and healthy eyes (p = 0.44 and p = 0.58). the mean rate of macular gcipl loss tended to be larger in advanced - glaucoma eyes than in healthy eyes, but the difference in mean rates between the two groups was not statistically significant (p = 0.12). distribution of the mean rates of change of circumpapillary retinal nerve fiber layer (cprnfl), minimum rim width (mrw), and macular ganglion cell inner plexiform layer (gcipl) thickness in healthy and advanced - glaucoma eyes. rates of global cprnfl, mrw, macular gcipl, and vf md loss by group by the structural measurement rate of change criterion, the number of identified progressing glaucoma eyes was 2 (5%) using cprnfl, 4 (11%) using the mrw, and 11 (31%) using the macular gcipl. table 4 presents baseline global cprnfl, mrw, macular gcipl, and vf md measurements by study group ; table 5 presents the mean rates of global cprnfl, mrw, macular gcipl, and vf md loss by study group. no significant difference was found between the vf md baseline measurement and md mean rate of change of the 11 eyes that progressed based on the macular gcipl criteria and 24 eyes that did not progress (p = 0.34, p = 0.2, respectively). however, mean macular gcipl thickness tended to be larger in the 11 eyes that progressed compared to the eyes that did not (p = 0.09). there was no significant difference in cprnfl and mrw thickness and mean rate of change between the 11 progressing eyes based on gcipl and the eyes that did not progress (p = 0.39, p = 0.43 and p = 0.37, p = 0.58, respectively). figure 2 shows the cprnfl, mrw, macular gcipl thickness, and vf of an eye identified as progressing by cprnfl, mrw, and macular gcipl. figure 3 shows the cprnfl, mrw, macular gcipl thickness, and vf of an eye with progression detected only by macular gcipl. baseline global cprnfl, mrw, macular gcipl, and vf md measurements by group rate of global cprnfl, mrw, macular gcipl, and vf md loss by group top row : circumpapillary retinal nerve fiber layer (cprnfl), minimum rim width (mrw), bottom row : macular ganglion cell inner plexiform layer (gcipl) thickness, and 24 - 2 visual field in one eye detected as glaucoma progressing by cprnfl, mrw, and macular gcipl (md vf = 22.3). top row : circumpapillary retinal nerve fiber layer (cprnfl), minimum rim width (mrw), bottom row : macular ganglion cell inner plexiform layer (gcipl) thickness, and 24 - 2 visual field in one eye detected as glaucoma progressing by only macular gcipl (md vf = 28.46). using the 3d whole - volume bkds method, the number of progressing glaucoma eyes identified was 13 (31%). among the 13 progressing eyes detected by the 3d whole - volume bkds, 7 eyes were also identified by macular gcipl, 3 eyes by mrw, and 1 eye by cprnfl. using the 3d whole - volume bkds method, no significant difference was found between the vf md baseline measurement and md rate of change of the 13 eyes that progressed based on the bkds and 22 eyes that did not progress (p = 0.11, p = 0.3, respectively). the gcipl mean rate of change was significantly faster in bkds progressing eyes than nonprogressing eyes (p = 0.03). there was no significant difference in baseline cprnfl and mrw thickness and mean rate of change between the 13 bkds progressing eyes and 22 nonprogressing eyes (p = 0.72, p = 0.84 and p = 0.48 and p = 71, respectively). our results suggest that even in very advanced glaucoma, structural loss can be detected in some eyes using standard global structural measures. specifically, macular gcipl had the highest proportion of eyes with detectable change (31%), followed by mrw (11%) and cprnfl (4%). in addition, the 3d whole - volume bkds change method, which does not require extensive retinal layer segmentation, detected change in 37% of eyes. moreover, only the mean rate of macular gcipl change reached statistical significance, suggesting that gcipl changes can be detected even in this group of severely advanced - oag eyes. in contrast, the mean rates of change in cprnfl and mrw were not significantly different from zero. the mean rates of change in the healthy eyes were all significantly different from zero, suggesting that aging effects can be detected even in a relatively short follow - up time. these results are important as detecting change in advanced - oag eyes is challenging, as the amount of remaining measurable neural tissue is limited. moreover, determining whether the glaucoma patient is stable or progressing is critical for determining whether the treatment initiated needs to be changed or intensified, as patients with advanced glaucoma are at a high risk of losing remaining vision and becoming functionally impaired or blind from the disease. this study is unique in that it focused on identification of change in very advanced disease where the usefulness of conventional structural and functional tests that usually guide treatment decisions is reduced (i.e., vf and cprnfl thickness). while the vf md is commonly used to classify the glaucoma subject into early, moderate, and advanced disease, it may not accurately reflect the extent of structural loss. for example, one eye with only a focal cprnfl defect may have the same vf md value as another eye with a diffuse cprnfl defect. in the first case it is possible that the rnfl thickness in sectors without the focal defect can still be used to monitor further change, which is less likely the case for the second eye. therefore, this report can be considered as a proof of concept ; if structural change was detectable in this very advanced stage of the disease using existing and novel methods for change detection, then structural change is also likely to be detectable in eyes with less advanced disease. recent advances in sd - oct technology have improved image resolution, made it possible to measure retina layer thickness and onh parameters, and allowed the imaging of deeper retinal structures such as the choroid and the lamina cribrosa. for these reasons, sd - oct has been widely adopted clinically to objectively assess small changes in the retina. in the current study, we evaluated the rate of change of cprnfl thickness, mrw, and macular gcipl in advanced - glaucoma eyes and compared the number of progressing glaucoma eyes using these measurements to a new 3d optic onh whole - volume change detection method, bkds, that does not require retinal layer segmentation. retinal layer segmentation is particularly challenging in eyes with advanced disease as the layers are thin, and results are more variable than in eyes with less severe glaucoma. this issue is of particular importance for cprnfl segmentation, as the presence of large blood vessels can adversely affect segmentation of the thin cprnfl in advanced disease. similarly, differentiating between the ganglion cell layer (gcl) and ipl is particularly challenging when the layers are thin, as in advanced oag. for this reason, we analyzed the macular gcipl and not the gcl as a separate layer. the salsa and spectralis instrument based retinal layer segmentation of eyes included in this study were manually checked and did not have segmentation failures of the macular gcipl, mrw, or cprnfl. there are several possible reasons why we found faster cprnfl and mrw change in healthy subjects than in advanced - glaucoma patients. in addition, cprnfl and mrw atrophy is already extensive in patients with advanced glaucoma. therefore, identification of cprnfl and mrw changes is more challenging at later stages of glaucoma when the layers have already thinned. the 3d whole - volume bkds offers several advantages compared to retinal structural- and thickness - based methods. first, the 3d whole - volume bkds does not require accurate segmentation of each retinal layer on each scan. rather, a glaucoma - based region of interest, generally consisting of rnfl, neuroretinal rim, and prelamina tissue, is delineated on the baseline scan only. therefore, measurement variability inherent in retinal layer segmentation algorithms will not adversely affect the ability to detect progression. the bkds also facilitates the analysis of the entire onh 3d volume for potential glaucomatous changes that may occur in the region of interest that also includes deeper layers such as prelaminar tissue. moreover, the use of spatial dependency favors the generation of homogeneous areas, reducing the likelihood of false - positive detection of change. third, the proposed kernel - based support vector data description (svdd) method allows the classifier to be trained using only nonprogressing eyes. gold standard for detection of progression in advanced glaucoma that can be used to identify progressing eyes for use in training the classifier. it is important to note that we have previously demonstrated the utility of the bkds for detection of onh progression in early- to moderate - glaucoma eyes using vf progression as the gold standard. for example, in our previous publications, bkds was implemented without any retinal layer segmentation. in the current study, a region of interest was defined by segmentation of the baseline images and progression detection limited to the designated region of interest. there are several limitations to the 3d whole - volume bkds method that should be noted. one limitation of the proposed method is the inclusion of retinal blood vessels in the change detection map. although the variation of retinal blood vessels may be compensated for by the classifier, this compensation by the classification algorithm could mask small changes in the rnfl or rim area. another limitation is the lack of a parameter to assess and quantify the rate of progression, which may be helpful for clinicians to estimate the likelihood that a patient will become functionally impaired in his or her lifetime. further, it is difficult to assess whether the detected changes are due to glaucomatous changes or other tissue remodeling that is not related to progression of the disease. nevertheless, while it is unclear if the detected changes are related or not to the glaucoma, it is important for the clinician to evaluate change that is outside normal limits. limitations of the current study include the small sample size, relative short follow - up time for both healthy subjects and glaucoma patients, and the limited age range of the healthy subjects. for these reasons, the proportion of progressing eyes and rates of change measured for gcipl, mrw, and cprnfl in this specific severely advanced - glaucoma group may not be generalizable to other groups of advanced - glaucoma patients. in addition, without a gold standard definition of progression in advanced disease, it is difficult to determine whether the detected changes are glaucomatous changes or age - related changes, or, as previously mentioned, to tissue remodeling not necessarily related to oag. we utilized nonprogressing healthy and stable glaucoma eyes in the analysis to reduce the possibility that the changes identified were due to aging or variability of the measurements. nevertheless, while it is unclear if the detected changes are related or not to the glaucoma, characterizing these changes may improve our understanding of the pathophysiology of glaucoma or age - related changes in these eyes with advanced disease. another limitation is the use of the global measurements to assess the rate of change of cprnfl, mrw, and gcipl. while using global measurements results in reduced variability compared to sectoral measurements, in advanced oag, they may underestimate the changes at locations where there is a region in which neural tissue remains intact. the development of automated methods to detect the remaining neural tissue may be helpful to assess more accurately regions of interest for monitoring the structural rate of change. in conclusion, our results suggest that even in very advanced disease, structural change can be detected, and that monitoring macular gcipl and 3d whole - volume bkds change shows promise for identifying progression in advanced glaucoma. however, a larger sample of advanced - glaucoma patients with longer follow - up is needed to validate these findings. | purposeto compare spectral - domain optical coherence tomography (sd - oct) standard structural measures and a new three - dimensional (3d) volume optic nerve head (onh) change detection method for detecting change over time in severely advanced - glaucoma (open - angle glaucoma [oag ]) patients.methodsthirty-five eyes of 35 patients with very advanced glaucoma (defined as a visual field mean deviation < 21 db) and 46 eyes of 30 healthy subjects to estimate aging changes were included. circumpapillary retinal fiber layer thickness (cprnfl), minimum rim width (mrw), and macular retinal ganglion cell inner plexiform layer (gcipl) thicknesses were measured using the san diego automated layer segmentation algorithm (salsa). progression was defined as structural loss faster than 95th percentile of healthy eyes. three - dimensional volume onh change was estimated using the bayesian - kernel detection scheme (bkds), which does not require extensive retinal layer segmentation.resultsthe number of progressing glaucoma eyes identified was highest for 3d volume bkds (13, 37%), followed by gcpil (11, 31%), cprnfl (4, 11%), and mrw (2, 6%). in advanced - oag eyes, only the mean rate of gcipl change reached statistical significance, 0.18 m / y (p = 0.02) ; the mean rates of cprnfl and mrw change were not statistically different from zero. in healthy eyes, the mean rates of cprnfl, mrw, and gcipl change were significantly different from zero. (all p < 0.001).conclusionsganglion cell inner plexiform layer and 3d volume bkds show promise for identifying change in severely advanced glaucoma. these results suggest that structural change can be detected in very advanced disease. longer follow - up is needed to determine whether changes identified are false positives or true progression. |
a 70-year - old japanese man with a 50-year, 10 cigarettes / day smoking history presented with hoarseness. chest computed tomography (ct) and brain magnetic resonance imaging (mri) showed a tumor in the left lung and multiple metastases to the lung, the bone, and brain. among serum tumor markers, neuron - specific enolase (68.9 ng / ml) and the pathology of transbronchial biopsied specimens demonstrated acidophilic tumor cells showing a cord - like distribution with small necrosis and one mitosis in 10 high - power fields (fig. 1). combined with immunohistochemical (ihc) findings of cd56+/chromogranin a+/synaptophysin+ (fig. 2a) and a low ki-67 labeling index (< 20%), biopsied specimens stained with hematoxylin and eosin staining show small necrotic foci (inset) and tumor cells with fine nuclear chromatin and moderate eosinophilic cytoplasm growing in a trabecular pattern and organoid nesting arrangement. (c) fish analysis of the alk locus using a break - apart probe strategy. strongly positive staining for synaptophysin (bb) (a) and alk (5a4, nichirei biosciences, tokyo) (b) was observed in tumor cells. (c) approximately 74% of the tumor cells showed rearrangement at the alk locus. further analyses revealed that anaplastic lymphoma kinase (alk) gene rearrangement was observed by both ihc (fig. the patient was initially treated with carboplatin (auc5, day 1) and etoposide (100 mg / m, days 1 - 3), however, the tumor size remained unchanged after four cycles of chemotherapy. thereafter, he was treated with an alk inhibitor, crizotinib (pfizer, tokyo, japan) 250 mg po twice daily, which reduced the tumors in the lung (fig. 3a and b) and the brain (fig. a chest ct scan and brain mri before and during treatment with crizotinib (a and c : may 2015, b and d : aug 2015). crizotinib reduced the primary mass (arrows) from 26 mm (a) to 15 mm (b), and the multiple lung metastases (arrowheads) disappeared. crizotinib also reduced the brain metastasis (arrows) from 13.3 mm (c) to 6.2 mm (d). although alk rearrangement accounts for approximately 5% of non - small cell lung carcinomas (nsclcs), alk rearrangement in neuroendocrine tumors (nets) including small cell lung carcinomas (sclcs), large cell neuroendocrine carcinomas (lcnecs), and carcinoid tumors is quite rare (1). to date, only four net cases, two sclc cases, one lcnec case and one atypical carcinoid tumor case have been reported to have alk rearrangement (2 - 5). in addition, nakamura and colleagues reported that no alk rearrangement was found among 227 nets including 52 carcinoid tumors (6). the biopsied tissues in the present case were optimal specimens without crushing for microscopic observation, and alk rearrangement was confirmed using two methods (ihc and fish). we thus contend that the lung tumor in the present case met the criteria of atypical carcinoid tumor, and that this atypical carcinoid tumor also had alk rearrangement. however, a potential limitation of this case is that the pathology of transbronchial biopsied specimens may not reflect the character of the whole tumor. we first treated our patient with chemotherapy according to a previous report (7), however, the regimen was ineffective. we then administered crizotinib, and it reduced the tumors in both the lung and brain. however, it was also reported that nets with alk rearrangement may be resistant to alk inhibitors (2,3). further analyses are needed to elucidate whether crizotinib may become a key tool for the treatment of carcinoid tumors with alk rearrangement. | this is the first report in which crizotinib, an anaplastic lymphoma kinase (alk) inhibitor, reduced an atypical carcinoid tumor with alk rearrangement. a 70-year - old man developed a tumor in the left lung and multiple metastases to the lung and brain. the pathology of transbronchial biopsied specimens demonstrated an atypical carcinoid pattern. combined with immunohistochemical findings, we diagnosed the tumor as atypical carcinoid. alk gene rearrangement was observed by both immunohistochemical (ihc) and fluorescence in situ hybridization. he was treated with chemotherapy as first - line therapy, however, the tumor did not respond to chemotherapy. thereafter, he was treated with crizotinib, which successfully reduced the tumors. |
melanoma is a malignancy of melanocytes, pigment - producing cells that reside in the basal epidermal layer. melanoma accounts for less than 2% of skin cancers but accounts for most skin cancer related deaths. the incidence of melanoma has been increasing for the past 30 years. in 2015 alone, there were approximately 74,000 newly diagnosed cases, 5% of which were from texas [1, 3 ]. the texas panhandle has one of the highest incidence rates in the state with 21.5 per 100,000 persons compared to the state average of 14.1 per 100,000. the texas panhandle also claims melanoma death rates nearly twice the national average [5, 6 ]. the national incidence and mortality of melanoma vary by gender, accounting for the 5th and 7th most common cancers in men and women, respectively. in 2015 risk factors that increase the risk of developing melanoma include blue or green eyes, light colored skin, dysplastic nevi, abnormal moles, blistering sunburns, excessive uv exposure, psoralen therapy with uva light, immunosuppression, and habitation closer to the equator or at higher elevations studies have also isolated six high risk factors that independently increase the risk of getting melanoma. they are actinic keratosis, blond or red hair, family history of melanoma, upper back freckles, three or more blistering sunburns prior to age 20, and three or more years of outdoor occupation as a teenager individuals with one or two of the risk factors have a tripled risk of developing melanoma compared to the rest of the population, and patients with previous melanoma have a ninefold increase in risk of developing subsequent melanoma compared to the rest of the population [9, 16 ]. thus, skin protection behaviors and environmental exposure play a crucial role in the development and subsequent management of melanoma. recommendations to reduce the risks of melanoma deaths and recurrence include routine self - examinations for suspicious lesions, sun avoidance, use of sunscreen, and protective clothing. however, not much research is available on skin protection behaviors after melanoma treatment, especially between genders. we looked at a representative sample of cutaneous melanoma cases diagnosed and surgically treated in the texas panhandle, a geographically high risk area. all patients were treated by surgical oncologists between 2008 and 2015. inclusion was limited to living patients of 18 years or older with biopsy - proven and surgically treated melanoma. telephone surveys lasting 8 to 10 minutes were conducted using a standardized script with three main categories consisting of health maintenance, skin protection, and sun avoidance as follows. telephone survey questions section i : health maintenance how often in the past year have you visited any physician for a skin examination?how often in the past year have you had a full body skin check by a healthcare provider?how often in the past year have you self - examined your skin for abnormal markings (changing color, getting bigger, new mole) for growths ? how often in the past year have you visited any physician for a skin examination ? how often in the past year have you had a full body skin check by a healthcare provider ? how often in the past year have you self - examined your skin for abnormal markings (changing color, getting bigger, new mole) for growths ? section ii : skin protection (4)how often do you wear a hat with a wide brim all the way around?(5)how often do you wear long sleeved shirts?(6)how often do you wear sunscreen of at least spf 30(7)how often do you wear sunglasses?(8)how often do you wear pants that reach your ankles ? how often do you wear a hat with a wide brim all the way around ? how often do you wear sunscreen of at least spf 30 how often do you wear sunglasses ? section iii : sun avoidance behavior (9)how often do you limit your outdoor activity?(10)when outside, how often do you seek shade?(11)how often do you worry about developing another case of skin cancer?(12)how often do you wear a hat, scarf, cap, or use an umbrella ? how often do you wear a hat, scarf, cap, or use an umbrella ? the last 2 questions have different answer choices (13)since being diagnosed with melanoma, how often do you take part in outdoor activities compared to before the diagnosis ? significantly less, slightly less, the same, slightly more, significantly more(14)since being diagnosed with melanoma, how often do you worry about your melanoma compared to before the diagnosis ? i worry a lot less, i worry slightly less, i worry about the same amount, i worry slightly more, i worry a lot moresurveys were mailed in prepaid envelopes to those who did not respond to at least three of our phone calls. data was evaluated and p values were calculated for each of the survey questions. since being diagnosed with melanoma, how often do you take part in outdoor activities compared to before the diagnosis ? significantly less, slightly less, the same, slightly more, significantly more since being diagnosed with melanoma, how often do you worry about your melanoma compared to before the diagnosis ? i worry a lot less, i worry slightly less, i worry about the same amount, i worry slightly more, i worry a lot more the participants included 82 males and 68 females with ages ranging from 18 to 88 years (table 1). overall, 87% of participants reported skin self - examination for abnormal markings more often, with females self - examining more often than men (table 2). of all participants, 94% reported wearing skin protective clothing (sunglasses, pants that reach the ankles, and long sleeved shirts) more often, with females being more than males. females limited their participation in outdoor activities after their diagnosis of melanoma to a greater degree than males, 79% to 54%, p 2 mm) tumors, higher risk of progression, and higher risk of metastasis [18, 19 ]. our study looked into what seems to be lacking in the literature, to see whether or not there is a gender - based difference in behavior after the treatment of melanoma. results showed that a larger percentage of females compared to males adopted behavioral changes to prevent future cutaneous melanoma. females were more likely to self - examine their skin for abnormal markings, and previous studies have shown a correlation between self- examinations and earlier melanoma diagnosis. females were also more likely to wear protective clothing, limit their outdoor activity, and seek shade, which would ultimately lessen their exposure to uv radiation and decrease their risk of developing blistering sunburns, both of which are risk factors for melanoma. women also worried more about their melanoma, which may be the underlying reason for their increased emphasis on preventative measures. one finding that seemed to deviate from the pattern was that men seem to wear a wide brim hat more often than females. this could possibly be due to behavioral change, but we hypothesize that it is more likely that males have careers involving agriculture or livestock in west texas, so they are more likely to be outdoors for longer periods of time. agriculture makes up the largest sector of the texas panhandle economy, and this predominately male workforce engaged in outdoor occupations including farming, ranching, and construction have a 68x higher uv exposure compared to workers in indoor occupations [20, 21 ]. melanoma recurrence is higher than once thought, occurring in more than 6% of patients after 10 years, 6.8% of patients after 15 years, and 11.3% of patients after 25 years. patients facing late recurrence were typically younger, with an average age of 41 to an average of 51 for early recurrence of melanoma [22, 23 ]. sunburns, which can increase the likelihood of getting melanoma, are preventable, yet nearly 40% of the us population report getting sunburns each year [24, 25 ]. thus, it is discouraging to find that more than half of the participants in both genders reported wearing sunscreen with greater than spf30 less often than before their diagnosis of melanoma. we also looked at age to see if a certain age group was more or less likely to use sunscreen, but the data for two age groups, over 55 and under 55, was not statistically significant. the majority of respondents spent less time in outdoor activities after their diagnosis of melanoma. when asked about their sunscreen habits, the majority of those who spent less time outdoors believed that since they were outside for shorter periods of time, they no longer needed sunscreen. the second most popular response was that since sunscreen did not prevent melanoma in the first place, it probably was not going to prevent a recurrence. our results point to the need of stronger patient education on the possibility of melanoma recurrence and on proper sunscreen usage to dispel misconceptions surrounding application efficacy. due to its preventable nature and its increasing incidence, melanoma has been labeled a public health crisis by the us surgeon general because a person who dies from melanoma has lost on average 20 years of potential life [1, 26, 27 ]. while there are no national guidelines in the united states regarding skin cancer screening, developed countries around the world, such as belgium, germany, australia, france, and japan have adopted population based screening for skin cancer. germany has seen a nearly 40% decrease in melanoma mortality as a result [28, 29 ]. patient adherence to preventative measures such as sunscreen needs to be pursued more aggressively. with 67% of melanoma deaths occurring in men and with less male attention to health maintenance, skin protection, and sun avoidance after melanoma treatment, more needs to be done in terms of education and follow - up, and mass population skin cancer screening should be adopted [13 ]. | purpose. skin protection behaviors and environmental exposure play a crucial role in the development and subsequent management of melanoma. this study investigates gender - based differences in skin protection behaviors after melanoma treatment. methods. patients diagnosed and surgically treated for cutaneous melanomas over the last six years in a geographically high risk area were surveyed over telephone using a standardized script. results. of 150 survey results obtained, there were 82 males and 68 females. overall, 87% of participants reported skin self - examination for abnormal markings more often and 94% reported wearing skin protective clothing more often, with females being more than males. females limited outdoor activity more often than males, 79% to 54%, p < 0.05. when outside, females sought shade more often than males, 75% to 56%, p < 0.05. however, males wore a wide brim hat more often than females, 52% to 28%, p < 0.05. interestingly, 60% of participants reported wearing spf 30 sunscreen less often, p < 0.05. conclusion. larger percentage of females adopted behavioral changes to prevent future melanoma. those living in high risk areas and with outdoor occupations need particular attention to skin care. population based screening should be adopted to deal with this rising public health crisis. |
group ii metabotropic glutamate receptors (mglu2 encoded by grm2 and mglu3 encoded by grm3) are g - protein coupled receptors that inhibit adenylate cyclase (niswender and conn, 2010). a key function of group ii mglu receptors is to act pre - synaptically to inhibit neurotransmitter release, and mglu2 receptors act primarily as autoreceptors to modulate the release of glutamate (anwyl, 1999 ; cartmell and schoepp, 2000 ; schoepp, 2001), whilst mglu3 are also glial. group ii mglu receptors have been implicated in both cognitive and emotional processes, and have been linked with a number of neuropsychiatric conditions, including anxiety, stress - related disorders, schizophrenia and substance misuse (harrison., 2008 ; markou, 2007 ; moghaddam, 2004 ; swanson., nevertheless, the precise role that these receptors play in cognition and emotion remains to be fully established. genetically modified mice represent an important tool for investigating the role of different receptor subtypes in behaviour (bannerman, 2009). in order to elucidate the role of group ii mglu receptors in cognition we have studied grm2/3 double ko mice, lacking both mglu2 and mglu3 (lyon., 2011). by studying these double ko mice we aimed to circumvent any possible compensatory changes and/or redundancy of function between these two homologous receptor subtypes (lyon., 2008). we previously reported that grm2/3 mice exhibit a distinct pattern of cognitive impairments across a range of hippocampus - dependent spatial memory tests (lyon., grm2/3 mice were impaired on appetitively motivated spatial memory tests (e.g. spatial working and reference memory on the radial maze), and on tests which rely on spontaneous exploratory behaviours (e.g. spatial novelty preference in a y - maze), but in contrast they performed as well as wild - type (wt) controls on aversively motivated spatial memory paradigms like the morris water maze. indeed, grm2/3 mice were impaired on an appetitive version of a y - maze spatial reference memory task but normal on a swim - escape version of the same task. grm2/3 mice were hypoactive when tested in photocell activity cages, leading us to suggest reduced levels of arousal. furthermore, while injection stress impaired spatial working memory performance on an appetitive task in wts, it actually improved the performance of the grm2/3 mice, consistent with an altered arousal an important question that remains concerns the relative contributions of mglu2 and mglu3 to these processes. a number of lines of evidence, mainly from pharmacological studies, have suggested a role for group ii mglu receptors in anxiety (harvey and shahid, 2012 ; swanson., 2005). an anxiolytic effect of mglu2/3 agonists has been demonstrated in a number of rodent anxiety paradigms [e.g. elevated plus maze (linden., 2005) ; fear potentiated startle (helton., 1998) ; lactate - induced panic (shekhar and keim, 2000) ], and confirmed in healthy human volunteers in the fear potentiated startle test (grillon., 2003), in panic disorder patients exposed to co2-induced anxiety (schoepp., 2003) and in patients with general anxiety disorder (dunayevich. furthermore, mglu2 selective positive allosteric modulators are now being developed which also display anxiolytic / antidepressant properties (fell., 2011). interestingly (although somewhat counter - intuitively), mglu2/3 antagonists have also been suggested for the treatment of anxiety (iijima., 2007 ;, 2006), although results are more equivocal. against this, studies in genetically modified mice lacking either mglu2 (grm2 mice) or mglu3 (grm3 mice) have reported no anxiety phenotype (fell., 2011 ; linden., 2005 ; morishima., one possible explanation for these null results is compensatory changes in gene expression and/or redundancy of function between these two homologous receptor subtypes for the anxiety phenotype in the single ko lines (lyon., 2008), whereas pharmacological ligands will activate or inhibit both mglu2 and mglu3. therefore, in the present study we assessed anxiety in grm2/3 mice (thus circumventing the possibility of compensatory changes / redundancy of function), using ethologically based, unconditioned tests, as part of a more extensive test battery investigating sensorimotor, motivational and emotional behaviours. this builds upon and extends our previous work characterising hippocampus - dependent cognitive behaviours in these mice (lyon., 2011). for comparison, we also evaluated each of the single kos (grm2 and grm3 mice) against their respective wt littermate controls, using the same battery of tests. in addition, we assessed the grm2 and grm3 mice on key spatial memory tests employed in our previous studies with grm2/3 mice (lyon., 2011). thus, spatial working / short - term memory was assessed in grm2 and grm3 mice using both appetitively motivated, rewarded alternation on the t - maze and a spontaneous, exploratory driven spatial novelty preference task in the y - maze. long - term spatial memory was assessed using both appetitive and aversive / swim - escape versions of the y - maze reference memory task. adult male mice (> 2.5 months) on a c57bl/6j background were obtained from glaxosmithkline, harlow, uk. single grm2 and grm3 mice, and their respective wt littermate controls, were generated as previously described (corti. separate lines of wt and grm2/3 mice were produced as in lyon. group sizes varied between experiments and lines, and are given in the relevant tables and figures. mice were 2.54 months old at the start of the anxiety / sensorimotor test battery, and 45.5 months old at the end of this test battery. they then began spatial memory testing, and were 78 months old at the end of the spatial memory tests. animals were housed in groups of 24 and kept on a 12-h light dark cycle (lights on at 07:00 and off at 19:00), with all testing conducted during the light phase. for the battery of anxiety and motor tests, and for the aversively motivated tasks, for all appetitively motivated tasks, mice were maintained on a restricted feeding schedule at not less than 90% of their free - feeding weight. for several days prior to the start of each appetitive test, mice were habituated to the maze and to drinking the sweetened condensed milk (diluted 50:50 with water) that was used as a reward. home office project and personal licenses held by the authors, and the study was approved by the local ethics committee. genotypes of all animals were confirmed by the mouse genotyping group at gsk, harlow. grm2 fragments were amplified using forward primer (ctg tct ctc tat ctc tct gc) and reverse primer (tgt gtg tgt gta aca tga tgg). pcrs were performed with a denaturing step at 95 c (15 min) then 94 c (30 s), followed by annealing at 60 c (90 s) and extension at 72 c (1 min). after 35 cycles, the reaction was maintained at 72 c for a further 10 min, and the products resolved on a 2% agarose gel. the wt product was a single 900 bp band, and the ko product a 450 bp band. grm3 genotyping yielded a 2 kbp product in wt and a 500 bp product in ko. the disparity in size prevented the two fragments from being amplified in a single multiplex pcr. two separate pcrs were therefore conducted, one for the wt product (forward primer : gtt tct agg act tcc tat gg ; reverse primer : aac gat gct ctg aca aac tcc) and a second for the ko product (forward primer : cgt acg tcg gtt gct atg g ; reverse primer : gtc aga tat agt gag agc agg). both pcrs were performed with a denaturing step at 95 c (15 min) then 94 c (30 s), followed by annealing at 56 c (90 s) and extension at 72 c (150 s). after 35 cycles, the reaction was maintained at 72 c for 10 min. the absence of grm2 mrna in founding members of the grm2 population was confirmed by the use of in situ hybridisation histochemistry (yokoi., 1996), as was the absence of grm3 mrna in the founding members of the grm3 population (corti., 2007). the order of testing was as follows : black & white alley ; neophagia (first version) ; open field ; horizontal bar ; rotarod test ; multiple static rods ; elevated plus maze, neophagia (second version) ; spatial novelty preference test ; locomotor activity ; appetitive spatial working memory t - maze, appetitive / aversive spatial reference memory (srm) y - maze (with test order counterbalanced for the two versions of the reference memory y - maze task). comparisons of grm2/3, grm2 and grm3 mice against their respective wt control groups were conducted separately, and by different experimenters. all behavioural testing took place during the light phase of the day between 9.00 am and 6.00 pm. data from the grm2/3 mice on spontaneous locomotor activity and the spatial memory tests has been published previously (lyon., 2011). anxiety was assessed using a number of ethological, unconditioned tests, which assessed approach / avoidance conflict in these mice. the black & white alley (120 cm 9 cm, 29 cm high walls) was painted black from one end to the middle, and white from the other end to the middle. the mouse was placed into the alley at the end of the black arm and observed for two minutes. variables measured were latency to enter the white arm (which is regarded as more anxiogenic than the black arm), total amount of time spent in the white arm, and number of crossings between the two arms. this test exploits the natural wariness of rodents to consume novel foodstuffs. to overcome potential floor / ceiling effects, two versions of the task were performed with increasing anxiogenic character. in each, the mouse was placed in a novel environment (underneath an upturned plastic jug / in a closed arm on an elevated y - maze) and presented with a completely novel food (sweetened condensed milk / noyes reward pellets). all mice were food deprived the night before for approximately 15 h. variables measured were latency to contact, and then to consume, the novel food. a maximum of 3 min was allowed for each trial. the elevated plus maze consisted of four 27 cm long, 8 cm wide alleys connected by a central platform to form a plus - shape. two of the alleys had high (30 cm) walls, and two had low (0.5 cm) walls. the high walled alleys (closed arms) are presumed to be less anxiogenic than the low walled ones (open arms), while the central platform (junction) (12.5 cm by 6 cm) remains relatively neutral. variables measured were latency to enter a closed arm, latency to enter an open arm, percentage of time spent in each area of the maze (open vs closed vs junction), and total distance covered within the maze. the open field comprised a brightly illuminated circular arena (a white metallic drum), with diameter 60 cm. the centre of the open field was defined as a circular area with an outer edge 19 cm from the edge of the arena. the mouse was placed inside the arena facing the sidewall and electronically tracked for five minutes. variables measured were percentage of time in the central area versus the outer area, and total distance covered in the arena. the horizontal bar was 0.2 cm in diameter, 38 cm long, and made of metal. it was attached to two wooden supports, and positioned 49 cm above the padded bench surface. the mouse was placed with its front paws touching the bar and then quickly released, so that it grasped the bar at its central point. performance was scored based on the length of time that the mouse held onto the bar : a score of 5 was given for holding on for 30 s or for traversing the bar to reach one of the wooden supports ; 4 for holding on for 2130 s ; 3 for 1120 s ; 2 for 610 s ; and 1 for 05 s. the rotarod was a 3.5 cm wide (diameter), 4.5 cm long knurled rod, attached at each end to 30 cm diameter flanges. if the mouse was still in place after ten seconds, the rotation of the rod was gradually accelerated at a rate of 20 rpm. the latency to fall from the rod and the speed of rotation at which the mouse fell were recorded. the multiple static rods consisted of five 60 cm long wooden rods attached perpendicularly to a supporting beam. the rods were arranged in order of decreasing diameter : rod 1 was 3.3 cm wide ; rod 2, 2.7 cm ; rod 3, 2.1 cm ; rod 4, 1.4 cm ; rod 5, 0.8 cm. the mouse was placed 2 cm from the distal end of the rod, facing away from the supporting beam, and the time taken for the mouse to turn 180 to face the supporting beam, recorded. these orientation times are sensitive to small deficits in motor co - ordination. the time taken for the mouse to run 60 cm along the beam to reach the refuge of the support (transit time the mouse was placed on the largest diameter rod first, continuing with the next largest on each subsequent trial. spontaneous locomotor activity was measured during a two - hour period in the light phase (12 pm2 pm). all mice were placed singly into a transparent plastic cage (26 cm 16 cm 17 cm) with a ventilated lid. two infrared photocell beams crossed the cage 1.5 cm above the floor, with each beam 7 cm from the centre of the cage. mice were left in a quiet room with the lights on for 2 h. the number of beam breaks made by each mouse was recorded in 24 bins of 5 min. single ko and wt mice were compared on a spontaneous, spatial novelty preference task in which behaviour is driven, not by an overt unconditioned stimulus (us ; e.g. a food reward), but instead relies upon animals ' natural exploratory drive. this task therefore provides a non - aversive experimental context but performance does not rely on the motivating or rewarding effects of food. we previously showed that grm2/3 double ko mice exhibit a reduced spatial novelty preference on this task (lyon., 2011), and we repeated the test in grm2/3 mice here. the y - maze was made from transparent perspex, and consisted of three 30 cm long, 8 cm wide arms with 20 cm high walls, connected by a central junction. each mouse was assigned two arms (the start arm and the other arm) to which they were exposed during the first phase of the task (the exposure phase). allocation of arms to specific spatial locations was counterbalanced within each genotype. during the 5-min exposure phase, the entrance to the third, novel, arm was closed off by the presence of a large perspex block. the mouse was placed at the end of the start arm, facing the experimenter, and allowed to explore the start arm and the other arm freely for five minutes, beginning as soon as the mouse left the start arm. the number of entries into each arm and the length of time spent there were recorded. at the end of the five minutes, the mouse was removed from the maze and returned to the home cage for one minute. during this time, the perspex block closing off the novel arm was removed and the sawdust redistributed throughout the maze to minimise the use of odour cues. the mouse was then returned immediately to the start arm, facing the experimenter, for the 2-min test phase. this consisted of two minutes free exploration during which the mouse could enter all 3 arms, beginning as soon as the mouse left the start arm. the amount of time that the mouse spent in each arm, and the number of entries into each arm, were recorded, during both the exposure and the test phase. for the test phase, a discrimination ratio [(novel arm)/(novel + other arm) ] was calculated both for number of arm entries and time spent in each arm. previous work in this laboratory has demonstrated that wt mice display a marked preference for the novel arm during the test phase, and that this preference relies on extramaze cues. this preference for the novel arm is abolished in mice with cytotoxic hippocampal lesions (sanderson., 2007). our previous study demonstrated that spatial working memory on the elevated t - maze is impaired in grm2/3 mice (lyon., 2011). the t - maze consisted of a wooden start arm (47 10 cm) and two identical goal arms (35 10 cm), surrounded by a 10 cm high wall. a food well was positioned 3 cm from the end of each goal arm, and the whole maze was surrounded by prominent distal extramaze cues. mice received five trials per day for six days, with an iti of approximately forty minutes. for analysis and presentation, data are presented as 3 blocks of 10 trials, having combined data from consecutive days. each trial consisted of a sample run followed by a choice run. on the sample run, mice were forced either left or right (chosen pseudorandomly with equal numbers of left and right turns, and no more than three consecutive turns in any direction) by the presence of a large wooden block, closing off one of the goal arms. at the end of the goal arm the mouse collected a reward of 0.1 ml sweetened condensed milk. the block was then removed and the mouse placed back in the start arm, facing the experimenter, for the choice run. the mouse could now select either goal arm but was rewarded only for choosing the arm that had not been visited on the sample run, i.e., it was rewarded for alternating (non - matching to place). the interval between the sample run and the choice run was approximately 5 s. the number of correct alternations was recorded for each mouse. in addition, we recorded latencies for both the sample runs and the choice runs. we recorded the latency of the mice to run (i) from the beginning of the start arm to the food well on the sample trial, and (ii) from the beginning of the start arm until making a choice into one of the goal arms on the choice trial. spatial working memory performance on the t - maze is dependent on the hippocampus (deacon., the aim of the experiment was to compare performance of wt and single ko mice on appetitively and aversively motivated versions of the y - maze spatial reference memory task, with the order of testing and the experimental rooms in which the tests were performed (and therefore the spatial cues available), fully counterbalanced in order to control for practice effects or differences in the salience of the available spatial cues (see also lyon., 2011). thus, 50% of wt and 50% of ko mice first performed the appetitive y - maze srm task in room a. these animals then performed an aversively motivated y - maze srm task in room b. conversely, the remaining 50% began with the aversively motivated y - maze task in room a, followed by the appetitively motivated y - maze task in room b. we have previously shown that the grm2/3 double ko mice are impaired on the appetitive, but not the aversive, version of the task (lyon., 2011). the elevated y - maze consisted of three identical wooden arms, each 50 cm long by 9 cm wide, with a low wall (0.5 cm), connected by a central polygonal platform (14 cm diameter). each mouse was assigned a goal arm, defined by its position relative to extramaze spatial cues, which was baited with 0.1 ml sweetened condensed milk on all trials. on each trial, the mouse was placed at the end of one of the two non - baited arms (the start arm), facing the experimenter ; 50% of trials began from the arm to the right of the goal arm, and 50% from the arm to the left. having been placed at the end of the start arm, the mouse was allowed to choose one of the remaining arms. if it chose the goal arm, it was allowed to consume the milk reward before being returned to the home cage. mice that chose incorrectly were returned to the home cage immediately. to prevent the use of intramaze cues, mice received ten trials per day for 6 days, with an inter - trial interval (iti) of approximately five minutes. the last block of ten trials was conducted using post - choice reinforcement : the condensed milk reward was added to the food well only after the mouse had made a choice, to ensure that the animals were not locating the milk by virtue of its odour. previous work in this laboratory using the same maze has demonstrated that this task is hippocampus - dependent in mice (deacon., 2002). the y - maze was made from transparent perspex, and consisted of three 30 cm long, 8 cm wide arms with 20 cm high walls, connected by a central junction. the maze was filled with water (temperature 21 c 1 c) to a depth of approximately 12 cm which obliged the mice to swim. mice could escape from the water by climbing onto a platform (8 cm by 8 cm) hidden approximately 1.5 cm below the water surface in one of the arms of the maze. mice received five trials per day in this deep water escape y - maze task for six days. on each trial the mouse was allowed 90 s to find the platform ; any that failed to do so were guided there by the experimenter. mice were allowed to rest on the platform for 30 s before being transferred to a heated cage. on day seven (24 h after training trial 30), a transfer test was performed, analogous to that used in the water maze, in order to assess the extent of any spatial memory for the platform location. the platform was removed from the maze and the mouse allowed to swim freely for 30 s. time spent searching in each arm was recorded. previous work in this laboratory has confirmed that the swimming y - maze task, like the appetitive y - maze, is hippocampus - dependent (unpublished). when comparing the performance of two groups of mice, parametric data were analysed using t - tests, or with a repeated measures anova if there was a within - subjects factor. where data violated the assumptions of normality or equality of variance, which are required for parametric analysis (i.e. the data were non - parametric), then mann whitney u - tests were performed for simple group comparisons with no within - subjects factors. for non - parametric data sets which included both between and within - subjects factors (e.g. multiple static rods data collected across different sized rods), the data were first transformed using a log10 transformation to satisfy the assumptions of normality and equality of variance, and then analysed using a two way, repeated measures anova. all animals displayed normal appearance and no gross abnormalities in home - cage behaviours (assessed during short, non - systematic observations by the experimenter during the light period). body weight of grm2/3 and grm3 mice did not differ from their respective wt controls (grm2/3, n = 20, 28.0 g 0.5 g vs. wt, n = 19, 28.5 g 0.3 g ; t 0.20 ; grm3, n = 15, 26.7 g 0.3 g vs. wt, n = 15, 27.1 g 0.5 g ; t 0.50). grm2 mice were slightly, but significantly, lighter than their wt littermates at the start of the test battery (grm2, n = 14, 27.1 g 0.4 g, vs. wt, n = 15, 28.8 g 0.6 g ; t(27) = 2.23 ; p 0.50). however, there was a significant genotype by time bin interaction (f(11,308) = 2.07 ; p 0.05). in agreement with our previous study (lyon., 2011), we again found that grm2/3 mice exhibited impaired short - term spatial memory on the exploratory driven, spatial novelty preference task (fig. 2a). during the exposure phase, both wt and grm2/3 mice spent a similar amount of time exploring the other (to - be - familiar) arm (wt = 120.8 8.4, grm2/3 mice = 114.4 5.2 s ; t 0.80). during the test phase, both groups showed a significant preference for the novel arm (one group t - tests conducted against a single value of 0.5 which corresponds to chance performance ; p 's 0.30). similarly, the grm3 mice did not differ significantly from their wt littermates (fig. 2c) during the exposure phase in terms of time exploring the other arm (wt = 100.3 6.5 s, grm3 = 100.5 6.8 s ; t 0.70), and total number of arm entries (wt = 24.7 7.5 s, grm3 = 30.9 9.5 s ; t(28) = 1.95 ; p = 0.06). during the test phase, a significant preference for the novel arm (one group t - tests conducted against a single value of 0.5 which corresponds to chance performance ; p 's 0.80). the number of arm entries during the test phase was also comparable between genotypes (wt = 13.7 3.1, grm3 = 13.9 2.9 ; t 0.80). spatial working memory was assessed during non - matching to place testing (rewarded alternation) on the elevated t - maze. we have previously shown that grm2/3 mice display a robust and enduring impairment on this task (lyon., 2011). in addition, these double ko mice exhibited shorter latencies to complete both the sample and the choice runs of the task. single grm2 mice were impaired in terms of choice accuracy on the spatial working memory t - maze task across the three blocks of testing (main effect of genotype f(1,27) = 4.24 ; p 0.90) or the choice runs (f 0.80). we reported previously that grm2/3 mice were impaired on an appetitively motivated, spatial reference memory task on the elevated y - maze (lyon., neither the single grm2 nor single grm3 mice were impaired on this task (fig. although there was some suggestion that the grm2 mice performed significantly less accurately on the first block of testing, anova revealed neither a main effect of genotype (f 0.40), nor a significant genotype by block interaction (f(5,125) = 2.08 ; p = 0.07), although there was a significant main effect of block (f(5,125) = 55.71 ; p 0.50), nor a genotype by block interaction (f(5,60) = 1.11 ; p = 0.37). for the grm3 mice, there was no sign of any spatial reference memory impairment. anova revealed a main effect of block (f(5,130) = 30.93 ; p 0.80), nor genotype by block interaction (f 0.50 ; fig. the same result was obtained when the analysis excluded those mice that had previously been trained on the aversive, swim - escape task (main effect of block f(5,70) = 13.28 ; p 0.60 ; grm2 cohort : f(2,23) 0.80) nor genotype by target arm interactions (grm3 cohort : f(2,24) 0.90 ; grm2 cohort : f(2,23) 0.60). it is also not the case that the mice were solving the task by smelling the food reward. during the sixth block of y - maze testing the milk reward was only delivered after the mice had made a choice (post - choice baiting). performance remained at a high level on these trials, confirming that the mice were not solving the task using the smell of the reward. furthermore, the entire maze was rotated periodically to prevent the mice from using intramaze cues. initially high performance levels also did n't appear to reflect any effect of the prior training on the aversive swim / escape y - maze task, as performance levels in the two sub - populations of mice (y - maze nave vs. y - maze experienced) were very similar. thus, it seems most likely that there was within - session learning during the first 10 trials of training. importantly, analysis of just the very first training trial for each animal in the two studies was not significantly above chance (62.7% correct ; binomial test : p > 0.05). both grm2 and grm3 mice acquired the aversive, swim / escape y - maze reference memory task as well as their respective controls, consistent with our previous study in the grm2/3 mice which had also revealed no impairment (lyon., 2011). f 0.40 ; genotype by block interaction 4b), and showed an equivalent preference for the target arm during the 30 s probe test at the end of testing (genotype comparison ; t(27) = 1.54 ; p = 0.14 ; % time in target arm : wt = 55.5 3.2, one group t - test conducted against a single value of 33.3% which corresponds to chance performance ; t(14) = 6.91 ; p 0.50 ; genotype by block interaction 4e), and spent a similar amount of time in the arm that had previously contained the platform during the probe test (genotype comparison ; t 0.50 ; % time in target arm : wt = 57.3 2.7, one group t - test conducted against a single value of 33.3% which corresponds to chance performance ; t(14) = 8.99 ; p group b, group a = group b, group a < group b). therefore, although the inverted u - shaped function is an attractive post - hoc explanation for much of the data generated here and elsewhere (lyon., 2011), it is very difficult in practice to predict a priori the direction and/or magnitude of an effect in any given experiment or, therefore, come up with a falsifiable hypothesis. arousal / stress levels and hence performance could be affected by a whole host of factors (e.g. age, gender, housing conditions, experimenter, time of day, prior history, experimental test conditions, behaviour of other animals, presence / absence of injection, level of food restriction), and this could be especially pertinent for hand run tests (e.g. ethological anxiety tests, maze tests of learning and memory) compared with operant tasks. ultimately, independent physiological measures of stress / arousal levels (e.g. corticosterone levels, indicators of sympathetic tone such as heart rate or blood pressure), taken during the behavioural test itself, may be necessary to understand fully the complex relationship between stress, arousal and cognitive performance, and the role which group ii mglus play in these processes. in summary, the behavioural phenotypes of the grm2 and grm3 mice were less pronounced than those of the double grm2/3 mice, consistent with the possibility of redundancy of function and/or compensation in the single ko lines. however, there was no clear effect on measures of anxiety in either the single or double ko mice. nevertheless, behavioural phenotypes were observed in these animals which are potentially consistent with a role for group ii metabotropic glutamate receptors at the interface between arousal processes and behavioural performance. | group ii metabotropic glutamate receptors (mglu2 and mglu3, encoded by grm2 and grm3) have been implicated in both cognitive and emotional processes, although their precise role remains to be established. studies with knockout (ko) mice provide an important approach for investigating the role of specific receptor genes in behaviour. in the present series of experiments we extended our prior characterisation of grm2/3/ double ko mice and, in complementary experiments, investigated the behavioural phenotype of single grm2/ and grm3/ mice. we found no consistent effect on anxiety in either the double or single ko mice. the lack of an anxiety phenotype in any of the lines contrasts with the clear anxiolytic effects of mglu2/3 ligands. motor co - ordination was impaired in grm2/3/ mice, but spared in single grm2/ and grm3/ mice. spatial working memory (rewarded alternation) testing on the elevated t - maze revealed a deficit in grm2/ mice throughout testing, whereas grm3/ mice exhibited a biphasic effect (initially impaired, but performing better than controls by the end of training). a biphasic effect on activity levels was seen for the grm2/ mice. overall, the phenotype in both grm2/ and grm3/ mice was less pronounced if present at all compared to grm2/3/ mice, across the range of task domains. this is consistent with possible redundancy of function and/or compensation in the single ko lines. results are discussed with reference to a possible role for group ii metabotropic glutamate receptors at the interface between arousal and behavioural performance, according to an inverted u - shaped function. |
colonic duplications are rare congenital anomalies that usually present during the first decade of life. the clinical picture varies according to the location and extent of the lesion, as well as the type of mucosal lining. treatment of choice is complete resection of the duplication that in case of a long tubular duplication of the colon entails total or subtotal colectomy due to shared blood supply of the native bowel and the duplication. a 3-year - old boy presented with complaints of constipation and bleeding per rectum since birth. on digital rectal examination, two lumina were palpable with an intervening septum. barium enema showed long segment colonic duplication with distal communication just above anal verge [figure 1 ]. meckel 's scan for ectopic gastric mucosa was negative. on exploratory laparotomy, complete colonic duplication from cecum till 2 cm proximal to anal verge both the lumens were of the same caliber and appearance. on gross examination, it was difficult to identify the normal colon and duplication. the common wall between the two was divided at the distal end using a stapling device inserted through the anus. barium enema showing the rectum (r), the duplication (d) and common wall (com) intra - operative photograph showing the total colonic duplication colonic duplication is a rare entity, though more common in children as compared to adults. gastrointestinal bleeding in bowel duplications can result from angiodysplasia or ectopic gastric mucosa leading to ulceration. however, the bleeding per rectum could have been caused by fissures due to the passage of hard constipated stool. the constipation in the present case possibly occurred due to a fecaloma in the distal part of the duplication causing compression of the normal lumen, thus obstructing the evacuation of the rectum. since the communication between the duplication and the normal large bowel was just proximal to the anal verge, the contraction of the external sphincter possibly allowed the feces to enter the duplication. and, as fecal matter continued to accumulate in the duplication, the constipation became progressive. by dividing the septum between the normal and duplicated distal large bowel, the rectum acquired a single lumen, and hence the evacuation became easy. a large communication between the duplicated and normal large bowel also ensured emptying of the fecal matter that collected in the duplication. limited division of the common wall in case of a complete colonic duplication is a simple, safe, easy, and quick procedure. | colonic duplications are rare congenital anomalies. treatment of choice is complete resection that in case of a long tubular duplication requires total or subtotal colectomy. a simple surgical technique for treatment of complete colonic duplication is described, which avoids the complications of extensive colonic resection. |
a 31-year - old male resident of tbilisi, georgia, sought treatment at the infectious pathology, aids and clinical immunology center in early june 2008, six days after onset of illness. at that time, he was enrolled in an ongoing laboratory - based surveillance study of acute febrile illness (afi). initial clinical symptoms were fever (maximum axillary temperature 39c), arthralgias and myalgias in the lower extremities, back pain, vomiting, and diffuse abdominal pain. vital signs indicated a pulse rate of 87 bpm and blood pressure of 140/80 mm hg. travel history included regular trips to marneuli district (a rural district south of tbilisi). laboratory findings were normal, with the exception of elevated band neutrophils (20%, reference range 1%6%) and lymphocytosis (44%, reference range 19%37%). c - reactive protein level was elevated (48.9 mg / ml, reference range < 6 mg / ml), and decreased total protein (62 mol / l) was noted on day 9 of illness, along with a decrease in urine output. proteinuria (3 g/24 h), microscopic hematuria, and elevated blood pressure (160/90 mm hg) were also observed. the patient was transferred to the nephrology department of the institute of urology in tbilisi with a diagnosis of acute renal failure. patient s fluid input and output were closely regulated, and his condition improved gradually without dialysis. serum samples were tested for antibodies against a panel of pathogens, including salmonella enterica serovar typhi, s. paratyphi a and b, epstein - barr virus, brucella spp., coxiella burnetti, hantavirus, rickettsia (spotted fever and scrub typhus groups), west nile virus, tick - borne encephalitis virus, and leptospira spp. all serologic test results were negative except for the test result for hantavirus. to corroborate hospital laboratory diagnostics, serum samples were also tested in a private laboratory in germany by using western blot assay (recomblot bunyavirus immunoglobulin [ig]g / igm ; mikrogen, neuried, germany) and immunofluorescence antibody (ifa) assay (progen, heidelberg, germany). results from the western blot assay were negative for puumala igg and positive for hantaan igg and dobrava igm. 3 in egypt conducted a hantavirus igm elisa (focus diagnostics, cypress, ca, usa) on paired serum samples (acute - phase sample positive : negative ratio = 8.42 ; convalescent phase = 7.815, cut - off 1.10) cultures were negative. a renal biospy specimen obtained 10 days after disease onset showed acute tubular necrosis with mild - grade arteriolosclerosis (figure). acute tubular necrosis in a renal biopsy specimen of the patient. the patient s general condition started to improve, with increased urine output, resolution of abdominal pain, and normalization of blood pressure (120/70 mm hg). the clinical presentation and results of serologic tests for this patient who had renal failure but no apparent hemorrhage were consistent with results previously described for hantavirus infection. although the differential diagnosis included other infectious and noninfectious causes of renal failure including leptospirosis, ongoing surveillance of afi in georgia provided the serologic testing capability that enabled clinicians to identify a hantavirus infection as the cause of this illness characterized by high fever and evidence of renal dysfunction (increased serum creatinine, proteinuria, and hematuria). the pathologic changes observed in hantavirus infection presumably result from increased vascular permeability, characterized clinically by elevated hematocrit and decreased serum protein levels. damage to the vascular endothelium along with cytokine - induced renal tubular and interstitial pathologic changes may partially explain renal failure associated with hantavirus infection. although the most commonly noted renal pathologic finding is acute interstitial nephritis, acute tubular cell necrosis is also described. a comparative study of puumala and dobrava renal pathology noted increased intensity and extent of medullary interstitial capillary injury, hemorrhages, and tubular necrosis among dobrava virus - infected patients (9). the strain of the infecting virus is unknown, but serologic results, along with the available information from surrounding countries, implicate dobrava virus as the infecting strain. the relatively mild clinical symptoms of this patient suggest that a variant of dobrava virus, or a closely related hantavirus strain that cross - reacts with dobrava, may be the etiologic agent. information about the circulating virus strains, clinical manifestation, rodent hosts, and disease prevalence are lacking for the caucasus. | we describe a laboratory - confirmed case of hantavirus infection in the republic of georgia. limited information is available about hantavirus infections in the caucasus, although the infection has been reported throughout europe and russia. increasing awareness and active disease surveillance contribute to our improved understanding of the geographic range of this pathogen. |
clozapine use is associated with various adverse events.1) the associations of eosinophilia, hepatitis, and pleural effusion with clozapine have received little attention because these conditions are considered to be rare or not life - threatening side effects. the incidence of eosinophilia associated with clozapine has been reported to range from 0.2% to 62%.2) eosinophilia usually develops during the initial phase, between weeks 3 and 5 of clozapine use, and follows a transient course characterized by spontaneous remission. however, eosinophilia has been associated with major organ involvement such as hepatitis.3) elevation of liver enzymes secondary to clozapine use is common and affects 30 - 50% of patients.4) it is usually transient and detected accidentally. the onset of liver toxicity is usually 4 - 5 weeks after initiating clozapine therapy.4) however, a few patients with clozapine - induced jaundice were reported to have died as a result of fulminant hepatic failure.5 - 7) it is necessary to understand the course and management of clozapine - induced eosinophilia and hepatitis. we discuss a patient who developed eosinophilia at the beginning of clozapine use and then successively developed pleural effusion and jaundice with hepatitis. a, a 47-year old woman with a 15-year history of schizophrenia, was hospitalized after noncompliance with antipsychotic medications, which resulted in decompensation characterized by aggressive behavior, auditory hallucinations and delusions. all laboratory tests performed on admission, including complete blood cell count (cbc), serum electrolytes, urinalysis, and liver function tests (lfts), were within normal limits. hepatitis serology revealed that the hepatitis b surface (hbs) antibody was positive and that the hbs antigen was negative. ms. a was a non - smoker and non - drinker with no history of substance misuse and no significant medical history. due to poor responses to previous antipsychotic treatments, the patient was started on clozapine with the dose titrated from 12.5 mg / day to 300 mg / day during a 4-week period. during this period the weekly checks of the cbc showed gradual increases in the eosinophil count following the beginning of clozapine treatment. the eosinophil count was 0.9% (57/mm) before clozapine use, 1.7% (142/mm) at day 8, 2.8% (248/mm) at day 15, and 5.0% (416/mm) at day 22. on day 29, the total leukocyte count increased to 10,910/mm, and the eosinophilia reached 23.6% (2,575/mm). the pleural effusion was considered to be the cause of the fever and leukocytosis, and conservative management of oral antibiotics was provided. because clozapine was effective in managing the psychotic symptoms, it was maintained at the reduced dosage of 100 mg / day. on day 42, the total leukocyte count was normalized, at 9,230/mm but the eosinophil count had increased to 54.2% (5,003/mm). she showed an intermittent 37.7 fever, but general myalgia had disappeared. on day 44, a repeat chest x - ray revealed that the pleural effusion had nearly disappeared, and the fever had subsided. the total leukocyte and eosinophil count decreased to 8,350/mm and 40.1% (3,348/mm), respectively. on day 48, the patient suddenly became jaundiced, and she was transferred to the department of internal medicine at a general hospital. the lfts were notable for the following abnormalities : alanine transaminase (alt) 254 iu / l (range, 4 - 43), aspartate transaminase (ast) 277 iu / l (range, 7 - 38), r - glutamyl - transferase (ggt) 573 u / l (range, 8 - 48), total bilirubin 6.0 mg / dl (range, 0.2 - 1.2), and direct bilirubin 3.5 mg / dl (range, 0.1 - 0.4). the patient retrospectively reported that her urine color had changed to red during the previous 2 weeks. after 5 days without clozapine, the lfts improved, showing an alt level of 22 iu / l, an ast level of 37 u / l, a total bilirubin of 0.6 mg / dl, and a direct bilirubin of 0.2 mg / dl. a was readmitted to our hospital after 1 week without clozapine for treatment of psychotic symptoms. the total leukocyte count was 4,400/mm with 3.4% (150/mm) eosinophil on the day of readmission. there were no recurrences of lft or cbc abnormalities during following treatment with olanzapine and haloperidol. in this case, the eosinophil count began to increase shortly after clozapine use and reached its peak level at week 5 - 6, and since then, the eosinophil count gradually decreased. pleural effusion and red colored urine developed at week 5 and jaundice developed around at week 7 when the eosinophilia was nearly disappeared. benign eosinophilia is peripheral eosinophilia noted shortly after clozapine administration without other evidence of inflammatory processes. some patients with eosinophilia have experienced inflammation of major organs such as pancreatitis8) and a few cases with more severe forms of multi - organ involvement have been reported.9,10) in cases in which eosinophilia is accompanied by the involvement of major organs, clozapine should be discontinued immediately. on the other hand the sandoz guidelines11) recommend that clozapine be discontinued when eosinophil counts exceed 4,000/mm, and that it not be resumed until they are lower than 3,000/mm. however, none of the three fatal cases of hepatic failure found comorbid eosinophilia.5 - 7) considering our case, it is possible that fulminant hepatitis including jaundice may develop after eosinophilia subsides. additional monitoring of eosinophil during mandatory weekly leukocyte follow - up visits may be helpful for detecting lft elevations during early stage. the sandoz guidelines indicate that clozapine should be discontinued if any lft increases which is clinically relevant or if symptoms of jaundice occurs. after normalization of lfts, some patients were able to restart clozapine,11) but some were not able to do so.12) most patients who developed jaundice did not restart clozapine. pleural effusions associated with clozapine have usually been associated with other systemic manifestations such as pericardial effusion.13) in our case, pleural effusion was accompanied by fever and leukocytosis and subsided after antibiotic therapy ; thus, parapneumonic effusion is probable. however, red - colored urine, fever, pleural effusion, and the peak eosinophil count were observed at around the same time. some reports have described multi - organ idiosyncratic responses to clozapine, such as eosinophilia, pleural effusion, hepatitis, cholecystitis, ascitis, and hematuria during clozapine use.9 - 10) therefore, we recommend that patients who develop rapid eosinophilia at the beginning of clozapine treatment should be monitored with lfts, chest x - rays, and urine analysis tests. | clozapine use is associated with various adverse events, some of which have received little attention, including eosinophilia, pleural effusion, and hepatitis. because of the fatality of jaundice with hepatitis, it is necessary to understand the course and management of clozapine - induced eosinophilia and hepatitis. we report on a case in which the eosinophil count began to increase shortly after clozapine use, and pleural effusion and fever then developed at the time eosinophilia was at its peak level. jaundice with hepatitis consecutively developed when all the above symptoms subsided. the liver function recovered rapidly after clozapine was discontinued. we recommend that patients who develop rapid eosinophilia at the beginning of clozapine treatment should be monitored with lfts, chest x - rays, and urine analysis tests. |
in conventional computed tomography (ct) tube voltages are fixed (constant) while ct scans are carried out. however, tube voltage modulation is helpful for at least two reasons. in addition, tube voltage modulation can obtain satisfactory image quality avoiding detector pixel saturation. when the thickness of the scanned object varies greatly with the view angle, the constant power of the x - ray generated by traditional ct may lead to pixel saturation or at least strike a balance of quantum noise among the different views. dynamically adjusting the x - ray tube voltage in synchrony with the ct scanning can avoid this problem. tube voltage modulation is very helpful in ct scanning, but when the voltage is modulated at different views during a ct scan, images reconstructed through commonly used reconstruction methods may contain various artifacts leading to inaccuracy and degradation of image quality. ideally, monochromatic x - ray beams are required in ct scanning. however, conventionally used x - ray beams in ct are polychromatic with a moderately broad energy spectrum. in this paper, different polychromatic x - ray beams are used through tube voltage modulating at different scanning views. as we know. however, the reconstruction algorithm is based on the assumption of the monochromatic property of the x - ray beam that just computed the average attenuation coefficient and thus leads to the appearance of cupping artifacts or beam hardening artifacts within conventionally reconstructed images. beam hardening effects in a fixed voltage are known to be one of the major sources of deterministic error. during recent decades, a number of correction methods have been developed, including physical approach, statistics approach, linearization, spectrum estimation, phantom calibration prereconstruction, threshold segmentation reprojection, and iteration method [39 ]. however, artifact correction in the case of tube modulation during a ct scan has been primarily addressed in the literature. water calibration for ct scanners with tube voltage modulation in 2010, in which the eccu algorithm for cupping artifact correction was provided, showed excellent simulation results. the typical artifact correction applied in clinical ct scanners is known as water correction, and so water phantom is used in the eccu method. to ensure the integrity of the algorithm, large water phantoms are required for routine calibrations. however, the size of the calibration phantom is limited by the scan field of view (sfov), which may lead to methodological limitations. in this paper, the effects of calibration phantoms for ct scanners with tube voltage modulation are investigated by a numerical simulation method. in section 2, we provide a brief review of the eccu algorithm, followed by a numerical implementation of the eccu algorithm. in section 3, we have performed two sets of simulation experiments to investigate the effect of the geometry parameter of water phantoms on the eccu algorithm. then, we investigate the effect of dual - material calibration phantoms on the eccu algorithm, including the area - ratio and geometrical arrangement of different materials. finally, conclusions and remarks are given in section 4. the log attenuation of a polychromatic x - ray spectrum, as used for ct, is given as (1)q(u, l)=ln(u, l, e)e(e, r)dlde, where l is the line of integration corresponding to the ray direction, r represents the position vector, (e, r) indicates the energy - dependent spatial distribution of the linear attenuation coefficient, e is the photon energy, and (u, l, e) is the normalized spectrum distribution of the emitted x - rays at tube voltage u. assuming the decomposition (e, r) = (e)f(r), we will get the following formula : (2)q(u, p)=ln(u, l, e)ep(e)de with p=f(r)dl, where (e) is the energy dependence of the most prominent material in the object. let q be the polychromatic projection data and p = d(u, q) the desired monochromatic material - specific projection data. the aim of the eccu algorithm is to acquire proper p from q(u, p). let p = d(u, q), which is some yet unknown decomposition function, as follows : (3)d(u, q)=n=0n1cnbn(u, q)=cb(u, q), where d(u, q) represents a linear combination of basis functions bn(u, q) and bn(u, q) = uq as basis functions with k = 0,, k and l = 0,, l. a set of (k + 1)(l + 1) basis images are defined as fn(r) = rbn(u, q), r represents the inverse radon transform, and fn is the reconstruction image of the projection data q after they have been passed through the basis functions bn(u, q). now, the reconstruction of the material - selective projection data can be written as a linear combination of these basis images : (4)f(r)=r1d(u, q)=r1cnbn(u, q)=cnr1bn(u, q)=cnfn(r)=cf(r). the set of coefficients c is solved through minimizing the least - squares deviation : (5)e2=w(r)(cf(r)t(r))2d2r, where t(r) represents a given template image and w(r) is the weight image used to suppress the contribution of unwanted structures of the calibration object. the process of the eccu method is calculating the coefficients c through calibration phantom. furthermore, these coefficients are used to preprocess projection data acquired from ordinary scanning through formula (3). influence of calibration phantom material and calibration phantom size on the eccu method is investigated in the following section. in this section, the effect of different calibration phantoms including single - material phantom and dual - material phantom on the eccu method is investigated by using computer simulation data. a projection simulation based on a physical imaging model and scanning phantom simulation is introduced in section 3.1. the investigation of single - material calibration phantom and dual - material calibration phantom is implemented in sections 3.2 and 3.3. to simulate the projection data of different phantoms acquired with a polychromatic x - ray source, we utilize the same scheme as in. the distribution function of a polychromatic x - ray energy spectrum emitted by x - ray tube ge maxi ray 125 [spectrum gui ] and the absorption attenuation coefficients were interpolated from the database of nist (national institute of standards and technology 's website). we first computed the linear integral projection of every material that formed the phantom and then computed corresponding polychromatic projections using a different spectrum. to investigate the effect of calibration phantoms on the eccu algorithm, the well - known forbild head phantom as a test phantom was simulated. the geometry parameters of the virtual ct system for scanning forbild head phantom are as follows. the distance from source to rotation center is 570 cm and the distance from source to detector is 435 cm. the tube voltage u as a function of the projection angle is shown in figure 1. subsequently, we simulated projection data of forbild head phantom using voltage modulation curves shown in figure 1, corresponding directly to the reconstructed image shown in figure 2(a). in figure 2(b), we show a reconstructed image from the monochromatic projection data as a contrast. in addition, all simulations were carried out using the voltage modulation profile in figure 1. in order to understand the effect of object size on the eccu method, a series of virtual solid water phantoms with different geometry sizes were investigated. here, two water phantoms are given as examples to illustrate the effect of geometry size on the eccu method. the first elliptical cylinder water phantom with semiaxes 48 cm and 40 cm the second with semiaxes 28 cm and 12 cm is shown in figure 3(b). then, the correction coefficients are used to correct the tube voltage modulated projection of the forbild head phantom. the correction results through phantom figures 3(a) and 3(b) are shown in figures 3(c) and 3(d). to show images of a proper ratio, the sfov of figures 3(c) and 3(d) are simply reduced to 1/3, which is enclosed by a red square, and the corresponding zoomed images are shown in figures 3(e) and 3(f). from figure 3(e), we can see that the corrected image is as good as the reconstructed image from the monochromatic projection shown in figure 2(b), which demonstrates that the eccu method is effective when the large water phantom is used. however, severe errors appear in the corrected images when the small water calibration phantom is used, as shown in figure 3(f). in order to analyze the reason leading to the failure of the eccu method, we investigated the maximum and minimum values of tube voltage modulated projection data, including water phantom in figures 3(a) and 3(b) and forbild head phantom in figure 2(a). although the size of the calibration phantom in figure 3(b) is much the same as that of the forbild head phantom, we can see that the scope of the polychromatic projection data of water phantom in figure 3(b) can not cover the polychromatic projection data of the forbild head phantom in figure 2(a), which may be the key reason leading to the failure of the eccu method. to verify that the above analysis is reasonable, the semiaxes of a water elliptical cylinder are 24 cm and 22 cm. from the geometry size of figures 3(a) and 3(b), we know that the size of figure 3(a) is larger than that of the actual testing phantom, but figure 3(b) is smaller than the actual testing phantom. again, correction coefficients of water calibration phantom in figures 3(a) and 3(b) are used to implement the eccu method. corrected images using calibration phantoms in figures 3(a) and 3(b) are shown in figures 4(a) and 4(b). the directly reconstructed image using tube voltage modulated projection data is shown in figure 4(c) and cupping artifacts appeared. in order to quantify the accuracy of the three reconstructed images, the profiles along figures 4(a), 4(b), and 4(c), it can be observed that the profile of figure 4(a) is a straight line, but the profiles of figures 4(b) and 4(c) are curves, which demonstrates that when the scanning phantom to be corrected is smaller than the standard calibration phantom, cupping artifacts (see the solid line in figure 4(d)) disappear. however, when the scanning phantom to be corrected is larger than the calibration phantom, the correction method is invalid (see the dash - dot line in figure 4(d)). it should be reasonable to assume that the eccu method required that the geometry of the calibration phantom be larger than that of the testing phantom when they are made of the same material. actually, the maximum size of the calibration phantom is limited due to the actual sfov ; therefore the material and geometry design of the calibration phantom are of great importance. actually, the maximum sfov in the ct system is designed according to the specified parameters of the scanning objects. with high - density objects that occupy the maximum sfov, an identically sized water calibration phantom may not be appropriate for the implementation of the eccu method, because the polychromatic projection data of the water phantom can not cover that of the scanning object. inserting a high - density mass material in the water phantom is a direct way to solve this problem. based on this idea, dual - material calibration phantoms are adopted and studied in this section. we have to mention that the polychromatic projections of dual - material calibration phantoms in this section could cover the polychromatic projection of the forbild head phantom, which are ensured by properly adjusting the ratio of the two materials in the fixed sfov. firstly, the effect of the geometrical arrangement of the dual - material phantom on the eccu method was investigated. we conducted two cylinder - in - cylinder phantoms : one cylinder - in - cylinder phantom was a 14 12 cm oval water phantom with an 8 6 cm bone insert, as shown in figure 5(a). the other was a 14 12 cm oval bone phantom with an 8 6 cm water insert, as shown in figure 5(b). in addition, a two - cylinder phantom was simulated, as shown in figure 5(c) ; the upper one was an 8 6 cm bone cylinder and the lower one was a 5 3 cm water cylinder. again, corresponding correction coefficients of the three calibration phantoms were computed through the eccu method. these correction coefficients are then used to correct the tube voltage modulated projection of the forbild head phantom. the correction results through phantom figures 5(a), 5(b), and 5(c) are shown in figures 5(d), 5(e), and 5(f), respectively. compared with the directly reconstructed image in figure 2(a), the corrected images in figures 5(d), 5(e), and 5(f) are almost free of artifacts, although the uniformity of figure 5(e) is not very good. for a more detailed analysis on the influence of cylinder - in - cylinder phantoms similar to figure 5(b) on the eccu method, the first one was a 14 12 cm oval bone phantom with a 13 11 cm water insert, as shown in figure 6(a). the second one was a 13 11 cm oval bone phantom with a 11.5 9.6 cm water insert, as shown in figure 6(b) and the last one was 13 11 cm oval bone phantom with a 12.4 10.4 cm water insert, in which a 1.2 1.0 cm oval bone was inserted in the center, as shown in figure 6(c). corresponding corrected images of the forbild head phantom through phantom figures 6(a), 6(b), and 6(c) are shown in figures 6(d), 6(e), and 6(f). we can see that bright artifacts appear in the area surrounded by the high - density materials ; also streak artifacts can be observed among the higher density materials. this phenomenon shows that the geometrical arrangement of figures 6(a), 6(b), and 6(c) is not good enough compared with calibration phantoms such as figures 5(a) and 5(c) even though the contrast of the forbild image is improved to a certain degree. lastly, the effect of the area - ratio of the dual - material phantom on the eccu method was investigated through cylinder - in - cylinder phantoms as in figure 5(a). the first cylinder - in - cylinder phantom was a 14 12 cm oval water phantom with a 1.5 1.0 cm bone insert, as shown in figure 7(a). the second one was a 14 12 cm oval water phantom with a 4 2 cm bone insert, as shown in figure 7(b). the last one was a 14 12 cm oval water phantom with a 5 3 cm bone insert, as shown in figure 7(c). the area - ratio of outer water phantom to inserted bone phantom for figures 7(a), 7(b), and 7(c) is 111 : 1, 20 : 1, and 10.2 : 1, respectively. the corresponding projection ranges of these phantoms are shown in table 3, which show that the polychromatic projections of the calibration phantom can cover the polychromatic projection data of the scanning object. again, the eccu method is implemented through these calibration phantoms, and the corresponding corrected images of the forbild head phantom through calibration phantom figures 7(a), 7(b), and 7(c) are shown in figures 7(d), 7(e), and 7(f). it can be observed that the corrected images agree well with the reconstructed image from the monochromatic projection data shown in figure 2(b), which demonstrates that this kind of cylinder - in - cylinder phantom is valid for the eccu method. also, the area - ratio may not influence the validity of the eccu method in case of this kind of cylinder - in - cylinder phantom. in this paper, calibration phantoms for ct scanners with tube voltage modulation are investigated through computer simulation. we investigated the effect of the geometry parameter of the water calibration phantom on the eccu algorithm. the simulation results show that the large water phantom can improve image quality, whilst a small water phantom may degrade image quality, because the polychromatic projection of the water phantom can not cover the polychromatic projection of the scanning object. we find that in order to assure the effectiveness of the eccu algorithm, the polychromatic projections of the calibration phantom must cover the polychromatic projection data of the scanning object. to assure the validity of the eccu method, dual - material calibration phantoms are introduced. furthermore, the geometry arrangement and the area - ratio of dual - material calibration phantoms were investigated. according to the numerical results, it can be concluded that dual - material calibration phantoms are valid in removing cupping artifacts and streak artifacts. | the effects of calibration phantoms on the correction results of the empirical artifacts correction method (eccu) for the case of tube modulation were investigated. to improve the validity of the eccu method, the effect of the geometry parameter of a typical single - material calibration phantom (water calibration phantom) on the eccu algorithm was investigated. dual - material calibration phantoms (such as water - bone calibration phantom), geometry arrangement, and the area - ratio of dual - material calibration phantoms were also studied. preliminary results implied that, to assure the effectiveness of the eccu algorithm, the polychromatic projections of calibration phantoms must cover the polychromatic projection data of the scanning object. however, the projection range of a water calibration phantom is limited by the scan field of view (sfov), thus leading to methodological limitations. a dual - material phantom of a proper size and material can overcome the limitations of a single - material phantom and achieve good correction effects. |
scapularis, i. ricinus, and i. persulcatus, the predominant vectors of lyme borreliosis in north america, europe, and asia, respectively, complicates interpreting epidemiologic studies of lyme borreliosis and other ixodid - borne disorders. a method to identify and distinguish strains within species is needed to carry out studies of the population biology and of the possible etiologic roles of these organisms. since most of these microorganisms are to date uncultivable or poorly cultivable, a method using dna amplification by polymerase chain reaction (pcr) is preferable. on the basis of the findings of liveris. (9), we further developed sequence analysis of the 16s-23s rrna intergenic spacer (igs) for strain typing and showed its advantages over other loci for the lyme borreliosis agents b. burgdorferi and b. afzelii (10). for this study, we applied this approach to typing the new borrelia spp. and included two relapsing fever agents, b. hermsii (endemic in the western and northwestern united states) and b. turicatae (endemic in the southwestern and south - central united states) (2). nine isolates of b. hermsii in our culture collection originated in new mexico, colorado, california, and washington state and were either from ornithodoros hermsi ticks, patients with relapsing fever, or, in one case, a bird (11). b. miyamotoi strains ht24, ht31, and hk004 from i. persulcatus ticks and strains nb103 - 1 and fr64b from apodemus spp. cultivable strains of these species were grown in barbour - stoenner - kelly ii medium. uncultivated species were initially identified in total dna extracts of ticks by using borrelia genus specific pcr, targeting flab gene (5). approximately 2% of a. americanum nymphs and adult females in collections from different areas of new jersey, illinois, and missouri contained b. lonestari. spirochetes were identified in i. scapularis nymphs collected at a 7.2-ha field site in southern connecticut and in i. ricinus nymphs collected at a 1.5-ha site in blekinge county in sweden (10). a connecticut strain of b. miyamotoi s.l. strain was maintained in mus musculus (7). part of the intergenic spacer was amplified by pcr with primers for the 3 end of the 16s rrna gene and the ilet trna gene (10). as a comparison to the intergenic spacer locus and to assess linkage disequilibrium, we also partially sequenced the chromosomal gene for the p66 outer membrane protein (10,13) after amplification by pcr as described in the table footnotes. the pcr products were either directly sequenced or first cloned into pcr2.1-topo vector (invitrogen, carlsbad, ca) before sequencing on a beckman ceq 8000 (beckman coulter, fullerton, ca) automated sequencer. the sequences were aligned automatically by using clustal x software (http://www-igbmc.u-strasbg.fr/bioinfo/clustalx) and then manually with macclade version 4.05 (http://macclade.org/macclade.html) (10). the maximum lengths of the alignments (http://spiro.mmg.uci.edu/data) were set by the shortest available sequence. accession numbers for the deposited sequences are given in the legend for the figure and in a footnote for the table. partial p66 genes were amplified by nested pcr with outer forward and reverse primers of 5gatttttctatatttggacacat and 5aatttaatcagattgtttagctcta and inner primers of 5gacacatatctaaaaaagcaaacac and 5ctaatccggtttttacgtatatgc and following conditions : 40 cycles of 94c for 60 s, 55c for 120 s, and 74c for 120 s. genbank accession numbers for p66 genotypes are the following : b. miyamotoi s.l. type 1 (ay363722), type 2 (ay363723), type 3 (ay363724) ; b. lonestari type 1 (ay363689), type 2 (ay363690), type 3 (ay363691) ; b. hermsii type 1 (af016408), type 2 (af228028), and type 4 (af116905). analysis of b. lonestari and b. hermsii p66 fragments was limited to 346 of 605 bp and 516 of 608 bp, respectively, which corresponded to the shortest sequences available for all types of the individual species. the pcr products for the intergenic spacer locus varied in length between species and ranged from 388 bp for b. miyamotoi s.l. from sweden to 685 bp for b. turicatae. the table summarizes the statistics for the aligned intergenic spacer and p66 sequences of the b. miyamotoi s.l., b. lonestari, and b. hermsii. the mean nucleotide diversity normalized for each aligned position was 38%-130% higher for the intergenic spacer locus than for the p66 locus. at the same time, intragenic recombination was not detected at the intergenic spacer locus with sawyer 's test (www.math.wustl.edu/~sawyer/mbprogs), which assesses the likelihood that polymorphisms in a sequence arose through recombination rather than mutation (data not shown). this result was consistent with the undetectable recombination at the intergenic spacer loci of b. burgdorferi (10). the genetic diversity at the intergenic spacer and p66 loci for the relapsing fever group species in a given geographic area was more limited than was the case for lyme borreliosis species (10). sequences of 22 samples from connecticut and 6 samples from sweden. as shown by the phylogram (figure), only one intergenic spacer genotype each was found for b. miyamotoi s.l. from the connecticut site and from sweden. in contrast, collections at the same sites and times, and from the same tick vectors, provided 8 intergenic spacer genotypes among 62 b. burgdorferi samples in i. scapularis and 9 intergenic spacer genotypes among 73 b. afzelii samples in i. ricinus (10). accepting a type i error level of 0.05, we would expect to have detected a second genotype of b. miyamotoi s.l. in a sample size of 22 the findings at the p66 locus for 10 connecticut samples and for 4 samples from sweden were similar : only one p66 genotype was detected at each location. unrooted maximum - likelihood phylogram for 16s-23s ribosomal rna gene intergenic spacer sequences of borrelia miyamotoi s.l. maximum likelihood settings for version 4.10b of paup (http://paup.csit.fsu.edu) for equally weighted characters corresponded to hasegawa - kishino - yano model with transition / transversion ratio, nucleotide frequencies, proportion of invariable sites, and gamma distribution shape parameter estimated by maximum likelihood. support for clades was evaluated by 100 bootstrap replications using full - heuristic search, and values > 50% are indicated along branches. solid and dashed scale bars indicate the number of substitutions per site for the corresponding branches. type 1 (ay363703), type 2 (ay363704), type 3 (ay363705), and type 4 (ay363706) ; b. lonestari type 1 (ay363707), type 2 (ay363708), and type 3 (ay363709) ; b. hermsii type 1 (ay515265), type 2 (ay515266), type 3 (ay515267), and type 4 (ay515269) ; b. turicatae type 1 (ay526494) and type 2 (ay526495). wa, washington state ; ca, california ; nm, new mexico ; co, colorado ; ks, kansas ; tx, texas ; il, illinois ; mo, missouri ; nj, new jersey. the samples of the other relapsing fever group species were not prospectively acquired for population studies, and thus, the findings provide only a tentative view of population structure. nevertheless, the results are consistent with an interpretation that the local strain diversity of the relapsing fever group species is more limited than that of lyme borreliosis agents. the intergenic spacer sequences of five b. miyamotoi isolates from ticks or mice from japan were identical, except for a single nucleotide in one isolate (figure) ; the p66 sequences were identical for each of the five isolates. four intergenic spacer genotypes were detected from the nine isolates of b. hermsii from different regions of the western united states ; the three intergenic spacer genotypes that were examined each had a different p66 allele. two of the linked intergenic spacer and p66 genotypes were unique to species from the rocky mountain region. the two strains of b. turicatae from texas and kansas differed in intergenic spacer genotype. a. americanum ticks collected in three states yielded three intergenic spacer genotypes from 20 samples positive for b. lonestari (table and figure). two of the linked genotypes were found at all three locations ; one was found in missouri and new jersey but not in illinois. samples of the b. miyamotoi s.l. showed greater genetic diversity at the intergenic spacer locus than did samples from other genomic groups (figure). however, even for species with fewer polymorphisms (table), the intergenic spacer sequences, with or without the p66 sequences, confirmed the monophyly of strains within each species. this pattern of relationship and the lack of evidence of gene conversion from horizontal gene transfer at this locus, demonstrates that, as for the lyme borreliosis spirochetes (10), the intergenic spacer region is both sensitive and sufficient for genotyping the relapsing fever group of borrelia species. sequencing this locus provides a means for further epidemiologic and ecologic studies of the newly discovered borrelia species of hard ticks, as well as of the relapsing fever agents that are reemerging as human pathogens (1). certain intergenic spacer genotypes of b. burgdorferi are associated with certain virulence phenotypes in humans (14). strain typing by pcr and sequence analysis should also be useful for identifying and characterizing the vertebrate reservoirs of b. lonestari and b. miyamotoi s.l. the linkage disequilibrium between the intergenic spacer and p66 loci indicate that the relapsing fever group species, like lyme borreliosis spirochetes (10,15), are highly clonal bacteria. why these two groups of tick - borne spirochetes appear to have different population structures | partial sequencing of the 16s-23s rdna intergenic spacer showed two to four genotypes each for borrelia hermsii and b. turicatae, both relapsing fever agents transmitted by argasid ticks, and for b. miyamotoi and b. lonestari, transmitted by ixodid ticks. field surveys of ixodes ticks in connecticut and sweden showed limited local diversity for b. miyamotoi. |
sentinel lymph node biopsy (slnb) is the standard practice for pathological staging in patients with localized melanoma in most melanoma centers worldwide [1, 2 ]. with a 20% likelihood of yielding positive results, it spares most patients to a complete lymph node dissection (clnd), a more invasive procedure [16 ]. although several factors have been identified as predictors of a positive slnb, only few have been proved to be independent predictors after adjusting for confounding variables. breslow thickness is the most consistently reported and well - established predictor of sentinel lymph node (sln) metastasis. other reported predictive factors are age, gender, primary site, ulceration, tumor mitotic rate, clark level, lymphovascular invasion, and absence of tumor - infiltrating lymphocytes [59 ]., management guidelines issued by the national comprehensive cancer network (nccn) emphasize the role of sln biopsy as staging and prognostic procedure. we investigated the association of several clinical and pathological variables with an increased likelihood of positive slnb and factors that have an impact in melanoma - related death in our population. we did a retrospective chart review of 221 cases of cutaneous melanoma which had a successful slnb. the cases were all from our department and refer to the period from january 2004 to december 2010. the procedure was performed in the presence of melanoma > 1.0 mm, or even thinner if adverse prognostic features were present, as recommended by nccn guidelines. most of the patients were staged up to t1b, but nine patients were in t1a, seven of them with exactly 1 mm breslow thickness. only patients without clinical or radiological evidence of nodal or distant metastases were selected to be submitted to slnb. lymphoscintigraphy was performed the day before surgery by intradermal injection of technetium 99 m sulfur colloid around the primary lesion or biopsy site to identify lymphatic basins by gamma imaging. single - photon emission computed tomography (spect) drainage was used in patient 's complex lymphatic drainage. the site of the sentinel lymph node (hot spot) was marked on the skin. on the day of surgery, with the aid of a hand - held gamma probe, a 1015 mm incision was made over the marked lymph node basin and after careful exploration of the tissue, the slb was localized and excised. all nodes with radioactive counts exceeding 10% of the node with the highest radioactive count were removed and sent for histopathological analysis. our data contains patient characteristics like age, gender, and location of the primary lesion (categorized into four anatomic locations : head and neck, trunk, upper limb, and lower limb) and histological features of the primary melanoma such as breslow thickness, tumor type, mitotic rate, ulceration, neurotropism, angioinvasion, and presence / absence of tumor - infiltrating lymphocytes. a pathologist (maria jos julio) reviewed the histological sections of all positive sln in our data to exclude misinterpretations in the original pathology reports. the slides were stained with hematoxylin - eosin and immunohistochemistry examination involved s100 and hmb45. the following micromorphometric features were registered : sln basin site, number of positive sln, size of largest metastatic deposit in sln (stratified into 2 groups : 1 mm and > 1 mm), intranodal location of tumor deposits (subcapsular, parenchymal, both, or extensive), number of metastatic foci, and presence of extranodal invasion and perinodal lymphatic invasion. clnd positivity (when performed), melanoma recurrence (peritumoral skin), and survival outcomes were assessed. statistical analysis was performed using software package for statistical science (spss for windows, version 18.0, chicago, il, usa). categorical data are presented as frequency (percentage) and continuous data are presented as mean standard deviation. for the comparison of categorical data, we used univariate and multivariate logistic regressions to test the correlation of each variable with slnb positivity. odds ratios of the significant predictors are provided along with 95% confidence intervals (ci). some histological variables were reported inconsistently and were not included in the data. overall survival (os) was calculated from the slnb to the date of death or last follow - up visit for all patients. kaplan - meier survival curves were compared with the logrank test ; multivariate analysis was performed using a cox regression model to estimate significant independent prognostic factors on survival. a test statistic with a p value 60 years (p 1 mm (p < 0.05), and local recurrence (p < 0.001) (figure 2). we found no significant correlation between overall survival and extracapsular invasion, perinodal lymphatic involvement, intranodal location of tumor, number of metastatic foci, or clnd. on multivariate cox proportional hazard analyses, independent significant prognostic factors for melanoma - specific survival were breslow thickness and sln status, whilst the other variables lose their association (table 5). the 5-year overall survival was significantly shorter in sln positive patients than in sln negative patients (53.1% versus 88.2%, p < 0.001), and about 35.4% of sln positive patients (n = 17) had melanoma - related death compared with 9.2% sln negative patients (n = 16) (p < 0.001, or 5.38, 95% ci 2.4611.78) (table 2). of the 21 patients in t1 stage none died of melanoma (table 6). instead, the cases of melanoma - related death (mrd) increased with breslow thickness (34.9% in t4 category, p < 0.001). despite the small number of patients in our study, our major findings are consistent with previous large trials. in particular, the slnb positivity rate and the percentage of additional lymph node metastasis reported in the previous literature are both about 20%, in line with our results [3, 5 ]. multicentre selective lymphadenectomy trial i (mslt - i) showed that patients with positive slnb who underwent immediate clnd had higher survival rates than those who only had lymph node dissection if clinical disease appeared (72% versus 52%). this result highlights the staging and prognostic value of sln biopsy, with an attempted intervention when the nodal tumor burden in sln positive patients is lower compared with clinically detected nodal metastases. our results confirm the predictive significance of breslow thickness and support the efficacy of sln biopsy as a staging and prognostic procedure. this reflects in part the heterogeneity in the measurement of the variables used in different studies, especially in the histological variables for which there is no standardized reporting. despite these findings, the practical indications for an slnb have not substantially changed in the last years. nowadays, an slnb is formally recommended for patients over the stage ib in the ajcc melanoma staging system. stage ib includes cutaneous melanomas greater than 1 mm in thickness, or thinner melanomas that also have ulceration or at least 1 mitosis per millimeter squared. an slnb biopsy should also be discussed and considered for patients with stage ia (1 mm in breslow thickness and no ulceration or mitoses) if adverse prognostic features are present. although there is no consensus about what defines adverse prognostic features, such features could include thickness over 0.75 mm, positive deep margins, lymphovascular invasion, or young age. although only 5% of positive slnb results are found in t1 melanomas, a small group of patients will benefit from a therapeutic procedure such as clnd, or inclusion in control trials [1416 ]. this explains our low threshold for an slnb, and our results are consistent with other studies. as expected, we find that this subset of patients has a better prognosis, with no melanoma - related death among the 21 patients staged in t1. cadili and dabbs (2010) found a higher rate of sln metastasis in nodular melanoma, and they hypothesized an inherent biological characteristic of nodular melanomas as an explanation for this finding. in addition, the presence of lymphocytic infiltrate was associated with a lower likelihood of a positive slnb, which highlights its protector value against sln metastasis [4, 17 ]. in contrast to other studies, we did not find any association of sln positivity with age, even after stratification by age groups. the sln status was shown to be a highly significant prognostic factor of overall survival, with a 5-year survival of about 88% in patients with negative slnb and 53% in those with positive slnb. it is worth noting that factors predictive of sln metastasis are similar to the prognostic factors for survival in melanoma patients. some authors have demonstrated that the prognosis of sln positive patients correlates with sentinel node tumor features, such as the maximum size of metastatic foci, intranodal location of tumor, extranodal spread, and perinodal lymphatic invasion [1821 ]. positivity of clnd was not significantly associated with a worse prognosis, perhaps due to the small sample in our study. to point out that the prognostic impact of local recurrence (peritumoral skin) was lost after adjustment for the others factors. this study has some limitations, as it is based on a relatively small sample and the variables were assessed retrospectively. moreover, information about the mitotic rate, a recently t1b criterion, was not always present, and some incomplete histological reports did not allow to incorporate more variables for statistical treatment. an interesting particularity in our melanoma patient 's population is a remarkable high number of melanomas on the lower limbs, mainly on the feet (21.3% of all cases). the biological behavior of melanoma is influenced by numerous factors (genetic, environment) which can vary from one region to another. it is thus worth knowing more about our particular population, combining clinical and histological features, and identifying subgroups of patients to allow for an individual clinical decision supported by evidence - based guidelines. | background. sentinel lymph node biopsy (slnb) is a standard procedure for patients with localized cutaneous melanoma. the national comprehensive cancer network (nccn) melanoma panel has reinforced the status of the sentinel lymph node (sln) as an important prognostic factor for melanoma survival. we sought to identify predictive factors associated with a positive slnb and overall survival in our population. methods. we performed a retrospective chart review of 221 patients who have done a successful slnb for melanoma between 2004 and 2010 at our department. univariate and multivariate analyses were done. results. the slnb was positive in 48 patients (21.7%). univariate analysis showed that male gender, increasing breslow thickness, tumor type, and absence of tumor - infiltrating lymphocytes were significantly associated with a positive slnb. multivariate analysis confirmed that breslow thickness and the absence of tumor - infiltrating lymphocytes are independently predictive of sln metastasis. the 5-year survival rates were 53.1% for sln positive patients and 88.2% for sln negative patients. breslow thickness and the sln status independently predict overall survival. conclusions. the risk factors for a positive slnb are consistent with those found in the previous literature. in addition, the sln status is a major determinant of survival, which highlights its importance in melanoma management. |
plants have a problem in dealing with cations. the potassium ion is the preferred inorganic cation of living cells, and plants are no exception to this rule ; invariably the concentration of k in the soil solution is lower than the cytosolic k concentration (100 - 200 mm), meaning that plants must actively take up and concentrate k using various types of ion transporter. because na is similar to k, and many k transporters do not discriminate sufficiently between these cations, excess external na can not only impair k acquisition but also lead to accumulation of na in plant cells, and as na is toxic to cells, this is undesirable. in terms of their ability to tolerate saline (mainly nacl) environments, glycophytes are salt - sensitive plants, including most cultivated species, that do not tolerate long exposure to even mild salinity. to avert na toxicity most glycophytes rely on restricting na intake, but because the cell 's interior is electronegative relative to the extracellular space, and because cation transporters in cell membranes are somewhat permeable to na, there is constant influx of na down this electrochemical gradient that can not be completely prevented. moreover, the outcome of long - term inhibition of k acquisition by competing na is chronic k deficiency. salt - tolerant plants, or halophytes (for example, the common ice plant mesembryanthemum crystallinum), in contrast, implement the alternative strategy to cope with excess ions in the soil solution. by coupling the uptake of ions by their roots with the compartmentation of ions into cellular vacuoles, halophytes effectively manage to convert potentially toxic ions into usable osmolytes, thereby accomplishing the greatest survival trick - turning a foe into a friend. most agriculturally important plants are glycophytes, so soil salinity represents a significant factor hindering crop yield in large areas of the world. although the capacity for selective ion uptake and efficient vacuolar compartmentation have long been regarded as the basis for tolerance of salinity, and so have become desirable traits in crops, a lack of understanding about the molecular entities mediating na transport and how na acquisition is coordinated has impaired progress in obtaining salt - tolerant crops. here, we summarize recent genetic and comparative studies in various plant species that have shed light on how na uptake and vacuolar compartmentation achieve ion homeostasis during episodes of salt stress. the roles of a number of classes of ion transporter have been clarified, and the pathways of transporter regulation are beginning to be identified. pioneering studies conducted more than 30 years ago by epstein and co - workers (see) demonstrated that na competes with k for uptake by plant roots, implying that k transporters are also the gates for na entry. although the first k transporters were cloned a decade ago, however, the identity of the major pathway(s) for na uptake has remained elusive. transporters of the hak - kt - kup family (which includes the high - affinity k - uptake transporter hak, k transporter kt, and k - uptake transporter kup) are highly selective for k (km 10 - 50 m) but can also transport na, albeit with much lower affinity. hak - kt - kup proteins are thought to be k / h symporters (moving both molecules in the same direction), permitting a concentration of k against its electrochemical gradient, to ensure k nutrition. another family of transporters, the hkt - trk proteins (which includes the high - affinity k transporter hkt and its homologs), shows mixed ion selectivity when expressed in heterologous systems. the wheat tahkt1, for example, functions as a na / k symporter at micromolar na concentrations but as a na uniporter (transporting only this single type of ion) at millimolar na concentrations, whereas the arabidopsis athkt1 transports only na. rice has both types of transporter : oshkt1 is a na transporter like athkt1 but oshkt2 behaves as a symporter or uniporter as does tahkt1. transcripts of the oshkt genes accumulated under low k concentrations and diminish in high external na ; together with the nature of the transporters, these data suggest that hkt proteins might mediate substantial na uptake. genetic evidence supporting a significant role for hkt proteins in na uptake has been provided recently by rus.. the arabidopsis sos3 (salt overly - sensitive 3) gene product is a ca - binding protein, deficiency in which elicits na sensitivity and an inability to grow at low external k concentrations. theoretically, hypersensitivity of sos3 mutant plants to nacl could arise either from increased na entry or from reduced k uptake. searching for mutations in other genes that suppressed the salt - sensitive phenotype of sos3 mutants, rus. isolated two independent loss - of - function mutants in athkt1, the only gene of the hkt - trk family in arabidopsis. the hkt1 mutation dramatically reduced the net na content of hkt1 sos3 double - mutant plants under a saline regime, to levels even lower than those of wild - type plants. interestingly, the hkt1 mutation also suppressed, instead of exacerbating, the low - k phenotype of sos3 plants. in fact, the k content of hkt1 sos3 double - mutant plants was higher than that of wild - type plants. together, these results indicate that athkt1 is not a relevant k - uptake system and provide evidence of substantial na influx through athkt1. because athkt1 is preferentially expressed in roots, it may mediate physiological na uptake in conditions of poor k availability, in which na could partially substitute for k, for instance as osmoticum (a solute contributing to osmotic pressure) in the vacuole. the recent study by rus. leaves open the question of whether or not the cation selectivity of athkt1 is regulated by a sos3-dependent signaling pathway. fungal trk k transport proteins, which are structurally related to hkts, modulate their na / k selectivity according to the ionic environment and the k status of the cell. because the hkt1 mutation was not segregated from the sos3 mutant background to assess the phenotype of a single hkt1 mutant, it is unclear whether athkt1 is an unconditional na transporter or if its na / k selectivity is distorted in the sos3 mutant background, allowing unrestricted na entry. thus, it remains possible that na uptake through athkt1 becomes detrimental to the plant only when other relevant na fluxes are compromised by the sos3 mutation (figure 1). is that the capacity of the hkt1 mutation to suppress the na sensitivity of sos3 mutant plants disappeared in medium with low concentrations of ca (0.15 mm). this suggests the operation of an alternative na - influx system, different from athkt1, that is hampered by high ca (2 mm) but becomes the prevalent pathway for na entry at low external ca concentrations. electrophysiological studies have confirmed the presence of non - selective voltage - independent cation channels (known as nsccs or vics) in arabidopsis root cells. these channels lack significant selectivity between monovalent cations, their affinity for k being only slightly higher than their na affinity (pk / pna = 1.49), and they are strongly blocked by external ca at low concentrations, with half - maximal inhibition at 0.1 mm. the probability of the nscc / vic channel being open decreased 10 - 15-fold with a 10-fold increase in external ca concentration. on the basis of similarities between nscc / vic transport behavior and na uptake by intact roots, nscc nscc / vics appear to be widespread among plants but their physiological function and molecular identity have remained obscure. recently, maathuis and sanders have shown that some nscc / vic currents are rapidly and reversibly deactivated by cyclic nucleotides (camp and cgmp) on the cytosolic side of root cell membranes, suggesting a direct interaction of cyclic nucleotides with the channel. there are 20 candidate genes in the arabidopsis genome that encode putative cyclic - nucleotide - gated channels (cngcs), having hallmark cyclic - nucleotide- and calmodulin - binding domains. in keeping with the idea that a nucleotide - sensitive nscc / vic forms a major pathway for na influx, supplemental camp and cgmp were found to improve the tolerance of arabidopsis seedlings to nacl but not to equivalent concentrations (equiosmolar amounts) of sorbitol. salt tolerance induced by cyclic nucleotides correlated with less accumulation of na after 5 days exposure to nacl and reduced uptake of radioactively labeled na in short - term experiments. it appears that only a subtype of nscc / vics are cngcs, however, because nucleotide sensitivity was found in only a fraction of cells exhibiting nscc / vic currents. moreover, the arabidopsis polypepetide cngc2, which has homology to animal ion channels, is activated by cyclic nucleotides, rather than inactivated, and displays different transport properties from nscc / vics. a mutant screen for improved tolerance to na at low external ca, perhaps in the sos3 mutant background, could confirm whether or not nscc / vics contribute to the ca - sensitive pathway for na influx unmasked by the hkt1 mutation, and could establish whether these channels belong to the cngc family. ion compartmentation is one successful strategy used by plant cells to cope with saline stress, because it couples growth by cell expansion, mainly due to an enlarging vacuole, with ion sequestration and detoxification from the cytosol. accrued ions provide energetically cheap osmoticum that helps balance the plant 's osmotic potential with that of the hypertonic soil solution, thereby alleviating the water deficit that is inherent to plants in a saline environment. the na / h antiporters (which transport the two ions in opposite directions) at the tonoplast (vacuolar membrane), mediate the transport of na into the vacuoles, with the energy for this coming from the electrochemical gradient of protons generated by the vacuolar h - atpase and h - pyrophosphatase. have reported inducing increased salt- and drought - tolerance in arabidopsis plants by moderate overexpression of the endogenous arabidopsis vacuolar h - pyrophosphatase, avp1. the stress tolerance of plants exposed to salinity was correlated with more negative solute potential (that is, greater concentration of total osmolytes), which permitted better water retention by desiccating plants, and with larger pools of na and k (a 20 - 40% increase in concentration). presumably, na accumulation occurs because of a greater h gradient and enhanced na / h exchange across the tonoplast, although the activity of the na / h antiporter in vesicles of this membrane was not experimentally determined. accumulation of k could also result from the activity of the vacuolar antiporters, one of which, nhx1 (na / h exchanger 1), has been shown to transport na and k. consistent with this interpretation, overexpression of the vacuolar cation antiporter nhx1 also increased the salt tolerance of arabidopsis, tomato and canola plants. vacuoles isolated from leaves of transgenic arabidopsis sustained higher na / h exchange rates, which directed greater na accumulation into aerial tissues than in wild - type plants. drought tolerance of nhx1 transgenics was not examined, however, leaving the unanswered question of whether stress tolerance imparted by avp1 can be explained solely by nhx1 upregulation. it would be informative to compare avp1 and nhx1 plants side by side and to test whether plants overexpressing both proteins are more stress - tolerant than either of the single - gene transgenics. similarly, given that plants engineered to amass more organic solutes, such as proline or polyalcohols, are also stress - tolerant, super - plants combining a greater capacity for the accumulation of ions in the vacuole and for accumulation of compatible solutes in the cytosol hold great promise for substantially improved fitness in adverse environments. by looking in a variety of plant species, genomic tools promise to assist in furthering our understanding of the molecular basis for salt - tolerance, and our ability to engineer it, in the future. sodium ions enter root cells through hkt proteins and non - selective voltage - independent cation channels, some of which (labeled cngc) are inactivated by cyclic nucleotides (camp and cgmp). although there is no direct experimental evidence for this suggestion, the transport activity or ion selectivity of hkt proteins could be regulated by a process dependent on the ca sensor sos3 to prevent excessive na uptake. sos3 associated with the protein kinase sos2 positively regulates the activity of the plasma membrane na / hantiporter sos1, which in turn mediates na extrusion and possibly long - distance na transport from roots to shoots. cytoplasmic na is compartmentalized into vacuoles within cells by the tonoplast (vacuolar membrane) na / h antiporter nhx1, dissipating the h gradient generated by the v - atpase (not shown) and the pyrophosphatase avp1 (which hydrolyzes pyrophosphate, ppi). | plants face a dilemma about sodium metabolism. uptake of ubiquitous sodium ions is desirable as a way to build osmotic potential, absorb water and sustain turgor, but excess sodium ions may be toxic. information from a number of plant species about the proteins involved in sodium - ion uptake helps to explain how plants manage to take in just the right amount. |
fungal species of the genus fusarium have been indicated as widely distributed plant pathogens and not only cause yield and quality losses but also lead to formation of mycotoxins that are hazardous to animals and humans. however, the contamination of various commodities, like barley, wheat, maize, or rice, with fusarium mycotoxins is often unavoidable.(1) also, fusarium strains isolated from potato tubers prevalently produce mycotoxins.(2) trichothecenes are an important class of mycotoxins and share a tricyclic nucleus, containing an epoxide group at c-12 and c-13, which is essential for their toxicity.(3) trichothecenes act as potent protein synthesis inhibitors in eukaryotic organisms.(4) at least 182 different trichothecenes have been isolated from natural sources.(5) trichothecenes can be classified into types a-, b-, c-, and d - trichothecenes, according to structural differences. among the most commonly occurring trichothecenes are the type b trichothecene deoxynivalenol and the type a trichothecenes t-2 toxin and its hydrolyzed derivative ht-2 toxin. europe, in comparison to the other continents of the world, has one of the most explicit regulations for mycotoxins in food and feed. in the eu, maximum tolerated limits have been established for several mycotoxin food combinations.(6) a sum parameter for t-2 and ht-2 toxin in cereals and cereal products is considered but not yet in force. scirpentriol (3,4,15-trihydroxy-12,13-epoxytrichothec-9-ene) has three hydroxyl groups that can be partly or fully acetylated, forming three monoacetoxyscirpenols, three diacetoxyscirpenols, and triacetoxyscirpenol.(7) members of the scirpentriol family, particularly 4,15-diacetoxyscirpenol (1) (figure 1, das), were described to be toxic against plants and animals.(10) 4,15-diacetoxyscirpenol was detected and isolated from cultures of fusarium equiseti (gibberella intricans), and its chemical properties and structure have been characterized.(11) 4,15-diacetoxyscirpenol can also be produced by a number of other fusarium species, including gibberella pulicaris (asexual stage : fusarium sambucinum), which is the major causative agent of potato tuber dry - rot. this important storage disease of potato tubers is of economic significance worldwide.(14) susceptibility of potato cultivars toward f. sambucinum correlates highly with the concentration of 4,15-diacetoxyscirpenol in infected tubers.(15) the production of trichothecenes may occur in potatoes artificially and naturally infected with this fungus either in the field or during storage. ld50 values of 4,15-diacetoxyscirpenol have been investigated in different animal species and found to be 23 mg / kg in mouse (intraperitoneal), 7.3 mg / kg in rat (oral), 1.0 mg / kg in rabbit (intravenous), and 0.37 mg / kg in swine (intravenous).(18) chemical structures of 4,15-diacetoxyscirpenol (1) and das - m1 (2). in the current study, the reduction of 4,15-diacetoxyscirpenol due to thermal treatment in aqueous solution was monitored, detecting a new major derivative. in addition, this conversion was monitored by cooking potatoes inoculated with fusarium sambucinum (synonym : f. sulphureum) strain mrc514.(19) after isolation, the structure of this derivative, termed das - m1 (2) (figure 1), was elucidated with nmr. the toxicity of das - m1, in comparison to 4,15-diacetoxyscirpenol, has been examined in vitro by a wheat germ extract transcription / translation system and in vivo on saccharomyces cerevisiae. strain mrc514,(19) which is a prolific producer of 4,15-diacetoxyscirpenol in liquid medium, was sporulated in mung bean broth. liquid czapek dox medium containing 2% peptone was inoculated with 10 spores/25 ml in magenta boxes. the still cultures were incubated in a plant growth chamber (16 h light/8 h dark) at 22 c. after 3 weeks of incubation the mycelia were removed from the cultures by suction filtration and the filtrates were extracted with 1 volume of ethyl acetate. the pooled ethyl acetate extracts were used for silica gel normal - phase flash chromatography using gradient elution with ethyl acetate / methanol (20% 100% methanol). ms / ms instrument (ab sciex, foster city, ca) equipped with a heated nebulizer (apci) source. the appropriate fractions were used for the purification of 4,15-diacetoxyscirpenol by an 1100 series preparative hplc system (agilent technologies, waldbronn, germany)., 10 m, luna rp - c18(2) semipreparative column (phenomenex, aschaffenburg, germany). an injection volume of 500 l and a flow rate of 16 ml / min were chosen. mobile phases were milli - q water (millipore, molsheim, france) and lc grade methanol (merck, darmstadt, germany). after an initial hold time of 2 min with 20% methanol, a linear gradient was applied which reached 100% methanol after 10 min. a 2 min hold time at the same composition was followed by a rapid change to the starting conditions, which were held for another 3 min to re - equilibrate the column. das - m1 was produced from an aqueous solution of 3.8 mg of 4,15-diacetoxyscirpenol after treatment for 72 h at 100 c under reflux. an amount of 2.96 mg of das - m1 was purified from this solution by preparative hplc system with the conditions shown above. 4,15-diacetoxyscirpenol eluted at 9.30 min, while the more polar das - m1 eluted at 7.90 min. ms / ms system with an apci source (see above) was used to characterize the purified compounds. chromatographic separation was achieved on an agilent 1100 hplc system using a 150 mm 4.6 mm i.d., 5 m, gemini rp - c18 column (phenomenex) at 25 c. a linear gradient from 20% to 90% aqueous methanol, containing 5 mm ammonium acetate, was applied. an amount of 25 l of each sample was injected into a flow rate of 1 ml / min. ms parameters were the following : curtain gas 35 psi (241 kpa), nebulizer gas 60 psi (414 kpa), auxiliary gas 15 psi (103 kpa), declustering potential 21 v, entrance potential 5.5 v. for characterization experiments, 10 mg / l solutions of 4,15-diacetoxyscirpenol and das - m1 were prepared in 50% aqueous methanol and injected by hplc. first, q3 full scans were acquired in positive mode from m / z 200700 within 1 s. the enhanced product ion (epi) scan mode was used to acquire ms / ms spectra between m / z 150 and 450. for the epi scans, the following further parameters were set : scan rate 1000 da / s, q0 trapping on, linear ion trap fill time 20 ms, collision energy 20 ev. the srm mode was used for quantitation of 4,15-diacetoxyscirpenol and das - m1. selection of the quantifier and qualifier transitions was based on transitions from the [m + nh4 ] ions to the most and second - most predominant fragment ions and were as follows : 4,15-diacetoxyscirpenol (quantifier) m / z 384.3 > 307.2 ; 4,15-diacetoxyscirpenol (qualifier) m / z 384.3 > 349.2 ; das - m1 (quantifier) m / z 402.3 > 325.2 ; das - m1 (qualifier) m / z 402.3 > 367.2. for all transitions, optimum declustering potentials of 21 v and collision energies of 15 ev were evaluated. analyst, version 1.5, was used for instrument control and data evaluation. for hr - ms experiments a ltq orbitrap xl high resolution mass spectrometer (thermo fisher scientific, waltham, ma) was used. a solution containing both 1 mg / l 4,15-diacetoxyscirpenol and das - m1 in 50% aqueous methanol together with 5 mm ammonium acetate was infused in the ion source using a syringe pump at a flow rate of 5 l / min. ionization was performed in electrospray positive mode with the following settings : ion transfer tube 300 c, sheath gas flow 45 (arbitrary units), auxiliary gas flow 5 (arbitrary units), source voltage 4 kv, capillary voltage 25 v, tube lens 125 v. ftms data were acquired at m / z 200700 with a resolution of 60.000. the ammonium adduct of 4,15-diacetoxyscirpenol was used for internal mass calibration (m / z 384.2017). possible elemental formulas were generated with the following restrictions : maximum mass deviation 2 ppm, number of carbon atoms 050, number of hydrogen atoms 0100, number of oxygen atoms 030, number of nitrogen atoms 010. the nitrogen rule was applied, ruling out elemental formulas with an odd number of nitrogen atoms. nmr spectra were recorded on a varian inova 600 mhz spectrometer (palo alto, ca). a concentrated solution of das - m1 in dmso - d6 in a 5 mm tube was used for structural determination. g - cosy (1024 256 data points) was used for scalar coupling correlation, and roesy (1024 256 data points) was used for dipolar coupling, using a 200 ms spin - lock time. the assignments were also confirmed by matching of the corresponding c h correlations obtained by hmqc spectra (with j1xh = 140 hz average scalar coupling constant). nmr spectra were processed with mestrec software (mestrelab research sl, santiago de compostela, spain). the trichothecene sensitive saccharomyces cerevisiae strain yzas107 (20) was used to investigate growth inhibition upon toxin addition in liquid cultures. an amount of 100 l of exponentially growing yeast cells (od600 = 0.05) in ypd medium was combined with 100 l of 4,15-diacetoxyscirpenol or das - m1 solutions in 10 ml glass tubes in triplicate. mg / l (054.6 m), while das - m1 concentrations ranged from 0 to 500 mg / l (1302 m) in water. tubes were incubated at 30 c for 24 h on a shaker (200 rpm). then an amount of 800 l of water was added to the tubes and the mixed contents were transferred into cuvettes. the absorbance of the initial cells at the beginning of the experiment was subtracted from all measured values. for the calculation of the percent growth, to analyze and compare the toxicities of das - m1 and 4,15-diacetoxyscirpenol in a cell - free system, an in vitro assay, based on inhibition of protein synthesis using translation of firefly luciferase in wheat germ extract (promega - tnt wheat germ extract, mannheim, germany), was performed according to the manufacturer s instructions. after 30 min (still in the linear range of product formation) the reactions containing variable concentrations of toxin were stopped by addition of 1 l of 20 mm cycloheximide solution. the reaction mixtures were transferred into a 96-well black plate, and an amount of 20 l of luciferase assay reagent (promega, mannheim, germany) was added. the amount of light produced by the formed luciferase was measured in a multichannel luminometer (wallac 1420 victor2, perkin - elmer, san jose, ca). the first experiment was conducted with pure 4,15-diacetoxyscirpenol standards in h2o. in order to examine the effects of ph on the conversion of 4,15-diacetoxyscirpenol to das - m1, the standard solutions (27.2 m) were prepared at three different ph values of 3.0, 5.0, and 7.0 in respective buffer solutions. the cooking tests were performed at three different temperatures : at 80 c (using a drying chamber), 100 c (under reflux) for 1, 4, and 8 h, respectively, and also at 121 c by using a pressure cooker (2 bar) for 1 and 4 h. all tests were carried out in triplicate. for the second set of thermal treatment tests, 25 potatoes of the cultivar tosca with similar sizes were washed and weighed. surfaces were sterilized by 10% chlorine bleach for 510 min, and afterward the potatoes were washed 3 times with sterile water for 5 min. a 3 mm deep cut was made in the middle of each potato by using a 9 mm cork borer. afterward, a 9 mm agar block from 3 d old pda plates inoculated with spores of the fusarium sambucinum strain mrc514 was inserted into the wound. agar (2% agar in h2o) and incubated for 14 d at 20 c in the dark. five potatoes were chosen randomly as controls (uncooked), and five potatoes from each treatment were cooked or autoclaved for 1 or 4 h, respectively. for cooking, each potato was put into a 400 ml beaker filled with 200 ml of boiling doubly distilled water. the beakers were covered by aluminum foil, the water levels were marked on the glass, and the beakers were put on a heat plate for 1 and 4 h, respectively. the water level was kept constant during the experiment by successively adding water as required. the pressure cooking experiments were carried out by autoclaving five potatoes each for 1 or 4 h, respectively, at 121 c, 2 bar. for this experiment the potatoes were also kept in 200 ml of water in 400 ml beakers, which were covered with aluminum foil. each tuber was cut into small pieces, and an amount of 200 ml of doubly distilled water was added. the contents of the beakers (from all experiments) were shredded with an ultra - turrax t25 (ika, staufen, germany) for 5 min. the homogenized samples were transferred into 600 ml beakers, and an amount of 200 ml of acetonitrile was added to each sample. the 2 ml aliquots of each sample were evaporated to dryness under a gentle stream of nitrogen, and the residues were dissolved in 100 l of 50% aqueous methanol. a reduction of the 4,15-diacetoxyscirpenol concentrations in repeatedly heat treated 4,15-diacetoxyscirpenol stock solutions was noted. the investigation of this unexpected effect led to the identification of a putative major degradation product, named das - m1, which was purified by preparative hplc for further characterization. for comparison of collision induced dissociation fragmentation patterns, enhanced product ion (epi) mass spectra of 4,15-diacetoxyscirpenol (figure 2a) and purified das - m1 (figure 2b) were recorded at equal concentrations (2.7 m). the ms / ms scans were performed in the positive ionization mode in the range of m / z 150450 with collision energies of 20 ev using the ammoniated ions as precursors. despite the mass difference of 18 da of the precursor ions, very similar ms / ms spectra, corresponding to neutral losses of multiple water and acetic acid molecules, were gained for both compounds. the elemental formula of das - m1 was obtained by high resolution mass spectrometry using a ltq - orbitrap and applying internal mass calibration. two major ions were visible in the spectrum at m / z 402.2124 and m / z 407.1677, showing the [m + nh4 ] and [m + na ] adducts, respectively. the difference between the theoretical mass and the measured mass of the [nh4 ] and [na ] adducts of das - m1 was + 0.4 and + 0.1 ppm, respectively. the obtained elemental formula corresponds to the sum of the 4,15-diacetoxyscirpenol formula (c19h26o7) plus h2o. ms / ms spectra of 4,15-diacetoxyscirpenol (a) and das - m1 (b). nmr measurements (table 1) revealed the exact chemical structure of das - m1. first of all, two acetyl groups, whose h and c chemical shift are similar to those of 4,15-diacetoxyscirpenol,(21) were assigned. furthermore, there are three hydroxy protons (identified by the lack of correlation in h c heterocorrelate spectrum). it is difficult to envisage some alternative structure in which two hydroxyl protons are not coupled. the proton and carbon signals for both the epoxide (h, 2.75 + 2.98 ppm ; c, 46.15 ppm) and the alkene (c for carbon 9, 139.05 ppm) in 4,15-diacetoxyscirpenol are not present in das - m1, showing the modification of these structural elements. however, since the hydrogen deficiency index is decreased by only one unit, either another double bond or another ring has to be formed. since no signal consistent with an alkene proton or carbon is seen, we conclude that a new ring is formed. ch3 - 16 is not coupled to any other proton, though it is no longer linked to an alkene. there are four ch2, five ch, and four ch3 groups in the spectra. two proton signals appeared at 1.65 and 1.30 ppm, which could be due to the ch2 group on carbon 13. however, the chemical shifts indicate that these protons are not on a carbon bearing oxygen. most important, these protons are coupled to a proton (at 1.95 ppm, identified as 10), which in turn is coupled to proton on carbon 11 (3.48 ppm). the roesy spectrum indicates the proximity of one oh to ch3 - 16 (1.05 ppm) and of the other to ch3 - 14 (0.84 ppm). a possible mechanism was proposed for other trichothecenes.(22) after protonation, an intramolecular attack by the -bond acting as nucleophile occurs, favored by the formation of a tertiary carbonium ion. the latter is then able to react with water as nucleophile from the rear side of the ring. assignments were made on the basis of g - cosy, roesy, and hmqc spectra. multiplicity : s, singlet ; d, doublet ; dd, doublet of doublets ; dt, doublet of triplets ; ddd, doublet of doublets of doublets ; m, multiplet. assignment based on roesy correlation with other protons. while the elucidated structure of das - m1 is new, analogue reaction products have been reported in very early literature about 4,15-diacetoxyscirpenol.(3) also for t-2 toxin, a similar reaction was found to form t-2 tetraol hydrates,(23) which proved to be nontoxic in a feed refusal assay with mice. as expected, 4,15-diacetoxyscirpenol strongly inhibited growth of the highly trichothecene sensitive yeast strain yzas107.(20) 4,15-diacetoxyscirpenol concentrations in the range of about 11 m led to a growth reduction of > 90% (figure 3). in contrast, das - m1 did not show any reduction of growth at the same concentration. a reduction of growth of > 90% was obtained only after adding about 600 m das - m1 to the growing yeast cells in liquid medium. we conclude that the in vivo toxicity of das - m1 to the indicator yeast is at about a factor of 50 lower than that of 4,15-diacetoxyscirpenol. a coupled in vitro transcription / translation system based on a wheat germ extract was used to express the reporter gene firefly luciferase, which oxidizes luciferin and releases light. the amount of light, which can be measured in a luminometer, is proportional to the amount of expressed enzyme. 4,15-diacetoxyscirpenol inhibits protein synthesis, which is reflected in the concentration dependent decrease of luciferase activity (figure 4). average values of the duplicate measurements showed that the inhibitory effect of 4,15-diacetoxyscirpenol is much higher than of the same concentration of das - m1. the ic50 value could not be reached for das - m1 even at 2 m. to compare the two substances with the available data, concentrations where 4,15-diacetoxyscirpenol reached this value (actually 68%) at 0.01 m, while 2 m das - m1 was necessary to reach a similar value (64%). from these results, we infer that the inhibitory influence of 4,15-diacetoxyscirpenol on protein biosynthesis is about 100 times higher than that of das - m1. the thermal treatment of aqueous 4,15-diacetoxyscirpenol standards resulted in the formation of das - m1. the conversion was increased considerably by either higher temperatures or more acidic ph values (table 2). for example, exposure to elevated temperatures for 4 h at ph 7.0 resulted in a decrease of 1%, 20%, or 46% 4,15-diacetoxyscirpenol at 80, 100, or 121 c, respectively. at ph 3.0 (again for 4 h of treatment), already 8%, 38%, or 91% less 4,15-diacetoxyscirpenol was found at 80, 100, or 121 c. also, the results of cooking potatoes inoculated with fusarium sambucinum showed that the amount of 4,15-diacetoxyscirpenol was the highest in the case of uncooked potatoes. here, a reduction of 26% 4,15-diacetoxyscirpenol after 1 h of cooking at 100 c and 81% after 4 h was observed. the transformation of 4,15-diacetoxyscirpenol to das - m1 was increased when a pressure cooker (121 c) was used. 89% or even 100% of 4,15-diacetoxyscirpenol was turned over after cooking for 1 or 4 h, respectively, even at neutral ph. this is particularly intriguing, as mycotoxins usually are considered to be thermally very stable. the long cooking times required to inactivate most of the toxin make it unlikely that thermal treatment can be exploited as the detoxification method for food or feed. yet, possibly higher conversion rates due to slight acidification of the cooking water of potatoes (as seen with pure standards) might allow improvement of the process. from the viewpoint of analytical chemistry the generally assumed thermal stability of 4,15-diacetoxyscirpenol (and other trichothecenes) is relative. extended heat treatment of biological samples containing 4,15-diacetoxyscirpenol (e.g., culture filtrates in order to inactivate fusarium) or heating of analytical standards to increase the solubility should be avoided, since it might lead to significant losses and to formation of the rearranged reaction product das - m1. | trichothecenes are an important class of mycotoxins that act as potent protein synthesis inhibitors in eukaryotic organisms. the compound 4,15-diacetoxyscirpenol is highly toxic for plants and animals. potatoes are especially prone to be contaminated with 4,15-diacetoxyscirpenol after infection with fusarium sambucinum. in the current study, the reduction of 4,15-diacetoxyscirpenol during thermal treatment in aqueous solution was monitored. a new derivative was detected and named das - m1. after isolation, das - m1 was characterized with lc hr - ms and lc ms / ms and structurally elucidated with 1h, 13c, and 2d nmr. potatoes were inoculated with f. sambucinum, and the infected potatoes were cooked at 100 or 121 c, respectively. a reduction of 4,15-diacetoxyscirpenol from about 26% (1 h at 100 c) to 100% (4 h at 121 c) was detected by means of lc ms / ms analysis. the effects of different ph values on the reduction of 4,15-diacetoxyscirpenol were investigated, showing higher conversion rates at more acidic ph values. in addition, the toxicity of 4,15-diacetoxyscirpenol and das - m1 was compared in vitro using a wheat germ transcription / translation assay and in vivo on saccharomyces cerevisiae. the results show that the inhibitory effect of das - m1 on yeast growth is about 50 times lower and inhibition of protein synthesis is about 100 times lower than that of 4,15-diacetoxyscirpenol. |
this cross - sectional study was conducted in collaboration between department of psychiatry and diabetes clinic of department of medicine in a secondary care referral hospital. the hospital is a multispecialty treatment facility center catering to the health needs of a defined group of the population from the entire province. diabetes patients are evaluated in detail in routine clinical practice, and all relevant biochemical tests are performed. the nature and purpose of the study were explained to all the participants, and informed consent was obtained before their inclusion in the study sample. the study sample comprised 100 patients of diabetes between the ages of 1870 years attending the outpatient department (opd) of diabetes clinic. utmost care was taken to ensure the homogeneity of the sample population by recruiting the close relatives or friends of the patients as a control group. diabetes was defined as either requiring oral or injectable antidiabetic medication or having random blood glucose level above 200 mg / dl. (1) to have current substance use disorder using diagnostic and statistical manual, fourth edition (dsm - iv) criteria. (2) to have current or past psychosis or mania or any other mental disorder using dsm - iv criteria except existing major depressive disorder (mdd). (3) to have major medical or surgical problem before the diagnosis of diabetes. a detailed evaluation of sociodemographic and clinical profile was made on specially designed semi - structured instrument by interviewing the participants and from the medical records. this included duration of illness, duration of treatment, type of treatment, bmi, complications due to diabetes, fasting, and postprandial blood glucose levels. participants were also be assessed for the presence of depression and fatigability by applying the patient health questionnaire-9 (phq-9) and fatigue severity scale (fss), respectively. phq-9, a self - report version of prime - md11, which assesses the presence of mdd using modified dsm - iv criteria. there is a good agreement reported between the phq diagnosis and those of independent psychiatry health professionals (for the diagnosis of any one or more phq disorder, = 0.65 ; overall accuracy, 85% ; sensitivity, 75% ; specificity, 90%). in this study, it has been validated in indian population and is considered to be reliable tool for diagnosis of depression. the phq-9 is a dual instrument that is used to establish a provisional depressive disorder as well as it provides a symptoms severity score. for the diagnosis of depression, we defined clinical significant depression as : a phq-9 score of 10 or above the fss emphasizes the impact of fatigue on daily life in terms of accumulation of functional fatigue effects, which appears suitable for detecting the presence and severity of fatigue. fss is designed to differentiate fatigue from clinical depression, since they have some common symptoms. the fss test different domains including motivation, exercise, and interference with work, family, or social life. it is 9 item questionnaires, and scoring is done by adding up the response (numbers) and dividing by 9. a score of < 4 is considered as having no fatigue, score of 44.9 are considered as having moderate fatigue, and scores of 5 or more are considered as having severe fatigue. fss has shown good reliability with a cronbach 's = 0.89 and also a strong construct validity. all data collected were entered into microsoft excel 2007 worksheet in the form of a master chart. inferential statistics such as chi - square test was used to find out the association of fatigue and depression with various factors and odds ratio (or) was used to quantify the association of depression with diabetes. microsoft excel and primer software version 6 (developed by mcgraw - hill global education holdings, llc) were used for analysis of the data. a detailed evaluation of sociodemographic and clinical profile was made on specially designed semi - structured instrument by interviewing the participants and from the medical records. this included duration of illness, duration of treatment, type of treatment, bmi, complications due to diabetes, fasting, and postprandial blood glucose levels. participants were also be assessed for the presence of depression and fatigability by applying the patient health questionnaire-9 (phq-9) and fatigue severity scale (fss), respectively. phq-9, a self - report version of prime - md11, which assesses the presence of mdd using modified dsm - iv criteria. there is a good agreement reported between the phq diagnosis and those of independent psychiatry health professionals (for the diagnosis of any one or more phq disorder, = 0.65 ; overall accuracy, 85% ; sensitivity, 75% ; specificity, 90%). in this study, it has been validated in indian population and is considered to be reliable tool for diagnosis of depression. the phq-9 is a dual instrument that is used to establish a provisional depressive disorder as well as it provides a symptoms severity score. for the diagnosis of depression, we defined clinical significant depression as : a phq-9 score of 10 or above. fss is the most commonly used fatigue specific questionnaire. the fss emphasizes the impact of fatigue on daily life in terms of accumulation of functional fatigue effects, which appears suitable for detecting the presence and severity of fatigue. fss is designed to differentiate fatigue from clinical depression, since they have some common symptoms. the fss test different domains including motivation, exercise, and interference with work, family, or social life. it is 9 item questionnaires, and scoring is done by adding up the response (numbers) and dividing by 9. a score of < 4 is considered as having no fatigue, score of 44.9 are considered as having moderate fatigue, and scores of 5 or more are considered as having severe fatigue. fss has shown good reliability with a cronbach 's = 0.89 and also a strong construct validity. all data collected were entered into microsoft excel 2007 worksheet in the form of a master chart. inferential statistics such as chi - square test was used to find out the association of fatigue and depression with various factors and odds ratio (or) was used to quantify the association of depression with diabetes. microsoft excel and primer software version 6 (developed by mcgraw - hill global education holdings, llc) were used for analysis of the data. equal number of age- and sex - matched healthy control was enrolled to serve as a comparison group for assessment of the prevalence of depression and fatigue in cases and controls. the study sample of diabetes patients comprised equal number of females (50%) and males (50%). the mean age of study subjects was 55.08 years (standard deviation [sd ] = 11.76) with mean duration of illness being 7.15 years (sd = 5.73). most of the patients (80%) had been receiving treatment for more than 12 months. seventy percent (n = 70) had been taking oral medication as compared to 30% of those receiving injectables (n = 30). fasting and postprandial blood sugar level were raised above normal in 64% (n = 64) and 89% (n = 89) of the study subjects, respectively. the average fasting and postpostprandial blood glucose level of the study subjects were 153.06 mg% (sd = 59.25) and 235.65 mg% (sd = 78.98), respectively. forty - six percent (n = 46) of the cases were without any diabetic complications. however, 41% (n = 41) had cardiovascular complications including coronary artery disease and hypertension (cad and ht) and 13% (n = 13) had retinopathy. almost half (47%) of the subjects had optimal bmi, followed by 34% and 15% being overweight and obese, respectively. four percent (n = 4) of the patients were underweight. in this study, fatigue and depression were found in 68% and 53% of diabetes patients as compared to 17% and 19% of nondiabetic participants (or for fatigue 10.37, 95% confidence interval [ci ] : 5.320.27 ; or for depression 2.8, 95% ci : 2.549.07) [table 1 ]. prevalence of fatigue and depression in diabetic cases and controls fatigue and depression both were found to be significantly associated with duration of illness, blood glucose level fasting as well as postprandial, with complications of diabetes and bmi among patients with diabetes. however, there was no significant association of fatigue and depression with sex, age, income, and type and duration of treatment [tables 2 and 3 ]. association of sociodemographic factors with fatigue and depression in diabetic cases correlation of clinical parameters with fatigue and depression in diabetic cases there were 2.53 times more chances of fatigue in diabetic subjects with depression as compared to those without depression [table 4 ]. patients of diabetes were almost five times more likely to develop depression than the healthy control group. similarly, khamseh. reported the prevalence of depression being as high as 71.8% in a sample of 206 iranian patients with type 1 and type 2 diabetes corroborating finding of this study. two major hypotheses are currently proposed to explain the causal pathway between diabetes and depression. the increased risk of type 2 diabetes in individual with depression has been attributed to increased counter - regulatory hormone release and action, alteration in glucose transport function, and increased immune inflammatory activation. these physiological alterations in turn lead to insulin resistance and beta islet cell dysfunction leading to the development of type 2 diabetes. another hypothesis assumes that chronic psychological stressors associated with chronic medical conditions such as diabetes may result in depression. prevalence of fatigue was assessed using fss, which tests the fatigue severity in terms of both mental and physical domain. further analysis of distribution curve has revealed that the fss was normally distributed even in small sample which may indicate that fss is the most appropriate test to use in this population. in this study, odds of fatigue were almost 10 times more in diabetes patients in comparison to healthy controls. epidemiological studies comprising 1137 subjects with type 2 diabetes has reported prevalence of fatigue as high as 61% which is almost in comparison to this study. the preponderance of fatigue in diabetes can result from various factors incorporating physiological changes such as altered blood glucose levels, diabetic complications, psychological phenomenon, diabetes - related emotional distress, or lifestyle factors such as being overweight or physically inactive. this included duration of illness, blood glucose level both fasting and postprandial, bmi, and diabetic complications including cad, ht, and retinopathy. correlation between duration of diabetes and high prevalence of depression has been established in other studies as well. however, balhara. the chronicity of illness is likely to impose several negative impacts including cost of treatment, poor drug compliance, diabetic complications, and increased fatigue which may cumulatively contribute to develop depression in these patients. similar correlation has been established by calrelti - weder. who evaluated fatigue in a placebo - controlled double blind study of interleukin 1 beta (il-1) antagonism with monoclonal anti il-1 antibody in 30 patients of type 2 diabetes. fatigue was found significantly associated with fasting plasma glucose levels in an epidemiological study of 1137 newly diagnosed type 2 diabetes. there is ample of evidence that establishes association between comorbid depression with poor glycemic control in diabetes. have found that depression was significantly associated with poor glycemic control in individuals with type 1 and type 2 diabetes. this includes less physical activities, unhealthy and irregular diet, and lower adherence to oral medications. similar observations have been made by another study in india by balhara. who have reported that bmi has been associated with increased prevalence of depression and anxiety in type 2 diabetes. obesity often leads to low self - esteem associated with economical, social, and psychological problems. fritschi. studied 83 women with type 2 diabetes to assess risk factors for fatigue. it is proposed that the fatigue itself may interfere with physical activity, hence interrupts in weight reduction. clouse. found that onset and prevalence of coronary heart disease were affected in depressed diabetic women. depression in these patients may negatively influence the drug compliance, physical activity, and diet intake leading to development of complications which itself may further contribute to development or exacerbation mood symptoms thus ensue a vicious cycle. like our study, fatigue was found significantly associated with a number of diabetic complications in a cross - sectional study designed to examine the presence of fatigue in type 2 diabetes. are likely to result in fatigue as it makes an individual more incapacitating and fragile. presence of depression further accentuates the fatigue. correlation between depression and fatigue was also established in this study as patients with depression had almost 2 times more odds to experience fatigue symptoms than those without depression. there is evidence to suggest that depression and fatigue may predict and influence each other in time. it has also been proposed that chronic fatigue is merely a form of depression considering the overlap in symptoms and occurrence. however, fatigue seems to have genetic and environmental risk factors that are independent of psychiatric symptoms as reported in twin studies. it has been argued that different definitions of fatigue in different studies may have led to this overlapping between depression and fatigue. nevertheless, empirical evidence suggests that the association between depression and fatigue becomes even larger when narrower and more exclusive definition of fatigue are used. feeling of both mental and physical fatigue is one of the common symptoms of depression, and the association between the two may well be explained by this common sharing of symptoms as well as some common risk factors such as diabetes responsible for the occurrence of both depression and fatigue as evident in this study. various clinical parameters of diabetes including duration of illness, alteration in blood glucose level, bmi, and diabetic complication are strongly associated with fatigue and depression both. presence of fatigue and depression in these patients may adversely affect the prognosis and impose additional cost of treatment, morbidity and mortality. regular monitoring of biochemical parameters such as blood glucose level and bmi are paramount to predict the development of fatigue and depression in type 2 diabetes. | introduction : type 2 diabetes mellitus is a significant health problem and imposes great physical, financial and psychological burden among the affected population. among people with diabetes, fatigue is a pervasive and distressing complaint, which is further accentuated by presence of depression.objective:to assess the prevalence of fatigue and depression and associated clinical and socio demographic correlates in type 2diabetes.materials and methods : this cross sectional study included 100 patients of diabetes type 2 and equal number of healthy controls between the ages of 18 to 70 years. a detailed evaluation of socio demographic and clinical parameters was made. participants were also assessed for presence of depression and fatigue using phq-9 and fatigue severity scale(fss)respectively.results : fatigue and depression was found in 68 % and 53 % of diabetic participants. diabetic patients were 10.37 times and 4.80 times more likely to suffer from fatigue and depression respectively. both fatigue and depression were found to be significantly associated with duration of illness, fasting and post prandial blood glucose level, diabetic complications and body mass index (bmi). fatigue was also strongly correlated with depression in study sample.conclusions:fatigue and depression are reasonably correlated with type 2 diabetes. various clinical parameters of diabetes are strongly associated with both fatigue and depression. fatigue itself has significant correlation with depression in type 2 diabetes. regular monitoring of biochemical parameters are paramount to predict the development of fatigue and depression in type 2 diabetes. |
the intergovernmental panel on climate change (ipcc) reports unequivocal evidence for the warming of climate systems with a global mean temperature rising 0.74c between 1906 and 2005, and the 11 years 19952006 have been reported as being among the 12 warmest years since 1850. the warming from climate change increases the risk of heat waves by compounding the existing problem of urban heat islands a result of urban areas being hotter than surrounding rural areas due to more impervious and heat absorbing surfaces that retain and subsequently reradiate incident solar radiation, less vegetation, and more local heat production [2, 3 ]. as such, climate change affecting these areas will have far - reaching consequences, as the proportion of the global population living in urban areas increases. for example, the urban proportion of the global population increased from 30% in the 1950s to over 50% in the early 2000s and, by the year 2030, 60% of the world 's population is expected to live in cities, according to the united nations (2001) world population prospects revision report. one city of importance is ahmedabad, india, with a population of 7.2 million. ahmedabad is the largest city in gujarat and among the fastest growing cities in india. located in the arid northwest region of india, ahmedabad 's hot season typically runs from march to june, with an average monthly maximum of 38.8c (101.8f) during this period. according to the india national assessment, the region of western ghats where the city of ahmedabad is located is projected to have mean annual temperatures of 26.8 0.4c27.5 0.4c in the 2030s, an increase of 1.7 - 1.8c with respect to the 1970s. in may 2010, ahmedabad experienced a record - setting heat wave which anecdotally resulted in increased all - cause mortality as temperatures locally reached as high as 46.8c. the health department of the ahmedabad municipal corporation (amc) reported that the total death toll from this heat wave was 47, with 29 deaths from heatstroke alone. however, this was based on a preliminary analysis without a formal excess mortality assessment. the informal death toll reported in ahmedabad is unfortunately realistic or even an underestimate of the actual health impact from the heat wave according to studies of heat - health impacts elsewhere. for example, in some northern us cities, the effects of heat have increased summer mortality by nearly 40% over baseline averages. also in the united states, heat waves cause more deaths annually than any other natural disaster. centers for disease control and prevention lists the three most common types of heat - related illnesses (hri) as heat cramps, heat exhaustion, and heatstroke. these types of illness can occur when individuals are exposed to extreme heat and may lead to death if not properly diagnosed and treated. the study of heat - related illness is a growing area and, thus far, has been primarily studied in occupational settings. for example, studies have found that workers exposed to extreme heat may be at risk of several types of heat - related illnesses. however, the effects of extreme heat are not limited to occupational settings nor only heat - related illness. in a review looking more broadly at elevated ambient temperatures, defined in this review and for the purposes of this study as outdoor temperatures as measured by standard meteorological services and mortality studies from 2001 to 2008, there was an association with higher ambient temperatures and increased risk of death from respiratory, cerebrovascular, and cardiovascular diseases, including ischemic heart disease, congestive heart failure, and myocardial infarction across all ages, race, and gender. higher ambient temperatures are also associated with other types of illness besides heat - related illness. in a california study, high ambient temperature was significantly associated with preterm birth, regardless of maternal racial / ethnic group, maternal age, maternal education, or sex of the infant. importantly, certain groups such as younger mothers, blacks, and asians had an even higher association of negative outcomes and temperature indicating the potentially important role of socioeconomic factors. one review of epidemiological literature identified 20 studies that investigated seasonality of birth outcomes and reported statistically significant seasonal patterns. most of the studies found peaks of preterm birth, stillbirth, and low birth weight in winter, summer, or both, which indicates the extremes of temperature may be an important determinant of poor birth outcomes. increasing ambient temperature has also been associated with infectious diseases such as diarrhea - associated morbidity in a 10-year taiwanese study and, indirectly, through changes in air quality, with respiratory illness. ambient temperatures are shown to be a universal hazard and concern, as they present various and vital implications to public health. this epidemiologic literature indicates that infants are a population particularly vulnerable to the rising global temperatures. while keeping an infant warm enough to prevent hypothermia homeothermy requires a balance among heat production, skin blood flow, sweating, and respiration in such a way that changes in heat loss or gain from the environment are precisely compensated. greater susceptibility of body temperature to ambient temperatures is to be expected in smaller organisms because of their large surface area to volume ratio, the relatively small insulating body shell, despite a higher percentage of brown adipose tissue in newborns, and the smaller body mass that acts as a heat buffer in large organisms. additionally, any pathological conditions such as malnutrition, as is widespread in india, or pulmonary disease can further exacerbate a baseline physiologic susceptibility. a review of data suggests that despite attempts to eliminate heat through adjustments in the peripheral circulation (narrowing central peripheral gradients) infants are not as able as older children and nonelderly adults to maintain set - point temperatures. in addition, the difficulty neonates have in thermoregulation makes them a potentially vulnerable population during times of extreme heat. in previous reports on heat waves and high ambient temperature, very few studies have considered or found effects in infants and young children. this is perhaps due to most studies being conducted using data from developed countries with likely higher rates of climate - controlled, indoor settings. a retrospective study of mortality related to a 2003 heat wave in france found moderate but significant excess mortality also occurred among male infants aged less than 1 year. another study done in california found increased mortality risk in infants 1year of age or less. during a scientific workshop in gujarat, india during the spring of 2011 focusing on heat and health, preliminary data highlighted the potential burden of disease on infants in non - climate - controlled buildings there, such as most homes and hospitals. non - climate - controlled refers to the absence of a heating or cooling system that regulates temperature and humidity within a building. one energy survey estimated that only 129 hospitals have air - conditioning of the approximately 16,000 total hospitals across the country [26, 27 ]. a review of the literature including both pubmed and web of science searches revealed little work on the association of elevated ambient temperatures with morbidity or mortality in non - climate - controlled settings (see supplementary annex 1 in supplementary material available online at http://dx.doi.org/10.1155/2014/946875). while absence of air - conditioning is a known risk factor for heat stroke and death among the elderly in residential settings and nursing homes in new york city, other institutional settings and health effects have not been studied. this study examines neonatal morbidity in a non - climate - controlled hospital setting during the may 2010 heat wave in ahmedabad. two primary questions of interest are (1) was there a relationship between high ambient temperatures and the rate of neonatal intensive care unit (nicu) admissions during the may 2010 heat wave in ahmedabad ? and (2) did the relocation of the maternity ward from top to ground floor have an effect on subsequent nicu admission rates ? this study is a retrospective review of hospital records for births and nicu admissions with a diagnosis for heat - related illness that occurred between april 1st and june 30th during the years 2009, 2010, and 2011 at the scl general hospital, serving a primarily low income population, in ahmedabad, gujarat, india. the data was obtained by manual transcription of the paper charts from the years of study. in 2009 and 2010, the maternity ward was on the fourth, highest, and reportedly hottest floor of the hospital, including may 2010 when the heat wave struck the city. after the 2010 heat wave but prior to the 2011 warm season of april, may, and june, the maternity ward was relocated to the ground and reportedly coolest level (figure 1). selection of the nine months enabled comparison with similar season months both before and after the 2010 heat wave event. temporal matching such as the one used here is commonly used in heat wave analyses and helps to minimize confounding by population scale variables [2931 ]. for the nine months in study, the data included the number of daily births at the hospital, total daily nicu admissions, and daily nicu admissions for heat - related illness (i.e., heat - related admissions). infants 028 days old born outside of hospital and in - hospital transfers from maternity ward. the study outcome of heat - related illness was a diagnosis of exclusion defined as neonates admitted to the nicu with body temperature 38c with any of the following signs or symptoms : refusal to feed, signs of dehydration, weight loss > 10% of birth weight, increased respiratory rate, convulsions, and/or lethargy. exclusion criteria included evidence of septicemia, acute gastroenteritis, or central nervous system infection based on available cultures or labs. weather data was obtained in person by study author (kk) directly from the india meteorological department. data included daily maximum and minimum temperatures and two daily relative humidity levels for the time period of april 1june 30 for the years 2009, 2010, and 2011. air pollution data was not available. to evaluate the effects of extreme heat on neonatal outcomes, we looked for an effect of maximum temperature and floor of the nicu on admissions for heat, as well as on total deliveries and non - heat - related nicu admissions. humidity was included in preliminary models but ultimately excluded because no association was seen and from a policy perspective humidity is not included in the weather department 's heat wave definition. first, graphical methods were used to suggest the type of function that would relate (heat - related) admissions to temperature. the preliminary visual evaluation suggested that the effect of temperature on admissions began at some point between 40c and 42c. we used generalized linear models to evaluate the number of daily events, which we assumed followed a poisson distribution. the variables used to predict this outcome were (i) maximum temperature per day, (ii) number of deliveries over the past three days, (iii) and whether the icu was located on the top floor (in 2009 and 2010) or on a lower floor. for the effect of heat, we used segmented regression and specifically chose a horizontal line up to a certain temperature t and then for max_t > t joined this segment with a line with slope 3. to further explore breakpoints, temperatures were selected from the 10th percentile of maximum temperature at 38c, to the 90th percentile at 43.5c for the temperature, t, in which the segmented line was allowed to slope upwards. the temperature of the best fit for the equation below, evaluated based on the log likelihood, was 42c. we used proc genmod of sas software, to estimate the parameters, 1, 2, 3 in (1) log[heat - related admissions ] = +1(births7.4)+2floor for max_t 10% weight loss, fever, and maternity ward versus out of hospital transfer, can be found in table 2. in the models, in which the t, the turn for the segmented regression, that is, breakpoint, varied from the 10th percentile of maximum temperature at 38c to the 90th percentile at 43.5c, the effect of floor and of increases in temperature was statistically significant. as described in section 2.3, the temperature of the best fit for our segmented regression model was 42c. at this temperature (42c), moving the maternity ward to a lower floor was associated with a predicted 64% reduction in heat - related admissions, 95% confidence intervals 3% to 89%. as for temperature association at this same breakpoint of 42c, each increase in degree celsius over 42c was associated with a 43% increase in heat - related admissions, 95% confidence intervals 9.2% to 88%. when examining non - heat - related nicu admissions instead of heat - related admission and then total number of deliveries, we found a similar direction of association though non - statistically significant results. for example, in the model looking at non - heat - related nicu admissions, controlling for floor and number of admissions, there was a 1% increase in admissions per degree increase over 40c (p =.83) and a predicted 14% reduction due to moving the floor to a lower level (p =.13). for deliveries per day, adjusting for floor, there was an increase of 2% in the number of deliveries per 1% increase in degree over 40c (p =.29). of note, we observe several outliers in which more heat - related admissions still occurred despite lower temperatures. various factors including alterations in individual or community protective factors conditions or behaviors that lower the effect of high temperatures on neonatal health or other meteorologic variables could be responsible, but limited data sets prevented exploration. analysis of the hospital and weather data found a relationship between ambient, or outdoor, temperatures and the number of nicu admissions for heat at a non - climate - controlled hospital in ahmedabad, india. we also found moving the location of a maternity ward within hospital from the fourth and highest floor to the ground and reportedly cooler floor after the may 2010 heat wave showed a protective effect. our data suggest that during the month of the heat wave, while the maternity ward remained on the top floor of the non - air - conditioned hospital, there was an increase in heat - related admissions to the nicu. there are several possible reasons for the observed increase in nicu admissions for heat during the month of the 2010 heat wave. it could be that heat affects the infant in utero and causes him or her to be more vulnerable at birth due to either a younger gestational age (perhaps even just a few days) or physiologic stress from heat independent of the timing of the labor and delivery. another possible reason for increased heat - related admissions is detection bias which perhaps shifted diagnosis of other illnesses toward heat. this possibility could not be ruled out completely because of lack of information about other diagnoses for other nicu admissions in our data set. additionally, the findings from this study would have been strengthened if, when looking at the effect of the maternity ward location, we had patient data on a period of outdoor temperatures comparable to that of the may 2010 heat wave but from the ground floor location. a previous study conducted on pregnant women in barcelona found episodes of a relatively high heat index on the day before delivery was associated with a 2-day reduction in average gestational age at delivery and the most extreme heat condition was associated with a 5-day reduction, suggesting a dose response relationship. while all babies admitted to the nicu for heat were listed as full term, the specific gestational age in weeks and days was not available to explore this further. as previously mentioned, little research exists on the effects of high ambient temperatures and the vulnerable population of neonates. one area that has been looked at is the relationship between temperature and sudden infant death syndrome (sids). a possible role for hyperthermia in sids has been hypothesized because some victims are found in unusually warm environments, are warm and sweaty when found dead, are wrapped tightly in clothing or bedding, have a history of febrile illness before death, or have high rectal temperatures at examination or autopsy [33, 34 ]. in our study, a larger dataset would permit exploration of these outstanding questions, which warrants the need for further study. one of the primary limitations to this study is that the lack of descriptive information on non - heat - related cases limited the ability to examine individual level risk factors. being able to examine other factors would possibly lead to evidence about protective effects and modifiable risk factors. for example, information is needed on neonates born at scl general hospital but not admitted to nicu, on all nicu admissions, and ideally on those brought into hospital following an outside of hospital birth. this information could be used to study other variables that may have contributed to heat vulnerability such as birth weight, socioeconomic status, mode of delivery, and breast or formula feeds. harsh environmental conditions and other negative factors could have a relatively large effect on birth outcome. we do know that some of the infants admitted to the nicu during the study period were born outside of the hospital, but we do not know their specific conditions nor their proportion of the total and thus are limited in the extent that we can explore the characteristics of these infants. our meteorological data were for ambient, that is, outdoor, conditions only and were used as a proxy of indoor conditions. direct indoor measurements would permit more precise characterization of the exposure. we can only estimate and infer based on what we know of indoor conditions in relation to outdoor temperature. the india meteorological department (imd) records their temperature data near the airport located on the outskirts of the city. an urban heat island effect of 24c has been reported in ahmedabad, suggesting that residents may experience hotter temperatures than those reported. lastly, in terms of limitations, the highest temperatures occurred when the nicu unit was on the top floor. we can find both temperature and floor significant even with the other in the model. however the co - linearity will increase the variability, and in interpreting the findings we should bear this dependence in mind. considering global health implications, it is important to note the difference in the heat wave criteria of ahmedabad compared to that of a developed city in a temperate zone such as new york, ny. new york city and much of the northern united states issues alerts of excessive heat when the maximum heat index is expected to reach 37.8c for a 24 hr period. as previously mentioned, in ahmedabad a heat wave, the 2010 heat wave was the first time the imd issued a severe heat wave warning in ahmedabad, cautioning people against sun stroke. repeated heat exposure has been known to decrease the sweating threshold, that is, a sensitization occurs in the course of repeated heat exposure rather than development of tolerance. those exposed to extreme ambient temperatures for extended periods of time will over time begin to sweat less. the sweating threshold shifts as it occurs during heat adaptation, accompanied by similar changes in the threshold temperatures for shivering and vasodilatation. in ahmedabad, the problem of repeated exposure to extreme heat is further compounded by a lack of easily available resources and public health awareness. such climatic differences underscore the importance of local or regional data for best characterization of any given population 's risk. from a public health perspective, further research resources need to be directed to places where heat adaptation resources such as air - conditioners are scarce, yet the need is high. it is important for initiatives to be specific for a target audience and to consider heat wave criteria of location. in addition, public health solutions should look toward engineering and architectural design solutions such as central ventilation shafts used in older ahmedabad buildings but not commonly in newer building and light - colored surfaces on rooftops to help with cooling on the top floors of buildings. there is a growing body of work regarding the energy savings from such relatively simple technologies, but the health effects of such interventions in non - climate - controlled buildings have not been well documented. recommendations for improved future research include a longitudinal study with descriptives collected on all data subjects. improved data would include temperature measurements taken from inside the maternity ward and birth information from those brought into the hospital from outside births. in order to explore in more depth the preceding questions regarding protective factors or modifiable risk factors and the vulnerabilities of the fetus in utero versus the neonate in the prenatal period, additional epidemiologic studies, and ultimately a randomized controlled trial with comparable hospitals and control groups would add to the understanding of the effects of hospital cooling interventions. this preliminary study supports the hypothesis that neonatal morbidity increases in non - climate - controlled settings during periods of extreme high ambient temperatures, applying evidence from study in ahmedabad, india. analysis of the maternity ward 's location revealed both the detrimental effects of high outdoor temperatures and the positive health effects of a simple hospital level intervention. these findings demonstrate the importance of simple surveillance measures in motivating a hospital policy change toward climate change adaptation here relocating one ward and the potential, as yet little studied, increasing health burden of heat in non - climate - controlled institutions serving vulnerable populations. the health effects of climate change are a growing international concern that may have dramatic implications for the health of future generations. newborns and pregnant women comprise some of our most heat - vulnerable populations and thus could be among those most affected by climate change. we emphasize the need for further research on climate change effects on and viable adaptation strategies for such heat - vulnerable populations. | health effects from climate change are an international concern with urban areas at particular risk due to urban heat island effects. the burden of disease on vulnerable populations in non - climate - controlled settings has not been well studied. this study compared neonatal morbidity in a non - air - conditioned hospital during the 2010 heat wave in ahmedabad to morbidity in the prior and subsequent years. the outcome of interest was neonatal intensive care unit (nicu) admissions for heat. during the months of april, may, and june of 2010, 24 nicu admissions were for heat versus 8 and 4 in 2009 and 2011, respectively. both the effect of moving the maternity ward and the effect of high temperatures were statistically significant, controlling for each other. above 42 degrees celsius, each daily maximum temperature increase of a degree was associated with 43% increase in heat - related admissions (95% ci 9.288%). lower floor location of the maternity ward within hospital which occurred after the 2010 heat wave showed a protective effect. these findings demonstrate the importance of simple surveillance measures in motivating a hospital policy change for climate change adaptation here relocating one ward and the potential increasing health burden of heat in non - climate - controlled institutions on vulnerable populations. |
drug resistance to currently deployed, established antimalarials such as chloroquine is driving the rise in global mortality due to malaria. malaria is responsible for roughly one million deaths annually, and as such novel inhibitors active against new parasite targets are urgently required in order to sustain and develop treatments against malaria. to this end, a program was undertaken to identify hit compounds active against the electron transport chain (etc) of plasmodium falciparum and specifically against nadh : ubiquinone oxidoreductase (pfndh2). pfndh2 is a single subunit 52 kda enzyme involved in the redox reaction of nadh oxidation with subsequent quinol production. localized in the mitochondrion, pfndh2 is a principal elctron donor to the etc, linking fermentative metabolism to the generation of mitochondrial electrochemical membrane potential (m), an essential function for parasite viability (figure 1). targeting the electron transport chain of the mitochondrion is a proven drug target as demonstrated by the drug atovaquone, targeting the cytochrome bc1 complex. the chain components are (i) p. falciparum : pfndh2 type ii nadh : quinone oxidoreductase, dhodh dihydroorotate dehydrogenase, g3pdh glycerol-3-phosphate dehydrogenase, mqo malate : quinone oxidoreductase, sdh succinate dehydrogenase, bc1 cytochrome bc1 complex, c cytochrome c, aa3 cytochrome c oxidase and the f1fo - atpase (complex v). in order to identify hit compounds, we employed a range of ligand - based chemoinformatics methods in the rational selection of approximately 17 000 compounds that were predicted to possess activity against pfndh2. the chemoinformatics approach were initiated from the identity of only one inhibitor of the target, hydroxy-2-dodecyl-4-(1h)-quinolone (hdq) and used molecular fingerprints, turbo similarity, principal components analysis, bayesian modeling, and bioisosteric replacement in order to select compounds for high - throughput screening (hts). the compounds were selected from a commercial library of 750 000 compounds (biofocus dpi) and were predicted to possess favorable absorption, distribution, metabolism, excretion, and toxicity (admet) characteristics. the selected compounds were subject to a sequential high - throughput screening methodology using an in vitro assay against recombinant pfndh2 as described previously. hit confirmation and potency determination revealed over 40 compounds with ic50 values ranging from below 50 nm to 40 m. analysis of these hits revealed that only two of the compounds were selected by more than one chemoinformatic method, justifying the use of several virtual screening approaches. seven distinct chemotypes were identified from the hit compounds and were thus primed for development as new agents against malaria (see supporting information). all 12 distinct chemotypes were briefly examined and key compounds were synthesized, and this led to the selection of the quinolone core as one of the main target chemotypes for structure activity relationship (sar) development due to its hdq - like structure (figure 2). mono 2-aryl quinolones emerging from quinolone hits identified in high - throughput screen and initial sar performed on template. quinolones identified from the hts were not considered appropriate for further optimization (see cde204758 and cde264055) but given the high potency of hit cde021056, versus pfndh2, we selected 2-substituted monoaryl quinolones as a core template with potential for sar development (note that several low micromolar saturated quinolones, e.g., cdd038715, were identified in this screen). the rationale for selection of the 2-aryl quinolone pharmacophore was to introduce additional lipophilicity in a region where hdq contains the flexible aliphatic side chain. subsequently, further extension of the side chain was performed, so it is more hdq - like, while incorporating functionality to impart metabolic stability within the analogue series, and this approach led to eventual identification of early lead compounds for this series. in terms of sar, the nature of the group at 3-position, the electronic / steric effect of substituents placed at the 5, 6, and 7 positions, the presence of a nitrogen in the a ring of the quinolone core, and changing from nh to noh (as in hdq) were all examined (figure 2). having identified mono aryl quinolones as hits against the target pfndh2 (ca. 50250 nm, e.g., 14a and 15a) with moderate activity in the whole cell phenotypic screen, our efforts were initially concentrated on the synthesis of a small number of additional analogues to see if activity could be improved further. the first structural alteration was to introduce a methyl substituent at the three position (e.g., 6a) ; this manipulation twists the 2-aryl side - chain, altering the torsion angle (figure 3) leading to a subsequent reduction in aggregation. aggregation via -stacking of aromatic ring systems leads to higher melting points, which has been shown to be closely related to solubility. molecular modeling was performed in order to analyze the relationship between melting point and the conformational effect of introducing a methyl or chloro group at the three position of the quinolone. monte carlo simulations were performed in order to sample the thermally accessible conformations and calculate the boltzmann weighted average torsion angle that best described the planarity of the 2-position aryl ring with respect to the quinolone ring (see figure 3 for torsional angle and supporting information for computational details). the torsion angle that best represents the planarity of the 2-aryl group with respect to the quinolone core. the melting point and computed boltzmann weighted average torsion angle were examined for four pairs of compounds : 6a and 14a, 6b and 14a, 14c and 15a, and finally 6d and 14e ; compounds within a pair are close analogues of each other with one compound incorporating a hydrogen substituent at the 3-position and the other either a methyl or chloro group. higher melting points within a pair were found to correlate with a hydrogen substituent at the 3-position ; conversely, lower melting points correlated with the presence of more bulky methyl or chloro groups. hydrogen substituted compounds were found to have lower computed thermally accessible torsional angles than their methyl - substituted counterparts, as exemplified by compounds 6a and 14a (figure 4, see supporting information for information for all pairs of compounds). this analysis supports the hypothesis that the solubility is related to the planarity/-stacking propensity of 2-aryl substituted quinolones. carbon, hydrogen, nitrogen, oxygen, and fluorine atoms are depicted in dark gray, off - white, blue, red, and pale - yellow respectively. the accompanying table shows the corresponding melting points and computed boltzmann weighted average torsional angles. other structural modifications investigated for the mono aryl series were the presence of a nitrogen within the a ring of the quinolone core, altering the phenyl substituent and using h or cl at the 3-position. from preliminary testing against the 3d7 strain of p. falciparum, it rapidly became apparent that activities below 500 nm versus the 3d7 strain could not be achieved. the chemistry employed to synthesize these compounds and their structures are covered in schemes 14 and tables 14 which will be described in detail for the subsequent bisaryl compounds. being cognizant of the hdq inhibitory activity against pfndh2, compounds were designed with an extended side chain. in order to avoid the metabolically unstable hdq side chain, a bisaryl group was chosen to mimic this side chain but maintain metabolic stability. the first series of compounds contains a methyl group at the 3-position (scheme 1 and table 1). bisaryl compounds with a ch2 and o linker were investigated with the nature of the terminal phenyl substituent being varied along with the position of the linker. the presence of additional substituents around the a ring of the quinolone core was also looked at in detail. the synthesis of these compounds was achieved in 46 steps from commercially available, inexpensive starting materials. aldehyde 1 was utilized in a grignard reaction to give alcohol 2 in 7099% yields. where aldehyde 1 was not commercially available, the aldehydes were synthesized in house (see supporting information). oxazoline 5 was prepared from the respective isatoic anhydride 4 in yields of 4060%. in the majority of compounds, the isatoic anhydrides were commercially available ; when this was not the case they were synthesized (see supporting information). reaction of oxazoline 5 with ketone 3 in the presence of ptsa gave the desired quinolones 6a w in 2085% yields. a selection of methoxy quinolones 6n p were then demethylated using bbr3 to give hydroxy quinolones 7a c in 5169% yields. 7c was then acetylated using triethylamine and acetyl chloride to give quinolone 8 in 70% yield (scheme 2). where yields of 3-methyl quinolones were very low in the final step, the methodology depicted in scheme 3 was employed. this route was also the highest yielding for compounds containing a nitrogen within the a ring of the quinolone core. ketone 3 was converted to dimethoxy acetal 9 in 4090% yield using trimethyl orthoformate and ptsa. reaction of diacetal 9 with various anthranilic acids 10 by refluxing in dowtherm a gave quinolones 11a h in 4366% yields (scheme 3 and table 2). analogues with a hydrogen at the 3-position were also synthesized (scheme 4 and table 3). in this case ketone 3 was reacted with diazo ethyl malonate to give diketylester 12 in 5868% yield. heating amine 13 in dowtherm a gave the desired quinolones 14a k in 4870% yield. crystals of quinolone 14e were grown and its structure was confirmed by x - ray crystallography (see figure 5, ccdc 833920). the effect of a hydroxyl group both in the a ring of the quinolone core and at the terminal end of the side chain was explored. to this end it was necessary to treat 7-ome quinolone 14h with bbr3 to give 7-oh quinolone 14l in 60% yield. treatment of 14k containing a side chain with a terminal methyl ester with lah gave 14 m with a terminal methyl alcohol in 78% yield. it has been shown from gsk s pyridone series that the presence of a chlorine at the 3-position was well tolerated. with this in mind a selection of the 3-h compounds were treated with sodium dichloroisocyanurate and sodium hydroxide to give 3-chloro quinolones 15a c in 5364% yields. while we believe the 2-bisaryl 3-methyl quinolones to be optimal for antimalarial activity and pfndh2 selectivity, it was a logical progression to investigate how interchanging the two substituents would influence both activity and selectivity. ketone 16 was reacted with oxazoline 17 to give the 3-monoaryl quinolone 18 in 27% yield. reaction of quinolone 18 with the boronic ester 19 gave the desired 3-bisaryl quinolone 20 in 89% yield (see figure 6). for the 6u variant quinolone 18 was reacted with phenol 21 in 30% yield to give the 3-bisaryl quinolone 22 with an oxygen linked side chain. the synthesis of hydroxymethyl quinolone 25 was undertaken to see if a hydroxymethyl group was tolerated in the molecule in order to provide a handle for the synthesis of appropriate pro - drugs such as phosphates or carbamates. reaction of quinolone 22 with ethyl chloroformate gave ester 23 in 70% yield, and subsequent reaction with selenium dioxide in dioxane gave a 98% yield of aldehyde 24. synthesis of 2-h, 3-bisaryl quinolone 29 was achieved by carrying out a suzuki reaction on chloro, bromo quinoline 26 in 45% yield. a further suzuki reaction was then undertaken to give chloro quinoline 28 in 50% yield. further investigation into the nature of the group tolerated at the 3-position was carried out. quinolones 32a c containing an ethyl ester at the 3-position were synthesized by reacting isatoic anhydride 30 with -keto ester 31 in the presence of nah and dmf in 3035% yield (see figure 7). the presence of a methyl alcohol at the 3-position could then be achieved using lah to convert the esters to 3-methyl alcohol quinolones 33a and 33b in 46% and 48% yields. as there are several examples of naturally occurring 1-hydroxy-4(1h)-quinolones that are known inhibitors of respiratory and photosynthetic electron transport chains, it was logical to explore the effect of an n oh compounds was achieved by reacting the quinolone with ethyl chloroformate to give carbonate 34 in 6099% yield. synthesis of the n - hydroxy analogues via the carbonate intermediate was advantageous as the carbonates themselves are possible pro - drugs and so subsequently were also tested for antimalarial activity. this was then oxidized using m - cpba to give the n - oxide 35 which was used crude in the final step. reaction with koh gives the desired n - hydroxy compound 36 in 8098% yield (scheme 8). optimization of the side chain to improve solubility and drug delivery is key to the successful development of these hits, and there are several strategies that we have adopted to date. further modifications to the side chain have included extending the terminal group using an oxy - linked alkyl morpholine to provide the opportunity for developing molecules that can be formulated as salts. this type of approach has been applied in the development of kinase inhibitors where incorporation of cyclic amine groups such as morpholine has transformed highly insoluble compounds into candidates with excellent drug - like properties. to incorporate the oxyl - linked morpholine side chain bisaryl aldehyde 37 addition of the ethyl morpholine subunit was achieved using potassium carbonate to give side chain 41 in 86% yields. reaction with oxazoline 5a in the presence of triflic acid gave quinolones 42 a c in 3055% yields (scheme 9). while our primary focus was to use medicinal chemistry manipulation of the core template to maximize solubility and activity, pro - drug approaches were also briefly examined. pro - drugs have been successfully adopted by gsk in their antimalarial pyridone (gsk932121) program. impressive in vivo antimalarial activity and exposure profiles have been achieved with pyridone - based phosphate pro - drugs. phosphate ester pro - drugs are highly ionized at physiological ph, highly soluble in water, are chemically stable and enzymatic cleavage at the gut wall by membrane - bound alkaline phosphatases produces high concentrations of the parent drug in the systemic circulation. phosphate pro - drugs have also been successfully developed for the 2-arylquinolone series of anticancer agents developed by chou. where chm-1-pna was developed as a novel water - soluble drug candidate (figure 6). compound 6j was used for the basis of our pro - drug work as it exhibited good in vitro antimalarial activity and selectivity against pfndh2 (see below). quinolone 6j was reacted with tetrabenzyl pyrophosphate in the presence of nah to give the phosphonate ester 43 in 87% yield. hydrogenation using pd / c gave phosphate pro - drug 44 in 80% yield (scheme 10). morpholine carbamate pro - drug 45 was made by reacting quinolone 6j with morpholine carbonyl chloride in the presence of potassium tert - butoxide to give the pro - drug in 66% yield (scheme 11). further strategies including the use of polar heterocycles in the side chain, use of other protonatable groups within the side chain, extending the terminal group using polar heterocycles, and the placement of a polar group centrally in the side chain with a lipophilic group at the terminal end are covered in the subsequent paper. tables 6, 7, and 8 show the antimalarial activity of all quinolones synthesized against the 3d7 strain of p. falciparum. table 6 shows activity for monoaryl analogues and while activity of these compounds is generally poor, a few key points can be taken from these results in terms of sar. in the case of monocyclic compounds, there is a definite trend toward better activity when cf3 groups are present in the side chain and when a chlorine atom is present at the 3-position. table 7 shows the antimalarial activities of quinolones 6c w, 11e h, 14e14 m, and 15c. clear trends are seen in the nature of the a ring substituent x. generally the presence of cl and f on the a ring is well tolerated and often enhances activity as seen when comparing 6d (117 nm) to 6j (36 nm), 6k (70 nm), and 6l (38 nm). larger a ring substituents such as cf3 as in the case of 6h (654 nm) and 6i (212 nm) and piperazine (14i, 430 nm and 14j, 443 nm) are less well tolerated with a 10-fold drop in activity seen. the presence of an ome group on the a ring is tolerated with substitution at the 7-position greatly enhancing activity. 6o has activity of 8 nm activity whereas all other regioisomeric ome compounds exhibit antimalarial activity of > 350 nm (6 m, n and p). substitution at the 7-position is also favorable when looking at oh substitution (7b, 139 nm versus 7a, 465 nm and 7c, 819 nm). nitrogens within the a ring are also not tolerated well as seen with 11e (407 nm) and 11h (506 nm). a hydrogen at the 3-position (r) does seem to offer a small advantage in terms of activity when comparing 14e (48 nm) to 6d (117 nm) and 14f (16 nm) to 11 g (24 nm) ; however, this small increase in activity is far outweighed by the decrease seen in solubility. when comparing 15c (19 nm) with 6d (117 nm) the presence of a chlorine atom greatly enhances activity, and this observation will be employed in future lead optimization campaigns in this area. pfbc1 ic50 data (nm) : 6d = 37.5, 6e = 219, 6f = 25.5, 6j = 9800, 14e = 13.9. looking in detail at the side chain, linker a variants para - ch2, meta - ch2, and para - o are all well tolerated with activity effects being determined by other areas of the molecule. the effect of the side chain terminal substituent is highly dependent on other functionality within the molecule, but as a general rule ocf3 is the optimal terminal group as demonstrated by the comparison of 6r (34 nm) to 6s (105 nm) and 6u (26 nm) to 6w (230 nm). large electron withdrawing groups are less well tolerated as seen with 14k (272 nm). alcohol groups both on the a ring and at the terminal end of the side chain results in a decrease in activity as demonstrated by 14l and 14 m. table 8 shows the antimalarial activities of the more structurally diverse bicyclic quinolones. from the small number of 3-aryl compounds synthesized, the effect of altering r can be seen. for this series of compounds me > ch2oh > h in terms of antimalarial activity. for a comparison of 3-aryl compounds vs 2-aryl compounds across the full range of in vitro data, see figure 7. other comparisons that can be made from the table include the effect of having an ethyl ester at the 3-position. ester 32a (39.6 nm) can be compared to its methyl equivalent 6c (107 nm) and likewise ester 32b (26 nm) to 6j (36 nm). in both cases core b compounds tested demonstrate good antimalarial activity, but there is no definite trend when compared to their core a counterparts. the general trend when n - hydroxy compounds are compared to the nh variants (36b (149 nm) cf 6j (36 nm), 36c (175 nm) cf 20 (36 nm), 36d (263 nm) cf 14e (48 nm), and 36e (35 nm) cf 6u (26 nm)) is a reduction in activity, although 36a is an exception to this. generally, the addition of an ethoxy morpholine group leads to a drop in 3d7 activity. this would concur with our previous observations that larger terminal substituents on the side chain are not well tolerated. having established the whole cell activity of all quinolone compounds, they were then tested against the pfndh2 enzyme. because of the time - consuming nature of the assay and large volume of parasites needed, only a small selection of the most active compounds were then tested against parasite bc1 in order to establish the selectivity of the compounds against pfndh2 (see footnote, table 7). a large number of the quinolones tested demonstrate nanomolar activity against pfndh2 and some selectivity against parasite bc1. from these compounds a selection was tested against the atovaquone resistant tm90c2b strain of p. falciparum (ic50 for atovaquone is 12 m in this strain). additionally a more select range of compounds were tested against the chloroquine resistant strain of p. falciparum, w2. the sar trends identified from the 3d7 data largely hold true for the w2 data with the presence of a 7-methoxy (6o, 13 nm) and 7-cl (6j, 17 nm) groups enhancing activity when compared to unsubstituted 6d (26 nm). a direct comparison of 3-aryl and 2-aryl quinolones can be made from the two pairs of compounds depicted in figure 7. this clearly depicts a loss of pfndh2 activity when moving from 2-aryl to 3-aryl examples with 6u having pfndh2 activity of 10 nm and its 3-aryl counterpart 22 having activity of 190 nm. 6d has 20 nm pfndh2 activity with this droping to 492 nm for 3-aryl quinolone 20. the most extreme example of this being 3-aryl quinolone 25 which shows no pfndh2. a selection of the most active quinolones were tested for in vivo activity using peters standard 4-day test (table 11). some solubility problems were encountered with the use of ssv (in most cases compounds had to be dosed as suspensions), but the use of det (compounds fully dissolved) is proof of concept that 6j (ck-2 - 68) clears the parasite in vivo with 100% parasite kill being achieved at 20 mg / kg. the pro - drug of 6j, compound 44 was successfully dosed in a sodium carbonate solution and 100% parasite kill was also seen at 20 mg / kg. 6d was also potent by oral route in the mouse model with 100% clearance at 20 mg / kg in this model. in the cases where parasite clearance did not reach 100%, we believe this to be a solubility issue as from the table it is clearly vehicle dependent. day 4 suppressive activity of key compounds in male cd-1 mice infected with plasmodium berghei. mice were exposed to the infection via intraperitoneal injection and then orally dosed with the relevant compound. because of 6j having excellent in vitro activity and selectivity against pfndh2, it was selected as the lead compound for further investigation. no significant cytotoxicity was observed for 6j at any concentration (cc50 > 50 m) in hepg2 cells. 6j was incubated at a concentration of 1 m with human liver microsomes (1 mg / ml) in the presence of nadph for 0, 10, 30, and 60 min. the in vitro half - life for 6jwas shown to be 226 min, with an intrinsic clearance value of 0.76 ml / min / kg. to conclude, a 46 step synthesis of a range of bisaryl quinolones with potent antimalarial activity both in vitro and in vivo has been reported. several compounds within this series have been proven to be selectively active against the pfndh2 enzyme. lead compounds within this series have antimalarial activity against the 3d7 strain of p. falciparum and pfndh2 activity in the low nanomolar region and for the most selective quinolone, 6j, a pfndh2/pfbc1 selectivity ratio of up to 600-fold. it is important to note that additional quinolones in this series have the ability to inhibit both pfndh2 and bc1 in the low nanomolar range and this dual targeting of two key mitochondrial enzyme targets may prove to be an advantage over single - targeting inhibitors with respect to drug efficacy and delaying the onset of parasite drug resistance. representative quinolones and their phosphate pro - drugs also have proven to be effective at clearing parasitic infection at 20 mg / kg in a murine model of malaria, and further work is in progress to optimize the solubility and admet properties of this series. all reactions that employed moisture sensitive reagents were performed in dry solvent under an atmosphere of nitrogen in oven - dried glassware. all reagents were purchased from sigma aldrich or alfa aesar chemical companies, and were used without purification. thin layer chromatography (tlc) was carried out on merck silica gel 60 f-254 plates and uv inactive compounds were visualized using iodine or anisaldehyde solution. flash column chromatography was performed on icn ecochrom 60 (3263 mesh) silica gel eluting with various solvent mixtures and using an air line to apply pressure. nmr spectra were recorded on a bruker amx 400 (h, 400 mhz ; c, 100 mhz) spectrometer. chemical shifts are described in parts per million () downfield from an internal standard of trimethylsilane. mass spectra were recorded on a vg analytical 7070e machine and fisons trio spectrometer using electron ionization (ei) and chemical ionization (ci). all compounds were found to be > 95% pure by hplc unless specified below. the appropriately substituted oxazoline 5 (4 mmol, 1.0 equiv) was added to a solution of ketone 3 (4 mmol, 1.0 equiv) and para - toluenesulfonic acid (20 mol %) in n - butanol (10 ml). the reaction mixture was heated to 130 c under nitrogen and stirred for 24 h. the solvent was removed under a vacuum and water (20 ml) was added. the aqueous solution was extracted with etoac (3 20 ml), dried over mgso4, and concentrated under a vacuum. the product was purified by column chromatography (eluting with 2080% etoac in n - hexane) to give quinolone 6. 6d : white powder (yield 36%) ; mp 212214 c ; h nmr (400 mhz, dmso) h 8.98 (s, 1h, nh), 8.27 (d, j = 8.3 hz, 1h), 7.60 (d, j = 8.1 hz, 1h), 7.56 (dt, j = 1.4 hz, 8.3 hz, 1h), 7.9 (d, j = 8.1 hz, 2h), 7.26 (dt, j = 1.5 hz, 8.1 hz, 1h), 7.20 (d, j = 8.0 hz, 2h), 7.16 (d, j = 8.6 hz, 2h), 7.11 (d, j = 8.1 hz, 2h), 3.96 (s, 2h), 2.01 (s, 3h) ; c nmr (100 mhz, dmso), c 178.7, 149.0, 142.4, 139.5, 133.8, 132.0, 130.6, 129.4, 126.4, 123.8, 121.5, 118.0, 116.6, 41.3, 12.9 ; ms (es), [m + h]m / z 410.1, hrms calculated for 410.1368 c24h19no2f3, found 410.1348. 6j : white solid (yield 30%) ; mp 240242 c ; h nmr (400 mhz, meod) 8.27 (d, j = 8.8 hz, 1h), 7.62 (s, 1h), 7.527.45 (m, 5h), 7.437.34 (m, 3h), 7.24 (d, j = 7.9 hz, 1h), 4.15 (s, 2h), 2.05 (s, 3h) ; ms (es) m / z 444 [m + h ] acc mass found : 444.0962, calculated 444.0978 for c24h18no2f3cl. 6u : white solid (yield 28%) ; mp 207208 c ; h nmr (400 mhz, cdcl3) 8.24 (d, j = 8.2 hz, 1h), 7.61 (d, j = 8.3 hz, 1h), 7.54 (t, j = 7.5 hz, 1h), 7.42 (d, j = 8.5 hz, 2h), 7.31 7.17 (m, 3h), 7.03 (dd, j = 8.6, 6.9 hz, 4h), 2.02 (s, 3h) ; c nmr (100 mhz, cdcl3) 179.14, 158.36, 155.06, 148.33, 145.44, 139.67, 131.94, 130.92, 130.58, 125.83, 123.79, 123.76, 123.15, 120.76, 118.57, 118.17, 116.35, 12.76 ; ms (es) m / z 412 [m + h ] acc mass found : 412.1175, calculated 412.1161 for c23h17no3f3. a suspension of phosphate 43 (0.18 mmol, 1.0 equiv) in anhydrous methanol (10 ml) was subjected to hydrogenation in the presence of 10% pd / c (50 mg) at room temperature for 10 min. the catalysts and any precipitates were filtered off and the methanol portion was analyzed by tlc. the solvent was removed in vacuo to give the desired phosphate pro - drug 44 and no further purification was required. white solid (yield 80%) ; mp 201203 c ; h nmr (400 mhz, cdcl3) 11.82 (s, 1h), 11.62 (s, 1h), 8.32 (d, j = 8.2 hz, 1h), 8.26 (d, j = 8.0 hz, 1h), 8.12 (d, j = 8.4 hz, 1h), 8.06 (s, 1h), 7.91 (t, j = 8.2 hz, 1h), 7.82 (t, j = 8.1 hz, 1h), 7.68 (d, j = 8.0 hz, 1h), 7.56 (d, j = 8.2 hz, 2h), 7.52 (d, j = 8.0 hz, 2h), 7.467.32 (m, 12h), 4.12 (s, 2h), 4.09 (s, 2h), 2.40 (s, 3h), 2.37 (s, 3h). p nmr (162 mhz, cdcl3) 5.027, 5.396 ; ms (es) m / z 522 [m h ] acc mass found : 522.0471, calculated 522.0485 for c24h17no5f3pcl. quinolone 6j (0.31 mmol) in anhydrous thf was added buok (52.7 mg, 0.47 mmol) at room temperature. the mixture was stirred for 1/2 h. 4-morpholinecarbonyl chloride (0.05 ml, 0.41 mmol) was added. the mixture was stirred for a further 2 h (followed by tlc). the reaction was quenched with brine and was extracted with ethyl acetate, dried over na2so4, filtered, and concentrated to an oil. the crude product was purified by column chromatography using 20% ethyl acetate in hexane to give 43 as a white solid (yield 66%) ; mp 148150 c ; h nmr (400 mhz, cdcl3) 8.12 (s, 1h), 7.74 (d, j = 8.9 hz, 1h), 7.53 (d, j = 8.1 hz, 2h), 7.49 (d, j = 8.9 hz, 1h), 7.30 (d, j = 8.1 hz, 2h), 7.24 (d, j = 8.9 hz, 2h), 7.14 (d, j = 8.8 hz, 2h), 4.06 (s, 2h), 3.873.83 (m, 6h), 3.65 (brs, 2h), 2.30 (s, 3h) ; ms (es) m / z 557 (m + h) acc mass found : 557.1443, calculated 557.1455 for c29h25n2o4f3cl. ic50s (50% inhibitory concentrations) were calculated by using the four - parameter logistic method (grafit program ; erithacus software, united kingdom) pfndh2 activity was measured using an end - point assay in a 384-well plate format. final assay concentrations used were 200 m nadh, 10 mm kcn, 1 g / ml f571 membrane, and 20 m decylubiquinone (dq). a pre - read at 340 nm was obtained prior to the addition of dq to initiate the reaction followed by a post - read at 1 min. the agreed qc pass criteria was z > 0.6 and signal / background > 10. compounds were selected by the described chemoinformatics algorithms from the biofocus dpi compound library (galapagos company). p. falciparum cell - free extracts were prepared from erythrocyte - freed parasites as described previously, and recombinant pfndh2 was prepared from the escherichia coli heterologous expression strain f571. all in vivo studies were approved by the appropriate institutional animal care and use committee and conducted in accordance with the international conference on harmonization (ich) safety guidelines. | a program was undertaken to identify hit compounds against nadh : ubiquinone oxidoreductase (pfndh2), a dehydrogenase of the mitochondrial electron transport chain of the malaria parasite plasmodium falciparum. pfndh2 has only one known inhibitor, hydroxy-2-dodecyl-4-(1h)-quinolone (hdq), and this was used along with a range of chemoinformatics methods in the rational selection of 17 000 compounds for high - throughput screening. twelve distinct chemotypes were identified and briefly examined leading to the selection of the quinolone core as the key target for structure activity relationship (sar) development. extensive structural exploration led to the selection of 2-bisaryl 3-methyl quinolones as a series for further biological evaluation. the lead compound within this series 7-chloro-3-methyl-2-(4-(4-(trifluoromethoxy)benzyl)phenyl)quinolin-4(1h)-one (ck-2 - 68) has antimalarial activity against the 3d7 strain of p. falciparum of 36 nm, is selective for pfndh2 over other respiratory enzymes (inhibitory ic50 against pfndh2 of 16 nm), and demonstrates low cytotoxicity and high metabolic stability in the presence of human liver microsomes. this lead compound and its phosphate pro - drug have potent in vivo antimalarial activity after oral administration, consistent with the target product profile of a drug for the treatment of uncomplicated malaria. other quinolones presented (e.g., 6d, 6f, 14e) have the capacity to inhibit both pfndh2 and p. falciparum cytochrome bc1, and studies to determine the potential advantage of this dual - targeting effect are in progress. |
in general, the physical ability of the elderly is lower than that of the young. the differences could be caused by compensation strategies crucial for gait ability, such as slow walking speed, or reduced range of motion of the joints for improving body stability during walking1, 2. falls primarily occur due to both a decline in physical ability due to aging and environmental causes. the environmental causes can be reduced by finding risk factors and deteriorations in physical and sensory functions3. however, low lighting, one of the causes of falls by the elderly, is common in daily living. insufficient visual information due to low lighting, can increase the risk of falling due to unseen obstacles or reduced body stability in daily living5. in addition, visual information plays a crucial role in the ability to avoid obstacles as well as in the proactive control of dynamic stability and route planning during level walking6, 7. nevertheless, most previous studies have focused on recognizing and avoiding obstacles, and walking on an uneven surface or stairs8,9,10. in other words, gait patterns during even - surface walking may change with lack of visual information, especially in the case of the elderly, who have a different balance strategy or method of maintaining body balance while walking than the young2. it is necessary to identify the effect of insufficient visual information on walking patterns by examining even - surface walking under low lighting. a recent study confirmed that there were significant differences in walking speed and lower limb kinematics (i.e., toe clearance) between the young and the elderly during level walking under low light. the authors of that considered that body stability was maintained by the elderly, because the subjects were walking on an even surface. however, in another study, which evaluated body stability, the medio - lateral range of motion at the center of mass was used to record the actual body stability. therefore, as a supplementary work, the goal of this study was to evaluate the changes in body stability at the head and the pelvis of the elderly while walking on an even surface under low light. ten healthy young males (21.6 1.7 years, 173.4 3.9 cm, 67.8 12.7 kg) and ten elderly adult males (72.0 5.5 years, 161.5 5.5 cm, 64.2 5.9 kg) without a medical history of a problem in the lower extremities for the past 1 year and no problems with vision participated in this experiment. all the elderly participants could walk more than 10 meters without the help of others, and their motor function was in the normal range at level five of the functional ambulation category (fac). the protocol of this study was approved by the ethics committee of konkuk university. experimental procedures were explained to the subjects, and their written consent was obtained. all subjects walked five times on a 7 m even - surface walkway at their preferred walking speed under normal light (> 300 lux, norm) and under low light (< 5 lux, low) conditions., usa) with six infrared cameras was used for data acquisition at a sampling frequency of 120 hz. six reflective markers with a diameter of 8 mm were attached to the head, lumbar spine (between l4 and l5) of the body, and both heels and toes. the experimental lighting condition (illumination) was measured at the middle of the walkway using a digital illuminometer (lx801, nicety, china) with 1 lux resolution and a 050000 lux measuring range. for the low light condition, the intensity of illumination was reduced when the subject started walking. for noise reduction of the position (3d motion) data provided by each mark, the data were ltered using a 2nd order zero - lag low - pass butterworth lter with a 7 hz cut - off frequency. using the nite difference equation, the acceleration data were calculated from the position data. for the comparison of gait and body stability, measurements were recorded of various parameters including walking speed, the stance ratio, and root mean square acceleration (rmsacc) at the head and pelvis. rmsacc is used to provide an indication of the average magnitude of acceleration in each direction during a complete walking trial, and in this study it represents the stability at the head and pelvis11. the paired t - test and independent t - test were performed for comparison of the lighting conditions within each group and between groups, respectively. the walking speed and stance phase of both groups are presented in table 1table 1.walking speed and the stance rationormal lightlow lightwalking speed (m / s)oldmean0.850.86(sd)(0.14)(0.15)youngmean1.40 1.30 (sd)(0.15)(0.13)stance ratio (%) oldmean59.4158.94(sd)(1.65)(2.36)youngmean54.7254.53(sd)(6.33)(5.55)toe clearance (cm)oldmean2.22.1(sd)(0.4)(0.3)youngmean2.5 3.1 (sd)(1.0)(0.3) : significant difference between lighting conditions in each group, p<0.05 ; : significant difference between the elderly and young under each lighting condition, p<0.05. the walking speed under both lighting conditions in the young group was faster than in the elderly group (normal light p=0.000 ; low light p=0.000). a significant difference was observed in the walking speed of the young group between the lighting conditions (p=0.000), but no significant difference was observed in the walking speed of the elderly group between the lighting conditions (p=0.859). because of the lower walking speed of the elderly group, the stance ratio of the elderly group was higher than that of the young group, but the difference was not significant. toe clearance (tc) showed a significant difference between the groups under all lighting conditions (normal light : p=0.036, low light : p=0.000). under both lighting conditions, the average toe clearances of the elderly group did not change much and the difference was not significant (normal light=2.2 cm, low light=2.1 cm, p=0.183). for the young group, a large difference was observed in average toe clearances between the lighting conditions (normal light=2.5 cm, low light=3.1 cm), but it was not statistically significant (p=0.149). : significant difference between lighting conditions in each group, p<0.05 ; : significant difference between the elderly and young under each lighting condition, p<0.05 the results of head and pelvis stability of both groups due to lighting conditions are presented in table 2table 2.head and body stabilityhead stability (rmsacc) normal lightlow lightapmlverapmlveroldmean0.020.140.240.07 0.48 0.88 (sd)(0.01)(0.08)(0.13)(0.05)(0.33)(0.62)youngmean0.030.140.270.030.190.37(sd)(0.01)(0.09)(0.17)(0.03)(0.11)(0.22)pelvic stability (rmsacc)normal lightlow lightapmlverapmlveroldmean0.04 0.430.840.11 1.09 2.14 (sd)(0.03)(0.30)(0.57)(0.07)(0.46)(0.87)youngmean0.080.520.940.090.500.87(sd)(0.03)(0.23)(0.43)(0.06)(0.29)(0.51)ap : anterior - posterior direction, ml : medio - lateral direction, ver : vertical direction ; rmsacc : root mean square of acceleration ; : significant difference between light conditions in each group, p<0.05 ; : significant difference between the elderly and young under each lighting condition, p<0.05. in the results of the elderly group, significant differences were found in all directions at the head and pelvis between the normal and low light conditions (head : anterio - posterior (ap) p=0.003 ; mediolateral (ml) p=0.001, vertical (ver) p=0.002 ; body : ap p=0.004 ; ml p=0.000, ver p=0.000). in the young group, no significant difference was found between the lighting conditions in head or pelvis stability. under the normal lighting condition, a significant difference was found in the ap direction of pelvis stability between the two groups. under the low lighting condition, significant differences were found in all directions of head and pelvis stability between the two groups (head : ap p=0.029 ; ml p=0.004, ver p=0.008 ; pelvis : ml p=0.001, ver p=0.000), except the ap direction of pelvic stability (p=0.548). ap : anterior - posterior direction, ml : medio - lateral direction, ver : vertical direction ; rmsacc : root mean square of acceleration ; : significant difference between light conditions in each group, p<0.05 ; : significant difference between the elderly and young under each lighting condition, p<0.05 a previous study reported that the young showed decreased walking speed and increased toe clearance while walking under low light, while the elderly did not show any changes in these variables. however, although there was a significant difference in gait adaptation between the elderly and young groups due to low light, no change was observed in the medio - lateral range of motion (rom) at the center of mass (com), which represents body stability, between the two groups7. in other words, no significant difference was shown in the body stability of the two groups due to low light. these results confirmed that even though there was a difference in gait pattern (walking speed, stance phase ratio, and tc) between the two groups while walking under low light, the body stability of both groups was maintained in level walking without disturbance. the results of the present study complement the research of the previous study, in which the medio - lateral range of motion of the com was used to represent stability. in this present study, rmsacc, which is commonly used to evaluate physical stability, was used to investigate head and pelvic stability11. the results of the elderly group in the present study show that rmsacc at the head as well as at the pelvis increased significantly, while no difference was observed in the rmsaccs of the young group due to low light condition (table 2). in other words, despite level walking, the body stability under low light of the elderly was reduced, and that of the young was maintained. to summarize the current and previous studies, young adults showed changes in gait pattern (such as decreased walking speed and increased toe clearance)7, but their head and pelvic stabilities were maintained, whereas the elderly did not show changes in gait pattern, but their head and pelvic stabilities were reduced. according to a previous study which investigated age - related differences in stability between level- and irregular - surface walking under normal light, rmsaccs of the elderly were smaller or similar to those of the young. the authors concluded that this was because the elderly adopt a more conservative gait pattern than the young to compensate for their lower physical abilities by reducing walking speed and step length11. average rmsaccs in the present study were similar to the results of a previous study, except during low light walking by the elderly. this demonstrates that the effect of low light on the elderly is greater than on young adults. from the point of view that the effects of light according to age may differ, this agrees with the result of hallemans.12, 13, who showed there were significant differences in step times and kinematics parameters between adults and children caused by vision deprivation. on the other hand, according to the results of thies., an irregular surface has a greater effect on the gait variability of elderly adults than on that of young adults, while low light only slightly affected gait variability12. although it has been reported that step length is related to body stability1, the research of thies. in other previous studies, various studies of the walking environment (such as stair descent6, uneven surface12, and obstacle10) were performed. most results show differences in gait parameters or stability between young and elderly groups. the level of difficulty of these walking conditions was thus greater than those of walking on level ground. according to previous studies using stair descent6 and obstacles10, toe clearance increases in the young in response to low light, whereas the elderly reduce or maintain the same toe clearance6, 10. the authors of those reports claimed that these differences are one of the factors that increase the fall risk of the elderly. thus, the results of this study agree with the results of previous studies, showing that walking on level ground under low light has an effect on body stability. these results can be used for the determination of the age - related effects of various walking conditions under low light, such as walking tests using various levels of difficulty, and age - related differences in gait adaptation. in a future study, to clarify the effect of low light, it will be necessary to perform additional experiments using various walking environments (i.e., uneven surface and obstacles) and a variety of subjects with a range of health conditions and ages. | [purpose ] the purpose of this study was to evaluate the changes in body stability of the elderly while walking on even surface ground under low light. [subjects ] ten young males and ten elderly males participated in this experiment. [methods ] each subject walked along a 7 m walkway five times at their preferred walking speed under normal (> 300 lux, norm) and low light conditions (< 5 lux, low). to compare the changes in body stability, the root mean square of acceleration (rmsacc) at the head and pelvis was used. [results ] the results show that the body stability of young adults showed a similar rmsacc in all directions at the head and pelvis between the normal and low light walking conditions. in contrast, the rmsacc in all directions at the head and pelvis during low light walking by elderly adults was significantly greater than that of normal light walking. [conclusion ] it was confirmed that, despite walking on even ground, low light condition affects the body stability of the elderly. to clearly evaluate the effect of low light with aging on gait pattern, further study will be necessary to perform additional experiments under various environmental conditions to investigate walking speed, multi - tasking, stairs, and uneven walkway performance. |
cerebral hyperperfusion syndrome (chs) is a rare (0 - 3%) but well - characterized complication after carotid endarterectomy (cea). it can occur any time during the 28 days following surgery, but most studies report onset within several hours to seven days after surgery. chs is characterized by throbbing ipsilateral headache, neurological deficits such as confusion, visual or other focal disturbance, and seizures. radiological aspects are brain edema, mass effect, focal infarct and petechial or massive ipsilateral hemorrhage. several mechanisms are involved in the pathophysiology of chs. first, cerebral blood flow increases, a result of multiple factors such as removal of stenosis, release of vasoactive peptides, baroreceptor reflex breakdown or trigeminovascular reflex lesion during surgery. hyperperfusion can exceed autoregulation capacity in a chronically hypoperfused hemisphere, cause transudation of fluid and vasogenic edema and increase vascular permeability by endothelial dysfunction. a 74-year - old man underwent endarterectomy for a right asymptomatic 90% nascet stenosis of the internal carotid artery. he was a former smoker, with a history of high blood pressure, hypercholesterolemia, a pacemaker for an atrioventricular block and ischemic cardiopathy with a coronary bypass. nine days after surgery, he was referred to the emergency department for a left hemiplegia. neurological examination showed altered and fluctuant consciousness, left hemiplegia and left visual and sensory neglect. in the first hours, the patient presented with a partial motor secondary generalized seizure. emergency brain ct scan showed a right frontal subarachnoidal hemorrhage, without parenchymal bleeding (fig. 1). a middle cerebral artery (mca) vasospasm was found on cerebral angiography, but no cerebral aneurysm or vascular malformation. because of the pacemaker, brain mri was not possible. treatment typically consists of levetiracetam (250 mg twice a day) to prevent seizure, nimodipine for vasospasm, and cessation of aspirin. evolution was favorable and neurological status improved in 2 days, without recurrence of seizure or headache. the incidence of chs after cea or carotid artery stenting (cas) is about 3%. subarachnoidal hemorrhage can occur in association with intracerebral hemorrhage, but rarely occurs isolated. to our knowledge, isolated subarachnoidal hemorrhages have been reported in 6 patients after cas and in only 1 after cea. another case is reported after cea but in a patient with an ipsilateral aneurysm, and the cause of the bleeding was not identified. the reason why subarachnoidal hemorrhage is more often associated with cas than cea is not known. our patient had some predisposing factors such as age, history of high blood pressure, severe carotid stenosis and treatment by aspirin. many predisposing factors for chs exist, especially preoperative severe cerebral blood flow decrease and pre- or postoperative hyperperfusion. identifying patients at risk of chs is essential because supervision, screening and early treatment may improve outcome. actually, various radiological techniques are studied to detect chs precociously, such as signal intensity of the mca on a time - of - flight sequence of a preoperative mri, functional mri or doppler. this may be an alerting symptom detectable in most patients useful in our aim to treat them early. therefore, early recognition of cerebral hyperperfusion is important to minimize perioperative risks associated with cea. the time of onset in the first week after cea and the type of headache presented by our patient were typical. the combination of headache, seizures and focal deficit was also characteristic for the diagnosis of chs. transcranial doppler showed an mca vasospasm maybe secondary to subarachnoidal hemorrhage, but no increase of the velocity of the mca was found. in patients with chs, this increase can be explain by the controlateral spasm, doppler performed two days after introducing treatment, or technical difficulties. because blood flow is pressure - dependent in patients with chs, blood pressure control is recommended, but there are no data from randomized trials. drugs of choice like clonidine or labetalol have to reduce arterial blood pressure but should have little effect on intracranial pressure. treatment of our patient with nicardipine can be discussed because it is a cerebral vasodilatating agent, but in this case, the vasospasm was the indication for this treatment. clinical outcome is dependent on the severity of chs and on the timing of diagnosis and treatment. neurological deficits seem to be reversible if there is no major damage caused by vasogenic edema or hemorrhage. several studies reported that chs, even if asymptomatic, is associated with impaired cognitive function.. it can be associated with intracerebral hemorrhage, but isolated subarachnoidal hemorrhage is extremely rare. | cerebral hyperperfusion syndrome is a rare but well - described complication following carotid endarterectomy or stenting. clinical signs are ipsilateral, throbbing, unilateral headache with nausea or vomiting, seizures, and neurological deficits, with or without intracerebral abnormalities on ct scan, such as brain edema or intracerebral hemorrhage. subarachnoidal hemorrhage is rarely described especially if it occurs isolated. we describe a 74-year - old man with a history of high blood pressure, hypercholesterolemia, atrioventricular block with pacemaker, and ischemic cardiopathy with coronary bypass. he underwent right carotid endarterectomy for a 90% nascet asymptomatic stenosis. four days after surgery, he complained of unusual headaches with right, throbbing hemicrania. nine days after surgery, he presented with left hemiplegia and a partial motor seizure. he had fluctuant altered consciousness, left hemiplegia, and left visual and sensory neglect. brain ct showed right frontal subarachnoidal hemorrhage without parenchymal bleeding. cerebral angiography found no cerebral aneurysm, no vascular malformation, but a vasospasm of the left middle cerebral artery. transcranial doppler confirmed this vasospasm. evolution was favorable with no recurrence of seizures but with an improvement of the neurological deficits and vasospasm. physicians should bear in mind this very rare complication of endarterectomy and immediately perform neuroimaging in case of unusual headache following endarterectomy or angioplasty. |
non - communicable diseases (ncds) are the most important health and financial issues of the century worldwide. in 2008, 63% of global deaths were due to ncds, and expenditure greater than $ 6.3 trillion united states dollars was estimated due to the five major ncds : cardiovascular disease, diabetes, cancer, chronic obstructive pulmonary disease, and mental illness.1, 2 these health and economic burdens due to ncds have been predicted to rise sharply by 2030 on a global scale. in japan, the burdens of increasing national health expenditures have caused major public health problems. according to the reports of the japan 's ministry of health, labour and welfare, the total medical expenditure (me) in 2013 was 40.06 trillion yen, of which approximately 40% was attributable to ncds, including cancer, coronary heart disease, and stroke. undergoing general health checkups (ghcs) is a common activity in many countries because the early diagnosis and treatment of ncds is a principle of preventive medicine. some previous studies have reported that not undergoing health checkups was associated with higher mortality in women, and health checkups may increase survival or decrease overall mortality among the elderly. however, recent studies have indicated that health checkups for an adult population were not associated with lower rates of all - cause mortality in a systematic review and meta - analysis.6, 7, 8 therefore, the benefits of ghcs are still not clear. some previous cross - sectional studies reported that an association between the rate of utilizing health checkups and the hospital inpatient fee or average mes was found across municipalities.9, 10, 11 takeuchi. reported that examinees aged over 70 years who had undergone health checkups for the past 3 years had lower mes per capita as outpatients and inpatients than non - examinees, but this study did not investigate the individual frequency of heath checkups. for outpatient mes, there was no reported difference between participants with low or high rates of health checkups in cities in one study. although one study among 1,811 middle - aged workers reported that the total medical expenditure was lower in those who had a higher frequency of health checkups over a period of 3 years, the sample size was small and the study was limited to occupational health. to our knowledge, there have been insufficient studies to clarify the relationship between the rate of utilizing ghcs and mes including outpatient, inpatient, and total fees in community populations involving large - scale cohort studies. the aim of the present study was to clarify the association between the rate of undergoing ghcs and subsequent mes using a large - scale retrospective cohort study in a middle - aged japanese population living in the community. a community - based retrospective cohort study was conducted in soka city, saitama prefecture, japan. soka city is an urban area adjacent to the northeast of tokyo, with a population of about 240,000. in japan, there are two kinds of public health insurance for the whole nation : employee health insurance for employees and their families and national health insurance for those not enrolling in the employee health insurance system. in soka city, approximately 30% of the population belong to the national health insurance, and the others belong to the employee health insurance. a total of 77,265 residents enrolled as soka city national health insurance subscribers, and 49,854 residents (24,547 males and 25,307 females) aged from 40 to 74 years old were invited to undergo health checkups in 2010. of the 49,854 subjects, 8,056 residents who were under 40 years old in 2002 and 8,381 residents who were soka city national health insurance subscribers after 2002 the subjects analyzed in the present study (67.0%) were 33,417 residents (15,819 males and 17,599 females) with complete datasets based on the records of mes from 2008 to 2010, and the data of general health checkups from 2002 to 2007, which were combined using the i d of the soka city national health insurance subscribers. records on mes and mc in 2008, 2009, and 2010 were provided by saitama national federation of health insurance societies, an agency of soka city national health insurance. per capita outpatient, inpatient, and total mes were calculated with 2008, 2009, and 2010 data, and the 3-year data (20082009) were pooled. the mc was determined based on visiting a medical institute more than once as an outpatient or for hospitalization from 2008 to 2010. according to the health services for the elderly act in japan, those aged 40 years old or older although ghcs are encouraged, each individual has no obligation to attend, and there is no penalty for not undergoing ghcs. in soka city, the insurer pays about 10,000 yen and individuals payed about 1,200 yen to undergo a ghc. annual ghcs in japan include the following : past medical history, anthropometric examination (weight, height, and blood pressure), laboratory examination (red blood cell count, hemoglobin concentration, packed cell volume, total serum cholesterol concentration, blood glucose concentration, aspartate aminotransferase and alanine aminotransferase activities, and serum uric acid), and electrocardiography. in this study, ghc utilization was assessed using 6-year records from 2002 to 2007, which were provided by saitama national federation of health insurance societies, an agency of soka city national health insurance, and three utilization subgroups were assigned : non - utilizers (zero times), low - frequency utilizers (13 times), and high - frequency utilizers (46 times). the number of ghcs was counted from 2002 to 2007, non - utilizers were excluded, and the other two subgroups were divided using a cutoff point of 3.7 times (the median value). per capita outpatient, inpatient, and total mes of 2010, 2009, 2008, and the mean of the pooled 3-year data from 2008 to 2010, are expressed as means (ranges). in this study, cost equivalents are reported using exchange rates in which one united states dollar ($) was equivalent to 120 japanese yen (jpy) and one euro was equivalent to jpy133 based on the rates in october 2015. the unit of japanese yen (jpy) of the present study is one thousand. because the frequency distributions of mes are often zero, and others are continuous, mes are mixed data that include compound poisson and gamma distributions. so, tweedie distributions15, 16, 17 in the generalized linear model (glm) were used to analyze the association of mes and mes plus the ghc cost with the ghcs utilization subgroups after adjustment for age and sex. the estimated marginal mean and 95% confidence interval (ci) are shown, and three pairwise comparisons among utilization groups using the bonferroni 's post - hoc test in the glm were employed. for analysis of medical consultation, a multivariate logistic regression model was used, with adjustment for age and sex. statistical analyses were performed using spss statistics 22 for windows (spss japan inc., ethical approval was given by the ethics committee at dokkyo medical university (university 27006). the identities of subjects remained anonymous, in compliance with the ethical guidelines for epidemiological research (ministry of education, culture, sports, science and technology, and ministry of health, labour and welfare, japan, 2013). a community - based retrospective cohort study was conducted in soka city, saitama prefecture, japan. soka city is an urban area adjacent to the northeast of tokyo, with a population of about 240,000. in japan, there are two kinds of public health insurance for the whole nation : employee health insurance for employees and their families and national health insurance for those not enrolling in the employee health insurance system. in soka city, approximately 30% of the population belong to the national health insurance, and the others belong to the employee health insurance. a total of 77,265 residents enrolled as soka city national health insurance subscribers, and 49,854 residents (24,547 males and 25,307 females) aged from 40 to 74 years old were invited to undergo health checkups in 2010. of the 49,854 subjects, 8,056 residents who were under 40 years old in 2002 and 8,381 residents who were soka city national health insurance subscribers after 2002 the subjects analyzed in the present study (67.0%) were 33,417 residents (15,819 males and 17,599 females) with complete datasets based on the records of mes from 2008 to 2010, and the data of general health checkups from 2002 to 2007, which were combined using the i d of the soka city national health insurance subscribers. records on mes and mc in 2008, 2009, and 2010 were provided by saitama national federation of health insurance societies, an agency of soka city national health insurance. per capita outpatient, inpatient, and total mes were calculated with 2008, 2009, and 2010 data, and the 3-year data (20082009) were pooled. the mc was determined based on visiting a medical institute more than once as an outpatient or for hospitalization from 2008 to 2010. according to the health services for the elderly act in japan, those aged 40 years old or older are recommended to undergo ghcs every year. although ghcs are encouraged, each individual has no obligation to attend, and there is no penalty for not undergoing ghcs. in soka city, the insurer pays about 10,000 yen and individuals payed about 1,200 yen to undergo a ghc. annual ghcs in japan include the following : past medical history, anthropometric examination (weight, height, and blood pressure), laboratory examination (red blood cell count, hemoglobin concentration, packed cell volume, total serum cholesterol concentration, blood glucose concentration, aspartate aminotransferase and alanine aminotransferase activities, and serum uric acid), and electrocardiography. in this study, ghc utilization was assessed using 6-year records from 2002 to 2007, which were provided by saitama national federation of health insurance societies, an agency of soka city national health insurance, and three utilization subgroups were assigned : non - utilizers (zero times), low - frequency utilizers (13 times), and high - frequency utilizers (46 times). the number of ghcs was counted from 2002 to 2007, non - utilizers were excluded, and the other two subgroups were divided using a cutoff point of 3.7 times (the median value). per capita outpatient, inpatient, and total mes of 2010, 2009, 2008, and the mean of the pooled 3-year data from 2008 to 2010, are expressed as means (ranges). in this study, cost equivalents are reported using exchange rates in which one united states dollar ($) was equivalent to 120 japanese yen (jpy) and one euro was equivalent to jpy133 based on the rates in october 2015. the unit of japanese yen (jpy) of the present study is one thousand. because the frequency distributions of mes are often zero, and others are continuous, mes are mixed data that include compound poisson and gamma distributions. so, tweedie distributions15, 16, 17 in the generalized linear model (glm) were used to analyze the association of mes and mes plus the ghc cost with the ghcs utilization subgroups after adjustment for age and sex. the estimated marginal mean and 95% confidence interval (ci) are shown, and three pairwise comparisons among utilization groups using the bonferroni 's post - hoc test in the glm were employed. for analysis of medical consultation, statistical analyses were performed using spss statistics 22 for windows (spss japan inc., tokyo, japan). ethical approval was given by the ethics committee at dokkyo medical university (university 27006). the identities of subjects remained anonymous, in compliance with the ethical guidelines for epidemiological research (ministry of education, culture, sports, science and technology, and ministry of health, labour and welfare, japan, 2013). table 1 shows the characteristics of sex and age in 2002 ; the status of participation in health checkups ; outpatient and inpatient mc ; and per capita outpatient, inpatient, and total mes in the 3-year period of 20082010. of the 33,417 participants, 20,578 (61.6%) were non - utilizers, 5,777 (17.3%) were low - frequency utilizers, and 7,062 (21.1%) were high - frequency utilizers based on the number of ghcs in the 6-year period from 2002 to 2007. table 2 shows that, based on the results of the multivariate logistic regression model, undergoing more health checkups was significantly correlated with a higher frequency of any outpatient mc, and a lower frequency of any inpatient mc in 2008, 2009, and 2010. the trend tests on the adjusted or of outpatient and inpatient mc were significant among the three ghc subgroups in 2008, 2009, and 2010. table 3 shows the association between the ghc attendance status and mes using tweedie analysis of glm and the bonferroni 's post - hoc test, after adjustment for age and sex. for outpatient mes, there were significant differences between high - frequency utilizers and non - utilizers in 2008 and 2009 and between high - frequency utilizers and low - frequency utilizers in 2009. compared with non - utilizers, high - frequency and low - frequency utilizers showed significantly higher inpatient mes in 2008, 2009, and 2010. compared with low - frequency utilizers, high - frequency utilizers showed significantly higher inpatient mes in 2009 and 2010. in 2008, 2009, and 2010, high - frequency and low - frequency utilizers showed significantly higher total mes than non - utilizers. in 2010, high - frequency utilizers showed significantly higher total mes than low - frequency utilizers. 1 shows the pooled estimated marginal means and 95% cis for 3-year mes associated with the frequencies of ghc attendance using tweedie analysis in the glm, after controlling for age and sex. compared with non - utilizers, high - frequency utilizers showed significantly higher outpatient mes (jpy394,700 [95% ci, jpy385,200-jpy404,400 ] vs. jpy373,100 [95% ci, jpy367,800-jpy378,500 ]). low- and high - frequency utilizers showed significantly lower inpatient mes (jpy224,000 [95% ci, jpy205,400-jpy244,300 ] and jpy181,500 [95% ci, jpy166,900-jpy197,400 ], respectively, vs. jpy309,300 [95% ci, jpy296,200-jpy323,100 ]) and total mes (jpy610,600 [95% ci jpy593,200-jpy628,200 ] and jpy580,700 [95% ci, jpy565,200-jpy596,600 ], respectively, vs. jpy686,600 [95% ci, jpy676,300-jpy697,200 ]) based on the pooled data from 2008 to 2010. 1 also reveals that the low- and high - frequency utilizers showed significantly higher outpatient mes and ghc costs and lower inpatient and total mes, as well as higher total ghc costs, than the non - utilizers. compared with low - frequency utilizers, high - frequency utilizers showed significantly higher outpatient mes and ghc costs we assessed the associations of the three groups of ghc frequency from 2002 to 2007 and outpatient, inpatient, and total mes of 2008, 2009, 2010, as well as pooled 3-year mes, in a retrospective cohort study of japanese residents. we found that outpatient mes of high - frequency utilizers were high in comparison with those of non - utilizers in 2008, 2009, and the 3 pooled years, and inpatient and total mes of low- and high - frequency utilizers were low in comparison with those of non - utilizers in 2008, 2009, 2010, and the 3 pooled years. to our knowledge, this is the first study to suggest that a higher frequency of attendance at ghcs may increase outpatient mes but decrease inpatient and total mes among japanese in the community using a large - scale retrospective cohort study design. outpatient mes were reported to be correlated negatively with ghc attendance in previous studies.11, 12, 19, 20 however, most of these studies used a cross - sectional design, preventing assessment of the association between ghcs and mes. in this study, we obtained results that contradict those of previous studies : outpatient mes increased with the frequency of ghc attendance. a previous study reported that the high rate of ghcs can increase outpatient care, and krogsboll. also indicated that health checks may be associated with more diagnoses and more drug treatment, so we consider these results in agreement with ours. moreover, we found that inpatient or total mes were negatively associated with attendance at ghcs, which is consistent with previous studies.9, 10, 11, 12, 13, 14 meanwhile, we found that inpatient mc deceased with the higher frequency of ghcs, which could lead to lower inpatient mes. according to takeuchi and suka., early diagnosis facilitated by early outpatient consultation is more likely to lead to a slight increase in outpatient mes but a decrease in inpatient mes for serious diseases, resulting in a decrease in the total cost of healthcare. according to fig. 1, per capita total mes pooled over the 3 years for non - utilizers, low - frequency utilizers, and high - frequency utilizers of ghcs were 686.3, 610.6, and 580.7 thousand yen, respectively. the differences between non - utilizers and high - frequency utilizers were 105.6 thousand yen, and the differences between low - frequency utilizers and high - frequency utilizers were 29.9 thousand yen. every year, an approximately 7.8 hundred million yen (6.5 million dollars or 5.9 million euro) decline can be estimated if non - utilizers and low - frequency utilizers become high - frequency utilizers among approximately 30,000 community residents. considering the ghc cost, it is possible to save 4.5 hundred million yen (3.8 million dollars or 3.4 million euro) ever year. although these savings would need to be confirmed through an intervention study in the future, encouraging attendance at ghcs is important to reduce mes. in this study, we also found the inpatient and total mes over a 3-year period were significantly lower in high - frequency utilizers than in low - frequency utilizers. however, after the ghc cost was added, the 3-year inpatient and total expenditures of high - frequency utilizers become higher than those in low - frequency utilizers, although this difference was not significant. from an economic viewpoint, the low - frequency ghc utilizers may represent good cost - benefit performance. in addition, the high - frequency ghc utilizers had a less medical consultation as inpatients and the definition of mes in japan does not include the cost of preventive medicine, such as health checkups, vaccination, and normal delivery. therefore, it is difficult to simply say whether low - frequency or high - frequency utilizers are preferable based on this study.. the strengths of the present study include the use of a retrospective cohort study design and inclusion of a large sample size, as well as the 6-year assessment of ghc attendance and 3-year mes based on the official records of japan national health insurance, which minimizes recall bias. additionally, the pooled 3-year mes were analyzed to account for individual changes from year to year. we used tweedie distributions of a glm, which are reported to facilitate favorable medical cost analysis, to analyze mes ; outpatient, inpatient, and total mes were assessed in the same period, and the relationship between mes and ghc attendances was examined. also, this is the first study to add the ghc cost to mes, allowing us to interpret the difference of mes among the subgroups of ghcs objectively, although mes do not usually include the cost of ghcs in japan. first, there were no data on subjects ' socioeconomic status (such as income level or education level), family members, health conditions, or behavioral elements, so we were unable to avoid the confounding bias caused by socioeconomic, health, and behavioral factors. considering that these potential confounding factors could impact attending ghcs,23, 24, 25 we should be careful in interpreting the results of this study. however, the bias of sociodemographic factors was minimized through adjustment for the age and sex in this study. second, we did not know why about 60% of residents did not participate in annual ghcs, so the reasons for non - participation will be assessed in future research. third, we were unable to distinguish the kinds of mes, such as cardiovascular disease, infectious diseases, and dental practice. finally, only one municipality was involved, so future research should focus on other municipalities to assess whether or not the findings are generalizable. this study suggests that outpatient mes rise when annual health check - ups are frequent and the ghc cost is not included, but inpatient mes and total mes are lower. increasing the rates of attendance at ghcs in community populations might be an important means of reducing healthcare expenditures. | backgroundwe sought to clarify the association between the personal utilization of general health checkups (ghcs) and medical expenditures (mes) in a middle - aged japanese population.methodsa retrospective cohort study was conducted. subjects were 33,417 residents (15,819 males and 17,598 females) aged 48 years or older in 2010 who were invited to undergo ghcs every year. official records on ghcs from 2002 to 2007 and mes from 2008 to 2010 were provided by soka city, saitama prefecture, japan. the utilization of ghcs was divided into zero times (non - utilizers), 13 times (low - frequency utilizers), and 46 times (high - frequency utilizers). tweedie distributions in the generalized linear model were used to analyze the association between mes and the subgroups of ghc utilization after adjustment for age and sex.resultsof the 33,417 subjects, 20,578 (61.6%) were non - utilizers, 5,777 (17.3%) were low - frequency utilizers, and 7,062 (21.1%) were high - frequency utilizers, based on the attendance to ghcs from 2002 to 2007. compared with the non - utilizers, the high - frequency utilizers showed significantly higher outpatient mes (jpy394,700 vs. jpy373,100). the low- and high - frequency utilizers showed significantly lower inpatient mes (jpy224,000 and jpy181,500 vs. jpy309,300) and total mes (jpy610,600 and jpy580,700 vs. jpy689,600) than the non - utilizers based on the pooled data from 2008 to 2010.conclusionsthis study suggests that the outpatient mes rise when annual ghcs are increasingly attended (not including the ghc cost), but inpatient and total mes are lower. to reduce mes, increasing the rates of attendance at ghcs by the general public may be important. |
cervicogenic headache (cgh) is a clinical syndrome characterized by primarily unilateral pain that originates in the neck, typically provoked by neck movement or pressure over tender points in the neck, with reduced range of movement of the cervical spine. features of cgh headache can be similar to other primary headache disorders such as migraine, tension - type headache, and related cranial neuralgias such as occipital neuralgia. the diagnostic criteria for cgh headache put forth by the international headache society (ihs) are as follows : a.pain, referred from a source in the neck and perceived in one or more regions of the head and/or face, fulfilling criteria c and d;b.clinical, laboratory, and/or imaging evidence of a disorder or lesion within the cervical spine or soft tissues of the neck known to be, or generally accepted as, a valid cause of headache;c.evidence that the pain can be attributed to the neck disorder or lesion based on at least one of the following : demonstration of clinical signs that implicate a source of pain in the neck;abolition of headache following diagnostic blockade of a cervical structure or its nerve supply using placebo- or other adequate controls;d.pain resolves within three months after successful treatment of the causative disorder or lesion. pain, referred from a source in the neck and perceived in one or more regions of the head and/or face, fulfilling criteria c and d ; clinical, laboratory, and/or imaging evidence of a disorder or lesion within the cervical spine or soft tissues of the neck known to be, or generally accepted as, a valid cause of headache ; evidence that the pain can be attributed to the neck disorder or lesion based on at least one of the following : demonstration of clinical signs that implicate a source of pain in the neck;abolition of headache following diagnostic blockade of a cervical structure or its nerve supply using placebo- or other adequate controls ; demonstration of clinical signs that implicate a source of pain in the neck ; abolition of headache following diagnostic blockade of a cervical structure or its nerve supply using placebo- or other adequate controls ; pain resolves within three months after successful treatment of the causative disorder or lesion. cgh is thought to be referred pain arising from cervical structures innervated by the upper three cervical spinal nerves, and therefore any structure innervated by the c1c3 spinal nerves could be the source for cervicogenic headache. these nerves relay pain signals to the trigeminocervical nucleus, which is the nociceptive nucleus of the head and upper neck. this convergence is hypothesized to be responsible for referred pain to the occiput and/or eyes. the potential pain generators of cgh are diverse ; they include atlanto - occipital joint, atlantoaxial (aa) joints, c2 - 3 zygapophysial joint, c2 - 3 intervertebral disc, cervical myofascial trigger points, and the upper cervical spinal nerves themselves. occipital neuralgia falls under a separate ihs heading, but may also produce cgh. the referred pain over the shoulder girdle, head, and upper arm can be either somatic referred pain (discogenic, facet joint - related, or myofascial) or radicular pain (nerve root irritation) ; pain in the forearm and hand is more likely to be radicular pain. for example, lateral atlantoaxial joint intra - articular injection can be effective for diagnosis and short - term pain relief for lateral atlantoaxial joint pain. this clinical entity is typically caused by osteoarthritis or post - traumatic event, and may account for up to 16 % of patients with cgh. symptoms include occipital or suboccipital pain, focal tenderness over the suboccipital area, restricted painful rotation of c1 on c2, and pain provocation by passive rotation of c1. third occipital headache is secondary to c2 - 3 facet joint arthritis ; this joint is innervated by the third occipital nerve, which is a superficial medial branch of c3 dorsal ramus. this can be seen in 27 % of patients with cgh after whiplash injury from a motor vehicle accident. tenderness over the c2 - 3 joint may be the only suggestive finding on physical examination. injection into this joint may produce pain relief, and radiofrequency ablation can be considered for long - term pain relief if temporary pain relief is achieved by third occipital nerve block. occipital neuralgia is coded separately under cranial neuralgias, but can produce symptoms indistinguishable from cgh. it typically presents as sharp pain in the occipital region, and this condition may require occipital nerve blockade for diagnosis and treatment. nerve blocks to target the greater and lesser occipital nerves from dorsal ramus of c2 and c3 can be both diagnostic and therapeutic. persistent headache secondary to occipital neuralgia may be amenable to occipital neurostimulation [9, 10 ]. c2 nerve root irritation or neuralgia is a subtype of occipital neuralgia that is caused by lesions affecting the c2 nerve root or dorsal ganglion such as neuroma, meningioma, or anomalous vessels. the c2 root lies posterior to the lateral atlantoaxial joint, and thus disorders or inflammation of this joint may lead to irritation or entrapment of the nerve root as well. c2 neuralgia manifests as intermittent lancinating occipital pain, and may be associated with autonomic symptoms such as lacrimation, ciliary injection, and rhinorrhea. abolition of pain by selective c2 nerve root block is essential for making an accurate diagnosis. cervical degenerative disease at c3 - 4, and particularly at c2 - 3, can produce cgh as well. cervical disc interventions for cervical discogenic pain are not commonly performed, however, due to the potential risk of esophageal penetration, leading to discitis or vascular injury. cervical myofascial pain from trigger points in the posterior neck muscles particularly trapezius, sternocleidomastoid, and splenius capitis has been proposed as a cause of headache [13, 14 ]. these tender points often overlie facet joints and may be indistinguishable from the latter as generators of pain. in addition, cervical myofascial pain frequently coexists with other acute and chronic painful musculoskeletal conditions, including cgh, cervical degenerative disc disease, cervical radiculopathy from nerve root irritation, cervical facet arthropathy, and chronic tension - type headache, although it may also be independent of other pain generators. a needling technique, with or without injectate, along with physical therapy, heat, and other conservative treatments, can provide pain relief. certainly, all of the cervical spinal injections carry significant risks and should be performed by well - trained pain specialists. cervical interlaminar epidural steroid injection (cesi) is one of the injections offered by pain specialists for treatment of cgh. access to the cervical epidural space is available by both interlaminar and transforaminal approaches, and fluoroscopy is recommended for either approach [1517 ]. in light of concerns regarding neurologic injury associated with transforaminal injection, one limitation with the interlaminar approach occurs in the case of obliteration of the posterior epidural space from previous surgery or focal central canal stenosis, which would make needle entry into the posterior epidural space difficult. anatomical considerations for cesi are as follows : the dimensions of the epidural space are smaller in the thoracic and cervical space compared with the lumbar region. the ligamentum flavum may not fuse in the midline, as this can be problematic when using the loss - of - resistance (lor) technique. the epidural space is narrowed between c3 and c6 vertebral levels, about 2 mm on average. the cervical interspaces with the largest interlaminar distance are typically found at c6/7 and c7/t1, which are the preferred entry points for most practitioners. solutions injected into the epidural space preferentially flow along the dural sheaths of the spinal nerves, as the only significant barrier to epidural flow is the posterior longitudinal ligament. thus fluid injected within the epidural space will tend to exit the spinal canal through the adjacent intervertebral foramina. there is strong evidence that cervical / thoracic / lumbar interlaminar epidural steroid injection as a class of anesthetic treatment is effective in selected patients with radicular pain or radiculopathy. the recent retrospective controlled trials revealed evidence of short - term relief of radicular pain for up to six weeks. ferrante. attempted to find predictors of clinical outcome in a retrospective review of 100 patients who received cesi. in this study, radicular pain predicted a better outcome, and radiological diagnosis of a normal scan predicted a poor outcome, which suggests that appropriate candidates for cesi are patients with radicular pain correlating to physical and/or radiological findings [20 ]. strub. looked prospectively at the short - term benefits of cesi in 161 patients, and found that 83 % of injections resulted in pain relief. patients with radicular symptoms into the fingers and with multilevel degenerative changes had a higher likelihood of success, while the odds of attaining pain relief were lower for patients requiring opiate analgesics, suggesting that epidural injections can be effective in the treatment of lumbar and cervical radicular pain. while cervical spinal nerve irritation is one of the etiologies of cgh, it is unclear whether cesi will be of benefit in the treatment of cgh. in this review, cgh is thought to be referred pain arising from cervical structures innervated by the upper three cervical spinal nerves, and therefore any structure innervated by the c1c3 spinal nerves could be the source for cervicogenic headache. these nerves relay pain signals to the trigeminocervical nucleus, which is the nociceptive nucleus of the head and upper neck. this convergence is hypothesized to be responsible for referred pain to the occiput and/or eyes. the potential pain generators of cgh are diverse ; they include atlanto - occipital joint, atlantoaxial (aa) joints, c2 - 3 zygapophysial joint, c2 - 3 intervertebral disc, cervical myofascial trigger points, and the upper cervical spinal nerves themselves. the referred pain over the shoulder girdle, head, and upper arm can be either somatic referred pain (discogenic, facet joint - related, or myofascial) or radicular pain (nerve root irritation) ; pain in the forearm and hand is more likely to be radicular pain. for example, lateral atlantoaxial joint intra - articular injection can be effective for diagnosis and short - term pain relief for lateral atlantoaxial joint pain. this clinical entity is typically caused by osteoarthritis or post - traumatic event, and may account for up to 16 % of patients with cgh. symptoms include occipital or suboccipital pain, focal tenderness over the suboccipital area, restricted painful rotation of c1 on c2, and pain provocation by passive rotation of c1. third occipital headache is secondary to c2 - 3 facet joint arthritis ; this joint is innervated by the third occipital nerve, which is a superficial medial branch of c3 dorsal ramus. this can be seen in 27 % of patients with cgh after whiplash injury from a motor vehicle accident. tenderness over the c2 - 3 joint may be the only suggestive finding on physical examination. injection into this joint may produce pain relief, and radiofrequency ablation can be considered for long - term pain relief if temporary pain relief is achieved by third occipital nerve block. occipital neuralgia is coded separately under cranial neuralgias, but can produce symptoms indistinguishable from cgh. it typically presents as sharp pain in the occipital region, and this condition may require occipital nerve blockade for diagnosis and treatment. nerve blocks to target the greater and lesser occipital nerves from dorsal ramus of c2 and c3 can be both diagnostic and therapeutic. persistent headache secondary to occipital neuralgia may be amenable to occipital neurostimulation [9, 10 ]. c2 nerve root irritation or neuralgia is a subtype of occipital neuralgia that is caused by lesions affecting the c2 nerve root or dorsal ganglion such as neuroma, meningioma, or anomalous vessels. the c2 root lies posterior to the lateral atlantoaxial joint, and thus disorders or inflammation of this joint may lead to irritation or entrapment of the nerve root as well. c2 neuralgia manifests as intermittent lancinating occipital pain, and may be associated with autonomic symptoms such as lacrimation, ciliary injection, and rhinorrhea. abolition of pain by selective c2 nerve root block is essential for making an accurate diagnosis. cervical degenerative disease at c3 - 4, and particularly at c2 - 3, can produce cgh as well. cervical disc interventions for cervical discogenic pain are not commonly performed, however, due to the potential risk of esophageal penetration, leading to discitis or vascular injury. cervical myofascial pain from trigger points in the posterior neck muscles particularly trapezius, sternocleidomastoid, and splenius capitis has been proposed as a cause of headache [13, 14 ]. these tender points often overlie facet joints and may be indistinguishable from the latter as generators of pain. in addition, cervical myofascial pain frequently coexists with other acute and chronic painful musculoskeletal conditions, including cgh, cervical degenerative disc disease, cervical radiculopathy from nerve root irritation, cervical facet arthropathy, and chronic tension - type headache, although it may also be independent of other pain generators. a needling technique, with or without injectate, along with physical therapy, heat, and other conservative treatments, certainly, all of the cervical spinal injections carry significant risks and should be performed by well - trained pain specialists. cervical interlaminar epidural steroid injection (cesi) is one of the injections offered by pain specialists for treatment of cgh. access to the cervical epidural space is available by both interlaminar and transforaminal approaches, and fluoroscopy is recommended for either approach [1517 ]. in light of concerns regarding neurologic injury associated with transforaminal injection, one limitation with the interlaminar approach occurs in the case of obliteration of the posterior epidural space from previous surgery or focal central canal stenosis, which would make needle entry into the posterior epidural space difficult. anatomical considerations for cesi are as follows : the dimensions of the epidural space are smaller in the thoracic and cervical space compared with the lumbar region. the ligamentum flavum may not fuse in the midline, as this can be problematic when using the loss - of - resistance (lor) technique. the epidural space is narrowed between c3 and c6 vertebral levels, about 2 mm on average. the cervical interspaces with the largest interlaminar distance are typically found at c6/7 and c7/t1, which are the preferred entry points for most practitioners. solutions injected into the epidural space preferentially flow along the dural sheaths of the spinal nerves, as the only significant barrier to epidural flow is the posterior longitudinal ligament. thus fluid injected within the epidural space will tend to exit the spinal canal through the adjacent intervertebral foramina. there is strong evidence that cervical / thoracic / lumbar interlaminar epidural steroid injection as a class of anesthetic treatment is effective in selected patients with radicular pain or radiculopathy. the recent retrospective controlled trials revealed evidence of short - term relief of radicular pain for up to six weeks. ferrante. attempted to find predictors of clinical outcome in a retrospective review of 100 patients who received cesi. in this study, radicular pain predicted a better outcome, and radiological diagnosis of a normal scan predicted a poor outcome, which suggests that appropriate candidates for cesi are patients with radicular pain correlating to physical and/or radiological findings [20 ]. strub. looked prospectively at the short - term benefits of cesi in 161 patients, and found that 83 % of injections resulted in pain relief. patients with radicular symptoms into the fingers and with multilevel degenerative changes had a higher likelihood of success, while the odds of attaining pain relief were lower for patients requiring opiate analgesics, suggesting that epidural injections can be effective in the treatment of lumbar and cervical radicular pain. while cervical spinal nerve irritation is one of the etiologies of cgh, it is unclear whether cesi will be of benefit in the treatment of cgh. in this review, we evaluate the current evidence of cesi in the treatment of cgh. the literature referenced was obtained via a computer search of pubmed and medline from 1966 through march of 2014. the search terms included cervicogenic headache, cervical epidural steroid injections, post - traumatic headache, treatment, and therapeutics. two of these were review articles ; three were small prospective case - control studies, of which one was a short letter to the editor to report longitudinal follow - up on a retrospective study. upon further inspection, we found that two of the prospective studies were by the same author and were virtually identical ; therefore we were able to review only two studies on this topic. martelletti. conducted a prospective case - control study comparing numerical intensity scale (nis) and drug consumption index (dci) in nine patients with cgh (eight females, one male) and a control group of six sex- and age - matched patients (five females, one male) with chronic tension - type headache (cth) [22 ]. all cgh patients in the study had suffered from a continuous form of the disease for at least six months and were taking pain medications on a regular basis. the clinical diagnosis of cgh in these patients was confirmed with either greater occipital nerve or c2 nerve root blockade. patients suffering from pain syndromes other than cgh were excluded. in consideration of the potential risk of the diagnostic technique, no placebo (i.e., saline solution) was used in the study. in order to examine unmasked conditions of both cgh and cth, each patient underwent a 72-hour washout period from analgesics and anti - inflammatory medications when admitted as an inpatient. with the patients in sitting position and neck flexed, the c6 - 7 or c7-t1 interspinous space was palpated, and cutaneous infiltration anesthesia was administered with mepivacaine 1 % and sodium bicarbonate. in the midline approach, an 18 g tuohy needle with syringe containing saline solution was inserted in the interspace, with loss - of resistance technique utilized to locate the epidural space ; 40 mg of methylprednisolone mixed in 34 ml of saline was injected into the cervical epidural space. no radiographic guidance was mentioned in this paper. a sharp decrease in nis and dci the short - term (12 hours) and medium - term (four weeks) clinical improvement in the cgh patients was statistically significant. the study results suggested that cesi could be beneficial in the treatment of cgh, as the authors hypothesized that this pain syndrome continued its course by sensitizing the cervical nerve roots and initiating a pain - producing loop involving nerve root and microvascular inflammation as well as mechanically - induced micro - injury. the authors also presented follow - up data on the longer - term effects of cesi on cgh. at the six - month endpoint comparing nis and dci values, the responses by cgh and cth patients were not statistically different. the inclusion criteria in this observational study as follows : vas score > 60 mm during the pain period, radiographic evidence of c2-c6 disk degeneration and/or spondylosis, and positive response to blocking of c2 and c3 nerve roots prior to enrollment. the authors utilized either fluoroscopic or ct guidance for placement of the catheter in the cervical epidural space. as the authors approached the epidural space at the lower cervical / upper thoracic, they threaded a small catheter with steel wire 8 - 12 cm superior into the anterior epidural space. lidocaine, dexamethasone, and saline were mixed together and infused at a rate of 5 ml / hour for three to four weeks. no control group was utilized in this study. in the first three months post - infusion, there was a significant decrease in number of days with mild to moderate pain, occurrence of severe pain, and nsaid usage. these parameters continued at improved rates in the next three months, but no significant differences were observed at 12 months. the results indicate that continuous epidural administration of local anesthetic and corticosteroid may control chronic cgh for at least six months. none of the patients reported any symptoms associated with corticosteroid - related adverse events such as gastroduodenal ulceration, hypothalamic - pituitary axis suppression, or infections. accurate diagnosis of cgh is difficult due to the heterogeneity of its presentation and the multiple pain generators within the trigeminocervical nucleus - upper cervical nerve convergence. in addition, it is currently not possible to determine whether the pain generator is somatic referred or radicular - type pain, other than to attempt blockade of cervical nerve root, facet joint, atlantoaxial, myofascial trigger point, or occipital nerve steroid injection. cesi with an interlaminar needle approach at c7-t1 or c6 - 7 epidural space is relatively safe compared to other cervical procedures. in the study by martelletti., cesi was not proven to be of benefit in the long - term (six months) relief of cgh, but was helpful in the short term (up to four weeks). based on prior studies of cervical epidural injections one of the reasons that the martelletti study failed to show a significant prolonged effect of cesi may be that the inclusion criteria of the study failed to selectively recruit patients with radicular pain from degenerative disc or spondylotic disease. the addition of a local anesthetic medication to the epidural steroid injection may prolong the effects of cesi. finally, it is unclear whether fluoroscopic guidance, which has been shown to improve patient safety and injection accuracy, was utilized in the study [24, 25 ]. he.s study of continuous epidural blockade for treatment of cervicogenic headache, although limited by lack of a control group, did show a decrease in the mean number of days patients experienced mild or moderate pain, the occurrence of severe pain, and daily nsaid usage at both three and six months. it is important to note that the inclusion criteria in this study comprised radiographic evidence of c2-c6 disk herniation, bulge, or degeneration, with positive response to blocking of c2 and c3 nerves for at least a one - week duration. this study revealed supporting evidence of cesi as an effective treatment for cgh when upper cervical disc pathologies are present. cervical disc pathology is one of the etiologies for local nerve root irritation and injury. the injection of steroids in this location can inhibit aseptic inflammation and neurotransmission within the c - fibers. the continuous irritation of the most commonly involved nerve roots (c2, c3, c4) may produce inflammation and secondary swelling, which can perpetuate pain. interestingly, in he s study, the epidural space was accessed at around the c7-t1 level. a steerable epidural catheter was placed through the needle and advanced 10 cm in the cephalad direction, which potentially targeted the upper cervical nerves responsible for persistent cgh. this method of injection to target the potential pain generators, along with the continuous infusion of corticosteroid / lidocaine over three to four weeks, may have contributed to the success of the study. in both the he and martelletti studies, no serious side effects were reported from epidural steroid injections. in the martelletti study, one cgh patient and two cth patients experienced a flushing sensation in the face, which lasted between 45 minutes and four hours post - injection. no long - term sequela of this symptom was seen. in the he study, none of the patients reported any symptoms associated with corticosteroid - related adverse events, such as hypothalamic - pituitary axis suppression, immunosuppression, or gastroduodenal ulceration. based on the minimal adverse effects reported in these studies, it appears that cesi is a relatively safe injection therapy for cgh. cgh is a complex medical condition that can be debilitating for patients and challenging for the treating physicians. because of the heterogeneity of the presentation and the numerous pain generators that can cause cgh, it is often difficult to identify the source of this chronic pain condition. as a result, there are several different interventional techniques available for the diagnosis and treatment of cgh. cesi is considered by many interventional pain management specialists to be a reasonable option for patients who have failed conservative treatments. the two studies reviewed above provided preliminary evidence of both short- and long - term pain relief, particularly for patients with clinical and radiographic evidence of upper cervical spinal nerve root irritation. further studies designed to include such patients with treatment protocols to target upper cervical nerve roots may provide additional evidence that cesi is an effective treatment for cervicogenic headache. | cervicogenic headache (cgh) is defined as referred pain from various cervical structures innervated by the upper three cervical spinal nerves. such structures are potential pain generators, and include the atlanto - occipital joint, atlantoaxial joint, c2 - 3 zygapophysial joint, c2 - 3 intervertebral disc, cervical myofascial trigger points, as well as the cervical spinal nerves. various interventional techniques, including cervical epidural steroid injection (cesi), have been proposed to treat this disorder. and while steroids administered by cervical epidural injection have been used in clinical practice to provide anti - inflammatory and analgesic effects that may alleviate pain in patients with cgh, the use of cesi in the diagnosis and treatment of cgh remains controversial. this article describes the neuroanatomy, neurophysiology, and classification of cgh as well as a review of the available literature describing cesi as treatment for this debilitating condition. |
type of fracture, neurological deficit, general conditions, and associated injuries affect both treatment and final result. although type b and c fractures following ao - magerl classification require surgical treatment, most type a fractures without neurological involvement can be safely treated in a conservative way [2, 3 ]. conservative treatment is a demanding procedure for the patient, and the risk of a final deformity has to be considered as a residual kyphosis can consistently worsen the quality of life of the patient. moreover, some situations rule out the chance for a conservative treatment. in case of polytrauma, claustrophobia, psychological disease, venous disease or previous deep venous thrombosis, obesity, and bronchopulmonary diseases, attention must also be paid to the fact that younger and active workers refuse the conservative treatment in order to avoid bed rest and an inactive period. a traditional open surgery may be an overtreatment in all these cases, considering blood loss, possible complications, hospital stay, and delayed functional recovery. in this setting, a good option can be a percutaneous minimally invasive surgery (mis) [4, 5 ]. this technique is suggested by the authors every time a conservative treatment is not indicated or advisable, and posterior open arthrodesis may represent an overtreatment. from may 2005 to december 2011, 163 vertebral fractures of the thoracic and lumbar spine in 122 patients were stabilized. eighty - tree patients were males and 39 females, the mean age was 48 years (from 15 to 85). eighteen patients were polytrauma with an average injury severity score of 25.2 (from 17 to 34). in those patient, all fractures were classified according to the ao - magerlclassification : the vast majority were type a fractures (a1 and a3), while type b or type c were recorded in a few cases (table 1). the most frequent construct was the monosegmental one (one level above and one below the fractured vertebra) in 96 cases. overall, 553 pedicle screws were implanted with a percutaneous technique. in 18 cases, a bone substitute (cement and hydroxyapatite) was introduced in the fractured vertebra to fill the anterior gap left after reduction, to better support the anterior column. in one of patients with poor bone stock due to osteoporosis, we used a fenestrated cemented screw, associated with kyphoplasty, to stabilize a t12 type a3 fracture (figure 1). in one case, the fracture stabilization was associated with a minimally invasive endoscopic - assisted discectomy and interbody fusion for a preexisting symptomatic degenerative disc - disease at the same level. in another case where t11, t12, and l3 type a fractures were associated with l1 and l2 type b fractures, we performed a percutaneous stabilization from t10 to l4 and an l1-l2 arthrodesis with a miniopen approach (figure 2). in no other case fusion was associated to the mis. to monotrauma patients with type a1, a2, and a3.1 fractures without significant stenosis of the spinal canal, a conservative option consisting of cast and bed rest the impairment of the spinal canal was less than 30%, and local kyphosis was less than 20 except in one case. all patients underwent plain radiographs and ct scan preoperatively and immediately postoperatively and were followed over time with systematic clinical and radiographic controls at 1, 3, 6, 12, and 24 months after surgery. the average surgical time was 113 minutes (range 35 to 240 minutes), and it was directly related to the number of screws implanted : the average time, reduced to 106 minutes using 4 pedicle screws, becomes 144 minutes with 6 screws and 171 minutes with 8 screws. postoperative analgesia was performed in all cases with a 36-hour lasting elastomeric pump containing an opioid and an nsaid. all monotrauma patients recovered the standing position in the second postoperative day on the average and were discharged on the fifth day. in polytrauma patients has been granted an immediate mobilization in the bed. the mean followup was 38 months, with a minimum of 6 months and a maximum of 72 months. all the cases, except one, have been considered healed after a 6-month control. radiographic evaluation was performed through the measurement of the segmental kyphosis and the wedging deformity of the involved vertebral body. clinical evaluation was performed by subjective evaluation of the final results by patients themselves, and every patient was satisfied of surgical procedure. radiographic evaluation showed a real improvement in the postoperative period (segmental kyphosis : 4.1 preop, 2.2 postop, and 2.7 fu kyphosis of the fractured vertebral segment : 12.2 preop, 5.9 postop, and 8.7 fu), but also a worsening of the segmentary kyphosis in the cases treated with cd horizon longitude (6.4 preop, 3.5 postop, and 7.8 fu) if implanted with multiaxial screws. (5.7 preop, 4.8 postop, 9.9 fu) (table 2). in two patients, one screw was found medial into the spine canal on the postoperative tc, without any clinical consequence. at the beginning of our experience, we planned to remove all implants including l2 or a lower vertebra, no implant above t10 and all the implants in the thoracolumbar junction showing clinical (local pain) or mechanical problems (hardware failure or screws mobilization). we planned hardware removal in the lumbar spine as we were afraid that posterior fixation without fusion in such a mobile part of the spine could lead to hardware failure and consequently to clinical problems. overall, the instrumentation has been removed in 23 patients (19%), in 5 cases due to a local complication and in 17 cases, as scheduled, because of implantationin the lumbar spine (figure 3). the average delay from first surgery to implant removal was 9,5 months (range : 636). in the 17 patients in which implant removal had been planned, only 3 showed screws mobilization, and only 2 had pain. none of them showed pain or loss of sagittal alignment at six - month followup. the complications were divided according to a temporal order of appearance in intraoperative and postoperative. the latter were divided into early if they appear within one month from the date of surgery and late when they occurred after that period. major complications were those involving an increased hospitalization, or a second operation not scheduled. we recorded 12 complications (9.8%) divided into 4 intraoperative (3.3%), 6 early postoperative (4.9%), 2 late postoperative (1.6%). intraoperative complications were all minor, related to mechanical instruments, which lengthened the surgical time but without any consequence for the patients. early postoperative complications were all major : 4 mechanical, 1 neurological and 1 infectious complication. in 2 patients the screw head disconnected from the stem in the first postoperative day. in one case, the patient was reoperated, while the other had to wear a brace for 3 months postoperatively. in 2 patients we recorded a pullout of the pedicle screws, 15 days and 20 days after surgery respectively. the first case was a 63-year old patient with 2 noncontiguous type a1 fractures (t11 and l1) undergoing mis from t10 the second case was a patient of 67 years fixed from t12 to l2 for a type a3 l1 fracture. in both cases, we performed the implant removal and a percutaneous augmentation of the vertebral bodies with cement. the neurologic complication was a cauda equina syndrome which appeared in the second postoperative day in a patient treated for a type a l1 fracture by t12l2 mis. we performed a complete removal of the hematoma with a microsurgical technique without finding the source of bleeding. the patient was subsequently sent to a rehabilitation center, and he completely regained the neurological functions in 2 months. two and a half after surgery underwent surgical debridement and removal of the instrumentation resulting in healing of the infection. the patient wore a 3-point bodice for further 45 days, and the fracture healed with a residual kyphosis of 18 degrees. in one case there was a nonunion in a patient with an a3 type t12 fracture, with initial kyphosis of 25. three months after surgery the patient still complained pain during weight bearing, and there was no evidence of healing on the ct scan. the patient underwent anterior fusion by thoracoscopic approach with incomplete pain relief. in the other case, there was an aseptic loosening of the screws in l5 in a young patient of 28 years, treated 3 years earlier by l3l5 mis for a b2 type l4 fracture. the patient had been scheduled for instrumentation removal 6 months after surgery, but he refused the operation. the choice of treatment of the thoracic and lumbar spine injuries is related to many factors such as the type of fracture, the presence of neurological damage, associated injuries, patient 's age, and others more. conservative treatment of stable vertebral fractures is proposed with success by many authors [2, 3, 911 ], with different techniques : bed rest followed by external orthoses, extension gymnastics, plaster jacket in bed, or stand reduction. regardless of the methodology adopted, the treatment should be continued for a period of at least 3 - 4 months during which the patient care and cooperation is mandatory. the problems related to bed rest, particularly in the elderly, are countless, although difficult to calculate. obesity, chronic obstructive pulmonary disease, venous incompetence, and psychiatric disorders are almost absolute contraindications to conservative treatment. in addition, today more and more patients need to return to their social and working life in a short time ; therefore, surgery becomes the simplest way to shortcut recovery. in our experience, only 15% of the patients eligible for mis opted for a conservative treatment. the rationale for applying mis in the management of the spine fractures is to reduce the approach - related morbidity associated with the conventional technique : iatrogenic muscle denervation, increased intramuscular pressures, ischemia, pain, and functional impairment. because of the impossibility to perform a fusion, the minimally invasive percutaneous stabilization has been limited to relatively stable vertebral fractures, involving mainly bone component with a consistent possibility of spontaneous healing after immobilization ; the screws and rods implanted acted as an internal fixator, leading to the biological healing of all fractures. one treated by instrumented fusion, while the other just fixed without fusion, showed that there were no statistically significant differences in the long term between the two groups with a slight advantage, both for clinical than for radiographic parameters, for the group treated only with fixation without fusion. pmma injection through fenestrated cannulated screws provided additional stability in fixation procedures carried out on osteoporotic vertebral columns without affecting fracture healing. implant removal remains a controversial key point against this technique as it requires a second surgery and a general anesthesia, adding risks for the patient and costs for the hospital. nevertheless, the real need for implant removal is probably much lower than that showed in our study as most of the patients who had the implant removed showed no clinical or radiological complications at the time of second surgery. the loss of correction, we observed during the followup for the cases treated with multiaxial screws could be explained by the possibility of this type of screws to have slight movement, also after implantation, between the head and the arm of the screw. for this reason, monoaxial screws should be considered for this kind of surgery, when it is possible. there are yet no studies that analyze the complications of mis in thoracic and lumbar spine fractures. a retrospective study compares two groups of patients treated by mis (10 patients) and arthrodesis with conventional technique (11 patients), with a minimum followup of 5 years. there is evidence of reduced blood loss for the group treated with mis, but the study did not consider the complications occurred. the complications in our series are comparable to those reported in the literature for conservative treatment, and much less than with open fusion. mis in the treatment of thoracolumbar and lumbar spine fractures represents a good alternative option to conservative treatment. clinical and functional results are better or comparable, time of recovery is much quicker and the rate of complications is low. implants need to be removed in case of complications or symptoms referred by the patient. the surgeon should also be confident about the instrumentation to reduce the duration of surgery and radiation exposure. the major complications primarily occur in the immediate postoperative period and can be related both to the implant and to the surgical procedure. patients should be informed about the potential complications and the possible need for instrumentation removal. | we studied 122 patients with 163 fractures of the thoracic and lumbar spine undergoing the surgical treatment by percutaneous transpedicular fixation and stabilization with minimally invasive technique. patient followup ranged from 6 to 72 months (mean 38 months), and the patients were assessed by clinical and radiographic evaluation. the results show that percutaneous transpedicular fixation and stabilization with minimally invasive technique is an adequate and satisfactory procedure to be used in specific type of the thoracolumbar and lumbar spine fractures. |
ultrasonografia trjwymiarowa (3d) barku jest uznawana za metod o porwnywalnej dokadnoci w stosunku do ultrasonografii dwuwymiarowej (2d). celem niniejszego badania byo porwnanie oceny patologii cigna nadgrzebieniowego za pomoc badania 3d pomidzy operatorami o rnym poziomie dowiadczenia. pilotaowe nieinterwencyjne, prospektywne, obserwacyjne badanie 2309 obrazw uzyskanych z bada 127 dorosych pacjentw cierpicych z powodu jednostronnego blu barku. badacz a wykaza si bardzo wysokim poziomem zgodnoci swoich ocen w oglnej klasyfikacji zerwania cigna minia nadgrzebieniowego (2d vs 3d = 0,892, porwnywalno parami 93,81%, runda ocen obrazw 3d nr 1 vs zgodno pomidzy badaczami bya tylko umiarkowana w porwnaniu z badaczem b (obrazy 3d) (= 0,497, porwnywalno parami 70,95%) i przecitna w porwnaniu z badaczem c (= 0,238, porwnywalno parami 42,38%). z tego powodu naley opracowa nowe kryteria diagnostyczne dla analizy obrazw 3d i wprowadzi nauczanie interpretacji bada two - dimensional (2d) ultrasound (us) is an inexpensive, painless, non - invasive, and fast method of a dynamic examination of the shoulder in real - time. it is characterized by a similar accuracy to the mri examination to evaluate superficial tendons and soft tissues with a high degree of resolution, including the rotator cuff and muscles. furthermore, us is not limited by mri contraindications, such as the patient 's body habitus, claustrophobia, inability to lie flat, or implanted devices not compatible with the magnetized environment of mri. yet, the major disadvantage of 2d us, including the sonography of the shoulder, is a high rater dependence. three - dimensional (3d) us with the advantages of multiplanar imaging facility with three perpendicular planes observed in any position, plus direction, has been an established prenatal diagnostic technique since the early 90 's. the use of this technique in musculoskeletal diagnostics has been reported in the examination of the neonatal hip and in the diagnosis of meniscus lesions. however, the role of 3d us in the diagnosis of shoulder pathologies is not clear with only few studies, and on small populations, investigating the rater dependency in 3d us. the objective of this study was to determine the inter - rater reliability in the analysis of 3d us image sets of the supraspinatus tendon between sonographers with different levels of experience in musculoskeletal 2d us. we performed a non - interventional, prospective, observational pilot study involving 127 patients who were referred for the sonographic examination of a painful shoulder with clinical suspected or considered supraspinatus tendon pathology by the referring doctor. they were recruited in the period between january, 2014 and july, 2014 and were enrolled in a single outpatient clinic after signing an informed consent. the study was performed in accordance with good clinical practice and carried out in compliance with the helsinki declaration. dynamic 2d us examination of both shoulders was conducted in accordance with the guidelines set by the swiss society of us medicine (schweizerische gesellschaft fr ultraschall in der medizin, sgum), musculoskeletal section which are compatible with the musculoskeletal us technical guidelines from the european society of musculoskeletal radiology (essr) and the guidelines of the european league against rheumatism (eular). 2d us examination was performed by an advanced sonographer (eular teacher / efsumb level 3 = rater a). ge logic e9 with ml6 - 15 probe was used and the scanning time for dynamic examination was 10 minutes. diagnostic criteria for the supraspinatus tendon in 2d us a volumetric 3d image set (616d probe on ge logic e9 and 616d probe on ge voluson e6, scanning time 2 minutes) with the visualization of the long biceps tendon at the level of the rotator cuff interval and the footprint of the supraspinatus tendon was acquired during the same examination. afterwards, a set of transverse, longitudinal, axial and rendered volumetric 3d images of the supraspinatus tendon insertion was created automatically. based on the assumption that the accuracy of ultrasound is comparable to mri in the evaluation of the rotator cuff lesions, we decided not to perform additional mri examination. afterwards, the blinded 3d image sets were scored independently by two other raters (one advanced sonographer eular teacher / efsumb level 2 = rater b and one fellow sonographer eular intermediate level = rater c) and with an interval of 3 months again by rater a. the most advanced rater a with 13 years of experience in ultrasound imaging set as gold standard. the findings of rater a were then compared to those of rater b and c. the possible findings with corresponding diagnostic criteria were the same as for 2d us (cf. tab. examples of 3d us images (coronar and 3d rendered views) to assess the inter - rater reliability between different raters with regard to the findings in the 3d us image sets we used statistic. for rater a intra - rater reliability analyses were conducted between the findings in 2d us and 3d image sets. overall interpretations of the statistic were based on the criteria described by landis and koch. the level of reliability was defined as follows : values of 0.81 to 0.99 were considered to represent almost a perfect reliability ; 0.61 to 0.80 substantial reliability ; 0.41 to 0.60 moderate reliability ; 0.21 to 0.40 fair reliability ; and 0.01 to 0.20 slight reliability. we obtained 2309 images (210 3d image sets) of 127 adult patients suffering from unilateral shoulder pain. in our study, the 3d image set acquisition took about 2 minutes, compared to 10 minutes in the 2d us examination. baseline characteristics are shown in tab. 2 and the us findings for the 2d us examinations are shown in tab. baseline characteristics of the patients enrolled in the study (n = 127) 2d us findings (n = 210) there was almost a perfect intra - rater reliability of rater a in the overall classification of supraspinatus tendon tears (2d vs 3d = 0.892, pairwise reliability 93.81%, 3d scoring round 1 vs 3d scoring round 2 = 0.875, pairwise reliability 92.857%). there was almost a perfect overall reliability in the classification of full thickness tears between 2d and 3d (= 0.810), and a substantial reliability in the classification of partial thickness tears (= 0.667). the inter - rater reliability between rater a and b was only moderate (= 0.497, pairwise reliability 70.95%) and fair between rater a and c (= 0.238, pairwise reliability 42.38%) comparing findings in the 3d us imaging sets. 3d us of the shoulder is as accurate as 2d us when compared to mri for the diagnosis of full- and partial - thickness supraspinatus tendon tears, and the 3d us examination significantly reduced the time between the initial scan and interpretation by a radiologist, which ultimately improved the efficiency of the workplace. however, the time spent on the interpretation of data obtained from 3d us was not measured in our study, therefore one could assume that the overall time will remain the same, except that the 3d us data are interpreted from a third party. the inter - rater reliability of 2d us of the shoulder had been investigated in the past with experienced sonographer. the conclusion was that further consensus regarding the standardisation of scanning technique and diagnostic criteria is necessary to improve the reproducibility of musculoskeletal ultrasonography even for an experienced sonographer. given different levels of experience in 2d us, sonography has a high level of inter - rater reliability for full - thickness rotator cuff tears and a lower inter - rater reliability for partial - thickness and intratendinous rotator cuff tears. studies have even shown that with 3d us, rotator cuff tears were more often correctly diagnosed than with a conventional 2d sonography. however, 3d us of the shoulder seems to have a poorer inter- and intra - rater reliability compared to 2d sonography as investigated by hayter. using mri for the classification of rotator cuff tears, fellowship - trained, experienced orthopaedic surgeons had a good reliability for predicting full - thickness rotator cuff tears and the number of tendons involved, and a moderate reliability in predicting the involved side of the partial - thickness rotator cuff tear, but a poor reliability in predicting the grade of the partial - thickness tear. in our study the reliability for predicting full thickness tears was almost perfect (= 0.810) and substantial (= 0.667) for predicting the partial - thickness tear. according to hayter., the reason behind is the difficulty in the interpretation of small partial - thickness tears at the footprint on 3d images, a common area affected by anisotropy. therefore, a standardized 3d us image acquisition with minimal areas of anisotropy should be defined. standardized cross - sectional images (like those made automatically with the 3d probe) in multiple section planes would be necessary with repositioning of the transducer. on the other hand, the 2d us examination compared to 3d us still has the additional advantage to collect information (e.g. sonopalpation, dynamic examination) in the differentiation of articular sided partial thickness tears versus tendinosis or anisotropy. the 2d us examination is known to be an examiner - dependent method. however, the superior advantage of ultrasound compared to all other imaging modalities (including 3d us) is the possibility to create static images as well as dynamic images, which provides a unique functional information. one weakness of our study is that this dynamic examination option was only given to rater a, who defined the standard sets, but not to rater b and c, who had to deal with sets of static 3d images. in conclusion, the reliability of 3d us of the supraspinatus tendon depends on the level of experience of the sonographer, according to our data and experience. experience in 2d us dose not seem to be sufficient for the analysis of the 3d us imaging sets. therefore, we propose to develop 3d diagnostic criteria for the examination of supraspinatus tendon pathologies prior to further 3d ultrasound studies of this shoulder area. authors do not report any financial or personal links with other persons or organizations, which might negatively affect the content of this publication and/or claim authorship rights to this publication. | backgroundthree - dimensional (3d) ultrasound of the shoulder is characterized by a comparable accuracy to two - dimensional (2d) ultrasound. no studies investigating 2d versus 3d inter - rater reliability in the detection of supraspinatus tendon tears taking into account the level of experience of the raters have been carried out so far.objectivesthe aim of this study was to determine the inter - rater reliability in the analysis of 3d ultrasound image sets of the supraspinatus tendon between sonographer with different levels of experience.patients and methodsnon - interventional, prospective, observational pilot study of 2309 images of 127 adult patients suffering from unilateral shoulder pain. 3d ultrasound image sets were scored by three raters independently. the intra - and interrater reliabilities were calculated.resultsthere was an excellent intra - rater reliability of rater a in the overall classification of supraspinatus tendon tears (2d vs 3d = 0.892, pairwise reliability 93.81%, 3d scoring round 1 vs 3d scoring round 2 = 0.875, pairwise reliability 92.857%). the inter - rater reliability was only moderate compared to rater b on 3d (= 0.497, pairwise reliability 70.95%) and fair compared to rater c (= 0.238, pairwise reliability 42.38%).conclusionsthe reliability of 3d ultrasound of the supraspinatus tendon depends on the level of experience of the sonographer. experience in 2d ultrasound does not seem to be sufficient for the analysis of 3d ultrasound imaging sets. therefore, for a 3d ultrasound analysis new diagnostic criteria have to be established and taught even to experienced 2d sonographers to improve reproducibility. |
the first report of accessory foramina dates back to 1956 and an anthropologic study in which multiple mental, ethmoidal and infraorbital foramina were described in the human race. inferior alveolar nerve (ian) traverses the mandible within the inferior alveolar nerve canal (ianc) and has three distinct anatomical patterns as it ends : mental nerve (mn), anterior loop (al) and mandibular incisive nerve (min). the mn may branch to smaller trunks before exiting from the mental foramen (mf), and may give rise to an accessory mental nerve (amn). intraosseous anterior short extension of mn beyond the mf is called anterior loop (al). mandibular incisive canal (mic) is the intraosseous extension of the mandibular canal that almost terminates in the apical region of the mandibular incisors emerging from a lingual foramen (lf). the mf may vary widely in incidence, size, number (i.e. presence of an accessory canal), location (i.e. with regard to teeth apices), shape (i.e. round vs. ovoid) and direction of opening. a single mental foramen is mainly found between the first and second premolar roots or inferior to the apex of the second premolar. no clear role for mandibular side, age and gender is documented, aside from race. it may be absent on 0.2% of the occasions reported by de freitas, who studied 1435 dry skulls. double and triple mfs are found in 1.810.6% and 0.61.2% of population. of interest, 1.1% may have bilateral accessory mental foramen (amf). more than 80% of the lingual foramen or foramina could be found between the two lateral incisors. the majority of cases are single in number and are located above the genial tubercle (72%), followed by double (22%) and triple (4%) lingual foramina, which appear on the lingual surface of the mandible in the interforaminal area. different emergence paths for mf with regard to its exiting point from ianc are as follows : posterior, right angled, posterior superior, labial, mesial (anterior) and superior directions. the mn is an afferent sensory nerve that supplies the sensation of chin, lip corner and its adjacent mucosa with its four major branches : angular, medial inferior, lateral inferior and mental branches. at lf in addition, the incisive artery may have anastomosis with right and left lingual arteries. reports considering the contents of this foramen, however, are not consistent addressing within nervous and vascular plexus. the anterior mandibular anatomical and neurovascular apparatus may be documented by intraoperative surgical findings, conventional radiographies (e.g. periapical and panoramic views), magnetic resonance imaging (mri), computed tomography (ct) and cone beam ct (cbct). more recently, doppler ultrasound study is suggested to assess the vascular content of the main and also to evaluate unusual accessory foramina. the presence of a accessory canal is influential on differential diagnoses with other radiolucent pathologic lesions, effectiveness of local anesthesia, intraoperative iatrogenic damages and increased chance of metastasis. hence, being aware of these canals is of paramount importance in all diagnoses, treatment plan and prognosis aspects. a 62-year - old patient referred was found to have one main mf and two amf with buccal emergence on the left side [figure 1a and b ]. examination of the right side revealed two mental foramina with buccal opening and one with lingual emergence [figure 1c and d ]. this lingual mental foramen was in communication with the main ianc and mf and a crestal extension of ianc [figure 2 ]. as evident in the panorama view, a communicating neural bundle existed between mental foramina, incisive canals and crestal opening of their vertical extension [figure 3 ]. 3d view of the patients mandible (arrows indicate mental foramina), (b) main (distal) and accessory (mesial) mental foramina on the right side, (c) main (middle) and accessory foramina (most medial and most distal) of the left side and (d) lingual accessory mental foramen on the ride side (arrow). mf : mental foramen, amf : accessory mental foramen (a d) communication of lingual amf with ianc and buccal mf. mf : mental foramen, amf : accessory mental foramen, ianc : inferior alveolar nerve canal topographic data of the main and accessory foramina (mm) (a) panoramic view of patient 's mandible. (b d) communications of the upper and lower lingual foramina and a crestal opening. lf : lingual foramen, alf : accessory lingual foramen investigating a 60-year - old patient in symphysis mentalis from the lingual side revealed two lf with two additional openings [table 1 and figure 4 ]. one of them was located at the buccal side and another was on the inferior border of the symphysis. (a) frontal view of the buccal emergence of the incisive nerve at the midline mandible (arrows), (b d) communications of buccal and lingual (lingual foramen) exit paths of the incisive nerve and reconstruction of three continuous cross - sectional images. af : accessory foramen with buccal emergence paths past medical history of both patients who were male and iranian was significant for hypertension and osteoporosis. dental history was significant for advanced periodontitis and severe bone loss and both wore complete denture for several years. both image acquisitions were performed with a cbct device (cranex 3d, soredex, finland) in a high - resolution mode with further multiplanar reconstruction using the a 62-year - old patient referred was found to have one main mf and two amf with buccal emergence on the left side [figure 1a and b ]. examination of the right side revealed two mental foramina with buccal opening and one with lingual emergence [figure 1c and d ]. this lingual mental foramen was in communication with the main ianc and mf and a crestal extension of ianc [figure 2 ]. as evident in the panorama view, a communicating neural bundle existed between mental foramina, incisive canals and crestal opening of their vertical extension [figure 3 ]. 3d view of the patients mandible (arrows indicate mental foramina), (b) main (distal) and accessory (mesial) mental foramina on the right side, (c) main (middle) and accessory foramina (most medial and most distal) of the left side and (d) lingual accessory mental foramen on the ride side (arrow). mf : mental foramen, amf : accessory mental foramen (a d) communication of lingual amf with ianc and buccal mf. mf : mental foramen, amf : accessory mental foramen, ianc : inferior alveolar nerve canal topographic data of the main and accessory foramina (mm) (a) panoramic view of patient 's mandible. (b d) communications of the upper and lower lingual foramina and a crestal opening. investigating a 60-year - old patient in symphysis mentalis from the lingual side revealed two lf with two additional openings [table 1 and figure 4 ]. one of them was located at the buccal side and another was on the inferior border of the symphysis. (a) frontal view of the buccal emergence of the incisive nerve at the midline mandible (arrows), (b d) communications of buccal and lingual (lingual foramen) exit paths of the incisive nerve and reconstruction of three continuous cross - sectional images. af : accessory foramen with buccal emergence paths past medical history of both patients who were male and iranian was significant for hypertension and osteoporosis. dental history was significant for advanced periodontitis and severe bone loss and both wore complete denture for several years. both image acquisitions were performed with a cbct device (cranex 3d, soredex, finland) in a high - resolution mode with further multiplanar reconstruction using the a case with six mental foamina and a case with two additional exiting paths aside two lingual foramina at the midline are reported. their contents are diverse. considering the neurovascular contents and possible significant communications and anastomoses with other important adjacent neural and vascular plexus should not be neglected just for their size. among two cases, one had multiple bilateral mental foramina and a rare lingual mental foramen with unusual neural plexus. a lingually located mf is very uncommon and a few reports do exist in the literature. the other case was noticed to have multiple lf with bicortical opening from the symphysis. dissimilar to the existing documented anatomical descriptions of lf, this situation is also rare. the amn, which is commonly less than 1 mm in diameter, could not be feasibly found in the periapical and panoramic views with 14% and 23.5% distortion rates, respectively (4). a helical ct, nevertheless, may also miss these anatomic variations due to its inherent low resolution. cone beam ct, however, is reliable to detect such small foramina with a precision of less than 0.06 mm discrepancy. as a misbelief, it is generally accepted that accessory foramina are located posterior and inferior to the main canal and are smaller in size. singh postulated that amf could be found beneath the apex of the first molar ; nevertheless, there are documented reports that clearly show that the accessory foramina may be found anterior (mesial) or superior to the main foramen and are even larger in size. we named the main canals with regard to the diameter of the branching trunk from ian. a mic is usually single on each side and is seen in 11% of the panoramic images. a cadaver study and cbct investigations reported that is does exist in 26100% of the cases. of interest, just one - third of the edentulous cadavers revealed this anatomic structure it is difficult to localize the mic in conventional radiographies due to the corresponding adjacent bony structures. besides the importance of successful local anesthesia, maxillofacial surgeons should be aware of the risk of damage during vestibuloplasty of anterior mandible with extensive bone resroption and during osteotomy, orthognatic surgery and genioplasty. accessory mental foramina should be differentiated from the buccal foramina or vascular foramina (nutritional foramina). moreover, they are smaller in size and do not communicate with the mandibular inferior alveolar nerve. as defined by ichikawa in 1961, a nutritional foramen is formed in the prenatal era and is a passage for communications of the lower lip, submental and facial arteries deep into the cancellous bone. the iranian population is aging. approaching this unique class of patients needs special medical, dental and psychiatric knowledge. edentulism occupies a considerable share of disability - adjusted life year score for mouth conditions in the + 60 year old population reported by the world health organization (who) for iranian people. when the presence of such accessory foramina is doubted or assured in an aged patient, a sophisticated dentist or team should take the responsibility of dental care of the patient for many reasons. first, polypharmacy is not uncommon in an elderly patient, including consumption of anticoagulant agents. there could be progressive bleeding through the limited space of a non - expandable osseous chamber and subsequent compressive neuropathy of within neural bundles. second, a profound and successful local anesthesia may guarantee the cooperation of an aged patient with labile emotion, which is substantially affected by the presence of accessory foramina. third, accessory foramina of the lingual side of the mandible, if neglected, may lead to paresthesia, ischemic necrosis and ulceration of the lingual side, which depends on their neurovascular content. from the prosthodontic aspect and flange extension limits, one should note the senile changes cephalic migration of mf and presence of mf or amf even beneath the crestal gingiva. in conclusion, accessory foramina are not uncommon, and a pre - operation limited cbct is suggested to avoid inadvertent damage, especially when planning a surgery in the mandibular inter - mental region. | being knowledgeable of neurovascularization of anterior mandible is crucial for successful local anesthesia and for safe minor and major oral surgeries of this part. the first case was 62 years old and was found to have two accessory mental foramina with buccal emergence on the left side and two accessory mental foramina with buccal and lingual emergence paths on the right side (overall five mental foramina). incisive nerve plexus with multiple cephalic branching was obvious on both sides. the second case was 60 years of age and had two lingual foramina on the lingual side with two accessory foramina on the buccal side of the symphysis. considering our findings, a pre - operation limited cone beam computed tomography is suggested to avoid inadvertent damage, especially when planning a surgery in the mandibular inter - mental region. |
as health is not merely the absence of disease but a positive state of physical, mental and social well - being { world health organization (who), 1986 } a healthy working environment is one in which there is not only the absence of harmful conditions but also the presence of health - promoting actions. occupational stress leads to physical disorders because the internal body system changes to try to cope with the stress. some physical disorders are short - ranged such as an upset stomach while others are long - ranged such as a stomach ulcer. the body responds to physical, mental, or emotional pressure by releasing stress hormones such as epinephrine and norepinephrine that increase blood pressure (bp), heart rate, and blood sugar levels. therefore, persons experiencing chronic stress can have digestive problems, fertility problems, urinary problems, and a weakened immune system. also, people with chronic stress are more prone to viral infections such as the flu or common cold and to have headaches, sleep trouble, depression, and anxiety. three sets of factors can act as potential sources of occupational stress including environmental, organizational, and individual. a high level of occupational stress not only detrimentally influences the quality, productivity, and creativity of the employees but also the employee 's health, well - being, and morale. good mental health is needed to maintain a healthy lifestyle and depression plays a central role in influencing the quality of life (qol). lifestyle - related factors such as obesity, drinking habits, diet, and physical inactivity are well - established determinants of hypertension. in contrast, the role of chronic workplace stress on long - term bp regulation and the predisposition to hypertension remain unclear. although, various facets of psychosocial job stress have been studied, the findings have been inconsistent although wright and sweeney have identified an association between coping strategy and higher diastolic bp. previous studies have not considered whether the relationship between work stress and bp could be mediated by lifestyle factors such as alcohol consumption and regular physical activity. workplace health and wellness are about early identification of chronic disease and lifestyle - related preventable risks. thus, the present study was conducted to examine the contribution of key demographic, occupational stress and lifestyle factors affecting the qol among bank employees. the study was conducted at mysore district, karnataka, india among the employees of selected public sector banks. all employees with a minimum of 3 complete years of service were included for participation in the study except pregnant women. a two - stage cluster random sampling method was used for the study. in the first stage, all the branches of the banks were listed out and then the employees were selected from the branches randomly. the sample size was calculated considering the prevalence of stress (p) to be 35% and relative precision (e) of 10% with a 95% confidence interval using the formula z p(1-p)/e. considering a design effect of 1.5, the final sample size calculated was 546. the job stress was assessed using the occupational stress index (osi) scale and the score base classification of stress was performed. a standardized questionnaire for measuring health - related qol questionnaire, short form 12 (sf-12) data analysis was performed with the help of the statistical software, statistical package for the social sciences (spss) version 15.0 (chicago, il, usa). multiple linear regression was performed to know the association between stress and qol after adjusting for potential confounders. of the 546 study participants, the demographic characteristics showed that about 57% were males [table 1 ]. majority of the study subjects belonged to the age group of more than 50 years (48.4%) followed by the age group of 4049 years (18.1%) [table 1 ]. most of the study subjects were graduates (67%) followed by those with postgraduate degree (28.8%). almost half of the study subjects ' current designation of work was clerk (51.6%) followed by the designation officer, which was 25.6% [table 1 ]. the proportion of officers experiencing severe stress(12.1%) was higher as compared to managers (5.6%) and clerks (6.7%) [table 2 ]. moderate stress was experienced more by clerks (68.4 %) as compared to officers or managers [table 2 ]. the proportion of respondents experiencing mild stress was higher among managers (34.70%) as compared to officers and clerks [table 2 ]. distribution of study subjects according to sociodemographic characteristics distribution of level of stress among the employees according to current workplace designation the mean physical component summary (pcs) and mental component summary (mcs) scores using the original united states standardization was 47.90 and 48.30, respectively. overall, the men scored significantly higher than women in pcs (p = 0.01). there was a significant relationship between pcs and mcs scores with sleep reduced due to work pressure (p < 0.001). the people who reported having ever consumed alcohol scored lower score on pcs scale as compared to those people who never consumed alcohol but the difference was not statistically significant (p = 0.530) [table 3 ]. the pcs showed significant association with at least one related morbidity (p < 0.001) [table 4 ]. a score difference of 5.6 in mcs was found between respondents with at least one morbid condition and those without any morbidity. the multiple linear regression analysis showed that with a unit increase in the age in years, the physical component summary score of qol decreased by an average of 0.07 [table 4 ]. there is a significant difference in the mcs (p < 0.001) among individuals with mild stress versus moderate stress. there was a difference of 7 points in the mcs score between those subjects who were mildly stressed and those who were severely stressed. variables such as age, presence of morbidity, and level of stress showed a significant association with mcs [table 5 ]. the independent variables in the multiple linear regression model showed no correlation with each other. distribution of study variables according to pcs and mcs multiple linear regression model to predict health - related quality of life from pcs multiple linear regression model to predict health - related quality of life from mcs this study found that the mean pcs score and mcs score using the original united states standardization were 47.90 and 48.30, respectively. the individuals with mild stress scored higher in both pcs score and mcs score than the individuals who showed moderate and severe stress levels. there was a significant association between age, presence of at least one morbidity, and level of stress with health - related qol. in the current study, about 19.6% of the employees suffered from back pain. the findings were consistent with a study conducted in brazil by marilda., which reported about 48% of the respondents with muscle tension. the study conducted by debra. showed that two - thirds of the participants reported one or more chronic conditions that were almost similar to the findings of the present study where the majority of the individuals showed at least one or more morbidity. about 12.10% of officers reported severe stress as compared to the managers (5.60%) and clerical grade employees (6.70%). as specified by raj and debashish, bank officers form a delicate link between the management and the clerical staff, which may be instrumental in the difference in the levels of stress demonstrated between the clerical and managerial staff. the study conducted by bhatia. showed a similar finding that people working below the supervisors such as officers or clerks experienced more stress. there was significant relation of pcs and mcs with chronic morbid conditions like heart disease diabetes and hypertension. a study by tuchsen points to the psychologically demanding work with unsatisfactory decision authority as a possible cause of this increased risk of developing morbidities. the people who had ever consumed alcohol scored lower on both pcs and mcs than those who never consumed alcohol. similar finding was reported by xu j. in their study among civil servants in china the presence of chronic morbid condition and physical activity has a significant association with pcs. a study by luiz. among financial service employees in brazil reported that job strain had its largest impact on mental health. in conclusion, the present study has shown that there is a high level of stress among the officers. there is an association between the level of stress and the health - related qol among the public bank employees. the individuals with mild stress scored higher in both physical and mental qols than the individuals in the moderate and severe stress levels. this study calls for initiatives to improve the qol of employees in the banking sector. further, the study was conducted among the public sector bank employees and the private banks may have different work environments ; hence, the study findings should be generalized to among private sector bank employees. | background : occupational morbidities have been estimated to cause an economic loss up to 1020% of the gross national product of a country. it is an important cause of occupational morbidity and decreased quality of life (qol) for the workers.aim:the aim of the present study is to assess the level of occupational stress and its association with the qol among the public sector bank employees.materials and methods : the present study was conducted among employees of public sector banks in mysore district, karnataka, india. a cross - sectional study design was used for the study. job stress was measured by using occupational stress index (osi) scale questionnaire and health - related qol was measured using the short form 12 (sf-12) questionnaire. the sample size estimated for the study was 526 and cluster random sampling technique was used. chi - square test was used to find the association between the study variables and level of stress. multiple linear regression model was used to find the determinants of health - related qol among the study subjects.results:the total number of the study subjects was 546 out of which 57% were males and 43% were females. the proportion of study subjects reporting to be current smokers was 4.2% and almost all study subjects reported occasional alcohol consumption. the mean physical component summary (pcs) score and mental component summary (mcs) using the original united states standardization were 47.90 and 48.30, respectively. the individuals with mild stress scored higher in both pcs and mcs than the individuals who had moderate to severe stress levels. there was significant association of health related quality of life with the age of the respondent, presence of at least one morbidity and level of stress with health - related qol.conclusion:this study has shown an association of occupational stress with the qol. there is a need for interventions aimed at mitigating the occupational stress among employees of the banking sector. |
loss of natural dentition has many subsequent complications that can be perceived in function (mastication and swallowing), speech (phonation), esthetics, and a negative psychological as well as social effect. it can ultimately lead to loss of vertical dimension, shortening of the lower face height that can change one 's appearance, cause an inverted smile (corners of the mouth sag), a toothless smile, frequent cracking or chapping at the corners of the mouth (angular cheilitis) and problems in chewing due to a decrease in bite force. reestablishing a correct vertical dimension of occlusion for those who have a collapsed vertical dimension is of optimum importance that can help in managing these deficits and, therefore, improving the quality of life. although there are many advances in materials and techniques applied in prosthodontics, in particularly, for the determination of the occlusal vertical dimension (ovd), still there is no scientific, accurate, and accepted method of assessing this component in edentulous patients and the clinical judgment still plays an important role. in the literature, measuring the distance between soft tissue landmarks on the face is one of many techniques used for predicting the vertical dimension of occlusion in complete denture construction. this method is based on the harmony of the face and facial proportions that have been advocated to be relatively constant and unchanged with age progress. two different ways of facial measurements can be applied to determine the ovd in edentulous patients : (1) measuring the resting vertical dimension between two points one on the upper jaw and the other on the lower jaw then subtract 24 mm which conform the freeway space. (2) to correlate a proportionate distance between two anatomical landmarks on the face. the willis gauge is commonly used to measure the ovd measuring the distance between the septum of the nose (subnasal [sn ]) and the inferior border of the mandible (menton [me ]). another is pleasure 's method that measures the distance between the tip of the nose (nasal [n ]) and the tip of the chin (gnathion [gn ]). the purpose of this study was to evaluate the relation between the distance from outer canthus of the eye to the corner of the mouth (rima oris [ro ]) and ovd measured by two methods in a sample of yemeni dental students. the sample frame included dental students who attended the faculty of dentistry, thamar university, dhamar, yemen. one hundred and fourteen subjects (76 male and 38 female) were randomly recruited for this study, the mean age was (22.34 1.83) and ranged from 19 to 28 years. ethical approval was obtained from the ethical committee of the college of dentistry and a signed informed consent form was also obtained from each subject prior to conducting this study. each participant, to be included, had to fulfill the inclusion criteria that are : a full dentition set (except third molars), class i jaw relation, and a harmonious as well as symmetrical face. the exclusion criteria were missing teeth, malocclusion, class ii or iii jaw relation, previous or current orthodontic treatment, previous major stomatognathic or plastic surgery, and disfigurement of the face. each subject was asked to sit in an erect forward position with an unsupported head. for centric occlusion, two different measurements of the ovd were performed using different landmarks on the face (n, gn, sn, and me). two dots using indelible pen were placed ; one on the tip of the nose (n) and the other on the tip of the chin (gn), the distance between the dots was recorded [figure 1 ]. for the second measurement, the distance between (sn) and (me) the parallelism between the septum of the nose and the under of the chin was achieved using a tongue blade and the subjects were asked to hold it lightly on the inferior border of the chin [figure 3 ]. the study variable (eye - ro) was obtained by recording the distance from the outer canthus of the eye to the corner of the mouth [figure 4 ]. a digital caliper was used to measure all variables (accurately measure within 0.02 mm/0.001 inch). excel 2013 was used for data entering. statistical package for the social sciences spss version 22.0 (ibm corp., released 2013. armonk, ny, usa : ibm corp.) was used for statistical analysis. pearson 's correlation coefficient test was utilized to study the correlation between the measured parameters at significant level p < 0.05 and 95% confidence level. independent t - test was used to find out the differences of means between males and females for the parameters of the study, as well as paired t - test, was performed to calculate the differences between the means for the study parameters. measurement of the distance from tip of the nose to tip of the chin parallelism for measurement measurement of the distance from septum of the nose to under of the chin measurement of the distance from outer canthus of the eye to rima oris sixteen subjects were randomly selected for test - retest method of reliability. the measurements were made twice on the same participants by one author with an interval of 2 weeks in between. tables 1 and 2 show the results of the agreement for all variables and between the two readings. findings suggest that all measurements can be repeated with high significance of reliability and reproducibility icc = 0.81 with p = 0.0001. intraclass correlation coefficient - reliability for all subjects intraclass correlation coefficient - reliability for the different measurements the measurements were made twice on the same participants by one author with an interval of 2 weeks in between. tables 1 and 2 show the results of the agreement for all variables and between the two readings. findings suggest that all measurements can be repeated with high significance of reliability and reproducibility icc = 0.81 with p = 0.0001. intraclass correlation coefficient - reliability for all subjects intraclass correlation coefficient - reliability for the different measurements this study consisted of 114 dental students. according to gender, the sample size comprised of 76 males (67%) and 38 females (33%) with an age range of 1928 years (22.34 1.82). the mean of the distance (eye - ro) was (70.79 4.01) mm with minimum 61.34 mm and maximum 80.47 mm, while (sn - me) was (67.24 4.59) mm ranging from 53.9776.81 mm and (n - gn) was (69.60 5.32) mm ranging from 57.4981.77 mm [table 3 ]. as shown in [figure 5 ], the measurements recorded from the distance (eye - ro) are closer to those recorded from (n - gn) than those taken from (sn - me). to find the correlation between the distances (eye - ro and n - gn) and (eye - ro and sn - me) correlation coefficient of pearson was initialized [table 4 ]. there was a significant correlation (r = 0.313) with p = 0.0007 for the pair (eye - ro and n - gn), while it was (r = 0.296) for the pair (eye - ro and sn - me) with p = 0.0014. the differences between the means were calculated for the two pairs as shown in [table 5 ]. the difference between the means for the pair (eye - ro and n - gn) was lesser than the difference between the means for the pair (eye - ro and sn - me). it was (1.19 5.57) with p = 0.025 and (3.55 5.12) with p = 0.0001 respectively. table 6 shows the differences between males and females for the study parameters, significant differences were found between males and females regarding the recordings measured from the outer canthus of the eye to parting of the lips (2.45 mm, p = 0.002). it was also significant for the readings from the tip of the nose to the tip of the chin (6.23 mm, p = 0.001). while there were no significant differences between the two genders regarding the distance from the septum of the nose to the under of the chin (0.30 mm, p = 0.750). descriptive statistics of the facial measurements for total subjects dotplots graph showing all readings correlation between (eye - rima oris) and other methods in all subjects differences between the means group statistics of all measurements comparing the gender reestablishing the vertical dimension of occlusion not only creates a space between the upper and lower ridges to be occupied by the artificial teeth but also improves the function of the denture prosthesis as well as the esthetic appearance of the patient. restoring this important component should be in harmony with the facial dimensions with no facial strain or patient discomfort. the absence of any preextraction records for the ovd makes the measurement of the vertical height of the lower third of the face arbitrary. since there is no superior method to establish the original ovd for all individuals, suggestions have been made to use the facial proportions as alternative methods to predict the missing ovd. this study was set out with the aim of assessing the relation between some distances measured from certain soft tissue landmarks on the face. in this study, the ovd measured from the tip of the nose to the tip of the chin was longer than ovd measured from the septum of the nose to the under of the chin while the distance from the outer canthus of the eye to the corner of the mouth was longer than both of them. however, the difference between the means for (eye - ro) and (sn - me) was higher than the one between (eye - ro) and (n - gn). these results agree with the findings of other studies, in which they found that the distance from the septum of the nose to the under of the chin was smaller than the other distances. statistically significant correlations were observed between the study variable (eye - ro) and the two readings of the ovd (n - gn) and (sn - me). this correlation was higher, with higher significant level, between the pair (eye - ro) and (n - gn) than that between (eye - ro) and (sn - me). although these findings seem to be consistent with those found by nagpal., delic., and basnet., they differ from a study conducted by tina - olaivar. in which he found that the difference between (eye - ro) and (n - gn) was 3 cm, this variation might be because their study was carried out on mongoloid individuals while this study was conducted on caucasian subjects. differences in the distance (between the outer canthus of the eye and parting of the lips) as well as (from tip of the nose to tip of the chin) between males and females were significant., delic., basent., and al - hamdany. it is somewhat surprising that no significant differences were found in the current study between males and females regarding the distance from the septum of the nose to the under of the chin. a possible explanation for this result might be the lack of adequate sample of female subjects (n = 38) compared with the larger sample of males (n = 76). another possible explanation for this is the variances in soft tissues topography that may reflect such a result. however, several limitations of this study should be noted ; the subjects were limited to a single race (yemenis), collected from convenient sample frame (dental students), and they may have been too young (22.34 years) to be used as considerable data for patients with lost ovd. thus, further studies using larger sample size from broader age and racial groups are recommended. within the limitations of the present study, the following conclusion can be drawn : eye - ro distance is a reliable method for predicting the ovd for the study groupif this distance is to be used as a method to predict ovd, it should be compared with the distance from the tip of the nose to the tip of the chin rather than the distance for septum of the nose to the under of the chin. eye - ro distance is a reliable method for predicting the ovd for the study group if this distance is to be used as a method to predict ovd, it should be compared with the distance from the tip of the nose to the tip of the chin rather than the distance for septum of the nose to the under of the chin. | objective : this study was conducted to evaluate the relationship between the distance measured from the distal outer of the eye to the parting line of the lips and the occlusal vertical dimension (ovd) measured by two methods.methods:one hundred and fourteen dental students (76 males and 38 females) were recruited for this study with mean age (22.34 1.83) years. the distance from distal canthus of the eye to rima oris (eye - ro) was compared with two different measurements of the ovd (nasal [n ] to gnathion [gn ], and subnasal [sn ] to menton [me ]). all distances were measured using modified digital caliper.results:pearson correlation coefficient test for correlations and paired samples t - test for differences were used with a significant level of (p < 0.05). there was a positive significant correlation between the eye - ro distance and the two measurements of the ovd. however, this correlation was stronger between eye - ro and the distance from the tip of the nose to the tip of the chin than that between eye - ro and the distance from the septum of the nose to the under of the chin (r = 0.313 with p = 0.0007, r = 0.296 with p = 0.0014), respectively.conclusion:the distance from the outer canthus of the eye to the parting of the lips seems to be a reliable method in predicting the ovd and should relate to the distance from the tip of the nose to the tip of the chin. |
pocket infection of pacemakers and implantable cardioverter defibrillators (icd) is usually treated by removing the device and re - implanting it in a new site following treatment. we present a complicated case of pocket infection, treated without the removal of the device. a 78-year - old man, a known case of hypertension, hyperlipidemia, and coronary artery bypass grafting (cabg) 8 years previously, presented with complete heart block plus unstable atrial and slow ventricular escape rhythm (left bundle branch block pattern) and received a permanent pacemaker (vvir mode). he was subsequently admitted several times due to decompensated heart failure (left ventricular ejection fraction = 20% and moderate mitral regurgitation), which led to his finally receiving a three - chamber cardiac resynchronization therapy (crt) device. afterwards, the patient developed a large hematoma around the pocket ; the sutures were, therefore, removed for drainage. the removal of the sutures was followed by the development of extended skin necrosis with massive purulent secretions and cellulitis around the incision site (figure 1). the patient was afebrile and symptomless, white blood cell count was 10050/mm, blood culture was negative, lab tests were normal, and there was no evidence for endocarditis. surgical tissue debridement was performed and staphylococcus epidermis grew in its culture, suggesting contamination. pocket infection being regarded as the primary diagnosis, the patient was treated with intravenous antibiotics (vancomycin, gentamicin, and ciprofloxacin), which cleared the inflammation and resolved the cellulitis. the existence of a massive soft tissue defect prompted the consultant surgeon to suggest relocating the generator and applying a tissue graft. be that as it may, the patient was device - dependent and the generator could not be transferred to another place as it was impossible to re - implant the left ventricle lead. additionally, further morbidity was reduced by eradicating the infection and curing the wound conservatively through keeping the generator outside the body (figure 2). the wound was thereafter irrigated with zinc sulfate lotion (1%) daily and dressed with silver sulfadiazine ointment and alginate comfeel dressing. the generator remained out of the pocket for 5 weeks in a sterilized condition ; and during the last 2 weeks, the edges of the wound were approximated gradually by sutures. after the wound had completely healed, the generator was successfully re - implanted in its prior location after sterilization with decocept. the surgical wound healed rapidly, the patient had no problem during a 10-month follow - up, and the crt worked properly (figure 3). infection of a medically inserted device is usually treated with appropriate antibiotics ; and if there is not a rapid response, the removal of the foreign body is advocated. otherwise, pocket infection carries a high risk of mortality and morbidity.1, 2 however, some reports have suggested that conservative treatment can be successful too. in such instances, leads are preserved and the icd is replaced following debridement, irrigation, and antibiotic therapy.3 in the case of our patient, the removal of the entire pacing system could probably predispose the patient to unexpected events. he suffered from heart failure (new york heart association functional class iii) and the coronary sinus lead was surgically implanted with difficulty in the first attempt ; the patient was, as a result, considered a high - risk case for another re - implantation. on the other hand, skin graft could pose a risk of anesthesia and surgery, a risk which seemed to be too difficult for the patient to tolerate. consequently, normal wound healing rather than skin graft application was opted for with a view to providing the patient with the opportunity to benefit from the crt function. we would posit that those who are susceptible to cardiac complications, especially the elderly population, can be treated with a conservative method that includes broad - spectrum antibiotics, debridement, and modern dressing. we would suggest that a conservative treatment of pacemaker pocket infection in those who have no signs of other infections such as endocarditis or septicemia could be a proper treatment, although it is needs more time and medical care. opting for such treatment must be at the doctor s discretion based on the patient s condition. | pocket infection of a cardiac device is usually treated by removing the device and re - implanting it in a new site after complete treatment of the infection. this report illustrates a complicated case of pocket infection in the wake of the implantation of a permanent pacemaker (cardiac resynchronization therapy). the patient was treated conservatively through daily irrigation and dressing, broad - spectrum antibiotics, and debridement without the device being removed ; the generator was kept out of the pocket for 5 weeks and then re - implanted in the same location successfully.the method of treatment presented herein can be of value, not least in the elderly population who might experience life - threatening events following the replacement of their cardiac devices. |
ear infections in children are a major health problem and may be associated with hearing impairment ; delayed speech and language development ; and academic and educational development. the most commonly identified ear infection is known as acute otitis media which is caused by swelling and infection in the middle ear. chronic ear infections can affect a child 's ability to learn and consequently may have a lifelong impact on his / her quality of life and overall development [5, 6 ]. it is estimated that almost all children will have had an ear infection by the age of five years. according to the canadian national longitudinal survey of children and youth (nlscy) in 2008/2009, 50% of the canadian children aged 2 to 3 years have had at least one ear infection since birth and 13% of children had frequent (four or more) ear infections. it was also reported that the rates of ear infection declined over the years 1994/1995 to 2008/2009 due to the reduction in exposure to environmental tobacco smoke. it has been reported that approximately 69% of us children < 12 years of age reported having at least one ear infection in their lifetime. in general, ear infections are mild and resolve by themselves over a short period of time ; however, if left untreated, this infection could lead to hearing loss, some point in the future. current recommendations for acute otitis media are to observe and treat with antibiotics only if the condition does not resolve in a few days, thus clinical assessment is important in managing the condition. research has shown that aboriginal ethnicity [1114 ] is an important risk factor for ear infections. these authors identified that there was a higher risk of having ear infections among aboriginal children compared to non - aboriginal children. other risk factors for ear infections include younger maternal age ; male sex [11, 12 ] ; younger age [11, 12 ] ; low birth weight ; low socioeconomic status [11, 12 ] ; daycare attendance [11, 12, 15 ] ; inadequate housing conditions ; lack of access to health care ; exposure to cigarette smoking [11, 12 ] ; and mothers who smoke during pregnancy. it was also noted that breastfed children were less likely to experience ear infection [6, 1113, 1618 ]. to our knowledge, there is no canadian data available to compare prevalence rates associated with risk factors of ear infection in aboriginal children or rural and urban canadian school - aged children. however, we are currently conducting two cohort studies, one with rural children and the second with first nations children living in two reserve communities in saskatchewan. the objective of this paper was to determine the prevalence and associated risk factors for ear infection in children 617 years old living in rural areas of the province or residing on - reserve. the term aboriginal peoples refers to descendants of the original inhabitants of north america. the canadian constitution recognizes three groups of aboriginal people : indians (commonly referred to as first nations who are registered indians under the indian act of canada), mtis, and inuit. these are three separate peoples with unique heritages, languages, cultural practices, and spiritual beliefs [19, 20 ]. the rural population was defined as consisting of those persons living in towns and municipalities outside the commuting zone of larger urban centres with population of 10,000 or more. data obtained from the child components of baseline surveys from the saskatchewan rural health study (srhs) [22, 23 ] and the first nations lung health project (fnlhp) were pooled for this report. the brief description of the study design related to the child component for each study is given below. the overall description of the srhs and details of the study designs for the adult and child components were described elsewhere [22, 23 ]. briefly, schools that were located within the rural municipalities and small towns that participated in the adult phase were considered to be the target schools for the child component. in order to facilitate parents ' and school authorities ' understanding of potential concerns related to children 's survey and assessments, permission was sought to conduct cross - sectional surveys of children 's health by parental report and following parental consent and child assent and clinical assessments (spirometry, allergy, and anthropomorphic testing) through the schools. this approach has been the methodological approach in other surveys of children 's health by the investigators and has been shown to provide good response rates [25, 26 ]. the study participants received a study package from the home room teacher to be taken home to their parents for completion. the package contained (i) the information letter ; (ii) the baseline questionnaire to be completed by a parent or guardian ; (iii) a consent form (parent or guardian) ; (iv) an assent form and information letter (child) ; and (v) a return envelope. parents were asked to send the completed questionnaire, signed parental consent, and assent forms sealed in the return envelope to the home room teacher within two weeks. the completed or not returned sealed study packages were retrieved from the schools by the research team at the end of four weeks. a total of 5667 study packages were distributed to students in grades 1 to 12 in the study area schools and 2757 (49%) were returned, with 42% of the forms being completed (n = 2383). of the 2,383 children, 301 were excluded from the final analysis due to missing data on key variables and identifying ethnicity other than caucasians resulting in a final sample size of 2082 children. of those 301, 147 were first nations / mtis ancestry. due to the unknown number of first nations children in this group overall description of the fnlhp and details of the study design for the adult component were described elsewhere. two reserve communities participated in the study. during the study period, children in kindergarten (6 years old) to grade 12 in community a and community b attended schools that were on - reserve (three schools) or a neighbouring school where many of the children from the reserve attended (one school) were eligible for participation. the potential study population was 603 first nations children. in order to facilitate parents / caregivers and community understanding of potential concerns related to the children 's survey and assessments, the research team met with the superintendent of the school divisions, the directors of education, persons holding the education portfolios at each of the reserves, and the school principals. in these four schools, permission to conduct the study was granted by different level of authorities. a parents / caregivers ' information session (supper night) an elder from each community was invited to attend the supper night who provided traditional knowledge and advice related to facilitating this project. during the gathering of information about the survey, consent and assent processes were discussed. information about the survey, parent / caregiver and child involvement was provided through the school newsletters. prospective participants received a personally addressed study package from the classroom teacher to be taken home to their parents / caregivers. the package contained (i) cover letter and questionnaire to be completed by a parent or caregiver ; (ii) parent - child information letter and consent / assent forms ; and (iii) a return envelope. parents or caregivers were asked to return the completed or uncompleted questionnaire, signed parental consent, and assent forms in a sealed envelope to the classroom teacher at the school within two weeks. for each survey returned, parents or caregivers received a $ 5 gift card. the completed, sealed study packages were retrieved from the schools by the research nurses after the two - week return date. a total of 603 study packages were distributed to students in kindergarten (6 years old) to grade 12 in the study area and 363 (60.2%) study packages were returned, with 58.2% of completed surveys (n = 351). approval for the study protocols was obtained from the biomedical research ethics board at the university of saskatchewan (# bio : 10 - 177 for the srhs and # bio : 13 - 27 for the fnlhp) and permission to conduct the surveys was obtained from the directors of each school division in june, 2010, and from the school principals in december, 2010, for the srhs, and in january, 2012, for the fnlhp. in both studies, child study questionnaire included items describing sociodemographics, health status of the child, childhood diseases and infections, other illnesses, the lifestyle and home environment, health risk behaviours, access to health care factors, and family history of respiratory health. the outcome variable of interest was the presence / absence of an ear infection, based on the following question : has a doctor ever said this child had an ear infection (yes / no) ? ; it is likely that reported ear infections include acute, chronic, and uncommon types. however, the nature or severity of ear infections was not reported. individual factors. information was collected on the following demographics : child 's sex ; child 's age ; first born child ; and obesity. obesity was derived according to age / sex specific classification cut - offs established by the international obesity task force [27, 28 ], using parental report of weight and height. information on the following individual variables expected to be associated with the ear infection was collected : asthma ; tonsillitis ; mother smoking during pregnancy ; and whether or not this child was breastfed and the duration of breastfeeding. information was collected on the following contextual factors : difficulty accessing to health care in the past 12 months ; presence / absence of smoke inside the house ; crowding based on number of people living in the home ; damage caused by dampness ; mold / mildew signs ; dampness ; socioeconomic status based on the mother 's education. logistic regression models were used to predict the relationship between ear infection, outcome of interest (yes or no), and a set of explanatory variables. based on bivariable analysis, the strength of associations was presented by adjusted odds ratios (oradj) and their 95% confidence intervals (ci). all variables which were statistically significant (p < 0.05) as well as important covariates were retained in the final multivariable model. a parsimonious model was selected based on hosmer - lemeshow goodness - of - fit statistic. there were 351 first nations children who participated in the fnlhp aged 617 years. for this paper, a new variable, ethnicity, first nations or caucasian, hence, the study population contains data from 2433 children that was used for analysis. table 1 depicts the comparison of characteristics by ethnicity. approximately, 57.8% of caucasian children reported having ever been diagnosed with an ear infection compared to 43.6% first nations children. breastfeeding longer than three months (57.5% versus 40.1%, resp.), higher rates of maternal smoking during pregnancy (51.6% versus 19.9%, resp.), higher rates of exposure to passive smoke (43.9% versus 12.5%, resp.), and higher rates of obese children (12.8% versus 5.9%, resp.) the univariate relationships between the environmental factors and personal factors or covariates and ear infection using unadjusted logistic regression are shown in table 2. the first nations children showed a lower prevalence of ear infection compared to caucasian children. younger children (611 yrs) were at higher risk of ever having been diagnosed with an ear infection compared to older children (1217 yrs). first born children were more likely to have an ear infection compared to their younger siblings. asthma, allergy, and tonsillitis were significant comorbid conditions for ear infection (table 2). the significant predictors of increased risk of ear infection were age, children in the age group of 611 years, tonsillitis, asthma and any respiratory related allergy, and being first born in the family, while there was decreased risk of ear infection associated with children who were breastfed longer than three months and ethnicity (first nations versus caucasians) (table 3). we did not find associations between passive smoking exposure, low birth weight, and other environmental exposures with the report of ear infections. otitis media (om) or middle ear infection is a common disease among children under the age of 6 years. according to kong and coates, ear infections were common in two age groups : between 6 and 24 months of age and 4 - 5 years of age. this was due to weaning ; exposure to environmental conditions ; and attending daycare or kindergarten. most research conducted in this topic studied children aged under 5 years [1315 ]. in this study, we were able to access the school - aged children aged 617 years from rural and first nations communities. we assumed that the question has a doctor ever said this child had an ear infection ? the results showed that the younger age group (611 years) had a higher risk of ear infections compared to the older age group. this could be due to the higher chance of younger children parents recalling the disease occurrence compared to older children. our results showed a greater prevalence of ear infection among caucasian children compared with first nations children (43.6% for first nations indigenous children were at higher risk for earlier and more severe ear infections compared to non - indigenous children [1, 11 ]. thomson reported that the hospitalization rates for otitis media were six times more frequent for first nations children than other children. findlay and janz showed that, among children aged 0 to 3 years, 46% of first nations children living off reserve had an ear infection compared to 40% of all canadian children within the same age range. another canadian study reported that aboriginal status was one of the strongest (or = 1.4) risk factors for otitis media in a population - based birth cohort. the first nations and inuit regional health survey (fnirhs) conducted with reserve communities in all provinces of canada in 1996/1997 revealed that the prevalence of ear infection was 15.8% for new born to 17 years old children and 20.3% for new born to five years old first nations / inuit children. on the other hand, the national longitudinal survey of children and youth (nlscy) in 1994/1995 demonstrated that the prevalence of ear infection was 53% among newborn to three years old children excluding the children living on first nations reserves. the difference in prevalence rates could be due to several reasons : in the nlscy, ear infection must have been diagnosed by a health professional, but, in fnirhs, this was not the case. no data were available on whether first nations parents wait longer before seeking care for otitis media compared to other parents. another important observation in the present study was higher prevalence of breastfeeding longer than three months among first nations children compared with caucasian children (57.5% versus 40.1%, resp.). this could be the reason for lower prevalence of ear infection observed among these first nations children compared with caucasian children in the current study. macmillan. reported that, in children up to two years of age, 39% of first nations / inuit children compared with 24% of other canadian children were breastfed for more than six months. the results from 2006 aboriginal children 's survey reported that a higher percentage (over 72%) of first nations / mtis children living off reserve were breastfed. many studies showed that breastfeeding has a protective effect on the development of otitis media [11, 30, 34 ]. this could be due to the immunological properties of breast milk, which contains specific antibodies against respiratory viruses. according to a recent study, not being breastfed at three months was a significant risk factor for ear infection. review reported that breastfeeding was strongly associated with a decreased risk for otitis media during the first year of life. salah. found that breastfeeding for less than three months was associated with an increased risk of developing otitis media compared with infants who were breastfed more than three months. similar to these studies, this study reported that children breastfed longer than three months were associated with a decreased risk of developing an ear infection compared with children who were not breastfed or breastfed for less than three months. studies have shown that ear infection develops significantly more often in boys than in girls [11, 30, 37 ]. this study did not report any significant difference in the prevalence of ear infection among boys and girls (56.2% versus 55.3%, resp.). an early meta - analysis of risk factors for acute otitis media reported that having at least one sibling significantly increased the risk of having an ear infection. reported that having a sibling was associated with an increased risk of otitis media in the early life of a child. other studies have reported siblings ' history of acute otitis media was a strong predictor of acute otitis media [30, 37 ]. another review of otitis media risk factors summarized that overcrowding in homes and families with a number of older siblings were risk factors. baraibar reported that these positive relationships between ear infection and having siblings could be due to both environmental and genetic factors. similar to these earlier studies, this study showed that first born children had a significantly higher prevalence of ear infections. in this study, we were unable to identify any association between overcrowding in homes and ear infection. two north american studies [40, 41 ] identified childhood obesity as an independent risk factor for ear infection. a significant relationship between childhood obesity and ear infection was not observed in this study although there was a greater trend towards ear infection if the child was obese compared with those who were not (61.3% versus 55.4%, resp.). it is a well - known factor that exposure to cigarette smoke is a risk factor for the development of ear infection among children [7, 11, 12, 17, 30, 35, 42, 43 ]. thomas reported that the reduced exposure to tobacco smoke had contributed to the decreased prevalence of ear infections among young canadian children during the period of 1994/1995 to 2008/2009. an australian study reported that passive cigarette smoking was a risk factor for otitis media among both aboriginal and non - aboriginal children. in addition, two studies found that parental smoking increased the risk of otitis media [1, 35 ] and one did not. in the present study, maternal smoking during pregnancy was not a significant risk factor for ear infection and a similar result was found by eldeirawi and persky. in contrast, some studies reported maternal smoking during pregnancy as a risk factor for the development of ear infection [14, 45, 46 ]. in addition to the risk factors mentioned above, several comorbid conditions were associated with ear infection. there is limited research on the effect of allergy in the pathogenesis of otitis media in younger children. results of a meta - analysis revealed that the presence of allergy or atopy increased the risk of ear infection. hurst demonstrated that the current medical evidence supports the link between allergy and ear infection and that, for more than 85% of cases with chronic ear infection, allergy might be the contributing factor. two studies looked at the association between ear infection and asthma [1, 8 ] and tonsillitis. furthermore, a history of repeated ear infections was associated with increased prevalence of asthma in children. the present study supported these findings and found significant associations between ear infections and asthma and tonsillitis. other studies also reported upper respiratory tract infections as a comorbid condition for ear infection [30, 36, 43 ]. very few canadian studies have examined the risk factors of ear infections among caucasian and first nations children together. this study included children from rural saskatchewan and first nations from two reserves in saskatchewan. on the other hand, the two studies had moderate response rates (srhs : 42.0% ; fnlhp : 58.2%). first nations children for this paper were coming from two sources and they were from two reserves in saskatchewan (community a : n = 195 ; 44.1% of ear infection prevalence and 54.9% of breastfeeding longer than three months ; community b : n = 156 ; 42.9% of ear infection prevalence and 60.9% of breastfeeding longer than three months). therefore, there is a variation of prevalence rates of ear infection and breastfeeding across communities. thus, we are unable to generalize these results to other first nations communities. in general, due to the cross - sectional nature of the study, one of the major limitations was the parent - reported survey recall - bias of disease history. although we have obtained information of whether or not this child was breastfed and duration of breastfeeding, we have not collected the information on feeding practices (e.g., exclusive breastfeeding, formula, or both). these results suggested that significant determinants of ear infection were younger age ; self - reported physician - diagnosed tonsillitis and asthma ; any respiratory allergy ; first born ; and ethnicity. breastfeeding longer than three months was protective. while ear infection was a prevalent condition of childhood, children of first nations heritage living in rural communities were less likely to have a history of ear infections when compared to their rural caucasian counterparts. | background. ear infections in children are a major health problem and may be associated with hearing impairment and delayed language development. objective. to determine the prevalence and the associated risk factors of ear infections in children 617 years old residing on two reserves and rural areas in the province of saskatchewan. methodology. data were provided from two rural cross - sectional children studies. outcome variable of interest was presence / absence of an ear infection. logistic regression analysis was conducted to examine the relationship between ear infection and the other covariates. results. the prevalence of ear infection was 57.8% for rural caucasian children and 43.6% for first nations children living on - reserve. first nations children had a lower risk of ear infection. ear infection prevalence was positively associated with younger age ; first born in the family ; self - reported physician - diagnosed tonsillitis ; self - reported physician - diagnosed asthma ; and any respiratory related allergy. protective effect of breastfeeding longer than three months was observed on the prevalence of ear infection. conclusions. while ear infection is a prevalent condition of childhood, first nations children were less likely to have a history of ear infections when compared to their rural caucasian counterparts. |
the epidermal growth factor receptor (egfr) is a member of the type 1 receptor tyrosine kinase (tk) family. it is a 170 kd transmembrane glycoprotein that binds egf, transforming growth factor (tgf)-, and many other ligands. upon binding, it dimerizes, and tk on the intracellular side of the receptor is activated to initiate the intracellular signaling cascade. egfr inhibitors (egfris) such as cetuximab enjoy an increasing popularity in the treatment of metastatic cancers including but not limited to head and neck squamous cell carcinoma (hnscc). such inhibitors include antibodies against egfr such as cetuximab, panitumumab, nimotuzumab, zalutumumab, and necitumumab, as well as the egfr tk inhibitors, gefitinib and erlotinib. in addition, multispecific tk inhibitors are available such as egfr / her2-inhibiting lapatinib, afatinib, neratinib, and vandetanib that act against egfr - tk as well as against the vegfr and ret pathways. the most common are maculopapular follicular acneiform eruptions, followed by facial erythema, seborrheic dermatitis, blepharitis, mucositis, stomatitis and mouth ulcers, xerosis, skin fragility and paronychia, fissuring or periungual pyogenic granulomas. typically, the onset of an acneiform eruption occurs after 1 week of treatment, and it is characterized by monomorphous follicular pustules on the face, scalp, and upper trunk. impetigo caused by staphylococcus aureus can occur as a superinfection that is easily recognized by the golden serous crusts. egfri - induced acneiform eruptions can be distinguished from acne vulgaris by the absence of comedones. inhibition of egfr inhibits proliferation, differentiation, and adhesion of keratinocytes, which may favor the uncontrolled growth of opportunistic bacteria thriving in areas rich in pilosebaceous units. it has been reported that egfr inhibition causes the release of inflammatory cytokines by keratinocytes. as the hair follicle, or pilosebaceous unit, is the focal point in acneiform skin eruptions, it is not unexpected that hair growth can be affected as well, resulting in either increased facial hair growth or trichomegaly of eyelashes or impairment of hair formation resulting in curly, brittle hair, and alopecia. erlotinib and gefitinib have been associated with inflammatory nonscarring alopecia, and severe forms of scalp involvement include folliculitis decalvans (fd), scarring alopecia, or erosive pustular dermatosis of the scalp. here, we report on the manifestations and management of a severe form of egfri - associated scarring alopecia. a 51-year - old physically challenged man was treated with the egfri cetuximab 500 mg and the alkylating agent cisplatin 75 mg for a stage 4 hnscc. he was referred to our clinic for cutaneous side effects, occurring 1 month after cetuximab therapy had been initiated. the patient presented at that time with pustules, erosions, tufted hair, and golden crusts on the cheeks, nose and front, neck, and throat [figure 1a ]. at 6 weeks after treatment onset, the entire scalp was involved, and only few remaining longer hair residues were visible [figure 1b ]. bacteriology performed on a pustule on the scalp revealed s. aureus, and a biopsy of the scalp showed dystrophic hair follicles surrounded by perifollicular inflammatory infiltrate with plasma cells. (a) after 4 weeks of treatment with cetuximab (b) 6 weeks into the epidermal growth factor receptor - inhibitor - inhibiting treatment. (c) after treatment with topical steroids and antiseptics, almost 2 months treatment have been started based on the above features, we retained the diagnosis of egrfi - induced fd, and initiated treatment with topical class iii steroids and antiseptics. within 3 weeks of treatment, the skin lesions had completely resolved [figure 1c ] and somewhat to our surprise, given the condition 's severity. the scarring alopecic areas were transformed into a status compatible with noninflammatory brocq 's pseudopelade. a systemic treatment would have been required, we performed immunohistochemical stainings for tumor necrosis factor- (tnf-), interleukin-1 (il-1), and il-17 of a scalp biopsy. compared to normal skin, increased expression was observed for il-17 and tnf- in lymphocytes and nonspecifically in plasma cells [figures 2a c and 3 ]. il-17 was more than 150-fold elevated compared to healthy skin samples (n = 2). immunohistochemical stainings with antibodies against (a) il-17, (b) tumor necrosis factor-, and (c) il-1 mrna level of il-17a, tumor necrosis factor-, and il-1 in lesional skin of the patient. the presented case is instructive considering the pronounced clinical presentation of egfri - induced destructive folliculitis of the scalp, and the surprisingly efficient treatment response to topical steroids and antiseptics. in this case, extensive hair loss was seen, which can cause a considerable decrease in the quality of life. egfri has been reported to elicit numerous types of hair loss including alopecia areata, erosive pustular dermatosis, and fd. while there are data on the expression of cytokines in alopecia areata, there is very little known about cytokine expression in fd. alopecia areata is associated with increased serum concentrations of tnf-, il-6, il-17a, as well as il-21 and il-22. il-1 has been shown to inhibit hair growth in vitro, and in a genetic analysis, il-1 single - nucleotide polymorphisms have been shown to be associated with alopecia areata. it has also been suggested that the il-17 gg genotype is associated with an increased susceptibility for aa. erosive pustulosis is another disease of the scalp that can be induced by egfri, and it is otherwise primarily seen in elderly people with atrophic sun - damaged skin. there have been no studies performed regarding the association of tnf- and any ils in patients suffering from egfri - induced skin eruptions. it has been published that tnf- is weakly to moderately expressed in fd. in our case, however, tnf- was highly expressed, at least 80 times more than in healthy skin samples at the mrna level [figure 3 ]. there is no data on il-17a and fd, and only one paper reported the expression levels of il-1 in fd, showing a weak - to - moderate level of il-1 expression, comparable with our findings. our data suggest that an increased expression of il-17a, with a more than 150-fold increase, may contribute to the pathogenesis of egfri - induced fd [figure 3 ]. since we report here a single case, these findings should be taken with caution and confirmed in the future. if tnf- or il-17a should prove to play an essential role in the pathomechanism of fd, associated or not to egfri, tnf- blockers, such as infliximab, etanercept, adalimumab or ustekinumab, as well as the il-17-inhibiting monoclonal antibody, secukinumab, may be the treatment options for severe cases. fa is supported by the hsm2 (hochspezialisierte medizin) of the canton of zurich and is on the advisory board of leo. | due to the increasingly widespread use and side effect profile of epidermal growth factor receptor inhibitors (egfris), cutaneous side effects of these drugs are frequently encountered. the egfr is expressed on keratinocytes and fibroblasts. inhibition of egfr can produce a range of cutaneous adverse effects, the most frequent being a characteristic acneiform skin eruption. as the latter is associated with good anti - neoplastic responses, the onset of egfri - induced acneiform skin eruption is typically viewed as a positive sign by patients and physicians. it can usually be treated well with standard acne drugs, but in rare cases, the skin eruption can be so severe that systemic therapy and/or interruption of egfri treatment are required. one of the severest forms of egfri - induced skin eruption occurring on the head and neck area resembles folliculitis decalvans. here, we discuss the management of such a case seen in our department. in addition, we present an analysis of tumor necrosis factor-, interleukin-1 (il-1), and il-17a expression based on immunohistochemical stains and qpcr. |
although oral antidiabetic drugs (oads) remain the mainstay in the treatment of type 2 diabetes mellitus (t2 dm), insulin therapy becomes inevitable in a substantial number of patients as the disease progresses. according to recent estimates, roughly 4 of 10 patients with t2 dm in india and gulf countries are using insulin alone or in combination with oads at any given point of time. insulin therapy is an essential part of diabetes management ; all type 1 and most type 2 diabetes patients require insulin at some stage. as injectable therapies such as human insulin, insulin analogs, and glucagon - like peptide-1 receptor agonists are used to manage diabetes, correct injection technique is vital for achievement of glycemic control. specific recommendations to collate and explain best practices in insulin injecting technique are needed for people with diabetes as well as health - care providers (hcps). inadequate knowledge regarding insulin usage is likely to influence its acceptance and adherence, and outcome of therapy, underscoring a great need to investigate knowledge, attitude, and practice of insulin use in patients with diabetes, type1 and type 2 alike.. lipodystrophy (ld), often caused by repeated reuse of needles, manifests as a localized lesion at the repeated injection site. ld are divided to two subgroups : lipohypertrophy (lh) and lipoatrophy (la). consistency, and la is a scarring lesion with depression. there was a strong relationship between the presence of lh and improper or lack of rotation of sites, as found in studies encompassing a detail analysis of execution of insulin injection process and their implications. lh retards insulin absorption significantly and to a sufficient magnitude to have an adverse effect on diabetes control. proper rotation of injection site and avoidance of needle reuse can prevent lh, or reduce its size which in turn improves glucose control. the primary objective of this study was to assess the knowledge and practice of patients with t2 dm on insulin treatment regarding vital parameters encompassing the self - injection process and to correlate these parameters with hard end points such as ld, self - reported hypoglycemia, and a glycemic status as indicated by glycated hemoglobin (hba1c). major secondary objectives were to assess patients ' awareness and execution of therapeutic lifestyle management parameters and self - monitoring of blood glucose (smbg), analysis of usage of concomitant oads. this cross - sectional registry - based retrospective trial was conducted in an urban tertiary referral clinic, which uses a customized software to collect relevant information at the 1 point of contact and also during follow - up through pro forma - based interview conducted by trained diabetic counselors under the constant supervision of specialist physician / endocrinologist. the electronic pro forma are built into a customized user - friendly software called diabetes, endocrinology and metabolic disease information management system (demims). data entries which are made during the years 20062016 were reviewed and filtered through a two - tier screening process. appropriateness for inclusion was based on the following points : (i) ongoing insulin usage for at least previous 3 months till the registration in the clinic (1 point of contact), (ii) having full comprehensive data addressing the insulin injection process, (iii) having full set of anthropometric data, and (iv) a hba1c level at registration or either before or after 3 weeks of the 1 point of contact. once a particular patient 's data were selected for enrollment in the study, the data entry team comprising a data entry operator and a diabetic counselor each would transfer the same to a microsoft excel master - sheet, which when completed was submitted to the biostatistician. hypoglycemia ' was defined as the occurrence of one or more typical symptoms, such as palpitations, tiredness, sweating, strong hunger, dizziness, and tremor, which were reverted by oral intake of carbohydrate or parenteral administration of glucose with or without a confirmed blood glucose reading of 70 mg / dl, by glucometer or incidental laboratory report. statistical analyses were performed using graphpad prism, version 6.01 (graphpad software, la jolla, ca, usa). the effect of yates ' correction is to prevent overestimation of statistical significance for small data. the logic of yates ' correction rests upon the fact that because contingency table analyses are based on dichotomous data, and the statistical chi - square distribution is continuous (rather than dichotomous), an adjustment must be applied to contingency table analyses, so as to obtain more accurate results. the analyzed dataset comprised a total number of 748 individuals with t2 dm who has been getting insulin. of 748 study participants, 466 (62.30%) were male whereas 282 (37.70%) were female. almost 2/3 (67.93%) of the participants were either overweight or obese by asian criteria. more than half of the participants were well educated with 67.78% having completed secondary education, and 51.7% having acquired at least a college graduation [table 1 ]. baseline characteristics, demographic and anthropometric profile table 2 highlights patient 's awareness as categorized by the interviewers (counselors) during the 1 clinic visit. only a few patients (90% being literate and > 50% being highly educated. such a phenomenon is quite expected in the current indian scenario in an urban referral center, notwithstanding the fact that the same may influence the outcome of such a study which looks at patients ' behavioral aspect in depth. however, despite having such advantageous background, only a negligible numbers of patients (1 injection) in 72.19% patients in our study and 96.89% in the south india study. frid. found needle reuse(>1prick) in approximately half of their patients worldwide, almost a third using the same needle up to 6 times. cost of needle was cited most frequently reason for such practice which had major impact on occurrence of lh (discussed later). in contrast, more than 4/5th patients were found to be (rightfully) avoiding needle reuse in developed nation like italy. although the recent guidelines have strongly discouraged needle reuse, the optimal cutoff for maximum number of injection per needle has not been definitively set. overall, lack of counseling on the part of hcp is more important than the patient 's ' affordability, and we opine that counselors should highlight the importance of using of needle only once, and explain how this step can minimize the long - term adverse effect of reuse. the same interventional study from italy also found that only 40.1% of patients considered other attributes of injection technique as very important at baseline which increased to 64.6% after 3 months counseling. another major issue as regards the injection technique was improper site rotation by an overwhelming majority (69.67%). rotation appeared to be a major problem in other cohorts from previously described studies as well. studies have reported that repeated injections of insulin in the same skin region induce local reactions of the subcutaneous adipose layer, broadly known as ld, but most often manifest as lh. the knowledge about factors triggering the subcutaneous tissue to develop firm growths of adipose tissue is limited. however, it appears that such lesions are the result of a multifactorial process, such as repeated injections / infusions with needles / catheters at the same body site, and local growth promoting action of insulin molecule or even insulin excipients. with insulin injection, reuse of needles surprisingly, well - designed and dedicated studies addressing this practical, highly relevant issue of lh as major source of variability in glycemic control has not been done by medical community, either clinicians, academicians, insulin or device manufacturers. few studies have shown that injecting into lipohypertrophic sites may result in significantly unpredictable and delayed absorption which can lead to hyperglycemia and/or hypoglycemia. the prevalence of lh in our study was 12.57% which was quite similar to another study from india, but much less compared to a study carried out on an italian population (48.7%), and a worldwide survey (30.8%) using visual inspection and manual palpation. another study from spain enrolling both t1 dm and t2 dm patients with 90% pen device users reported lh in 2/3. the following confounders may be responsible for lower prevalence of lh in our study : (i) ours was not a prospective study (ii) mean duration of insulin treatment and mean number of injection per day were comparatively lower in our cohort. one weakness of our study was our inability to detect and characterize lh using ultrasonography which can easily distinguish the affected tissue from adjacent normal sc tissue. in ultrasonography, appearance of homogeneous hyperechogenic densities filling part or all of the sc tissue at injection sites characterizes lh. there could be underreporting of such lesions if combined visual inspection and manual palpation (by diabetic counselors) remains the only modality of detection, which can partly explain lower prevalence in our study. ld was significantly (p < 0.05) associated with the use of different human (14.74%) compared to analogue insulin (8.24%). like a recent survey from south india, we found overwhelmingly robust association of lh (risk ratio 20.07, p < 0.001) with wrong / improper rotation of injection site, while the same for confounders like repeated use of same needle is less robust but nevertheless significant [table 6 ]. frid., using logistic regression analysis found incorrect rotation and duration on insulin treatment to be the most important factors associated with lh (p < 0.001). less robust but nevertheless significant correlation between the presence of lh and the reuse of needles, numbers of injections per day, an earlier age at diagnosis of dm, a longer duration of having dm and taking insulin have also been documented in that large survey. unlike the worldwide survey, in our study, the duration of insulin treatment, numbers of injections per day, tdd of insulin, and daily insulin dose per kilogram body weight were marginally but insignificantly higher in patients having lh [table 7 ]. these may be due to lesser numbers of patients in our cohort. in a spanish cohort, among patients with lh, 61% reported needle reuse, reversely those who reused needles, of them 70% had lh. such findings can have huge clinical implication as they can provide the right direction to intervention strategies to avoid lh in patients treated with insulin. importance of educating the patients to self - examine and detect early changes leading to lh and la has already been emphasized by others. the international study by frid. found that the mean hba1c level was 0.55% higher in patients with lh than in those without lh (p < 0.05). a trend of worsened glycemic status among patients having lh was seen in our cohort also. however, the change was without statistical significance [table 7 ]. the smaller and insignificant difference may be due to smaller size of the study cohort and other dominant factors influencing glycemic excursions. another prospective interventional study has shown 6.8% reduction in hba1c, and 2 unit absolute reduction of total daily insulin requirement within 3 months of counseling to avoid areas with lh and rotating properly while injecting insulin. the main reasons could be impaired and variable insulin absorption and action when the insulin is injected into the affected tissue. frid. have documented significantly higher occurrence of unexpected hypoglycemia and glucose variability in patients who had lh and incorrect rotation of site. in a spanish cohort, 39.1% of patients with lh had unexplained hypoglycemia compared to only 5.9% in those without lh (p < 0.01). in our study, also, patients with lh had more hypoglycemic episodes compared to those without lh, though the difference did not achieve a statistical significance [table 7 ]. this may be due to low absolute number of patients with lh, and underreporting of hypoglycemia due to retrospective data collection. at times, patients may have missed out on detecting minor hypoglycemia. lack of access to glucometer in majority of patients also deprived them of the opportunity to correlate their subtle symptoms with blood glucose. or, there may be dominant factors other than lh such as insulin dose, concomitant drugs or dietary indiscipline, etc. our work adds much - needed information to our knowledge about diabetes care, insulin use, and injection practices. the current study reveals the unique patterns of insulin usage and injection practices in india, highlights the high prevalence of lh in insulin users, and identifies the factors associated with this complication. the results of this study provide real - life data, which will help formulate newer strategies to improve delivery of diabetes care. saptarshi bose is currently employed by biocon limited, bengaluru. however, the views expressed in this article are his personal | introduction : insulin remains the cornerstone of therapy in a substantial number of patients with type 2 diabetes mellitus (t2 dm). inadequate knowledge regarding insulin usage is likely to influence its acceptance and adherence, and outcome of therapy, underscoring great need to investigate knowledge, attitude, and practice of insulin usage in patients with t2dm.methodology:a cross - sectional registry - based retrospective study analyzed data collected from 748 respondents (male : 466, female : 282), mostly from high or middle economic status, who were enrolled as outpatient in a referral clinic during last 10 years (20062016), to assess the general characteristics of patients with type 2 diabetes and their baseline knowledge, attitude, and practice of insulin usage and injection practices.results:mean standard deviation (sd) of duration of diabetes was 12.24 7.60 years and mean sd duration of insulin therapy was 3.42 4.18 years, which was initiated after a mean sd diabetes duration of 8.80 6.42 years. mean insulin dose per kilogram of body weight / day was 0.51 0.27 units. total daily dose of insulin was 33.36 18.44 units and number of injections / day (mean sd) was 2.06 0.73. among the respondents, 58.96% were on human insulin and 35.70% were on analog insulin. pen devices were used by 66.08% of the population whereas 31.76% used insulin syringes. the prevalence of lipohypertrophy (lh) was 12.57%, which was significantly (p < 0.001) associated with wrong technique with regard to injection angle (10.45% vs. 23.02%), site of injection (7.00% vs. 30.51%), rotation of site of injection (0.88% vs. 17.66%), and reuse of needle (5.77% vs. 15.19%). lh was also significantly (p < 0.05) associated with the use of human (14.74%) compared to analog insulin (8.24%).conclusion : the current study highlights the unique patterns of insulin usage and associated high prevalence of lh among insulin users in india. |
a coronary av fistula consists of a communication between a coronary artery and a cardiac chamber, a great artery or the vena cava. in 1865, krause1) described a congenital av fistula, and this type of fistula makes up a part of the congenital anomalies of the coronary arteries, which occur in 1% to 2% of the population2). multiple fistulas occur in 10.7% to 16% of all coronary av fistulas, whereas both coronary arteries are involved in about 5%2 - 4). this report describes the bilateral involvement of a coronary av fistula, and this was coexistent with variant angina. a 64-year - old woman presented with complains of progressive dyspnea on effort and also chest discomfort she 'd had for 10 days. she has had no particular prior medical / surgical history. on the physical examination, the pulse rate was 70 beats / min and the blood pressure was 130/70 mmhg. the electrocardiogram displayed normal sinus rhythm ; the chest x - ray showed no signs of pulmonary hyperemia or mass lesions, and the central shadow was normal (cardiothoracic ratio=0.49). the transthoracic echocardiography demonstrated a normal finding with good lv systolic function and the stress transthoracic echocardiography also showed no regional wall motion in the left ventricle. 24-hour holter monitoring showed no specific findings except for rare ventricular premature complexes (vpcs). there were no atheroma and stenotic lesions on the coronary angiogram, but it did reveal bilateral coronary av fistula coexistent with vasospatic angina. one fistula originated from the distal septal branch of the left anterior descending artery and the other originated from a distal right ventricular branch of the right coronary artery and the latter drained into the right ventricle (figure 1). the spasm study found that the middle to distal left anterior descending artery had diffuse 90% vasoconstriction with chest pain after a left intracoronary ergonovine injection. for coronary av fistula, the site of origin of the fistula is from the right coronary artery in 50% to 58% of patients, from the left anterior descending artery in 25% of patients, from the circumflex artery in 18.3% of patients, from the diagonal branch in 1.9% of patients and from the left main coronary artery (lmca) or the circumflex - marginal branch in 0.7% of patients, respectively2, 3, 5, 6). in the above mentioned studies, the coronary av fistula drainage site was the pulmonary artery in 29.8% to 43% of patients, the right ventricle in 14% to 40% of patients, the right atrium in 19% to 20.2% of patients, the left ventricle in 5.8% to 19% of patients and the left atrium in 5% of patients. twenty percent of the patients with congenital coronary av fistula have other congenital or acquired heart disease2 - 4, 7 - 9). for the adults with av fistula angina pectoris and myocardial infarction that are due to coronary artery steal occur in 3% to 7% of av fistula patients. congestive heart failure develops in 19% of these patients, and endocarditis in the fistula occurs in 20%. only one case has been reported with the coronary av fistula coexistent with variant angina10). the treatment of a coronary av fistula depends on its presentation and the magnitude of the pulmonary - to - systemic flow. yet it has been suggested that surgical ligation4), with or without the use of extracorporeal support, could be a form of treatment due to the natural history of the disease, which is not always benign, and also due to the low incidence of spontaneous fistula closure in patients with a large coronary av fistula. in conclusion, we report here on a case that showed the very rare occurrence of bilateral coronary av fistula that was coexistent with variant angina. | a coronary arteriovenous (av) fistula consists of a communication between a coronary artery and a cardiac chamber, a great artery or the vena cava. it is the most common anomaly that can affect coronary perfusion. yet bilateral involvement of a coronary fistula, constitutes an uncommon subgroup of coronary av fistulas. we herein report on a case of bilateral coronary av fistula that was coexistent with variant angina originating from the distal right ventricular branch of the right coronary artery and the distal septal branch of the left anterior descending artery, and the latter drained into the right ventricle. |
the transformation of a normal cell into a cancerous phenotype requires stages of initiation, progression, and promotion by altering specific genes [13 ]. although predisposition to cancer can not be signaled out by a single factor, a group of factors place some individuals at a higher risk of acquiring the disease. most of the high - risk cases may have a genetic background, but in some instances dietary choices can dictate the outcome of health. as determined by population and epidemiological studies, the predominant forms of cancer and cancer - related deaths are those of the lung and bronchus, breast, colorectal, and prostate [4, 5 ]. these cancers are also more prevalent in the western parts of the world and are much lower in asian countries. a well - balanced diet that includes more of vegetables and fruits with less fat / meat intake is in most cases a staple of many asian countries [4, 5 ]. many hypotheses have supported that diet and environment greatly influence cellular function and health. phytochemicals are plant - based chemicals that mediate their positive health benefits directly, by affecting specific molecular targets such as genes, or indirectly as stabilized conjugates affecting metabolic pathways. many genes play significant roles in the cell cycle pathway, and some of these are altered in cancer cells [1, 2 ]. the aim of most studies is to understand and formulate mechanistic pathways by which these naturally derived chemicals can alter the fate of a cell. for a cancerous cell to survive, it should be able to proliferate, obtain energy, and establish angiogenic pathways, in a tumor mass. altering genes that affect these pathways can serve as suitable tools to decrease tumor mass and also allow for tumor regression. in this paper, the key focus will be on mechanistic pathways that are regulated by nutraceuticals to bring about changes in the tumor environment and serve as alternative approaches for cancer prevention and therapy (figure 1). however, in this paper only some of the most potent and promising chemopreventive and therapeutic molecules will be analyzed, with emphasis on combination therapy of these with other nutramolecules. most phytochemicals derived from dietary sources are classified under an umbrella of specific chemical compounds as detailed in table 1. these molecules may not have a nutrient value but are germane to the function of a cell. various studies have shown that these molecules can induce apoptosis, inhibit cellular proliferation, affect angiogenesis, and affect cancer metabolism in various cancers, all of which are hindrances to tumor growth (figure 1). several of the phytochemicals listed in table 1 have been investigated in terms of their curative properties. however, one must carefully interpret the observed results in vitro and in vivo before testing the same in a clinical setting. tests in culture are pure, in that there is only one cell type in the culture plate and all conditions are controlled, including the bioactive compound. in vivo, however, the scenario changes as there are a host of other factors that need to be taken into account, including age, weight, diet, and metabolism of the compound. a bioactive molecule in culture may be subjected to less metabolic changes and may be presented to the cell in its native form. however, in vivo the same compound may be presented differently, perhaps as a conjugate, and its mode of action may change amongst the multitude of other molecules in the host 's microenvironment. many in vivo experiments also control for the type of diet being administered to the organism, where the concentrations or plasma availability can be adjusted. therefore, what may work well in vitro, may have no agonistic effects or even antagonistic effects in vivo, and such discrepancies are often seen when comparing population and epidemiological studies in terms of chemical efficacy. an effective nutraceutical is one that will have a low nontoxic dose while creating a magnitude of change in tumor dynamics. this means that at a low dose the compound should act fast on the tumor load. however, if the time taken to be effective is slow, the problems faced would be maintaining a tolerable dose and increasing bioavailability and stability. a solution to such a problem would be to use a combinatorial approach to therapy, a bioactive molecule with an effective synthetic drug or double - nutratherapy (e.g., curcumin and resveratrol). have shown that some compounds exert their antitumor functions at much higher concentrations and that dietary consumption is insufficient to achieve such effective concentrations at the tumor site. therefore, the mode of delivery is a very important factor that needs to be considered at clinical trials and during in vivo studies. the nontoxic properties of natural compounds are essential to the design of a formulated therapy. however, evidence along several lines of treatment has shown that some compounds are preferentially more potent in activity when administered early in life [9, 10 ]. for instance, soy - based prevention of breast cancer is thought to be more successful when soy products and their derivatives are consumed in early development. isoflavones are a group of phytochemicals that are predominant constituents of a soy - based diet [9, 10 ]. among isoflavones, the three major constituents that have been shown to have remarkable influences in cancer prevention and therapy are genistein, diadzein, and glycitin. they are collectively grouped as phytoestrogens for their weak estrogen - like activity and bind preferentially to er- receptors [1215 ]. evidence of antiproliferative activity of genistein in vitro stems from its ability to inhibit the tyrosine kinase enzyme that is most often upregulated in cancer cells [16, 17 ]. as a chemopreventive agent, genistein is thought to influence the differentiation process of mammary tissue. it is believed that early differentiation of mammary tissue into terminal buds, as seen in rats, serves as a chemopreventive strategy as it reduces the susceptibility of the epithelial cells in the ducts to carcinogens or estrogen and the ontogeny process. many aggressive cancers have altered epidermal growth factor (egf) receptors on their cell surface allowing for a continuous downstream signaling pathway for cell division [18, 19 ]. this is interesting, as genistein can serve as a two - fold approach molecule for prevention and treatment. when egf binds to its receptors, tyrosine kinase activation results in the phoshorylation of tyrosine residues of proteins involved in downstream cell signaling pathways that trigger cell division. though studies have shown that genistein increases the egf transcript early in development of mammary tissue, this perhaps is essential for differentiation and faster development of the breast tissue. in the long run therefore, a decrease in egf mrna coupled with inhibition of tyrosine kinase by genistein would profoundly decrease tumor growth as cell signaling pathways are crucial to tumor maintenance. numerous studies have highlighted the antiproliferative role of genistein in various cancers ; however, there are some studies indicating that genistein may increase cell proliferation [19, 47 ]. a key point to note is that nutraceuticals can be effective based on the form of genistein or its dose given at the time of the study (tables 2 and 3), especially with respect to in vitro and in vivo models. importantly, the downstream targets of bioactive molecules under investigation need to be ascertained for each specific tissue, if overall health applications are an issue. for example, in breast tissue, egf may be highly expressed, but, in colon cells or pancreatic cells, genes that regulate cell division other than egf may be affected. cell culture experiments using plant - based nutrients depend on the sensitivity of the cells that are being investigated. when cell lines are established, they are derived from cancerous tissues of specific organs and are, therefore, cell - type specific. this is drastically different in a clinical setting where the molecule has to mediate its activity amongst a host of various molecules and cell types. therefore, the concentration of the phytonutrient in the supplemented diet will be crucial to its efficacy in the tumor environment. this can help explain the discrepancies seen in clinical trials of genistein for different tissues [47, 49, 50 ]. outcomes of some in vitro studies suggest that, like other bioactive compounds, genistein appears to have a specific cut - off concentration at which this isoflavone can exhibit anticarcinogenic activity (10 m or even higher) [48, 51 ], and it is, therefore, imperative to achieve such concentrations in vivo. isoflavones, in particular, genistein, have been extensively studied as prospective antitumor molecules in the treatment of prostate cancer [19, 52, 53 ]. there has been a well established line of evidence that genistein works against prostate cancer, but a majority of studies are in vitro in cultured cells [19, 5256 ]. limited clinical trials have tested the therapeutic efficacy of genistein in prostate cancer and those that have revealed inconsistencies in cell proliferation and tumor growth [5760 ]. given the inconsistencies in some of the outcomes, emphasis should be on the dose of the supplement and the form of the nutrient in the supplement at the time of administration to the patient in clinical trials. the highest achievable plasma concentration of isoflavones is 1 m through orally administered food sources. from previous studies, however, there is ample evidence that genistein and other isoflavones do exhibit anticancer properties and inhibit cell proliferation and tumor growth. a clinical study by gardner. showed that treatment of patients with dietary supplements (82 mg / day aglycone equivalents) of isoflavone yielded a higher concentration of total isoflavones in the prostatic tissues than in serum. therefore, there is a possibility of increasing the concentration of isoflavones to anticarcinogenic levels in tissue. an orally administered dose of isoflavones must withstand the rigors of the alimentary canal and become metabolized before they can be made available to tissues. this conjugation is perhaps the best way to present the molecule to the cell in tissues, and the hydrolysis of the conjugates in the tissue allows available free genistein delivery to the cells, as presented or tested in vitro. for pharmaceutical companies, it is required to formulate supplements with precise ratios of individual constituents of the compound. unless a very pure form, a capsule or supplement may contain a mixture of genistein, diadzein, and glycetin (tables 1, 2, 3, and 4). the percentage of each nutrient in the mixture will have a profound effect on the bioavailability of the compound after metabolism (tables 2 and 3). to design such a product is certainly not easy and is dependent on many factors, but the two essential factors are the grade / stage of the tumor and the site or origin of the tissue. of the two isoflavones, diadzein has been shown to have a lesser apoptotic effect on prostate cancer cells but can inhibit neoplastic transformation. therefore, it would be advantageous to use supplements containing the two bioactive nutrients as chemopreventive agents. of the predominant high - risk cancers, genistein appears to have a greater affect on prostate cancers [5254 ]. genistein mediates the apoptosis of cancer cells by activating and/or inhibiting genes and/or enzymes germane to tumor maintenance (figure 1, table 4). some of these important mechanisms are the inhibition of the activity of tyrosine kinase, nuclear factor kappa b (nf-b), and vitamin d 24-hydroxylase, activation of tumor suppressor genes, and modulation of androgen - responsive gene expression, prostate - specific antigen (psa), and the androgen receptor (table 4). of the prominent isoflavonones in soy, diadzein is less effective in its action on prostate cancer, but, unlike genistein, it is metabolized to equol, an isoflavandiol which has a longer half - life than genistein. the longer half- life of equol creates the possibility of using this chemical in combination with other available nutraceuticals, where the net effect may be synergistic. however, prior preclinical tests are required to investigate this possibility. other dietary compounds are also of great interest in this regard. in vitro, vitamin d (vit d) has potent tumor prevention ability and can induce differentiation and apoptosis in some of the most predominant cancers. the use of nutrients as a possible treatment approach is based on the fact that chemicals occurring naturally will minimize side effects when applied to a biosystem. however, the in vitro dose at which vit d induces its antitumor properties causes hypercalcemic conditions that can preclude treatment in patients. in prostate cancer, a leading cause of cancer deaths in the western parts of the world, however, as the cancer becomes aggressive, hormone ablation therapy fails, and progression ensues via androgen - independent pathways. vitamin d is an alternate form of treatment in prostate cancer (pca) and is shown to induce apoptosis in pca cells in vitro. all pca cell lines in vitro are not equally receptive to the vitamin d treatment or genistein. cell lines such as du145 prostate cancer cells are especially more resistant as they express high levels of cyp24, an enzyme that catabolizes vit d3 into less active metabolites. to circumvent this problem, a recent study showed that a dual combination therapy, of du145 to genistein and vit d3, increased the sensitivity of the cells to vit d3 by decreasing cyp24 expression. what is interesting to note is that the combination approach not only lowered the effective dose, but was able to abrogate cell proliferation as well. this lowered concentration of genistein at 100 nm is achieveable in vivo through dietary sources, and clinical studies would be required to determine the localization of genistein and vit d3 in prostatic tissues. an in vivo study for colorectal cancer has demonstrated a similar effect, but in this case the mice were given a single gavage of 250 g of genistein. this mode of nutrient administration is useful for a preclinical test and probably has applications as a chemopreventive supplement. however, in terms of a clinical setting, patients are often exposed to a host of other nutrients or isoflavones in their diet, and ; therefore, an in vivo model replicating such an environment with various percentages of isoflavones will allow for a better understanding of concentration and bioavailability of genistein that can mediate an apoptotic effect and reduce cyp24 expression in colonic tissues in the presence of vitamin d. the antimetastatic properties of genistein are mediated by altering the expression of nf-b, and inhibiting the tyrosine kinase enzyme [17, 90 ]. non - small - cell lung cancer (nsclc) is a highly aggressive form of lung cancer with a poor prognosis. activation of epidermal growth factor receptor tyrosine kinase (egfr - tk) enhances the cell signaling pathways allowing tumor growth. the use of drugs that inhibit egfr - tk and affect nf-b, a gene whose transcribed products are essential for invasion and metastasis, can induce a more aggressive approach of reducing tumor size and the spread of the disease. a clinical therapy should be aimed at reducing tumor growth and spread by inhibiting mechanisms that contribute to the activation of metastasis. in nsclc, genistein remarkably enhances the effects of egfr - tk inhibitors, such as erlotinib and gefitinib, when used in combination with each of them, respectively. this effect was seen to be mediated by a marked reduction in nf-b and others, such as egfr, pakt, cox-2, and pge(2), essential for regulating genes that control division, proliferation and metastasis. a few studies have shown how a combined approach can lower the effective dose concentration even of chemotherapeutic drugs, minimizing potential side effects. a study conducted on breast and pancreatic cells showed that, when the cells were primed with genistein, lower concentrations of the chemotherapeutic drugs were needed to significantly bring about growth inhibition and apoptosis than with the drugs alone. in addition, nf-b was transcriptionally inhibited in the combined treatment. from a number of investigations, a common thread of evidence seems to emerge that considerable variation in the efficacy of bionutrients in cancer treatment exists and differs even among the same cell lines tested. cell lines derived from the same tissue hypothetically should be sensitive to the same dose or chemical class of the phytonutrients, but such is not always the case. alternate medicinal approaches have an important task to identify crucial factors that change the sensitivity of the chemical and determine chemical modifications that would be necessary to modulate more synchronized results across several cell lines expressing similar genotypic and phenotypic signatures. of the major food - derived phytochemical constituents that are extensively studied for their chemopreventive and chemotherapeutic use, egcg and genistein egcg has been shown to have numerous anticancer properties which include antiangiogenic activity by affecting the transcriptional expression of vascular endothelial growth factor (vegf), inhibiting tumor initiation and promotion by inhibiting signal transduction pathways via [phosphatidyloinositol 3-kinase - akt kinase- nf-b ] [9294 ], inhibiting egfr, inhibiting her-2 receptor phophorylation in breast carcinoma cells that constitutively expresses her-2/neu receptor, inducing apoptosis in estrogen receptor-(er-) independent breast cancer cells, causing antimetastatic activity, inhibiting proteasome formation, inhibiting glucose - regulated protein (grp78) activity ; inhibiting insulin - like growth factor - i receptor (igf - ir), and preventing invasion of tumors by inducing hmg - box transcription factor 1 (hbp1) transcriptional repressor, an inhibitor of the wnt signaling pathway crucial for tumor - invasive property. the serum level concentrations of egcg are important to ensure that an effective response is seen without adverse or even tumor - promoting functions. studies have shown that high doses of catechins that include a higher concentration of two prominent compounds, epicatechin gallate (ecg) and egcg, induce hypoxia - inducible factor 1 which is responsible for activating genes related to hypoxia conditions. most breast cancers are er dependent ; however, for breast cancers and others that are er independent, egcg inhibits the growth of tumor cells through the process of apoptosis [96, 103 ]. as seen in mda - mb-468 er - negative cells, cellular apoptosis however, such doses may be irrelevant to clinical applications as they may be physiologically unachievable through dietary consumption. therefore, clinical trials should be aimed at achieving desired anticancer preventive or tumor functions at much lowered doses. one study demonstrated that combining egcg with the drug taxol, which is commonly used to treat breast carcinomas, lowered the effective dose of egcg, ranging from 0.11.0 g / ml which is a serum obtainable level through metabolism. this same group showed that higher doses (3040 g) of egcg were required to mediate a similar effect when used alone. egcg can be exploited as a chemopreventive agent if it prevents cancerous lesions from occurring at lower dose concentrations and for prolonged periods of time. most in vitro studies have used relatively high doses of egcg and such doses may prove to be more tumor promotive than preventive in longer exposure time periods. in a study designed by pianetti., contradictory results on the effects of egcg on her-2/neu overexpressed receptor in nf639 breast cancer cells was observed. at short exposure times, egcg was very effective in reducing cell proliferation, but at prolonged exposure cells became resistant to egcg with increased levels of nf-b. this observed change in drug - induced resistance was related to the activation of mitogen - activated protein kinase. it appears that single doses or one specific chemical constituent is mostly insufficient to induce tumor suppression or regression. such in vitro data outcomes emphasize that a dual - drug treatment approach is necessary to treat the disease. perhaps egcg should be administered early in treatment, but later other phytochemicals or drugs, in conjunction with egcg, may need to be administered in the treatment regimen. in their dual - drug treatment of nf639 her-2/neu breast cancer cells, yang. found that treating the cells initially with egcg lowered cell proliferation and the later introduction of the mapk inhibitor, u0126, reduced invasive phenotype. most studies determining the anticancer drug properties of egcg are preclinical. for better understanding of specific egcg effects, egcg has different roles in er - dependent versus er - independent receptors, and, therefore, the type of diet needed to emulate in vitro doses need to be clearly understood through clinical trials and careful pharmacokinetic studies of these doses in healthy individuals, er - positive breast cancer patients, and er - independent tumors. in testing phytochemicals of the same or different class it is rather uncertain which markers are necessary to determine comparable dosage values for in vitro versus in vivo efficacies. formulation of a diet is one of the major deciding factors in the functional efficacy of a chemical constituent. it defines the concentration of the dose that will be available in vivo, after metabolism, and determines the diet that needs to be given to achieve such an outcome. even though single - dose individual or mixed phytochemical treatments are currently available to cancer patients, they are relatively new and much more research in this direction is warranted. one such therapy that is rapidly gaining importance and holds promise for future cancer treatments is combination therapies using plant - based chemical compounds known as nutraceuticals. in prevention or treatment, combinatorial approaches can be of the following types : a phytonutrient and an effective drug, two or more phytonutrients, a synthetic phytonutrient and an effective drug, or a synthetic phytonutrient and a natural nutrient. studies in the last few decades have focused attention on unraveling the protective properties and mechanistic actions of many phytochemicals. still the pharmacokinetics of quite a few of these phytochemicals are not known, and, for a few that are known, there is much variability based on mode and form of delivery, dose, and the model organism of study (tables 2, 3, and 4). another interesting approach to enhancing curative and preventive properties of these nutrients is combination therapies. the therapy is based on the factual information available at hand and using the potent properties of one with that of another to enhance synergistic or additive actions (figure 1). in this paper, groups that have worked with different phytomolecules belonging to a different or the same chemical class of compounds have been analyzed for their antitumorigenic activities, and the overall results of the experiments for each group are described in table 4. sustained chemotherapeutic treatment with this drug has often resulted in drug resistance and tumor progression. many chemotherapeutic drugs induce the expression of the metastatic gene nf-b which encourages tumor progression. interestingly, natural - based compounds that are pharmacologically safe have been shown to inactivate nf-b expression. taxol is a powerful drug in the treatment of cancer therefore, in order to prevent metastasis, a combination of taxol with curcumin has been shown to downregulate the expression of nf-b and induce apoptosis. a study conducted on an invasive breast tumor cell line, mda - mb-231, has shown how and when compounds added to the cells determine the overall efficacy of the treatment. a sequential addition of curcumin and xanthorrhizol (a rhizomal sesquiterpenoid of curcuma xanthorrhiza) in culture resulted in additive and antagonistic effects depending on which compound was added first to the culture. however, simultaneous addition of the compounds resulted in synergistic effects at lower concentrations and agonistic effects at higher concentrations. such experiments provide evidence that the efficacy of a drug is dependent on dose, time, and how it is presented to the cells. therefore, results obtained might be contradictory if doses used are simply antagonist or additive. for a successful combination therapy or prevention, synergistic doses are more relevant to mediate downstream effects, as lower concentrations of the test biomolecules will be required. dha is a dietary compound present in fish oil that has been shown to have potent chemopreventive affects against cancer. however, what is most often observed is that all cells from the same tissue sample do not react the same way to the test compound. it is essential to have a chemopreventive or therapeutic agent that can induce its effects on a wide range of cancerous cells arising from the same tissue. in this study, the authors analyzed five cell lines expressing different cell surface receptors (table 6) which make them susceptible to chemotherapeutic compounds but in different ways and to different degrees. the combinatorial synergistic doses for each cell line were different, as shown in the table 4. in particular, one breast cancer cell line, sk - br-3, which is er - negative exhibited a higher uptake of curcumin in the presence of dha. dha does not directly contribute to cell inhibition, but the combination of this compound with curcumin greatly enhances the uptake of curcumin by the cells. this compound, dha, can reach a plasma concentration level of 200 m. although the focus of this study was entirely based on the sk - br-3 cell line, the effects of reduced synergy on other cell lines in terms of transcriptome effects need to be investigated. mammary tumors may contain a heterogenous population of cells exhibiting different surface receptors. using combination therapy should be aimed at reducing the populations of all these cell types within the tumor site to truly exhibit antitumor potency with minimal side effects. the aim to use natural compounds in diets is to render the chemopreventive properties of the compounds to the tissues. numerous studies have shown that single dosage of compounds used alone is effective for chemoprevention. although combination studies are just beginning to surface as more prominent approaches in clinical treatment, studies, though limited, have shown that synergistic effects of the compounds are able to be achieved at much lower doses than when compounds are used alone. especially in cancers that are hormonally regulated, the tissues are often exposed to external or internal hormonal stimulation, like estrogen, as in the case of breast tissue. environmental agents that mimic estrogen - like activity can often stimulate or initiate the carcinogenic process. curcumin, a curcuminoid, and genistein, an isoflavone, are derived from two different chemical classes, yet they have been known to inhibit a variety of tumor types in vitro and in vivo. clinical trials of these compounds individually have been tested [19, 60, 104, 105 ]. the mechanistic action of the individual compounds in many different cancers has been investigated as well. however, using these compounds in combination drastically affects the development of tumors by mediating changes in shape and growth inhibition. such changes were observed both in er - positive and er - negative cells, indicative of the dual use of such a combination in prevention and therapy. the ineffectiveness of certain drugs in prolonged chemotherapy stems from the resistance that some cancers develop with time. this is one of the major obstacles in cancer therapy, especially in cancers that are multidrug resistant (mdr). the problem in finding a suitable cure for non - small - cell lung cancers is the mdr phenotype it exhibits. treating mdr cells such as non - small - cell lung carcinoma nci - h460/r cells with a commonly employed drug, sf (obtained by the amination and subsequent oxidation of 6-thioguanosine), in cell cultures has been shown to inhibit cell growth. this observed cytotoxicity is enhanced several folds when low doses of the natural compound, curcumin, are used in combination, which are otherwise ineffective unless very high concentrations are used. these compounds mediate a synergistic effect in regulating the cell cycle phases and downregulate mdr genes, thereby, enhancing tumor regression phenotypes even in the presence of mutated p53 molecules. compounds that regulate the expression or activity of cox-2 in cells may be instrumental in mediating chemotherapeutic effects on the tissue or cells. celecoxib is a potent inhibitor of cox-2 and is presumed to target its active site. it appears that monotherapy regimes are very effective in inhibiting cancer growth, proliferation, metastasis, and invasion, as seen in numerous in vitro and in vivo models. however, prolonged exposures at concentrations relatively higher than what can be achieved with combination doses may result in unwanted side effects. testing the efficacy of celecoxib with cucumin showed that at lower doses of celecoxib it was possible to enforce synergistic inhibitory growth effects on colon cells which expressed various levels of cox-2. like many other in vitro investigations, this study emphasizes the fact that combining powerful drugs with naturally available potent compounds can reduce the dose needed to mediate potent anticarcinogenic effects with minimal side effects. clinically, such studies are relevant as the doses used or needed are within the physiologically dose range. with colon cancer having such a high incidence rate in the western populations, such therapies can be taken as advantage, and biomolecules having preventive potential against the formation of precancerous lesions need to be supplemented in diets of patients at high - risk. coltect is a novel chemotherapeutic dietary drug with a formulation of curcumin, a turmeric extract (95% curcuminoids) mixed with turmeric powder 1 : 1, green tea (60% polyphenols and 25% egcg) in a 2 : 1 ratio, and 0.1 mg / ml of l - selenomethionine. 5-asa is an anti - inflammatory drug, which has been shown to have a preventive role in polyp formation that is thought to occur via the inflammation process in conditions like inflammatory bowl disorder. coltect has been effective against ht-29 human colon adenocarcinoma grade ii cells in vitro, and this nutraceutical complex in combination with 5-asa has been shown to inhibit the formation or growth of chemically induced aberrant crypt foci (acf) in rat models. the molecular mechanism by which this inhibition is mediated is via the inhibition of cox-2 pathways in ht-29 cells, which has been supported by in vitro studies of other groups [106, 107 ]. however, growth inhibition can be affected via cox-2-independent pathways possibly through mechanisms that are regulated by the functional polyphenol complex in coltect. such complex mixtures are of clinical significance as many different control mechanisms can be regulated by the presence of individual constituents of the polyphenols which are a part of the formulated mixture of coltect. most prostate cancers begin as a hormone - dependent tumor, and the hormone is primarily androgen. however, the more aggressive forms of prostate cancer are androgen - independent and hormonal therapies fail to be effective. curcumin, obtained from curcumin longa, has been shown to inhibit the phosphorylation of egfr, inhibit the akt signaling pathway, and negatively regulate nf-b. phenylethylisothiocyanate, a phytochemical in cruciferous vegetables, has been shown to inhibit prostate cancer cell growth in vitro and this observation has been supported by epidemiological studies showing that consumption of cruciferous vegetables has an inverse effect on prostate cancer risk. when two bioactive molecules with similar effects are used in treating hormonally independent tumors in affecting receptor mediated signaling, the effects are more pronounced than when used as individual compounds. with peitc and curcumin, the observed effect was more additive than synergistic, but cell growth inhibition was profoundly affected by the inhibition of nf-b pathways and akt signaling pathways. these results were corroborated by in vivo studies in mice using human pc-3 prostate cancer cells. since egcg has similar effects on prostate cancer cells, egcg could also possibly serve as a substitute in place of curcumin for such a treatment strategy. although a few studies have shown that d - limonene, an abundant monoterpene in citrus oils, exhibits antimitogenic activity, its alcohol - derivated perillyl alchohol (pa) has a greater inhibitory effect on cell migration in cancerous cells. a study by reddy. used subtoxic doses of pa to determine this effect. further preclinical studies are necessary to determine the effective yet nontoxic serum / tissue concentration that can be achieved from a diet rich in citrus intake, in conjunction with phytonutrients of the same class or a different class. not much is known about the percentage composition of d - limonene and its metabolized constituents that are required to achieve an effective monterpene anticarcinogenic activity. in comparison to its oxygenated derivatives, limonene has the least cytotoxic effect on both noncancerous and cancerous breast cell lines and, therefore, can be applicable in chemoprevention. these foci are preneoplastic lesions and are biomarkers for the progression into colon cancer. in colonic crypts that are chemically induced, limonene asserts its effect by inhibiting the activity of ornithine decarboxylase, an enzyme essential for the polyamine biosynthesis pathway. this pathway regulates the cell cycle, and d - limonene - dependent inhibition of ornithine decarboxylase (odc) encourages an antiproliferative activity. if aberrant crypt foci are the initial markers for colon carcinogenesis, and d - limonene and its derivatives assert their roles against initiation and promotion phases of cancer, then a diet rich in citrus foods can prevent crypt formation. therefore, d - limonene appears to have potential as a chemopreventive agent in colon carcinogenesis. however, in vivo studies often do not correlate with results in vitro for many of the reasons discussed earlier. once the intake of a compound is deemed safe for human consumption, it is imperative to analyze and study the mechanistic and metabolic functions in human subjects to determine the efficacy of the nutrient in question. as in the case of understanding limonene protection against colonic carcinogenesis, the studies were performed on rats and for shorter exposure time to the compound or its derivatives. therefore, further in vivo models are required to determine the toxicity of the treatment for longer periods of time, as d - limonene is nontoxic but its alcohol derivatives could be toxic. many combination studies are underway to determine an effective approach in treating advanced and aggressive prostate cancers. docetaxel, a synthetic derivative of taxol, is primarily used to inhibit the microtubular structures in cancerous cells that support cell division. in addition to its role as a microtubule disruptive molecule, it has a host of inhibitory actions on genes which regulate cell proliferation, mitotic spindle formation, transcription factors, and oncogenesis. d - limonene, discussed earlier has been shown to have anti - prostate carcinogenic effects at low dose concentrations. logically ; therefore, combining the two compounds may have a plethora of positive antitumor functionalities. in a study by rabi and bishayee, the combined treatment enhanced the sensitivity of du145 prostate cancer cells that are known to be apoptotic resistant. this enhanced sensitivity was thought to be mediated by reactive oxygen species (ros) generation and activation of caspase 3 and 9. such a positive in vitro outcome warrants further investigations in vivo, in models that mimic the progression of the disease, before it can be used in dietary supplements for therapy. serum lycopene (a carotenoid) levels have been shown to have an inverse correlation with prostate cancer risk. a diet - based population study showed that, of all the carotenoids assessed, high serum lycopene levels showed a statistically significant lower prostate cancer risk. further analysis of their data revealed that lower serum lycopene levels in conjunction with -carotene supplements were effective against lowering the risk of prostate cancer, suggestive for a combinatorial therapy. certain dietary compounds can be the source of cancer formation as seen with prostate cancer. it is believed that the nonfat portion of milk and excess calcium are some main factors in prostate cancer risk. numerous in vitro studies have shown that carotenoids have a greater influence in reducing tumors of the prostate origin, and lycopene and 1,2-dihydroxyvitamin d3 are at the forefront as risk reduction factors. in addition to their role as potent inhibitors of prostate cancer growth, they are biologically safe and cheaper forms of treatment. 1,2-dihydroxyvitamin d3 and lycopene have physiologically different roles, but combined they modulate pathways to synergistically inhibit proliferation and differentiation at much lower concentrations and bear additive effects on cell cycle progression. the assessments that lycopene is a safe dietary molecule with anticancer properties is supported by a number of population epidemiological and cohort - based studies. however, it is important to ensure that the statistical models used are able to adjust for many parameters for a true significant outcome. regardless of the statistical model employed in these assessment studies, lycopene has emerged as a potent risk - reducing factor of prostate cancer and has been even supported by a study that was carried out across 28 countries. intervention combination studies have not yet been performed. however, in vivo - based studies in mice models have shown that lycopene administered in the form of tomato powder and broccoli powder in a 10 : 10 ratio, increases its serum concentration to about 538 nm / g with about 0.4 nm / g concentrated in the prostate tissue itself. diet - based intervention studies are required to determine the formulated diet required to improve the availability in the serum of patients and enhance the localized concentration of the molecule in the tissue. such a diet - based treatment may serve as a suitable chemopreventive approach against prostate cancer or with patients at high - risk of the disease. even though bioactive molecules successfully work in administering their protective functions in vitro, it appears through in vivo studies that diet and availability crucially dictate outcomes. a critical question to be asked is what factors constitute a perfect blend of bioactive mixtures. with the current research thus far, it is hard to address what the cut - off ratios are that need to be used in a diet that contain mixtures of potent nutraceuticals to coordinate similar effects clinically. possibly a slight change in concentration of even one of the effective biomolecules may render the mixture ineffective in its function. it is rather an important task for pharmaceutical chemists and nutritionists to determine the ratios of effective biomolecules in a mixture and determine the pharmacokinetics and dynamics of that mixture. fru / his, a ketosamine, is also a derived product from tomatoes obtained by the reaction of a carbohydrate with an amino acid. this particular ketosamine has been found to assert chemopreventive effects by synergistically enhancing the activity of lycopene, by neutralizing ros species and inhibiting dna damage. therefore, the complex of these two molecules may have a pivotal role in prostate cancer prevention. although a rat model was used to determine the results of the treatment and pharmacokinetics of the compound are still not known, the combination of the two seemed to preferentially localize in the prostate more than in other tissues that were tested. occasionally, a combination may fail to incite anticarcinogenic effects as was seen by mossine.. their experiments were conducted on the prostate adenocarcinoma rat model that was used by other groups, and their data had contradictory results to the effective action of lycopene itself and in conjunction with other micronutrients. their study revealed that lycopene was not able to inhibit or reduce tumor load alone or in combination and that selenium alone in the mixture was able to induce antitumorigenic effects. such outcomes are important as they open up more questions as to why a molecule that affects a given pathway behaves differently when tested within the same experimental model. is it always dose or concentration or does molecule preparation and delivery impart effects on the efficacy of a drug ? docetaxel is a potent chemotherapeutic drug that is clinically used to treat patients with advanced metastatic prostate cancers. although the drug extends survival, it is for a very limited time period and with a poor prognosis. lycopene, a natural compound, has been shown to have strong cancer inhibitory properties against the prostate tissue. one study tested the possibility to use this combination of compounds to enhance survival of patients that were detected with aggressive, androgen - independent tumors. as predicted, docetaxel inhibited tumor growth in nude mice that bore tumor xenografts of human du 145 cells. analysis of molecular mechanisms revealed that the action of docetaxel was on regulating the insulin - like growth factor receptor (igfr) pathway by suppressing igf, and this effect was synergistically enhanced in the presence of lycopene. together the molecules asserted negative downstream effects on akt signaling pathways and suppressed survivin, products of which have been known to maintain tumor growth and enhance metastasis. clinical trials using this combination may prove effective in treating patients that express high levels of igfr in the prostate tumor and extend survival for a longer duration than what is possibly achieved by docetaxel alone, which is about 1820 months. egcg exhibits strong chemopreventive and therapeutic activities as it influences many pathways as shown in figure 1. some of the mechanistic pathways are involved in regulating the levels of bcl2, survivin, and xiap and activation of caspase-3/7 to induce apoptosis. egcg is also involved in inhibiting genes that are required for transition from epithelial to mesenchymal cells and retards migration and invasion which are primarily advantageous in terms of controlling aggressive tumors. egcg mediates such synergistic actions in conjunction with quercetin to retard the self - renewal properties of cancer stem cells (cscs), a population that, if inhibited, can influence tumor regression. quercetin, a polyphenol, downregulates the expression of the heat shock protein (hsp90) known to influence apoptosis and growth inhibition of prostate tumors. therefore, the combination of these molecules modulates their respective therapeutic effects to mediate synergistic growth retardation of cscs. the study by tang. used relatively higher concentrations of egcg (60 m) in the presence of 20 m quercetin. probably concentrations of egcg that can mediate similar synergistic levels, albeit at lower doses, need to be investigated, and the therapeutic potential across cancer stems cells of other origins need to be assessed if clinical applications are to be considered. selective estrogen receptor modulators that are used in the clinical treatment of breast cancers display dual agonist / antagonist effects in the tissues, especially in cancer initiation and progression. agonistic - estrogen - like activity can in some instances enhance tumor progression which is not desired in most clinical treatments. resveratrol, a polyphenolic compound abundant in grape skin and grape products including wine, is known to have chemopreventive properties as supported by numerous in vitro and in vivo studies. however, based on the experimental cell type, resveratrol induces either agonistic or antagonistic effects that can be weak or very pronounced. resveratrol agonistic effects are totally reversed in the presence of estrogen, possibly mediated through estrogen receptor. this reversal of effects is pertinent to prevention of breast cancer lesions in ducts that could become long - term neoplastic and cancerous. of its many cancer protective functions, resveratrol in combination with glucan when natural compounds exhibit multi - chemopreventive properties, conjugation therapies are advantageous over monotherapies. albeit not clinically tested, harnessing cancer preventive and immune modulating functions of nutraceuticals seems to be a plausible approach to targeting hormonally independent aggressive tumors. numerous studies have analyzed their protective and therapeutic functions in vitro on tumor initiation that was chemically induced or in vivo via cellular implanted tumor formation. few studies have established the functions of combined polyphenols on established tumors, as the majority of investigations have focused on individual mechanistic effects of the compounds. dietary serum concentrations are influenced by the individual percentage of biomolecules present in the diet. therefore, individual protective assessments of a compound show higher dose requirements, whilst mixtures may require lower doses to achieve the same effects. additive and synergistic effects of compounds occur if their individual functions are enhanced in the presence of other molecules, perhaps by reinforcing the serum stability and availability of the various compounds in the mixture. such observations were seen in both in vitro and in vivo testing of a mixture of three polyphenols, resveratrol, quercetin, and catechin, albeit pharmacokinetics studies are warranted. cyclophosphamide, a neoplastic drug, has a broad spectrum of activity on a variety of cancers, including breast cancers. dose reduction of the compound would be a means of reducing its toxicity without compensating its anticarcinogenic activity. resveratrol has been shown to successfully lower the effective dose of cyclophosphamide without altering its anticarcinogenic activity. both of the compounds together synergistically enhance caspase - mediated cytotoxic activity, as demonstrated in mcf-7 cells, an aggressive breast cancer cell line (table 4). the combination therapy resulted in the upregulation of p53, proapoptotic genes, bax and fas, and downregulation of antiapoptotic gene bcl-2, suggestive of an apoptotic mechanism involved in cell death. n - butyrate is a short chain fatty acid produced by bacterial fermentation of fiber in the colon. the compound is a known differentiating agent and induces an epithelial phenotype in certain cultured cells. n - butyrate is a potent histone deacetylase (hdac) inhibitor as well and one of its differentiation - inducing properties stems from its ability to inhibit hdacs. the combination of two bioactive molecules influencing apoptosis via different mechanistic pathways may associate to render an apoptotic phenotype in cancerous cells and inhibit tumor formation and progression. the 2 mm dose of n - butyrate used in the wolter and stein study is probably much higher than what can be physiologically achieved. this dose is probably suitable for treatment of colon cancers where higher molar doses of n - butyrate are possible. however, n - butyrate is highly unstable, and its serum concentrations are lower than 2 mm. since this molecule is a differentiating agent, its clinical use in treatment of other cancers is relevant. however, such therapies require absolute lower effective doses and can probably be achieved by combining with molecules other than resveratrol or modifying the compound to specific conjugates to reach serum concentration levels. 5-fluorouracil inhibits thymidylate synthase, prevents dna proliferation, and induces dna damage - related apoptosis in colon cancer cells. phase i clinical trials using a combination of resveratrol and grape powder have shown that resveratrol at low doses inhibit wnt, a gene that is upregulated in colon cancers. taking advantage of therapeutic effects of nutraceuticals, combined therapy of aforementioned resveratrol with 5-fu surfaces as a principal strategy in treating colon cancers. when used in combination, the presumption is that either additive or synergistic effects of the two could mediate tumor inhibition by modulating their individual apoptotic effects. the concern in using resveratrol is that higher concentrations of the doses are required in the treatment which clinically may not be reached through dietary consumption. genistein and resveratrol as individual phytochemicals are very effective in the treatment and prevention of prostate cancer progression in rodent studies. poorly differentiated prostate cancers often fail to respond to androgen - dependent treatments, and alternate treatments are required. androgen receptors likewise have two functional roles, one as a tumor suppressor in normal prostate tissue and the other as an oncogene in neoplastic transformation, where it is altered either by mutations or dna damage. genistein and resveratrol used in an in vivo rat - based study, modeled to understand the mechanistic action of combined treatments in the progression of prostate cancer, showed that they had more pronounced effects, albeit not synergistic. the statistically significant additive functions of reducing cell proliferation through mechanisms that regulate the androgen receptor levels and igf-1, a biomarker found in patient serums with progressive and aggressive prostate cancers were achieved in combined therapies over the monotherapy regimes. the combination of genistein and resveratrol increased serum availability of both, but higher concentrations of resveratrol were achievable as compared to the single - dose regimen. perhaps, absorption and stability of resveratrol were profoundly affected in a combined environment, which is clinically a clear advantage. the doses used in the study are physiologically safe and achievable in vivo by consumption of a soy - based diet high in the percentage of genistein. however, resveratrol is found in low levels in grape - based dietary products, and, therefore ; a pure supplement of the compound is necessary in case that higher doses are required. previous studies have shown that egcg, a major polyphenol in green tea, can inhibit tumor growth through mechanisms that alter dna methylation activity, reversing the expression of silenced genes involved in tumor inhibition in cancer cells. hypomethylation of the promoters that are cpg - rich is more likely to be transcribed, with an exception of few like htert, the regulatory gene of telomerase [82, 116119 ]. epigenetics is a mechanism that has been studied for decades, and factors that regulate epigenetics are now believed to be very important as treatment possibilities in controlling tumors. dna methylation and histone deacetylation are well known epigenetic mechanisms that regulate many of the genes involved in cancers of various origins. genistein combined with sfn, an histone deacetylase inhibitor (hdaci) has been successful in inducing the transcription of genes involved in regulating cell cycle by reversing the hypermethylated states of their promoters. this change was observed at low doses and was enhanced in the presence of sulforaphane more than that when genistein was used alone. however, in vivo studies of the same are warranted to determine epigenetic behavior of the dietary compounds before applications to human treatments are considered. oddly, even though both are isothiocyanates, they exert their therapeutic effects by controlling different pathways involved in tumorigenic inhibition. stat3, a member of the stat group of transcriptional factors, is required for early development and is dispensable in adult tissues. however, there appears to be a correlation between the constitutive expression of stat3 and tumor development, indicative of its role as an oncogene. this gene appears to have important roles in cell proliferation, angiogenesis, and metastsis, a crucial requirement of tumor survival. both bitc and sulforaphane have cancer inhibitory effects, affecting independent cell signaling pathways. however, the sequential combination of the two has been shown to regulate the stat3 gene and others (table 4), thereby, inducing apoptosis. how dietary molecules are presented to the cells in vitro sequential addition of bitc to the cells after sulforaphane treatment was performed, which enhanced the reduction of stat3 levels ; however, simultaneous additions were not performed. simultaneous additions would be important for any combination study to determine possible synergistic, additive, or antagonistic effects between the compounds. preclinical studies should include various combinatorial interactions of the nutraceuticals being tested to determine the best way of using combined molecules in therapy. dietary foods are sometimes modified to produce carcinogens through metabolism by the action of phase i enzymes. subsequently, the action of phase ii enzymes rapidly metabolizes these products to more soluble forms that are eliminated as body waste. phase ii enzymes are more concentrated in the duodenum and small intestine and less available in the colon. increasing the availability of these enzymes in the colon can get rid of harmful carcinogens reducing the incidence of colon cancers, and, therefore, dietary supplements that induce phase ii enzymes would be promising tools for colon cancer prevention. sfn, an isothiocyanate, and apigenin, a flavanol, have independent cancer preventive functions. ugt1a1 is a major player in the detoxification process of carcinogens formed in the body and, therefore, is a potent phase ii enzyme. treating nondifferentiated colon cells with a combination of sfn and apigenin was found to synergistically induce the expression of ugt1a1 suggesting a possible dietary tool for colon cancer prevention. the in vitro dose of the individual compounds used in the study was at physiological safe levels and can be easily achieved in vivo. the importance of investigating the roles of dose combinations on chemopreventive or therapeutic functions has been well dissected in a study by pappa.. lower doses of sfn demonstrate antagonistic effects on cell proliferation and higher doses of both compounds had synergistic effects. synergism of compounds is preferred if the outcome is tumor regression, but in clinical treatments synergistic actions should be mediated at safe lower concentrations rather than at cytotoxic levels. presumably, the choice of compounds used, based on the genetic or cellular function required, is imperative to the success of the treatment. possibly, sfn can synergistically inhibit the proliferation of cancer cells with compounds other than dim at much lower doses, which has been investigated in studies using sfn with flavanols. this clearly highlights the problems of using combined therapies, especially since dosage is of critical importance for the success of clinical trials. when seeking for dietary molecules with potential chemoprotective and therapeutic properties, it is essential to understand how they mediate their combined action. based on mechanistic studies, only compounds that are able to achieve synergistic or additive inhibitory or inductive actions on cellular genes, pathways, and/or phenotypes can then be chosen for treatment, even though their individual actions may be more pronounced. patients with aberrant polyp crypt (apc) mutations are prone to spontaneously form aberrant polyps in their intestinal tissue, which later can transform to colorectal cancers. treatment with dmb found in licorice can effectively inhibit such mutations in apc, thereby protecting individuals from aberrant polyp formations. sfn has a myriad of chemopreventive functions as seen before in other studies and in various tissues. a combination of these two chemopreventive agents will have a profound impact on individuals that are at high - risk or reduce the incidence of colon cancers through dietary supplementation. the study by shen. showed that dietary intake of sfn and dmb negatively influenced the incidence and number of tumors formed in the apc mice. interestingly, the serum and plasma levels of sfn and dbm were lower in the combined doses than when the compounds were used individually. regardless of the low serum availability, the combination was able to mediate synergistic tumor inhibitory effects. this has important clinical significance as it is possible to achieve greater tumor toxic effects at low plasma concentrations. chemopreventive agents are much sought after as an early interventional approach to prevent tumor development or to lower the incidence risk of cancers. given that the current available methods of treatment are chemotherapy, radiation, and surgery, all of which can induce significant side effects, an urgent need for alternate or adjuvant therapies has arisen.. therefore, alternate medicine aims at harnessing the protective properties of these nonessential nutrients toward cancer prevention and treatment. a large database of studies supports the use of biomolecules in cancer treatment, albeit a majority of those are in vitro studies. regardless of limited in vivo studies and clinical trials, phytochemicals show great promise in cancer treatment considering their safe use. caution must be taken when addressing the efficacy of these molecules in clinical trials as many factors modulate their effects on cellular functions as detailed in table 5. combinatorial studies also show great promise, especially when lower nontoxic doses are required for prolonged periods to mediate potent chemotherapeutic functions with minimal side effects. two of the major problems currently faced are dosage and delivery. to maintain a constant physiological serum dose availability, it is imperative that the agent is concentrated and stable in the tissue of concern. nanotechnology is fast catching pace as the next level of technology in all spheres of science. limited in vitro studies have shown that encapsulating dietary supplements in nanoparticles can effectively deliver the supplement and increase its stability and availability. | the genesis of cancer is often a slow process and the risk of developing cancer increases with age. altering a diet that includes consumption of beneficial phytochemicals can influence the balance and availability of dietary chemopreventive agents. in chemopreventive approaches, foods containing chemicals that have anticancer properties can be supplemented in diets to prevent precancerous lesions from occurring. this necessitates further understanding of how phytochemicals can potently maintain healthy cells. fortunately there is a plethora of plant - based phytochemicals although few of them are well studied in terms of their application as cancer chemopreventive and therapeutic agents. in this analysis we will examine phytochemicals that have strong chemopreventive and therapeutic properties in vitro as well as the design and modification of these bioactive compounds for preclinical and clinical applications. the increasing potential of combinational approaches using more than one bioactive dietary compound in chemoprevention or cancer therapy will also be evaluated. many novel approaches to cancer prevention are on the horizon, several of which are showing great promise in saving lives in a cost - effective manner. |
since kalloo. introduced the transgastric abdominal approach using endoscopy in animal experiments in 2004, natural orifice transluminal endoscopic surgery (notes) has been attempted worldwide and has improved tremendously in a short time. notes which was reported only in animal experiments, started to be applied to humans in 2007. the strasburg group performed the hybrid method of a transvaginal endoscopic cholecystectomy using a 5-mm abdominal trocar successfully for the first time, and rao. in india did a video presentation of a transgastric appendectomy through the stomach. in korea, shin. did a video presentation of a hybrid transvaginal endoscopic appendectomy using a 5-mm abdominal trocar in 2007 for the first time. afterward, kim. reported a transgastric abdominal inspection by using the notes technique in an animal experiment, and lee. performed a notes appendectomy in gynecological patients by using only endoscopic instruments the ultimate goal of notes is to perform abdominal surgery, such as a cholecystectomy and an appendectomy, transorally through the stomach wall. if a complete notes could be performed, theoretically, since abdominal wounds would be absent, pain should be less than it would be for conventional surgical methods, esthetic effects would be superior, and patients could, thus, return to work eariler. nevertheless, notes has numerous limitations, such as a longer operation time due to technical difficulties and a shortage of proper equipment. in addition, in regard to closure of the perforation site within the natural orifice, an acceptable closure method is not yet present ; hence, the development of proper closure method should be pursued. currently, the posterior vaginal wall is available as a safe route, numerous surgeries, such as a gynecological transvaginal hysterectomy, have already been performed by using a transvaginal approach, and perforation areas could be safely closed with manual suturing. this is a report of a hybrid endoscopic appendectomy that was combined with a transvaginal approach using colonoscopy and an abdominal approach with a 5-mm working port. this study was approved by the ethics committee of soonchunhyang university (schbc - irb-07 - 24), and informed consent was obtained from the patient. a 74-year - old female patient was admitted via the outpatient clinic for abdominal pain in the right lower quadrant area that had persisted for two days. the patient had no specific medical illnesses and family history. based on history taking and physical examination, acute appendicitis was suspected ; thus, laboratory tests and abdominal ultrasonography were performed. on the blood test, leucocytes were increased to 12,000/mm, and other test results were within normal ranges. on the chest and the abdominal radiographs, there were no specific findings. on abdominal sonography, the appendix was thickened to 10 mm, thus confirming acute appendicitis. before surgery, the potential risks of the transvaginal approach, such as vaginal hemorrhage, infection, and dyspareunia, were explained sufficiently to the patient, and informed consents were taken after their approval. one hour prior to surgery, a second generation antibiotic was administered intravenously. under general anesthesia, a transverse 5-mm skin incision was made along the inferior margin of the umbilicus, and a 5-mm trocar was inserted. under co2-pneumoperitoneum, the surgeon moved to the patient 's perineal side (between legs) and made a 15-mm incision in the posterior vaginal wall and inserted a 15-mm trocar under laparoscopic vision. through the 15-mm trocar the monitor view was switched from the laparoscopic camera to the colonoscopic view, and the peritoneal cavity was assessed. after laparoscopic camera in the 5-mm abdominal trocar had been removed, an ultrasonic scalpel was inserted. the inflamed appendix in the right lower abdomen was examined using the colonoscope, and using endoscopic graspers, we dissected the appendix from the adjacent bowels by lifting the tip of the appendix (fig. the mesoappendix was dissected using the ultrasonic scalpels by coagulation modes, and hemostasis of the appendiceal artery was confirmed. 4) and moved to outside the abdomen, together with the colonoscope, through the tranvaginal trocar by using endoscopic graspers (fig. 5). after hemostasis had been confirmed, the perforation site in the posterior vaginal wall was sutured manually. the patient started to eat from one day after surgery and was discharged 3 days after surgery without wound infection, fever, pelvic pain, urinary difficulty or other specific complication. the vaginal wound dressing was done at 1 day after surgery, similar to the wound care after obstetrical gynecological surgery, and antibiotic suppositories were inserted for one week. at the ambulatory follow - up observation performed two weeks after discharge, the abdominal and vaginal wound had healed well, and the patient had no specific complaints. together with robotic surgeries, notes is considered to be the next - generation minimally - invasive surgery ; thus, numerous efforts in this area are being made in many countries. theoretically, if complete notes could be performed, an abdominal incision would be absent ; hence, from the aspect of cosmetics or complications, results better than those from previous laparotomy or laparoscopic surgery could be obtained, and shorter time to return to work would be possible. development of proper notes equipment will remove one of the present limitations of notes surgery do that it could be applied to more surgical fields. currently, several problems should be resolved for the further application of notes techniques to humans. the ultimate goal of notes is to perform intraabdominal surgery without abdominal incision through the stomach, colon or bladder. however, proper closure methods for the routes of organs after intraabdominal manipulation are not available. in animal experiments, successful closure using endoscopic clips has been reported ; nonetheless, experiences in humans are still not sufficient. park. attempted closure of the stomach wall using t - tags in humans. in their study, one case out of 2 developed severe complications, and they suggested that application of notes to humans still had many difficulties. presently, pure notes using an approach through the stomach, colon and bladder is not possible, and hybrid methods using one or two abdominal incisions in combination are widely used. second is an ethical problem. because of the limitation of an intraabdominal approach, a transvaginal route, which is applicable to only women, is preferred. however, controversy still exists from an ethical aspect. reviewing the result of a questionnaire survey conducted by sung. on women receiving a cholecystectomy, the percentage of women wanting to undergo a transvaginal approach was 38%, which is less than half. the results of a survey performed by strickland. on 300 women regarding the willingness to undergo the transvaginal approach notes show that approximately 70% of the women expressed a negative opinion. to resolve such ethical problems, the ethical committee, as well as the committee for clinical trials, of each hospital should consider notes carefully, and it should be performed after obtaining informed consents from the patient. in regard to our surgery, the institutional review board of our hospital recommends that patients of child - bearing age be excluded due to risk of infertility and that a hybrid notes, rather than pure notes, be performed due to the limitations on the closure methods. the surgeon of this study performed more than 500 laparoscopic surgeries. including laparoscopic colectomies, and had experience with more than 100 cases of colonoscopy, and 3 cases of notes in animal experiments. generally, bacteriostatic sterilization is sufficient for routine endoscopic purposes ; however, for intraperitoneal insertion, bacteriocidal sterilization is required. in our study, following the guideline suggested by the minimal access therapy decontamination working group, bacteriocidal sterilization was performed with ethylene oxide. in contrast to pure notes, which is a technique using only endoscopy without abdominal incisions, hybrid notes refers to a procedure inserting one or two trocars in the abdominal area and using laparoscopic equipment. presently, the safety of pure notes without the application of laparoscopic equipment has not been established yet ; thus, hybrid methods are best for applications to humans. in a hybrid transvaginal endoscopic appendectomy, the first step is to prepare the pneumoperitoneum. in the pure notes procedure, the pneumoperitoneum is generated by a perforation of the vaginal posterior wall, and in the hybrid method, a 5-mm trocar is inserted in the vicinity of the umbilicus. thus, if a trocar is used, the pneumoperitoneum and the perforation of the posterior vaginal wall can be performed safely. a limitation of the current endoscopic procedures is that the endoscopic equipment is not suitable for intraperitoneal surgeries. in regard to endoscopic forceps, the elasticity is high, and the hardness is low ; thus, it is difficult to retract the appendix. in addition, concerning the endoscopic loop ligatures, the safety of the ligation of the base of appendix has not been established. therefore, for time being, it is safe to use laparoscopic equipment such as laparoscopic loop ligatures. recently in europe, notes procedure equipment, such as the anubiscope, has been developed and is undergoing clinical trials. in the future, if such equipment is introduced, the indications for notes should be safely and readily expanded. | since kalloo and colleagues first reported the feasibility and safety of a peroral transgastric approach in the porcine model in 2004, various groups have reported more complex natural orifice transluminal endoscopic surgery (notes) procedures, such as the cholecystectomy, splenectomy and liver biopsy, in the porcine model. natural orifice access to the abdominal cavity, such as transgastric, transvesical, transcolonic, and transvaginal, has been described. although a novel, minimally invasive approach to the abdominal cavity is a peroral endoscopic transgastric approach, there are still some challenging issues, such as the risk of infection and leakage, and the method of gastric closure. hybrid - notes is an ideal first step in humans. human hybrid transvaginal access has been used for years by many surgeons for diagnostic and therapeutic purposes. here, we report a transvaginal flexible endoscopic appendectomy, with a 5-mm umbilical port using ultrasonic scissors in a 74-year - old woman with acute appendicitis. |
however, there is no conclusive definition regarding the most sensitive endpoint for the efficacy of -blockers in the treatment of chronic heart failure (chf). a meta - analysis published in 1998 included 18 published double - blind, placebo - controlled, parallel - group trials of -blockers in 3,023 patients with heart failure, which supported the therapeutic benefits of -blockers treatment on left ventricular ejection fraction, new york heart association (nyha) functional class, hospital stays and mortality rate (1). the -blockers showed the most significant effects on ejection fraction and on the combined risk of mortality and hospital stays in patients with heart failure. the ejection fraction was increased by -blockers by 29% (p 30 days and follow - up time period of > 3 months. any studies that recruited patients 9 weeks to 10 subjects with mild asthma. the dose escalation was performed on a weekly basis based on pre - determined safety lung function, asthma control, and hemodynamic parameters. the safety and effects of -blockers on airway hyper - responsiveness, and indices of respiratory function have been described (6). nadolol was effective in the cases of asthma. in 80% of tested patients, 9 weeks of treatment with nadolol resulted in a significant increase in pc20 in a dose - dependent manner, which reached 2.1-doubling doses at 40 mg (p0.05). these results were consistent with geographic region (usa versus rest of world) and ejection fraction subgroups. the subgroup analysis revealed that the beneficial survival effect of -blocker was limited to studies with subjects of mean age 18 years experiencing non - cardiac vascular surgery. the meta - analysis was carried out with a fixed - effect model with ors and 95% cis. the results from two double - blind, randomized controlled trials comparing perioperative effects of -blockers (metoprolol) with placebo, on cardiovascular outcomes in subjects experiencing major non - cardiac vascular surgery were analyzed. a total of 599 subjects were included to be treated with -blockers (301 subjects) or placebo (298 subjects). the outcomes were revealed only in a single study and neither of the studies reported on vascular patency / graft occlusion, which decreases the quality of evidence to moderate. there was no evidence to indicate that perioperative -adrenergic blockade reduced all - cause mortality, cardiovascular mortality, non - fatal mi, arrhythmia, heart failure, stroke, composite cardiovascular events or re - hospitalisation at 30 days. however, there was strong evidence that -adrenergic blockers increased the odds of intra - operative bradycardia (or, 4.97, 95% ci : 3.227.65 ; p 30 days and follow - up time period of > 3 months. any studies that recruited patients 9 weeks to 10 subjects with mild asthma. the dose escalation was performed on a weekly basis based on pre - determined safety lung function, asthma control, and hemodynamic parameters. the safety and effects of -blockers on airway hyper - responsiveness, and indices of respiratory function have been described (6). nadolol was effective in the cases of asthma. in 80% of tested patients, 9 weeks of treatment with nadolol resulted in a significant increase in pc20 in a dose - dependent manner, which reached 2.1-doubling doses at 40 mg (p0.05). these results were consistent with geographic region (usa versus rest of world) and ejection fraction subgroups. the subgroup analysis revealed that the beneficial survival effect of -blocker was limited to studies with subjects of mean age 18 years experiencing non - cardiac vascular surgery. the meta - analysis was carried out with a fixed - effect model with ors and 95% cis. the results from two double - blind, randomized controlled trials comparing perioperative effects of -blockers (metoprolol) with placebo, on cardiovascular outcomes in subjects experiencing major non - cardiac vascular surgery were analyzed. a total of 599 subjects were included to be treated with -blockers (301 subjects) or placebo (298 subjects). the outcomes were revealed only in a single study and neither of the studies reported on vascular patency / graft occlusion, which decreases the quality of evidence to moderate. there was no evidence to indicate that perioperative -adrenergic blockade reduced all - cause mortality, cardiovascular mortality, non - fatal mi, arrhythmia, heart failure, stroke, composite cardiovascular events or re - hospitalisation at 30 days. however, there was strong evidence that -adrenergic blockers increased the odds of intra - operative bradycardia (or, 4.97, 95% ci : 3.227.65 ; p 30 days and follow - up time period of > 3 months. any studies that recruited patients 9 weeks to 10 subjects with mild asthma. the dose escalation was performed on a weekly basis based on pre - determined safety lung function, asthma control, and hemodynamic parameters. the safety and effects of -blockers on airway hyper - responsiveness, and indices of respiratory function have been described (6). nadolol was effective in the cases of asthma. in 80% of tested patients, 9 weeks of treatment with nadolol resulted in a significant increase in pc20 in a dose - dependent manner, which reached 2.1-doubling doses at 40 mg (p0.05). these results were consistent with geographic region (usa versus rest of world) and ejection fraction subgroups. the subgroup analysis revealed that the beneficial survival effect of -blocker was limited to studies with subjects of mean age 18 years experiencing non - cardiac vascular surgery. the meta - analysis was carried out with a fixed - effect model with ors and 95% cis. the results from two double - blind, randomized controlled trials comparing perioperative effects of -blockers (metoprolol) with placebo, on cardiovascular outcomes in subjects experiencing major non - cardiac vascular surgery were analyzed. a total of 599 subjects were included to be treated with -blockers (301 subjects) or placebo (298 subjects). the outcomes were revealed only in a single study and neither of the studies reported on vascular patency / graft occlusion, which decreases the quality of evidence to moderate. there was no evidence to indicate that perioperative -adrenergic blockade reduced all - cause mortality, cardiovascular mortality, non - fatal mi, arrhythmia, heart failure, stroke, composite cardiovascular events or re - hospitalisation at 30 days. however, there was strong evidence that -adrenergic blockers increased the odds of intra - operative bradycardia (or, 4.97, 95% ci : 3.227.65 ; p<0.00001) and intra - operative hypotension (or, 1.84, 95% ci : 1.312.59 ; p=0.0005). the meta - analysis did not strongly support that perioperative -blockers improve postoperative cardiac morbidity and mortality in subjects experiencing major non - cardiac vascular surgery. however, -blockers provided some therapeutic benefits in patients with heart failure and reduced ejection fraction according to the recent network of meta - analysis. in conclusion, results of the meta - analysis studies have shown a marked decreased in the incidence of overall mortality, cardiovascular mortality, and sudden death by 3439%. -blockers reduced mortality in patients with ihd by 30%, which was not significantly different compared to non - ihd patients (26%) (p=0.08). the reduction in mortality was greater with vasodilating than with non - vasodilating agents (45 vs. 27% ; p=0.007), particularly in patients without ihd (62%), compared with those with ihd (22% ; p=0.03) (40). the -blockers with vasodilating effects demonstrated a better efficacy on reducing mortality than the non - vasodilating agents, especially in non - ihd patients. in a meta - analysis study, the results did not support that perioperative treatment with -blockers correlated with decreased postoperative cardiac morbidity and mortality in individuals experiencing major non - cardiac vascular surgery. the effects of -blockers on heart failure patients with impaired ejection fraction was primarily because of a class effect, since no statistics from present studies supported the advantage of any single agent over other agents. in summary, the findings of the meta - analyses have shown that -blockers preserved ejection fraction in heart failure patients. the effects for recurrent mi and angina in the reperfusion era can not last for long (only 30 days). | adrenergic -blockers are drugs that bind to, but do not activate -adrenergic receptors. instead they block the actions of -adrenergic agonists and are used for the treatment of various diseases such as cardiac arrhythmias, angina pectoris, myocardial infarction, hypertension, headache, migraines, stress, anxiety, prostate cancer, and heart failure. several meta - analysis studies have shown that -blockers improve the heart function and reduce the risks of cardiovascular events, rate of mortality, and sudden death through chronic heart failure (chf) of patients. the present study identified results from recent meta - analyses of -adrenergic blockers and their usefulness in chf. databases including medline / embase / cochrane central register of controlled trials (central), and pubmed were searched for the periods may, 1985 to march, 2011 and june, 2013 to august, 2015, and a number of studies identified. results of those studies showed that use of -blockers was associated with decreased sudden cardiac death in patients with heart failure. however, contradictory results have also been reported. the present meta - analysis aimed to determine the efficacy of -blockers on mortality and morbidity in patients with heart failure. the results showed that mortality was significantly reduced by -blocker treatment prior to the surgery of heart failure patients. the results from the meta - analysis studies showed that -blocker treatment in heart failure patients correlated with a significant decrease in long - term mortality, even in patients that meet one or more exclusion criteria of the merit - hf study. in summary, the findings of the current meta - analysis revealed beneficial effects different -blockers have on patients with heart failure or related heart disease. |
situs inversus is an uncommon condition caused by a single autosomal recessive gene of incomplete penetration. a potential diagnostic dilemma can occur in the young female patient with a history of situs inversus who presents with pelvic pain. a 32-year - old multiparous patient with a known history of situs inversus presented with complaints of pelvic pain. the patient underwent an operative laparoscopy, which revealed stage ii pelvic endometriosis based on the american fertility society revised classification for endometriosis (r - afs), with appendicular and periappendicular adhesions involving the cecum. the authors believe the laparoscopic approach to an appendectomy is ideal in a patient with situs inversus and should be performed at the time of laparoscopy performed for another reason. situs inversus (si) is an uncommon condition caused by a single autosomal recessive gene of incomplete penetration, which occurs in 1 in 5000 to 1 in 10 000 live births. a potential diagnostic dilemma can occur in the young female patient with a known history of si, who may present with pelvic pain. although the differential diagnosis of pelvic pain is quite extensive, in the patient with si, a correct preoperative diagnosis can be difficult to obtain, as the symptoms and signs are often misleading. about 50% of patients with left - sided appendicitis, for example, have pain on the right side. the appendix is usually located near the cecum in the left lower quadrant in si. although the viscera are transposed, the components of the nervous system are not, allowing the patient to experience diffuse abdominal pain. as a result, in addition to a thorough history, a physical examination, and imaging studies, laparoscopy provides the surgeon with pertinent information that can contribute to the optimal care of the patient. the authors report a case with a literature review, where a laparoscopic appendectomy was performed as part of the surgical treatment for pelvic pain due to endometriosis in a patient with si. a 32-year - old gravida 2 para 2 patient with a known history of si presented with complaints of pelvic pain. after thorough counseling, the patient underwent an operative laparoscopy for the evaluation of her pelvic pain. furthermore, appendicular and periappendicular adhesions involving the cecum were noted. the cecum and appendix were located on the left side and the sigmoid on the right. the liver showed the left pole on the right side of the abdomen, and the gallbladder was located on the left. primarily 2 different anatomic defects result in a left - sided appendix : situs inversus and, less commonly, malrotation of the midgut loop. during the first trimester of pregnancy, normal embryonic development of the abdominal viscera takes place. at approximately 6 weeks of gestation, the midgut herniates into the umbilical cord and returns at 10 weeks after the enlargement of the peritoneal cavity has taken place. normal developments require a 270 degree counterclockwise rotation, which yields in most cases, a right - sided appendix. si occurs when the rotation is 270 degrees clockwise as opposed to a counterclockwise rotation. this then results in the complete reversal of all abdominal, and possibly thoracic, viscera with a left - sided appendix. si is defined as a mirror - image transposition of the abdominal viscera, which occurs with an incidence of 1/5000 to 1/10 000 live births. situs inversus totalis, a complete inversion of both the thoracic and abdominal viscera, occurs in the general population with an incidence rate of 1/1400 to 1/35 000. appendicitis, including both right- and left - sided disease, occurs at an annual incidence of 1/1000. it has been stated that approximately 6% of the population will experience appendicitis in a lifetime. the first reported laparoscopic appendectomy performed on a patient (male) with si was in 1997 in italy, and a review of the literature reveals that this is the only case of laparoscopic appendectomy in a patient with this type of anatomic anomaly. to the authors ' best knowledge, ours is the first reported case of a laparoscopic appendectomy on a female patient with si. the authors propose a plausible explanation to the uncommon performance of the procedure at hand. in addition to the rare occurrence of si and the controversy surrounding incidental appendectomies in general, the infrequent performance of such procedures may also be partly due to the ongoing debate over the indications for laparoscopic versus open surgery for performing an appendectomy. the dispute may also be related to the surgical comfort level of the surgeon performing laparoscopic surgery. as stated earlier, in the patient with si, a correct preoperative diagnosis can be difficult to obtain, as the symptoms and signs are often misleading. the authors believe laparoscopy can offer significant diagnostic advantages for all patients, regardless of sex, when such anomalies are encountered. attention should not be restricted to the pelvic anatomy alone, but the entire abdomen should carefully be assessed. the authors believe that laparoscopy performed for pelvic pathology offers the opportunity not only to manage the primary problem, but to also remove the appendix to prevent any misdiagnoses, or complications resulting from delayed diagnoses, to occur in the future. the authors conclude that patients with a history of si should receive an appendectomy at the time of laparoscopy performed for another reason. appendicitis can mimic gynecologic pathology. forfeiting the opportunity to remove this vestigial organ at the time of surgery, especially in this type of anatomic defect, will only mean that such patients will be subjected to a potential diagnostic quandary in the future. removing the appendix eliminates any possibility of future misdiagnoses. it will also exclude the risks of complications that come with delayed diagnosis, such as an appendiceal rupture, which can cause infertility in the young female patient. the authors ' analysis of their recent data (unpublished) supports the notion that the appendix can be removed laparoscopically with virtually no complication or morbidity. another issue at hand is the operative approach to the patient with si presenting with an acute abdomen or pelvic pain. the authors concur with contini in that a diagnostic laparoscopy should be performed first in all such cases prior to performing any further procedures. the diagnostic scope will not only confirm or dispel the preoperative diagnosis, but it allows an appropriate surgical incision to be made if the surgery can not be performed laparoscopically. in conclusion, the authors believe the laparoscopic approach to an appendectomy is ideal in a patient with si and should be done prophylactically at the time of laparoscopy performed for any reason. | background : situs inversus is an uncommon condition caused by a single autosomal recessive gene of incomplete penetration. a potential diagnostic dilemma can occur in the young female patient with a history of situs inversus who presents with pelvic pain.methods:a 32-year - old multiparous patient with a known history of situs inversus presented with complaints of pelvic pain. a medical history and full physical examination were indicative of possible endometriosis.results:the patient underwent an operative laparoscopy, which revealed stage ii pelvic endometriosis based on the american fertility society revised classification for endometriosis (r - afs), with appendicular and periappendicular adhesions involving the cecum. ablation of endometriosis and an appendectomy were performed.conclusion:the authors believe the laparoscopic approach to an appendectomy is ideal in a patient with situs inversus and should be performed at the time of laparoscopy performed for another reason. |
protein glycosylation, which in eukaryotes occurs predominantly in endoplasmic reticulum (er) and the golgi apparatus, is the most prevalent and complex post - translational modification. it was originally believed that only eukaryotic membrane - bound or secreted proteins were glycosylated, however it is now known that this process occurs in a range of eukaryotic nuclear and cytoplasmic proteins, as well as in bacteria and archaea. the process of glycosylation covalently attaches a glycan, a reaction catalysed by glycosyltransferases, to the growing end of a carbohydrate chain on a nascent protein or lipid. these modifications play a crucial role in every aspect of biology including increasing protein solubility ; increasing structural stability and protection from proteolysis ; assistance in protein folding ; participation in immune responses ; cell cell and cell - extra cellular matrix (ecm) recognition ; and selective protein targeting in both intra- or extracellular destinations. glycosylation permits diversity of the proteome by encompassing a wide range of variables such as glycosidic linkages (anomeric configuration ; carbon / carbon linkage between sugars, n- or o - linked), composition, structure and length. in eukaryotes, before any of these glycosylation reactions can occur, the activated sugar must be transported into the golgi or er lumen where it can be used as a substrate by glycosyltransferases, a task performed by a family of transport proteins called nucleotide sugar transporters (nsts). cellular membranes, including those that enclose organelles, are biological barriers that selectively either allow, inhibit, restrict or dictate the rate of flow of a range of solutes such as charged organic or inorganic molecules. transporter proteins are an effective solution to the movement of selected solutes across these hydrophobic barriers that would otherwise be excluded. the slcs, which is a classification of human transporters, now include 52 families. with such a range of slc families, there are a wide variety of solutes that can be transported, from amino acids to sugars, to complex organic molecules. as such, slcs also contain different transport strategies and mechanisms to achieve their function, such as operating as antiporters, symporters or simple carriers. the solute carrier family slc35 (hugo gene nomenclature committee) comprises members of the evolutionary conserved family of human nsts. the solute carrier family slc35 of human nsts is divided into 7 subfamilies (slc35a - g), identified on the basis of sequence similarity (slc35e - g are orphan transporters, that is, their physiological functions are yet to be determined). each nst subfamily is then divided further to differentiate the type of substrate(s) that is / are transported (table 1). nsts are highly conserved type iii trans - membrane (tm) proteins that provide a link between the synthesis of nucleotide sugars (in the er, nucleus or cytosol), and the glycosylation process that occurs in the golgi or er lumen. it is well - established that nsts function as antiporters, exchanging cytosolic nucleotide sugar for the corresponding lumenal nucleotide monophosphate (fig. 1) [812 ]. that is, a constant level of nucleotide sugar is maintained in the golgi or er lumen through the equimolar exchange of nucleotide sugar with nucleotide monophosphate. the nst antiporter mechanism has been investigated in nsts reconstituted into proteoliposomes, yeast golgi vesicles, and directly in golgi fractions isolated from rat liver. studies using cst reconstituted into phosphatidylcholine proteoliposomes preloaded with cmp significantly stimulated the uptake of cmp - sialic acid in a phenomenon known as trans - stimulation. however, the ability of the cst (and other nsts) to translocate its corresponding nucleotide sugar in the presence and absence of the antiporter molecular (nucleotide monophosphate) has lead to the characterisation of this transport system as leaky. thirty years of nst research aimed at identification and biochemical characterisation has identified a number of features that are common to all currently known nsts (reviewed in), including:translocation of the entire nucleotide sugar;translocation is saturable ; temperature, concentration and time dependent with apparent km in the order of 110 m ; and is able to concentrate the nucleotide sugar within the lumen of the er or golgi;translocation is insensitive to the presence of atp and ionophores and are energised by the coupled translocation of the corresponding nucleoside monophosphate in the opposite direction (antiporter);translocation is competitively inhibited by the corresponding nucleoside mono- and diphosphate, but not by the free sugar;some nucleotide sugars are translocated exclusively into the golgi apparatus, some exclusively in the er, while others are translocated in both, including some being splice variant dependent. translocation of the entire nucleotide sugar ; translocation is saturable ; temperature, concentration and time dependent with apparent km in the order of 110 m ; and is able to concentrate the nucleotide sugar within the lumen of the er or golgi ; translocation is insensitive to the presence of atp and ionophores and are energised by the coupled translocation of the corresponding nucleoside monophosphate in the opposite direction (antiporter) ; translocation is competitively inhibited by the corresponding nucleoside mono- and diphosphate, but not by the free sugar ; some nucleotide sugars are translocated exclusively into the golgi apparatus, some exclusively in the er, while others are translocated in both, including some being splice variant dependent. the initial identification of a range of nsts was achieved through complementation analysis [31,3942 ]. subsequent characterisation of the majority of these nsts was with respect to their ability to translocate a single nucleotide sugar, and it was commonly accepted that nsts had absolute substrate specificities. more recently however, multi - substrate transporters of nucleotide sugars have been described in vitro (table 1). in caenorhabditis elegans for example all three of these have been shown to have multi - substrate specificity including that encoded by the gene zk896.9, which is capable of transporting udp - glucose (udp - glc), udp - galactose (udp - gal), udp - n - acetylglucosamine (udp - glcnac) and udp - n - acetylgalactosamine (udp - galnac). multi - substrate specificity may be partially explained by a common evolutionary ancestor, or alternatively recent studies have proposed that nst redundancy may be an evolutionary backup mechanism in case of nst impairment, deletion or mutation. although the amino acid sequence of a number of nsts from a range of species has been determined, this information however has not proven to be a good indicator of substrate specificity. for example, the mammalian cmp - sialic acid transporter (cst) and udp - gal transporter (ugt) are 43% identical, yet are only able to transport the corresponding nucleotide sugars (cmp - neu5ac and udp - gal, respectively), whereas the udp - glcnac transporter (ngt) from kluyveromyces lactis, which shares only 22% identity with the human ngt, has the same nucleotide sugar substrate. similarly, in vitro studies show that the transport of udp - glcnac in humans is maintained by 3 different nsts (slc35a3, slc35b4 and slc35d2) from 3 subfamilies that share very low amino acid identity (see table 1 and references therein). little is known regarding the exact structure of nsts due to the difficulty associated with crystallising membrane proteins. to date, no three - dimensional structure of any nst has been elucidated. what is known is based on computer predictions, mutagenesis experiments, epitope - tagging studies and evolutionary analysis. in general, nst membrane topology has been predicted to comprise between six to ten trans - membrane (tm) domains linked by hydrophilic loops on both sides of the golgi membrane. all nst topologies predicted to date suggest that the c- and n - termini are present on the cytosolic side [5153 ], corresponding to an even number of tm domains. a distinct exception to this classical nst topology is the aspergillus fumigatus udp - galactofuranose transporter which has 11 predicted tm domains. it has been shown that several golgi apparatus nsts such as those that transport udp - galnac, gdp - fuc, atp and paps appear as homodimers, whereas the gdp - man transporter (gmt) from leishmania donovani is presumed to be a hexamer in solution. as well as potential homo - oligomers being formed in the membrane, there are also reports describing interactions, or possible complexes being formed between nsts and glycosyltransferases. sprong. also concluded that the ceramide galactosyltransferase guarantees an adequate supply of udp - gal in the er lumen by retaining the ugt in a molecular complex. thus far the oligomeric state of a functional nst has not been conclusively determined. for readers interested in inverted membrane protein topologies and conformational dynamics of antiporters the cdna that encodes for the human udp - gal transporter (ugt) was first cloned and characterised by muira., in 1996, and was believed to have been the first mammalian nst cdna sequence described. detailed characterisation of the ugt was possible using the mutant cell lines mdck - rca, cho - lec8 and had-1. complementation of these ugt defective cell lines restored transport activity, and expression of recombinant ugt in mammalian and yeast cells confirmed its localisation and specificity. interestingly, two isoforms of gene encoding the ugt, ugt1 and ugt2 have been identified in humans. analyses of these human splice variants show that the only difference is confined to the proteins extreme c - termini. ugt1 is localised only in the golgi apparatus, whereas the ugt2 c - terminus contains a dilysine motif that is responsible for dual localisation in the golgi and er. a recent study concluded that although ugt2 is more abundant in nearly all mammalian tissues and cell lines tested, expression of both splice variants is important for glycosylation of proteins in mammalian cells. compared to several other well - characterised transporters, the udp - glcnac transporter (ngt) shows limited amino acid sequence identity to other ngts that transport the same substrate, in particular yeast and mammals. it has been proposed that the transport mechanisms of the ugt and ngt may be coupled. the overexpression of ngt in mdck - rca (madin - darby canine kidney - ricin resistant) and cho - lec8 mutant cells defective in ugt has been found to restore galactosylation of n - glycans. these cells lack udp - gal transport in the golgi apparatus and therefore are unable to add gal to glycans. although ngt overexpression restored udp - gal transport, it also resulted in the decrease of transport of its natural substrate udp - glcnac into the golgi. this data suggested that the biological function of both the ngt and ugt in galactosylation might be coupled. recent investigations into substrate specificity of the ugt have shown that the ugt / cst can function as a chimeric transporter, this is addressed in more detail later in this review. using co - immunoprecipitation analysis and flim - fret measurements on living cells, it was demonstrated that ngt and ugt form complexes when overexpressed in mdck - rca cells. this suggested that ngt / ugt complexes either mediate transport of both substrates (udp - gal and udp - glcnac) or alternatively these complexes just bring the ngt and ugt homodimers together. either way, the ability of ngt and ugt to interact with each other may be a regulation mechanism of n - glycan biosynthesis in the golgi by ensuring adequate supply of both natural substrates to their respective glycosyltransferases. it was concluded that the ngt and ugt function in glycosylation is combined via their mutual interaction. however, it must be stressed that these studies are based on overexpression of the ngt and ugt, and therefore may not truly reflect the physiological situation. interestingly, overexpression of certain receptors [7375 ] has been shown to create a brefeldin effect. brefeldin a (bfa) is a fungal metabolite that affects the molecular mechanisms regulating membrane traffic and organelle structure. treatment with bfa leads to a rapid accumulation of proteins in the er and a collapse of the golgi stacks. the result is that the golgi apparatus largely disappears leaving golgi proteins to intermix with those in the er. with overexpression of these particular proteins, the effects were phenotypically indistinguishable from those treated with the addition of bfa. more recently a number of cdgs have been identified due to slc35a2 (ugt) and slc35a3 (ngt) mutation, specifically slc35a2 has been implicated in early - onset epileptic encephalopathy and slc35a3 in autism. the gdp - fucose transporter (gft) regulates the fucosylation of glycans predominantly in the golgi. it was first identified using complementation cloning during investigations into the congenital disease of glycosylation - iic (cdgiic), now known as leukocyte adhesion deficiency ii (ladii). this disease is characterised by a lack of fucosylated glycoconjugates resulting in immunodeficiency and severe mental and growth retardation. interestingly, the gft shows a substantial level of amino acid conservation with both the cst and ugt however, even now, the elements essential for activity and localisation of the gft remain poorly understood. although overexpression of slc35c2 (a putative gft) also shows slight competition with the gft in the o - fucosylation of notch, gft is essential for the core fucosylation of n - glycans and optimal notch signalling in mammalian cells. as with all nsts, elucidating the structure function relationship remains elusive due to the lack of a crystal structure. studying the gft has had an added challenge due to the lack of an appropriate mutant cell line. recently, a novel chinese hamster ovary (cho) mutant (cho - gmt5) was established that harboured double genetic defects in both the cst and gft producing n - glycans deficient in both sialic acid (sia) and fucose (fuc). studies using this mutant found that the c - terminal tail of the gft was critical for its activity (fuc - binding lectin recognition) but not localisation to the golgi, in contrast to the murine cst and several other transporters. this latest cho - gmt5 study highlights several new structure / function relationships for this transporter. the gdp - mannose transporter (gmt) from l. donovani and saccharomyces cerevisiae was originally identified and characterised in 1997. in 2003 a novel human nucleotide sugar transporter gene, hfrc1, was cloned and characterised as being a multi - substrate specific nst homologous to drosophila melanogaster fringe connection, c. elegans sqv-7 and human ugtrel7. in yeast, the heterologous expression of hfrc1 revealed the multi - substrate transport of udp - glcnac, udp - glc and gdp - man. interestingly, and importantly, when expressed in mammalian cells, udp - glcnac and udp - glc were transported but gdp - man was not. hfrc1 was subsequently identified and characterised as a member of slc35d2 by the same group that had previously identified and characterised the murine and human slc35d1. the transporter encoded by hfrc1 is localised in the golgi apparatus and exhibits approximately 50% identity with the human slc35d1. it should be stressed that confirming gmt function in yeast is problematic as yeast possesses a high level of endogenous gdp - man transport that can potentially interfere with the detection of heterologous expressed gmt activity. the gmt is fundamentally essential for pathogens such as a. fumigatus whose cell wall is comprised predominantly of galactomannan, the main defence against the host immune system. the key role played by the gmt in the biosynthesis of the fungal galactomannan cell wall was recently highlighted by the absence of galactomannan synthesis following the targeted deletion of the gmt. this suggests that the gmt may be an attractive target for drug discovery, particularly given the lack of a human gmt activity. similarly, the protozoa leishmania is protected by a glycocalyx composed mainly of gal- and man - glycoconjugates. this protective coat is a virulence factor that shields the parasite from hostile environments and supports its development and method of invasion. as with the cell wall of a. fumigatus, interruption of the corresponding essential transporter gmt in l. donovani we have recently utilised a saturation transfer difference nmr spectroscopy (std nmr) approach to complement functional used assays to monitor the interaction of nucleotides and nucleotide sugars with the nsts present in isolated golgi - enriched fractions [9294 ]. std nmr is based on saturating the protein resonances with a cascade of selective pulses (on - resonance spectrum). if a ligand is in fast exchange with the protein - binding site then the saturation can be transferred to the binding ligand. ligand protons that are in closest contact with the protein will receive a higher degree of saturation than ligand protons that are more solvent exposed. a spectrum without any saturation (off - resonance spectrum) is simultaneously acquired and subtraction of the on - resonance spectrum and the off - resonance spectrum results in the final difference spectrum (std) showing only signals from binding ligands. additionally, protons in close proximity to the protein surface will show stronger std nmr signals compared to ligand protons that are solvent exposed. non - binding ligands will not show any std nmr signals at all. utilising our std nmr spectroscopy approach we directly investigated the binding of gdp - man, gdp, gmp and man to the golgi - enriched fractions isolated from aspergillus (and fig. 2). we showed through std nmr competition experiments that gdp binds tighter to the aspergillus gmt than gmp and gdp - man, with man binding only weakly. based on these experiments the relative importance / affinity of individual ligand moieties that bind the aspergillus gmt were summarised as follows ; gdp gmp gdp - man man. however, the observation that gdp binds the gmt with higher affinity than the natural substrates (gmp - man and gmp) can now be exploited in the design of novel gmt inhibitors. the cst is located exclusively in the golgi apparatus where it co - localises with st6gali in the medial and trans golgi, and translocates cmp - sialic acid (cmp - sia) from the cytosol into the golgi lumen in exchange for cmp in an antiporter mechanism (see fig. 1). chinese hamster ovary mutants of the complementation group lec2 (cho 6b2) express a strong reduction of sialylated glycoconjugates due to a defect in the cst. by expression cloning it was shown to encode a highly hydrophobic, multiple membrane spanning protein of 36.4 kda. using the same cloning strategy the cdna encoding the hamster cst was also isolated with the amino acid sequence showing a 95% identity with the mcst. related cdnas from human, s. cerevisiae, and c. elegans were also identified by homology searches of gene databases. expression of the murine cst in yeast was used to confirm the ability of the cloned cst to translocate cmp - sia. due to the fact that yeast does not express sia, it represented an ideal background free model to study the cst and to demonstrate that the cdna identified by complementation cloning encoded an active transporter and not just an accessory protein required for cmp - sia transport / translocation. subsequent to cloning and expression of the cst, independent groups began structure function relationship investigations. initially, the cst derived from five independent clones of the lec2 complementation group were analysed to determine the molecular defects leading to the inactivation of the cst. it was shown that the mutant cst mrna expression level was the same as that of the wild - type, and the mutant was also correctly targeted to the golgi apparatus. this indicated that the gly189glu mutation was directly responsible for the inactivation of cst transport activity. exchanging gly189 to ala did not affect transport, though gly189gln and gly189ile mutants resembled the inactivate gly189glu mutant (table 2 and supplementary data table a). this suggested that the insertion of a large amino acid at this position 189 rather than the charge associated with glu that rendered the cst inactive. the exchange gly189 to glu occurs in a region that is highly conserved in both the mammalian cst and ugt, as well as in schizosaccharomyces pombe and c. elegans, suggesting this region is essential for a functional transporter. subsequent to cloning and expression of the cst, independent groups began structure function relationship investigations. initially, the cst derived from five independent clones of the lec2 complementation group were analysed to determine the molecular defects leading to the inactivation of the cst. it was shown that the mutant cst mrna expression level was the same as that of the wild - type, and the mutant was also correctly targeted to the golgi apparatus. this indicated that the gly189glu mutation was directly responsible for the inactivation of cst transport activity. exchanging gly189 to ala did not affect transport, though gly189gln and gly189ile mutants resembled the inactivate gly189glu mutant (table 2 and supplementary data table a). this suggested that the insertion of a large amino acid at position 189 rather than the charge associated with glu rendered the cst inactive. the exchange gly189 to glu occurs in a region that is highly conserved in both the mammalian cst and ugt, as well as in schizosaccharomyces pombe and c. elegans, suggesting this region is essential for a functional transporter. (1999) predicted 10 tm domains with both the n- and c - terminals facing the cytosolic side of the golgi membrane (fig. this model was deduced by epitope - tagging studies, site - directed mutagenesis and hydrophobicity plots, and established that gly189 is one of 10 gly residues spread across four tm domains (tm 58) that were presumed to form a putative hydrophilic channel. the creation of eight double mutants exchanging each gly pair with ala and ile confirmed the importance of these gly residues (fig. 3 and table 2). briefly, recombinant human erythropoietin (epo) is a heavily glycosylated molecule and a simple analysis of the sialylation pattern using isoelectric focusing (ief) can identify any changes in these patterns. mar-11 cho cells lack a functional cst and these cells were used as the host to analyse the relative activities of different mutant transporters. using this assay system lim. (2008) concluded that there was a direct correlation between the increased steric hindrance associated with the exchange of gly with either ala or ile and the reduction of cst substrate translocation. the suggestion of a gly - rich hydrophilic channel or pore through which cmp - sia can pass is contradictory to the hypothesis that the cst is a simple solute carrier and to the concept of an antiporter mechanism. this was based on experimental evidence that the transporter has the ability to alternatively expose its cmp / cmp - sia binding site from either the cytosolic or luminal side of the golgi membrane. however, the two hypotheses can be reconciled in that the binding of cmp or cmp - sia to the cst may permit a conformational change that allows the formation of a gly - rich hydrophilic channel, enabling the selective translocation of the bound molecule. this unfortunately can only be conclusively demonstrated through the elucidation of the cst crystal structure. much of what we know regarding the cst (and ugt) structure function relationship comes from a series of elegant studies evaluating the function of an array of ugt / cst chimeric transporters in both lec2 and lec8 cho complementation groups. initial studies showed that substitution of cst helix 7 into the ugt chimera was enough to elicit cst activity, with the addition of helices 2 and/or 3 greatly enhancing the efficiency, suggesting that this chimeric cst / ugt now had the ability to recognise and transport both udp - gal and cmp - sia (table 2). more recently further analysis of ugt / cst chimeras has defined a sub - molecular region that is necessary for cmp - sia recognition. analysis of chimeras indicated that the val208gly217 stretch in the cst (located in the helix 7) was essential for cst activity. two of the amino acids located in this stretch, tyr214 and ser216 were subsequently identified by site - directed mutagenesis (both single and double mutants) to be important for cmp - sia recognition, with tyr214 found to be critical for substrate recognition (table 2). the authors postulated that hydrogen bond formation involving the hydroxyl side - chains of these two amino acids may make specific interaction with the sia moiety of the substrate. utilising std nmr spectroscopy we were able to confirm the importance of tyr214 in cmp - sia recognition, specifically that it is intimately involved in the recognition and binding to the sia moiety of cmp - sia. the generation of a tyr214ala cst mutant leads to the complete loss of std signals associated with sia, even though significant binding was observed to the cmp moiety. in addition to tyr214, we were also able to identify another cst mutant, lys65ala that leads to a significant reduction in cmp - sia recognition. the latter residue in particular was identified using a bio - informatic approach where a sequence alignment of the mouse and human ugt and seven evolutionary diverse csts (h. sapiens, mucaca mulatta, mus musculus, gallus gallus, xenopus laevis, takifugu rubripes, and danio rerio) was performed. as shown in supplementary fig. a, a number of structural elements including the 10 gly residues stretching tm 58 that have been implicated in the formation of a transporter channel, and gln101, leu136, and lys272 and residues in the human cst loop regions shown to be essential for transport activity appear not to confer substrate specificity as they are conserved in both the cst and ugt. however, ser216 and tyr214, independently identified by maggioni. and takeshima - futagami. as being important for cmp - sia recognition are highly conserved in evolutionary distant cst, but are not found in either the mouse or human ugt. a also reveals the presence of seven cys residues absolutely conserved in all csts that are not present in the ugt. three cys residues are present within the ugt, but their locations differ to those present in the cst sequence. to further explore the role of these cys residues in disulphide bond formation, a web - based disulphide bond prediction algorithm dianna of the seven cys residues in the cst six were predicted to form disulphide bonds, giving both intra- and inter - tmd connections. the cys putatively involved in disulphide bond formation are cys16cys49 (tmd1tmd2), cys127cys131 (tmd4tmd4) and cys152cys307 (tm5tm9) (highlighted in fig. we therefore explored how the disruption of two of these putative disulphide bonds in the cst (c16a and c152a, supplementary fig. however only cys16ala had any effect on cmp - sia binding as assessed by std nmr spectroscopy, this is despite the fact that alkylating and reducing agents completely abolished cst cmp - sia interaction. this is interesting in so far as sialyltransferases contain two to four invariant cys residues that are all involved in cmp - neu5ac substrate binding. these cys residues are indispensable to the structural and functional integrity of sialyltransferases, with complete loss of catalytic activity observed following the mutation of either invariant cys to ala or ser. however, unlike sialyltransferases where the mutation of single cys residues abolishes activity, it would appear that in the cst disruption of multiple cys is required to achieve a similar outcome. utilising std nmr spectroscopy we were able to confirm the importance of tyr214 in cmp - sia recognition, specifically that it is intimately involved in the recognition and binding to the sia moiety of cmp - sia. the generation of a tyr214ala cst mutant leads to the complete loss of std signals associated with sia, even though significant binding was observed to the cmp moiety. in addition to tyr214, we were also able to identify another cst mutant, lys65ala that leads to a significant reduction in cmp - sia recognition. the latter residue in particular was identified using a bio - informatic approach where a sequence alignment of the mouse and human ugt and seven evolutionary diverse csts (h. sapiens, mucaca mulatta, mus musculus, gallus gallus, xenopus laevis, takifugu rubripes, and danio rerio) was performed. as shown in supplementary fig. a, a number of structural elements including the 10 gly residues stretching tm 58 that have been implicated in the formation of a transporter channel, and gln101, leu136, and lys272 and residues in the human cst loop regions shown to be essential for transport activity appear not to confer substrate specificity as they are conserved in both the cst and ugt. as being important for cmp - sia recognition are highly conserved in evolutionary distant cst, but are not found in either the mouse or human ugt. a also reveals the presence of seven cys residues absolutely conserved in all csts that are not present in the ugt. three cys residues are present within the ugt, but their locations differ to those present in the cst sequence. to further explore the role of these cys residues in disulphide bond formation, a web - based disulphide bond prediction algorithm of the seven cys residues in the cst six were predicted to form disulphide bonds, giving both intra- and inter - tmd connections. the cys putatively involved in disulphide bond formation are cys16cys49 (tmd1tmd2), cys127cys131 (tmd4tmd4) and cys152cys307 (tm5tm9) (highlighted in fig. a2). of the three cys residues in the ugt none were predicted to be involved in disulphide bond formation. we therefore explored how the disruption of two of these putative disulphide bonds in the cst (c16a and c152a, supplementary fig. however only cys16ala had any effect on cmp - sia binding as assessed by std nmr spectroscopy, this is despite the fact that alkylating and reducing agents completely abolished cst cmp - sia interaction. this is interesting in so far as sialyltransferases contain two to four invariant cys residues that are all involved in cmp - neu5ac substrate binding. these cys residues are indispensable to the structural and functional integrity of sialyltransferases, with complete loss of catalytic activity observed following the mutation of either invariant cys to ala or ser. however, unlike sialyltransferases where the mutation of single cys residues abolishes activity, it would appear that in the cst disruption of multiple cys is required to achieve a similar outcome. in addition to the importance of specific tm domains in cst and ugt activities, the function of the cst hydrophilic loops through green fluorescent protein (gfp) insertion experiments has also been assessed. three distinct loops that congregate around tmd3 and tmd7, as well as several highly conserved amino acids were found to be crucial for the transport activity of both the cst and ugt (table 2 and highlighted in orange in fig. significant progress has been made over the past decade towards not only the elucidation of nst structure function relationship, but also better understanding the role of nsts in various disease states including cdgs and microbial pathogenesis (e.g. a. fumigatus and leishmania). these data have been generated using a multidisciplinary approach employing techniques ranging from site directed mutagenesis and complementation analyses to std nmr spectroscopy and transport assays. the studies covered in this review have provided a fundamental understanding of several important nsts. the continued use of multidisciplinary approaches towards understanding nst structure and function will provide further important advances in the field. however, only with the elucidation of the 3-dimensional structure of an nst will a full understanding of the structure function relationship of this important class of transporter be realised. cys residues predicted to form disulphide bonds between tmd1tmd2 (), tmd4tmd4 () and tmd5tmd9 (#) are indicated. tm 2, 3 and 7 are shaded grey, residues known to be involved in transport activity are boxed in black, and residues conserved in all studied csts boxed in red.supplementary table acst and cst / ugt chimeric mutations. cys residues predicted to form disulphide bonds between tmd1tmd2 (), tmd4tmd4 () and tmd5tmd9 (#) are indicated. tm 2, 3 and 7 are shaded grey, residues known to be involved in transport activity are boxed in black, and residues conserved in all studied csts boxed in red. | the proteomes of eukaryotes, bacteria and archaea are highly diverse due, in part, to the complex post - translational modification of protein glycosylation. the diversity of glycosylation in eukaryotes is reliant on nucleotide sugar transporters to translocate specific nucleotide sugars that are synthesised in the cytosol and nucleus, into the endoplasmic reticulum and golgi apparatus where glycosylation reactions occur. thirty years of research utilising multidisciplinary approaches has contributed to our current understanding of nst function and structure. in this review, the structure and function, with reference to various disease states, of several nsts including the udp - galactose, udp - n - acetylglucosamine, udp - n - acetylgalactosamine, gdp - fucose, udp - n - acetylglucosamine / udp - glucose / gdp - mannose and cmp - sialic acid transporters will be described. little is known regarding the exact structure of nsts due to difficulties associated with crystallising membrane proteins. to date, no three - dimensional structure of any nst has been elucidated. what is known is based on computer predictions, mutagenesis experiments, epitope - tagging studies, in - vitro assays and phylogenetic analysis. in this regard the best - characterised nst to date is the cmp - sialic acid transporter (cst). therefore in this review we will provide the current state - of - play with respect to the structure function relationship of the (cst). in particular we have summarised work performed by a number groups detailing the affect of various mutations on cst transport activity, efficiency, and substrate specificity. |
i had always been fascinated by how things are built, taking a brief interest in architecture, but a couple of weeks spent in labs oriented my choice to biology. at the end of my bachelor degree studies, i was extremely fortunate to be invited by susan gasser at the swiss institute for cancer research to join her lab for my diploma thesis after we met in her undergraduate cell cycle class. joining her lab was the first turning point of my as - yet nonexistent career. she was extremely present in her lab and taught all of us very high standards, and her excitement was highly communicative. she also showed me, through example, that one can be both a highly successful scientist and a mother. under her guidance, we showed an interplay between telomeres and dna double - stranded breaks in yeast, with the dna end - binding ku proteins localizing at and clustering at telomeres at the nuclear periphery but relocalizing to dna breaks upon dna damage (laroche. this study, which suggested that pools of ku proteins at telomeres can be released to scan the genome for dna strand breaks, raised my interest in the spatial organization of cellular functions and oriented my choice to further study this broad topic. during my undergraduate studies, of which i spent one year at the university of zurich, i had been captivated by courses taught by konrad basler and ernst hafen on drosophila development and pattern formation, and i thought this topic would be fun to study for my phd. although graduate programs are now becoming more common in europe, they did not really exist at the time, so i simply wrote to and interviewed with a number of labs whose research excited me. i decided to join the lab of daniel st johnston at the gurdon institute in cambridge. this happened at an extremely exciting time : the lab was full of fantastic phd students (most of whom now have their own labs), including my future husband, richard benton. it was also a turning point in drosophila research, with the genome having been just sequenced, allowing one to clone a gene in only a few months, rather than years. a postdoc, katia smith - litire, had initiated a clonal screen in the germ line for mutations affecting oocyte polarization, so together with another postdoc, vincent leclerc, we visually screened more than 5000 manually dissected fly ovaries (martin., 2003). this screen identified the drosophila homologue of the conserved tumor suppressor gene lkb1, and we went on to demonstrate that lkb1 has a general role in cell polarization (martin and st. because of lkb1 's well - established role in tumor suppression, our work also led to the proposal relatively novel at the time that loss of cell polarity may contribute to the formation of tumors. while doing my phd work, i realized that i liked to study patterning but became aware that i was more attracted to the cellular than the organismal level. i therefore took the somewhat unusual decision to start postdoctoral work on a simpler model organism, thus dispensing with the complexities of multicellularity. during my first ascb meeting in 2001, i had been struck by the beauty of individual microtubules probing the cellular space in fission yeast, as presented on an animated poster by fred chang. new york seemed like an exciting place and large enough for richard and me to find exciting positions. i therefore joined fred 's lab at columbia university, where i started delving into the cross - talk between microtubule and actin cytoskeletons. i discovered a physical link between proteins at the microtubule plus ends and a formin, which nucleates actin filaments, suggesting a mechanism by which microtubules may remodel actin structures (martin., 2005). i also studied the regulation of the formin for3, describing an unexpected dynamic retrograde behavior of for3 with actin cables (martin and chang, 2006) and showing, in collaboration with the group of pilar prez, that for3, like other formins, is regulated by an intramolecular autoinhibitory interaction (martin., 2007). fission yeast work was and remains beautiful for its apparent simplicity, although i have somewhat progressed from my enthusiastic, nave start, realizing things are sometimes more complex than they appear. the chance to start my own lab presented itself unexpectedly less than three years after i settled in manhattan. the center for integrative genomics at the university of lausanne was looking for potential applicants to a swiss national science foundation (snsf) program aimed at attracting scientists with swiss links back to switzerland to set up their own labs. i had met one faculty member, christian fankhauser, who suggested i come for interview, which resulted in my applying for and obtaining the snsf funding. in the meantime, my husband obtained a tenure - track assistant professorship position in the same department, so we moved to switzerland in the summer of 2007 with our newborn daughter. anyone who has started a lab knows that the early years are both thrilling and terrifying. luckily, having secured snsf funding before starting, i spent very little time on grant writing. i could instead concentrate on research and spent most of my time in the lab. during my stay in fred 's lab, while working with a phd student (padte., 2006), i had discovered a hint of an unexpected function of a polarity factor, the kinase pom1, in the cell cycle. fred gave me the freedom to pursue this in my own lab, which i turned into a project for myself and for an excellent technician, martine berthelot - grosjean. it turned out to be fascinating : we discovered that the pom1 kinase forms gradients from each end of the rod - shaped fission yeast cell that extend to the middle of the cell and negatively regulate a medially localized protein kinase, cdr2, itself an indirect activator of cdk1. as cells grow in length, less pom1 reaches the middle of the cell, thus relieving the negative regulation and promoting cdk1 activation. from this, we hypothesized a model for how fission yeast cells can perceive their own length and couple mitotic entry with attainment of a sufficient size. when i heard the same model presented by jamie moseley (then a postdoc in paul nurse 's lab) at the first conference i was invited to as an independent group leader ! jamie and i decided to openly communicate and, when both our papers were accepted back - to - back a few months later, i realized this was possibly the best friendly competition that had ever happened to me (martin and berthelot - grosjean, 2009 ; moseley., 2009). since then, i have obtained a tenured position in the neighboring microbiology department at the university of lausanne, and our son was born (both events occurred at nearly the same time). the lab has grown a lot, and i regret i do n't get to spend much time doing experiments anymore, but i still get just as excited about new results and enjoy immensely the intellectual stimulation that i receive from my students and postdocs. we have gone on to dissect the molecular mechanisms behind the formation of pom1 gradients (hachet., 2011), showing these gradients are nucleated by a local dephosphorylation event that reveals a lipid - binding domain and are shaped by autophosphorylation and lateral movements. we have also probed morphogenetic questions, showing that normal rod shapes are formed by the combined action of actin - based transport and exocyst - mediated vesicle tethering at cell poles (bendezu and martin, 2011), but that actin - based transport can be circumvented by rerouting vesicles along microtubules (lo presti and martin, 2011). some of our next, exciting questions are defining how these or other morphogenetic pathways are regulated when cells exit their normal rod shape and grow toward mating partners during sexual differentiation. it is only recently, on coming back to switzerland to start my lab, that i became acutely aware of women 's issues, simply because there are very few women here. in my faculty, currently less than 10% of tenured professors are women, and this is not an exception among similar faculties in switzerland. let me finish with a simple message drawn from my experience and addressed especially to young women considering a research career : first, do what interests you your enthusiasm and curiosity will take you a long way. finally, with the help of a supportive partner, career and family are not mutually exclusive, and if both require adjustments, they also complement each other by bringing (dynamic) balance to one 's life ! | i am tremendously honored to receive the 2012 women in cell biology junior award. in this essay, i recount my career path over the past 15 years. although many details are specific to my own experiences, i hope that some generalizations can be made to encourage more women to pursue independent scientific careers. mine is a story of choosing a captivating question, making the most of your opportunities, and finding a balance with life outside the lab. |
as part of the clinical work - up, the patient underwent an abdominal computed tomography, which demonstrated colonic distension and small bowel ileus with focal narrowing and obstruction of the transverse colon (fig. mechanical obstructive ileus was suspected, and a colonoscopy revealed luminal erosion and stricture of the transverse colon. microscopic examination of multiple blind biopsies showed erosion and vascular congestion with no evidence of malignancy. a whole body scan to evaluate the patient was diagnosed with colonic malignancy, and right hemicolectomy was performed. on gross examination, the resected specimen displayed infiltrative submucosal lesions that involved the whole circumference and resulted in colonic stricture (fig. histologically, the colonic mucosa was intact except for focal erosion, and the muscular layer was markedly hypertrophied at the stricture site. further microscopic examination revealed that a benign glandular structure of gastric origin invaded the erosive colonic mucosa. these glands showed a downward growth pattern toward the submucosa and the muscular layer, gastric differentiation, and focal cystic dilatation (fig. additionally, we identified an adenocarcinoma that originated in the heterotopic gastric glands in the submucosa and muscular layers. the adenocarcinoma foci were composed of glands as well as isolated tumor cells and clusters with focal mucin production and were moderately to poorly differentiated (fig. immunohistochemically, both the heterotopic glands and adenocarcinoma showed positive results for cytokeratin (ck) 7 and muc5ac and were negative for ck20, cdx2, and muc2 (figs. 2, 3). on the basis of these findings, heterotopic gastric mucosa in the transverse colon and development of invasive adenocarcinoma were diagnosed and staged at pt3, pn1b (2/43), pmx according to the 7th edition of the cancer staging manual of the american joint committee on cancer. heterotopic gastric mucosa has been identified throughout the gastrointestinal tract, more commonly in the cervical esophagus, duodenum, or meckel 's diverticulum.5,6 although the etiology of gastric heterotopia is still unknown, it has been hypothesized that it could be either developmental or acquired. depending on the location, three mechanisms have been suggested for the development of heterotopic gastric mucosa. one possibility is that remnant tissue could remain in the distal esophageal portion of the gut during the developmental descent of the stomach. although this mechanism could explain gastric heterotopia of the esophagus, it can not explain heterotopic gastric mucosa in more distal intestinal tracts.1 it has also been proposed that the condition may be acquired and is the result of an abnormal regenerative process following the destruction of normal intestinal mucosa. however, this theory is not supported by any descriptions of gastric heterotopia following destruction of gastrointestinal mucosa due to gastroenteritis or other inflammatory conditions.4 the third and most plausible hypothesis is that heterotopic gastric mucosa is the result of abnormal differentiation of local tissues. pluripotent primitive endoderm stem cells have the ability to differentiate into all cell types of the gastrointestinal epithelium. an error in differentiation could lead to the gastric mucosa being present anywhere throughout the gastrointestinal tract.1,4 gastric heterotopia in the large bowel is fairy infrequent, and most cases have been reported in the rectum. review of the literature has revealed only eight such cases, including the present one, involving the colon proximal to the rectum.1 - 3 the risk and possibility of malignant transformation of heterotopic gastric mucosa have not been properly evaluated, although malignant change of heterotopic gastric mucosa has been reported for the esophagus, gallbladder, and adenomyosis of the stomach.4,6 we found only one report describing an association between gastric heterotopia in the colon and a premalignant tubulovillous adenoma.2 moreover, two case reports of adenocarcinoma in the small bowel arising from heterotopic gas tric mucosa were published.6,7 one case described multifocal gastric heterotopia with gastritis cystic profunda in the ileum and an adenocarcinoma in one of the lesions.6 the other case documented jejunal adenocarcinoma in heterotopic gastric mucosa with variable grades of dysplasia.7 in our case, features of both benign glandular structure with cystic dilatation and adenocarcinoma in the colonic wall were observed, raising the question of whether the adenocarcinoma was of gastric or intestinal origin. the observation that the cystically dilated glands and adenocarcinoma were ck7+/ck20-/cdx2-/muc5ac+/muc2- whereas the adjacent colonic mucosa was ck7-/ck20+/cdx2+/muc5ac-/muc2 + indicated that the heterotopic glands and carcinoma were of gastric origin. as mentioned previously, the risk of malignant transformation of heterotopic gastric mucosa is unknown. moreover, no case reports have described the malignant transformation of heterotopic gastric mucosa of the colon. sauer.4 proposed that the number of cases of gastric heterotopia that undergo malignant change may be underestimated because once the tumor grows, it obliterates the minute focus of heterotopic gastric mucosa. in conclusion, we report the first case of colonic adenocarcinoma arising from gastric heterotopia. our findings suggest that heterotopic gastric mucosa of the colon has the potential of undergoing malignant transformation. | heterotopic gastric mucosa occurs in all areas of the gastrointestinal tract including the nasopharynx, tongue, esophagus, small intestine, colon, and rectum. gastric heterotopia of the large bowel is infrequent, and most cases have been reported in the rectum. review of the literature has revealed only eight cases involving the colon proximal to the rectum. little is known of the natural history of gastric heterotopias, except that. it usually presents with gastrointestinal bleeding, though other serious complications such as bowel perforation, intussusceptions, and fistula formation, are possible. further, it is unclear whether heterotopic gastric mucosa progresses to malignancy. herein, we describe a case of adenocarcinoma of the transverse colon arising from gastric heterotopia. to the best of our knowledge, this is the first report of adenocarcinoma arising from heterotopic gastric mucosa in the colon. |
tropical theileriosis is a tick - borne disease caused by the protozoan parasite theileria annulata and is transmitted by the tick vector hyalomma anatolicum [1, 2 ]. this disease is a major constraint on livestock production in areas at risk of the infection. early and accurate diagnosis of the disease is crucial for the control of the infection. during the acute phase of the infection, when the level of parasitemia is high, it is easier to diagnose the infection by microscopical examination of giemsa - stained thin blood smear, which is the most common traditional method for diagnosis of blood parasites. however, serological assays are more suitable for the diagnosis of the disease during the chronic phase of the infection, where the animals serve as carriers. these animals have higher antibody titers, while the level of parasitemia is low and microscopically hardly undetectable. the present study aims at evaluating the reliability of the commercial elisa kit depending on its sensitivity and specificity in the diagnosis of theileria annulata infection in naturally infected cattle. the present study was conducted on 468 cattle samples which were collected from different localities in al - wadi al - jadid governorate, egypt. two whole blood samples were collected from the jugular vein using vacutainer tubes, one without anticoagulant for serum preparation and the other one containing ethylene diamine tetra acetic acid (edta) as anticoagulant for dna extraction. three thin blood smears from each animal were examined for confirmation of the infection through detection of intraerythrocytic piroplasms. serological diagnosis was carried out using svanovir theileria annulata - ab (boehringer ingelheim svanova, uppsala, sweden ; the kit is not yet released to the market) that utilizes a recombinant theileria annulata surface protein (tasp) antigen and as recommended by the manufacturer. measurement of the optical density (od) at 450 nm was carried out using multiscan spectrum (thermo electron corporation, finland) elisa reader. results were presented as percent positivity (pp) that were calculated as the mean od values of duplicate tested samples divided by the mean od values of the positive control and multiplied by 100. the cut - off was set at 46 pp with specificity and sensitivity of 100% by using medcalc software bvba, belgium. dna extraction from whole blood was carried out according to the manufacturer 's instructions of the commercial kits (qia amp blood kit, qiagen, ltd, uk, cat. dna amplification by using tams-1 primer for the standard pcr, primer tams-1 f (5atg ctg caa atg agg at) and tspms1 r (5gga ctg atg aga aga cga tga g), to amplify 785 bp fragment of the theileria annulata 30 kda major merozoite surface antigen gene. the specific bands were detected by high performance ultraviolet trans - illuminator, (uv, inc, uk) and the image of the pcr products containing the dna sequence of 785 bp was visualized using doc - itls, image acquisition software (uvp, inc, uk). molecular techniques are considered as the most sensitive and specific diagnostic assays for the diagnosis of theileria annulata infection [4, 6, 8 ]. accordingly, tams-1 pcr was used as a reference test to evaluate the reliability of the svanovir theileria annulata - ab under field conditions (figure 2). for comparison, samples were also analyzed with giemsa blood smear (figure 1). tabidi. and salih. have previously reported poor sensitivity using conventional methods. moreover, problems regarding cross - reaction between theileria species were also recorded. in order to avoid cross - reactions in the svanovir theileria annulata - ab, the tasp protein used as antigen in the present study no cross - reactions were found using the tasp recombinant protein in elisa analyzing anti - babesia sera or sera from animals experimentally infected with theileria mutans and theileria parva. [11, 12 ]. no cross - reactivity was recorded when ta - lfd test was performed examining sera from animals experimentally infected with babesia bovis, babesia bigemina, trypanosoma brucei, anaplasma marginale, theileria mutans, and theileria parva as well as serum from an animal testing positive in an elisa for detection of infection with theileria lestoquardi. interestingly, none of the serum samples of theileria annulata - negative control animals could be positively tested. moreover, the svanovir theileria annulata - ab was validated against monospecific sera to trypanosoma brucei, anaplasma marginale, babesia bovis, babesia bigemina, and theileria parva. antibodies to these pathogens were not detected in the elisa (data not shown). the results of our study confirm a similar pattern where the tams-1 pcr confirmed theileria annulata infection in 343 out of 468 samples (73.29%). the svanovir theileria annulata - ab scored 340 out of the 468 samples as positive (72.65%) while the giemsa - stained blood smear only confirmed 145 positive cases (30.98%). the tams-1 pcr revealed 125 samples as negative. in the svanovir theileria annulata - ab 128 samples turned to be negative, while the giemsa - stained blood smear scored as many as 323 negative samples (table 1). in comparison 313 of the 343 tams-1 pcr positive samples turned positive in the svanovir theileria annulata - ab while 98 of the 125 pcr negative samples became elisa negative the svanovir theileria annulata - ab scored 27 samples false positive and 30 samples false negative in comparison to the tams-1 pcr giving a sensitivity of 91.25% and a specificity of 78.4%. the giemsa blood smear, on the other hand, missed more than half of the tams-1 pcr positive samples, giving a sensitivity of 42.27%, while all 125 pcr negative samples scored correctly negative (specificity 100%) (table 3). considering the fact that pcr detects very small amount of dna although the elisa shows a lower specificity (78.4%) compared to the blood smear (100%), it shows a better correlation to the pcr. in the elisa 57 samples obtained a different status while in the blood smear as many as 198 samples scored incorrectly in comparison to the pcr. the elisa is therefore considered as an excellent tool in detecting theileria annulata antibodies, especially in chronic and carrier animals. during the acute phase of the disease it is recommended to use another assay since the elisa is unlikely to detect antibodies during the first week of infection. our results confirmed that the thin blood smear is a specific but moderately sensitive diagnostic test (table 2). although it is a cheap, easy, and fast test, it is limited for detection of the acute infection, when the level of parasitemia is high enough to be detected microscopically. these findings are in agreement with previous results obtained by [10, 14 ]. predictive values usually give an indication about the accuracy of a result in an assay. the positive predicted value (ppv) scores the probability that the disease is present when the test is positive while the negative predictive value (npv) scores the probability that the disease is not present when obtaining a negative test result. svanovir theileria annulata - ab revealed a relatively high ppv, (92%), and as expected did also the giemsa blood smear, 100% (table 3). these findings indicate that during further investigations the svanovir theileria annulata - ab has the ability to correctly identify true positive cases as being positive. the npv of svanovir theileria annulata - ab was (76.56%) and is considered relatively high as compared to 38.70% for the thin blood smear. these results clearly indicate that the svanovir theileria annulata - ab has a much higher ability to detect true negative cases compared to thin blood smear. the combined predictive values were 87.82% and 57.69% for the svanovir theileria annulata - ab and the giemsa - stained blood smear, respectively. the svanovir theileria annulata - ab is an excellent tool for detection of antibodies to the parasite in chronic and carrier animals. microscopic examination of giemsa - stained thin blood smear is helpful in day - to - day examination during acute infection, making quick decisions and confirming the infection. this important information is crucial for decision makers to start with a control program or not. the svanovir theileria annulata - ab is highly recommended for epidemiological studies of tropical theileriosis in cattle, especially to detect chronic and carrier cases. | the present study assesses the efficacy of svanovir theileria annulata - ab, the first commercial elisa kit for the diagnosis of theileria annulata infection in cattle based on a recombinant protein known as t. annulata surface protein (tasp). as a reference test, a polymerase chain reaction (pcr) assay depending on t. annulata merozoite surface antigen (tams-1) was applied. a total of 468 blood samples as well as serum samples were randomly collected from cattle and tested in the pcr as well as in the elisa developed in this study. moreover, all samples were also analyzed by conventional giemsa - stained blood smear. the results of this study revealed a good correlation between the results obtained by pcr and the elisa, whereas all pcr positive samples scored correctly positive in the elisa and 73 of the 125 pcr negative samples scored correctly negative. taken together, a sensitivity of 91.25% and a specificity of 78.4% were recorded, when compared to the pcr data. in conclusion, the svanovir theileria annulata - ab is a suitable diagnostic assay for use in the diagnosis and epidemiological surveys of theileria annulata infection in chronic and carrier animals. |
chloroform is a known contaminant of chlorinated drinking water and of swimming pool water disinfected with chlorine or one of its derivatives. few data exist regarding the importance of dermal and inhalation exposure routes to the chloroform body burden resulting from domestic and recreational use of chlorinated water. in our experimental study involving 11 male swimmers, we quantified the body burden resulting from exposure to various concentrations of chloroform in water and air of an indoor swimming pool, during a daily 55-min exercise period. from the first to the sixth exercise period, chcl3 mean concentration in water was increased from 159 micrograms / l to 553 micrograms / l. corresponding mean air chcl3 level ranged from 597 ppb to 1630 ppb. to dissociate the dermal exposure route from that of inhalation, swimmers used scuba tanks during an additional exercise period. chloroform concentrations were measured in alveolar air before and after each exercise period, as well as after 35 min of physical activity. chloroform levels in water and air were measured every 10 min. we examined the relationship between alveolar air concentration (a measure of body burden) at 35 and 55 min and environmental chloroform concentrations by using multiple regression models. the natural logarithm of alveolar air concentration was strongly correlated with aqueous chloroform concentration both at 35 (p2 < 0.001, r2 = 0.75) and 55 min (p < 0.001, r2 = 0.86). the relationship with air concentrations was also statistically significant (35 min : p < 0.001, r2 = 0.58, 55 min : p < 0.001, r2 = 0.63).(abstract truncated at 250 words)imagesfigure 1.figure 2. afigure 2. bfigure 3. afigure 3. b |
|
mild cognitive impairment (mci) and alzheimer s disease (ad) are accompanied by a number of neuropsychiatric symptoms, as well as cognitive decline. among the neuropsychiatric symptoms, apathy is the most frequent symptom, independent of ad severity.1 apathy is also prevalent in subjects with mci,2,3 occurring in more than a third of individuals.3 apathy is defined as a syndrome with diminished motivation, initiative and interest, and blunting of emotions.4 several prior works reported that apathy was associated with progression to ad in amnestic mci (amci) individuals,5 executive dysfunction and impairment of activities of daily living.68 to date, previous studies attempted to explore the neural substrates of apathy in ad. studies using different modalities including structural magnetic resonance imaging (mri), positron emission tomography (pet) and single photon emission computed tomography (spect) have shown associations among apathy and cortical thinning, white matter integrity change, hypometabolism and hypoperfusion in the orbitofrontal, anterior cingulate and inferior temporal areas in the brains of ad patients.915 additionally, several studies showed that the presence of white matter lesions was associated with apathy in amci patients.16,17 although strong evidence indicates that apathy is correlated with these specific brain damages that might affect disconnection of the cortico - subcortical network, the direct effects of apathy on the functional connectivity (fc) of the brain remain unclear. resting - state functional mri (rs - fmri) has recently been highlighted as a new technique for investigating functional intrinsic connectivity networks (icns) without an experimentally determined context in patients with dementia.18 functional brain network models are useful to understand the pathophysiology because they consider how neural systems are distributed across the entire brain instead of a specific brain area.19 to the best of our knowledge, only one study on subjects with mci has been performed to investigate the relationship between apathy and icns.20 this study assessed four different brain networks : the fronto - parietal control network (fpcn ; aka central executive network [cen ]), default mode network (dmn), ventral attention network (aka salience network [sn ]) and dorsal attention network (dan), using the neuropsychiatric inventory. the results of the study showed a significant association between increased affective symptoms, in particular, apathy and reduced rs fpcn connectivity. however, they could not show association between apathy and other networks such as the dmn or sn. this might be due to lack of normal distribution of lower apathy score (mean sd ; 0.31.0) of the study participants. moreover, as the study only investigated associations between the mean fc of the resting - state network (rsn) and apathy score, it was hard to find out more sophisticated voxel - wise regional fc changes within the large - scale functional networks (dmn, sn, and fpcn) due to apathy of amci subjects. to overcome the limitations of the previous study, we investigated the distinctive patterns of association between apathy severity and the whole - brain voxel - wise fc of the three large - scale icns (dmn, sn and cen) in amci subjects with clinically significant apathetic symptom. based on the literature cited, we conceptualized the apathy in amci as the behavioral expression of an abnormal rs fc of the brain and hypothesized that apathetic subjects would exhibit aberrant fc changes in the three icns. they were recruited through the outpatient geriatric psychiatry clinic of st vincent s hospital from january 2013 to february 2015. patients with amci met the petersen s criteria:21 1) memory complaint, preferably corroborated by an informant ; 2) objective memory impairment for age, education, and gender ; 3) essentially preserved general cognitive function ; 4) largely intact activities of daily living ; and 5) not demented. objective memory impairment was defined as a performance score of 1.5 sd below the respective age-, education- and gender - specific normative means in at least one of the four episodic memory tests included in the korean version of consortium to establish a registry for alzheimer s disease (cerad - k) neuropsychological battery, namely the word list memory(wlm), word list recall (wlr), word list recognition (wlrc), and constructional recall (cr) tests.23 the severity of apathy was assessed using the apathy inventory (ia),24 that is based on the neuropsychiatric inventory model.25 patients who had a score of 4 or more on the total ia scale with clinically significant apathy were included in the amci group.24 study participants who had other neurological or psychiatric conditions were excluded. fifty healthy control (con) subjects were recruited within the community through advertisement in a local newspaper. con subjects were matched to the patients on age, handedness, and level of education. the study was approved and conducted in accordance with the ethical and safety guidelines set forth by the local institutional review board of the catholic university of korea. written informed consent was obtained from all participants. imaging data were collected at the department of radiology, st vincent s hospital, the catholic university of korea, using a 3 t siemens verio machine and eight - channel siemens head coil. the parameters of t1-weighted volumetric magnetization - prepared rapid gradient echo scan sequences were te = 2.5 ms, tr = 1,900 ms, inversion time = 900 ms, fov = 250 mm, matrix = 256256, and voxel size = 1.01.01.0 mm. rs functional images were collected using a t2 weighting gradient echo sequence with tr = 2,490 ms, te = 30 ms, matrix = 12812829, and voxel size = 223 mm. keep your eyes closed and think of nothing in particular. in this study, we used a seed - to - voxel analysis method for evaluation of effect of apathy on fc of three icns. we produced individual subject seed - to - voxel connectivity maps using the conn - fmri functional connectivity toolbox v1.5 (http://www.nitrc.org/projects/conn). slice time correction, realignment, normalization, and spatial smoothing were performed for preprocessing of images with a 6 mm kernel, and the images were temporally band - pass filtered (0.009 < f < 0.08 hz). a component - based noise correction method was used to remove physiological and other noise artifacts.26 these methods involved extraction of the signals from white matter and cerebrospinal fluid regions with movement - related covariates. the seed region of interests (rois) consisting of spheres 6 mm in radius centered on montreal neurological institute (mni) coordinates (montreal, qc, canada) were used to identify the corresponding networks in prior studies. each rsn and its corresponding seed roi (in mni coordinates) are as follows : dmn (posterior cingulate cortex : 1, 55, 17), cen (left and right dorsolateral cortex : 42, 34, 20/44, 36, 20), and sn (left and right frontoinsular cortex : 32, 26, 14/38, 22, 10). for each subject, the average blood oxygen level - dependent time course of each seed was extracted from the functional echo planar images, and then it was correlated with the time courses of whole - brain voxels, using pearson correlation analysis. fisher s r - to - z transformation of correlation coefficients was conducted for general linear model (glm) analysis. in the second - level analysis, connectivity maps from all participants were entered into glm, that was used for measuring the group differences of the fc for each icn with age, gender, and education as nuisance variables. to examine the relationships between apathy severity and fc of the icns in the amci group, the total ia scores were correlated with fcs of the dmn, the sn, and the cen using the glm. they were recruited through the outpatient geriatric psychiatry clinic of st vincent s hospital from january 2013 to february 2015. patients with amci met the petersen s criteria:21 1) memory complaint, preferably corroborated by an informant ; 2) objective memory impairment for age, education, and gender ; 3) essentially preserved general cognitive function ; 4) largely intact activities of daily living ; and 5) not demented. objective memory impairment was defined as a performance score of 1.5 sd below the respective age-, education- and gender - specific normative means in at least one of the four episodic memory tests included in the korean version of consortium to establish a registry for alzheimer s disease (cerad - k) neuropsychological battery, namely the word list memory(wlm), word list recall (wlr), word list recognition (wlrc), and constructional recall (cr) tests.23 the severity of apathy was assessed using the apathy inventory (ia),24 that is based on the neuropsychiatric inventory model.25 patients who had a score of 4 or more on the total ia scale with clinically significant apathy were included in the amci group.24 study participants who had other neurological or psychiatric conditions were excluded. fifty healthy control (con) subjects were recruited within the community through advertisement in a local newspaper. con subjects were matched to the patients on age, handedness, and level of education. the study was approved and conducted in accordance with the ethical and safety guidelines set forth by the local institutional review board of the catholic university of korea. written informed consent was obtained from all participants. imaging data were collected at the department of radiology, st vincent s hospital, the catholic university of korea, using a 3 t siemens verio machine and eight - channel siemens head coil. the parameters of t1-weighted volumetric magnetization - prepared rapid gradient echo scan sequences were te = 2.5 ms, tr = 1,900 ms, inversion time = 900 ms, fov = 250 mm, matrix = 256256, and voxel size = 1.01.01.0 mm. rs functional images were collected using a t2 weighting gradient echo sequence with tr = 2,490 ms, te = 30 ms, matrix = 12812829, and voxel size = 223 mm. in this study, we used a seed - to - voxel analysis method for evaluation of effect of apathy on fc of three icns. we produced individual subject seed - to - voxel connectivity maps using the conn - fmri functional connectivity toolbox v1.5 (http://www.nitrc.org/projects/conn). slice time correction, realignment, normalization, and spatial smoothing were performed for preprocessing of images with a 6 mm kernel, and the images were temporally band - pass filtered (0.009 < f < 0.08 hz). a component - based noise correction method was used to remove physiological and other noise artifacts.26 these methods involved extraction of the signals from white matter and cerebrospinal fluid regions with movement - related covariates. the seed region of interests (rois) consisting of spheres 6 mm in radius centered on montreal neurological institute (mni) coordinates (montreal, qc, canada) were used to identify the corresponding networks in prior studies. each rsn and its corresponding seed roi (in mni coordinates) are as follows : dmn (posterior cingulate cortex : 1, 55, 17), cen (left and right dorsolateral cortex : 42, 34, 20/44, 36, 20), and sn (left and right frontoinsular cortex : 32, 26, 14/38, 22, 10). for each subject, the average blood oxygen level - dependent time course of each seed was extracted from the functional echo planar images, and then it was correlated with the time courses of whole - brain voxels, using pearson correlation analysis. fisher s r - to - z transformation of correlation coefficients was conducted for general linear model (glm) analysis. in the second - level analysis, connectivity maps from all participants were entered into glm, that was used for measuring the group differences of the fc for each icn with age, gender, and education as nuisance variables. to examine the relationships between apathy severity and fc of the icns in the amci group, the total ia scores were correlated with fcs of the dmn, the sn, and the cen using the glm. smirnov test showed that all variables including total ia scores and cerad - k neuropsychological test scores were normally distributed. there were no significant differences in gender, age or education between the amci and con groups. compared with the con group, the amci group showed significantly poorer performances in the mini mental status examination, wlm, wlr, wlrc, and cr in cerad - k neuropsychological battery (p<0.05). figure 1 shows the statistical map representing the dmn, sn, and cen determined across all subjects. group analysis showed lower fc in the dmn in the amci group compared to the con group in the anterior cingulate cortex and posterior cingulate. in the sn, there were no significant differences between the amci and the con groups in the fcs. the fc in the left middle temporal gyrus and right supramarginal gyrus was significantly higher within the cen in the amci group compared to the con group (table 2 and figure 2 ; fdr - corrected p<0.05). figure 2 shows the results of the analysis of correlation between the fcs of the dmn, sn, and cen and the total ia score in the amci group. in the dmn, the fc of the anterior cingulate was negatively correlated with total ia score. in the cen, the fcs of the middle frontal, inferior frontal, and supramarginal gyrus were positively correlated with the total ia score (table 2 ; fdr - corrected p<0.05). there was no significant difference between the fc of the sn and the total ia score in the amci group. smirnov test showed that all variables including total ia scores and cerad - k neuropsychological test scores were normally distributed. there were no significant differences in gender, age or education between the amci and con groups. compared with the con group, the amci group showed significantly poorer performances in the mini mental status examination, wlm, wlr, wlrc, and cr in cerad - k neuropsychological battery (p<0.05). figure 1 shows the statistical map representing the dmn, sn, and cen determined across all subjects. group analysis showed lower fc in the dmn in the amci group compared to the con group in the anterior cingulate cortex and posterior cingulate. in the sn, there were no significant differences between the amci and the con groups in the fcs. the fc in the left middle temporal gyrus and right supramarginal gyrus was significantly higher within the cen in the amci group compared to the con group (table 2 and figure 2 ; fdr - corrected p<0.05). figure 2 shows the results of the analysis of correlation between the fcs of the dmn, sn, and cen and the total ia score in the amci group. in the dmn, the fc of the anterior cingulate was negatively correlated with total ia score. in the cen, the fcs of the middle frontal, inferior frontal, and supramarginal gyrus were positively correlated with the total ia score (table 2 ; fdr - corrected p<0.05). there was no significant difference between the fc of the sn and the total ia score in the amci group. although this study is not the first rs - fmri study on the apathy in amci, it is the first study to elaborate the relationships between apathy severity and fcs of the large - scale icns such as the dmn, the sn, and the cen. in this study, we found that the fcs of the dmn were lower and those of the cen were higher in the amci group than in the con group, that were partially in line with the previous studies. dmn s activity during rest is necessary for memory consolidation.27 additionally, amyloid deposition, one of the hallmark pathologies of ad, is found initially and most prominently in dmn hubs.2830 for these reasons, the dmn is the most frequently studied network in dementia. loss of fc in the dmn is a well - established finding in ad patients, but it is inconsistent in mci patients. our findings showing a decreased fc in the dmn of mci patients are consistent with previous studies.3134 however, the changes of the dmn in mci patients remain controversial. a previous study showed the selective disruption of the dmn in mci patients, indicating both decreased and increased dmn connectivity.11 moreover, the most recent study on mci patients presented increased dmn connectivity.35 gardini explained that increased fc of the dmn in amci subjects may reflect a maladaptive mechanism that would represent the damaged brain s attempt to cope with regional atrophy or amyloid deposition in these areas.36 based on the current uncertainty inherent in the clinical concept of mci,37,38 controversial changes of dmn in amci patients may be due to the heterogeneity of the amci population between the studies. besides the dmn, sn and cen play important roles in cognitive processing.39 the sn plays a crucial role in switching between the cen and the dmn.40 once a salient event is detected, the sn initiates the appropriate transient control signals to engage the cen to mediate attention, working memory, and executive control, all while disengaging the dmn.41 negative correlations (anticorrelations) between the dmn and the cen or sn support the reciprocal relationship between these icns.41,42 other rs - fmri studies explained that the greater fcs of the cen and sn might be due to a compensatory mechanism associated with dmn impairments.31,43 therefore, the results that showed decreased fcs of the dmn and increased fcs of the cen in the amci group could be interpreted by the dmn impairment associated with disease progression and aberrant hyperactivity of cen associated with a compensatory process. we also found that total ia score of the amci group was negatively correlated with the fc of the anterior cingulate within the dmn and positively correlated with the fc of the middle frontal, inferior frontal, and supramarginal gyrus within the cen in the amci group. apathy is a complex syndrome with lack of initiation, lack of interest, and reduced emotional responsiveness4 due to direct or indirect involvement of the prefrontal lobes.44 neural substrates associated with apathy were found in several studies in ad spectrum disorders. an spect imaging study found that apathy was negatively correlated with perfusion in the right anterior cingulate cortex, right middle orbitofrontal gyrus, and left superior dorsolateral prefrontal cortex.9 an mri study using voxel - based morphometry found that apathy was associated with atrophy of the anterior cingulate, ventrolateral orbitofrontal cortex, and left insula in ad.45 other studies using mri with diffusion tensor imaging have shown relationships between increased white matter abnormalities and apathy in mci and ad.15,17,46 a recent study found that the presence of lesions in the anterior thalamic radiations was associated with the severity of apathy in amci.16 these studies confirmed the evidence of white matter disconnection associated with apathy and support the view that alterations in the neural mechanisms of apathy occur in the early course of ad. furthermore, a recent rs - fmri study revealed that a decreased fpcn was associated with greater apathy in mci.20 our findings build upon previous work by suggesting fc changes in the three icns for individuals with amci who have greater apathy. also, our result of association between apathy and anterior cingulate coincided with many existing reports in ad.3,4648 the anterior cingulate is one of the important anatomical structures involved in motivation. the meso - cortico - limbic pathway is a dopaminergic network from the ventral tegmentum49 to the different anterior cortical regions (frontal and parietal) connecting via the anterior cingulate.50 therefore, the disruption of connections between the anterior cingulate and other cortical and subcortical regions would lead to the mechanism of apathy.51 the present study has several limitations. further longitudinal studies will be needed to clarify the large - scale functional network changes underlying apathy in the ad progression. second, as we recruited icns that were most similar to the previously identified networks template, other networks of interest such as the dan could not be observed. third, we did not account for use of psychotropic medications such as antidepressants, cholinesterase inhibitors, dopamine agonists or stimulants such as methylpenidate or modafinil that reportedly help patients with apathy. despite these limitations, this study showed that apathy is associated with an alteration of large - scale functional brain networks, that included not only the intra - networks but also inter - networks of the dmn, sn, and cen. additionally, we included a relatively large number of subjects compared with the studies previously reported. we showed altered fcs of the dmn and cen and distinctive patterns of correlations between apathy and fcs in the dmn and cen in the amci group. these results might reflect putative role of functional network change in the development of apathy in amci. additional large and longitudinal studies will help further elucidate the underlying neurobiological mechanism of apathy in ad progression. | backgroundalthough several prior works reported that apathy is associated with conversion to alzheimer s disease in individuals with amnestic mild cognitive impairment (amci), effects of apathy on the functional connectivity (fc) of the brain remain unclear. in this study, we assessed the pattern of association between apathy and default mode network (dmn), salience network and central executive network (cen) in amci subjects.methodsfifty subjects with amci and 50 controls (cons) participated in this study. they underwent clinical assessments and magnetic resonance imaging for the structural and resting - state scan. we explored the patterns of association between apathy inventory (ia) total score and the whole - brain voxel - wise fcs of the dmn, salience network and cen in amci subjects.resultswe observed that the fcs of the dmn were less and those of cen were more in the amci group than the con group. total ia score was negatively correlated with fcs of the anterior cingulate within the dmn, and positively correlated with fcs of the middle frontal, inferior frontal, and supramarginal gyrus within the cen in the amci group.conclusionour findings suggest that distinctive patterns of association between apathy and fcs in the dmn and cen in the amci group might reflect the putative role of functional network change in the development of apathy in amci. |
in 1913 goodman levy [24, 25 ] showed that chloroform - induced ventricular tachyarrhythmias were abolished by cardiac sympathetic denervation. additionally, sympathetic activation induced identical ventricular tachyarrhythmias, indicating a direct neurological rather than cardiac effect of chloroform. subsequently, beattie showed that these tachyarrhythmias were abolished by mid - collicular, but not higher, diencephalic sectioning. histological examination indicated degeneration of a pathway originating in the hypothalamus and terminating in the intermediolateral column (close to the cells of origin of sympathetic preganglionic fibers). aschenbrenner reported seven young patients with cortical and diencephalic tumors who developed ventricular ectopy or nodal rhythm. these patients lacked cardiac history or post mortem ischemic cardiac pathology to explain their death. much of this was forgotten with the advent of world war ii. in the aftermath, single case reports of intriguing ecg repolarization changes after subarachnoid hemorrhage (sah) were reported : inverted t waves (often tall, symmetrical downward peaking) and prolonged qtc interval with st elevation or depression. cropp initially thought these changes indicated coronary artery disease and delayed surgery, with fatal consequences. no patient had a cardiac history, most were young and no autopsied case showed coronary artery pathology. aneurysm position led to implication of inferior frontal structures and possible vagal mechanisms in the etiology of these cardiac changes. recently, kono compared 7 sah patients with repolarization changes and 5 in whom no ecg abnormalities were detected. additional to subendocardial hemorrhages, scattered myocyte necrosis was observed surrounded by infiltrating monocytes and interstitial hemorrhages (myocytolysis). electron microscopy showed clustering of cardiac pathology around nerves and indicated a neural rather than vascular origin. others investigated stress as a pointer to cerebral - cardiac interactions. in a holter study, stress induced ventricular ectopy when healthy individuals addressed an audience. in those with documented cardiac disease, frequency and severity of ventricular ectopy toivonen investigated arousal effects on the ambulatory ecg of 30 healthy physicians without known heart disease. recordings were compared just before and during emergency calls. the t wave inverted in 67 % subjects and asymptomatic st depression as rr interval shortened, the qt interval failed to show the expected decrease. thus, arousal can significantly affect ventricular repolarization even in putatively normal hearts, presumably through sympathetic mechanisms. coupled with the resemblance of myocytolysis to phaeochromocytoma cardiomyopathy, the cardiac pathology accompanying catecholamine infusion and prolonged stress, these observations strongly indicate that sympathetic neural activation can destabilize cardiac structure and function. much recent evidence indicates the arrhythmogenic potential of catecholamines. mid - myocardial cells have been identified in the dog and human ventricle sensitive to catecholamines which may underlie the pro - arrhythmic effects of cardiac sympathetic activation. in this regard, cao compared cardiac innervation density in patients with or without history of ventricular arrhythmias. increased sympathetic nerve density was found around blood vessels and areas of myocardial damage only in those with an arrhythmia history. they then infused nerve growth factor (ngf) into canine left stellate ganglia. when combined with av block and experimental mi, vt and sudden cardiac death occurred only in the ngf - treated animals. this suggested that sympathetic neural remodeling might facilitate ventricular arrhythmias and contribute to sudden cardiac death. conversely, manitius - robeck reported ictal sinus arrest during temporal lobe seizures. in one patient, cortical dysplasia was associated with a near - complete absence of mibg - spect determined cardiac sympathetic innervation. the bradyarrhythmias were abolished by surgery indicating a permissive interaction and developmental link between cortical dysplasia and reduced cardiac sympathetic innervation. stroke is associated with an adverse long - term cardiac outlook, possibly relating to altered sympathovagal balance. barron reported that compared with age / gender matched controls, total spectral power of rr intervals was reduced after stroke ; power associated with cardiac parasympathetic neural activity was particularly affected indicating a shift in sympathovagal balance. strittmatter reported that cardiac sympathetic tone was increased within 5 days of stroke and similar findings were reported by giubilei, who also showed persistence for at least 3 weeks. additionally, korpelainen. demonstrated that diurnal cardiac autonomic variability was disturbed after acute stroke with a striking loss of nocturnal vagal dominance. sander [42, 44 ] reported that absence of circadian cardiovascular variation was particularly striking after insular infarction. these patients had higher plasma no - radrenaline levels, increased nocturnal blood pressure, a higher incidence of qtc interval prolongation and ventricular arrhythmias than patients with stroke in other locations. however, in these, and many other such studies the contribution of concomitant coronary artery disease and medications were not assessed. collectively these data strongly indicate that the brain has a major influence on cardiac structure and function and that this is likely mediated through alterations in patterning of sympathovagal relationships. in 1913 goodman levy [24, 25 ] showed that chloroform - induced ventricular tachyarrhythmias were abolished by cardiac sympathetic denervation. additionally, sympathetic activation induced identical ventricular tachyarrhythmias, indicating a direct neurological rather than cardiac effect of chloroform. subsequently, beattie showed that these tachyarrhythmias were abolished by mid - collicular, but not higher, diencephalic sectioning. histological examination indicated degeneration of a pathway originating in the hypothalamus and terminating in the intermediolateral column (close to the cells of origin of sympathetic preganglionic fibers). aschenbrenner reported seven young patients with cortical and diencephalic tumors who developed ventricular ectopy or nodal rhythm. these patients lacked cardiac history or post mortem ischemic cardiac pathology to explain their death. much of this was forgotten with the advent of world war ii. in the aftermath, single case reports of intriguing ecg repolarization changes after subarachnoid hemorrhage (sah) were reported : inverted t waves (often tall, symmetrical downward peaking) and prolonged qtc interval with st elevation or depression. cropp initially thought these changes indicated coronary artery disease and delayed surgery, with fatal consequences. no patient had a cardiac history, most were young and no autopsied case showed coronary artery pathology. aneurysm position led to implication of inferior frontal structures and possible vagal mechanisms in the etiology of these cardiac changes. recently, kono compared 7 sah patients with repolarization changes and 5 in whom no ecg abnormalities were detected. additional to subendocardial hemorrhages, scattered myocyte necrosis was observed surrounded by infiltrating monocytes and interstitial hemorrhages (myocytolysis). electron microscopy showed clustering of cardiac pathology around nerves and indicated a neural rather than vascular origin. others investigated stress as a pointer to cerebral - cardiac interactions. in a holter study, stress induced ventricular ectopy when healthy individuals addressed an audience. in those with documented cardiac disease, frequency and severity of ventricular ectopy toivonen investigated arousal effects on the ambulatory ecg of 30 healthy physicians without known heart disease. recordings were compared just before and during emergency calls. the t wave inverted in 67 % subjects and asymptomatic st depression as rr interval shortened, the qt interval failed to show the expected decrease. thus, arousal can significantly affect ventricular repolarization even in putatively normal hearts, presumably through sympathetic mechanisms. coupled with the resemblance of myocytolysis to phaeochromocytoma cardiomyopathy, the cardiac pathology accompanying catecholamine infusion and prolonged stress, these observations strongly indicate that sympathetic neural activation can destabilize cardiac structure and function. much recent evidence indicates the arrhythmogenic potential of catecholamines. mid - myocardial cells have been identified in the dog and human ventricle sensitive to catecholamines which may underlie the pro - arrhythmic effects of cardiac sympathetic activation. in this regard, cao compared cardiac innervation density in patients with or without history of ventricular arrhythmias. increased sympathetic nerve density was found around blood vessels and areas of myocardial damage only in those with an arrhythmia history. they then infused nerve growth factor (ngf) into canine left stellate ganglia. when combined with av block and experimental mi, vt and sudden cardiac death occurred only in the ngf - treated animals. this suggested that sympathetic neural remodeling might facilitate ventricular arrhythmias and contribute to sudden cardiac death. conversely, manitius - robeck reported ictal sinus arrest during temporal lobe seizures. in one patient, cortical dysplasia was associated with a near - complete absence of mibg - spect determined cardiac sympathetic innervation. the bradyarrhythmias were abolished by surgery indicating a permissive interaction and developmental link between cortical dysplasia and reduced cardiac sympathetic innervation. stroke is associated with an adverse long - term cardiac outlook, possibly relating to altered sympathovagal balance. barron reported that compared with age / gender matched controls, total spectral power of rr intervals was reduced after stroke ; power associated with cardiac parasympathetic neural activity was particularly affected indicating a shift in sympathovagal balance. strittmatter reported that cardiac sympathetic tone was increased within 5 days of stroke and similar findings were reported by giubilei, who also showed persistence for at least 3 weeks. additionally, korpelainen. demonstrated that diurnal cardiac autonomic variability was disturbed after acute stroke with a striking loss of nocturnal vagal dominance. sander [42, 44 ] reported that absence of circadian cardiovascular variation was particularly striking after insular infarction. these patients had higher plasma no - radrenaline levels, increased nocturnal blood pressure, a higher incidence of qtc interval prolongation and ventricular arrhythmias than patients with stroke in other locations. however, in these, and many other such studies the contribution of concomitant coronary artery disease and medications were not assessed. collectively these data strongly indicate that the brain has a major influence on cardiac structure and function and that this is likely mediated through alterations in patterning of sympathovagal relationships. while evidence for cerebral involvement in cardiac dysfunction is persuasive, frequency, predisposing circumstances and relevance for outcome are unclear. regard, early traces of (non - ischemic) myocytolysis were found in 26% of patients dying of non - ischemic causes (pneumonia, sepsis) and in 89% of sah, 71% of intracerebral hemorrhage, and 52% of ischemic stroke deaths. while indicative, these data come from a select group of patients for whom post mortem data were available. stroke may provide a good model to investigate neurocardiac influences : lesion location may be identified with precision, and onset categorized with some accuracy. however few studies detail arrhythmia incidence after stroke, and even fewer have controlled for concomitant coronary artery disease. comparing ecgs before and after stroke, lavy indicated a 39 % incidence of new onset cardiac arrhythmias in patients without cardiac history. goldstein reviewed 53 acute stroke patients (including sah) ecgs obtained within 24 hours of admission and recordings taken an average of 4 months earlier. qt prolongation of new onset was seen in 32% of strokes (against 2% of controls) ; t wave inversion and u waves were present in 15% of stroke patients and in none of the controls. new onset cardiac arrhythmias (of which atrial fibrillation was the most frequent) were present in 25% of all stroke patients, and 3% of controls. curiously, there was no difference in ventricular arrhythmia incidence between the two groups. however, this may not be too surprising since the ecg underestimates arrhythmia incidence. in other studies, where holter recording has been used, ventricular arrhythmia incidence after stroke was higher, varying from 2575% without control for co - existing cardiac disorders or for whether these were new or pre - existing. in yamour s uncontrolled study of intracerebral hemorrhage patients, comparison with pre - event ecg status indicated a new onset ventricular arrhythmia in 10% of patients and interestingly correlated with a temporoparietal location. in our recent unpublished observations, ventricular tachyarrhythmias ventricular premature beats occurred in 2.4% of strokes, and in 2% of 37 patients admitted with transient ischemic attacks (tia). tia patients served as controls with similar demographics, incidence of coronary artery disease (70%), atherosclerotic risk factors and medication experience. however, holter monitoring revealed a ventricular tachyarrhythmia incidence of 12% in stroke, and 3% in tia patients, bigeminy in 21% and 5% respectively, ventricular ectopy in 71% and 73% respectively, and atrial fibrillation in 9% and 3% respectively. atrial fibrillation is commonly found in ecg studies of stroke [14, 23 ]. however, when pre - event ecgs are used for comparison, it is unclear whether paroxysmal arrhythmia preceded and in some cases, caused stroke because of embolic potential. additionally, most reports do not control for cardiac concomitants (indeed, 40% of acute stroke patients without cardiac symptoms are reported to have > 70% stenosis on coronary angiography). cardiac arrhythmia incidence is reportedly highest after sah (98 %), of which multifocal ventricular beats occur on cardiac monitoring in 54%, couplets in 40% and unsustained ventricular tachycardia in 29 %. cardiac arrhythmias may be associated with adverse outcome : 80% mortality in acute stroke patients with ventricular tachyarrhythmias, compared to 23% in those without. similarly, an association was documented between poor outcome (including death) in patients with arrhythmias or ecg changes after sah. wong reported that after adjusting for overt cardiac disease and traditional ischemic risk factors, stroke patients with qtc prolongation in lead v6 had a 2.8 relative risk of cardiac death. if the qtc exceeded 480ms then the specificity was 94% for cardiac death prediction within five years. eckhardt showed that insular strokes were particularly associated with qt dispersion lengthening compared with those in other locations. this is most pronounced after subarachnoid hemorrhage, but may also accompany intracerebral hemorrhage and ischemia. in many reported series, precision is reduced by failure to account for concomitant ischemic cardiac disorders as a confounding variable, and by the use of ecg rather than holter data. additionally, most studies are of short duration, performed in the acute phase and do not investigate the longer - term cardiovascular consequences of the lesion. it is this latter which may prove to be of importance in determining survival, and, as yet, definitive data on this point are lacking. while evidence for cerebral involvement in cardiac dysfunction is persuasive, frequency, predisposing circumstances and relevance for outcome are unclear. regard, early traces of (non - ischemic) myocytolysis were found in 26% of patients dying of non - ischemic causes (pneumonia, sepsis) and in 89% of sah, 71% of intracerebral hemorrhage, and 52% of ischemic stroke deaths. while indicative, these data come from a select group of patients for whom post mortem data were available. stroke may provide a good model to investigate neurocardiac influences : lesion location may be identified with precision, and onset categorized with some accuracy. however few studies detail arrhythmia incidence after stroke, and even fewer have controlled for concomitant coronary artery disease. comparing ecgs before and after stroke, lavy indicated a 39 % incidence of new onset cardiac arrhythmias in patients without cardiac history. goldstein reviewed 53 acute stroke patients (including sah) ecgs obtained within 24 hours of admission and recordings taken an average of 4 months earlier. qt prolongation of new onset was seen in 32% of strokes (against 2% of controls) ; t wave inversion and u waves were present in 15% of stroke patients and in none of the controls. new onset cardiac arrhythmias (of which atrial fibrillation was the most frequent) were present in 25% of all stroke patients, and 3% of controls. curiously, there was no difference in ventricular arrhythmia incidence between the two groups. however, this may not be too surprising since the ecg underestimates arrhythmia incidence. in other studies, where holter recording has been used, ventricular arrhythmia incidence after stroke was higher, varying from 2575% without control for co - existing cardiac disorders or for whether these were new or pre - existing. in yamour s uncontrolled study of intracerebral hemorrhage patients, comparison with pre - event ecg status indicated a new onset ventricular arrhythmia in 10% of patients and interestingly correlated with a temporoparietal location. in our recent unpublished observations, ventricular tachyarrhythmias ventricular premature beats occurred in 2.4% of strokes, and in 2% of 37 patients admitted with transient ischemic attacks (tia). tia patients served as controls with similar demographics, incidence of coronary artery disease (70%), atherosclerotic risk factors and medication experience. however, holter monitoring revealed a ventricular tachyarrhythmia incidence of 12% in stroke, and 3% in tia patients, bigeminy in 21% and 5% respectively, ventricular ectopy in 71% and 73% respectively, and atrial fibrillation in 9% and 3% respectively. atrial fibrillation is commonly found in ecg studies of stroke [14, 23 ]. however, when pre - event ecgs are used for comparison, it is unclear whether paroxysmal arrhythmia preceded and in some cases, caused stroke because of embolic potential. additionally, most reports do not control for cardiac concomitants (indeed, 40% of acute stroke patients without cardiac symptoms are reported to have > 70% stenosis on coronary angiography). cardiac arrhythmia incidence is reportedly highest after sah (98 %), of which multifocal ventricular beats occur on cardiac monitoring in 54%, couplets in 40% and unsustained ventricular tachycardia in 29 %. cardiac arrhythmias may be associated with adverse outcome : 80% mortality in acute stroke patients with ventricular tachyarrhythmias, compared to 23% in those without. similarly, an association was documented between poor outcome (including death) in patients with arrhythmias or ecg changes after sah. wong reported that after adjusting for overt cardiac disease and traditional ischemic risk factors, stroke patients with qtc prolongation in lead v6 had a 2.8 relative risk of cardiac death. if the qtc exceeded 480ms then the specificity was 94% for cardiac death prediction within five years. eckhardt showed that insular strokes were particularly associated with qt dispersion lengthening compared with those in other locations. this is most pronounced after subarachnoid hemorrhage, but may also accompany intracerebral hemorrhage and ischemia. in many reported series, precision is reduced by failure to account for concomitant ischemic cardiac disorders as a confounding variable, and by the use of ecg rather than holter data. additionally, most studies are of short duration, performed in the acute phase and do not investigate the longer - term cardiovascular consequences of the lesion. it is this latter which may prove to be of importance in determining survival, and, as yet, definitive data on this point are lacking. in many species the insular cortex plays a pivotal role in the integration of autonomic function. phasic microstimulation of the rat left insula resulted in qt prolongation, st depression, pronounced bradycardia, complete heart block and idioventricular rhythm ending in asystole. myocytolysis was apparent on cardiac examination and plasma noradrenaline levels were elevated, without a change in adrenaline (which in the rat indicates neural rather than adrenal origin).neither was provoked by stimulation of peri - insular sensory cortex.thus, cerebral stimulation can reproducibly generate lethal cardiac arrhythmias and pathology resembling changes seen after stroke or sudden unexpected death in epilepsy. lesions confined mainly to the right posterior insula of the rat increase blood pressure and heart rate without altering baroreceptor sensitivity. conversely, left posterior insular lesions do not alter cardiovascular variables, but increase baroreceptor sensitivity. previously, we had shown that damage to the right hemisphere in a rat middle cerebral artery occlusion model increased both qt interval and plasma norepinephrine. direct recording from cardiac sympathetic nerves is difficult ; however surrogate measures of sympathovagal balance may be assessed from spectral analysis of heart rate.we have shown in the rat that right posterior insular stimulation increases cardiac sympathetic tone in the absence of heart rate, blood pressure or respiration changes. interestingly, baroreceptor sensitivity decreased, a finding also linked to increased mortality after stroke. these laterality issues are of interest because of previous observations that in the human, right carotid amylobarbital infusion produces bradycardia, and left carotid infusion is accompanied by tachycardia.additionally, an increased incidence of supraventricular tachycardia was reported in patients with right middle cerebral artery stroke. our investigations in the human indicate that left caudal anterior insular stimulation during surgery for intractable epilepsy increases the frequency of bradycardia and depressor responses, whereas stimulation of a similar region of the right anterior insula is associated with heart rate and diastolic blood pressure elevation.although both types of response were elicitable from either insula, the proportion varied, and the degree of bradycardia was greater on left insular stimulation. these data indicate that in the human at least, some lateralization of cardiovascular representation may exist with sympathetic predominance of cardiovascular regulation being a right insular function, and parasympathetic cardiac neural regulation relating to the left insula. consistent with the hypothesis of left insular cardioinhibitory representation, these patients had a higher basal heart rate than age - gender matched controls. cardiac autonomic balance was shifted towards sympathetic predominance and mirrored the effects of rising from sitting to standing in the control group. interestingly 40% of these patients developed ecg changes not seen on premorbid traces, comprising tachycardia, t wave inversion, prominent u waves and qtc prolongation. a similar case has also been reported of an arrhythmia resolving after evacuation of a left insular hematoma.we have also encountered a patient who developed transient st depression 3 days after left insular infarction in the absence of cardiac history, coronary artery disease, or echocardiographic abnormalities. others have indicated a significant role for the right insular cortex in cardiovascular decompensation after stroke. tokgozoglu showed that compared to age - gender matched controls total spectral energy was reduced after ischemic stroke as noted previously by others. however, this was particularly marked in patients with stroke involving the right middle cerebral artery, or the insular cortex. sudden death was observed in 11%, but occurred more often after right mca lesions. naver indicated that heart rate variability entrained to deep breathing (a parasympathetic relationship) was reduced with right sided stroke, whereas peripheral sympathetic influences were equally distributed between the two sides. sympathetic skin response and pulse rate variation (parasympathetic measure) were suppressed in patients with both right or left hemisphere lesions compared with controls. this effect was more marked with right hemisphere lesions, although the authors failed to show a statistical difference when right and left sides were compared. on the other hand, li indicated that supraventricular arrhythmias were more frequently encountered after right insular infarction compared with strokes in other locations. interestingly, st abnormalities were more frequent after left insular involvement in comparison with controls or strokes in other locations. sander showed that right hemisphere infarction reduced circadian blood pressure variability and increased nocturnal blood pressure compared to left hemisphere infarcts. additionally, higher serum noradrenaline levels, longer qtc prolongation and more cardiac arrhythmias were observed after right hemisphere infarction. in general, changes were greatest when there was insular involvement, under which circumstances no laterality effects were observed. whereas these changes indicate that left insular lesions may disrupt interactions of central oscillators regulating cardiac rhythmicity, there is some inconsistency in the data. certainly, right rostral posterior insular stimulation in the rat increases cardiac sympathetic tone ; however, lesions involving this region also increase heart rate and blood pressure. these seemingly incompatible effects may relate to anesthetic effects on descending inhibitory and excitatory pathways. under baseline anesthesia conditions inhibitory pathways (probably insular efferents to the lateral hypothalamic area) may be maximally operational, and this inhibition is released by insular lesioning. on the other hand, stimulation recruits excitatory pathways, possibly quiescent under basal anesthetic conditions. human investigations were conducted in minimally anesthetized individuals and so the relationships may differ. in the rat, the major cardiac effect, however, appears related to parasympathetic upregulation (bradyarrhythmias and complete heart block). in many species the insular cortex plays a pivotal role in the integration of autonomic function. phasic microstimulation of the rat left insula resulted in qt prolongation, st depression, pronounced bradycardia, complete heart block and idioventricular rhythm ending in asystole. myocytolysis was apparent on cardiac examination and plasma noradrenaline levels were elevated, without a change in adrenaline (which in the rat indicates neural rather than adrenal origin).neither was provoked by stimulation of peri - insular sensory cortex.thus, cerebral stimulation can reproducibly generate lethal cardiac arrhythmias and pathology resembling changes seen after stroke or sudden unexpected death in epilepsy. lesions confined mainly to the right posterior insula of the rat increase blood pressure and heart rate without altering baroreceptor sensitivity. conversely, left posterior insular lesions do not alter cardiovascular variables, but increase baroreceptor sensitivity. previously, we had shown that damage to the right hemisphere in a rat middle cerebral artery occlusion model increased both qt interval and plasma norepinephrine. direct recording from cardiac sympathetic nerves is difficult ; however surrogate measures of sympathovagal balance may be assessed from spectral analysis of heart rate.we have shown in the rat that right posterior insular stimulation increases cardiac sympathetic tone in the absence of heart rate, blood pressure or respiration changes. interestingly, baroreceptor sensitivity decreased, a finding also linked to increased mortality after stroke. these laterality issues are of interest because of previous observations that in the human, right carotid amylobarbital infusion produces bradycardia, and left carotid infusion is accompanied by tachycardia.additionally, an increased incidence of supraventricular tachycardia was reported in patients with right middle cerebral artery stroke. our investigations in the human indicate that left caudal anterior insular stimulation during surgery for intractable epilepsy increases the frequency of bradycardia and depressor responses, whereas stimulation of a similar region of the right anterior insula is associated with heart rate and diastolic blood pressure elevation.although both types of response were elicitable from either insula, the proportion varied, and the degree of bradycardia was greater on left insular stimulation. these data indicate that in the human at least, some lateralization of cardiovascular representation may exist with sympathetic predominance of cardiovascular regulation being a right insular function, and parasympathetic cardiac neural regulation relating to the left insula. consistent with the hypothesis of left insular cardioinhibitory representation, these patients had a higher basal heart rate than age - gender matched controls. cardiac autonomic balance was shifted towards sympathetic predominance and mirrored the effects of rising from sitting to standing in the control group. interestingly 40% of these patients developed ecg changes not seen on premorbid traces, comprising tachycardia, t wave inversion, prominent u waves and qtc prolongation. a similar case has also been reported of an arrhythmia resolving after evacuation of a left insular hematoma.we have also encountered a patient who developed transient st depression 3 days after left insular infarction in the absence of cardiac history, coronary artery disease, or echocardiographic abnormalities. others have indicated a significant role for the right insular cortex in cardiovascular decompensation after stroke. tokgozoglu showed that compared to age - gender matched controls total spectral energy was reduced after ischemic stroke as noted previously by others. however, this was particularly marked in patients with stroke involving the right middle cerebral artery, or the insular cortex. sudden death was observed in 11%, but occurred more often after right mca lesions. naver indicated that heart rate variability entrained to deep breathing (a parasympathetic relationship) was reduced with right sided stroke, whereas peripheral sympathetic influences were equally distributed between the two sides. sympathetic skin response and pulse rate variation (parasympathetic measure) were suppressed in patients with both right or left hemisphere lesions compared with controls. this effect was more marked with right hemisphere lesions, although the authors failed to show a statistical difference when right and left sides were compared. on the other hand, li indicated that supraventricular arrhythmias were more frequently encountered after right insular infarction compared with strokes in other locations. interestingly, st abnormalities were more frequent after left insular involvement in comparison with controls or strokes in other locations. sander showed that right hemisphere infarction reduced circadian blood pressure variability and increased nocturnal blood pressure compared to left hemisphere infarcts. additionally, higher serum noradrenaline levels, longer qtc prolongation and more cardiac arrhythmias were observed after right hemisphere infarction. in general, changes were greatest when there was insular involvement, under which circumstances no laterality effects were observed. whereas these changes indicate that left insular lesions may disrupt interactions of central oscillators regulating cardiac rhythmicity, there is some inconsistency in the data. certainly, right rostral posterior insular stimulation in the rat increases cardiac sympathetic tone ; however, lesions involving this region also increase heart rate and blood pressure. these seemingly incompatible effects may relate to anesthetic effects on descending inhibitory and excitatory pathways. under baseline anesthesia conditions inhibitory pathways (probably insular efferents to the lateral hypothalamic area) may be maximally operational, and this inhibition is released by insular lesioning. on the other hand, stimulation recruits excitatory pathways, possibly quiescent under basal anesthetic conditions. human investigations were conducted in minimally anesthetized individuals and so the relationships may differ. in the rat, the major cardiac effect, however, appears related to parasympathetic upregulation (bradyarrhythmias and complete heart block). considerable evidence for the role of the cortex in the regulation of cardiac rate and rhythm exists from historical sources, contemporary clinical observation and animal experimentation. there is a large body of evidence indicating that insular involvement may adversely affect cardiac prognosis after stroke. whereas there is little doubt now that lateralization of cardiovascular function occurs within the cortex of many species, there is some discrepancy regarding the evidence as to whether lesions of the left or right insula may be more clinically significant. in some part, this may reflect interspecies extrapolations, state dependency of the observed responses, whether or not clinical data refer to lesions confined solely to the insular cortex (as in our reports) or merely involve the insula in addition to adjacent regions (as in the case of others). for example, we have identified an inhibitory input to the insula from adjacent regions ; when damaged, but sparing the insula itself, this may result in cardiovascular disinhibition, an effect differing from involvement of the insula alone. on balance however, it is most likely that in the human, lesions ablating part or all of the left anterior insula and its efferent connections and ablation of inhibitory circuminsular efferents to the right insular cortex are of consequence with regard to determining cardiovascular outcomes after neurological damage. temporal dephasing of the relationships between the neuraxially dispersed oscillators controlling sympathovagal activity is the likely underlying mechanism which, interacting with concomitant ischemic cardiac and vascular disease if present, poses a potential threat to the integrity and function of the heart. these effects may not be manifest in the acute phase, but may become so chronically, especially with central synaptic reorganization after stroke. environmental, and especially psychological, stressors may activate a reorganized system leading to upregulation and dysfunction of sympathetic neural input with resultant cardiac arrhythmia generation, cardiac structural damage and decompensation. clearly, long - term follow - up studies of stroke patients could be exceptionally useful to determine the validity of this argument. | abstractthat the brain may be involved in cardiovascular regulation has been acknowledged for over a century. that cardiac arrhythmias may result from cortical derangement has been less well recognized. that cortical cardiac representation may be lateralized is even more controversial. recent evidence implicates several cortical structures, especially the insula, in cardiac rate and rhythm control. experimental models indicate that insular lesions may be arrhythmogenic. accumulating data show similar lesion effects in humans. in the rat, monkey and man sympathetic cardiovascular control is generally represented in the right insula, although pronounced insulo - insular connectivity has been demonstrated. proarrhythmic shifts in cardiac sympathovagal balance occur after human stroke, including left insular lesions. this evidence implicates the cortex in the promotion and even generation of cardiovascular dysfunction under appropriate circumstances. |
dementia increases the risk of falls among the elderly by the impairment of judgment, gait, and visual - spatial perception as well as the ability to recognize and avoid hazards [1, 2 ]. factors such as disability [3, 4 ], physical activity, functional status, cognitive function, and the environmental conditions [712 ] can influence the risk of falls in the elderly. the environment including external conditions such as warmth, noise, and light surrounding people can increase the rate of falls in later life. dementia aggravates age related changes in sensory receptions in the body, which can increase the sensitivity for environmental conditions, and the risk of falls consequently. disability defined as difficulty to perform daily activities [4, 13 ] can cause limitations in body functioning and structures and consequently inhibit activities and participations in particular environmental settings. performance of daily living activities is associated with balance in the rest or moving from one position to another. limited activities can increase the risk of falls two to four times. on the other hand, physical activities positively affect health and cognitive function in the elderly. regular exercises improve muscle strength, reaction time, balance, and gait, which help to prevent and reduce developing secondary conditions caused by functional decline and physical diseases. however, this study is proposed to assess the effects of disability, physical activity, functional status, and environmental conditions as well as sociodemographic factors on the likelihood of falls in the elderly with dementia. the project was registered in the national medical research register (project code : nmrr-09 - 443 - 4148). approval and permission for conducting the study were received from the ethical committee of the ministry of health. it was a national cross - sectional survey titled determinants of health status among older malaysians and carried out in cooperation with the institute for health behavioral research, the national institute of health, the ministry of health, and the institute of gerontology, universiti putra malaysia (upm). the research included 1210 elderly with dementia who were malaysian population aged 60 years and above living in noninstitutional places. the elderly residing in institutions and bedridden were excluded and were not recruited into the study. the data were collected by trained interviewers and the average duration of interview lasted approximately 60 minutes. samples represented the malaysian population in terms of age and were collected from peninsular malaysia that was divided into four zones of north, south, west, and central. the current study determined the effects of age, ethnicity, disability, marital status, physical activity, sex differences, educational level, environmental condition, and functional status on the risk of falls. in this study, minimental score less than 26 in addition, the definition of falls was according to the international classification of diseases (icd-9), which excluded falls due to the loss of consciousness, epileptic seizure, and sudden onset of paralysis such as stroke. history of falls was referred to as having at least one fall, at day or night time, during the past six months. the environmental settings were evaluated based on qualities and facilities found in the living places of subjects [10, 20 ]. the condition of environment was related to strength, lighting, ventilation, noise, cleanliness, sanitation, electrical supply, water supply, and toilet types in places. functional status was measured by get up and go test (gugt) [21, 22 ], which was based on the ability to rise from a chair, walk three meters, turn, and return to the chair. the measurement of disability was by the schedule of 12-item who - das ii classified from the international classification of functioning (icf), disability and health. the prevalence of falls was calculated for whole samples in regard to their age, ethnicity, disability, marital status, physical activity, educational level, sex differences, functional status, and environmental conditions. bivariate analysis was applied using a series of chi square tests to examine the association of each variable with the risk of falls in the elderly with dementia. the multiple logistic regression analysis was used to identify the effects of age, ethnicity, disability, sex differences, marital status, educational level, environmental conditions, functional status, and physical activity on the risk of falls in respondents. odds ratios (or) with 95% confidence intervals (95% ci) were computed. the critical level for rejection of the null hypothesis all analyses were performed using the statistical package for the ibm social sciences (spss) software version 20.0 (chicago, il, usa). analysis was carried out on data from 1210 respondents who were the malaysian elderly with dementia. the prevalence of falls among respondents was 17% (95% ci : 15.0119.24) (table 1). the results showed that the risk of falls in the environments with lower quality (23.6%) was higher than that in the environments with higher quality (15.1%). furthermore, the percentage of falls was as high as 12.7% for samples who live in the environment with higher facility and 17.7% for those in the environment with lower facility. the findings indicated that disability (20.4%) increased the risk of falls more than normal ability (15.4%). in addition, the risk of falls in functional decline (22.9%) was higher than that in the normal functional status (13.6%). the proportion of falls in samples with low physical activity (18.3%) was higher than that among those with moderate to high physical activity (15.4%). it was found that the prevalence of falls was 19.4% in single subjects and 14.2% in married subjects. females (18.3%) experienced a higher rate of falls compared to males (14.8%). the prevalence of falls was 14.7% among respondents with education and 18.5% among those with no education. among the samples, the results of bivariate analysis showed that the likelihood of falls is not uniform across the elderly with dementia. the findings of chi square tests among respondents showed that the risk of falls significantly associated with ethnicity (= 10.20, p = 0.001), disability (= 4.18, p = 0.026), the environmental quality (= 11.05, p = 0.001), marital status (= 5.75, p = 0.010), and functional decline (= 14.44, p = 0.001). it was found that the risk of falls was not significantly affected by the environmental facility, physical activity, sex differences, and educational level (p > 0.05) (table 2). the results of multivariate logistic regression analysis showed the significant effects of ethnicity (p = 0.002), functional decline (p = 0.019), and the environmental quality (p = 0.011) on the risk of falls in older people with dementia. the results indicated that age, disability, physical activity, educational level, marital status, sex differences, and the environmental facility were not significant predictors of risk for having fall in subjects (p > 0.05). although functional decline (or = 1.67, 95% ci : 1.092.57) and non - malay ethnicity (or = 1.73, 95% ci : 1.222.45) significantly increased the risk of falls, the improved environmental quality (or = 0.64, 95% ci : 0.450.90) reduced the rate of falls in respondents (table 3). the elderly with dementia experience falls four to five times more than those without cognitive problems [1, 24 ] which is because of the impairment of judgment, orientation, and visuospatial perception. in addition, the risk of falls in the elderly associates with age related changes in the body systems, functional status, physical activity, and environmental conditions. the current study investigated the effects of age, ethnicity, disability, marital status, physical activity, sex differences, educational level, functional status, and the environmental conditions on the risk of falls in the malaysian elderly with dementia. the results showed that ethnicity, functional status, and the environmental quality significantly predicted the risk of falls. the increased risk of falls probably was due to cognitive impairment, balance problems, and insufficient mobility. medications, cognitive decline, physical problems, psychological conditions, vision problems, and orthostatic blood pressure can elevate the risk of falls due to mobility deficits and the effect on balance in subjects. our findings were in line with the existing reports indicating a direct correlation between functional decline and further risk of falls in the elderly [7, 21, 26 ]. the results showed that the increased environmental quality decreased the risk of falls in demented elderly. it sounds that an appropriate environmental quality potentially helps respondents to overcome deficits in physical fitness and cognitive abilities posed by dementia and therefore reduces the risk of falls [10, 12 ]. surprisingly, physical activity, disability, and the environmental facility had no significant effects on the risk of falls in the malaysian elderly with dementia. apparently, the influence of environmental facility on the risk of falls depends on the kind of hazards and functional decline. furthermore, the risky behaviors of respondents and their attitudes can potentially enhance the risk of falls. meanwhile, the lack of a uniform scientific definition for potential hazards and a standardized identification as well as diverse instrumental assessments may affect results. the present study confirmed an earlier research [5, 16, 2830 ] indicating no significant relationship between physical activity and increased risk of falls. it seems that the effect of physical activity is probably associated with the amount of physical activity and the type of activity. in addition, income, sex differences, marital status, educational level, and the environmental quality are possible confounding factors to interact between physical activity and cognition when considering the risk of falls among demented elderly. such effect was probably due to the differences in physical, behavioral, environmental, and social factors among subjects. disability associates with health [10, 13 ] and age related loss of physical conditions. therefore, disability accompanies less functions, activities, and participation of demented elderly in dangerous situations and reduces the risk of falls consequently. our research confirmed the reported direct correlation between ethnicity and the risk of falls in the elderly [1, 7, 32 ] which was contrary to some reports [3335 ]. such inconsistency in results is probably due to the differences in predisposition, lifestyle, and cultures. in addition, correlation of age to the risk of falls in earlier reports [1, 9, 37, 38 ] was found unlikely in our research. lack of such link in subjects can be explained by the influences of contributing factors interfering with the effects of age on the risk of falls. in this study, marital status, sex differences, and educational level did not predict probability of falls in respondents. while several previous research [1, 7, 39 ] indicated no correlation between sex differences and the risk of falls, bueno - cavanillas and colleagues found a similar pattern to our findings. contrary to our research, marital status and educational level [1, 7, 41, 42 ] have been reported to have impacts on the rate of falls among elderly. such disparity is probably due to interfering and influencing factors such as income, supplement intake, social support, sleep disorders, and the environmental quality on the risk of falls in the elderly with dementia. as falls can cause much burden and costs in demented elderly and their caregivers [45, 46 ], further investigations are needed to identify all possible risk factors associated with dementia. we concluded that ethnicity, functional status, and the environmental quality significantly predicted the risk of falls in the elderly with dementia. it was found that functional decline and ethnic non - malay increased the risk of falls. furthermore, the increased environmental quality reduced the likelihood of falls. increased knowledge about dementia as fall is a major health issue in the elderly and dementia, further studies are required to find out the way to prevent or reduce falls in the older individuals with dementia. such findings help to reduce cost and burden on demented elderly and provide them with a healthy life. furthermore, the presence of cognitive decline and high prevalence of comorbidities in respondents could interrupt the identification of certain causes of falls. | this study aimed to determine the effects of disability, physical activity, and functional status as well as environmental conditions on the risk of falls among the elderly with dementia after adjusting for sociodemographic factors. data were derived from a group including 1210 malaysian elderly who were demented and noninstitutionalized. the study was a national cross - sectional survey that was entitled determinants of health status among older malaysians. approximately 17% of subjects experienced falls. the results showed that ethnic non - malay (or = 1.73) and functional decline (or = 1.67) significantly increased the risk of falls in samples (p 0.05). it was concluded that functional decline and ethnic non - malay increased the risk of falls but the increased environmental quality reduced falls. |
among diseases, cancer has the highest rate of mortality worldwide. prevention and early diagnosis of cancer it is now well established that diet has a significant effect on cancer incidences.1 for many years food was accepted as the source of all nutrients required to accomplish the physiological functions needed for development, growth, health, and reproduction. for humans, macronutrients like na, ca, mg, k, and cl are required in large quantity, whereas trace elements (te) like cr, mn, fe, co, cu, zn and mo are required in quantities of less than 100 mg per day and are called micronutrients.2 it has been observed that an imbalance of tes is one of the significant causative factors for diseases.3,4 further, there is a strong association between macronutrients and tes resulting in the buildup of toxic or carcinogenic metals at the expense of macronutrients, leading to cancer.59 deficiency in any trace element leads to undesirable pathological conditions that can be prevented or reversed by adequate supplementation. however, supplementation should be carefully administered given the toxic effects of tes when taken in excess of the required amount. in order to prevent excess consumption of te, a tolerable upper intake level (tuil), the highest level of nutrient that is likely to pose no risk to the general population, has been prescribed by the u.s. food and nutrition board of the institute of medicine10 for mn, fe, cu, zn and se and not for any other elements. the risk of adverse effects also increases with any intake above the tuil.11 however, the estimates made for tuils is based on a risk assessment model with varying uncertainty factors and never considered the initial concentration of te in each individual.12 furthermore, the risk assessment model never considered the complex interaction among nutrients13 or drug nutrient interactions, and hence requires scientific validation.11 the variation in concentration of some of tes in the blood when compared to their inherent initial concentration is used for cancer screening on an individual by individual basis. the existence of this inherent initial concentration leads to a correlation among the tes and forms a dynamic balance due to complex interactions among them. the existing chemometric techniques like multivariate linear regressions (mlr), step wise regression, principal component analysis (pca), artificial neural networks (anns), and backpropagation neural networks (bpnn) are unable to predict the initial concentration of tes and hence do not provide satisfactory results for cancer screening.14,15 furthermore, supplementation in order to treat a particular disease should consider the toxic levels of all the other tes16 that these chemometric techniques fail to account. in this paper, instead of estimating the initial concentration, we propose an information theory based expert system (es) for estimating the lowest limit of toxicity association (llta) for cancer screening, supplementation, and mitigation of toxicity of te. medicinal doctors admit that they are still doing evidential medicine instead of making diagnosis based on hard facts, whereas an es can guide them in their decision.17 as carcinogenic toxic tes build up at the expense of macronutrients, leading to cancer, the es estimates the llta between the macro and micronutrients. the es is based on minimizing the total toxicity of any particular te by decreasing its association with the macro and micronutrients in blood samples. the es considers the dynamic environment of interacting tes and minimizes the total toxicity using the information theoretic concept of mutual information (mi). mi is a generalized measure of correlation, analogous to a linear correlation coefficient, but is sensitive to non - linear dependencies between tes. in particular, a vanishing mi implies that the toxicity among the nutrients are independent, but not so with vanishing pearson coefficient.18 thus mi provides a general measure of association between nutrients that is applicable regardless of the shape of their concentration distribution. furthermore mi, unlike linear or rank order correlation, is insensitive to non - monotonic dependence between macro and micro nutrients.19 the es is based on an algorithm maximizing the mi by estimating the bounds for the correlated information between nutrients, using the technique of determinant inequalities (tdi) developed by the authors.20 this technique is unlike other es which are restricted to a group of compounds having similar structure.21 the advantage of the es is that for any specific treatment due to toxicity of a particular te, its llta for the rest of the macro and micronutrients are computed so that a complete toxic fingerprint of the entire te in the body is available to the physician. such a fingerprint would enable the physician to prescribe required medication containing the macronutrients to annul the toxicity of cancer risk te.22 we demonstrate the superiority of our es based on mi over the principal component analysis (pca) in the analysis of a blood sample. we first formulate the relationship between toxicity and the concentration of the nutrients using covariance information. as the interaction between tes and macronutrients are stronger in cancer risk groups, we then use the information theoretic concept of mi to depict the strong correlation between them. we then deal with tdi to maximize the mi and the algorithm developed to estimate llta. the flow chart for cancer screening is depicted in flow chart 1 ; the flow chart 2 portrays cancer management with macronutrients. let ci (i = 1,, n) be the concentration of each of the n macronutrients, cj (j = 1,, n) be the concentration of each of the n te, and let ti and tj be respective toxicity. we can write, (1)ti = ti(ci) using the first order perturbation theory, we can calculate any change in ti due to small changes in dci of ci as (2)dti=iticidci using the notation t = (dt / t) and c = (dc / c) the relative variance - covariance in t is usually obtained as (titj) and can be expressed using eq. (2) as (3)(ti tj)=b(ci cj)btp the value of (t/c) c / t, which is linear under our linear perturbation theory and constant over the chosen statistical ensemble, is called relative sensitivity matrix b, ie, b = (t/c) c / t. the linearity of the sensitivity data ensures the covariance data are not independent. in eq. (3) the product of the concentrations (cicj) is the basic definition of the covariance matrix mc and hence, eq. (3) can be rewritten as mt = b mcb where mt = (titj) is the relative variance covariance matrix for t and b is the transpose of b. the correlation coefficient ij between the concentration ci and cj is defined as (4)ij=[cov(ci, cj)/{var.(ci)}0.5{var.(cj)}0.5 ] ij vary between + 1 and 1 and is a measure of strength of the association between the concentrations of the nutrients. any decrease in ij from its present value indicates the decrease in the strength of association between the concentrations of the nutrients and hence the toxicities among them, as per eq. the strength of the association among the nutrients vanishes and the toxicities become independent when ij = 0. let, t1, t2 be toxicities of any two nutrients whose corresponding concentrations are c1 and c2 respectively in the blood. the uncertainty in t1 given the knowledge of t2 is given by the conditional entropy h(t1|t2). the uncertainty of the pair t1, t2 is measured by joint entropy h(t1,t2). mutual information, mi(t1,t2) is defined as the reduction of the uncertainty in t1 due to knowledge of t2 (or vice versa) ie, (5)mi(t1,t2)=h(t1)h(t1|t2)=h(t2)h(t2|t1)=h(t1)+h(t2)h(t1,t2) mi(t1,t2) for two variables is always a non - negative quantity and it is zero only when the toxicities t1 and t2 is independent. when mi(t1,t2) = 0, then h(t1) + h(t2) = h(t1,t2)the joint entropy of total toxicity is the sum of the individual entropy of toxicities and is the maximum toxic limit. thus, the joint entropy of total toxicity is less than the sum of the individual entropy of toxicities. figure 1 depicts pictorially the association and independence of toxicities for mi(t1,t2) > 0 and mi(t1,t2) = 0 respectively. | is the absolute value of the determinant of the correlation matrix. thus, mi(t1,t2) is a measure of statistical correlation of toxicities between the nutrients t1 and t2which depends on the absolute value of the determinant of the correlation matrix and mi(t1,t2) is maximum when g is made maximum. for example, when, =(112211) where 12 is the correlation coefficient between c1 and c2, and g = | det. thus, by maximizing g from knowledge of the bounds for the correlated elements of, the strength of the association between the nutrients is minimized. minimization of the strength of the association leads minimization of total toxicities between the nutrients as previously mentioned and depicted in figure 1 in the case where mi(t1,t2) > 0. thus, an index of minimization of total toxicities between two correlated nutrients is the maximization of mi or g by the estimation of upper and lower bounds for the correlated elements of the correlation matrix. the particular bound value of ij yields the maximum g results in llta. hence, our technique gives a scientific validation for the estimation of t0 (or the llta having concentration c0) and thus forms the basis for screening, supplementation, and mitigation of toxicity of te. the algorithm developed by us to determine the upper and lower bounds of the correlated elements for the correlation matrix is done using a technique of determinant inequalities (tdi) is described below. information theory is endowed with a multitude of powerful theorems for computing bounds on the optimum representation and transmission of information bearing channels. here, we develop the technique of determinant inequalities to estimate the upper and lower bounds for the constant inherent initial toxicity t0, which has concentration c0 in the blood samples and causes correlation or bias. a rigorous estimate of bounds is provided by the upper and lower bounds, u and l respectively, such that u c0 l. this constant bias appears in one or several elements of the determinant g. let us suppose the sign of the determinant g can be determined. then g can be considered as a polynomial in c0 ie, g = g(c0) and the roots of the determinant function g(c0) = 0 enable us to estimate the permissible values of c0 ; hence the upper and lower bounds can be determined. thus to determine the bounds on c0, two conditions must be met the sign of the determinant g has to be known and the roots of the polynomial g(c0) = 0 should be determined. the determinant g is positive when ij = 0. in this case, only the uncorrelated diagonal elements of exist. such a determinant is called a gram determinant, or gramian, and its positivity is expressed as an inequality (7)g0 the upper and lower bounds are determined by solving the polynomial equation g (c0) = 0. for the purpose of illustration, let us consider a (33) correlation matrix with elements of as follows. 0 requires that 1232122 + 21213231320 from the above equation, it is clear that 12 must lie between two roots of the quadratic equation, which constitute the upper, and lower bounds of 12. let us designate, gi : determinant with ith row and column deleted, gij : determinant with ith and jth row and column deleted, (note that when g has only two rows and columns then g12= 1)gii : determinant with ii=0,gij : determinant with ij = 0, and row j and column i deleted. gi : determinant with ith row and column deleted, gij : determinant with ith and jth row and column deleted, (note that when g has only two rows and columns then g12= 1) gii : determinant with ii=0, gij : determinant with ij = 0, and row j and column i deleted. according to eq. (7), g 0 and hence gi and gij are also gram determinants of lower order. thus g 0, gi > 0, gij > 0 and we can establish the following inequalities : ij+(gii / gi)0,(g+ij)(ijg)0where g = { (1) gij (gigj)}/gij. thus for the uncorrelated component, the lower bound is ii gii / gi, while for the correlated component the upper and lower bounds are (8)g+ijg according to hadamard s inequality, g = det. the maximum value of the determinant is the product of the diagonal elements and the least value is zero, when ij is either + 1 or 1. since, the mi can not be negative, the value of either the upper or the lower bound of ij which maximizes the determinant g is the robust value which maximizes the mi. blood samples from 100 patients, consisting of 58 women and 42 men from ages ranging between 20 and 80, were collected in this study. extreme precaution was taken in the collection of these samples in order to prevent contamination from the exogenous trace element (te). for each of the blood samples, multi - element concentrations were estimated using neutron activation analysis (naa). naa is an attractive technique for rapid multi - element analysis of biological samples.25 the multi - element data, which is the concentration of the macronutrients and the te for the above 100 patients, was reduced to correlation matrix using the standard chemometric procedures.26 the concentration correlation matrix for eleven elements in blood plasma is depicted in table 1. among these eleven, we focused our attention on the te cr, intake of which increases breast cancer mortality.16 in table 2, the lower bound values of ij for ten elements which have correlation with cr are obtained using eq. it is observed that only the lower bound values yield the maximum value of g. the values of obtained by the pca are also tabulated in table 2 for comparison. the estimation of lower bounds for as depicted in table 2 is also very low compared to the existing value of elements. as lower values of leads to decreased toxicities between the macro and the te, these lower bound values represent the llta. further, mi as represented by the value of g is 0.07 for lower bound values as compared to 0.01 for the existing elements. the sequence of screening is depicted serially from 1 to 5 as follows : (1) we collect the blood sample of the patients ; (2) we subject these blood samples to naa ; (3) the naa enables us to determine the elemental concentration of both the macronutrients and the te ; (4) using these concentration values, we generate the correlation matrix using chemometric techniques ; and (5) as te builds up at the expense of macronutrients, we examine critically the value of correlation coefficient of cancer causing te with the macronutrients. these correlation matrix are the input data to our technique of determinant inequalities (tdi). upper bound (ub) and lower bound (lb) values for each of correlation coefficients are generated by tdi. the values of either the (ub) or the (lb) which gives the highest value of mutual information (mi) is used for supplementation of macronutrients. the variation in concentration of tes in the blood from inherent initial concentrations is an indication of malignancies and is used for cancer screening and diagnosis in individuals. all existing chemometric techniques like mlr, pca, anns, and bpnn do not provide initial inherent concentration c0 and hence their concentration estimation does not provide satisfactory results for cancer screening. furthermore, the above techniques are suitable only for weekly correlated systems and unsuitable for processing the complex and strong correlations between macronutrients and tes. as carcinogenic toxic tes build up at the expense of macronutrients, we have proposed an expert system (es) for cancer screening which involves minimizing the strength of the association between macronutrients and tes using mi. mi is maximum for a higher value of g, leading to least association of toxicities. hence, our technique gives a scientific validation for the estimation of t0 or the llta having concentration c0. it therefore forms the basis for screening, supplementation, and mitigation of toxicity of tes. furthermore, from table 2, the lower bound values are all much lower compared to pca. as pca values are higher, they do not lead to decreased association between the macronutrient and the tes and accordingly can not be used to predict llta. thus, selective mitigation of toxicity of a specific te is possible by decreasing its association with the other macro and micronutrients, using an algorithm based on mi. even though we have chosen cr for selective mitigation, our algorithm enables us to obtain the bounds for each of the tes so that their association with the other elements can be selectively decreased by maximization of mi. such te - wise mitigation of toxicity is possible only by mi and not by either pca or independent component analysis (ica). as regards supplementation, a careful analysis of table 2 would reveal that the lower bound values are all anti - correlated compared to existing values, which in only some cases are anti - correlated. as mentioned earlier, when macronutrients are consumed by humans in large quantities, because of their anti - correlation with tes, they reduce the toxicity of te. thus, in the above case, the patient who consumes mg, fe and zn in large quantities would not be at risk of breast cancer due to cr toxicity. the llta value gives a scientific proof for supplementation of mg, fe, and zn to boost the immune system against cancer. most expert systems provide prediction of toxicity only for a restricted group of compounds based on quantitative structure activity relationships (qsar) and never provide toxicity profile for all of the elements present in a sample. unlike those based on qsar, our expert system is not restricted to specific compounds but rather provides the llta for all tes that are in association with any of micro and macronutrients. | cancer risk management involves obliterating excess concentration of cancer causing trace elements by the natural immune system and hence intake of nutritious diet is of paramount importance. human diet should consist of essential macronutrients that have to be consumed in large quantities and trace elements are to be consumed in very little amount. as some of these trace elements are causative factors for various types of cancer and build up at the expense of macronutrients, cancer risk management of these trace elements should be based on their initial concentration in the blood of each individual and not on their tolerable upper intake level. we propose an information theory based expert system (es) for estimating the lowest limit of toxicity association between the trace elements and the macronutrients. such an estimate would enable the physician to prescribe required medication containing the macronutrients to annul the toxicity of cancer risk trace elements. the lowest limit of toxicity association is achieved by minimizing the correlated information of the concentration correlation matrix using the concept of mutual information (mi) and an algorithm based on a technique of determinant inequalities (tdi) developed by the authors. the novelty of our es is that it provides the lowest limit of toxicity profile for all trace elements in the blood not restricted to a group of compounds having similar structure. we demonstrate the superiority our algorithm over principal component analysis in mitigating trace element toxicity in blood samples. |
mixed martial arts (mma) is a well - known sport that uses various real fighting techniques and allows fighters to take down their opponents by utilizing chopping, punching, and grappling techniques1. in the early period, mma was considered an intense and dangerous sport, and was widely recognized as violent2, 3. however, the violent aspects of the sport have been responsible for its growing popularity and vitalization over the last few yeares4. mma is an exciting and fast - paced sport and it is expected to attract not only athletes but also spectators who prefer dynamic sports. despite its popularity, some medical organizations, including the american medical association, recommend the total ban of the sport because of its dangerous and lethal nature5. mma involves intensive sparring and learning techniques, practice, and participation in competition and thus carries risks of various types of injuries are possible. moreover, this sport is associated with extreme physical injury to the opponent and confers a significant risk of brain injury6. therefore, the risk of injury and the types of injuries related to mma competitions should be investigated in order to identify the cause and risk factors of injuries. however, the empirical analysis of injuries associated with mma has been relatively limited7. the purpose of the present research was to examine the types of injuries associated with mma and their locations in order to provide substantial information to help decrease the risk of these injuries during mma. the study included 470 mma athletes who practiced mma or who participated in mma competitions in the seoul metropolitan city and gyeongnam province of korea between june 3, 2015 and november 6, 2015. the study considered for inclusion only participants who had visited a medical institution more than thrice and were diagnosed with injuries. the convenient sampling method was used, based on the non - probability sampling extraction method. before data collection, the purpose of the study was explicitly addressed, and all the participants provided consent for data collection. the responses to the questionnaire items were kept confidential in any circumstance. by using the questionnaire, data on age, sex, length of participation, the length of participation was categorized as follows : 1) less than 1 year, 2) 1 to 3 years, and 3) more than 3 years. for the categorization of injury diagnosis and injury locations, the scales developed by kazemi. in 2009 were adopted8. based on these criteria, the injury locations were divided into head, foot, thigh, knee, ankle, trunk, wrist, forearm, and other body parts, and injury diagnoses were categorized as contusions, sprains, strains, fractures, joint dysfunction, and brain concussion. after completing the survey, all the questionnaires were examined in detail, and incorrect and incomplete questionnaires were excluded. of the 470 questionnaires, 15 that contained untrustworthy information were excluded. of the participants, 455 completed the questionnaire, of whom 438 were male and 17 were female. the high number of male participants than female participants can be attributed to the fact that female mma athletes in korea are few. the characteristics of the participants are presented in table 1table 1.subjects characteristics (n=455)categoryfrequency%age (years)1019132.9202928462.43015834.7gendermale43896.3female173.7length of participation (years)323752.1. the injuries were registered by using a binary multiple response method. the most frequent injury location was the arm (n=253), followed by the neck (n=146), head (n=118), hand (n=71), wrist (n=65), shoulder (n=37), and thigh (n=30). the injury diagnoses medically confirmed by physicians are presented in table 3table 3.injury diagnosesdiagnosisfrequency%laceration32137.3concussion17920.8contusion14216.5fracture536.2strain516.0joint dysfunction455.2sprain252.9dislocation202.3epistaxis151.8other91.0total860100.0. the most frequent injury type was laceration (n=321), followed by concussion (n=179), contusion (n=142), fracture (n=53), strain (n=51), joint dysfunction (n=45), sprain (n=25), and dislocation (n=20). the aim of this research was to provide information on what mainstreams injuries occurred in mma competitions among participants or coaches by inquiring about the types of injury and medical diagnoses and thereby help them efficiently prevent or manage injuries that occur during competitions. the present study found that the main locations of the injuries during mma were the upper extremities, neck, and head, indicating the difference in style between mma and other martial arts. martial arts such as taekwondo, which is globally renowned9, 10, involve extensive use of the legs for kicking, while mma involves extensive use of the hands for punching to score points. for achieving a knockout, the head is targeted in mma, making it a high - risk location for injuries. the injury patterns in mma are generally considered as similar to those in other combat sports. however, as mma includes various types of martial arts, the risk of injury is higher in mma than in other combat sports11. complex skills and high level of power are required in mma ; therefore, the risk of injury is high. the findings of the present study are consistent with those of previous studies that showed that the most frequent location of injuries during mma was the upper extremities12, 13. in the present study, laceration was the most frequent injury type, and this finding is consistent with the finding of a previous study12. during mma competitions, athletes commonly exchange high - intensity punches, which increase the risk of laceration. concussive injuries and head trauma are important injuries in mma14. in the present study, fractures and strains were not common. if the risks of injury during mma are ignored, athletes might experience many different severe injuries, and repetitive and severe injuries could cause permanent disability, especially in athletes who have been participating in mma competitions for a long time. in conclusion, the upper extremities, neck, and head might be the most common locations of injuries, and lacerations, concussion, and contusions might be the most common diagnoses of injuries in competitive mma athletes. reducing the risk of injury by establishing alert systems and preventing critical injuries by incorporating safety measures are important. for instance, substantial and periodic education about causes and types of injuries, and how to avoid or reduce the risk of injuries during competitions will be alternatives. | [purpose ] the purpose of the present study was to examine the types of injuries associated with mixed martial arts and their location in order to provide substantial information to help reduce the risk of these injuries during mixed martial arts. [subjects and methods ] data were collected from 455 mixed martial arts athletes who practiced mixed martial arts or who participated in mixed martial arts competitions in the seoul metropolitan city and gyeongnam province of korea between june 3, 2015, and november 6, 2015. questionnaires were used to collect the data. the convenience sampling method was used, based on the non - probability sampling extraction method. [results ] the arm, neck, and head were the most frequent locations of the injuries ; and lacerations, concussions, and contusions were the most frequently diagnosed types of injuries in the mixed martial arts athletes in this study. [conclusion ] reducing the risk of injury by establishing an alert system and preventing critical injuries by incorporating safety measures are important. |
young adults attending college demonstrate an even greater trajectory of weight gain (i.e., 1.84.1 kg) [25 ]. importantly, weight gain, rather than initial weight status, leads to adverse changes in cardiovascular disease risk factors and the metabolic syndrome among young adults. given the large number of young adults attending college or university each year and the health implications of weight gain in this population, the early college years appear to be a critical period for promoting weight management. prior research in college students using qualitative interviews and focus groups indicated that, during high school, healthy meals and regular exercise were part of a student 's routine, but these positive health behaviors appear to decline during the transition to college. thus, weight gain prevention efforts targeting this population should not only provide education on healthy diet and physical activity behaviors, but also instill skills in goal setting, planning, and self - monitoring, while incorporating social and environmental support to facilitate adherence and maintenance of healthy behaviors. in the young adult population, low - intensity (i.e., limited or no intervention contact such as monthly phone calls or newsletters) and knowledge - only approaches that do not include recommendations for energy intake reduction do not appear to be effective in preventing weight gain [810 ]. high - intensity (i.e., frequent contact : 5 sessions / week for 16 months ; twice weekly for 15 weeks ; twice per month for two months, monthly thereafter for two years) interventions that include regular group sessions or supervised exercise have been successful in producing weight maintenance in this population ; however, high - intensity approaches require significant time for both participants and program staff, and extensive program resources. previous interventions in this area have also focused on daily weighing without nutrition or physical activity education, increasing physical activity without including a dietary component (project grad), and short - term (6-week) social cognitive theory - based internet - based education and feedback addressing healthy eating and exercise. gow. reported that an internet behavioral intervention combined with weight and caloric feedback was successful in maintaining body mass index (bmi) in college freshmen ; however, this study was conducted over a short - time period and had overall retention rates of 68.6%. internet - based interventions promoting weight gain prevention that include social cognitive determinants have been successful in other populations such as high - school females and middle - aged adults [16, 17 ]. however, specific challenges that must be addressed in developing weight management interventions for the young adult population include program participation and retention [18, 19 ]. formative work in this population revealed that academic course credit and monetary incentives would increase student 's interest in an intervention program. previous investigations that have offered course credit as an incentive have differed in course content and intervention protocol. enrolled female college freshmen into one of two groups : a nutrition science course or a control group (no course). neither group experienced weight changes throughout the 16-month study so weight outcomes could not be attributed to the intervention alone. enrolled university seniors in one of two courses for credit : a physical activity intervention focusing on methods of behavioral self - management or a knowledge - oriented control course. this intervention focused primarily on physical activity measures alone without a nutritional component, and weight management outcomes were not assessed. these studies suggest that course credit offered as an incentive may increase initial participation rates within this population, but the effect on weight outcomes is unknown. while monetary incentives may improve participation rates and weight management outcomes in the general adult population, this intervention component has not been evaluated in college - aged adults. a number of studies described above used a social cognitive theory - based intervention that focused on promoting positive outcome expectations and self - efficacy, to varying results [8, 13, 15 ]. to our knowledge, an intervention targeting weight gain prevention among college freshman, which includes strategies aimed at instilling individual self - regulation (e.g., self - monitoring, goal setting, modest financial incentives as feedback), as well as physical and social environmental support for healthy lifestyle behaviors, has not been conducted. further, these self - regulation strategies when combined with intervention content that targets outcome expectations and self - efficacy could possibly be the key to intervention success [23, 24 ]. therefore, the purpose of this investigation was to evaluate the feasibility, acceptability, and preliminary efficacy of a moderate - intensity, social cognitive theory - based intervention utilizing the internet and in - class sessions that would incorporate these self - regulation components to prevent weight gain in college freshmen and to compare this intervention approach to a social cognitive theory - based approach with a similar amount of contact, but without an explicit focus on self - regulation skills. normal weight, overweight, or obese (body mass index [bmi ] 1840 kg / m) first - time freshmen living on campus were recruited from three dormitories on the university campus. (i.e., the week prior to the onset of fall semester classes). both active and passive recruitment methods were used. active methods included enlisting resident advisors (ras) from each dormitory to personally invite residents to attend a group information recruitment session led by the study coordinators (ed, kp). ras were enlisted using email advertisements sent to dormitory supervisors, and ra recruitment incentives were used to both recruit and retain study participants. those successful in recruiting residents who completed baseline and posttesting were compensated $ 10 per resident. passive recruitment methods included posting study fliers in dormitories and word - of - mouth. individuals were excluded if they were 40 kg / m) were ineligible due to the weight and size limit of the dual - energy x - ray absorptiometer (dxa) table and due to clinical obesity treatment guidelines which recommend substantial weight loss. the study protocol was approved by the university 's institutional review board, and all participants provided written informed consent prior to study enrollment. students were informed that the purpose of the study was to determine the effectiveness of two weight control programs developed for college freshmen. individuals meeting enrollment criteria completed baseline laboratory assessments, which included measurement of height, weight, body composition, and habitual dietary intake and physical activity level. height was measured in centimeters without shoes using a wall - mounted stadiometer, and body weight was measured to the nearest 0.1 kg using a digital scale with participants wearing light clothing (shorts, t - shirt) and no shoes (scale - tronic model 5002, wheaton, il). percentage body fat, absolute fat mass, and fat - free mass were measured using dxa (ge lunar prodigy ; ge healthcare, madison, wi) ; this unit is able to precisely determine lean body mass (root mean squared error value of 0.24 kg). habitual dietary intake was assessed using the average of three multiple pass 24-hour recalls ; the multiple pass recall method is able to determine energy intake to within 810% of actual energy intake in both men and women [27, 28 ]. the first recall was done in person at the laboratory session, and the second and third were done via telephone ; recalls were collected within a two - week period by a trained research assistant. participants were provided with two - dimensional food models to assist in portion size determination. recalls were analyzed using dietary analysis software (nds - r 4.05 ; university of minnesota, minneapolis, mn). habitual physical activity was measured in minutes per week of mild, moderate, and strenuous activity, as well as hours per weekday / weekend day of sedentary activity using a measure that has demonstrated validity, reliability, and sensitivity to change when compared to objective measures. participants also completed a health beliefs survey ; this questionnaire assesses social cognitive theory determinants of diet and physical activity behaviors and has adequate to high internal consistencies (cronbach 's = 0.680.90). following completion of baseline assessments, students were randomly assigned to either a social cognitive theory - based (sct) or a social cognitive theory plus self - regulation skills training - based (sctsr) 1-credit pass / fail course and were enrolled during the fall semester of 2009. of the 45 students randomized to the courses, only 2 students knew each other (they were randomly assigned to separate groups). both courses provided an equal number of online modules and biweekly in - class sessions (50 min / session) with an instructor (m.s. or ph.d.- level graduate student in nutrition / exercise science), which lasted throughout the 14-week semester. students in each course received equal amounts of in - person contact with the course instructor. each module was followed by completion of a required in - class quiz. the sct course modules (figure 1) focused on outcome expectations by providing knowledge about healthy eating, physical activity, and their benefits ; in - class sessions reinforced outcome expectations and focused self - efficacy through physical activity and nutrition lessons and experiential activities. the sctsr course modules provided information about healthy eating and benefits of physical activity (figure 1) but included self - regulation features. our approach to self - regulation was based the conceptualization that it includes three general categories self - monitoring (and the social and cognitive conditions under which one engages in self - monitoring), goal setting, and enlisting self - motivating supports and incentives to sustain health behaviors. specifically, course content and modules included information to assist students with planning and tracking, sample meal plans using foods available at university dining facilities as well as off - campus fast food restaurants, sample workout plans that could be followed at on - campus fitness facilities, and weekly emails that provided information on focused on self - regulation strategies related to diet and physical activity behaviors. for example, email content focused on self - regulatory skills related to portion control, tracking eating behaviors such as fruit / vegetable consumption, and self - monitoring of physical activity. (411fit, unc charlotte, charlotte, nc) to log daily diet / activity behaviors. to receive a passing grade for the self - regulation component of the course (15% of total grade), sctsr students were required to complete online diet and physical activity tracking for at least 70% of total number of assigned days, as follows : two weeks in month 1, one week per month in months 24 (i.e., 25 of 35 assigned days). in addition to encouraging the development of planning and tracking skills, in - class sessions included content on goal setting and overcoming barriers to healthy eating and performing physical activity. during the class sessions and following each of the assignments that encouraged self - regulation skills, participants were provided with feedback on their progress and encouraged to make appropriate changes to their goals and planning strategies based on degree of successful attainment. participants in the sctsr course were also offered monetary incentives for maintaining their body weight (or for maintaining body fat, if weight increased due to lean mass gains) throughout the semester. this incentive was used as a reflection of self - motivating incentives based upon our preliminary qualitative work where college students indicated that financial incentives would be motivational. it could also be argued that incentives align with outcome expectations and may have been an appropriate component for the sct intervention arm. however, the alignment of incentives with goal setting and feedback (clear self - regulatory strategies) would have resulted in sct participants explicitly setting goals thereby minimizing the difference between conditions. sctsr participants were weighed monthly during a brief, 10-minute laboratory session (figure 1) and offered $ 5, $ 10, and $ 15 for weight maintenance at months 1, 2, and 3, respectively, for a total of $ 30 if individuals maintained weight during the entire semester and attended each monthly weigh - in. these modest incentives were intended to align with the goal of weight gain prevention as a method to provide timely feedback and encourage continued attention to the goal. following the intervention at the end of the semester, participants repeated baseline measurements (body weight and composition, three 24-hour food intake recalls, self - reported physical activity level, health beliefs survey). all participants were compensated $ 20 if they completed both pre- and posttesting measurements. participants were also asked to disclose friends or other known acquaintances prior to starting the intervention who were in a different group to assess possible contamination, and they completed an online open - ended survey at the end of the semester to evaluate the acceptability of intervention features and overall course experience. baseline group demographic characteristics were assessed using independent sample t - tests for continuous variables and chi - square tests for frequency variables (gender) (spss versus 12.0 for windows, spss inc, chicago, il). repeated measures anova were used to assess group and time differences for subjects completing the intervention. associations among variables were assessed by simple bivariate correlational analyses (pearson 's r). due to the sample size and exploratory nature of the trial, we set an a priori level of significance at p 50% of students in the sctsr class remarked to the instructor that the required online tracking (411fit) was excessive in terms of time required. among young adults (aged 1825 years), the college transition represents a critical period for establishing and maintaining a healthy weight. yet the challenges of recruiting young adults to participate in weight management interventions and in retention rates have been recognized [18, 19 ]. the purpose of this investigation was to evaluate the feasibility, acceptability, and preliminary efficacy of two moderate - intensity interventions created to prevent weight gain in college freshmen. an additional purpose was to compare this sctsr intervention to an sct program that lacked an explicit focus on self - regulation skills. although recruitment and retention did not represent significant problems in this investigation, the intervention was unsuccessful in preventing weight gain over the 14-week period. previous studies have demonstrated yearly average weight gains of 1.84.1 kg [24, 31 ], and if students in this investigation continued to gain weight at the same rate, they would be within that range by the end of their first year in college. although there was no group difference in weight gain over the 14-week period, the sct intervention group maintained relative (i.e., %) and absolute fat mass as compared to the sctsr group. students enrolled in the sctsr course expressed to instructors that they believed the course required more time and effort than would be expected for a one - credit course, which may have contributed to the lack of positive weight - related outcomes. consistent with this possibility, one student in the sctsr course discontinued the study because of the time commitment required. in contrast, the students in the sct course reported that they associated the class with having fun and requested items such as daily meal plans to help them reach their goals. in addition, the open - ended survey results suggested that students would have benefited from additional in - class sessions. instead, biweekly quizzes were utilized to evaluate compliance with completing online class modules. as this was part of a for - credit course, students may have focused more on completing course requirements and tracking / homework assignments instead of utilizing the weight gain prevention skills for their own benefit and health. overall, both approaches appeared acceptable in that both groups had high class attendance and quiz grades, favorable course and instructor ratings, and very low attrition (i.e., one dropout). indeed, relative to retention in other similar studies, both sctsr and sct were very high [13, 15 ]. it is unclear whether these high retention rates may be attributed to the incentive of course credit. students were informed of university policies related to maintaining full - time status prior to enrollment to allow students the opportunity to discontinue the study if they decided to withdraw from the course. if so, this may have limited the initial enrollment numbers. on the other hand, five students were enrolled in the course but discontinued the study prior to the first class session, and subsequent retention rates were high. reported higher retention rates for the duration of the course but failed to retain subjects for follow - up testing, whereas sallis. experienced a 53% and 25% dropout rate in the first and second semesters, respectively. short - term interventions (six-16 weeks) aimed at preventing weight gain in young adults have reported positive outcomes using both small- and large - change self - regulation interventions and a theory - based online intervention combined with email feedback. retention rates were relatively high (~80%) in the combined intervention group of the latter investigation, although the study duration was relatively brief (i.e., six weeks). one longer - duration educational / behavioral intervention study which utilized small - group seminars for first- and second - year college students reported favorable outcomes ; compared to the control condition, body weight in the intervention group was 1.3 kg lower after two years. study retention rate in this investigation was 83% ; however, the study population consisted of health science majors, who may not be representative of the general college student population. prior work in college students indicated that both monetary incentives and academic course credit would increase student 's interest in participating in a program aimed at improving weight - related health behaviors. as a component of interventions aimed at improving health behaviors, monetary incentives appear to have beneficial effects on weight management outcomes in the general adult population over a six- to 18-month - time period. however, the effectiveness of incentives to improve weight management outcomes within special populations groups, such as economically disadvantaged individuals or college - aged adults, is not known. the findings of this investigation do not suggest that a moderate intensity sctsr intervention which includes monetary and academic (i.e., course credit) incentives will prevent weight gain among college freshmen. although our interventions were unsuccessful in preventing weight gain, there are several strengths that should be noted. measures of both weight and body composition (dxa) were included, as opposed to weight alone or bmi. in young adult males, body composition may be a more appropriate outcome variable than body weight alone as growth may still be taking place ; the dxa assesses fat mass and fat - free mass, both of which may contribute to body weight gain. the increase in fat - free mass over time (table 2) provides support for this point. inclusion of the open - ended intervention course survey provided valuable (and largely positive) feedback, attendance was high and attrition was minimal in both intervention courses, knowledge gains were demonstrated as suggested by the high quiz grades, and instructor ratings were in the good to excellent range. a final strength is that the course format was designed and delivered in a way that could be duplicated and disseminated to other universities, through the use of online components / modules and structured in - class sessions. thus, we are unable to extrapolate the findings beyond our sample or to address the degree to which body composition changes were sustained over a longer period of time. however, the randomization procedure, use of objective measures of body composition, and assessing changes of potential intervention mediators are improvements over previous studies examining weight gain prevention in this population. the latter feature is especially important in that we identified consistent and expected relationships between the changes in social cognitive theory variables and changes in behavioral and weight status outcomes. this suggests that, while the sctsr and sct may not have been successful in universal weight gain prevention, the targeted variables are viable for consideration in developing future interventions for this target population. to our knowledge, this is first weight gain prevention intervention trial for college freshman, which includes strategies aimed at instilling individual behavior change skills (e.g., self - regulation, self - monitoring, goal setting, financial incentives), as well as physical and social environmental support for healthy lifestyle behaviors. the intervention programs appeared to be well received and feasible to deliver, although knowledge gains did not lead to improvements in weight - related outcomes. future studies should address program components such as self - regulation strategies and incentives which are effective for this population, while addressing issues related to student 's perceived time constraints, program feasibility, and dissemination potential. | the college transition represents a critical period for maintaining a healthy weight, yet intervention participation and retention represent significant challenges. the objective of this investigation was to evaluate the preliminary efficacy and acceptability of two interventions to prevent freshman weight gain. one intervention provided opportunities to improve outcome expectations and self - efficacy within a social cognitive theory framework (sct), while the other targeted the same variables but focused on explicit training in self - regulation skills (sctsr). methods. freshmen (n = 45) aged > 18 years were randomized to a 14-week intervention, sct or sctsr ; both included online modules and in - class meetings. of the 45 students randomized, 5 withdrew before the classes began and 39 completed pre- and posttesting. primary outcomes included body weight / composition, health behaviors, and program acceptability. analyses included independent sample t - tests, repeated measures anova, and bivariate correlational analyses. results. body weight increased over the 14-week period, but there was no group difference. percent body fat increased in sctsr but not sct (mean difference : sctsr, + 1.63 0.52% ; sct, 0.25 0.45% ; p = 0.01). class attendance was 100% (sctsr) and 98% (sct) ; sctsr students (> 50%) remarked that the online tracking required too much time. conclusions. the intervention was well received, although there were no improvements in weight outcomes. |
with the current understanding of the mechanism of coronary artery disease, acute st segment elevation myocardial infarction, non - st segment elevation myocardial infarction, and unstable angina can be classified as acute coronary syndrome (acs). acute myocardial infarction (ami) is one of the most common cardiovascular diseases, having the highest morbidity and mortality in the world [13 ]. in the year 2010, more than 6 million patients were hospitalized for treatment of ami in the united states. owing to china s aging population, the incidence rate of this disease has increased drastically. according to official estimates, more than 16 million people annually will succumb to ami by 2020. patients suffer ami due to myocardial necrosis, an ischemic injury that leads to the deformation of mitral annulus. the effects of mild ischemic mvr include left ventricular remodeling and left ventricular enlargement. in severe cases, it can lead to left ventricular dysfunction and left ventricular failure, which is a life - threatening condition. when ischemic mvr is severe, the survival rate is just 1 year in more than 60% cases. coronary artery bypass grafting (cabg) and mitral valve repair or replacement (mvrr) surgery are carried out on patients who develop significant ischemic mvr after myocardial infarction. these surgical treatments can remove coronary artery blockages and mvr simultaneously, helping restore normal left ventricle geometry. according to current guidelines, surgical intervention is the conventional method for treating ischemic mvr with an ejection fraction (ef) of 30% or greater (class i recommendation) ; a class ii b recommendation is when the ef is 30% or less. however, several studies have reported that the survival rate is not significantly different when patients with ischemic mvr are treated with mvrr and cabg [914 ]. in other words, medical researchers are still dubious that mvrr surgery is suitable for treating patients who develop ischemic mvr after myocardial infarction. in this study, we pooled results of recent studies and performed a meta - analysis to investigate the efficacy and patient prognosis of cabg combined with or without mvrr. a comprehensive search was performed in ovidsp, pubmed, cochrane library, and embase to access medical literature from january 1986 to march 2015. we identified and reviewed all the studies that described the trials comparing the efficacy of only cabg with the combined treatment of cabg and mvrr, which were used to treat patients with moderate to severe ischemic mvr (> 2 + grade) after acs. in pubmed, search terms were presented in text string format as follows : ischemic mitral valve regurgitation or ischemic mitral valve insufficiency) and (mitral valve repair or mitral valve annuloplasty or mitral valve replacement) and (coronary bypass grafting or surgical revascularization) and (acute myocardial infarction or acute coronary syndrome or acs). we performed the meta - analysis to compare the differences in the short - term (mean hospital mortality rate) and long - term survival rates of patients treated with cabg only and those treated with both cabg and mvrr. secondary outcomes were compared with the preoperative and postoperative degree of mvr, left ventricular end - systolic volume (lvesv), left ventricular ejection fraction (lvef), and new york heart association (nyha) class. the criteria for excluding the articles were as follows : (1) no direct comparison between only cabg and the combined technique of cabg and mvrr ; (2) etiologies for mvr were myxomatous, rheumatic, infectious, congenital, or degenerative ; (3) mitral valve regurgitation was accompanied by mitral valve prolapse, tendon rupture, or papillary muscle rupture ; (4) no survival curves or hazard ratios ; (5) articles were not written in english. the quality of each included study was evaluated by 2 researchers who cross - checked the extracted data from the selected case control study or randomized controlled trials. if they had differences of opinion, then they sought the opinion of a third researcher. baseline characteristics were described using proportions of discrete variables, while medians and standard deviation were calculated for continuous variables. to compare discrete variables of different groups, the kruskal - wallis test was conducted. in each individual study, the odds ratio was calculated for short - term survival, while hazard ratios were calculated for determining long - term survival. in each study, the survival curves compared the efficacy of only cabg with the combined technique of cabg and mvrr. these survival curves were checked and evaluated for time intervals of 2, 3, or 6 months depending on their mean follow - up years. the heterogeneity of patients and treatment procedures were incorporated in the random - effects model, including the study of statistical data and the 95% confidence intervals (cis). the heterogeneity of patients was examined using cochran s q test and the i statistic. the degree of heterogeneity was divided into 3 grades : low (75%). meta - analysis was conducted using review manager, version 5.3 (the cochrane collaboration, update software, oxford). a comprehensive search was performed in ovidsp, pubmed, cochrane library, and embase to access medical literature from january 1986 to march 2015. we identified and reviewed all the studies that described the trials comparing the efficacy of only cabg with the combined treatment of cabg and mvrr, which were used to treat patients with moderate to severe ischemic mvr (> 2 + grade) after acs. in pubmed, search terms were presented in text string format as follows : ischemic mitral valve regurgitation or ischemic mitral valve insufficiency) and (mitral valve repair or mitral valve annuloplasty or mitral valve replacement) and (coronary bypass grafting or surgical revascularization) and (acute myocardial infarction or acute coronary syndrome or acs). we performed the meta - analysis to compare the differences in the short - term (mean hospital mortality rate) and long - term survival rates of patients treated with cabg only and those treated with both cabg and mvrr. secondary outcomes were compared with the preoperative and postoperative degree of mvr, left ventricular end - systolic volume (lvesv), left ventricular ejection fraction (lvef), and new york heart association (nyha) class. the criteria for excluding the articles were as follows : (1) no direct comparison between only cabg and the combined technique of cabg and mvrr ; (2) etiologies for mvr were myxomatous, rheumatic, infectious, congenital, or degenerative ; (3) mitral valve regurgitation was accompanied by mitral valve prolapse, tendon rupture, or papillary muscle rupture ; (4) no survival curves or hazard ratios ; (5) articles were not written in english. the quality of each included study was evaluated by 2 researchers who cross - checked the extracted data from the selected case control study or randomized controlled trials. if they had differences of opinion baseline characteristics were described using proportions of discrete variables, while medians and standard deviation were calculated for continuous variables. to compare discrete variables of different groups, the pearson test was performed. to compare continuous variables of different groups, the kruskal - wallis test was conducted. in each individual study, the odds ratio was calculated for short - term survival, while hazard ratios were calculated for determining long - term survival. in each study, the survival curves compared the efficacy of only cabg with the combined technique of cabg and mvrr. these survival curves were checked and evaluated for time intervals of 2, 3, or 6 months depending on their mean follow - up years. the heterogeneity of patients and treatment procedures were incorporated in the random - effects model, including the study of statistical data and the 95% confidence intervals (cis). the heterogeneity of patients was examined using cochran s q test and the i statistic. the degree of heterogeneity was divided into 3 grades : low (75%). meta - analysis was conducted using review manager, version 5.3 (the cochrane collaboration, update software, oxford). in total, we reviewed 1183 studies, including 1159 studies in ovidsp and 24 studies in pubmed ; however, we could not find any related studies in embase or cochrane library. while perusing through title, abstract, and full text of manuscripts, we found that a cohort of 5 studies met the inclusion criteria [9,11,1618 ]. among them, only 1 study was a prospective randomized trial, while the other studies were retrospective observational trials (figure 1). a total of 3120 patients were included in all the studies that met our inclusion criteria. among them, 2545 (82%) patients were treated with only cabg, while 575 (18%) patients underwent both cabg and mvrr. the average age of the study population was 67 years ; the patients were in the age group of 61 to 70 years. the mean percentage of male patients was 61%. in the analyzed studies, the proportion of male patients varied from 26% to 81%. the study presented by kang had no published data on the number of patients with hypertension. however, in other studies more than half of the included patients also suffered from hypertension. the degree of mvr was more than 2 + in all the patients that were included preoperatively. after performing revascularization surgery, the degree of residual mvr in patients treated with only cabg was less than 1 +, but the degree of mvr was lower in patients treated with both cabg and mvrr (0.90.6 vs. 0.60.6). nevertheless, there was no significant difference between the 2 groups. cabg combined with mvrr was better than only cabg in reducing the mean lvesv and nyha classes, but only 1 study indicated that there were significant differences between the 2 surgical procedures. in the improvement of the mean lvef, the results of the 2 surgical procedures were similar, except for 1 study showing no improvement in cabg combined with mvrr. short - term survival was defined as patients who died within 30 days despite being admitted in a hospital. in 3 studies, the total hospital mortality rate in patients treated with both cabg and mvrr techniques was 4.8% (5/104), which was higher than the 2.8% hospital mortality rate of patients treated with only cabg (6/216). however, there was no significant difference in the hospital mortality rates of these patients (p=0.358). odds ratio (or) range varied from 1.00 (no favoring) to 8.47 (favoring cabg only). we also assessed the heterogeneity of patients included in the studies (chi=1.24, p=0.54, and i=0%). the pooled or was 2.54 (95% ci, 0.659.95 ; p=0.18) (figure 2), indicating that the hospital mortality in patients treated with both cabg and mvrr techniques was similar to that witnessed in patients treated with only cabg. through the short - term funnel plots, we deduced that there was no publication bias in the included studies (figure 3). the shortest observation period of these studies was approximately 5 years, while the longest observation period was over 10 years. because these studies were not randomized controlled trials, the chosen survival curves were adjusted before analyzing. the study hazard ratios varied from 1.22 to 5.16 (figure 4). while assessing potential heterogeneity, (chi=2.55 and p=0.28) we found that there was no significant heterogeneity in patients included in various studies. furthermore, i=21%, so the variability between these studies was due to low heterogeneity. in summary, the pooled study population showed that compared to the cabg group, long - term survival was more pronounced in the group treated with both cabg and mvrr techniques. moreover, there was no publication bias in the included articles (figure 5). a total of 3120 patients were included in all the studies that met our inclusion criteria. among them, 2545 (82%) patients were treated with only cabg, while 575 (18%) patients underwent both cabg and mvrr. the average age of the study population was 67 years ; the patients were in the age group of 61 to 70 years. the mean percentage of male patients was 61%. in the analyzed studies, the proportion of male patients varied from 26% to 81%. the study presented by kang had no published data on the number of patients with hypertension. however, in other studies more than half of the included patients also suffered from hypertension. the degree of mvr was more than 2 + in all the patients that were included preoperatively. after performing revascularization surgery, the degree of residual mvr in patients treated with only cabg was less than 1 +, but the degree of mvr was lower in patients treated with both cabg and mvrr (0.90.6 vs. 0.60.6). nevertheless, there was no significant difference between the 2 groups. cabg combined with mvrr was better than only cabg in reducing the mean lvesv and nyha classes, but only 1 study indicated that there were significant differences between the 2 surgical procedures. in the improvement of the mean lvef, the results of the 2 surgical procedures were similar, except for 1 study showing no improvement in cabg combined with mvrr. short - term survival was defined as patients who died within 30 days despite being admitted in a hospital. in 3 studies, the total hospital mortality rate in patients treated with both cabg and mvrr techniques was 4.8% (5/104), which was higher than the 2.8% hospital mortality rate of patients treated with only cabg (6/216). however, there was no significant difference in the hospital mortality rates of these patients (p=0.358). odds ratio (or) range varied from 1.00 (no favoring) to 8.47 (favoring cabg only). we also assessed the heterogeneity of patients included in the studies (chi=1.24, p=0.54, and i=0%). the pooled or was 2.54 (95% ci, 0.659.95 ; p=0.18) (figure 2), indicating that the hospital mortality in patients treated with both cabg and mvrr techniques was similar to that witnessed in patients treated with only cabg. through the short - term funnel plots, we deduced that there was no publication bias in the included studies (figure 3). the shortest observation period of these studies was approximately 5 years, while the longest observation period was over 10 years. because these studies were not randomized controlled trials, the chosen survival curves were adjusted before analyzing. the study hazard ratios varied from 1.22 to 5.16 (figure 4). while assessing potential heterogeneity, (chi=2.55 and p=0.28) furthermore, i=21%, so the variability between these studies was due to low heterogeneity. in summary, the pooled study population showed that compared to the cabg group, long - term survival was more pronounced in the group treated with both cabg and mvrr techniques. moreover, there was no publication bias in the included articles (figure 5). this complication is more pronounced in patients who suffer ami : the incidence rate of ischemic mvr is up to 1350% in patients who have suffered ami. in most patients with mild mvr, the symptoms are not very obvious. however, in patients with moderate to severe mvr, the typical symptoms include palpitation, angina, heart failure, or even death. therefore, many scholars dispute whether patients with ischemic mvr must be treated with concomitant mitral valve surgery. ischemic mvr leads to left ventricular volume overload, resulting in left ventricular remodeling that aggravates mvr. therefore, mvrr surgery can reduce left ventricular volume overload by reducing the mitral valve flow, which is also beneficial in left ventricular remodeling. we found that after the surgery, the degree of residual mvr in patients treated with both cabg and mvrr was lower than that in patients treated with only cabg. the combinatorial technique of cabg and mvrr was also better than that of only cabg, regardless of the mean of lvesv, lvef, or nyha classes. these results had been confirmed by most studies, and they were also suitable for patients with end - stage cardiomyopathy. except for the gangemi study, no improvement was reported in the heart function of patients treated with mvrr surgery, perhaps because preoperative left ventricular function had been overestimated in these studies. several studies reported that the prognosis of patients improved when they were treated with both cabg and mvrr surgeries. in a case - controlled study, the long - term survival rates in 58 patients with moderate mvr were similar to the 58 case - matched patients without mvr. several studies, including a multicenter randomized trial by deja., have reported that mv repair can significantly improve the survival rate of patients as compared to only cabg [2632 ]. the risk associated with surgical and postoperative mortality does not increase in patients treated with combinatorial techniques of cabg and mvrr surgeries, although the operation time increases as compared to patients treated with only cabg. however, in guiding clinical management of ischemic mvr, the results of our meta - analyses have some limitations : most studies were carried out on a small number of patients, so the sample size is small in most studies. furthermore, outdated studies do not include current ischemic mvr assessment techniques adequately, increasing perioperative surgical risk. the comparison of different groups could not fully summarize the total range of treatment modalities, including cabg with or without mvrr [2630 ]. according to our meta - analysis, compared to patients treated with only cabg, long - term survival rates were lower in patients treated with both cabg and mvrr. several studies, including a 2009 meta - analysis, have reported that there is no enhancement in the survival rates of patients with ischemic mvr when they are treated with both cabg and mvrr [914 ]. ischemic mvr occurs because of left ventricular (lv) remodeling and dilatation after myocardial infarction, which tethers and pulls the mitral valve apart ; the mitral valve is normal in structure but is incompetent as a result of a dilated and dysfunctional left ventricle. therefore, ischemic mvr can be corrected with only cabg ; this surgical intervention can successfully restore coronary flow. therefore, the survival rate of patients treated with only cabg might be higher than those treated by both cabg and mvrr techniques. the search method was very limited and failed to include all the published literature, including published papers of organizations and conferences. we only reviewed manuscripts that were published in english, so papers published in other languages were not included. therefore, we may have missed out some important findings of research studies published in other languages. the keyword search included ischemic mitral valve regurgitation, functional mitral valve regurgitation, ischemic mitral valve insufficiency and mitral valve repair, mitral valve annuloplasty, mitral valve replacement or mvs, and coronary bypass grafting or surgical revascularization. although these keywords were consistent with other studies [3638 ], we also included acute myocardial infarction or acute coronary syndrome. therefore, our selected literature may not be same as the meta - analysis of 2009. thus, different studies were included and reviewed in our meta - analysis. most patients with serious mvr were treated with both cabg and mvrr techniques, so there could be bias in selected population. myocardial viability also plays an important role in the surgical management of ischemic mvr. after performing the cabg technique, the dysfunctional yet viable myocardium undergoes significant recovery. we did not perform routine tests to determine the myocardial viability of patients. in the near future the search method was very limited and failed to include all the published literature, including published papers of organizations and conferences. we only reviewed manuscripts that were published in english, so papers published in other languages were not included. therefore, we may have missed out some important findings of research studies published in other languages. the keyword search included ischemic mitral valve regurgitation, functional mitral valve regurgitation, ischemic mitral valve insufficiency and mitral valve repair, mitral valve annuloplasty, mitral valve replacement or mvs, and coronary bypass grafting or surgical revascularization. although these keywords were consistent with other studies [3638 ], we also included acute myocardial infarction or acute coronary syndrome. therefore, our selected literature may not be same as the meta - analysis of 2009. thus, different studies were included and reviewed in our meta - analysis. most patients with serious mvr were treated with both cabg and mvrr techniques, so there could be bias in selected population. myocardial viability also plays an important role in the surgical management of ischemic mvr. after performing the cabg technique we did not perform routine tests to determine the myocardial viability of patients. in the near future the patients with acs complicated with ischemic mvr can achieve reduced mitral regurgitation and improved left ventricular function through either only cabg or both cabg and mvrr surgery. there is still no evidence that the long - term survival rate of cabg combined with mvrr is superior to that of only cabg, while the hospital mortality and secondary outcomes were similar in both. we expect that the new technology of mitral valve surgery can bring about some changes. the optimal surgery plan still needs to be adjusted according to the individual situation of the patient. | backgroundthere is no consensus on whether mitral valve repair or replacement (mvrr) must be performed to treat ischemic mitral regurgitation (mvr) after myocardial infarction. our objective in this study was to investigate the efficacy of coronary artery bypass grafting (cabg) combined with or without mvrr for the ischemic mvr.material/methodsan article search was performed in ovidsp, pubmed, cochrane library, and embase. in these articles, researchers compared the efficacy of cabg with or without mvrr in treating patients with ischemic mvr after acute coronary syndrome (acs). we performed a meta - analysis to compare the differences in the short - term and long - term survival rates of patients treated with cabg only and those treated with both cabg and mvrr. secondary outcomes were compared with the preoperative and postoperative degree of mvr, left ventricular end - systolic volume (lvesv), left ventricular ejection fraction (lvef), and new york heart association (nyha) class.resultsout of the 1183 studies, we selected only 5 articles. a total of 3120 patients were enrolled ; the cabg and mvrr group included 575 patients, while the cabg only group included 2545 patients. long - term survival was higher in the cabg only group (hazard ratio [hr ], 1.34 ; 95% confidence interval [ci ] 1.151.58, p=0.003). hospital mortality was similar in both the groups (odds ratio [or ], 2.54 ; 95% ci, 0.659.95 ; p=0.18). no differences were found in the degree of residual mvr, the mean of lvesv, lvef, or nyha class.conclusionsin patients with ischemic mvr, the short - term survival rate was similar in both groups. moreover, there was no significant improvement in the long - term survival rates of patients treated with both cag and mvrr. |
the natural materials have advantages over synthetic ones since they are chemically inert, nontoxic, less expensive, biodegradable, and widely available. these can also be modified in different ways to obtain tailor - made materials and thus can compete with the available synthetic polymers. the importance of biocompatible and biodegradable hydrophilic polymers has wide applications in different fields such as polymer engineering, chemical engineering, pharmaceuticals, food, and agriculture because of their propensity to combine with others [24 ]. the blends of these biopolymers are also of significant importance and recently have been investigated for application in drug delivery systems and in the field of foods science [5, 6 ]. in the plastic industry, polyvinyl alcohol blends with agar and hydroxyethylcellulose have been investigated in order to improve the mechanical properties of biodegradable films. such blends showed superior performances over the conventional individual polymers and, consequently, the range of applications have grown rapidly for such class of materials. in the recent years, carbohydrate and biodegradable polymers have been extensively used to develop the controlled release formulations of drugs having short plasma life. amongst the various polymers employed, hydrophilic biopolymers are quite suitable because they are nontoxic and acceptable by the regulatory authorities. the choice of selecting the natural gum and its blends for sustained release effect depends upon its gelling strength. the interacting blends of poly(acrylic acid) with poly(vinylpyrrolidone) or poly(vinyl alcohol) in aqueous solutions have been studied by ultrasonic, rheological, and viscometric techniques [9, 10 ]. different types of interactions, such as electrostatic interaction, hydrogen bonding, and hydrophobic interaction, are established between biopolymers. in order to clarify the association of biopolymers through structure formation, it is important to study the molecular interactions of different kinds of biopolymers. it is thought that the structural formation of biopolymer blends is an important subject from both industrial and scientific points of view. isabgol husk is medicinally important polysaccharide and it has been reported for the treatment of constipation, diabetes, diarrhoea, inflammation bowl diseases, ulcerative colitis, cancer, obesity, high cholesterol, and so forth. husk mucilage obtained from the seed coat by mechanical milling / grinding of the outer layer of the seeds is fibrous and hydrophilic and forms the clear, colorless mucilaginous gel by absorbing water. recently, the us food and drug administration has authorized the use of food products containing soluble fiber from isabgol husk. a gastroretentive sustained release delivery system of ofloxacin has been developed with release polymers like psyllium husk and a swelling agent, crospovidone [13, 14 ]. gum katira, an exudate from the bark of cochlospermum religiosum (family cochlospermaceae), is pale and semitransparent and insoluble in water but swells into a pasty transparent mass with water. it has obtained great importance in recent years and is exported annually from india for use in cigar, paste, and ice - cream industries. the gum is sweet, thermogenic, anodyne, sedative, and useful in cough, diarrhea, dysentery, pharyngitis, gonorrhoea, syphilis, and trachoma. it consists of equimolecular proportion of l - rhamnose, d - galactose, and d - galacturonic acid, together with traces of a ketohexose. it has been reported that [12]-4-linked galacturonic acid is present in the linear chain of this polysaccharide with similar residues of neutral sugars [17, 18 ]. this study has been carried out for rheological properties of blends comprising isabgol husk and gum katira and is based on assessment of miscibility of isabgol husk and gum katira blends in different concentrations. other chemicals and regents such as potassium dihydrogen phosphate, sodium hydroxide, and hydrochloric acid of analytical grade were procured from loba chemie, mumbai, and used as such without further purification and modification. about 1 and 2 mass% dispersion of isabgol husk and gum katira were prepared in distilled water and kept aside at room temperature for 6 h to remove the entrapped air and complete swelling. the blends of isabgol husk and gum katira comprising each 1 mass% were prepared by thoroughly mixing the above dispersions in three percentage ratios such as 75 : 25, 50 : 50, and 25 : 75, respectively. the blends by applying 2 mass% of isabgol husk and 1 mass% of gum katira dispersion and vice versa were also prepared in the above compositions for assessing the effect of polysaccharides concentrations on miscibility. viscosities of these dispersions in pure and blend form were determined in triplicate (n = 3) by brookfield 's viscometer (model : rv dv - e, usa) by taking 6.7 ml of the sample into a removable sample chamber. the removable sample chamber was inserted into the water jacket assembly and an insulation cap was placed on the chamber to maintain the temperature constant of dispersions samples during measurements. for rheological investigation, the compatibility in terms of miscibility of isabgol husk and gum katira in blends containing different strengths of these polysaccharides was analyzed at 298.15, 313.15, and 333.15k. the miscibility of isabgol husk and gum katira blends in dispersion form was studied by calculating the polymer - polymer interaction parameter b of the blends using the krigbaum and wall equation (1)bm = x12b11 + 2x1x2b12+x22b22, where x1 and x2 are the mass fraction of isabgol husk and gum katira, respectively, b11 and b22 are the respective interaction parameters of isabgol husk and gum katira dispersions, respectively, b12 is the interaction parameter of the blend system, and bm represents the global interaction between two polymeric species, respectively. here, the interaction parameters b11, bm were calculated from the slope of the plot of reduced viscosity of isabgol husk and gum katira and their blends versus concentration, respectively. the samples were studied in triplicate (n = 3) and the data were represented as the mean of the successive results with their respective standard deviations. the linear relationship found from such plots for the entire composition is generally the characteristic of blend compatibility. the miscibility of these blends was also analyzed by calculating the reduced viscosity (sp / c). here, then, from the nature of the plot of (sp / c) versus c, blend compatibility was predicted. []m were calculated for both the individual polymers and their blends followed by extrapolation of sp / c to zero concentration. the values of the intrinsic viscosity []m obtained from such plots for the blends were also calculated theoretically by using the following expression, and compared(2)[]m=[]1x1+[]2x2. the interaction parameter b12 was calculated theoretically by using the equation (3)b12=(b1b2)1/2. here, the value of b1b2 was the slope of the plots of reduced viscosity versus concentration of the individual polymers calculated by using classical huggins equation : (4)spc=[]0+bc. thus, the difference b between the theoretically calculated b12 from the above equation and that of the experimental b12 calculated from the equation was calculated as (5)b=(b12b12). non - newtonian behavior can be simply expressed through an equation and in some cases ; the coefficients of a model can be used to draw the inference regarding the performance of a fluid under conditions of use. newtonian flow is defined by a phenomenon of response in shear stress for a change in shear rate (linear relationship). the newtonian equation for viscosity has been modified many times to characterize non - newtonian behavior. some of the widely used equations include the following : (6)casson equation : =0+d,(7)casson chocolate equation : (1+a)=20+(1+a)d,(8)bingham plastic equation : =0+d,(9)power law : =kd,(10)ipc paste analysis : =krs, where is shear stress (n / m), 0 yield stress / shear stress at zero shear rate (n / m), d is shear rate (sec), a is spindle radius, k is consistency index (mpas), s is shear sensitivity factor, respectively. using the magnitudes of k and n, apparent viscosity (app) at shear rate of 1 sec (60 rpm) was calculated. in addition, the effect of temperature (298.15, 313.15, and 333.15k) on app,60 rpm was studied for isabgol husk, gum katira, and their blends dispersions using the arrhenius equation : (11)app,60=aexp(eactrt), where app,60 rpm is the apparent viscosity (mpas) at 60 rpm (1 s), a is a constant (mpas), t is the absolute temperature (k), r is the gas constant (8.3144 j / molk), and eact is the activation energy (kj / mol), respectively. the following equations were applied for the calculation of viscosity of blends from the individual viscosity data and from the volume of gum katira and isabgol husk applied in the blends preparation. the rheological data obtained from individual polymeric dispersion of gum katira and isabgol husk was compared with blends : (12)=11+22,(13)mix=2+1(1/1)2+(2/22),(14)mix=1+2(1/2)1+(1/21), where 2 the viscosity of gum katira dispersion, 1 the volume fraction of isabgol husk dispersion, and the results of different parameters studied were treated statistically and the data were reported as mean standard deviation (sd) for three successive determinations (n = 3). statistical analysis was performed by student 's t - test, anova, and f test at 95% confidence level, using a statistical package (sigmastat v.2.07, systat software inc., san jose, california). in order to understand the flow behaviour of the dispersions before and after blending, the dependence of flow properties like viscosity, shear stress, and shear rate was also investigated. the composition of blends of gum katira and isabgol husk with their rheoparameters is shown in table 1. the study was performed in triplicate (n = 3) and the data were represented as mean with standard deviation. as the flow behaviour of hydrophilic dispersion depends upon speed of rotation (shear rate), all these parameters were analyzed at a particular speed (60 rpm or 1 sec) by maintaining the recommended rate of torque value. it was observed that, on increasing the concentration of isabgol husk in blends, the viscosity was increased while a reverse effect was observed with gum katira dispersions. the impact of isabgol husk on enhancement of viscosity of blends was considered due to its more water retention capacity as the values of viscosity of isabgol husk and gum katira dispersion in 1% w / v dispersion were 137.6 1.3531 mpa and 53.3 2.6147 mpa, respectively, at 298.15k. in all the dispersions, the viscosity of the blends was decreased on increasing the temperature from 298.15k to 333.15k. the change in viscosity was slightly less on increasing temperature from 298.15k to 313.15k but these changes in viscosity were predicted more significant on increasing the temperature up to 333.15k (p all the hydrocolloids comprising polysaccharides interact with water, reducing its diffusion and stabilizing its presence, and water is retained specifically through direct hydrogen bonding or the structure of these polymers contains water within extensive inter- and intramolecular voids. as the interactions between hydrocolloids and water depend on hydrogen bonding, the thermal conditions influence the water retention capacity. hence, on higher temperature, the retained water may come out from blends and results in lower viscosity. these entanglements in blends of isabgol husk and gum katira at higher concentration of isabgol husk may lead to enhancement of viscosity. moreover, large and conformationally stiff blends at higher concentration of isabgol husk may present essentially static surfaces encouraging extensive structure in surrounding water and holding it for prolonged time. isabgol husk and gum katira being polysaccharide in nature are composed of different pentose and hexose branched chain structures with terminal hydrophilic groups and these are responsible for water retention as well as interaction with various ionic dispersing media. moreover, the manufacturing conditions during their applicability in various processes may also have an impact on their flow characteristics. hence, the effect of acidic (0.1 n hcl) and basic media (phosphate buffer ph 7.4) was analyzed on the flow pattern of 1% w / v aqueous dispersion of isabgol husk and gum katira that are shown in figure 1. the behaviour of husk and gum katira in 0.1 n hcl, phosphate buffer (ph 7.4) and water was pseudoplastic in nature (n 0), or strong repulsive (0) interactions, respectively. here, miscibility is the equilibrium composition of the two components above which the free energy of mixing is greater than zero, and phase separation is thermodynamically favorable. generally, the immiscible blends of polymers show a negative deviation (b 0) is expected for the blends of comparatively higher solubility and homogeneous nature of the components. the comparative analysis of experimental viscosity determination of different blends containing 1 mass% of isabgol husk and 1 mass% of gum katira with mathematical analysis by (12), (13), and (14) has been shown in figure 2. the viscosity determined by mathematical expressions and experimentations was similar and no significant difference (p > 0.05) was observed. the calculated values of b for blends at 1 mass% of isabgol husk and 1 mass% of gum katira with interaction parameter b12 calculated theoretically by (3), (4), and (5) and experimentally are represented in table 2. it was observed that the values of b were increased on increasing the temperature from room temperature to 313.15k and to 333.15k, respectively, in all compositions of blends, and, at higher concentrations of isabgol husk in blends (2 : 1), b was found to be 42.64 at 298.15k and 11.78 at 333.15k, respectively. however, in blends comprising higher concentrations of gum katira (1 : 2), b was 7.7 at 298.15k and 3.69 at 333.15k, respectively b indicated the interaction and miscibility of blends at experimental thermal conditions and compositions of isabgol husk and gum katira such as 1 : 1, 2 : 1, and 1 : 2 in mass% while more interaction and miscibility were depicted in blends containing comparatively higher isabgol husk concentrations. the intrinsic viscosities of blends having polymer ratio 1 : 1 mass% at 298.15k, 313.15k, and 333.15k were found to be 9.11 1.0613, 20.786 0.6932, and 29.885 2.0232 mpas, respectively. the values of intrinsic viscosities of blends at 2 : 1 mass% (isabgol husk : gum katira) were found to be 23.92 1.210, 65.571 2.6932, and 79.143 1.8001 mpas at 298.15k, 313.15k, and 333.15k, respectively. but, on increasing gum strength in blends as 2 mass%, the intrinsic viscosity was found lower than that obtained in higher strength of isabgol husk. the results were 14 2.0513, 27.179 0.8562, and 49.286 2.6320 mpas at 298.15k, 313.15k, and 333.15k, respectively. the experimental data of intrinsic viscosities was similar to mathematical results obtained by (2) (p > 0.05). the flow behaviour of isabgol husk - gum katira blends (1 : 1 mass%) indicated newtonian flow pattern (e.g., viscosity was constant with increment of shear rate) at lower shear rate regions, while a shear - thinning flow behavior (e.g., viscosity decreased with increment of shear rate) was observed at higher shear rate regions. it seems that, at lower shear rates, there could be a constant formation and disruption of chain - chain entanglements and the rate of disruption with formation of the polymer chain entanglements could be at equilibrium ; therefore, the viscosity might remain unchanged. as the shear rate increased, the rate of formation of entanglements could not keep up with the rate of disruption of the entanglements and resulted in decrement of viscosity with the increase in shear rate. the effect of shear rate was also observed on isabgol husk dispersion and gum katira dispersion, but it was comparatively more and significant in blends as steep decrement in viscosity of dispersions was created on increment of shear stress. the flow index (n) and consistency index (k) values obtained from the power law model (9) for the blends at 298.15, 313.15, and 333.15k (n isabgol husk - gum katira > gum katira. however, the plastic viscosity data and yield stress data were slightly higher for bingham model than those obtained from casson and casson chocolate equation. the deviation of the fitted parameters for bingham equation was < 0.05% when compared to ~1% of deviation obtained for casson and casson chocolate equation. the miscibility of isabgol husk and gum katira blends in equal proportions as well as in higher concentrations of one another was found at studied thermal conditions. the blends and their components such as isabgol husk and gum katira were found to be pseudoplastic in viscosity behaviour as, on increasing the shear stress, the viscosity was decreased down. the significant effect on rheological behaviour was shown by isabgol husk as on higher concentration of husk ; the plastic viscosity and yield stress were increased as analyzed by bingham, casson, and casson chocolate model. the effect of temperature on viscosity was found according to arrhenius equation, and in blends containing higher concentration of isabgol husk than gum katira, more energy was required to start the flow. the results of miscibility of isabgol husk and gum katira blends proved that the blends of these biopolymers may have potential in food and pharmaceutical industries. the pseudoplastic flow pattern in acidic and basic media may also play significant role in blends performance during food processing. in drug delivery systems, these blends may act as modulator for drug release in different environmental conditions of in vitro as well as in vivo studies. also, applicability of the shear - thinning / pseudoplastic behaviour of these blends may also be advantageous for easy flow of lava, ketchup, jellies, gems, nail polish, paint, cream, paste, ointment, and varnish and even for some polymeric solutions from the containers. | the rheological parameters of isabgol husk, gum katira, and their blends were determined in different media such as distilled water, 0.1 n hcl, and phosphate buffer (ph 7.4). the blend properties of isabgol husk and gum katira were measured for four different percentage compositions in order to understand their compatibility in dispersion form such as 00 : 100, 25 : 50, 50 : 50, 75 : 25, and 100 : 00 in the gel strength of 1 mass%. the miscibility of blends was determined by calculating isabgol husk - gum katira interaction parameters by krigbaum and wall equation. other rheological properties were analyzed by bingham, power, casson, casson chocolate, and ipc paste analysis. the study revealed that the power flow index p was less than 1 in all concentrations of isabgol husk, gum katira, and their blends dispersions indicating the shear - thinning (pseudoplastic) behavior. all blends followed pseudoplastic behavior at thermal conditions as 298.15, 313.15, and 333.15k and in dispersion media such as distilled water, 0.1 n hcl, and phosphate buffer (ph 7.4). moreover, the study indicated the applicability of these blends in the development of drug delivery systems and in industries, for example, ice - cream, paste, nutraceutical, and so forth. |
this valvular defect is often detected in infancy and tends to be incompatible with life. in asymptomatic patients, the presence of a unileaflet mitral valve is most commonly due to a severely hypoplastic posterior mitral leaflet. a 22-year - old otherwise healthy man presented to the clinic complaining of recurrent episodes of " heart racing ". prior laboratory testing was not significant for anemia, infection, thyroid or adrenal disease, vitamin deficiencies or electrolyte derangements. a transthoracic echocardiogram revealed a preserved left ventricular ejection fraction of 55%, normal left ventricle size and thickness, normal diastolic filling and an unusual incidental finding of a unileaflet mitral valve. the anterior mitral valve leaflet was markedly elongated, mildly thickened, and occupied the entire closure line of the mitral annulus with no contribution of the hypoplastic posterior leaflet. the coaption zone was intact with no mr (fig. 1, 2, and 3, supplementary movie 1 and 2). as to his palpitations, he was diagnosed with an underlying anxiety disorder and successfully treated with anxiolytic therapy. congenital malformations of the mitral valve are extremely rare and include congenital mitral stenosis, parachute mitral valve, double orifice of the mitral valve, cleft mitral valve, atresia, and unileaflet mitral valve.1) unileaflet mitral valve is the rarest of these congenital anomalies. aplasia of the posterior mitral valve leaflet is responsible for unileaflet mitral valve in the neonatal period and associated with severe mr that is usually incompatible with life without surgical intervention.2) existing literature in the field document cases of unileaflet mitral valve in asymptomatic patients of all age groups and mostly result from a severely hypoplastic posterior mitral valve.1)2)3)4)5)6)7) the prevalence of this anomaly is estimated to be 1:8800 in german population;2) however, the true prevalence is expected to be much lower in the general population. to the best of our knowledge, there have only been 11 reported cases of post - neonatal unileaflet mitral valve in the literature, of which 70% of cases were found to be in asymptomatic patients. the majority of cases were found after detection of a systolic murmur during routine physical examination.1)2)3)4)5)6)7) in the aforementioned cases, transthoracic echocardiography (tte) revealed a thickened and elongated anterior mitral valve with significant prolapse into the left atrium.2) in two of the cases, patients developed severe mr and underwent surgical correction and were found to have hypoplasia of the posterior mitral valve with absence of the chordae tendinae.4)6) it was also suggested that 3d echocardiography with transesophageal echocardiography (tee) outlines the congenital abnormalities of mitral valve better than tte or only tee.1) the prognosis in asymptomatic individuals is unclear ; however, there is a potential for worsening mr with age due to annular dilation. there are no guidelines or recommendations currently for screening or follow - up monitoring of these patients. in our opinion, it may be appropriate to follow - up such patients with annual physical examinations and perform echocardiography if symptoms develop or mr murmur develops / worsens. in conclusion, hereby we represent a rare case of unileaflet mitral valve and review not only the importance of echocardiography in accurate diagnosis, but also highlight the importance of periodic surveillance with echocardiography in early detection of mr in such cases. transthoracic echocardiogram color doppler of the parasternal long axis : no evidence of mitral regurgitation. | unileaflet mitral valve is the rarest of the congenital mitral valve anomalies and is usually life threatening in infancy due to severe mitral regurgitation (mr). in most asymptomatic individuals, it is mostly due to hypoplastic posterior mitral leaflet. we present a 22-year - old male with palpitations, who was found to have an echocardiogram revealing an elongated anterior mitral valve leaflet with severely hypoplastic posterior mitral valve leaflet appearing as a unileaflet mitral valve without mr. our case is one of the 11 reported cases in the literature so far. we hereby review those cases and conclude that these patients are likely to be at risk of developing worsening mr later in their lives. |
first, there is a vasodilation in the pre- and postglomerular arterioles, which leads to higher intraglomerular blood flow and pressure. this causes an early hyperfiltration in the nephrons and eventually damages the glomerular membrane and allows for proteins, glucose, and other molecules to be filtered by the glomerulus and then excreted in the urine. secondly, the final irreversible stage is a vasoconstriction of the glomerular arterioles, which results in low blood flow and glomerular filtration rates. the nitric oxide (no) system has been shown to be altered in diabetes and in diabetic nephropathy. nitric oxide is a vasodilator and if it is deficient or its metabolism is altered, this affects renal function and insulin sensitivity. la is an amino acid that is synthesized within the body and can also be found in various types of food. endothelial nos (enos) results in no release from the endothelium of blood vessels and causes vasodilation via cyclic guanosine monophosphate (cgmp). inducible nos (inos) is an isozyme that is present in an oxidative environment. high levels of inos produce larger amounts of no, which allows no to react with superoxide forming peroxynitrite and thus leads to cell toxicity and/or death. therefore, higher levels of renal enos compared to inos would be beneficial in the late stages of diabetic nephropathy to maintain renal blood flow via vasodilation. while it is true in the early stages of diabetic nephropathy that there is renal vasodilation and hyperfiltration, it is in the later stages that glomerular filtration rate decreases and the continued availability of nitric oxide would maintain glomerular filtration rate and renal blood flow. our hypothesis is that nitric oxide bioavailability may be increased by l - arginine treatment in the later stages of diabetic nephropathy. la deficiency causes endothelial inflammation and cardiovascular disorders, and dietary la supplementation can reverse these disorders [9, 10 ]. in patients with type 2 diabetes mellitus (t2 dm), la supplementation resulted in a significant increase in no concentration and total antioxidant status of the patient. in a rat model of t2 dm, the obese zucker rat, it has been reported these rats had significantly lower renal function compared to the diabetic animals fed an antioxidant diet. this suggests that in an oxidative stress environment renal function declines and may be due to the increased production of peroxynitrite via inos resulting in cell death. therefore, we hypothesized that la dietary supplementation will alter the no biosynthetic pathway and preserve renal function in diabetic wistar rats. to test this hypothesis, we utilized the wistar rat model of t2 dm and evaluated the effects of la dietary supplementation on four components of the no pathway : renal enos and inos protein levels, urinary cgmp and plasma nitrotyrosine, and nitrite. we report the novel findings that la supplementation preserves glomerular filtration rate via alterations in the no pathway and improves insulin resistance in diabetic wistar rats. all of the animal work was conducted with approval from the ohio university institutional animal care and use committee. male wistar rats, 27 in total, were purchased from harlan laboratories (indianapolis, in) at 6 weeks of age. after being acclimated to laboratory conditions for 4 days, they were randomly divided into three experimental groups (n = 9 rats / group). group 1 served as the nondiabetic controls (nondiabetic control) and was fed a standard ad libitum diet (purina mills, inc., st. group 2 served as the type 2 diabetic controls (diabetic control) and was fed a high (61%) sucrose (hs) diet (purina mills inc., st. group 3 (la) was fed the same hs diet with additional 1 g / kg body weight l - arginine supplementation given twice daily via oral gavage (sigma - aldrich corporation, st. each group was maintained on their respective diet for a total of 8 weeks. before being placed on the experimental diets, fasting blood glucose measurements were taken weekly using a one touch glucometer (johnson and johnson). at the initiation of the diet, each rat was placed in a metabolic cage with access to water solely for a 24-hour urine collection. glomerular filtration rate (gfr) based on creatinine clearance was determined using urine and plasma creatinine assay kits (cayman chemicals, ann arbor, mi, number 500701 and number 700460) and urine output levels. gfr was calculated by urine concentration multiplied by the urine output, all divided by plasma concentration. cgmp urine levels were measured using a kit from cayman chemicals (cayman chemicals, ann arbor, mi, number 581021). plasma nitrotyrosine measurements were made using a nitrotyrosine assay kit (hycult laboratories, uden, the netherlands, number hk501). these measurements were repeated at experimental times of 3, 6, and 8 weeks. a glucose tolerance test (gtt) blood glucose readings for the gtt were taken at 0, 15, 30, 60, 90, 120, and 150 minutes after intraperitoneal injection of glucose. plasma nitrite levels were measured using a chemical assay kit (cayman chemicals, number 780001) and were tested at weeks 0 and 8. at the end of the 8-week period, rats were euthanized and one kidney was removed ; the renal medulla and renal cortex were separated and collected and stored in liquid nitrogen for renal enos and inos protein level analyses by western blot. western blots were performed to assess the renal cortex and medulla protein levels of enos and inos. short isoform - specific primary antibodies to enos (1 : 1000 dilution, sc-654, santa cruz biotech, santa cruz, ca) and inos (inos - a, 1 : 2000, alpha diagnostics international, san antonio, tx) were used. goat anti - rabbit horseradish peroxidase - conjugated secondary antibody (1 : 2000 dilution, number 20320, alpha diagnostics international, san antonio, tx) was subsequently applied. -actin was measured as an internal control using a monoclonal primary antibody (1 : 2000 dilution, a2228, sigma - aldrich corporation, st. louis, mo) and horseradish peroxidase - conjugated goat anti - mouse secondary antibody (1 : 30 000 dilution, a9044, sigma - aldrich corporation, st. membranes were detected with ecl immunoblotting detection reagents (ge healthcare, piscataway, nj) and bands were quantified using a chemi doc chemiluminiscent detection system and quantity one software (bio - rad, richmond ca). the results were expressed as nos/-actin density ratio. as the main analytic framework multilevel modeling each model contained one between - subjects factor treatment (tx : control, diabetic control, l - arginine) and one within - subjects factor time. in each model the baseline level was included as a covariate to increase power to detect group differences. at each time point the la rats were heavier than the nondiabetic control rats at all weeks except weeks 0, 1, and 2 but were lighter than the diabetic control rats at all weeks (figure 2). similarly, the diabetic control rats were heavier than the nondiabetic control rats at all weeks except for weeks 0 and 2 (figure 2). glucose levels in la rats were higher at weeks 0 and 6 but lower at weeks 3 and 8 than those in the nondiabetic control rats and higher than in the diabetic control rats at week 0 (figure 3). fasting blood glucose levels in the diabetic control rats were higher at week 6 and lower at week 8 than those in the nondiabetic control rats (figure 3). la supplementation did not improve fasting blood glucose levels at the termination of the experimental protocol time period (figure 3). la supplementation resulted in higher gfr at all time periods compared to the nondiabetic control rats and at weeks 3 and 8 compared to diabetic controls (figure 4). gfrs in the nondiabetic control rats were lower than those in the diabetic control rats at weeks 0 and 3 but were higher at weeks 6 and 8 (figure 4). the nondiabetic control rats had significantly lower cgmp levels than the other 2 groups at week 6 and lower than the la rats at week 8 (figure 5). it is important to note that the diabetic control rats did not have as drastic an increase in cgmp levels as la and nondiabetic control rats at weeks 6 and 8 (figure 5). la rats had higher plasma nitrotyrosine levels relative to nondiabetic control rats at week 0, but la rats had higher plasma nitrotyrosine levels relative to diabetic control rats at week 3 (figure 6). at weeks 6 and 8, la supplemented rats had higher plasma nitrotyrosine levels relative to nondiabetic control rats, but lower plasma nitrotyrosine levels relative to diabetic control rats (figure 6). the diabetic control rats had higher plasma nitrotyrosine levels relative to both of the other groups at weeks 6 and 8 (figure 6). the diabetic control rats had higher glucose levels than the nondiabetic control rats at all times after glucose challenge except for 120 minutes, while the la rats had higher glucose levels than the nondiabetic control rats at 30, 60, and 90 minutes (figure 7). most importantly, the la rats had lower glucose levels than the diabetic control rats at 15 and 30 minutes after glucose challenge (figure 7). la supplementation did not affect nitrite levels compared to diabetic control rats (figure 8). the nondiabetic control rats had lower nitrite levels than the other 2 groups at week 8 (figure 8). in the renal cortex and medulla of rats in all groups, enos monomers (74, 77, 116, 130, and 150 kda) and dimers (195, 320, and 380 kda) and also inos monomers (70, 77, 115, 122, and 139 kda) and dimers (164, 178, 224, 301, and 322 kda) were detected. the distribution of enos and inos monomers and dimers by splice forms in the cortex and medulla of different experimental groups is presented in tables 1 and 2. the enos protein levels were higher in both the renal cortex and medulla in la - treated diabetic rats compared to untreated diabetic rats. likewise, the inos protein levels were lower in both the renal cortex and medulla in la - treated diabetic rats compared to untreated diabetic rats (tables 1 and 2). dietary l - arginine (la) supplementation given to type 2 diabetic (t2 dm) rats preserved renal function compared to t2 dm rats not receiving la. when la was supplemented to the diet of t2 dm rats, it was converted to nitric oxide (no) by nitric oxide synthase (nos). the no produced was presumably activated via endothelial nos (enos) into guanylyl cyclase (gc). in the biosynthetic pathway, gc is then transformed into cyclic guanosine monophosphate (cgmp). due to the rise of no and enos, there were increased levels of the second messenger cgmp that acts on the vascular endothelium causing vasodilation which would increase glomerular filtration rate (gfr). greater vasodilation slows the progression of renal failure and diabetic nephropathy by maintaining renal blood flow. these findings are important because the results show that la supplementation may be an inexpensive nutritional treatment for t2 dm patients. it is speculated that renal vasodilation most likely occurred in this study due to the observed greater levels of mediators involved in the no biosynthetic pathway. gfr, as estimated by creatinine clearance, showed increased filtration for those diabetic rats supplemented with la. the la treated diabetic rats did have higher gfrs at the beginning of the study. however, the gfrs of the la treated diabetic rats remained higher throughout the study compared to untreated diabetic rats. in the pathogenesis of diabetic nephropathy, once gfr is reduced, it is often irreversible. once the t2 dm diagnosis is made, a dietary la supplementation used as an early intervention may prove to be beneficial in these patients. increased levels of enos and lower levels of inos in the renal medulla and cortex this is most probably due to an overabundance of plasma cgmp being produced from enos in the no pathway. l - arginine is a substrate for at least 5 enzymes identified in mammals, including arginase, arginine - glycine transaminase, kyotorphin synthase, nitric oxide synthase, and arginine decarboxylase. l - arginine is essential for the synthesis of creatine, urea, polyamines, nitric oxide, and agmatine. a beneficial effect of acute and chronic l - arginine supplementation on endothelial - derived nitric oxide production and endothelial function has been shown in a number of studies. in fact, we saw a beneficial effect on the preservation of glomerular filtration rate in our diabetic model at the conclusion of the study. therefore, we hypothesize that enos was the substrate for l - arginine causing renal microvascular vasodilation and increased renal blood flow and thus glomerular filtration rate. found that elevated arginase enzyme activity in the diabetic rat kidney inhibits nos activity and nos becomes uncoupled and this reduces the viability of no and increases oxidative stress. this results in endothelial cell dysfunction with increased arginase enzyme activity and damage to the diabetic kidney. therefore, we conclude that the substrate for l - arginine that maintained glomerular filtration rate in our diabetic model was enos and not arginase enzyme since we observed a beneficial effect and not a detrimental effect on renal function with l - arginine supplementation [18, 19 ]. relative nitrotyrosine observations resulted in lower levels in the plasma for la supplemented t2 dm rats when compared to the diabetic control rats. this is a positive finding in terms of the no biosynthetic pathway because it means that there are higher levels of nitrotyrosine in the urine. based on the no pathway, cell damage via oxidation and chlorination would be bypassed (figure 1). this is to be expected due to auto oxidation in the no pathway and presumably equal concentrations of nitrite that remained in the plasma and promoted cell protection. if nitrate concentrations in the urine are high, then peroxynitrite, from inos, has been inactivated and cell damage or death is avoided (figure 1). there were no apparent differences among the groups in reference to body weight and fasting glucose. these findings are important because these results clearly show that alterations in the no biosynthetic pathway precede the observance of abnormally high glucose levels and higher body weights at the beginning of the study. however, the diabetic control group did increase in body weight much more rapidly than the nondiabetic controls as the study progressed into week 3 and beyond. the gtt shows that la supplementation does improve glucose tolerance in diabetic rats compared to the diabetic controls.. also showed improvement in glucose tolerance and insulin sensitivity in t2 dm rats and reported that one of the possible mechanisms was alterations in the biosynthetic no pathway. together, these findings imply that la supplementation has beneficial effects in preserving renal function in t2 dm subjects when implemented at the initial time of diagnosis. in future studies, alterations in the no pathway need to be determined. to further prove and solidify these study 's findings, the plasma and urinary nitrate, plasma cgmp, urinary nitrite, and urinary nitrotyrosine levels should be tested. also, the different stages of diabetes and an extended experimental timeline should be considered. for example, future studies may include focusing on the effects of la supplementation on calcium channels in the vasculature, since awumey. determined that enos and no production regulate extracellular calcium - induced relaxation. observing la supplementation in vivo to investigate the renal microvascular vasodilatory effects to no - mediated vasodilators would provide further insight into the mechanism of action of la nutrient supplementation. the inexpensive dietary la supplementation could be considered a nutritional supplement administered to t2 dm patients, as an alternative to other available antidiabetic drugs. l - arginine may be an inexpensive alternative treatment for type 2 diabetics. in this study, early intervention with l - arginine supplementation was beneficial by preserving glomerular filtration rates, presumably via increased renal endothelial nitric oxide synthase levels leading to renal vasodilation ; however, additional studies are needed to examine the alterations in the other many mediators involved in the nitric oxide pathway to further support this claim. lastly, there was an improvement in the insulin sensitivity in the la treated diabetic rats versus versus untreated diabetic rats. | rat studies demonstrated that type ii diabetes mellitus (t2 dm) decreases both the production and bioavailability of nitric oxide (no). l - arginine (la) provides the precursor for the production of no. we hypothesized that la dietary supplementation will preserve no production via endothelial nitric oxide synthase (enos) causing renal microvascular vasodilation and increased glomerular blood flow and thus increasing glomerular filtration rate (gfr). this would impede the formation of reactive oxygen species which contributes to cell damage and death. la supplementation preserved gfr in the treated diabetic rats compared to untreated diabetic rats. we provide evidence that this effect may be due to increased levels of enos and urinary cyclic guanosine monophosphate, which leads to renal microvascular vasodilation. plasma nitrotyrosine was decreased in the la treated rats ; however, plasma nitrite levels remained unaffected as expected. marked improvements in glucose tolerance were also observed in the la treated diabetic rats. these results demonstrate that la supplementation preserves no activity and may delay the onset of insulin resistance and renal dysfunction during hyperglycemic stress. these results suggest the importance of the no pathway in consequent renal dysfunction and in the development of insulin resistance in diabetic rats. |
vesicoureteral reflux (vur) is a relatively common disease in children ; the onset rate in children ranges from 0.4% to 1.8%. vur is diagnosed by voiding cystourethrography, and the severity of reflux is graded in accordance with the standards of the international reflux study in children (irsc). the reflux grade is an important diagnostic method for determining the treatment and prognosis of vur. in lower grade vur, therefore, patients who are determined to have lower grade vur tend to be treated conservatively until the vur resolves. however, there has been much controversy concerning the treatment guidelines for grade iii and iv reflux. to this end, smellie reported that patients with high - grade vur often have spontaneous resolution of vur. furthermore, many arguments have been made as to whether the existing grades are suitable for predicting the spontaneous resolution of vur. in addition to reflux grade, it has also been reported that age, laterality (unilateral or bilateral), and gender exert an influence on the spontaneous resolution of reflux. in addition to the existing prognostic factors and reflux grades, other factors have recently been reported. in particular, we have focused on the recent literature that vur is influenced by the severity of distal ureteral dilatation and analyzed the degree with which distal ureteral dilatation influenced the spontaneous resolution of vur to ascertain whether ureteral dilatation is as valuable a prognostic factor as the ones currently in existence. this study retrospectively analyzed how the degree of distal ureteral dilatation influenced the spontaneous resolution of vur. between april 1999 and august 2008, a total of 114 patients who were diagnosed with primary vur and were managed with prophylactic antibiotics were included in this study. patients with congenital anomalies and functional disorders in the urinary tract, such as congenitally malformed urethra, neurogenic bladder, double ureters and urethral valve, hutch diverticulum, and refluxing megaureter, were excluded from this study. the patients ' mean age was 24.2 months (range, 6 - 108 months). the mean follow - up duration was 37.6 months (range, 12 - 102 months), and there were 75 and 39 cases of unilateral and bilateral vur, respectively. there were 10, 32, 39, 20, and 13 cases each of grade i, ii, iii, iv, and v reflux, respectively (table 1). the degree of distal ureteral dilatation was analyzed as the longest diameter from among the distal ureters between the sacroiliac joint and the ureterovesical junction on voiding vesicourethrography. to correct the ureteral diameter, which may change as a child grows, the ureteral diameter ratio was calculated by dividing the maximum diameter of the distal ureter by its distance from the first lumbar vertebra to the fourth lumbar vertebra. we selected lumbar spine length to correct the ureteral diameter because currarino reported that there is linear growth of the spine from birth to 16 years, and the rib, scapula, other bones screen the thoracic spine on voiding vesicourethrography. the correlation between the ureteral diameter ratio and spontaneous resolution was analyzed. for conservative treatment, prophylactic antibiotics were used. because it is believed that vur is a predisposing factor for urinary tract infection, which in turn may cause permanent renal injury, voiding cystourethrography was performed on all subjects at intervals of 6 months or 1 year. cases for which vur was not observed on the voiding cystourethrography were defined as spontaneous resolution. the correlation between each factor and spontaneous resolution was analyzed through both univariate analysis and multivariate analysis. for statistical analysis, the sas software (version 9.1.2 ; sas institute, cary, nc, usa) was used ; chi - squared test, p for trend, spearman rank correlation, and a logistic regression model were performed. cases for which the p - values were less than 0.05 were considered statistically significant. surgical operations were performed on 44 (38%) of the other 57 cases in which reflux had already progressed or had not changed. medical treatment with prophylactic antibiotics and follow - ups there were 65 cases aged less than 1 year and 49 cases aged over 1 year ; of those less than 1 year of age, 35 cases (53%) showed spontaneous resolution, and of those aged 1 year or older, 22 cases (44%) showed spontaneous resolution. however, this difference was not statistically significant (p=0.344). additionally, spontaneous resolution occurred in 28 of 66 males (42%) and in 29 of 48 females (60%) (p=0.057). spontaneous resolution occurred in 42 of 75 cases (56%) of unilateral vur and in 15 of 39 cases (38%) of bilateral vur (p=0.048). in each grade (i to v), 7 cases (70%), 23 cases (71%), 21 cases (53%), 5 cases (25%), and 1 case (8%) had spontaneous resolution, respectively, demonstrating that spontaneous resolution rates were higher in the lower grades (p<0.001) (table 2). 0.004 - 0.216), and the univariate and multivariate analyses showed that the spontaneous resolution rate significantly increased as the ureteral diameter ratio decreased (p<0.001) (table 3, fig., there was a statistical correlation between ureteral diameter ratio and vur grade (p<0.001, rs=0.643). it is well known that age, gender, laterality, and reflux grade have a large influence on the occurrence of spontaneous resolution in patients with primary vur. with respect to age, yeung demonstrated that in 155 patients with primary vur, the spontaneous resolution rate was higher in high - grade patients aged less than 1 year than in those older than 1 year. park who performed conservative treatments of 48 cases of ureteral reflux for 35 months (on average), reported that reflux spontaneously resolved in 27 cases and that the resolution rate was higher in younger patients, despite higher grades of reflux. it is thought that the immature muscles of the vesical trigone develop with time and that the submucosal ureter becomes longer. in this study, the spontaneous resolution rate reached 53% and 44% in patients aged less than 1 year and in those aged 1 year and above, respectively. although the rate was higher in younger patients, the difference was not statistically significant. many studies have suggested that the onset rate of vur is higher in girls than in boys. chand performed a study with 15,504 children and reported that the onset rate was approximately two times higher in girls less than 2 years of age than in boys of the same age. according to the report by yeom, in general, the onset rate of vur was higher in girls than in boys ; however, in the case of children aged less than 1 year, the rate was higher in boys. in our study, the overall onset rate was higher in boys (57%) than in girls (43%). this may have resulted from the fact that children less than 1 year of age accounted for 44 boys and 21 girls in our study, which means that the onset rate may have been inflated owing to the larger number of boys. with respect to spontaneous resolution, schwab reported that vur was rapidly resolved in boys compared with girls, and sjstrm reported that the spontaneous resolution rate of high - grade vur (at least grade iv) was higher in boys aged less than 1 year than in girls of the same age grouping. in our study, however, it was higher in girls (60%) than in boys (42%), although the difference was not statistically significant. this difference might have resulted from there being more high - grade vur in boys than in girls. with regard to the correlation between laterality and spontaneous resolution, estrada smellie performed a study among children with grade iii or iv reflux and reported that the spontaneous resolution rate was significantly higher in unilateral vur. tamminen - mbius reported that the spontaneous resolution rate reached 12% in bilateral vur but was 54% in unilateral vur. similarly, in our study, the rate of spontaneous resolution was significantly higher in unilateral vur than in bilateral vur (56% vs. 38%, p=0.048). zerati filho researched spontaneous resolution rates in 417 children for 2.7 years (on average), and found resolution rates of 87.5%, 77.6%, 52.8%, 12.2%, and 4.3% for grade i, ii, iii, iv, and v reflux, respectively. arant reported that the spontaneous resolution rate reached 80% in grade i and ii primary vur without operative management. schwab performed a study with 214 children and showed that the spontaneous resolution rate was 13% in low - grade vur (grade iii and less) and 5% in high - grade vur (grade iv and over). barroso observed 178 children with unilateral vur for 55 months on average and reported that there was a strong possibility that high - grade vur could develop into bilateral vur. in our study, 69% of low - grade vur (grade ii or less) spontaneously resolved ; however, for high - grade vur (grade iv and over), the spontaneous resolution rate was just 18%, showing the inverse relationship between the spontaneous resolution rate and the reflux grade. one is that the antireflux function is weakened due to the congenitally immature muscles that go from the vesical trigone to the terminal ureter. the other is that the ureterovesical junction, formed from the outside in during fetal life, makes the submucosal ureter shorter and causes vur. specifically, the length and diameter of the submucosal ureter may be a large part of primary vur. however, the reflux grade is used to evaluate the severity of primary vur, a grading system that reflects the structure of the upper urinary system, including the renal pelvis and the renal calyx, and the subjective judgement of the person making the evaluation is reflected in grading. on the authority of such hypotheses, we calculated the ureteral diameter ratio by dividing the maximum diameter of the distal ureter by the distance from the first lumbar vertebra to the fourth one so as to correct the ureteral diameter for change with child growth. few studies have been carried out about distal ureteral dilatation as a factor influencing the spontaneous resolution of primary vur. mndez classified patients into three groups according to how much the lower ureter was dilated on ultrasonography and analyzed the prognoses after ureteral submucosal injection. they reported that distal ureteral dilatation was an important prognostic factor in treating primary reflux. lee divided the maximum length of the lower ureter, as measured by preoperative voiding cystourethrography using the length of the fourth lumbar vertebra, and performed ureteral submucosal injection according to the calculated ratio and analyzed its relationship to the recurrence of vur. the results showed that the dilatation of the lower ureter was a significant prognostic factor. we analyzed the influence of distal ureteral dilatation on the spontaneous resolution of vur, through univariate analysis based on the logistic regression model and multivariate analysis from which age, gender, laterality, and reflux grade were excluded. as a result, we determined that the ureteral diameter ratio was significantly related to the spontaneous resolution of reflux. thus, it appears that the ureteral diameter ratio may objectively measure vesicoureteral structure and thus may be an appropriate index to predict not only the present state of vur but also the possibility of spontaneous resolution. we have presented the degree of distal ureteral dilatation, which has the benefit of predicting spontaneous resolution more objectively. distal ureteral dilatation may be another prognostic factor in vur, determining therapeutic course and predicting spontaneous resolution of vur. | purposerecently, several studies have suggested that distal ureteral dilatation is an important factor influencing the spontaneous resolution of primary vesicoureteral reflux (vur). we evaluated the relationship between distal ureteral dilatation and the spontaneous resolution of primary vur.materials and methodsthe medical records of 114 patients with primary vur maintained on prophylactic antibiotics from april 1999 to august 2008 were retrospectively reviewed. the patients ' mean age was 24.2 months (range, 6 - 108 months). there were 66 male patients and 48 female patients. the mean follow - up was 37.6 months (range, 12 - 102 months). we analyzed various factors including age, gender, grade of reflux, laterality, and ureteral diameter ratio (udr ; the largest ureteral diameter was divided by the distance from the l1 - 4 vertebral body to minimize the differences in diameter by age) to determine whether these factors influenced the spontaneous resolution of primary vur.resultsunilateral, low - grade reflux and low udr were significantly associated with the spontaneous resolution of reflux (p=0.048, p<0.001, and p<0.001, respectively). the multivariate analysis revealed that the spontaneous resolution rate of primary reflux was significantly higher in patients with low udr than in patients with high udr (p<0.001).conclusionsthe degree of distal ureteral dilatation is expected to be another important factor in determining therapeutic course and predicting the spontaneous resolution of vur. |
bronchial diseases, such as bronchitis, bronchiectasia, and bronchomalacia, are frequently encountered in small animal medicine. among these conditions, bronchiectasia and bronchial collapse caused by bronchomalacia bronchomalacia in dogs is defined as weakening of the walls of principal bronchi and other smaller airways so that they become less rigid and functionally incompetent. severe bonchiectasia can be readily diagnosed using conventional radiography, but focal or mild cases are not easily detected. therefore, more accurate diagnostic methods for identifying changes in the bronchial diameter are important for diagnosing theses bronchial diseases. conventional radiography is the most non - invasive modality for diagnosing pulmonary disease, but there is limitation of identifying each bronchus due to its superimposing characteristics of conventional radiography. however, this technique is not easily performed in small dogs due to their smaller bronchial lumen. computed tomography (ct) is an accurate method for diagnosing bronchiectasia as well as other pulmonary diseases. this technique is more accurate than conventional radiography and less invasive than bronchoscopy. in human medicine, the bronchoarterial (ba) ratio is one of the most widely used criteria for identifying cases of bronchiectasia. evaluation of the ba ratio in small animal medicine has been recently performed in dogs and cats. however, the study populations were small and ba ratios in specific breeds have not been established. shih tzu, pekingese, and pugs are usually considered brachycephalic and have brachycephalic syndrome including stenotic nares, elongation of the soft palate, and tracheal problems. due to dynamic upper airway obstruction, brachycephalic dogs must generate large pressure changes during inhalation and exhalation throughout their lifetime. during both respiratory phases, we hypothesized that the ba ratio of brachycephalic dogs may be different from that in other non - brachycephalic dogs because of pressure gradient changes in bronchus. the purpose of this study was to determine the ba ratio of clinically normal brachycephalic dogs. thoracic ct results for brachycephalic dogs were obtained from three institutions (seoul national university, royal animal medical center, and irion animal hospital) in korea. dogs with a history of pulmonary diseases as well as those with any abnormal thoracic radiography or ct findings of the cardiopulmonary system the age of the dogs ranged from 3 to 13 years with a mean age of 8.1 years. four poodles, three english cocker spaniels, two miniature schnauzers, and one coton de toluea dogs were included in the non - brachycephalic group. the examination was performed with the animals in a sternal recumbent position under general anesthesia induced with isoflurane (ifran ; hana pharm, korea) and propofol (provive 1% ; claris lifesciences, india). for all examinations, transvers images with at least 3-mm slice thickness were acquired using a moderately edge enhancing reconstruction algorithm at the lung window level (ww : 2000 ; wl : -100). a dedicated imaging viewing station with commercially available viewing and analysis software (spectra ; infinitt healthcare, korea) five lung lobes including the right cranial, left cranial, right middle, right caudal, and left caudal were assessed. the right and left cranial lobar bronchi were evaluated by reviewing axial images acquired at the level of the fourth rib. the internal diameter of the bronchial lumens and accompanying arteries were measured in the same image with electronic calipers. if a bronchus or pulmonary artery was not prominent enough to be measured at the level of the fourth rib, the delineated bronchus and arteries were measured in the neighboring image up to the level of the rib immediately cranial or caudal. the same approach was used to determine the bronchus lumen and arterial diameter of the right and left caudal lung lobes at the level of the ninth rib (fig. 1). measurement of the right middle bronchus and artery was performed at the greatest width of this airway usually visible parallel in the axial image (fig. the mean and standard deviation of each lung lobe and each dog were calculated individually. a one - way repeated measures analysis of variance was performed for the ba ratios of each lung lobe. a mean of the mean ba ratios of each dog and the corresponding 99% confidence intervals was also calculated. a linear regression analysis of the ba ratio along with a welch two sample t - test for the shih tzu and pekingese dogs were performed. to evaluate differences relative to the non - brachycephalic dogs, a total 23 dogs and 112 ba ratios were obtained for the five measurement locations. three measurements for two dogs could not be obtained due to poor visualization of the bronchus. the mean of mean ba ratios for the dogs was 1.08 0.10 (99% ci = 0.98~1.18, table 1). there was no significant difference in mean ba ratio between the lung lobes or the individual canines (p = 0.148, fig. 3). furthermore, no relationship according to breed (p = 0.59) or age (r = 0.06, figs. 4 and 5) was observed. a total 10 dogs and 49 ba ratios for non - brachycephalic dogs the mean of mean ba ratios for non - brachycephalic dogs was 1.50 0.06 (99% ci = 1.46~1.56, table 1). there was significant difference between the two groups identified by the independent sample t - test (p = 0.00). the ba ratio for the brachycephalic animals (1.08 0.10) was lower than that of the non - brachycephalic healthy dogs (1.50 0.06). in a previous study, a mean ba ratio of healthy dogs similar to the one calculated for our study was identified. a lower mean ba ratio for brachycephalic dogs could represent a higher prevalence of upper airway obstruction and chronic airway obstruction that may change the bronchus. additionally, the ba ratio for brachycephalic dogs varied more widely in this study compared to the ratio for non - brachycephalic animals. irregularity of the bronchus lumen and diameter in brachycephalic dogs due to the nature of the upper airway obstruction may account for this variation. overall, results of this study demonstrated that evaluation of local bronchial disease in brachycephalic animals by ct can be performed precisely and used to avoid misinterpretation caused by normal variation. these results indicated that anatomical variation of each lung lobe did not influence the ba ratios. no significant difference associated with age was found, showing that conditions related to advanced age such as bronchial wall calcification or decreased elasticity did not affect the ba ratios. in other studies of ba ratios obtained for normal dogs and cats, the single breath hold technique was used to facilitate adequate inhalation. in the current investigation, apnea was induced for almost every animal by hyperventilation due to the retrospective nature of the study. all the participating animals in both the brachycephalic and non - brachycephalic groups were subjected to the same breath hold technique. thus, comparison between the two groups was reliable. in the present study, ct was performed for almost all patients to screen for non - pulmonary conditions such as intervertebral disc disease or orthopedic problems. dogs included in the present investigation were small breed animals (shih tzu and pekingese) and chest conformation varied. conventionally, the bronchus and vessels of both caudal lung lobes are evaluated at the level of the eleventh rib. however, in our population most lungs were not present at this level. the ba ratio of larger brachycephalic breeds (e.g., boxer or english bulldog) requires further study. in conclusion, data from this study will be useful for diagnosing early bronchial disease in specific breeds. | the bronchoarterial (ba) ratio measured with computed tomography is widely used in human medicine to diagnose bronchial dilation or collapse. although use of the ba ratio in veterinary medicine has been recently studied, this has not been evaluated in brachycephalic dogs predisposed to bronchial diseases including bronchial collapse. the purpose of this study was to establish ba ratios for brachycephalic dogs and compare the values with those of non - brachycephalic dogs. twenty - three brachycephalic dogs and 15 non - brachycephalic dogs without clinical pulmonary disease were evaluated. the ba ratio of the lobar bronchi in the left and right cranial as well as the right middle, left, and right caudal lung lobes was measured. no significant difference in mean ba ratio was observed between lung lobes or the individual animals (p = 0.148). the mean ba ratio was 1.08 0.10 (99% ci = 0.98~1.18) for brachycephalic dogs and 1.51 0.05 (99% ci = 1.46~1.56) for the non - brachycephalic group. there was a significant difference between the mean ba ratios of the brachycephalic and non - brachycephalic groups (p = 0.00). defining the normal limit of the ba ratio for brachycephalic breeds may be helpful for diagnosing bronchial disease in brachycephalic dogs. |
release of hydrocarbons into the environment, accidentally or due to industrial practices, is a major cause of environmental pollution. hence, the hydrocarbonoclastic capacities of various gammaproteobacteria have drawn attention as a possible strategy for oil spill bioremediation (van beilen. 2003, 2007 ; we focus on the degradation of dodecane, which is known to be a contaminant in areas related to fuel spills (gunasekera. 2013) and heavy metal mining where it is used as a solvent for radionuclide extraction (baumgaertner and finsterwalder 1970 ; alibrahim and shlewit 2007 ; nakashima and kolarik 2007). the n - alkanes are typically functionalized by oxidation of one terminal methyl group to generate the corresponding alcohol by an alkane hydroxylase system. this system consists of three components : an integral membrane protein alkane monooxygenase, alkb, a soluble nadh - rubredoxin reductase, alkt, and a soluble rubredoxin, alkg (eggink. together, these protein components, along with two redox cofactors (nadh and fad) catalyze the conversion of an alkane to the corresponding alkanol. the alkanol is further oxidized via a pathway involving an alcohol dehydrogenase (alkj), aldehyde dehydrogenase (alkh) and acyl - coa synthetase (alkk), followed by the -oxidation pathway (van beilen. aerobic alkane degradation is best characterized in the alkb - containing pseudomonas putida gpo1 (van beilen, wubbolts and witholt 1994 ; van beilen. acinetobacter alkane monooxygenases belong to a novel family and are referred to as alkm instead. most acinetobacters are known to have two alkane monooxygenases (alkm) that degrade overlapping ranges of alkanes (generally c9c40) (van beilen. given the low amino acid similarity of alkb and alkm (13), it is possible that alkm has a different mechanism of alkane oxidation, which might prove useful in alkane bioremediation under certain conditions. (2012) found that rag-1 significantly outperforms 16 other acinetobacter strains in terms of the biomass accumulated when grown on n - alkanes. (2016) have shown that rag-1 has an exceptional ability to degrade c10c25 n - alkanes. the whole - genome sequence of this strain is available (fondi. it contains two alkane - metabolizing proteins alkma and alkmb with 60% identity to each other. rag-1 has been widely studied for its ability to produce a potent biosurfactant, emulsan (rosenberg. 1982 ; pines and gutnick 1986 ; nakar and gutnick 2001 ; peleg. 2012). although it has been postulated that emulsan assists in alkane uptake, additional mechanisms that aid uptake and mitigate the potential alcohol toxicity have not been studied. microarray - based alkane transcriptional response has been studied in the alkb - containing strains alcanivorax borkumensis (sabirova. the alkane transcriptional response of the alkm - containing acinetobacter oleivorans dr1 identified upregulation of alkane metabolism, fatty acid metabolism, glyoxylate pathway and oxidative stress defense response genes (jung. dr1 harbors two alkane monooxygenases with varied degrees of similarity to the alkane monooxygenases of rag-1 (supplementary information 1, supporting information). this suggests differences in their hydrocarbonoclastic phenotype making it imperative to specifically study the powerful alkane - degrading strain rag-1. pairwise comparative analyses were performed on rag-1 grown in dodecane, dodecanol and sodium acetate (control, hereafter referred to as acetate). this is the first study to (i) specifically look at transcriptomic response in a hydrocarbonoclastic bacteria grown on dodecane, and (ii) compare gene expression data between cultures grown on an alkane and the corresponding alkanol, obtaining confirmation of the role of alkma and alkmb genes in dodecane metabolism along with identification of potential ancillary genes involved in dodecane uptake. uncovering the genetic determinants responsible for alkm - based dodecane degradation capacity will be helpful in developing effective bioremediation strategies. acinetobacter venetianus rag-1 (atcc 31012) was maintained on e2 medium (brown, gunasekera and ruiz 2014) with either 1% v / v dodecane (smits. 2002) or 0.01% v / v ethanol (dams - kozlowska and kaplan 2007) at 30c. 2002), rag-1 was grown in triplicates on three different carbon sources : dodecane (1% v / v), dodecanol (5 mm) and sodium acetate (0.2% w / v). total rna was extracted using the qiagen 's rneasy mini kit followed by dnase treatment to eliminate any dna contamination. the total rna samples were prepared for illumina next - generation sequencing using the ribozero kit and prepxtm rna - seq library preparation kit at the functional genomics lab (qb3-berkeley core research facility, berkeley, usa) and sequenced on illumina hiseq2000. the rag-1 genome (ncbi accession number appo00000000.1) was uploaded to rast (aziz. 2015) server for annotation. the trimmed, rrna - depleted rna - seq reads were mapped against the rast - annotated rag-1 genome using the clc bio genomics workbench 8.0.2 software (http://www.clcbio.com/products/clcgenomicsworkbench), which re - implemented edger rna quantification workflow (robinson, mccarthy and smyth 2010). genes exhibiting at least 2-fold change and less than 0.05 false discovery rate (fdr) were considered differentially regulated. the data are accessible through geo series accession number gse78186 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse78186) in ncbi 's gene expression omnibus (edgar, domrachev and lash 2002). genes were functionally annotated using the clusters of orthologous groups (cogs) database (tatusov. 2000), the seed subsystems database (silva. 2016) and blast2go (conesa. 2005) to assign gene ontology (go) terms (ashburner. the ncbi reference number and the protein sequence corresponding to the seed - based open reading frames (orfs) are listed in supplementary information 3 (supporting information). domains were identified using ncbi 's conserved domain database (marchler - bauer. rna - seq was used to compare rag-1 grown in dodecane, dodecanol or acetate as the sole carbon source. the numbers of genes differentially expressed in the pairwise comparisons are presented in table 1. the genes upregulated at least 10-fold in the pairwise comparisons could be more significant, and are listed in the supplementary information 4 (supporting information). differentially expressed genes were grouped using seed subsystem - based annotation, the cog gene distribution and go classification (supplementary information 5, supporting information). the number of differentially expressed genes (exhibiting at least 2-fold change and 2, fdr < 0.05) in dodecane relative to dodecanol in a. venetianus rag-1. thin fimbriae are postulated to enable rag-1 to adhere to hydrophobic surfaces like n - alkane droplets, rendering these accessible for cellular uptake. to the best of our knowledge, the genes coding for thin fimbriae involved in alkane uptake, have not been identified. we found a pilus - coding gene cluster (orf_1622-orf_1627) exclusively upregulated (2.48.9-fold) in dodecane relative to dodecanol and acetate. these genes are also clustered in the alkane - degrading strain acinetobacter baumanni ab307 - 0294. it is possible that this gene cluster codes for the thin fimbriae that aid in the alkane uptake in rag-1. as reported in previous gene expression studies (gunasekera. 2015), an upregulation of genes homologous to iron uptake genes (orf_2445, orf_2118 and orf_2945) was seen when rag-1 was grown in dodecane relative to acetate. this is expected since the alkane monooxygenase is known to possess an iron - containing core. genes upregulated when grown on both dodecane and dodecanol relative to acetate are likely important in dodecanol metabolism. these genes encoded ectoine biosynthesis, bacterioferritin - associated ferredoxin and certain transporters (table 3). genes upregulated in dodecane relative to dodecanol might be important in alkane uptake and oxidation (table 4). transporters upregulated in dodecane (relative to dodecanol and sodium acetate), dodecane and dodecanol (relative to sodium acetate), and dodecanol (relative to dodecane and sodium acetate) in a. venetianus rag-1. other genes of interest (not including genes coding for core alkane metabolism) highly upregulated in dodecane relative to dodecanol, dodecane and dodecanol relative to sodium acetate, and dodecanol relative to dodecane in a. venetianus rag-1. conversely, genes upregulated when grown in dodecanol relative to dodecane are most likely involved in alcohol uptake or alcohol stress response. the seed annotation confirms that genes involved in stress response were highly upregulated when grown in dodecanol (table 4). other genes significantly upregulated in dodecanol include the orf_1050-orf_1052, which are also clustered in other alkane - metabolizing bacteria such as p. aeruginosa pao1, p. fluorescens sbw25 and a. borkumensis sk2. in addition, genes coding for the putative membrane protein (orf_1238) and putative permease (orf _ 2440) are significantly upregulated in externally supplied dodecanol, suggesting their possible role in alkanol uptake. growth on acetate was marked by 5.8-fold upregulation of acetate permease, actp (orf_3034) relative to dodecane. this acetate is likely phosphorylated to acetyl - coa, by acetate kinase and phosphate acetyltransferase. the homologs of acetate kinase (orf_632) and phosphate acetyltransferase (orf_633) were upregulated 4.1- and 4.6-fold when grown in acetate relative to dodecane. it is known that the glyoxylate bypass pathway is essential for growth on carbon substrates such as acetate since it allows conversion of acetyl - coa to metabolic intermediates (kornberg 1966). accordingly, the orfs coding for the enzymes citrate synthase (orf_313), aconitase (orf_2449), isocitrate lyase (orf_2800), malate synthase (orf_2347) and malate dehydrogenase (orf_290) were upregulated 6.6-, 10.0-, 21.8-, 2.7- and 6.9-fold in acetate relative to dodecane. we report the first comprehensive transcriptome analysis of the highly efficient alkane - degrading strain rag-1. this strain encodes three genes involved in alkane oxidation : alkma, alkmb and alma. the gene alkmb demonstrated the highest differential expression and may be primarily involved in dodecane oxidation. given that alma was not differentially expressed, it might not be involved in dodecane oxidation. since the hypothetical protein located next to alkmb is very highly upregulated, future studies should include this gene when attempting heterologous expression of alkane monooxygenase from rag-1. the genes coding for a permease, an outer membrane protein and thin fimbriae were implicated in dodecane uptake. this study provides a functional understanding of pathways involved in dodecane uptake and metabolism in the strain rag-1 beyond annotations, and the data is useful for utilizing this metabolism natively or reconstituting it in another host. this work was supported by funding from the lawrence livermore national lab (llnl) via us department of energy, office of science, office of biological and environmental research contract de - ac02 - 05ch11231 between lawrence berkeley national laboratory and the us department of energy [lbnl award no. this work was performed under the auspices of the us department of energy by llnl under contract de - ac52 - 07na27344. the us government retains and the publisher, by accepting the article for publication, acknowledges that the us government retains a non - exclusive, paid - up, irrevocable, worldwide license to publish or reproduce the published form of this manuscript, or allow others to do so, for us government purposes. | the hydrocarbonoclastic bacterium acinetobacter venetianus rag-1 has attracted substantial attention due to its powerful oil - degrading capabilities and its potential to play an important ecological role in the cleanup of alkanes. in this study, we compare the transcriptome of the strain rag-1 grown in dodecane, the corresponding alkanol (dodecanol), and sodium acetate for the characterization of genes involved in dodecane uptake and utilization. comparison of the transcriptional responses of rag-1 grown on dodecane led to the identification of 1074 genes that were differentially expressed relative to sodium acetate. of these, 622 genes were upregulated when grown in dodecane. the highly upregulated genes were involved in alkane catabolism, along with stress response. our data suggest alkmb to be primarily involved in dodecane oxidation. transcriptional response of rag-1 grown on dodecane relative to dodecanol also led to the identification of permease, outer membrane protein and thin fimbriae coding genes potentially involved in dodecane uptake. this study provides the first model for key genes involved in alkane uptake and metabolism in a. venetianus rag-1. |
the experiment was carried out in accordance with the ethics and animal handling committee of the school of veterinary medicine and animal science of the university of so paulo. it was conducted at the research farm of the university of so paulo (usp) in pirassununga, sp, brazil, using 51 clinically healthy, cycling, multiparous, non - lactating nellore cows (bos indicus), 4 to 10 years old, with a body condition score between 3 and 4 (scale : 0, emaciated ; 5, obese), maintained under the same pasture regimen supplemented with sugar cane and/or corn silage, concentrate and free access to water and mineralized salt. estruses were synchronized (n = 51) by injecting two i m doses of prostaglandin f2 (pgf2) analogue (500 g sodium cloprostenol ; sincrocio, ouro fino animal health, cravinhos, brazil) 14 days apart. at the time of the second pgf2 injection, usa) device, and animals were observed twice daily until the sixth day after the last pgf2 injection for standing heat. ultrasound exams were performed with the aid of a duplex b - mode (grey - scale) and colour - doppler instrument (mylab30 vet gold ; esaote healthcare, so paulo, sp, brazil) equipped with a multi - frequency linear transducer 12 h after the animals displayed estrus in order to confirm the presence and location of a pre - ovulatory follicle and ai was performed. six days post - ai, an endometrial biopsy was collected from the uterine horn contralateral to ovulation, as determined by the presence of a corpus luteum (cl). once collected, the biopsy was placed in cryotubes and immediately immersed in liquid nitrogen, then transferred to 80 c for storage. blood sampling for determination of progesterone concentrations was performed at the time of biopsy and processed as described by mesquita.. after the biopsy procedure, cows received two 1 g doses of the anti - inflammatory medication flunixin meglumine (desflan, ouro fino animal health, cravinhos, brazil) in a 24 h interval and one dose of a penicillin / streptomycin based antibiotic (penfort reforado, ouro fino animal health, cravinhos, brazil). plasma p4 concentrations were measured by a solid - phase radioimmunoassay (coat - a - count ; siemens medical solutions diagnostics, los angeles, usa). the animals were observed for signs of abnormal vaginal secretions and/or discomfort after the biopsy. pregnancy diagnosis was performed 30 days post - ai via trans - rectal ultrasonography exam. rna - seq was performed on samples selected retrospectively based on the day 30 pregnancy diagnosis (n = 6 samples from each pregnant and non - pregnant animals). animals were selected based on two criteria : plasma p4 concentrations on day 6 must had been within a 1.5 ng / ml interval among all animals and, ovulations must had been confirmed within 12 h after ai as determined by ultrasound exam. frozen uterine samples (30 mg) were macerated in liquid nitrogen using a stainless steel apparatus, immediately mixed with buffer rlt from the rneasy mini columns kit (qiagen, so paulo, sp, brazil) and further dna, rna and protein extractions performed using a commercial purification kit (qiagen allprep dna / rna / protein mini kit, so paulo, sp, brazil) according to the manufacturer 's recommendations. rna purity and concentration were determined by spectrophotometry (thermo fisher scientific, suwanee, ga, usa) and rna integrity was assessed using the 2100 bioanalyzer (agilent technologies brasil ltda, so paulo, sp, brazil). the synthesis of deoxyribonucleic acid (cdna) was performed by reverse transcription using the high capacity cdna reverse transcription kit (life technologies, frederick, maryland, usa) according to manufacturer 's instructions. for the transcriptome analyses of expression patterns in pregnant and non - pregnant animals, cdna was generated using a routine rna library preparation truseq protocol developed by illumina technologies (san diego, ca) using 1 g of total rna as input. using the kit, mrna was first isolated from total rna by performing a polya selection step, followed by construction of paired - end sequencing libraries with an insert size of about 300 bp. briefly, polya selected rna was cleaved as per illumina protocol and the cleaved fragments were used to generate first strand cdna using superscript ii reverse transcriptase and random hexamers. resulting products were amplified via pcr and cdna libraries were then purified and validated using the bioanalyzer 2100 (agilent technologies). samples were multiplexed with unique six - mer barcodes and run on multiple lanes to obtain 2 100 bp reads. the paired end (pe) reads were filtered using the seqyclean v1.4.13 package (https://bitbucket.org/izhbannikov/seqyclean) which removed all reads with a mean quality under 26 and removed the primer and vector contaminants using the univec database (http://www.ncbi.nlm.nih.gov/tools/vecscreen/univec/). the reads were mapped using the local alignment with bowtie2 v2.1.0 against the masked bos taurus genome masked assembly (bos taurusumd3.1) and read counts were obtained using htseq - count v0.5.4p2 (http://www-huber.embl.de/users/anders/htseq/doc/count.html). from the six biopsies collected in the non - pregnant cows and used for rna - seq, one sample did not correctly align with the bovine genome and was consequently omitted from the analysis. the differential expression analysis of the rna - seq data was performed with package deseq2 v1.12.1, from r. after normalization, the log2 fold change was obtained through a general linear model approach, the significance test was followed by the fdr - benjamini - hochberg correction for multiple tests. genes with the normalized read counts < 5 across all samples were filtered out from the analysis. the enrichment analyses of different functional databases was done using the functional annotation tool of the database for annotation, visualization, and integrated discovery (david bioinformatics resources 6.7, niaid / nih) using as background the genes used on the differential expression analysis. the total list of genes derived from pregnant and non - pregnant endometrium was subjected to gene ontology annotation. from the total list, genes involved in different cellular and molecular processes nine of the differentially regulated genes as well as exhibiting the highest fold changes between pregnant and non - pregnant cows were selected from the rna - seq results for qrt - pcr analysis. primers for each selected gene were designed using primerquestqm tools (idt ; http://idtdna.com/scitools/applications/primerquest). amplicon sequence identity was confirmed with ncbi basic local alignment search tool software (blast http://blast.ncbi.nlm.nih.gov/blast.cgi). quantitative real - time pcr was performed using the steponeplus applied biosystem real - time pcr system and amplification was conducted in triplicate. reactions were performed in a final volume of 20 l using 10.0 l of power sybr green pcr master mix (warrington, uk), 10 m of each primer (forward and reverse), and 4 l of cdna (diluted 1:40). temperature profiles comprised an initial denaturation step at 95 c for 10 min, and 40 cycles with denaturation at 95 c for 15 s and annealing at 60 c for 1 min. relative expression levels of the selected target genes were calculated with the linregpcr software method. the cycle threshold (ct) values determined for the target genes were normalized against the reference gene. statistical analyses of qrt - pcr data were performed using student 's paired t - test. the transcript levels of nine genes were re - evaluated using quantitative real - time pcr (qrt - pcr). rna from the same animals assigned to the rna - seq analysis (pregnant, n = 6 ; non - pregnant, n = 6) were used for the qrt - pcr validation experiment. moreover, transcript levels from uterine biopsies of 15 additional animals (pregnant, n = 5 ; non - pregnant, n = 10) from animals of the same experiment were quantified. overall, there was an agreement for the results obtained from rna - seq and qrt - pcr. the experiment was carried out in accordance with the ethics and animal handling committee of the school of veterinary medicine and animal science of the university of so paulo. it was conducted at the research farm of the university of so paulo (usp) in pirassununga, sp, brazil, using 51 clinically healthy, cycling, multiparous, non - lactating nellore cows (bos indicus), 4 to 10 years old, with a body condition score between 3 and 4 (scale : 0, emaciated ; 5, obese), maintained under the same pasture regimen supplemented with sugar cane and/or corn silage, concentrate and free access to water and mineralized salt. estruses were synchronized (n = 51) by injecting two i m doses of prostaglandin f2 (pgf2) analogue (500 g sodium cloprostenol ; sincrocio, ouro fino animal health, cravinhos, brazil) 14 days apart. at the time of the second pgf2 injection, usa) device, and animals were observed twice daily until the sixth day after the last pgf2 injection for standing heat. ultrasound exams were performed with the aid of a duplex b - mode (grey - scale) and colour - doppler instrument (mylab30 vet gold ; esaote healthcare, so paulo, sp, brazil) equipped with a multi - frequency linear transducer 12 h after the animals displayed estrus in order to confirm the presence and location of a pre - ovulatory follicle and ai was performed. six days post - ai, an endometrial biopsy was collected from the uterine horn contralateral to ovulation, as determined by the presence of a corpus luteum (cl). once collected, the biopsy was placed in cryotubes and immediately immersed in liquid nitrogen, then transferred to 80 c for storage. blood sampling for determination of progesterone concentrations was performed at the time of biopsy and processed as described by mesquita.. after the biopsy procedure, cows received two 1 g doses of the anti - inflammatory medication flunixin meglumine (desflan, ouro fino animal health, cravinhos, brazil) in a 24 h interval and one dose of a penicillin / streptomycin based antibiotic (penfort reforado, ouro fino animal health, cravinhos, brazil). plasma p4 concentrations were measured by a solid - phase radioimmunoassay (coat - a - count ; siemens medical solutions diagnostics, los angeles, usa). the animals were observed for signs of abnormal vaginal secretions and/or discomfort after the biopsy. pregnancy diagnosis was performed 30 days post - ai via trans - rectal ultrasonography exam. rna - seq was performed on samples selected retrospectively based on the day 30 pregnancy diagnosis (n = 6 samples from each pregnant and non - pregnant animals). animals were selected based on two criteria : plasma p4 concentrations on day 6 must had been within a 1.5 ng / ml interval among all animals and, ovulations must had been confirmed within 12 h after ai as determined by ultrasound exam. frozen uterine samples (30 mg) were macerated in liquid nitrogen using a stainless steel apparatus, immediately mixed with buffer rlt from the rneasy mini columns kit (qiagen, so paulo, sp, brazil) and further dna, rna and protein extractions performed using a commercial purification kit (qiagen allprep dna / rna / protein mini kit, so paulo, sp, brazil) according to the manufacturer 's recommendations. rna purity and concentration were determined by spectrophotometry (thermo fisher scientific, suwanee, ga, usa) and rna integrity was assessed using the 2100 bioanalyzer (agilent technologies brasil ltda, so paulo, sp, brazil). the synthesis of deoxyribonucleic acid (cdna) was performed by reverse transcription using the high capacity cdna reverse transcription kit (life technologies, frederick, maryland, usa) according to manufacturer 's instructions. for the transcriptome analyses of expression patterns in pregnant and non - pregnant animals, cdna was generated using a routine rna library preparation truseq protocol developed by illumina technologies (san diego, ca) using 1 g of total rna as input. using the kit, mrna was first isolated from total rna by performing a polya selection step, followed by construction of paired - end sequencing libraries with an insert size of about 300 bp. briefly, polya selected rna was cleaved as per illumina protocol and the cleaved fragments were used to generate first strand cdna using superscript ii reverse transcriptase and random hexamers. resulting products were amplified via pcr and cdna libraries were then purified and validated using the bioanalyzer 2100 (agilent technologies). samples were multiplexed with unique six - mer barcodes and run on multiple lanes to obtain 2 100 bp reads. the paired end (pe) reads were filtered using the seqyclean v1.4.13 package (https://bitbucket.org/izhbannikov/seqyclean) which removed all reads with a mean quality under 26 and removed the primer and vector contaminants using the univec database (http://www.ncbi.nlm.nih.gov/tools/vecscreen/univec/). the reads were mapped using the local alignment with bowtie2 v2.1.0 against the masked bos taurus genome masked assembly (bos taurusumd3.1) and read counts were obtained using htseq - count v0.5.4p2 (http://www-huber.embl.de/users/anders/htseq/doc/count.html). from the six biopsies collected in the non - pregnant cows and used for rna - seq, one sample did not correctly align with the bovine genome and was consequently omitted from the analysis. the differential expression analysis of the rna - seq data was performed with package deseq2 v1.12.1, from r. after normalization, the log2 fold change was obtained through a general linear model approach, the significance test was followed by the fdr - benjamini - hochberg correction for multiple tests. genes with the normalized read counts < 5 across all samples were filtered out from the analysis. the enrichment analyses of different functional databases was done using the functional annotation tool of the database for annotation, visualization, and integrated discovery (david bioinformatics resources 6.7, niaid / nih) using as background the genes used on the differential expression analysis. the total list of genes derived from pregnant and non - pregnant endometrium was subjected to gene ontology annotation. from the total list, genes involved in different cellular and molecular processes nine of the differentially regulated genes as well as exhibiting the highest fold changes between pregnant and non - pregnant cows were selected from the rna - seq results for qrt - pcr analysis. primers for each selected gene were designed using primerquestqm tools (idt ; http://idtdna.com/scitools/applications/primerquest). amplicon sequence identity was confirmed with ncbi basic local alignment search tool software (blast http://blast.ncbi.nlm.nih.gov/blast.cgi). quantitative real - time pcr was performed using the steponeplus applied biosystem real - time pcr system and amplification was conducted in triplicate. reactions were performed in a final volume of 20 l using 10.0 l of power sybr green pcr master mix (warrington, uk), 10 m of each primer (forward and reverse), and 4 l of cdna (diluted 1:40). temperature profiles comprised an initial denaturation step at 95 c for 10 min, and 40 cycles with denaturation at 95 c for 15 s and annealing at 60 c for 1 min. relative expression levels of the selected target genes were calculated with the linregpcr software method. the cycle threshold (ct) values determined for the target genes were normalized against the reference gene. statistical analyses of qrt - pcr data were performed using student 's paired t - test. the transcript levels of nine genes were re - evaluated using quantitative real - time pcr (qrt - pcr). rna from the same animals assigned to the rna - seq analysis (pregnant, n = 6 ; non - pregnant, n = 6) were used for the qrt - pcr validation experiment. moreover, transcript levels from uterine biopsies of 15 additional animals (pregnant, n = 5 ; non - pregnant, n = 10) from animals of the same experiment were quantified. overall, there was an agreement for the results obtained from rna - seq and qrt - pcr. | the uterus plays a central role among the reproductive tissues in the context of early embryo - maternal communication and a successful pregnancy depends on a complex series of endometrial molecular and cellular events. the factors responsible for the initial interaction between maternal and embryonic tissues, leading to the establishment of pregnancy, remain poorly understood. in this context, illumina 's next - generation sequencing technology has been used to discover the uterine transcriptome signature that is favourable for ongoing pregnancy. more specifically, the present report documents on a retrospective in vivo study in which data on pregnancy outcome were linked to uterine gene expression signatures on day 6 (bovine model). using the rna - seq method, 14.654 reference genes were effectively analysed for differential expression between pregnant and non - pregnant uterine tissue. transcriptome data revealed that 216 genes were differently expressed when comparing uterine tissue from pregnant and non - pregnant cows. all read sequences were deposited in the sequence read archive (sra) of the ncbi (http://www.ncbi.nlm.nih.gov/sra). an overview of the gene expression data has been deposited in ncbi 's gene expression omnibus (geo) and is accessible through geo series accession number gse65117. this allows the research community to enhance reproducibility and allows for new discoveries by comparing datasets of signatures linked to receptivity and/or pregnancy success. the resulting information can serve as tool to identify valuable and urgently needed biomarkers for scoring maternal receptivity and even for accurate detection of early pregnancy, which is a matter of cross - species interest. beyond gene expression analysis as a marker tool, the rna - seq information on pregnant uterine tissue can be used to gain novel mechanistic insights, such as by identifying alternative splicing events, allele - specific expression, and rare and novel transcripts that might be involved in the onset of maternal receptivity. this concept is unique and provides a new approach towards strategies that are highly needed to improve efficiency of fertility treatments. |
non - alcoholic fatty liver disease (nafld) and its more severe form, non - alcoholic steatohepatitis (nash), have become the metabolic epidemics of the modern world. these have been attributed to the growing prevalence of obesity and insulin resistance in the population. roughly a third of obese people are prone to and develop nafld / nash in their lifetime. on the other hand, this has been described extensively and we know that some lean people are prone to nafld / nash as well. therefore, it is logical to think of other, yet unknown, factors triggering the process of fatty liver in the liver of obese and lean people. the epidemic of obesity and nafld / nash has occurred alongside economic development and adopting a more western type of diet in most parts of the world. meanwhile the metabolic syndrome has risen as a serious threat to the health of communities and a new burden on the health economy. gastro - esophageal reflux disease (gerd) has also been considered as the gastro - intestinal manifestation of the metabolic syndrome. interestingly gerd is also on the rise in parallel with nafld / nash and obesity is a risk factor for gerd too. again not all obese people develop gerd and many patients with gerd are not obese. having common epidemiologic backgrounds, it looks plausible that these conditions may have a common trigger or mechanism for their development. the exact pathophysiologic mechanisms causing gerd are not known, but recent, animal, ecologic, and human data have linked excess dietary nitrate to gerd. nitrate is an inert compound and can only take part in biochemical reactions after being reduced to nitrite by the nitrate reductase of oral bacteria residing on the dorsum of the tongue. the ingested nitrite then enters an enterosalivary circulation and is re - secreted into the mouth by salivary glands. it has been recently shown that oral nitrate reductase activity (nra) is increased in patients with erosive gerd. therefore, oral flora may play a role in development of erosive gastro - esophageal reflux disease. as gerd is considered a gastrointestinal (gi) manifestation of the metabolic syndrome which is in turn related to nash / nafld, common pathways may exist. having these in mind, we hypothesized that oral nra may have an effect on development of nafld / nash. nash was defined as having at least grade - i fatty liver on abdominal ultrasound examination and either aspartate aminotransferase (ast) or alanine aminotransferase (alt) more than 1.5 times the upper normal limit on two occasions during the six months before enrollment. all patients were checked for hepatitis b and c, autoimmune hepatitis, wilson s disease, alpha-1 anti - trypsin deficiency, and hemochromatosis and required to be negative for all these. in addition, those who took herbal medicine or supplements for bodybuilding regularly were excluded from the study. controls were selected from patients referring to one of the authors (sm) and were matched for age. the following data were obtained from each participant : height (in centimeters), weight (in kilograms), waist circumference (in centimeters), hip circumference (in centimeters), aspartate aminotransferase (ast, iu / l), alanine aminotransferase (alt, iu / l), fasting blood sugar (fbs, mg / dl), total cholesterol (mg / dl), serum triglyceride (tg, mg / dl), high density lipoprotein (hdl, mg / dl)), low density lipoprotein (ldl, mg / dl), and fasting serum insulin level (u / ml). body mass index (bmi, kg / m) and homeostasis model assessment - insulin resistance (homa - ir) were calculated, the latter using fbs and fasting serum insulin level. participants underwent abdominal ultrasound examination for assessment of fatty liver as well and their fat estimation reported as grades of fatty change. all participants were asked to report to the clinic after an overnight fast and avoiding food containing high nitrate (including lettuce, cabbage, celery, turnip, beetroot, radish, and rhubarb) for at least eight hours. after filling in a questionnaire for demographic, clinical and paraclinical information, oral nra briefly, particiapants rinsed their mouth with 22 ml of deionized, sterile water initially. then he / she was asked to hold 22 ml of a 10 mg nitrate - n / l solution in the mouth for 3 min. the subject was instructed to mix the solution in the mouth at the beginning and every 1 min over the 3 min, and 1.5 ml of the solution incubated in the mouth was sampled with a sterile syringe after each mixing (i.e., at the beginning and at 1-min intervals). the samples were gathered in special tubes and the rest of the nitrate reductase in the samples was inactivated to prevent in vitro activity. the nitrite was then measured immediately according to the previously described method and the slope of nitrite concentration was used to determine the nra accordingly and reported as g nitrite - n formed per person per minute. twenty - three people (11 cases and 12 controls, all male) were enrolled. the patients heights were comparable but cases weighed significantly heavier than controls (table-1). total cholesterol, hdl and ldl were comparable in the two groups, but tg was significantly higher among cases than controls (187.5 vs. 118.1 mg / dl respectively, p=0.014). there was also a trend towards higher fbs among cases (91.0 vs. 83.7 mg / dl respectively, p=0.081). two cases had grade - i, one had grade - iii, and the rest had grade - ii fatty liver on abdominal ultrasound examination. one control was reported to have a grade - i fatty liver with normal liver enzyme levels. mean oral nra was not different between the two groups (2.82 vs. 3.51 g nitrite - n formed per person per minute for cases and controls respectively, p=0.46). there were two outliers among controls (nra level>8 g nitrite - n formed per person per minute). nafld and nash are among the common problems for which people seek medical advice and their prevalence is increasing worldwide. although frequency of nafld / nash increases with increasing bmi, but most obese people never develop these conditions. besides, lean people may develop nafld / nash. is it a genetic predisposition (which probably is) or are there environmental factors affecting this ? it is not possible to answer this question yet, but hypotheses can be generated. considering the vast metabolic activities of these microbes and their extensive involvement in human physiology, it is plausible to hypothesize that alterations in this milieu may have effects on disease behavior in different patients. in other words,, the oral and gi flora may be more influential in metabolic diseases which involve diet and its constituents in some way. an important point in such studies is that it may not be a given microbe which affects the outcome, but the metabolic effect of the given microbe in a given milieu of other microbes and their topographical distribution in an environment determines the final effect. therefore, despite the fact that looking for individual microbes is informative, but checking metabolic pathways may be more enlightening. we tested the oral nitrate reductase activity as a marker of oral flora composition in individuals with and without nash. nra was selected as it has been recently shown that it may contribute to development of erosive reflux disease which itself is considered a gi manifestation of the metabolic syndrome just like nash. according to our data, oral nitrite production is not different between people with nafld / nash and age - matched controls. in other words, strengths of our study include that we measured nra with an accurate and reproducible method in vivo. another point which may have affected our data is that nra measurements for controls have been done in the colder months of the year. another point which may have affected our results is that nash patients in our study had significantly higher bmi levels. the question to be answered is that if bmi is associated with development of nash, why some obese / overweight people develop nash / nafld, while other people with similar bmi do not. for this to be answered, we need cases and controls to be comparable in their bmis. in addition, controlling or matching for other confounders may in further studies may give us better insight to this concept. therefore, it is still possible that oral nra and excessive dietary nitrate can have a role in development of nafld / nash. hence, studies with higher numbers of cases and controls with a more meticulous methodology are warranted. | background nafld / nash is a manifestation of metabolic syndrome and is associated with obesity / overweight. not all obese / overweight individuals develop nash. gastro - esophageal reflux disease (gerd) is considered a gastrointestinal manifestation of the metabolic syndrome and is associated with obesity / overweight. again not all obese / overweight individuals develop gerd. recent data show association of dietary nitrate content and oral nitrate reductase activity (nra) with gerd. nitrates need to be converted to nitrite (done in human beings by nitrate reductase of oral bacteria exclusively) to be active in metabolic pathways. objective to assess the relation between nash / nafld and oral nra. methods oral nra was measured in individuals with nash (compatible abdominal ultrasound and two elevated alt / ast levels over six months) and was compared with that of those without nash. oral nra was measured according to a previously reported protocol. results eleven nash patients and twelve controls were enrolled. mean oral nra activity were 2.82 vs. 3.51 g nitrite - n formed per person per minute for cases and controls respectively (p=0.46). conclusion according to our data, oral nitrite production is not different between individual swith and without nash. |
we studied the behavior of the red mason bees (osmia bicornis l.) inside artificial cells made from plastic tubes with two open ends (8 mm inner diameter) and natural cell walls from red mason bee nests. the cocoons that were used in the experiment were overwintered in a climatic chamber set at + 4 c and were taken from these conditions immediately before use in an experiment. each cocoon was cut open on top, and the bee inside was sexed based on its morphological characteristics (seidelmann. then, the cocoon was placed inside the artificial cell, and both ends of the tube were closed using natural mud cell walls. the two undamaged cell walls were attached to the ends of the tubes with paper tape, and a bee could successfully leave the cell through a wall after chewing through it. one wall was placed with its rough and convex side to the inside of the artificial cell, and the other was placed with its smooth and concave side to the inside of the artificial cell. the convex wall under natural conditions is the one that should be chewed by the bee to emerge from the nest. if a bee were to chew the concave side, it would direct itself towards the inside of the nest. therefore, bees oriented towards the convex wall are called correctly oriented, in contrast to those oriented towards the concave wall, which are called misoriented. we used males and females, and each cocoon was placed either correctly (with the bee s head facing the convex wall) or not (with the bee s head facing the concave wall). the artificial cells with bee cocoons were placed inside a cardboard box to ensure darkness. artificial cells were examined to determine whether a bee emerged through a correct (convex) or incorrect (concave) wall. the frequency of these choices was compared separately for males and females in cocoons that were placed correctly or incorrectly in artificial cells. the emergence of 40 male and 43 female bees from their artificial cells was recorded. all of the 17 males and 18 females that were placed in the artificial cells towards the convex wall (i.e., correctly oriented) emerged through this wall. of the bees whose cocoons were placed in their cells towards the concave wall (i.e., misoriented), 19 out of 23 males and 2 out of 25 females turned inside their cells and emerged from the correct (convex) wall (p < 0.001 ; table 1). table 1.number of red mason bees that chewed through the convex (correct) or concave (incorrect) mud wall of their artificial nest after emerging from their cocoon, stratified by sex and initial positioninitial positionsexwhich exit did they take?correctincorrectcorrectmale170correctfemale180incorrectmale194incorrectfemale223 number of red mason bees that chewed through the convex (correct) or concave (incorrect) mud wall of their artificial nest after emerging from their cocoon, stratified by sex and initial position the results of our experiment show that shape and/or texture of the cell walls can be used by emerging adult bees as a cue indicating the direction of the nest entrance and allow them to correct their wrong orientation. whereas most males that we examined used the information provided by the cell walls to emerge through the correct side of the artificial cell, females did not follow this cue and simply headed in the direction in which they had been positioned in their cocoons. females are larger than males, which makes it more difficult for them to turn inside the narrow space of a cell. under natural conditions, it is possible that females in narrower nests are only able to proceed straight ahead. however, the tendency not to turn arises from more than physical inability. when placed in an artificial cell with both ends closed without the ability to chew their way outside, ca. 45% of females (and not only the smallest ones) turned around in their artificial cells (unpublished data). a similar observation was made in solitary wasps, where insects that were experimentally tuned around as pupae tried to emerge towards the blind end of the nests, although in many cases they probably had enough space to turn around (cooper 1957). differences in the strategies of males and females are logical in light of previous studies on cocoon orientation in the nest. females are positioned with their heads towards the inside of the nest much less frequently than are males (torchio 1980 ; szentgyrgyi and woyciechowski 2013). this difference is explained by the relatively decreased ability of females to turn around inside their cells because of their size. however, this difference does not mean that proper orientation in the nest is not necessary for males. our experiment shows that the decision of from where to emerge may be postponed in males compared to females, who orient themselves correctly as cocooned larvae and, thus, do not verify their decision as eclosed adults. in contrast, males follow directional cues less strictly as larvae and tend to choose to chew through the correct wall regardless of their position in their cocoons. however, the concave side of the wall may be more difficult to chew for a male than for a female. males have weaker mandibles than females, and chewing through the smooth surfaces of the concave wall can be a challenge. in contrast, the convex wall is rough, with many small bulges and cracks that allow mandibles to get a good grip. difficulty chewing can be a directional cue informing a male red mason bee that he is chewing the wrong wall for emergence. however, it is also possible that bees carefully examine the walls using their antennae or legs before they start to attack the wall. our experiment on the red mason bee shows that the regulation of behavior inside the nest may be more complicated than previously thought. there seems to be more than one time point during development when bees can control their position in relation to the nest entrance. the time points differ in their relative importance between the two sexes, and this behavioral difference is likely related to their sexual size dimorphism. sexual dimorphism in solitary bees most likely evolved because of the different fitness of males and females in relation to their body mass. larger females are more effective in collecting food for offspring which increases their reproductive success, e.g., by reducing risk of nest parasitism (seidelmann. in contrast, effect of body size on reproductive success has not been shown in males, because their competition for mates does not involve fights between males (seidelmann 1999). our study shows that this dimorphism can result in evolving further differences between sexes, even in behavioral traits. | numerous species of solitary bees and wasps build linear nests with only one entrance. developing insects must orient themselves inside their nest to choose the correct direction in which to emerge. misorientation and chewing towards the dead end of the nest can result in significant mortality. most insects position themselves towards the nest entrance during cocoon construction ; however, some individuals are misoriented. we tested whether imagines can examine and possibly correct their orientation after emerging from their cocoons. males were usually able to correct their misoriented position based on the shape of the cell wall and emerged through the correct entrance, whereas most females pursued the direction that they faced in their cocoons. we suggest that there can be more than one time point during development when bees can control their position in relation to the nest entrance and that the importance of these time points varies between sexes. |
most organisms are normally diploid, which means that they have two sets of chromosomes : one set inherited from each parent. polyploid types are labeled according to the number of chromosome sets in the nucleus : triploid (three sets ; 3x, (69,xxx)), tetraploid (four sets ; 4x, (92,xxxx)), pentaploid (five sets ; 5x), hexaploid (six sets ; 6x), octaploid (eight sets ; 8x), decaploid (10 sets ; 10x) and dodecaploid (12 sets ; 12x). we present a unique case of a chronic idiopathic thrombocytopenic purpura (itp) patient who presented in our hospital with low platelet count. however, on bone marrow karyotyping, it was incidentally discovered that he had an octaploidy of autosomes. an elderly 68-year - old male, a known case of chronic itp for more than a decade, presented in our hospital with chief complaints of petechial rashes and ecchymosis over extremities and bleeding from oral cavity since 3 - 4 days prior to hospitalization. he saw a physician before coming to our hospital and received one dose of iv methylprednisolone and oral wysolone. he was stable for 10 days, but his platelet counts dropped to around 23,000/ cuml soon after. he was then given anti - d dose, after which his platelet counts improved gradually. meanwhile, his bone marrow karyotyping was also done and chromosomal analysis revealed two cell lines., 20% cells analyzed revealed a total of 184 chromosomes, of which 176 autosomal chromosomes showed octaploidy with four copies each of x and y chromosome [figure 1 ]. itp is a clinical syndrome in which a decreased number of circulating platelets (thrombocytopenia) manifests as a bleeding tendency, easy bruising (purpura) or extravasation of blood from capillaries into skin and mucous membranes (petechiae). in persons with itp, platelets are coated with autoantibodies to platelet membrane antigens, resulting in splenic sequestration and phagocytosis by mononuclear macrophages. the resulting shortened life span of platelets in the circulation, together with incomplete compensation by increased platelet production by bone marrow megakaryocytes, results in a decreased platelet count. three forms of the itp occur on the basis of duration of the disease : acute, chronic and intermittent. the chronic form of itp is more common in young women, with a female to male ratio of 3:1. these antibodies are believed to be against the gpiib / iiia, fibrinogen receptor on the platelet membrane. karyotyping is the process of pairing and ordering all the chromosomes of an organism thus providing a genome - wide snapshot of an individual 's chromosomes. karyotypes are prepared using standardized staining procedures that reveal characteristic structural features for each chromosome. clinical cytogeneticists analyze human karyotypes to detect gross genetic changes - anomalies involving several megabases or more of dna. the modal number (mn) may be expressed as a range between two chromosome numbers. modal numbers in the haploid (n), diploid (2n), triploid (3n) or tetraploid (4n) range, or near but not equal to any multiple of the haploid number, and which can not be given as a precise number, may be expressed as near - haploid (n), hypohaploid (n), hyperhaploid (n+), near - diploid (2n), hypodiploid (2n), hyperdiploid (2n+), near - triploid (3n), hypotriploid (3n), hypertriploid (xb+), near - tetraploid (4n), hypotetraploid (4n), hypertetraploid (4n+), and so on. pseudodiploid, pseudotriploid, etc. are used to describe a karyotype that has the number of chromosomes equal to a multiple of the haploid number (euploid) but is abnormal because of the presence of acquired numerical and/or structural aberrations. octaploidy or near - octaploidy is a rare finding which has not been reported in a case of immune thrombocytopenia. a solitary case of near - octaploidy has been reported in a case of essential thrombocythemia by kwong, in 1993. in the present case, on analyzing the karyotype, it was found that the patient had apparently normal karyotype in 80% of the cell lines, but 20% of the cell lines showed a near - octaploidy. it could be an incidental finding or may have been an association with the recurrent relapses and recurrences the patient is experiencing. the report is hereby presented firstly because of its rarity in occurrence and secondly because it may have been associated with platelets disorder as both the cases reported (the present one and the one by kwong.) were platelet disorder. itp is a clinical syndrome in which a decreased number of circulating platelets (thrombocytopenia) manifests as a bleeding tendency, easy bruising (purpura) or extravasation of blood from capillaries into skin and mucous membranes (petechiae). in persons with itp, platelets are coated with autoantibodies to platelet membrane antigens, resulting in splenic sequestration and phagocytosis by mononuclear macrophages. the resulting shortened life span of platelets in the circulation, together with incomplete compensation by increased platelet production by bone marrow megakaryocytes, results in a decreased platelet count. three forms of the itp occur on the basis of duration of the disease : acute, chronic and intermittent. the chronic form of itp is more common in young women, with a female to male ratio of 3:1. these antibodies are believed to be against the gpiib / iiia, fibrinogen receptor on the platelet membrane. karyotyping is the process of pairing and ordering all the chromosomes of an organism thus providing a genome - wide snapshot of an individual 's chromosomes. karyotypes are prepared using standardized staining procedures that reveal characteristic structural features for each chromosome. clinical cytogeneticists analyze human karyotypes to detect gross genetic changes - anomalies involving several megabases or more of dna. the modal number (mn) may be expressed as a range between two chromosome numbers. modal numbers in the haploid (n), diploid (2n), triploid (3n) or tetraploid (4n) range, or near but not equal to any multiple of the haploid number, and which can not be given as a precise number, may be expressed as near - haploid (n), hypohaploid (n), hyperhaploid (n+), near - diploid (2n), hypodiploid (2n), hyperdiploid (2n+), near - triploid (3n), hypotriploid (3n), hypertriploid (xb+), near - tetraploid (4n), hypotetraploid (4n), hypertetraploid (4n+), and so on. pseudodiploid, pseudotriploid, etc. are used to describe a karyotype that has the number of chromosomes equal to a multiple of the haploid number (euploid) but is abnormal because of the presence of acquired numerical and/or structural aberrations. octaploidy or near - octaploidy is a rare finding which has not been reported in a case of immune thrombocytopenia. a solitary case of near - octaploidy has been reported in a case of essential thrombocythemia by kwong, in 1993. in the present case, on analyzing the karyotype, it was found that the patient had apparently normal karyotype in 80% of the cell lines, but 20% of the cell lines showed a near - octaploidy. it could be an incidental finding or may have been an association with the recurrent relapses and recurrences the patient is experiencing. the report is hereby presented firstly because of its rarity in occurrence and secondly because it may have been associated with platelets disorder as both the cases reported (the present one and the one by kwong.) were platelet disorder. itp is a clinical syndrome in which a decreased number of circulating platelets (thrombocytopenia) manifests as a bleeding tendency, easy bruising (purpura) or extravasation of blood from capillaries into skin and mucous membranes (petechiae). in persons with itp, platelets are coated with autoantibodies to platelet membrane antigens, resulting in splenic sequestration and phagocytosis by mononuclear macrophages. the resulting shortened life span of platelets in the circulation, together with incomplete compensation by increased platelet production by bone marrow megakaryocytes, results in a decreased platelet count. three forms of the itp occur on the basis of duration of the disease : acute, chronic and intermittent. the chronic form of itp is more common in young women, with a female to male ratio of 3:1. these antibodies are believed to be against the gpiib / iiia, fibrinogen receptor on the platelet membrane. karyotyping is the process of pairing and ordering all the chromosomes of an organism thus providing a genome - wide snapshot of an individual 's chromosomes. karyotypes are prepared using standardized staining procedures that reveal characteristic structural features for each chromosome. clinical cytogeneticists analyze human karyotypes to detect gross genetic changes - anomalies involving several megabases or more of dna. the modal number (mn) may be expressed as a range between two chromosome numbers. modal numbers in the haploid (n), diploid (2n), triploid (3n) or tetraploid (4n) range, or near but not equal to any multiple of the haploid number, and which can not be given as a precise number, may be expressed as near - haploid (n), hypohaploid (n), hyperhaploid (n+), near - diploid (2n), hypodiploid (2n), hyperdiploid (2n+), near - triploid (3n), hypotriploid (3n), hypertriploid (xb+), near - tetraploid (4n), hypotetraploid (4n), hypertetraploid (4n+), and so on. pseudodiploid, pseudotriploid, etc. are used to describe a karyotype that has the number of chromosomes equal to a multiple of the haploid number (euploid) but is abnormal because of the presence of acquired numerical and/or structural aberrations. octaploidy or near - octaploidy is a rare finding which has not been reported in a case of immune thrombocytopenia. a solitary case of near - octaploidy has been reported in a case of essential thrombocythemia by kwong, in 1993. in the present case, on analyzing the karyotype, it was found that the patient had apparently normal karyotype in 80% of the cell lines, but 20% of the cell lines showed a near - octaploidy. it could be an incidental finding or may have been an association with the recurrent relapses and recurrences the patient is experiencing. the report is hereby presented firstly because of its rarity in occurrence and secondly because it may have been associated with platelets disorder as both the cases reported (the present one and the one by kwong.) were platelet disorder. | we report a case of an elderly 68-year - old male who presented in our hospital with chief complaints of petechial rashes and ecchymosis over extremities and bleeding from the oral cavity since 34 days prior to hospitalization. he saw a physician before coming to our hospital and received one dose of iv methylprednisolone and oral wysolone. he had come to our hospital for further management. bone marrow karyotyping was done and chromosomal analysis revealed two cell lines. eighty percent of the cells analyzed revealed apparently normal male karyotype. however, 20% cells analyzed revealed a total of 184 chromosomes, suggesting octaploidy. |
its side effects when used in high doses include bone marrow depression, alopecia, mucositis, sterility, hemorrhagic cystitis, and symptomatic hyponatremia due to severe water intoxication. mmol / l) is a serious electrolyte disorder with life - threatening neurological complications and is rarely induced by low dose cyclophosphamide (< 20 mg / kg). until now, there has been only one reported case of severe hyponatremia with generalized seizure from low - dose intravenous cyclophosphamide based chemotherapy in a breast cancer patient. we report a case of severe, symptomatic hyponatremia that developed in a female breast cancer patient following the first cycle of chemotherapy containing low - dose cyclophosphamide. a 56-year - old woman was scheduled to receive four cycles of adjuvant chemotherapy containing doxorubicin 60 mg / m and, cyclophosphamide 600 mg / m (ac) and thereafter four cycles of adjuvant chemotherapy containing paclitaxel 175 mg / m (t) with a three - week time interval for stage iib (pt2n1m0) invasive ductal carcinoma of the right breast. her past medical history included hypertension and cerebral hemorrhage in the left temporal lobe that developed 15 years prior, for which she was treated properly with propranolol 40 mg, nifedipine 30 mg, enalapril maleate 10 mg, and acetyl salicylic acid 100 mg once daily without experiencing any side effects. her laboratory tests and 2-d echocardiogram were normal before the first cycle of adjuvant chemotherapy. during the first cycle of adjuvant chemotherapy containing doxorubicin 90 mg and cyclophosphamide 900 mg, she went to the emergency department the following day (50 hours after adjuvant chemotherapy) due to general weakness, nausea, vomiting, and edema. just after arriving at the hospital, she developed a generalized seizure with convulsions, following a period of impaired consciousness and incoherent speech. a glasgow coma score of 3 was noted. her vital signs were blood pressure 140/80 mmhg, pulse rate 78 beats / min, and body temperature 37.1. laboratory tests showed the followings : hemoglobin 14.2 g / dl, platelets 201,000/mm, white blood cell count 7,800/mm, blood urea nitrogen 8.2 mg / dl, serum creatinine 0.65 mg / dl, serum sodium concentration 116 mmol / l, serum potassium 3.6 mmol / l, serum chloride 87 mmol / l, serum albumin 4.3 g / dl, serum osmolality 254 mosmol / kg, and urine sodium concentration 34 mmol / l. urine analysis showed specific gravity 1.039, ph 6.5, protein -, blood -, wbc / high powered field (hpf) 0 - 1, red blood cells / hpf 0 - 1. the brain computed tomography (ct) revealed no interval change as compared to the previous brain ct. to correct her severe symptomatic hyponatremia, urgent medical treatment with hypertonic saline solution and furosemide, her serum sodium concentration rose gradually from 116 to 126 mmol / l and the patient slowly recovered from her neurological symptoms. the serum sodium concentration was gradually corrected to 136 mmol / l by infusion of isotonic saline for the next two days (table 1). she was discharged asymptomatically after 10 days and was admitted to the hospital for the second adjuvant chemotherapy. she was treated with 20% dose reduction of chemotherapy and we checked her body weight, electrolytes, and input / output daily to prevent severe hyponatremia induced by low dose cyclophosphamide. although she had water retention with a 2 kg - weight gain during the chemotherapy, she was successfully treated with hypertonic saline solution and furosemide without any neurologic symptoms. we will treat her with adjuvant ac (doxorubicin + cyclophosphamide) chemotherapy as initially scheduled. symptomatic hyponatremia with a generalized seizure was observed in our patient 48 hours after treatment of the first cycle of ac chemotherapy. hyponatremia usually occurs 4 - 12 hours after the administration of cyclophosphamide, although sometimes not until 48 hours afterwards, as in our case, and returns to normal in around 24 hours. the antidiuretic effect seems to be related to the appearance of active alkylating metabolites of cyclophosphamide. we suspected intravenous low - dose cyclophosphamide - based chemotherapy as the cause of severe hyponatremia since other causes were ruled out. a cerebral hemorrhage lesion in her past medical history could have caused a generalized seizure with convulsions, but her brain ct and magnetic resonance imaging scan showed no interval changes before and after the seizure attack, and she recovered from her neurologic symptoms after the correction of her hyponatremia. the enalapril maleate that she took as an antihypertensive drug could also have caused hyponatremia. however, she had been well, without any symptoms related to hyponatremia during the treatment of hypertension with enalapril maleate. however, it is necessary to keep in mind the possibility that her past medical history, including the cerebral hemorrhage and enalapril maleate medication, may have been predisposing factors that deteriorated her severe hyponatremic symptoms. in this case, she had a 3.5 kg - weight gain after chemotherapy. although we performed overhydration on her to prevent hemorrhagic cystitis, this was not enough to explain her weight gain and severe hyponatremia. after her discharge from the hospital, she insisted on a low salt diet due to her concern about hypertension. water intoxication induced by low - dose cyclophosphamide might have been accelerated due to overhydration and her low salt diet. severe hyponatremia has been previously reported in patients treated with high - dose cyclophosphamide (30 - 40 mg / kg) and moderate - dose (20 - 30 mg / kg) intravenous cyclophosphamide [5 - 9 ]. there have been four malignant disease cases in which severe symptomatic hyponatremia was reported from low - dose intravenous cyclophosphamide therapy including, our case and other malignant disease cases. two cases, including our case, were women with breast cancer suffering from severe hyponatremia after adjuvant chemotherapy, and another was a man with multiple myeloma suffering from severe hyponatremia after a single dose of low - dose cyclophosphamide. the last one was a woman with metastatic adenocarcinoma of small salivary glands who received a cycle of ac chemotherapy and concomitant use of cisplatin. the mechanisms of hyponatremia induced by cyclophosphamide have not been clearly understood, but there are some possible mechanisms of cyclophosphamide induced hyponatremia. that hypothesis is corroborated by the postmortem examination that was performed on one patient who received high - dose cyclophosphamide, and demonstrated loss of herring 's bodies and degranulation of various hypothalamic neurosecretory organelles. the cyclophosphamide metabolite could act indirectly by causing adh release ; this has been demonstrated with ifosfamide, a close structural analogue to cyclophosphamide. speculated that the antidiuretic effect of cyclophosphamide might be related to increased renal action of vasopressin by alkylating metabolites, and water retention might involve a direct tubular effect of cyclophosphamide metabolite on the collecting duct epithelium, because it was demonstrated in a case with established diabetes insipidus that developed cyclophosphamide associated antidiuresis without vasopressin secretion. therefore, further studies will be necessary to evaluate the molecular mechanisms of hyponatremia induced by cyclophosphamide and establish dose dependant relationships of cyclophosphamide with the severity of hyponatremia. second, common symptoms like nausea, vomiting, and general weakness due to chemotherapy might be a sign of severe hyponatremia. third, clinicians must pay more attention to a patient with comorbidities such as nephritic syndrome or concurrent medications that can be associated with hyponatremia. in conclusion, clinicians must always keep in mind that life - threatening acute hyponatremia can be induced by intravenous cyclophosphamide during chemotherapy, even if the dosage is low. | cyclophosphamide is commonly used in the treatment of malignant diseases. symptomatic severe hyponatremia induced by low - dose cyclophosphamide is very uncommon worldwide. recently we experienced a case of a 56-year - old woman with breast cancer who developed severe hyponatremia with generalized seizure after the first cycle of adjuvant chemotherapy with doxorubicin and cyclophosphamide. her laboratory test showed a serum sodium of 116 mmol / l. her hyponatremia was initially treated with hypertonic saline solution and furosemide. she completely recovered without neurological deficits after slow correction of the serum sodium concentration over two days. clinicians must always keep in mind that life - threatening acute hyponatremia can be induced by intravenous cyclophosphamide during chemotherapy, even if the dosage is low. |
maintaining dna integrity is essential to facilitate proper physiological processes including dna replication, repair, and transcription. the disruption of replication by reactive oxygen species (ros) has been linked to a variety of diseases and disorders [13 ]. causative in the development of disease via this mechanism is the stalling or collapse of replication forks. when this occurs, atypical secondary structures form which must be resolved and/or repaired before replication can resume. additionally, it has been shown that elevated levels of oxidative stress during replication result in a prolonged s - phase and if left unrepaired, can lead to apoptosis. double strand - breaks (dsbs), being one of the most lethal dna damaging events resulting from ros, are known to form through oxidative damage and have recently been reported to be replication induced. replication induced dsbs are proposed to result from a single strand - break (ssb) and/or other damage lesions generated in replicating dna. under conditions of oxidative stress, ssbs can result from hydrogen atom abstraction at the 2-deoxyribose ring in oligonucleotides. when a single hydrogen atom is removed by a ros from any of the five carbons of the sugar moiety (figure 1(a)), a highly reactive sugar radical is produced (figure 1(b)). when trapping of the radical by a hydrogen atom donor does not occur, a strand - break is usually generated (figure 1(c)). it is believed that the above - mentioned creation of stalled and collapsed replication forks is related to such sugar damaging events. the resulting substrates then signal spontaneous homologous recombination and nonhomologous end - joining. our laboratory is interested in determining the role of dna structure in preserving genomic integrity through protection of the nucleic acid from oxidative damage. we have observed that the selective generation of radical intermediates in dna architectures that act as models of substrates which form during the process of replication results in elevated levels of strand - break products when compared to duplex dna. the formation of 3 and 5-overhangs (ovhgs) containing a phosphate at the ss - dsdna junction, as well as duplex substrates containing a terminal phosphate was observed. additionally, the formation of 1-(2-deoxy--d - threo - pentofuranosyl)thymidine (2-deoxyxylothymidine, 3, figure 2) was observed as a result of trapping of the c3-thymidinyl radical from the alpha face of the nucleotide by glutathione (gsh). this damage product was also formed readily in replication relevant architectures, while nearly absent in duplex dna. together, these results highlight the protection against oxidative damage offered by the duplex structure of dna when the c3-thymidinyl radical is the reactive intermediate. the effect of oxidatively generated damage lesions on the structure and stability of dna substrates has received limited attention [10, 11 ]. herein, we analyze the impact of damage lesions on the structure and stability of dna architectures, which model those generated during replication. the impact of the presence of these lesions on replication derived model architectures reveals how dna damage alters the stability of nucleotide substrates associated with replication. oligonucleotides containing 3 (z) were synthesized, using established methods, on an abi 391 automated dna synthesizer. the synthesis of sequence 1 : 5-tttttztttcaggttgcg-3 and sequence 2 : 5-gcgttggactttzttttt-3 was performed on a 0.2 m scale using polystyrene columns (glen research, sterling, va). oligonucleotides were cleaved from the resin and the nucleobase and phosphate protecting groups removed by heating at 55c overnight in aqueous ammonium hydroxide (2830%). oligonucleotide purification was accomplished using oligonucleotide purification cartridges (opc, glen research, sterling, va) and the samples were quantified (= 158,100 l / molecm) using uv absorbance at 260 nm on an agilent 8453 uv - visible spectrophotometer. sample purity was assessed by tandem ion - exchange / reverse - phase high - performance liquid chromatography and the identity confirmed using matrix - assisted laser desorption / ionization time - of - flight mass spectrometry (maldi - tof ms). all unmodified oligonucleotides were either synthesized or purchased (integrated dna technologies, coralville, ia, usa). melting experiments were conducted on a varian cary 3e uv - vis spectrophotometer equipped with a temperature controller. absorbance changes for oligonucleotides (2 m) in 25 mm chelex-100 treated phosphate buffer (ph 7.3) containing 60 mm potassium acetate and 6 mm magnesium acetate were recorded as a function of temperature from 1080c at a rate of 0.5c / min at 260 nm. the average of three scans was taken and reported errors were calculated using standard deviation. calculated tm was determined by subtracting the experimental values obtained for the 2-deoxyribose containing construct from the corresponding constructs containing 3. the circular dichroism spectra for all architectures reported were collected using an aviv 62ds cd spectrometer at 25c, using a quartz cuvette with a path length of 1 mm in a thermostatted holder. spectra were collected from 320 to 200 nm at a rate of 20 nm / min using a bandwidth of 1 nm. four scans were accumulated and averaged. oligonucleotides were measured in phosphate buffer (ph 7.3) at (5 m). raw data () were converted to molar ellipticity ([]) ([] = /(10cl)) and smoothed using a moving average of three. calorimetric excess heat capacity (cp) versus temperature (t) profiles was plotted for each dna architecture using data obtained on a vp micro - calorimeter following established methods. concentration of oligonucleotide samples was 0.2 mm in phosphate buffer (ph 7.3). all samples were stirred and degassed using a microcal thermovac for 16 minutes at 25c. samples were loaded and scanned at a rate of 1c / min from 10c to 100c. values for hdsc, s, and hh were determined utilizing the equations listed below : (1)hdsc=t0tucp(ex)dt,s=t0tucp(ex)tmdt,hh=4rtm2cp(m)hdsc, where cp(ex) is the excess heat capacity, hdsc is the enthalpy obtained directly from the raw data that has been baseline corrected and normalized, s is the entropy calculated without assuming a two - state melting transition, hh is the calculated van't hoff enthalpy, and cp(m) is the transition maximum value for cp(ex). g at 25c was obtained using the following gibbs free energy equation : (2)g25=hdscts. calculations for hdsc, s, and g25 were obtained by subtracting the values obtained for the core sequence from the corresponding products of interest. during dna replication, both the leading and lagging strand templates undergo a variety of architectural changes including the formation and unwinding of duplexes, as well as the transient formation of overhangs, flaps, and forks. our previous work as well as that of others [9, 16, 17 ] has shown that the structure of dna has a profound impact on the fate of 2-deoxyribose radicals. after determining the structures of the lesions formed through independent generation of the c3-thymidinyl radical, we investigated their impact on the structure and stability of dna architectures that form via this type of damage. the interplay between dna structure and damage outcomes is an important paradigm in our understanding of the ability of dna to protect itself from damage events and the ability to repair damage when it occurs. the substrates utilized in these studies were designed to allow for the evaluation of the effects of both 3 and the strand - break products observed in our previous work. generally, the presence of short overhangs or terminal phosphates increases the stability of dna constructs when compared to the corresponding blunt - ended duplexes [1822 ]. in previous work, the effect of overhangs, otherwise known as dangling ends, on duplex stability was determined utilizing self - complimentary dnas that produce a dangling end at both ends of the substrate (figure 3). this design requires consideration of the thermodynamic contribution of two overhangs to dna stability, which was compensated for by either halving the values of g or accounting for the changes induced by both [19, 21 ]. it is our hypothesis that the presence of dangling ends on both ends of the core dna sequence has an influence on the tm and/or thermodynamics of melting. this is supported by the results reported in benight. who used substrates containing both a 5 and 3-ovhg as well as dangling ends containing two 5-ovhgs. these substrates indicated that the thermodynamic impact of the overhang was dependent upon the dna substrates used. the substrates utilized in these studies were designed to allow for the direct evaluation of the effects introduced by a single overhang, phosphate or 3. the melting temperatures for duplex, 5 and 3-ovhgs and fork architectures were determined for unmodified architectures as well as those containing 3. incorporation of 3 into these architectures revealed that the replacement of a single 2-deoxyribose with 3 decreases the stability of the duplex region (table 1). previously, it was shown that dna duplexes containing 3 in a single location demonstrate decreased stability when compared to the unmodified duplex. this indicates that the inversion of configuration at the c3-position of 2-deoxyribose to 2-deoxyxylose at a single nucleoside significantly destabilizes the dna duplex [10, 24 ]. we made the same observation in the case of dna duplexes 1d and 2d, obtaining decreases in tm of 5.1c and 5.3c, respectively. however, when 3 is found at an overhang or fork junction, the effect is significantly decreased. melting temperatures of 5-ovhgs 1a and 1b and fork 1e & 1f show no appreciable change when 3 is placed at the junction. alternatively, the 3-ovhg 2b and fork 2f containing 3 at the same position demonstrate a decrease in tm of 1.4c and 0.7c, respectively. as indicated by the respective melting temperatures of 2b and 2f, the overall effect of 3 appears to have less of an impact on stability in less stable substrates. these results suggest that the destabilizing effect of 3 is not only dependent on dna architecture, but also on the location of the modification relative to the 5 and 3 ends of the oligonucleotide. to determine the effect of 3 on the overall conformation of these substrates, cd analysis of duplex, 5 and 3-ovhgs and fork dna architectures containing 3 previously, it was observed that 3 has a minimal effect on the secondary structure of duplex dna. all architectures, with and without 3, were observed to be predominately b - form as indicated by the presence of a positive band around 280 nm and a negative band around 245 nm. thus, the presence of 3 does not have a significant effect on the global conformation of these substrates. in comparing the architectures for sequence 1 to those of sequence 2, more pronounced differences between 2-deoxyribose versus 3 containing architectures of sequence 2 were observed as indicated by decreases in the minima at 245 nm and maxima at 280 nm. in duplex substrates 2c and 2d, the presence of 3 causes a decrease in the intensity of the minima at 245 nm and the maxima at 280 nm. in the 3-ovhg 2b, the presence of 3 significantly decreases the intensity of the minimum at 245 nm, but has minimal to no affect on the maximum at 280 nm. additionally, fork 2f shows no change at the minimum while a decrease in the maximum is observed. taken together, the presence of 3 at a single location has more of an effect on base pairing interactions in duplex dna, ovhg, and fork architectures of sequence 2, than sequence 1. in considering the architectures for sequence 1, the comparisons between those containing unmodified oligomers and those containing 3, 5-ovhg 1a and 1b and fork 1e and 1f, indicate no significant difference in overall conformation. interestingly, the region between 240 and 300 nm in the spectra was obtained for duplexes 1c and 1d ; there are also minimal differences with the exception of the shoulder at 260 nm. in the presence of 3, this shoulder is lost. this is an important observation as the presence of this shoulder is characteristic of poly at duplex regions. however, this shoulder is not lost in the analysis of the duplex containing 3 of sequence 2 (2d). this indicates that poly at base pairing in duplex dna is affected by the presence of 3 in sequence 1, but not in sequence 2, suggesting a sequence dependent effect on duplex structure by the presence of a single 3. thermal melting and cd analysis are powerful methods for the evaluation of changes in dna stability and structure. here we demonstrate differences in substrate stability and structure introduced by the presence of 3 in duplex, ovhg and fork architectures. this is the first time that 5-ovhg, 3-ovhg, and fork constructs containing 3 have been reported. it appears that 3 has a greater effect when located closer to the 3 end of the strand. in sequence 1, where 3 is located near the 5 end of the strand, the tm and cd analysis of 5-ovhgs 1a and 1b and forks 1e and 1f show no change in stability and insignificant differences in conformation. this indicates that 3 does not disrupt base pairing in the duplex region 3 of 3. in the case of 3-ovhg 2b and fork 2f, where 3 is located near the 3 end of the oligonucleotide, both decreases in stability and conformational changes are evident, indicating that 3 effects base pairing 5 of the lesion. in duplex dna, the presence of 3 causes the characteristic poly at shoulder to be lost in the cd spectra of 1d, but maintained in 2d. if 3 affects base - pairing interactions in both the 5 and 3 directions, it is expected that both duplex constructs of sequences 1 and 2 containing 3 would lose the poly at shoulder in the cd spectra. provided that there are only five base pairs 5 of 3 in 1d, and twelve base pairs 5 of 3 in 2d, the differences in the duplex cd spectra can be attributed to an effect of 3 on conformation towards the 5 end, resulting in a greater disruption in the structure of sequence 1. interestingly, despite the conformation differences indicated through cd analysis between unmodified and 3 containing sequences, both duplex constructs containing 3 are destabilized to the same extent. given that base context, the position of 3 and design of the architecture are conserved between sequence 1 and 2, and the observed changes can only be attributed to 3. strand - breaks resulting from 2-deoxyribose oxidation are often associated with phosphorylated 3 and 5 ends. the effects of such lesions on the stability of model replication forks for both sequence 1 and 2 were determined (table 2). the presence of a 5 or 3 terminal phosphate on duplexes 1h and 2h decreases the tm values by 0.4c and 0.9c, respectively. previously, it was shown that changes in tm caused by a 3 or 5 terminal phosphate on duplex dna are dependent on counter - ion concentration. at comparable counter ion concentrations, bower. observed a decrease in tm in the presence of a 5 or 3 phosphate by 0.8c and 0.3c, respectively. besides the difference in experimental design, our experiments have the terminal phosphate residing beside an at bp, while in the work by bower. it resides beside a gc bp. the small difference in destabilization observed between the 5 and 3 phosphates herein and those reported by bower. suggests that the terminal base - pair adjacent to the phosphate may contribute to the effects of the terminal phosphates. k) decreases the tm of the core duplex by 1.92.8c, while a 5-ovhg (2i & 2 k) causes a less significant decrease of 1.11.3c. it has been widely demonstrated that overhangs consisting of one nucleotide, regardless of polarity, are stabilizing. this stabilization is attributed to base stacking between the unpaired nucleoside and the neighboring base pair. our results indicate that the presence of either a 6 mer 3 or 5-ovhg decreases core duplex stability. interestingly, the range in tm for the 5-ovhgs is significantly smaller than that of the 3-ovhgs. this suggests that the base context of the single - stranded region influences the tm of the 3-ovhg more than the 5-ovhg. additional studies using 3 mer, 4 mer, and 5 mer ovhgs will be pursued to further evaluate the effect of overhang length on tm. in using the constructs with a phosphate at the ss - dsdna junction, both the effect of the overhang and phosphate were evaluated to determine how their combined presence influences core duplex stability. compared to the tm introduced by the ovhgs alone, we observed that a 3-ovhg decreases the tm by an additional 0.6c when a phosphate is present at the ss - dsdna junction (1j & 1l), while the 5-ovhg decreases duplex stability by an additional 0.3c in the presence of a phosphate (2j & 2l). as seen previously in the case of ovhgs without a phosphate, the range of destabilization introduced by the 5-ovhgs with a phosphate at the ss - dsdna junction is lower than that of the comparable 3-ovhgs. this further suggests that the decrease in stability is influenced by the base context of the 3-ovhg region, but not by the 5-ovhg region. additionally, the decrease in tm introduced by the 5 phosphate at the ss - dsdna junction (1j & 1l) is more than twice that observed for the terminal 5 phosphate (1h), while the 3 phosphate at the ss - dsdna junction (2j & 2l) has only a slightly greater effect on tm than the terminal 3 phosphate (2h). together, these results indicate that the 3-ovhg and 3 phosphate have a larger effect on the stability of the duplex region than the corresponding 5-ovhg and 5 phosphate. furthermore, decreases in duplex stability are observed when both an overhang and phosphate are present. differential scanning calorimetry of c3-thymidinyl radical derived single strand - break products of the model replication fork was performed to thermodynamically characterize the effects of ovhgs and phosphates on the core duplex dna as indicated in table 3. previously, using dangling ends, the presence of a 5 phosphate was shown to decrease the g of formation for duplex dna, while the 3 phosphate introduces minimal to no change. additionally, favorable changes in g of formation and melting have been observed for both 3 and 5 dangling ends up to two dangling bases, indicating stabilization [1922 ]. interestingly, dangling ends ranging from 3 to 10 bases have been reported to be stabilizing in the case of the 5 end and destabilizing in the case of the 3 end. the presence of a 3-ovhg destabilizes by an average of 0.93 kcal / mol, while the 5-ovhg destabilizes by 0.16 kcal / mol. the presence of a single 3 or 5 terminal phosphate also causes destabilization of the duplex. these results show no measurable difference in g25 between 3 versus 5 terminal phosphates, indicating that the presence of a terminal phosphate, increases the g25 by an average of + 0.38 kcal / mol. additionally, the destabilization introduced by a 3-ovhg in the presence of the phosphate at the ss - dsdna junction compared to the 5-ovhg in the presence of the phosphate at the same position resulted in no significant difference in g25 for constructs 1l and 2l. alternatively, in constructs 1j and 2j, the 3-ovhg with the phosphate at the ss - dsdna junction has no effect on dna stability, while the comparable 5-ovhg destabilizes by 0.80 kcal / mol. lastly, the effect introduced by the phosphate at the ss - dsdna junction of overhangs is found to be destabilizing in the case of the 3 phosphate in 2j and 2l (+ 0.82 kcal / mol), stabilizing in the case of the 5 phosphate in 1j (0.76 kcal / mol) and not significant in 1l. together, these results show that all strand - break products, consisting of an individual overhang, phosphate, or both, contain less stable duplexes for both sequence 1 and 2, as indicated by unfavorable g25 values in all cases except for 1j. as previously mentioned, all architectures investigated, except for 1j, are less stable as indicated by the tm and g25 values for uv and dsc analyses. here one can determine the effects of an individual 3 or 5 phosphate and an individual 3 or 5-ovhg. 3-ovhgs are more destabilizing and lower the tm by ~1c more than the 5-ovhgs. additionally, 3-ovhgs (1i & 1 k) demonstrate an increase in both entropy and enthalpy, while 5 ovhg 2 k demonstrates a decrease in entropy and enthalpy. in the case of the 3-ovhg, the observed destabilization is enthalpic in nature, while in the case of the 5-ovhg, destabilization is entropic in nature. thus, based on the small sampling of dna ovhg constructs investigated here, these results indicate that both a single 3- and 5-ovhg of six nucleotides are destabilizing, but the 3-ovhg is more destabilizing and enthalpy driven, while the 5-ovhg is entropy driven. with respect to the terminal phosphates, both uv melting and dsc analyses indicate that the 3 phosphate (2h) decreases the tm to a greater extent than the 5 phosphate (1h). by averaging the tm values of the uv melting and dsc experiments, it is observed that the 3 phosphate decreases the tm by 0.70c, about twice the change induced by the 5 phosphate, 0.37c. interestingly, no measurable difference in g25 is observed for an individual 3 or 5 terminal phosphate, indicating that polarity does not affect the destabilization introduced by a terminal phosphate. the destabilization observed in the presence of a single 3 or 5 terminal phosphate is enthalpy driven, thermodynamically following the trend found for the 3-ovhgs. in evaluating the constructs containing both an overhang and phosphate, the destabilization introduced by the overhang region in the presence of a phosphate at the ss - dsdna junction appears to be heavily dependent on base context and polarity. this is demonstrated by the lack of differences observed in g25 values for constructs 1l and 2l, indicating a 6 mer overhang of mixed base context to be destabilizing to the same extent, regardless of polarity. while in the case of constructs 1j and 2j, the 3-ovhg introduces no measurable change in g25, and the comparable 5-ovhg destabilizes by + 0.80 kcal / mol. intriguingly, the effect of the phosphate at the ss - dsdna junction appears to be sequence dependent as indicated by the destabilization introduced by the 3 phosphate in 2j and 2l, stabilization by the 5 phosphate in 1j, and the lack of effect on stability in the case of the 5 phosphate in 1l. given the high levels of formation of 3 in vitro, there is a strong possibility that this lesion also forms in biological systems. the effects of this lesion on dna stability and structure, as well as previously reported effects of 1-(2-deoxy--d - threo - pentofuranosyl)nucleotides on the enzymatic cleavage of the sugar - phosphate backbone, indicate that 3 will have a significant impact on genomic integrity if left unrepaired. thus, the fidelity of replication processes should be investigated to determine the physiological consequences of this lesion. currently, detailed structural studies investigating the effect of 3 on dna structure are being pursued to understand fully the structural impact of the presence of this lesion. alternatively, evaluating the implications of 3 and 5-ovhgs and phosphates on dna stability related to replication may provide insight into the thermodynamic contributions of dna to facilitate protein - dna binding and selectivity. the counter - ion condensation (cc) theory has been applied to dna and dna - protein complexes and found to be reliable in determining the driving forces for dna - protein interactions. specifically, it has been determined that the binding energy required for dna - protein interactions can be divided into electrostatic and nonelectrostatic components. the electrostatic portion is completely entropic in nature, while the nonelectrostatic portion, which is responsible for specificity, corresponds to the binding enthalpy. given the cc theory and the results reported herein for strand - break product stability, dna stability has the potential to be utilized to establish the driving force of binding for replication proteins that recognize and bind to these architectures. two dna replication relate proteins that may heavily rely on differences in duplex stability in replication relevant architectures are the single - stranded dna binding proteins (ssbs) and dna polymerases. single - stranded dna binding proteins, which are generally classified as nonspecific in binding, are essential in both replication and repair processes. the human single - stranded dna binding protein, known as replication protein a (rpa), has been reported to preferentially bind to 3-ovhgs and demonstrates a directionality of binding with respect to the 3 and 5 ends of the bound dna [3032 ]. additionally, the single - stranded dna binding protein of t4 demonstrates a preference for 5-ovhgs, while that of e. coli demonstrates a binding preference for 3-ovhgs. given that the destabilization of the 3-ovhg is found to be enthalpy driven, this may suggest that the hrpa and e. coli single - stranded dna binding proteins preferential bind 3-ovhgs to form more favorable nonelectrostatic interactions. if this is the case, then the energy barrier to forming these non - electrostatic dna - protein interactions may be lower in the case of 3-ovhg, than with 5-ovhg, as the non - electrostatic component is the driving force of 3ovhg destabilization. this hypothesis is in good agreement with the literature, of which calorimetric studies of the e. coli single - stranded dna binding protein binding to dna have been reported to be enthalpically driven. dna - protein binding is expected to be favorable with respect to both dna and protein, while the inherent decrease in enthalpy introduced by the 3-ovhg may increase binding for the e. coli single - stranded dna binding protein by suppressing the energy barrier of binding. recently, it was reported that pol i in e. coli (klenow) preferentially binds to dna replication architectures as compared to those generated from strand - breaks, suggesting that the klenow polymerase can selectively associate with dna replication substrates. specifically, the presence of a 3 phosphate at the ss - dsdna junction was observed to decrease the binding affinity by 0.91.5 kcal / mol, depending on the presence of magnesium. our results indicate that the presence of a 3 phosphate at the ss - dsdna junction destabilizes to the extent of 0.82 kcal / mol, suggesting that the presence of the 3 phosphate and its impact on dna stability accounts for a significant amount of destabilization in the dna - protein binding complex. furthermore, the destabilization introduced by this 3 phosphate is enthalpy driven, suggesting that the binding of klenow is likely enthalpy dependent. previous results reported the binding of klenow at physiological temperatures to be enthalpy driven, being in good agreement with our hypothesis. this further supports the significance of dna damage lesions and their impact on dna stability in understanding the formation and stability of dna - protein interactions. the impact of strand - break products on dna stability in model dna architectures mimicking those generated through 2-deoxyribose oxidation at the c3-position during replication has been analyzed. the results obtained demonstrate that both an individual 3 or 5-ovhg of six nucleotides is destabilizing, with the 3-ovhg destabilizing to a greater extent than the 5-ovhg. also, the presence of an individual 3 or 5 terminal phosphate was observed to be destabilizing, but intriguingly, enthalpy is the driving force of destabilization for the 3-ovhg and both 3 and 5 terminal phosphates, while the 5-ovhg is entropy driven. alternatively, the effects on substrate stability of ovhgs containing a phosphate at the ss - dsdna junction are highly dependent on base context and polarity. in addition to these strand - break substrates, we determined the effects of 3 on the structure and stability of dsdna, fork, 3 and 5-ovhg. the presence of 3 was observed to have a greater impact on both stability and structure when located closer to the 3 end of the oligonucleotide strand. taken together, evaluating the impact of lesions previously observed as a result of c3-radical formation in replication relevant architectures provides insight into how these dna damage lesions alter the stability and structure of replication associated nucleotide substrates, directly expanding the current scope of how oxidatively generated sugar damage impacts dna integrity. with these results reported herein and our previous results in determining the impact of dna structure on the fate of the c3-thymidinyl radical, the role of proteins can now be evaluated to determine the interplay between oxidative sugar damage and protein binding. | damaged dna, generated by the abstraction of one of five hydrogen atoms from the 2-deoxyribose ring of the nucleic acid, can contain a variety of lesions, some of which compromise physiological processes. recently, dna damage, resulting from the formation of a c3-thymidinyl radical in dna oligomers, was found to be dependent on nucleic acid structure. architectures relevant to dna replication were observed to generate larger amounts of strand - break and 1-(2-deoxy--d - threo - pentofuranosyl)thymidine formation than that observed for duplex dna. to understand how this damage can affect the integrity of dna, the impact of c3-thymidinyl radical derived lesions on dna stability and structure was characterized using biophysical methods. dna architectures evaluated include duplex dna (dsdna), single 3 or 5-overhangs (ovhgs), and forks. thermal melting analysis and differential scanning calorimetry measurements indicate that an individual 3-ovhg is more destabilizing than a 5-ovhg. the presence of a terminal 3 or 5 phosphate decreases the g25 to the same extent, while the effect of the phosphate at the ss - dsdna junction of ovhgs is dependent on sequence. additionally, the effect of 1-(2-deoxy--d - threo - pentofuranosyl)thymidine is found to depend on dna architecture and proximity to the 3 end of the damaged strand. |
it is well established on the fact that regular exercise can help in treating various brain disorders such as depression, insomnia, parkinson disease, and alzheimer s disease. however in case of the patients with intellectual disabilities, they lack determination to participate in any physical exercise mainly due to decreased motor nerves activity, behavioral disorder, lack of concentration and poor communication skills. additionally, since establishing voluntarily participations and self - motivations are difficult for the intellectual disabled patients, the effectiveness of the rehabilitation treatment is also very limited. therefore there is a need for appropriate measure to be taken for the purpose of providing interest and motivation to the intellectually disabled patients. considering these aspects, through unique and interesting characteristics of water, aquatic exercise could maximize the effectiveness of exercise. since embarrassment of physical disabilities can be overcome in water, patients with intellectual disabilities can actively participate in exercising. recently, as part of effective methods of improving the cognitive functions caused by the deficiency of neurotransmitters in depression, alzheimer s disease, stroke, and parkinson s disease, the ces (cranial electrotherapy stimulation) equipments are given attentions to. the ces activates on the particular neurons of the electrical current in the brain stem, increasing the production of the neurotransmitters thereby increasing the electric and chemical activations. the ces can be used as non - pharmaceutical intervention method for the purpose of chronic pain syndromes such as anxiety, depression, insomnia, stress relief, headache, backache, toothache, muscle pain that are reported to be largely effective in improving anxiety and pain prior to surgery. importantly, the effect of ces is related to enhanced motion performance capability in stroke patients that can be used as a tool to enhance the effectiveness of exercise during the process of rehabilitation [4 - 6 ]. therefore it is expected that the effect of the ces measure may enhances the cognitive function of the intellectually disabled. on the other hand, the bdnf (brain - derived neuropathic factor), the igf-1 (insulin - like growth factor), and the vegf (vascular endothelial growth factor) that came into the recent spotlight, may increase the resistance on the death of the neurons cells and facilitates the production of cerebrovascular and nerve formations [7 - 9 ]. it is being reported that the signal control of the nerve formation in the hippocampus affecting bdnf, igf-1 and vegf, strengthens the neural plasticity, learning and memory and enhances the cognitive function. in light of these facts, exercise of the brain with nerve disability, the ces interventions and the analysis of the bdnf, igf-1 and vegf could verify the rehabilitation methods and their effectiveness. hence, in this experiment, the aquatic exercise was conducted to the mentally ill patient for the purpose of inducing interest in exercising, and the ces measures that have been known to be effective in improving cognitive function, concentration, and anxiety symptoms, were taken. therefore the objective of this experiment is to prove the rehabilitation effect of the aquatic exercise and ces through 12 weeks of conducting aquatic exercises and by analyzing the ces measures such as cognitive function, bdnf, igf-1, and vegf. the participants of this experiment are 15 intellectually disabled patients, aged between 13~17 with second to third degree of mental disability ratings which included autistic patients. they were from the disabled community c, students of the middle and high school swimming lessons doing as part of their special physical education program. 5 patients were allocated in each group of the control group, exercise group and exercise + ces group respectively. the aquatic exercise program was produced through expert meeting between the special physical education instructors and swimming instructors. the aquatic exercise composed of 10 minutes of preparation exercise, 30 minutes of main exercise and 10 minutes of clean - up exercise which involved total of 50 minutes, running every three times a week. putting focus on the actual swimming style, the aquatic program composed of leg posture, hand posture, respiration, freestyle, and backstroke. having regards on the intensity of exercise, individual differences on the physical functions of the disabled patients were considered thereby the duration and the levels of difficulty were appropriately chosen by the instructor. the ces used in the experiment was alpha - stim 100 (electromedical products international, usa), where the electrical current being 100~600 a, with the frequency value of 0.5, 1.5, 100 hz (pulse / sec). the ces measures were divided into three stages of introduction, development and ending stages that composed of approximately 25~35 minutes. in the ces manual, it is recommended to use within 600 a range in accordance to the individual response. however considering the fact that the participants in the experiments were all intellectually disabled patients, from week 1~4, low current of 100a was initiated, increasing to 200 a in week 5~8, to the maximum current of 300 a in week 9~12. the cognitive function test used in the experiment was the k - wab (korean western aphasia battery), the standardized version of wab (western aphasia battery). the cognitive function assessment provisions were the oral language test, written language test and the movement test. oral language test comprised total of 420 points which consisted of speaking, comprehension, naming and speech repeating provisions. the written language test comprised total of 200 points which consisted reading and writing provisions. the movement test comprised total point of 180, which included provisions such as action organization, space, calculation and drawing. the method of measurement was carried out by professional assessor asking questions to the participants, and then asked to follow in accordance to the instruction given which was then assessed in points through observation and recording of the answers and conducts given by the participants. for blood analysis, 10 ml of blood samples were taken from brachial vein at before and after training. igf-1 was measured by the diasorin using a liaison igf-1 kit and analyzed by clia method. using the spss 19.0 statistical software, mean and deviance were calculated, and mean difference test was conducted through the method of two - way anova with repeated measures. in case that correlation effects appear, one - way anova and paired t - test were conducted. the participants of this experiment are 15 intellectually disabled patients, aged between 13~17 with second to third degree of mental disability ratings which included autistic patients. they were from the disabled community c, students of the middle and high school swimming lessons doing as part of their special physical education program. 5 patients were allocated in each group of the control group, exercise group and exercise + ces group respectively. the aquatic exercise program was produced through expert meeting between the special physical education instructors and swimming instructors. the aquatic exercise composed of 10 minutes of preparation exercise, 30 minutes of main exercise and 10 minutes of clean - up exercise which involved total of 50 minutes, running every three times a week. putting focus on the actual swimming style, the aquatic program composed of leg posture, hand posture, respiration, freestyle, and backstroke. having regards on the intensity of exercise, individual differences on the physical functions of the disabled patients were considered thereby the duration and the levels of difficulty were appropriately chosen by the instructor. the ces used in the experiment was alpha - stim 100 (electromedical products international, usa), where the electrical current being 100~600 a, with the frequency value of 0.5, 1.5, 100 hz (pulse / sec). the ces measures were divided into three stages of introduction, development and ending stages that composed of approximately 25~35 minutes. in the ces manual, it is recommended to use within 600 a range in accordance to the individual response. however considering the fact that the participants in the experiments were all intellectually disabled patients, from week 1~4, low current of 100a was initiated, increasing to 200 a in week 5~8, to the maximum current of 300 a in week 9~12. the cognitive function test used in the experiment was the k - wab (korean western aphasia battery), the standardized version of wab (western aphasia battery). the cognitive function assessment provisions were the oral language test, written language test and the movement test. oral language test comprised total of 420 points which consisted of speaking, comprehension, naming and speech repeating provisions. the written language test comprised total of 200 points which consisted reading and writing provisions. the movement test comprised total point of 180, which included provisions such as action organization, space, calculation and drawing. the method of measurement was carried out by professional assessor asking questions to the participants, and then asked to follow in accordance to the instruction given which was then assessed in points through observation and recording of the answers and conducts given by the participants. 10 ml of blood samples were taken from brachial vein at before and after training. igf-1 was measured by the diasorin using a liaison igf-1 kit and analyzed by clia method. using the spss 19.0 statistical software, mean and deviance were calculated, and mean difference test was conducted through the method of two - way anova with repeated measures. in case that correlation effects appear, one - way anova and paired t - test were conducted. the changes in the cognitive function assessment data showed that there were significant differences in all groups, point in time, and cause - effect relationships (p 0.05). the changes in the vegf assessment data showed that there were significant differences in all groups, point in time, and cause - effect relationships (p 0.05). the changes in the vegf assessment data showed that there were significant differences in all groups, point in time, and cause - effect relationships (p < 0.05, p < 0.001). in another word, there were significant differences in before and after treatments between the exercise and exercise + ces groups (p < 0.05). even the comparison data between each group, despite the fact that the exercise and exercise + ces intervention groups showed significant increase than the controlled group, there was no significant difference observed when compared between the exercise and exercise + ces groups. in this experiment, the effect of aquatic exercise and ces measures on the changes of cognitive functions, bdnf, igf-1, vegf, and serotonin values were analyzed and discussed accordingly. according to the wilson., in relation to exercise and cognitive function, it has been reported that exercise stimulates the biochemical changes of the nerves in the brain which induce the activation of the neurotransmitters and formation of the genetics thereby affecting the proliferation of the neurons and their survival resulting in the enhancement of learning, memory and cognitive function skills. however through which mechanism that exercising affects the brain and its cognitive function remains unknown. in this experiment, the cognitive functions of the exercise group and exercise + ces group increased after the treatment group than before treatment. according to the wilson., the reduction in the cognitive function was highly correlated to the reduction of the physical functions. salmons & sahakian showed that low concentration and attention deficiency characteristics that are common in patients with brain disabilities improved through regular exercise. especially in the foster. it has been shown that the cognitive function was greatly increased in the exercise + ces group than the exercise group alone hence additional ces intervention was identified to be helpful in enhancing the cognitive function of the patients with intellectual disabilities. it is therefore estimated that the ces interventions stimulates the tiny current in the brain neurons which boost the electric and chemical activations thereby enhancing the cognitive function of the intellectually disabled. the changes in the bdnf in the experiment showed significant increase by 52.6% in the exercise group, and 52.3% in the exercise + ces group. however the ces measures were found to be ineffective as there was no significant difference identified between the exercise group and exercise + ces group. according to the seifert., it has been suggested that the bdnf concentration was increased in the brain after 3 month of exercising, and the ferris. and hillman. studies have reported that the brain function was increased including cognitive function resulted by the bdnf increase through exercising. analyzing the correlation between the cognitive function and the bdnf from this experiment, static correlation (r = 0.45, p < 0.05) was identified where it is thereby suggested that regular exercise increase the level of the bdnf, which enhances the cognitive function of the brain. additionally, in the experiment, the changes in the igf-1 level in exercise group and exercise + ces group increased after treatment in comparison with the before treatment, yet the difference was insignificant. eliakin have suggested that there was a sudden increase in the igf-1 level immediately after exercise, and berg & bang study have reported that the igf-1 concentration started to increase at 5 minutes of exercising where the peak concentration was reached at approximately 20 minutes. considering these aspects, it is suggested that the changes in the igf-1 level in one - off exercise reacts more vigorously in accordance with the intensity of exercise, than the level that has been stabilized before and after the treatment. on the other hand, the experiment showed significant increase in the vegf by 63.4% in the exercise group, and 71.4% in the exercise + ces group. however, additional effect of ces measures could not be confirmed as there was no significant difference between the exercise and exercise + ces group. according to the franzoni., regular exercise was found to be effective in increasing the function of the endotheliocytes by increasing the productivity of the vegf. studies have identified that the increased level of vefg enhances the blood flow rate of the internal aorta and arteriole which would helps the blood supply and vascularization through peripheral reduction in the blood vessel resistance which is associated with the brain cognitive function. from the experiment, the aquatic exercise increased the vegf level in the brain that positively affected the brain vascular cells and blood flow rate, which could explain why there had been an increased cognitive function. as follows, the aquatic exercise has been shown to be effective in improving cognitive function of the intellectually disabled patients and additional ces interventions was shown to improve even in greater effect in the cognitive function skills. additionally, regular exercise increased the concentration of bdnf and vegf where as bdnf and vegf level increased, the cognitive function skill too increased. the purpose of this study was to investigate the effects of aquatic exercise and ces treatment on the cognitive function by using k - wab and bdnf, igf-1, and vegf of persons with intellectual disabilities. cognitive function level were significantly increased in exercise + ces group than exercise group and control group. the changes of blood bdnf and vegf concentration were significantly increased in exercise group and exercise + ces group than control group. as a result, it can be explain that exercise helps cognitive function of persons with intellectual disabilities and micro - current stimulation with ces treatment further improves cognitive function by activating nerve cell. in addition, it can be suggested that the increment of bdnf by exercise stimulates the production of brain cells and the increase of vegf by exercise accelerates the production of endothelial cells. in conclusion, it can be concluded that ces treatment with exercise can amend cognitive function of persons with intellectual disabilities more effectively and increase of bdnf and vegf by exercise can explain the cognitive function improvement of persons with intellectual disabilities. | [purpose]the purpose of this study was to investigate the effects of aquatic exercise and ces treatment on the cognitive function by using k - wab and bdnf, igf-1, and vegf of persons with intellectual disabilities.[methods]all subjects were 15 male with intellectual disabilities who were participating in the aquatic training program and ces treatment during 12 weeks at rehabilitation center. the subjects were divided into control group, exercise group, and exercise+ces group. blood samples for bdnf, igf-1, and vegf were taken from brachial vein at rest between before and after treatment.[results]the results are summarized as follows : cognitive function level increased significantly in the exercise+ces group compared to those in the exercise and control group. the changes of blood igf-1 concentration were no significant difference among groups. the changes of blood bdnf and vegf concentration were significantly increased in exercise group and exercise+ces group than control group. however, blood bdnf and vegf concentration were significantly difference between exercise group and exercise+ces group.[conclusion]in conclusion, it can be concluded that ces treatment with exercise can amend cognitive function of persons with intellectual disabilities more effectively and increase of bdnf and vegf by exercise can explain the cognitive function improvement of persons with intellectual disabilities. |
systemic lupus erythematosus is a multifactorial autoimmune disease of complex etiology, and may be associated with cognitive dysfunction, seizures and headaches. headaches in sle patients have been attributed to vasculitis, which may be a part of sle manifestation, and may present like migrainous headaches, tension headaches, psychological upsets or depression. throbbing / thunder clap headaches, headaches in patients with sle are evaluated thoroughly for exclusion of cortical venous thrombosis and subarachnoid hemorrhage (sah). presence of antiphospholipid antibodies and antiribosomal p antibodies are highly specific for neuropsychiatric manifestations of sle. negativity of these antibodies does not exclude vascular events in a prolonged course of sle. the most common manifestation of diffuse cns lupus is cognitive dysfunction including difficulties with memory and reasoning. when excruciating, they often indicate sle flare, and when milder, they are difficult to distinguish from migraine or tension headaches. small mycotic, berry aneurysms are known to occur in sle, and may present with sudden rupture - sah. although the incidence of sah ranges from 15.3% to 30% in autopsied sle patients, true incidence of cerebral aneurysm associated with sle is unknown. aneurysm formation in sle is thought to be a sequel of inflammation and necrosis of tunica media. subarachnoid hemorrhage in sle secondary to rupture of these aneurysms is suspected, and proved by meticulous clinical examination, good imaging techniques and specific autoantibodies. aneurysms in the brain can undergo rupture and subsequent leaks of blood into the subarachnoid space ; the so called sentinel bleed. herein the a case of lupus nephritis, in remission, presenting with headache is described. a 22-year - old girl presented to the outpatient department (opd) of a tertiary care hospital with complaints of headache and nausea for one week. she was a known case of sle for the preceding three and a half years and was on a regular follow up. she had been treated earlier on two different occasions in the same institution for the relapse of nephrotic syndrome, and had achieved complete remission with 2 mg / kg mycophenolate mofetil (mmf) and 30 mg / kg prednisolone. her renal biopsy done earlier was suggestive of focal segmental glomerulonephritis. on examination her blood pressure (bp) was 150/90 mmhg and pulse rate (pr) was 96 beats per minute (bpm). clinical examination did not reveal signs of raised intracranial tension or neurological deficits, and her fundoscopic examination was normal. plain ct scan brain, lumbar puncture, echocardiography, and abdominal ultrasound with renal doppler were normal. the patient was treated with intravenous pulse methylprednisolone (1000 mg) therapy with and cyclophosphamide (2 mg / kg / day) for five days. the values of renal parameters helped us to make our thought clear of the possibility of any relapse of lupus nephritis. on the third day of her admission, she had severe headache. a high degree of suspicion of vascular aneurysm was kept in mind, and she underwent a four vessel angiography (figure 1), which revealed two culprit saccular aneurysms of 7.2 mm and 3.9 mm at the bifurcation of left middle cerebral artery (mca). she was immediately referred to the neurosurgery department, where craniotomy and aneurysmal clipping were performed. the surgeons felt that the aneurysms were at the verge of rupture, and none of them could be resected for histopathological examination. postoperative follow up was uneventful, and she was discharged after two weeks of hospital stay. she has been on regular follow up with oral prednisolone (30 mg per day) and mycophenolate moefatil (2 g per day). a high index of suspicion towards a rare cause clinched the diagnosis as the patient had developed left mca territory aneurysms, diagnosed on four vessel digital substraction angiography. although the pathogenesis of aneurysms in sle is still obscure, pathologic manifestations of sle include various changes in medium - sized and small blood vessels, which contain many lesions at different stages of development. autopsy findings support the theory that pathogenesis of cerebral aneurysms is acquired rather than congenital. headaches in sle patients should be distinguished clinically and evaluated with intricacy, keeping the possibilities of other causes of sle headaches. vasculitis of the aneurysmal wall is interesting from the standpoint of the pathogenesis of cerebral aneurysm through vasculitic changes in blood vessel, which was noted in a very few cases of sle. this rare presentation of an unusual occurrence of unruptured mca territory aneurysm as a co - morbid condition in a patient with sle presenting with headache opens the corridors of thoughts towards the rare and more fatal conditions that can be associated in patients with sle. a high grade suspicion made us to evaluate and treat this patient in a different perspective, and helped in preventing the ensuing devastating neurological catastrophe. it has to be kept in mind that sah is a rare complication of sle. subarachnoid hemorrhage in asian patients (reportedly more in japanese) is more frequent as compared to that in patients from western countries, and can occur regardless of sle disease activity. the signs, symptoms and history of the present case indicate that clinicians must pay attention to the possibilities of rare presentations of aneurysms in patients with sle. | a 22-year - old female patient presented to the emergency department of a tertiary care hospital with symptoms of headache and nausea. she has been on a regular follow - up for the preceding three and a half years after being diagnosed as systemic lupus erythematosus (sle). she had been treated earlier for sle nephritis in the same institution, and had two relapses of nephrotic syndrome in the last three and a half years for which she had been treated and had achieved complete remission. all possibilities of headaches in background of sle were considered. cns examination was inconclusive. there was no nuchal rigidity or no cranial nerve deficits. fundoscopy and plain ct scan of brain were normal. the possibility of cns - lupus was considered considering the high values of antiphospholipid antibodies (apla). treatment was initiated accordingly ; however, there was no improvement in her symptoms. although being rare in a patient with sle, the possibility of an aneurysm was considered. four vessel digital substraction angiography revealed two unruptured aneurysms of 7.2 mm and 3.9 mm in the left middle cerebral artery (mca) territory. craniotomy and aneurysmal clipping was done successfully, and the patient was relieved of her symptoms. a high degree of suspicion towards a rarer cause clinched the diagnosis of a left mca territory stem artery aneurysm. this rationale of strong suspicion and discussion of differential diagnosis brought a change in the management of the patient. |
although this generation of mechanical thrombectomy (mt) techniques, including stent retriever and direct thrombus aspiration, has resulted in higher recanalization rates compared to previous generations6811161821), acute internal carotid artery (ica) occlusion with extensive clot - burden still can result in poor outcomes, perhaps as a result of difficult recanalization, higher complication rate, or non - involved - territory embolization41019). there have been a few attempts to introduce a method for reducing clot - burden by manual clot aspiration, either through a balloon - tipped guide catheter (bgc) or a non - bgc31222). we routinely practiced proximal aspiration thrombectomy (pat) for clot - burden reduction in the cases of intracranial ica occlusion since the bgc was introduced in korea. our method pat involved manual clot aspiration using a 50 cc syringe at the cervical segment ica through a 6 fr coaxial guide catheter, while the balloon of the outer 9 fr bgc was inflated. after a few attempts of pat, our standard mt involving forced arterial suction thrombectomy (fast) with the penumbra reperfusion catheter (penumbra inc., alameda, ca, usa) and/or solitaire stent (covidien, irvine, ca, usa) the primary purpose of this study was to evaluate the efficacy of the aforementioned pat for clot - burden reduction in cases of acute intracranial ica occlusion by comparing procedure time and angiographic (thrombolysis in cerebral infarction, tici)5) and functional (modified rankin scale, mrs) outcome between two treatment periods (period 1 : standard mt without pat ; period 2 : pat first, then standard mt for the remaining occlusion). we reviewed 112 consecutive patients from a five - year period who received mt for acute intracranial ica occlusion. the inclusion criteria for mt were as follows : 1) acute ischemic stroke corresponding to intracranial ica occlusion on ct angiography or mr angiography ; 2) infarction volume on dwi or ct less than half of the corresponding vascular territory. we excluded 26 patients with ica occlusion thought to be caused by preexisting severe stenosis at the carotid bulb where urgent carotid angioplasty and/or stenting for recanalization were required. after inspection of treatable ica occlusion by diagnostic angiography, mt was performed by 2 experienced neurointerventionists under local or general anesthesia. in period 1 (from may 2009 to june 2011), our standard mt with fast using the penumbra reperfusion catheter and/or the solitaire stent was directly performed at the occlusion level of intracranial ica. techniques for fast and solitaire thrombectomy are the same as previously described81418). in period 2 (from july 2011 to june 2014), the mt procedure was initiated by pat, which was comprised of manual clot aspiration using a 50 cc syringe at the cervical segment ica through a 100-cm long 6 fr coaxial guide catheter (envoy ; cordis, miami lakes, fl, usa) while the balloon of an outer 85-cm long 9 fr bgc (optimo ; tokai medical, aichi, japan) was inflated (fig. 1). we defined ' responder ' as a case where some amount of clot was retrieved and the following angiography showed partial or full reperfusion after pat (fig. if the following angiography still demonstrated ica occlusion after pat, the case was regarded as ' non - responder ' (fig. 2, lower two rows). after a few attempts of pat, subsequent mt was undertaken to recanalize the remaining occlusion using fast and/or stent retriever. once the solitaire stent became available in october 2010, solitaire stent thrombectomy followed fast in refractory cases9). neurological deficit was assessed with the national institute of health stroke scale (nihss) at baseline, 1 day, and 7 days. a brain ct scan was performed 24 hours after endovascular treatment and in case of neurological deterioration. reperfusion was measured using the tici scale and was counted as successful if tici 2b-3 was achieved in the final angiography. symptomatic intracranial hemorrhage (ich) was defined as any hemorrhage with an increase in nihss score of 4 or more within 24 hours18). the mrs was used to evaluate functional outcome at 3 months after index stroke, and mrs 02 was defined as a favorable functional outcome. the statistical analysis was performed using the spss statistical package (spss for windows, version 20.0, chicago, il, usa). the, fisher exact, independent t, and mann - whitney u tests were used for comparison as appropriate. we reviewed 112 consecutive patients from a five - year period who received mt for acute intracranial ica occlusion. the inclusion criteria for mt were as follows : 1) acute ischemic stroke corresponding to intracranial ica occlusion on ct angiography or mr angiography ; 2) infarction volume on dwi or ct less than half of the corresponding vascular territory. we excluded 26 patients with ica occlusion thought to be caused by preexisting severe stenosis at the carotid bulb where urgent carotid angioplasty and/or stenting for recanalization were required. after inspection of treatable ica occlusion by diagnostic angiography, mt was performed by 2 experienced neurointerventionists under local or general anesthesia. in period 1 (from may 2009 to june 2011), our standard mt with fast using the penumbra reperfusion catheter and/or the solitaire stent was directly performed at the occlusion level of intracranial ica. techniques for fast and solitaire thrombectomy are the same as previously described81418). in period 2 (from july 2011 to june 2014), the mt procedure was initiated by pat, which was comprised of manual clot aspiration using a 50 cc syringe at the cervical segment ica through a 100-cm long 6 fr coaxial guide catheter (envoy ; cordis, miami lakes, fl, usa) while the balloon of an outer 85-cm long 9 fr bgc (optimo ; tokai medical, aichi, japan) was inflated (fig. 1). we defined ' responder ' as a case where some amount of clot was retrieved and the following angiography showed partial or full reperfusion after pat (fig. if the following angiography still demonstrated ica occlusion after pat, the case was regarded as ' non - responder ' (fig. 2, lower two rows). after a few attempts of pat, subsequent mt was undertaken to recanalize the remaining occlusion using fast and/or stent retriever. once the solitaire stent became available in october 2010, solitaire stent thrombectomy followed fast in refractory cases9). neurological deficit was assessed with the national institute of health stroke scale (nihss) at baseline, 1 day, and 7 days. a brain ct scan was performed 24 hours after endovascular treatment and in case of neurological deterioration. reperfusion was measured using the tici scale and was counted as successful if tici 2b-3 was achieved in the final angiography. symptomatic intracranial hemorrhage (ich) was defined as any hemorrhage with an increase in nihss score of 4 or more within 24 hours18). the mrs was used to evaluate functional outcome at 3 months after index stroke, and mrs 02 was defined as a favorable functional outcome. the statistical analysis was performed using the spss statistical package (spss for windows, version 20.0, chicago, il, usa). the, fisher exact, independent t, and mann - whitney u tests were used for comparison as appropriate. eighty - six patients with acute intracranial ica occlusion were treated with mt and were included in this analysis. pat was effective in 28.3% (15/53) of patients in period 2, resulting in complete recanalization for 5 and incomplete recanalization for the other 10 (fig. 2). no clinically relevant differences were found in the baseline characteristics between the 2 groups, with the exception of door - to - puncture time (table 1). the median puncture - to - reperfusion time was 94.5 minutes in period 1 and 56.0 minutes in period 2, a difference that was statistically significant (p=0.002). tici of 2b-3 reperfusion was achieved in 15 of 33 patients in period 1 and 39 of 53 patients in period 2, with significantly better reperfusion in period 2 (45.5% vs. 73.6% ; p=0.009). and also, distal embolization was non - significantly less in the period 2 (33.3% vs. 22.6% ; p=0.276). there was only a trend for better 3-month favorable outcome in period 2 (36.4% vs. 54.7% ; p=0.097). there were no significant differences between the 2 groups regarding the incidence of procedure - related complications and symptomatic ich (p=0.556 and p=1.000, respectively). in the subgroup analysis between ' responder ' (n=15) and ' non - responder ' (n=38) in period 2 (table 2), there was a significantly higher incidence of atrial fibrillation in the responder subgroup (86.7% vs. 57.9% ; p=0.046). the median puncture - to - reperfusion time was significantly shorter in the responder subgroup (31 minutes vs. 71 minutes ; p=0.001), and the rate of tici 2b-3 reperfusion also showed a better tendency in the responder subgroup (93.3% vs. 65.8% ; p=0.080). however, there was no significant difference in 3-month favorable outcome (66.7% vs. 50.0% ; p=0.272). regarding the subsequent mt method for the remaining occlusion after pat, only 6.7% (1/15) of responders were treated with fast - to - solitaire switching, compared to 52.6% (20/38) of the non - responders. it is widely known that an occlusion at ica location itself can be regarded as an important indicator of poor prognosis19). the presence of a larger clot - burden in the ica occlusion compared to other locations could be one major cause of such a poor clinical course1). a larger thrombus volume results in a smaller surface area - to - thrombus ratio at the occlusion site, which presumably can decrease the efficacy of intravenous thrombolysis with tissue - type plasminogen activator and mt21320). in addition, the potential for non - target embolization of uninvolved territories can be another practical concern during mt in such cases10). to date, timely recanalization is the only procedure that has been shown to improve outcome717). in that regard, there have been several attempts to reduce clot - burden during mts for acute ica occlusions to achieve better angiographic and functional outcome31222). in our practice, standard mt using fast and/or solitaire stent was directly undertaken at the occlusion level of the intracranial ica in period 1. however in period 2, we routinely began with pat for clot - burden reduction in such cases, which featured manual clot aspiration at the cervical segment ica with a 6 fr coaxial guide catheter through a 9 fr bgc ; then we followed with the standard mt as in period 1 for the cases of remaining occlusions. this study highlights the role of pat with bgc by comparing variables between the 2 periods with different mt protocols for intracranial ica occlusions. the main findings of this study were the following : 1) there was a significantly shorter puncture - to - recanalization time (p=0.003), a significantly higher rate of tici 2b-3 recanalization (p=0.009), but only a trend for better 3-month favorable outcome (p=0.097) in period 2 compared to period 1 ; 2) pat was effective in 28.3% (15/53) of the patients in period 2, where complete recanalization occurred in 5 and incomplete recanalization in the other 10 (fig. 2) ; 3) in the subgroup analysis between ' responder ' and ' non - responder ' in period 2, there was a higher incidence of atrial fibrillation (p=0.046) and a significantly shorter puncture - to - recanalization time (p=0.008) in responder subgroup ; on the other hand, there was only a trend for higher tici 2b-3 recanalization (p=0.080) and no significant differences in 3-month favorable outcome (p=0.272). regarding the mt techniques used for any remaining occlusion, there was a significantly higher number of fast - to - solitaire switching in non - responder subgroup (1/15, 6.7% in responder vs. 20/38, 52.6% in non - responder, p=0.002). this can be explained by noting that most of the subsequent mt in the responder subgroup was simply finished without additional solitaire thrombectomy ; but in the non - responder subgroup, the following mt was not always easy, and 52.6% required fast - to - solitaire switching. as previously published9), fast - to - solitaire switching can play some role in achieving better angiographic and functional outcome in difficult cases. thus, we hypothesized that more case numbers of switching in the non - responder subgroup could be one possible explanation of the non - significant differences in tici 2b-3 recanalization and 3-month favorable outcome in the subgroup analysis between ' responder ' and ' non - responder '. this just requires the advancement of a 6 fr guide catheter through a 9 fr bgc, followed by manual aspiration. two or three attempts of this procedure take only a few minutes ; and if the case is refractory, an institutional mt protocol can easily follow. this required no advancement of additional devices to the intracranial artery ; thus, the chance of complications may be minimal. third, this can be more effective than the historically - performed clot aspiration technique under manual compression of the common carotid artery1522) because a bgc can make a definite proximal flow arrest. finally, we can apply an intermediate guide catheter ; for example, distal access catheter (concentric medical, mountain view, ca, usa) or navien catheter (covidien, mansfield, ma, usa), as a substitute for the 6 fr guide catheter during pat, which may be more effective because such catheters can be advanced more distally. the application of bgc played an important role for the pat and subsequent standard mt. first, in the general aspiration thrombectomy, aspiration using pump or syringe was performed after contact between thrombus and reperfusion catheter. however, pat was performed distant proximal area without facing between thrombus and reperfusion catheter. therefore, proximal flow arrest by bgc could establish temporary closed space, which was theoretically better circumstance for pat. second, during subsequent standard mt, the rate of distal embolization was non - significantly less in the period 2 (33.3% vs. 22.6, p=0.276). although similar mt strategy was applied between periods, time from groin puncture to recanalization was shorter in the period 2. and also, in the comparison between period 1 and non - responder of period 2, time from groin puncture to recanalization revealed shorter tendency in the non - responder of period 2 (94.5 min vs. 71.0 min, p=0.052) and successful recanalization rate demonstrated higher tendency (45.5% vs. 65.85%, p=0.085). therefore, the treatment groups were not randomized and concurrent. and, as we previously discussed, the difference in number of switching cases between both periods could be a bias in the interpretation of the present data. in addition, there was a baseline imbalance for door - to - puncture time between the two periods. the door - to - puncture time was significantly reduced in period 2, which might have resulted from increased experience at the system level. the present study compared two different strategies for intracranial ica occlusion with similar baseline characteristics. based upon the data, pat effective in 28.3% of the cases, which resulted in shorter puncture - to - recanalization times and significantly higher tici 2b-3 recanalization rates without increasing the incidence of procedure - related complications or ich. however, these results should be interpreted cautiously because of the aforementioned limitations, and confirmation by prospective multi - center trials seems necessary. | objectivemechanical thrombectomy (mt) for acute intracranial internal carotid artery (ica) occlusion is often complicated by difficult revascularization and non - involved territory embolization possibly related with larger clot - burden. this study aims to evaluate the efficacy of proximal aspiration thrombectomy (pat) using a balloon - tipped guide catheter for clot - burden reduction in such cases with period - to - period analysis (period 1 : standard mt without pat ; period 2 : pat first, then standard mt for the remaining occlusion).methodseighty - six patients who underwent mt for acute intracranial ica occlusion were included in this analysis from the prospectively maintained stroke registry (33 patients in period 1 and 53 in period 2). in period 2, ' responder ' was defined as a case where some amount of clot was retrieved by pat and the following angiography showed partial or full recanalization.resultsfifteen of fifty - three patients in period 2 (28.3%) were ' responders ' to pat. there was a significantly higher incidence of atrial fibrillation in the ' responder ' subgroup. period 2 showed a significantly shorter puncture - to - reperfusion time (94.5 minutes vs. 56.0 minutes ; p=0.002), a significantly higher thrombolysis in cerebral infarction of 2b-3 reperfusion (45.5% vs. 73.6% ; p=0.009), but only a trend for better 3-month favorable outcome (mrs 02 ; 36.4% vs. 54.7% ; p=0.097). there was no increase in the incidence of procedure - related complications or intracranial hemorrhage in period 2.conclusiona strategy of pat before standard mt may result in shorter puncture - to - reperfusion time and better angiographic outcome than a strategy of standard mt for acute intracranial ica occlusion. |
hypergastrinemia is classified into a primary type, as observed in gastrinoma, and a secondary type mostly due to increased gastrin secretion in response to low gastric acid levels. infection can occur in early childhood, and inappropriate hypergastrinemia has been shown in asymptomatic healthy subjects with h. pylori infection. when the pyloric antrum is infected with h. pylori, g cells can be stimulated by bacterial ammonia or by gastric mucosal cytokines produced in response to h. pylori infection. alternatively, somatostatin production by d cells can be impaired by h. pylori infection, and a decrease in somatostatin secretion can induce increasing gastrin secretion. we examined a young child with persistent epigastric discomfort and failure to thrive that we concluded was likely due to h. pylori infection. although gastric anatomy was normal, the serum gastrin levels in the patient were markedly elevated and a differential diagnosis of gastrinoma was considered to be necessary. based on the results of the patient 's response to a ca injection test and the clinical course after eradication treatment for h. pylori infection, a diagnosis of secondary hypergastrinemia associated with h. pylori infection was confirmed. a 5-year - old boy presented with epigastric discomfort in the summer of 2008. the symptom was marked during fasting, especially at dawn, and relieved after meals. neither loss of appetite nor diarrhea were noted, but there had been no weight gain during the preceding year. due to the persistent epigastric discomfort, he was taken to an outpatient clinic and an antiemetic was started with no favorable effect. his parents and an elder sister had no history of gastric / duodenal diseases. on admission, his height was 111 cm and body weight was 18.3 kg. the serum gastrin level was 635 pg / ml, the maximum value during the course of treatment being 1,680 pg / ml (fig. 1). serum pepsinogen (pg) i level was 102.7 ng / ml and the pg i / ii ratio was 23.2, indicating a hyperacidic state. the normal values reported in children are : gastrin 92.5 39.7 pg / ml, pg i 37.4 13.0 ng / ml, and pg i / ii ratio 5.8 1.6. upper gastrointestinal endoscopy showed normal gastric mucosal folds and no abnormalities including no gastric mucosal atrophy. administration of an h2 blocker (1 mg / kg / day) was started for epigastric discomfort. to investigate the cause of hypergastrinemia, a ca ca was infused over 3 h at a rate of 4.0 mg / kg / h. in cases with gastrinoma, however, in this patient, the gastrin level did not change with ca injection, showing no definitive response to a large load of ca in 3 h. in addition, contrast - enhanced dynamic ct revealed no space - occupying lesions. a urea breath test showed 2.8% (normal range < 2.5%), and a test for the fecal h. pylori antigen was positive. since h. pylori infection was considered to be a possible cause of hypergastrinemia, eradication therapy was performed (fig. 1). a proton pomp inhibitor (rabeprazole, 0.5 mg / kg / day), ampc (50 mg / kg / day), and metronidazole (20 mg / kg / day) the efficacy of eradication therapy was assessed after 2 months by using a repeated urea breath test that showed a normalization to 0.6%. endoscopy 5 months after therapy revealed a decrease in gastric mucosal folds while pathological examination showed a decrease in inflammatory cell infiltration. 7 months after therapy, blood examination showed a gastrin level of 191 pg / ml, a pg i level of 36.7 ng / ml, and a pg i / ii ratio of 7.3. after the eradication, the epigastric pain gradually disappeared. to clarify the role of somatostatin secretion in the gastric mucosa in this patient, immunostaining of the gastric mucosa with an anti - gastrin antibody and anti - somatostatin antibody was performed before eradiation therapy. g and d cells were counted at 400-fold magnification, based on the method of czaja.. a gastric mucosal specimen was examined and compared to another specimen from a 7-year - old girl who had no abnormalities detected by endoscopy or by pathological examination. the specimen from this patient showed average numbers of 78 g cells and 24 d cells from 3 high - power visual fields, and a g / d cell ratio of 3.25. the specimen from the control patient showed 76 g cells, 62 d cells, and a g / d cell ratio of 1.22. in the czaja report, the mean g cell count was 79, d cell count 45, and g / d cell ratio 1.79 in the normal controls. the immunostaining study showed that the d cell count in this patient was lower than in controls, resulting in an increased g / d ratio. when food enters the stomach, gastrin is secreted by g cells in the pyloric antrum and via the circulation acts on gastrin receptors of parietal cells in the gastric body, inducing gastric juice secretion from these parietal cells. when food is propelled into the duodenum, secretin is secreted by duodenal mucosal cells and promotes somatostatin secretion by d cells in the gastric body. via somatostatin, both gastrin secretion by g cells and gastric juice secretion by parietal cells are inhibited. hypergastrinemia is classified into a primary type, as observed in gastrinoma, and a secondary type mostly due to increased gastrin secretion in response to low gastric acid levels. in this patient, because an abnormally elevated serum gastrin level with absence of gastric mucosal atrophy was noted, the possibility of gastrinoma was considered. in addition, there are no established criteria for the diagnosis of gastrinoma, and it is made after a comprehensive evaluation based on the following examinations : serum gastrin, secretin injection test, ca injection test, and angiography. hypergastrinemia showing a serum gastrin level of more than 10 times the normal upper limit strongly suggests the presence of gastrinoma. however, 2/3 of cases of gastrinoma show a gastrin level less than 10 times the normal upper limit. the secretin injection test could not be performed because secretin was not available in japan at the time of study. the ca injection test shows significant increases in serum gastrin level in patients with gastrinoma compared to controls. a previous study showed a positive increase in serum gastrin in 80% of patients with gastrinoma. since pancreatic endocrine tumors are generally hypervascular, angiography is also useful for their evaluation. however, its sensitivity and specificity are not high (less than 80% for each). in this patient, the gastrin level was abnormally elevated, but the presence of gastrinoma was considered to be unlikely based on the results of imaging studies and the ca injection test. the following hypothesis has been proposed : when the pyloric antrum is infected with h. pylori, g cells are stimulated by ammonia produced from the bacterium or by gastric mucosal cytokines such as il-8 and tnf - a that are produced in response to h. pylori infection. alternatively, d cell function, including somatostatin production, is impaired by h. pylori infection. as a result, it is also speculated that a decrease in somatostatin secretion, one of the factors inhibiting acid secretion, is the main cause of hyperacidity in h. pylori infection. a comparison of the g / d cell ratio between our study and that by czaja. showed no increase in g cells but a decrease in d cells resulting in a high g / d ratio in our patient. thus, a decrease in somatostatin secretion due to a reduction in d cell population might have induced hypergastrinemia in this case. the diagnosis of gastrinoma is generally difficult and needs a multi - faceted approach. in some cases, gastrin secretion tests using ca or secretin should be performed while in other cases contrast ct should be done. in children with h. pylori infection showing a high gastrin level requiring differentiation from gastrinoma, immunohistological examination of the gastric mucosa to identify gastrin - secreting cells and somatostatin - secreting cells to confirm in addition, confirmation of a decrease in serum gastrin levels by eradication therapy in patients with h. pylori infection may also be feasible as a therapeutic diagnosis for excluding gastrinoma. in cases with a pending diagnosis of gastrinoma, repeated contrast - enhanced ct examination involving a high level of x - ray exposure is not desirable during childhood. in children with h. pylori infection showing a marked hypergastrinemia, immunohistochemical examination and therapeutic diagnosis by eradication | a 5-year - old boy was referred to our department for persistent epigastric discomfort. serum gastrin level was 635 pg / ml with a pepsinogen (pg) i level of 102.7 ng / ml and a pg i / ii ratio of 23.2, indicating a hyperacidic state. upper gastrointestinal endoscopy showed normal gastric mucosal folds and no abnormalities including no gastric mucosal atrophy. to investigate the cause of hypergastrinemia, a ca injection test was performed and the patient showed no definitive response to a large load of ca. contrast - enhanced dynamic ct revealed no space - occupying lesions. the results from these two studies were not consistent with the presence of gastrinoma. a urea breath test showed 2.8%, and a test for the fecal h. pylori antigen was positive. since h. pylori infection was considered to be a possible cause of hypergastrinemia, eradication therapy was introduced. the therapy was shown to be successful by using a repeated urea breath test that showed a normalization to 0.6%. 7 months after the therapy blood examination showed a gastrin level of 191 pg / ml, a pg i level of 36.7 ng / ml, and a pg i / ii ratio of 7.3. an immunostaining study of the gastric mucosa suggested that a decrease in somatostatin secretion due to a reduction in d cell population might have induced hypergastrinemia in this case. in children with h. pylori infection showing marked hypergastrinemia, immunohistochemical examination and therapeutic diagnosis by eradication may be helpful in the differential diagnosis of gastrinoma. |
he described the case of a pregnant woman who suffered intraperitoneal haemorrhage in the absence of trauma ; the source of bleeding was not identified. it occurs more frequently in males than in females at a ratio of 3 : 2, and most cases occur in later middle age between 55 and 64 years. we report the case of a young male presenting with abdominal apoplexy because of rupture of the short gastric arteries. a 23-year - old male, of polish origin, was brought in by the ambulance to the emergency department. the duration from pain onset to presentation was 15 h. on that morning, he complained of feeling light headed and had experienced an episode of syncope. there was no history of trauma, nausea or vomiting. on examination, he was tender predominantly in the epigastric and right iliac fossa sections of the abdomen. the remainder of the physical examination was unremarkable on presentation, his vital signs were : heart rate of 78/min ; blood pressure of 99/50 ; respiratory rate of 20/min ; temperature of 35.7c ; saturating 100% on air with a gcs of 15/15. he reported a pain score of 12 on a 4-point scale. in terms of laboratory tests, he had an hb of 89 g / l, an mcv of 92 fl, a platelet count of 146 10/l, a white cell count of 14.5 10/l and a crp of < 1 mg / l. he was placed nil by mouth and started on intravenous fluid resuscitation. however, while awaiting a chest x - ray, he experienced two further episodes of syncope. the operation was converted to an open laparotomy as the source of bleeding could not be identified. rupture of the short gastric vessels is a rare case of abdominal apoplexy. in their review of 85 patients with abdominal apoplexy, carter and gosney the left gastric artery, superior mesenteric artery and splenic artery were listed as the most common sites of rupture in order of decreasing frequency. we have summarized the key features of 13 cases of short gastric vessel rupture identified in the literature (table 1). table 1:selected cases of short gastric vessel rupture from the literatureauthoragesexchief symptompredispositionoperationresultrege and bhat 14 yearsmaleabdominal pain ligation and splenectomyrecoveryhight and philippart 21 yearsmaleabdominal painvomitingligation and splenectomyrecoverywilliams. 21 yearsmaleabdominal painvomitingligationrecoveryho 21 yearsmaleabdominal fullness and diarrhoeavomitingligationrecoverykaplan and hausmann 26 yearsmalechest and abdominal painvomitingligationrecoveryrodero. 25 yearsmaleabdominal painvomitingligationrecoveryhsien - pin sun 20 yearsmaleabdominal pain ligationrecovery selected cases of short gastric vessel rupture from the literature most cases of abdominal apoplexy are believed to occur because of a predisposing vascular lesion. in older patients, arteriosclerosis with or without hypertension is believed to be the most common cause. with younger patients, congenital defects in the medial coat of the visceral arteries eight of the 13 cases, we identified occurred following bouts of vomiting (table 1). hayes. proposed that retching may cause a partial, gastric volvulus. the severity of the pain is related to the volume and rapidity of expansion of the blood volume. this is followed by a latent period, devoid of symptoms, lasting from hours to days. in the terminal phase, there is an increasing severity of symptoms and the manifestations of shock become evident. our patient appears to have presented in the early terminal phase. in terms of investigations, computed tomography of the abdomen has been reported as the most useful. in haemodynamically unstable patients, fast (focused assessment by sonography in trauma) examination may be useful to detect intra - abdominal haemorrhage. however, it was necessary to convert to laparotomy via an upper midline incision to identify the bleeding point. the choice of intervention is determined by the age and condition of the patient, as well as the site of bleeding. prognosis for the patient is dependent on early diagnosis and intervention. in patients who do not undergo surgery, mortality has historically approached 100%. however, prompt surgical intervention has been described to reduce mortality to 8.6%, especially where a definite bleeding point can be located and ligated. diagnosis of abdominal apoplexy is dependent on maintaining an awareness of the condition in one 's differential diagnoses. unfortunately, lack of suspicion continues to delay diagnosis, worsening the prognosis for the patient. one should suspect abdominal apoplexy in individual presenting with atypical abdominal pain and signs of shock. vomiting, hypertension and arteriosclerosis should further raise suspicion of possible vessel rupture. in cases where abdominal apoplexy is suspected | abdominal apoplexy or idiopathic spontaneous intraperitoneal haemorrhage is defined as the presence of free blood within the peritoneal cavity. non - traumatic and non - iatrogenic causes may cause abdominal apoplexy. it has a variable clinical presentation, with abdominal pain being an early and non - specific symptom. we report a rare case of a 23-year - old male with abdominal apoplexy because of rupture of the short gastric artery. he presented to our department with abdominal pain. later, he developed signs of shock, and was found to have haemoperitoneum on laparotomy. we ligated the short gastric artery, which was the bleeding source, and he had an uneventful postoperative course. we also review the literature on existing cases of short gastric vessel rupture. |
the affected tissues in periodontics, such as periodontal ligament, cementum, and alveolar bone, suffer morphological alterations and cause negative consequences to the patients oral health. the periodontal therapies have as an objective the control of the disease progression and inflammatory process giving back the function of the lost support structures. the furcation site is frequently affected by periodontal disease mainly due to its specific anatomy that complicates the effectiveness of calculus removal and decontamination of the area. factors such as root trunk length, furcation entrance, root separation, and root surface area can affect diagnosis, and consequently, the choice of the appropriate therapy for furcally involved molars. once suggested that guide tissue regeneration (gtr) could restore the lost periodontal tissues in class ii furcation defects. in order to avoid a second surgery for membrane removal, a bioresorbable barrier was developed. difficulties with barrier membranes have included in space maintenance of the site and limited bone fill in furcation areas. alternatively, class ii furcation bone replacement grafts have achieved similar results to gtr barriers. the use of bone graft materials has been suggested as beneficial with non - resorbable and resorbable barriers. guide bone regeneration (gbr) is based on the formation of new bone to fill bone defects. the result of the gtr depends on the membrane stability, the flap first intention healing, and patients compliance. some complications can occur with the membranes such as : exposure, collapse, and infection, causing the regeneration to fail. if during the healing process occurs a displacement or collapse of the membrane, the formation of the new bone will be affected. the procedures will result in healing with long junctional epithelium and limited connective tissue attachment. the bone substitutes present themselves commercially in many ways : organic and inorganic, cortical or spongy, macro or and micro particles, block, floccus and fragments. the demineralized bovine bone, with 0.5 to 1.0 mm particles, is a biocompative bone substitute, acellular, not cytotoxic, not immunogenic, not pyrogenic and of high level of purity, indicated for the filling of bone failures. its mechanism of action is by osteoconduction and act again as support for bone being reabsorbed and bone matrix formation on the place, allowing this material to be used isolated or in association with graft materials with the osteoinductive or osteogenic action. the surgical glue used for helping in a lot of procedures is consisted of on n - butil-2-cyanocrylate (nbca) modified by the addition of a monomer. it has high hemostatic and adhesive properties and, once solidified, produces an antiseptic barrier effective against against infectious agents or pathogens frequently found in surgical environment. when in contact with tissue or humid environment, it polymerizes rapidly, creating a thin elastic coating with high resistance to tension, which guarantees a solid accession of the tissues. this coating adapts itself naturally to the tissue anatomy which is applied, it is waterproof, and is not damaged by blood or organic fluids. once solidified, the coating can be perforated by a suture needle, once the product polymerization does not form crystalline aggregates. the polymerization time is short when correctly applied ; starts its solidification after around 1 to 2 seconds, completing its reaction after around 60 to 90 seconds. the treatment of molar furcation defects remains a challenge. a combined gbr therapy with bioabsorbable hydroxyapatite and tetracycline or gtr with a coronally advanced flap showed better results on furcation closure compared to open flap debridement. the use of lyophilized bovine bone in association with the ncba - glue as a barrier in attempt to treat class ii furcation lesions can be an option of treatment. therefore, the objective of this study was to evaluate the clinical response of gbr and barrier of ncba surgical glue (glubran glue 2) in the treatment of mandibular buccal class ii furcation lesion. a 30-year - old healthy man, leukodermic, non - smoking presented for treatment in the dental clinic at positivo university. anamnesis and clinical examination were performed and the periodontal clinical parameters were assessed and are described in table 1. it was observed, a clinical attachment loss (cal) at buccal surface of the tooth 37 and class ii furcation lesion through the buccal - lingual (b - l) direction. after 90 days from baseline, the patient was reevaluated [figure 1a b ]. once the furcation lesion was still present and remained on similar levels as the initial periodontal exam, it was decided by a surgical intervention. the proposed treatment was gbr associated with ncba - glue as a barrier [figure 2 ]. the surgical procedure began with extern antisepsis, with polivinil - pirrolidonaiodo (pvpi) and mouthwash with chlorhexidine digluconate at 0.12% (periogard) during 1 minute. a reverse bevel incision was from the distal face of tooth 37 and extending to the mesial face of the same tooth, encompassing the papillae with vertical releasing incisions beyond the mucogengival line in a full thickness flap [figure 3 ]. biomaterial division, made in brazil), [figure 4 ] moistened with physiological serum, inserted in the furcation area with a type lucas no 2. one milliliter of surgical glue was applied with an insulin syringe distributed over the graft in drops [figure 5 ]. the flap was replaced and sutured with a 5 - 0 mononylon wire (ethicon- johnson and johnson). for postsurgical pain control, 600 mg ibuprofen every 4 to 6 hours and 500 mg amoxicillin (b) initial clinical aspect of element 37 (buccal) surgical glue (nbca) used as a barrier a full thickness mucoperiosteal flap reflected. furcation class ii exposion on toth 37 furcation area with biomaterial - organic lyophilized bone graft setting the surgical glue on the bone graft it was observed after 10 days post - treatment, [figure 6 ] the gingival margin was on the same level of the cemento - enamel junction. no complications were observed at the treated site, no acute inflammation neither an abscess. after 1 year of treatment it was observed that a small cal had occurred at the buccal site. clinical buccal aspect (one month post surgery) (a) x - ray after 1 year of follow up. the proposed treatment for this case report was gbr associated with ncba - glue as a barrier in a class ii furcation lesion. it has been shown that the use of bone graft for filling the buccal defect of molar with class ii furcation lesion associated with a membrane of ncba - glue to stabilize the bone graft resulted in a horizontal bone gain and clinical stability. the treatment of bone defects is a challenge for periodontists that always seek for a complete closure. also, the studies that involve class ii furcation lesion treatment need a larger time of proservation to evaluate the durability of the clinical effects and confirm the results. beyond the influence of anatomic characteristics of furcation lesion, the location in the arc and the furcation entry position interfere in a negative way in the daily sanitation reducing the periodontal treatment through the bacterial recolonization. there is no evidence that the gtr associated with bovine graft is a predictable treatment for level iii furcation lesion in humans, but it was observed that in class ii furcation defects the combination of gtr with a bone substitute and not absorbable membrane found significant results in vertical and horizontal bone level in mandibular molars. beyond that, a long - term study has shown that the molars with periodontitis involving furcation have a bigger rate of periodontal destruction. it was descript that to achieve horizontal and vertical bone increase in gtr, four principles must be followed as : the epithelium exclusion and the conjunctive tissue, maintenance of space, clot stabilization and primary wound closure, to allow that osteogenic cells invade the gtr area. according to the literature, the size of bone particles can interfere with the gbr therapy success. when a liophillized demineralized bone is used in particles sizes of 0.12 to 1.00 mm have a better osteoinductive effect then the particles smaller than 0.12 mm. very small particle sizes can cause an answer of macrophages and are rapidly reabsorbed with a little or no bone formation. the use of barriers in gtr optimizes the results and confirms a bigger gain of clinical insertion level., 2001, about the cytotoxicity of the gulbran2 and its compatibility with blood showed that the toxicity is associated with the polymerization heat and that the glue has an acceptable toxicity when diluted and presented blood compatibility, and it was also verified in the present study. surgical glue have a strong capacity of ligament with the biological tissues and high resistance when polymerized, and resistance to traction. a membrane of ncba - glue has been used in surgical procedures and endoscopes where tissue adhesives are commonly used as reinforcement of sutures or as collage and homeostatic agent. the use of ncba - glue as barriers had optimized the results in class ii furcation lesion treatment. | the guided bone regeneration (gbr) is a technique that uses resorbable and non - resorbable membranes in association with other filling biomaterials. gbr is one of the optional treatments for therapy of class ii furcation defects. the current case report evaluates clinically and radiographically the use of the cyanoacrylate membrane (glubran 2) associated with organic bovine bone (genox) for the treatment of vestibular class ii furcation defect on the lower left molar. conclusion : the gbr is an option in the treatment of vestibular class ii furcation defects and cyanoacrylate surgical glue, acting as a mechanic barrier and providing an efficient stability for the graft. |
patients with lifestyle - related chronic diseases, including diabetes mellitus, dyslipidemia, and hypertension, are often treated with daily oral medications, and adherence to the medications is a key factor in the management of chronic diseases (1,2). it is well recognized that patients ' satisfaction with treatment is a major determinant of adherence (3), and strategies for improving treatment satisfaction have been long discussed. furthermore, on the basis of the belief that a lower dosing frequency would improve satisfaction, once - weekly oral medications have been developed for lifestyle - related chronic diseases. recently, a few of them have begun to make an appearance in clinical practice (5 - 7). it is true that once - weekly bisphosphonates, an anti - osteoporotic drug, was a successful precedent for once - weekly oral medications. as previous studies revealed, osteoporotic patients strongly preferred a once - weekly bisphosphonate to a once - daily one (8,9). however, bisphosphonates are far from easy to take, whereas medications for lifestyle - related chronic diseases currently available are not as troublesome as bisphosphonates. it might be that the troublesomeness of taking bisphosphonates encourages the preference for once - weekly dosing versus more frequent dosing. it remains unknown whether this preference would be similarly true for less troublesome medications for lifestyle - related chronic diseases. in addition, given that only a few kinds of once - weekly medications are available at present, and that patients with lifestyle - related chronic diseases often take a number of oral medications, it is currently impossible to change all of their medications to once - weekly ones. as such, any once - weekly medications must be taken together with daily medications. however, little is known about the patient perspectives on the combined use of a once - weekly medication with daily medications. in the present study, we examined whether changing a daily oral medication for a once - weekly oral one would improve treatment satisfaction in patients treated with more than one daily oral medications for chronic diseases. we performed a questionnaire - based survey, to compare the current satisfaction with the ongoing daily oral treatment (current daily - only treatment) and an expected satisfaction with an imaginary oral treatment changing one of the daily oral medications for a once - weekly oral medication (imaginary daily - and - weekly treatment). the questionnaire contained a total of 10 statements related to treatment satisfaction and asked to what extent a respondent agreed with each statement. the response was obtained on a 7-point likert scale, with a range from 0, indicating strongly disagree the questionnaire was developed on the concept that all items would, either positively or negatively, reflect a single underlying factor, namely satisfaction with oral treatment, and calculation of a total score was expected. regarding the current daily - only treatment, the questionnaire asked how a respondent felt about his or her current daily oral treatment, with the following 10 statements presented : 1. i hope to continue receiving the current oral treatment. similarly, to examine the expected satisfaction with an imaginary daily - and - weekly treatment, the questionnaire asked, if you could change only one of your daily oral medications for a once - a - week oral medication, how would you feel about the oral treatment including the weekly medication ? note that all of the statements for the current daily - only treatment and those for the imaginary daily - and - weekly treatment corresponded to each other. the study population were adult japanese outpatients with lifestyle - related chronic disease who had multiple daily oral medications prescribed in shiraiwa medical clinic, osaka, japan. a total of 1,091 outpatients were asked to participate in the current study, and 1,071 (98%) ultimately participated. the study was performed in accordance with the declaration of helsinki and was approved by the ethics committees of shiraiwa medical clinic and osaka university hospital. the participants responded to the questionnaire for both the current daily - only treatment and an imaginary daily - and - weekly treatment. the patient attributes, including age, sex, and dosing regimens they received, were collected from their medical records. descriptive statistics are given as the mean standard deviation for continuous variables and as percentages for categorical variables if not otherwise mentioned. a p value less than 0.05 was considered to be significant, and 95% confidence intervals (cis) were given when required. an explorative factor analysis with a varimax rotation was performed on the 10 items of the questionnaire. 1, was used to determine the optimal number of factors. in a factor analysis, the good scaling property of each item was judged by loadings of > 0.40 on one factor and 0.40 on one factor and 1 (4.7 and 1.7). in the 2-factor structure, explaining 55% of variance, all 10 items were successfully separated into 6 positively and 4 negatively worded items (see 2-factor solution in table 2). cronbach 's was 0.881 for the 6-item positively worded scale and 0.816 for the 4-item negatively worded scale, whereas the corresponding item - total correlations ranged from 0.562 to 0.744 and 0.617 to 0.669, respectively. in contrast, in the 1-factor structure, explaining 42% of variance, all 10 items again had > 0.40 of the absolute loading values ; the loadings were > 0.40 for the 6 positive items and < -0.40 for the 4 negative items (see 1-factor solution in table 2). their communalities ranged from 0.223 to 0.598. in the assessment of reliability with the 4 negative items scored inversely, the item - total correlations ranged from 0.490 to 0.665, and cronbach 's was as high as 0.862, which was never exceeded if any item was deleted (table 2). these findings indicated a high internal consistency, suggesting that all 6 positive and 4 negative items related to one underlying factor, and that a total score of satisfaction could be developed by summing the scores of all 10 items, with the rating of the 4 negatively worded items reversed. two - factor solution explained 55% of variance, whereas 1-factor solution explained 42%. reliability for the 1-factor solution was assessed with the rating of the 4 negatively worded items (no. 5 to 8) reversed (e.g., from 0 to 6, and from 6 to 0). chronbach s of the total 10-item scale was 0.862. in the study population, the satisfaction score for the current daily - only treatment was 43 11 (median, 42 ; interquartile range, 34 to 52 ; range 8 to 60). the general linear model adjusted for patient attributes revealed that dosing regimens independently associated with the satisfaction scores were the frequency of dosing (standardized partial regression coefficient =-0.182, p<0.001) and the combined use of self - injections (=-0.077, p=0.027), but not the number (i.e. the kind) of medications (=-0.040, p=0.402). of the 1,022 patients who completely responded to the questionnaire for the current daily - only treatment, 973 (95%) also completely responded to that for an imaginary daily - and - weekly treatment. as table 3 shows, the individual item scores for the imaginary daily - and - weekly treatment were worse on the whole than those for the current daily - only treatment. the total satisfaction score, calculated similarly to the current daily - only treatment, was significantly lower than that for the current treatment, with p value less than 0.001 and effect size d equal to 0.49. thirty percent of the patients (n=291) gave a higher score for the imaginary daily - and - weekly treatment than for the current daily - only treatment. comparison of item scores between the current daily - only treatment and an imaginary daily - and - weekly treatment. individual item scores of agreement were ranged from 0 (" strongly disagree ") to 6 (" strongly agree "). the total satisfaction score, with possible range between 0 and 60, was calculated by summing the scores of all 10 items, after the rating of the 4 negatively worded items (no. 5, 6, 7, and 8) reversed. the median, interquartile range, and range of the total satisfaction score were 42, 34 - 52, and 8 - 60 for the current daily - only treatment, and 36, 29 - 45, and 0 - 60 for the imaginary daily - and - weekly treatment. as shown in table 4, patients giving a higher score for the imaginary daily - and - weekly treatment than for the current daily - only treatment were more prevalent in the subgroup with a lower score for the current daily - only treatment. the general linear model revealed that none of the current dosing regimens were significantly associated with the satisfaction score for an imaginary daily - and - weekly treatment ; the standardized partial regression coefficient was -0.012 for the number (i.e. the kind) of medications (p=0.809), -0.036 for the frequency of dosing (p=0.381), and the combined use of self - injections (=0.007, p=0.837), respectively. we also confirmed that the total satisfaction score for the imaginary daily - and - weekly treatment was not significantly correlated with age (r=0.051, p=0.115). neither was it significantly associated with diabetes mellitus (p=0.438), dyslipidemia (p=0.948), circulatory diseases (p=0.511), or hyperuricemia (p=0.601). in addition, it was not significantly correlated with the control levels ; the correlation coefficient r was 0.020 (p=0.588) for hemoglobin a1c levels and 0.053 (p=0.312) for fasting plasma glucose levels in patients with diabetes mellitus, -0.014 (p=0.751) for low - density lipoprotein cholesterol levels and -0.009 (p=0.886) for triglycerides levels in patients with dyslipidemia, -0.040 (p=0.371) for systolic blood pressure and -0.034 (p=0.444) for diastolic blood pressure in patients with hypertension, and -0.155 (p=0.079) for uric acid levels in patients with hyperuricemia. the current study indicated that treatment satisfaction would be, on average, attenuated in patients treated with multiple daily oral medications for chronic diseases if one of the oral medications was changed to a once - weekly one. patients giving a higher score for the imaginary daily - and - weekly treatment than for the current daily - only treatment were more prevalent in the subgroup with a lower score for the current daily - only treatment. the risk analysis for the current treatment satisfaction revealed that a higher daily frequency of dosing and combined use of self - injections were negatively associated with the treatment satisfaction, indicating that the complexity of the dosing regimens would be less satisfying. indeed, these complicated regimens are reported to be linked with non - adherence (4). drug regimens with reduced dosing frequencies are believed to be preferred by patients, which might result in improved treatment satisfaction. based on this belief, once - weekly oral medications have been developed (5), and once - weekly bisphosphonates are one of the successful precedents (8,9). however, the current findings showed that the majority of the patients treated with polypharmacy for lifestyle - related chronic diseases gave a lower satisfaction score to the imaginary daily - and - weekly treatment than the current daily - only treatment, indicating that they did not favor a regimen using a once - weekly medication together. although the true underlying reason for this unexpected finding is unknown, one possible explanation is that the medications for lifestyle - related chronic diseases currently available are not as troublesome to consume as bisphosphonates. bisphosphonates are not easy to take ; patients must take a bisphosphonate after waking up in the morning, with a full glass (i.e. around 180 ml, and not less) of water, and no other drink (including water rich in minerals), at least 30 minutes before eating a meal, drinking a beverage, or taking any other medicine. they must also sit or stand (not lie down) for at least 30 minutes after taking it. the troublesomeness of taking a bisphosphonate may encourage the preference for once - weekly dosing. by contrast, the currently available daily medications for lifestyle - related chronic diseases are not as troublesome to take. relatively, the troublesomeness of combined use of a once - weekly oral medication plus daily ones would stand out. a previous questionnaire - based study reported that patients were generally positive about once - weekly medications (10). however, the researchers drew the patients ' responses by presenting the hypothesis that patients could change all oral medications for a once weekly medication if they wished. this situation is in contrast to the current clinical setting, in which only a few kinds of once - weekly medications are available at present and one once - weekly medication can not be a substitute for polypharmacy. as such, once - weekly medications must be combined with daily medications for the time being. our study demonstrated that, in such a real - world situation, only a limited population would draw an expected advantage, i.e. improved satisfaction, from a daily - and - weekly combination treatment. the per - item analysis (table 3) showed that inferiority of the imaginary daily - and - weekly treatment to the current daily - only treatment was observed in various aspects. patients did not regard the treatment as all that simple, and were suspicious about the drug efficacy. an unfavorable impression of a newly started medication may lead to reluctance to take the medication (11 - 13). when medical staff make a well - meant attempt to switch a daily medication to a weekly one in non - adherent patients with polypharmacy, they should be aware of this potential psychological barrier to the daily - and - weekly treatment. the patients ' preformed impression of the daily - and - weekly treatment is often poor, and an attempt to alter the regimen might further deteriorate the medication adherence, contrary to expectations. however, we must not overlook the fact that a third of the population gave a higher score for the imaginary daily - and - weekly treatment than the current daily - only treatment, suggesting that a proposal to switch one daily medication to a weekly one would draw favorable responses from these patients. unfortunately, the current study could not detect any significant clinical predictor for the total satisfaction score for the imaginary daily - and - weekly treatment, meaning that it would be difficult to predict the expected satisfaction based on the patients ' clinical backgrounds. given that the lowest quintile of the current treatment satisfaction was more likely to give a relatively high satisfaction score for the imaginary daily - and - weekly treatment, the risk factors for dissatisfaction with the current daily - only treatment (i.e. the frequency of dosing and the combined use of self - injections) would be clinically useful as passive markers for relative satisfaction with the daily - and - weekly treatment. indeed, when we performed a multivariate logistic regression analysis, the frequency of dosing and the combined use of self - injections were significantly associated with a higher satisfaction score for the imaginary daily - and - weekly treatment than the current daily - only treatment (both p<0.05) (data not shown). however, it is of note that these variables were only risk factors for dissatisfaction with the current daily - only treatment and for a relatively high satisfaction score for the imaginary daily - and - weekly treatment ; they were not direct predictors for the absolute satisfaction with the imaginary daily - and - weekly treatment. the psychological factors involved in the expected satisfaction with the daily - and - weekly treatment must be thoroughly investigated. a deeper understanding of the patient perspective on the combination therapy of once - weekly oral medication plus daily ones would promote the improvement of treatment satisfaction and medication adherence. a more detailed survey regarding the patient perspective on combination therapy of once - weekly medications first, we only surveyed the patients ' expected satisfaction with an imaginary treatment using a once - weekly medication and did not actually administer the treatment to the patients. however, given that patients ' perspectives could substantially influence medication adherence, the current findings may still be of use in initiating a once - weekly medication. second, the current questionnaire did not survey the patient perspective on the imaginary therapy with all their medications changed to once - weekly ones. we were therefore unable to compare that perspective with the current satisfaction or the daily - and - weekly treatment. third, the current study did not include patients who already took once - weekly medications. retrospectively, the data on the pill count - based medication adherence were available from medical records in 363 diabetic patients (36%). in this limited population, medication adherence was distributed as 94% 10% ; 165 patients (46%) had 100% adherence, 132 (36%) had 90 - 99%, 43 (12%) had 80 - 89%, and 23 (6%) had 79% adherence. the medication adherence was significantly associated with a total satisfaction score for the current daily - only treatment (r=0.120, p=0.022) but was not correlated with that for the imaginary daily - and - weekly treatment (r=0.003, p=0.960). however, this finding was from a limited population, and whether or not this finding is representative of a trend in the whole population remains unknown. future studies prospectively and thoroughly investigating medication adherence in the whole study population will be needed to confirm the association with the patient perspective and the medication adherence. medication insurance systems, cultures, relative socioeconomic status, and other confounding factors might influence the attitude toward treatments. future studies with populations of other ethnicities will be needed to validate the current findings. in conclusion, the current study indicated that treatment satisfaction would be on average attenuated in patients treated with more than one daily oral medication for chronic diseases if one of the oral medications was changed to a once - weekly one. improvements in the satisfaction were less expected in the subgroup more satisfied with the current daily - only treatment. iichiro shimomura : honoraria, takeda pharmaceutical and msd ; research funding, takeda pharmaceutical and msd. | objective the current study investigated whether or not patients taking multiple daily oral medications for lifestyle - related chronic diseases would have positive perspectives on changing one of their medications to a once - weekly one. methods a total of 1,071 japanese outpatients participated in the current study. we performed a questionnaire - based survey and compared the current satisfaction with the ongoing daily oral treatment (current daily - only treatment) and an expected satisfaction with an imaginary oral treatment changing one of their daily oral medications to a once - weekly oral medication (imaginary daily - and - weekly treatment). results medications were taken for diabetes mellitus in 72% of the patients, for dyslipidemia in 54%, and for circulatory diseases, including hypertension, in 73%. compared to their satisfaction with the current daily - only treatment, an expected satisfaction with the imaginary daily - and - weekly treatment was on average significantly attenuated (p<0.001, effect size d=0.49). the prevalence of a higher satisfaction score for the imaginary daily - and - weekly treatment versus the current daily - only treatment was 30% in the overall population. the prevalence was 59%, 40%, 29%, 14%, and 8% in the 1st, 2nd, 3rd, 4th, and 5th quintile of the satisfaction score with the current daily - only treatment (p<0.001 for trend). conclusion treatment satisfaction would be on average attenuated if one of the multiple daily oral medications was changed to a once - weekly one. improvement in the satisfaction was less expected in the subgroup that was more satisfied with the current daily - only treatment. |
the generation of torsion angle restraints is among the most critical steps in protein structure determination by nmr. in many cases, torsion angles also are used in lieu of other restraints (i.e. noes) when these data are missing. the importance of torsion angle information tends to increase with the size of the protein being studied as the quality and quantity of other restraints, such as noes, deteriorate due to increased spectral overlap and reduced sensitivity. because of their importance in structure calculations, all commonly used software packages for nmr structure determination, such as cns (1), xplor (2), cyana (3) and amber (4), accept torsion angles as restraints. in nmr, the information about torsion angles is commonly obtained from scalar couplings (e.g. jhnh, jh-1n, jch) and cross - correlated relaxation experiments (510), and often involves comparing peak intensities or measuring peak splitting. the accuracy of these measurements can be severely compromised by signal broadening and low signal - to - noise ratios, especially when dealing with larger (> 150 residue) proteins. indeed, it is well known that h, c and co shifts are very sensitive to backbone / angles, while n shifts appear to be significantly influenced by side chain 1 angles of the preceding residue (11). chemical shift measurements are less affected by peak overlap or reduced spectral sensitivity than measurements of peak intensities and peak splittings. furthermore, chemical shift measurements are routinely obtained for all peptides and proteins and often do not require additional nmr experiments beyond those needed for backbone assignments. indeed, chemical shift measurements are commonly done as the first step in the nmr - assisted determination of protein structures. the simplicity and accuracy of chemical shift measurements in combination with the public availability of thousands of protein chemical shift assignments has prompted the development of a number of protocols that use chemical shifts to predict backbone dihedral angles (1217). talos (17) is one such example and is currently one of the most commonly used programs that utilize chemical shifts to obtain dihedral angles. talos predicts and torsion angles by comparing the chemical shifts and primary sequence of the protein being studied with a database of homologous polypeptides with known torsion angles and chemical shifts. talos has made a profound impact on protein nmr, having appeared in more than 700 published works to date. for instance, it does not predict side chain (1) or cis - trans peptide bond angles () nor can it handle mis - referenced chemical shifts. furthermore, talos does not provide information about bounds of torsion angle restraints that are required for nmr structure calculations. it also runs very slowly (22 min for a 150 residue protein on a 2.6 ghz processor). the motivation for the current work was our belief that the prediction of torsion angles could be extended to angles other than and, that these predictions could be performed much faster, and that their accuracy could be significantly improved if the recent advances in our understanding of chemical shifts and the growing body of protein structural information could be implemented in a prediction protocol. here we describe a program, called preditor (prediction of torsion angles from chemical shift and homology), that is able to accurately predict a large number of protein torsion angles (,,,) using either h, c and n chemical shift assignments or protein sequence (alone) as input. overall, the program is 35 faster and the accuracy (for combined shift - based and homology - based prediction of / angles, using a 30 tolerance) is 20% greater than talos. the program can also predict g+, g, trans states of 1 angles with 84% accuracy and angles are predicted with essentially 100% accuracy (using a 2-state, cis / trans state prediction). preditor is able to extend the limits of torsion angle prediction accuracy by (i) combining shift based and homology based predictions, (ii) taking advantage of better understanding the relationship between chemical shifts and torsion angles and (iii) utilizing recent advances in correcting mis - referenced nmr assignments and predicting of protein flexibility from chemical shifts. preditor is composed of two parts, a front - end web interface (figure 1) written in python and html and a back - end calculator that consists of several programs including rci (18), csi (19), vadar (20), blast (21) and refcor [based on (22) ] as well as several parsing and conversion utilities for reading input files. four of the programs blast, vadar, csi and the core of the preditor code are written in ansi standard c. several other programs including rci, refcor and most input parsing and conversion utilities are written in python. preditor also accesses two databases, a local database of nmr assignments and torsion angles and the protein data bank (23). preditor accepts three kinds of input files : (i) chemical shift assignments in bmrb nmr - star format (24), (ii) chemical shift assignments in shifty format (25) and (iii) raw protein sequence in fasta format (26). users can either upload an input file into the web server (via a browse button) or paste the data in a standard text box. users are also offered several options to adjust program operations to suit their specific needs. by default, preditor uses both chemical shifts (via refdb) and sequence homology (to structural homologues in the pdb) to predict torsion angles. however, the reliance on homology - based predictions may not be desirable in some cases. for example, a user may wish to assess the agreement between the shift - based (nmr) torsion angles and the torsion angles measured for an existing x - ray structure of the same protein. in such cases, preditor allows users to select the radio - button option to predict dihedral angles from chemical shifts only. in other cases, a user may only want to use homology - based predictions in his or her research. for instance, a comparison of torsion angles predicted from chemical shifts with those predicted via homology may aid in resolving ambiguous cases during the nmr assignment process. in these cases, users may select the radio - button option to predict dihedral angles via homology only. preditor also offer users the flexibility to specify the pdb i d of the protein structure that should be used in homology - based predictions. this feature is especially useful when the structure of the best - matching homologue was solved, say, under significantly different experimental conditions (e.g. high urea concentration to partially unfold the protein) or if the structure corresponds to a protein in a different functional form (e.g. ligand - bound, post - translationally modified, etc.). to help users identify an appropriate homologue, we offer an option to blast their protein against the pdb and to display the results so they are hyperlinked to the corresponding pages of the pdb. if a fasta sequence only is used as input, torsion angles are predicted from a pdb homologue with the best blast e - value. one of the more important advantages of preditor over existing programs is its capability to correct mis - referenced chemical shifts (17,27). chemical shift referencing, particularly for c and n shifts, continues to be a major problem in biomolecular nmr with about 20% of newly deposited assignments in the bmrb database being mis - referenced (28). mis - referenced shifts could substantially reduce the performance of chemical shift - based torsion angle predictions. preditor 's reference correction option is always turned on by default and can be switched off if necessary. an average preditor run takes about 38 cpu seconds on a 2.6 ghz processor equipped with 512 mbytes of ram. as might be expected, preditor displays the name of the input file, the options selected, the pdb i d, the blast e - value and the level of identity of the pdb homologue (if any) used in predictions. below these data, the predicted torsion angles (,, and 1), their errors and confidence scores are shown in a tabular format. in addition to these data, the output page contains hyperlinks to additional web pages with the results of the sequence alignment (blast results), chemical shift reference corrections (refcor results), the predictions of protein flexibility (rci results) and secondary structure predictions (csi results) derived from chemical shifts. the preditor server also allows users to download the predicted / calculated dihedral angles restraints in cns, cyana, amber and xplor format. in addition to its rich and extensive data output, preditor also offers a comprehensive list of help pages to assist users in preparing their input files, in understanding torsion angle prediction methods and in understanding the program output. this information is provided to make the preditor protocol as transparent as possible and to facilitate any troubleshooting if necessary. the basic preditor prediction algorithm has been described in much more detail elsewhere (27). preditor predicts protein torsion angles using a combined protocol that can be roughly divided into two components : shift - based predictions and homology - based predictions. if a set of nmr assignments is submitted to the program, both types of predictions are run and their results are merged based on their respective errors or confidence levels, and on switch points as explained below. if a fasta sequence is supplied as an input file, only homology - based predictions are performed. chemical shift - based predictions are initiated by re - referencing the nmr assignments (if this option is not turned off by the user). refcor applies a recently published protocol that uses h chemical shifts for the initial identification of secondary structure and the calculation of reference offsets (22). refcor can also go beyond the original procedure and properly predict secondary structure and correct referencing using other nuclei (c, co and c) or a consensus chemical shift index calculation (19). these features enable preditor / refcor to re - reference shifts in the absence of h assignments. a more detailed description of refcor features and performance will be published elsewhere. for shift - based predictions, preditor derives backbone torsion angles by comparing the chemical shifts of successive amino acid triplets from the query sequence with triplets contained in preditor 's own shift / structure database. currently, the most recent version of this shift / structure database consists of 141 different protein entries obtained from refdb (providing chemical shift data) and the pdb (providing torsion angle data) the chemical shifts in the database were re - referenced via shiftcor (28). updates to the database and updates of preditor 's performance relative to its standard test sets will be posted on preditor 's help pages at regular intervals. to calculate the backbone torsion angles from chemical shifts, preditor calculates a sequence / shift similarity score [s(i, j) ]. for each query triplet i and each database triplet j the similarity score s(i, j) is calculated using the following equation. 1s(i, j)={0.5kn1(seqsim)+kn2(|ci+ncj+n|)+kn3(|ci+ncj+n|)+kn4(|coi+ncoj+n|)+kn5(|hi+nhj+n|)+kn6(|ni+nnj+n|)+kn7(|hni+nhnj+n|) where sums over the triplet of n = 1 to 1, knm corresponds to empirically determined weighting coefficients (table 1 on the preditor help page) for each triplet n of each term m, seqsim represents the sequence similarity between each sequence triplet using the seqsee weight matrix (29). x is the secondary chemical shift (30) of nucleus x. the similarity score [s(i, j) ] between the query triplet and database triplet is calculated for all triplets in the database. the ten triplets with the lowest scores are selected and torsion angles for central triplet residues are extracted. the predicted torsion angles are clustered if the difference of the or angles is less than 15. the mean and angles of the cluster with the lowest overall s(i, j) score are used as the predicted torsion angles for the central residue of the query triplet. preditor uses probabilistic 1 hypersurfaces calculated by dunbrack (31) to generate an initial set of predicted 1 angles based on conformations of or angles. each 1 angle is predicted to be in one of three states (60, + 60and 180) and assigned a confidence score between 0 and 1 (with 1 being most confident). by default, preditor assigns a trans conformation (180) to angles of all non - proline residues. the presence of cis peptide bonds in proline residues is detected via comparison of the c and c shifts (32). if the absolute difference between the c and c shifts is greater than 9 p.p.m. or if trp, tyr, phe, gly and cys are in either i 1 or i + 1 positions around proline (33) and c, c shift difference is between 8 and 9 p.p.m. preditor 's homology - based predictions are initiated from a pairwise sequence alignment of the input sequence and all known pdb sequences using blast (21). the structure with the lowest e - value is retrieved from the pdb and its dihedral angles are calculated by vadar (20). torsion angles are mapped to the query sequence using the sequence alignment provided by blast. in addition, a angle of 65 is mapped on to pro regardless of the values of homology - predicted angles. prior to merging shift - based and homology - based predictions, the error limits (for / angles) and confidence scores (for,, 1) angles are calculated for each method as described below. predictions with higher confidence scores or lower error limits are given precedence over predictions with lower confidence scores or higher error limits. however, if shift - derived torsion angles of four or more consecutive residues are significantly different (> 60) frompdb - derived values, the shift - based predictions are given precedence. when homology - based predictions are not possible, the shift - derived predictions are used. the selection of either homology - based predictions or shift - based predictions is also determined by the rationale for adding the switch points was our observation that accuracy of predicted angles decreases significantly with increase of beta - sheet content in proteins and reduction of sequence identity of the homologue identified by blast (27). the switch points were obtained empirically by thorough analysis of these dependencies and are listed in web table 2 on preditor 's help page. preditor assigns an error to each predicted / torsion angle by combining its confidence scores with predicted or identified secondary structures and local sequence identity. the relationship to confidence scores and estimated / torsion angle errors are listed in web table 3 of preditor 's help page. these error values were determined empirically by attempting to minimize both the size of the assigned error and the number of erroneous predictions with high (0.7) confidence values. generally speaking residues in helices have smaller errors than beta strands and angles have smaller errors than angles. confidence scores in preditor are calculated using the following formula : 2c=2(3s(i, j)/239)2 where c is the confidence score and s(i, j) is the similarity score calculated in equation 1. the confidence scores depend on both the sequence and chemical shift similarity of the query protein sequence triplets to the corresponding sequence triplets found in the preditor database. this formula produces values that range from 0.0 to 1.0 (with 1.0 having the highest confidence). roughly speaking a preditor confidence rating 0.7 corresponds to the talos rating of ambiguous. with the homology search turned off, preditor predictions having a confidence score 0.7, have an error rate that is slightly > 3%. typically 6065% of preditor predictions (with the homology search turned off) have a confidence score 0.7. with preditor 's pdb - homology search turned on, the error rate is similar (3%) but the percentage of accepted predictions is 15% greater. likewise, for pdb - based predictions the error limits are generally several degrees smaller. note also that when pdb homologues are found the confidence scores vary with the local sequence identity of the pdb homologue (see preditor 's help page for more details). preditor uses a probabilistic hypersurface model (34) to estimate the confidence of 1 prediction from chemical shifts. as with the / torsion angles the confidence values for 1 angle predictions vary between 0.0 and 1.0, with 1.0 being the highest level. confidence levels of homology - based predictions of 1 have been derived empirically from the dependence of prediction accuracy on the level homologue sequence identity. confidence levels derived from pdb homologues are shown in web table 4 on preditor 's help page. when assignments for fewer than six nuclei (c, c, co, h, n and hn) are available, the predicted torsion angle error is multiplied by a scaling factor (see web table 5 on preditor 's help page). these scaling factors were determined for each of the 63 possible assignment combinations by measuring the average increase of preditor 's prediction errors for each of these combinations in the preditor database. preditor was optimized, tested and evaluated on a training set of 141 proteins (20 489 residues), for which complete or nearly complete h, c and n chemical shifts were known and for which high quality pdb structures were available (web table 6 on the preditor help page). to evaluate the performance of the algorithm for the training set, we used a leave - one - out procedure by removing a query protein from preditor database prior to running the algorithm. the accuracy of the predictions, (/), was determined using the following equation : 3(/)i=(|obspred|)+(|obspred|) where obs and obs are observed and pred and pred are predicted and angles, respectively. if the (/) value for residue i was < 30 (denoted as /) the prediction was considered correct. to estimate accuracy 1 angles, the observed and predicted 1 angles were grouped into trans, gauche+ and gauche these three categories. predictions are considered to be correct if both predicted and observed 1 angles belonged to the same rotamer group. the overall performance for (/) or 1 was determined by calculating percentage of correctly identified torsion angles from their total number in a given protein. the measurement of angle accuracy was based on a similar protocol and the performance of the program to predict and identify the 15 cis peptide bonds in the training set. the average / accuracy for the full version of preditor on this 141 protein training set was 90.3%. the average 1 accuracy was 83.8% (versus 64.4% for shift - only derived predictions), while the accuracy was 99.98% for trans peptide bond identification and 93% for cis peptide bond identification. to assess preditor 's relative performance against talos a subset of 31 of the 141 proteins were also analyzed by talos. the results of this comparison, both in terms of accuracy and computational speed are summarized in supplementary table a (see the supplementary data and). these data indicate that preditor is substantially faster (37) and 20.2% more accurate than talos. to test the program further and to ensure that the preditor algorithms had not been over - trained or become biased. an independent test set of 15 randomly chosen proteins (2665 residues) not found in either the talos or preditor training set was analyzed by both preditor and talos. as seen in table 1, preditor is 18% more accurate than talos for and predictions, when both pdb - derived and shift - based predictions are used. the average preditor run takes 37.5 cpu seconds while the average talos run is 1305 cpu seconds on the same 2.6 ghz processor. these results are essentially identical to the results seen in supplementary table a. in summary, preditor is a web server that is capable to rapidly obtain accurate estimates of,, 1 and torsion angles, including their error limits and confidence levels, using only chemical shift assignments or protein sequence as input data. comparisons suggest that these estimates are as good or better than what can be obtained using existing methods and that the approach used here is generally applicable to any protein for which h, c and n shift assignments are available. in addition to its speed and high level of performance preditor also offers other unique features including dihedral angle prediction via pdb structure mapping, automated chemical shift re - referencing (to improve accuracy), prediction of proline cis / trans states, automated generation of xplor, cyana, amber or cns torsion angle restraint output and a simple - to - use web - based user interface. because of its improved accuracy and extended capabilities, we believe preditor may lead to important changes in general nmr structure determination protocols, allowing more users to place tighter constraints and/or more weight on torsion angle restraint data. preditor supports bmrb, shifty and fasta formatted input files performance using the / score of the full version of preditor, a disabled version of preditor (shift - based predictions only) and talos for the test set of 15 randomly chosen proteins | every year between 500 and 1000 peptide and protein structures are determined by nmr and deposited into the protein data bank. however, the process of nmr structure determination continues to be a manually intensive and time - consuming task. one of the most tedious and error - prone aspects of this process involves the determination of torsion angle restraints including phi, psi, omega and chi angles. most methods require many days of additional experiments, painstaking measurements or complex calculations. here we wish to describe a web server, called preditor, which greatly accelerates and simplifies this task. preditor accepts sequence and/or chemical shift data as input and generates torsion angle predictions (with predicted errors) for phi, psi, omega and chi-1 angles. preditor combines sequence alignment methods with advanced chemical shift analysis techniques to generate its torsion angle predictions. the method is fast (< 40 s per protein) and accurate, with 88% of phi / psi predictions being within 30 of the correct values, 84% of chi-1 predictions being correct and 99.97% of omega angles being correct. preditor is 35 times faster and up to 20% more accurate than any existing method. preditor also provides accurate assessments of the torsion angle errors so that the torsion angle constraints can be readily fed into standard structure refinement programs, such as cns, xplor, amber and cyana. other unique features to preditor include dihedral angle prediction via pdb structure mapping, automated chemical shift re - referencing (to improve accuracy), prediction of proline cis / trans states and a simple user interface. the preditor website is located at :. |
they can have consequences for jobs, careers, and socioeconomic conditions at both the individual and family level, as well as having an important economic impact on productivity and health, and generating substantial health care and social insurance costs1,2,3. research findings show that work injuries cause earning losses4, 5, an increased use of social services, occupational disruptions1, 5, and financial difficulties5, amongst other effects. studies about the socioeconomic consequences of work injuries are rare, and are commonly affected by limited comparability, due to differences in health care systems and funding policies1, 5. however, knowledge about the economic or social impact of diseases or injuries is relevant to decision makers, particularly in developing or emerging countries where scarce resources need to be efficiently balanced across health care demands. unfortunately, data about occupational diseases and injuries are commonly of poor quality, have limited coverage and are largely underreported6. in 2007, in the us, a total of 8,564,619 non - fatal occupational injuries, which constitute the majority of all work - related health problems, were estimated following adjustment for under - reporting. non - fatal work injury costs were u$45.95 billion, an average on medical expenses of $ 5,3697. a large proportion of injuries did not cause any days away from work (88.1%) but 1,020,181 workers suffered temporary disability, corresponding to us$82.08 million of total costs, with an average of u$8,046 spent on medical care bills. insurance reimbursement covered only 25% of total costs7. furthermore, using us data for occupational injuries which occurred in industrial settings, lander. (2012)8 estimated an average hospital cost of us$32,254 per case (median us$18,364, 90th percentile us $ 66,607) but no costs per payer or cost components were reported. this system is composed of a public component, the unified health system, sus, which provides universal health care free of charge, and a private component partially funded by sus. the establishment of sus in the 1988 constitution came about as a result of the citizens rights movement that emerged in the form of political resistance during the military dictatorship. its current structure and funding are a result of this historical process, underlined by struggles and negotiations between the private health care industry and the social rights for all movement. the sus principles are the provision of universal health care coverage based on equitable access, which is free of charge and includes full coverage for all health needs, ranging from vaccines to organ transplants. nevertheless, it allows for private initiatives through health insurance or the direct payment of health care services. public funding accounts for approximately 40% of all costs, 3.14% of brazilian gdp, while private resources comprise 60% of total funding, or 4.84% of gdp9. given that only 25% of the population has private health insurance, public health spending is us$500.00 per capita per year, but the figure is twice as much for private health insurance schemes9. health insurance represents 21.7% of private costs and 34.5% of out - of - pocket expenses, mainly in the purchase of medicines10. data from the national household budget survey shows that average out - of - pocket family health care costs in 20082009 were us$80.5 per month, however, although they are crucial to treatment success, transport expenses were not recorded11. unlike the universal coverage of the public health care system, social insurance is based on compulsory contributions from workers and employers, estimated as a proportion of the firm s payroll. social insurance is therefore limited to formally registered workers who comprise over half of all the employed labor force in the country. social insurance covers a range of compensation benefits paid for sick or maternity leave, retirement, work injuries indemnity and others12. since 1999 the proportion of informal workers has fallen in brazil, and the number of formally hired workers has increased, either as wage workers or self - employed contributors13. however, one can safely assume that workers lack awareness about their rights to social insurance benefits, which limits their access to compensation benefits. data in brazil about the direct costs of work injuries is scarce and is limited to sus. disability or lost workdays are usually estimated through compensation benefits, restricted to insured workers and to the most severe cases, with 15 or more disability days. in 1998, the cost to sus of outpatient treatment for work injuries accounted for us$281,334.00, rising to us$386,220.00 in 2000, a 37.3% growth in only three years. hospital costs also increased from us$10,543,810.00 to us$10,732,205.00, during the same period, a 1.8% increment. the average admission cost was us$311.0014. with data from a community - based prospective study carried out between 2000 and 2006 in the city of salvador, bahia, brazil, santana. of these, 49.5% received medical treatment in emergency departments, hospitals and outpatient facilities ; the most common provider was sus (71.0%), while private health insurance was responsible for only 15.1% of these patients. no data was found for the social consequences of work injuries or related health care costs. in this study we intend to estimate the health care costs and consequences to workers lives of work injuries among users of public emergency care departments in a large urban area in brazil. this is a prospective longitudinal study carried out on all cases of work - related injuries identified in the emergency health care services of the two largest public hospitals in the city of salvador, the capital of the state of bahia, in northeast brazil. cases were recruited from june through september 2005, and visited by trained interviewers within the first week after hospital discharge. they were visited every month during the follow - up period, until recovery or treatment dropout. the city of salvador is the third largest city in brazil, and the most important metropolitan area in the northeast region. in 2011, there were 2,676,606 inhabitants, who were predominantly afro - descendants (83%) and poor (19.5% earn the minimal wage or less), and its human development index (hdi) was 0.805, ranking 467th out of 5,561 municipalities in the country15. following approval of the study protocol by hospital staff and internal review boards, the field work took place from june through september 2005. at the first stage we asked the reception and triage teams to collaborate in the identification and recruitment of study subjects on their arrival at the reception room. in order to select occupation - related injuries, each victim was asked about the circumstances of their trauma, as recommended by the international collaborative effort on injury statistics (ice)16 : what were you doing ?, how did it happen ?, where were you when it happened ? were you using any piece of equipment or tool ? and the question was added because brazilian legislation considers commuting injuries to be work - related. secondly, when patients were discharged, transferred for in ward treatment or were able to be interviewed, we invited them to participate in the study. we used a short questionnaire to collect data about personal information, including home address details, which are usually difficult to find in poor suburban areas, and advised them about the follow - up visits. when patients were not able to provide information, a family member was interviewed. the third phase consisted of monthly household visits to collect data about costs and treatment evolution. questionnaires were used to obtain socio - demographic, occupational and injury data, health and social insurance characteristics and coverage, and all direct costs related to treatment of the work injury. a total of three research instruments were used : a hospital spreadsheet, an in - hospital identification questionnaire and a follow - up questionnaire. the hospital spreadsheet was used to help identify the relationship between the causes of work injuries. victims or their companions answered questions in the emergency admission room or during clinical triage ; the in - hospital identification questionnaire was used to gather personal data, addresses, details about how to reach the household and current clinical conditions, while diagnosis was coded using the international statistical classification of diseases and related health problems, 10th revision (icd-10). data on the nature and extension of injuries per anatomical region were also recorded, in order to estimate a standardized severity score. during household visits following hospital discharge other information regarding socio - demographics, occupation, family, social and health insurance, health status, and costs related to treatment were recorded using specific questionnaires. because it is usually difficult to recall daily living expenses, a diary recording sheet was used to collect data. cost components were : transport ; the purchase of medicines or other wound treatment needs ; inpatient and outpatient care which involved physical therapy for rehabilitation ; clinical tests and imaging ; and others, comprised of special meals, equipment rental and maintenance of, for example, wheelchairs, crutches etc. each recorded expense was classified by main payer according to the worker s report. hospital costs were drawn from accountant management reports used to assess the monetary value of reimbursement under the sus financial system. work injuries were defined as cases of lesions from external causes, drowning and poisoning occurring in the workplace, while performing work - related tasks outdoors, in remote places, or when commuting to / from work, which corresponds to the brazilian legal definition. the relationship with work the descriptive variables were : sex ; age (analyzed in tertiles, 1427, 2837 and 3869 years of age) ; ethnicity (white, mixed race and black) ; education, coded as low (less than elementary education), medium (incomplete high school), and high (high school or more) ; monthly family income, analyzed in tertiles : low (less than us$250.00 per month), medium (us$250.00 us$417.00) and high (417.0010432.92730.013132.3monthly worker wage (us$) 141.009128.84853.313932.2141.00225.0010934.52527.813433.0 > 226.00 or more11636.71718.913333.8informal jobsno16552.25662.222254.7yes15147.83437.818445.3type of employment biscateiro (odd - job man)3511.177.84210.3self - employed8125.61213.39322.9wage / informal worker3511.11516.75012.3wage / formal worker16552.25662.222154.4tradeconstruction11636.733.311929.3services7122.54246.711327.8retail3410.81112.24511.1manufacturing309.511.1317.6domestic services30.92932.2327.9transport3611.4368.9other268.244.4307.4p 417.00 1,01141725081,0363.515monthly worker income (us$) in contrast, lost workdays among females fell with monthly family income and worker earnings, respectively. both males and females had an increased number of lost workdays when comparing formal to informal workers. the social consequences of work - related injury according to sexvariablesmalefemaletotaln=316%n=90%n=406%are you covered by social insurance (n=406)no13943.92628.916540.6yes, as a formal wage worker16451.95358.921753.5yes, as a public servant61.977.8133.2yes, as contributing self employed41.322.261.5yes, as a domestic worker22.220.5other30.930.7for eligible workers (n=217) intend to file a compensation claim6439.01324.57735.5do not know what is needed to file a compensation claim 12676.85196.217781.6the injury was notified to social insurance6036.61222.67233.2workers with 15 lost work days or more (20 males and 5 females)received a compensation benefit 1994.7240.02195.2earnings lost while unable to work (n=329)12950.83850.716750.8when returned to work (n=384)there were no job changes26588.97587.234088.5was dismissed (lost the job)144.778.1215.5changed occupation (same firm)93.033.5123.1other103.411.2112.9family consequencesa family relative is helping with health care3718.61820.44819.0difficulties with daily expenses (n=383)4615.5910.55514.4family members had to start work (n=383) 31.011.241.0need financial help from relatives41.4041.0other20.7020.5p 417.00 1,01141725081,0363.515monthly worker income (us$) in contrast, lost workdays among females fell with monthly family income and worker earnings, respectively. both males and females had an increased number of lost workdays when comparing formal to informal workers. this study shows that work injuries treated in public emergency care departments in a large city in brazil were mostly those of formal wage workers affected by mild / medium severity lesions. formal workers are legally insured and eligible for compensation benefits when unable to work, however our findings show that the majority of the study population was not aware of their rights or of how to obtain insurance benefits. only a few workers were compensated when disabled or had a injury notification filed at the national social insurance institute. for both men and women, approximately half of the cases suffered loss of earnings following the injury. however, women were more likely to be dismissed when they returned to work than men. the need for a family member to act as a caregiver and difficulties with family budgeting were the most frequently reported family consequences. costs for all 406 cases accounted for us$40,077.00, an average of us$98.00, but individual costs varied widely according to severity. in fact, mild / medium severity cases (n=317) outnumbered injuries classified as serious / critical (n=89), but costs were higher for the most severe cases (59.6%), with an average cost of us$269.00. costs for patient transport, hospital / outpatient care, and the purchase of medicines and miscellaneous items accounted for the majority of costs. the workers burden of costs related to occupational injuries was higher than for other payers. out - of - pocket costs surpassed the estimates of other payers, and was higher when injuries were more severe. most of the out - of - pocket costs were related to transport and the purchase of medicines and other wound care products. costs for inpatient / outpatient care and tests / imaging were mostly funded by sus, while private health plan costs were negligible. work injuries also caused economic losses, since we estimated 2,639 lost workdays, with males having more disability work time than females. work - related injuries are known for the great burden they represent worldwide, and their relevance for public health policies is well established, since they are mostly avoidable3, 5, 6. they cause suffering and disability, have an impact on health care costs, lead to economic losses, and affect the lives of workers and their families3, 5. compensation benefits when unable to work are an important social resource in reducing the social and economic impact of injuries on workers. however, the number of uninsured workers is scaling up globally, with the growth of the informal economy, and in the number of informal wage workers, unregistered self - employed workers and the unemployed19. although the proportion of informal jobs has been falling in brazil since 199914, in 2011, 43.2% of male and 45.6% of female workers were informal, and consequently uninsured20. surprisingly, our findings demonstrated that most eligible workers were not aware of their rights or how to obtain compensation benefits. this reflects the lack of information and poor education of workers related to rights such as social security, even when it concerns earnings. nevertheless, almost all injured male workers with a disability for 15 days or more received compensation benefits (19/20, 94.0%), while only two female cases granted benefits (40%) out of those five eligible to claim for it. problems related to social insurance management in brazil are well - known and include the complexity of the procedures involved in filing a compensation claim, long waiting times, an insufficient number of facilities, as well as other barriers21. these problems need to be addressed, with a particular focus on the self - employed or micro entrepreneurs, who, as a result of inclusive policies in brazil, have recently been included in the country s social insurance system. lack of awareness about compensation benefits signaled the need to enhance learning opportunities focusing on rights and access to social protection benefits for workers. our results demonstrate that a substantial proportion of both men and women suffered loss of earnings following injury, as a consequence of a disability that affected their work, or because employers did not want to take responsibility during the post injury period, which is more likely to occur in the case of unprotected informal workers. it is also noticeable that women were more likely to lose jobs after work injury than men, which probably reflects the more fragile labor protection mechanisms available for women in vulnerable situations and demonstrates gender - related inequality. we did not observe meaningful differences between men and women in the impact of work injuries on the family. however, it is noticeable that relatives had to become caregivers, which obviously implies lost earnings that affect the household budget. this impact may be more significant for informal workers who have no access to compensation benefits. as well as the impact of work injury on earnings or job losses, worker burden from work injuries involves direct costs. although sus is responsible for universal health care in brazil, some related health costs are not covered, such as patient transport for follow - up visits, equipment rental etc. although out - of - pocket costs are expected, we did not anticipate that they would be the major source of expenditure that we observed, demonstrating a higher proportion of the total costs when injuries were more severe. while surprising, this is consistent with data from the 20082009 national household budget survey in brazil, in which 16.0% of the family budget were spent on transport and 5.9% on health care, which is equal to the amount spend on food21. transport for people with a limited ability to walk, for instance, is difficult to manage given the poor public transport system in brazil, the fact that taxis are usually expensive and that rehabilitation commonly requires several regular patient visits over long periods of time. the use of taxis is unaffordable for poor workers, who are more likely to live in neighborhoods in peripheral urban areas commonly some distance from health care facilities. other relevant out - of - pocket costs were associated to the purchase of medicines and other miscellaneous items used for the treatment of wounds at home. these costs may increase with treatment duration, particularly for outpatient care and rehabilitation, which lasts longer in the most severe cases22. the heavy burden of medicine is recognized by the government as an important cause of non - compliance and treatment dropout, leading to the adoption of a national medicine policy to enhance access to medicines within sus. amongst other activities, this program is based on the increased production of low - cost generic pharmaceutical drugs, and free - of - charge medicines used for the treatment of chronic diseases, thus contributing to an alleviation of the health care burden on poor families. the implementation of primary health care based on family health strategies accounts for over 32 thousand health teams, with an estimated coverage of 80% of the entire population23, and is a relevant opportunity for the provision of health care to all workers. the low participation of private health care is worth noting, given that most formal workers are covered by private health insurance paid by employers. although costs for private health insurance premiums were not available, the remaining contribution of entrepreneurs to direct costs for work injuries was low. there were a considerable number of lost workdays resulting from disability caused by work injuries, which could affect the productivity of firms or worker earnings, particularly when these were self - employed or have informal jobs. in sum, direct costs impact more heavily on workers and their families, and on the government, which is the main source of funding for hospital and outpatient care for the poor. we need to treat the conclusions of this study cautiously, due to a number of methodological limitations. follow - up studies are costly, time consuming, and involve complex logistics when carried out in poor brazilian areas where violence is common. recruitment of injured workers in emergency rooms is challenging, because of the suffering involved, and the balance required, on ethical grounds, in dealing with patients, medical staff, and researcher needs. patients were receptive to follow - up visits but problems with cost recall may have affected the accuracy of their records. the study population was small and some planned analysis was not feasible. despite these limitations, the study sheds light on a rarely addressed issue, the socioeconomic burden on poor workers and their families of the direct costs arising from work injuries. the longitudinal design ensured more accurate data by reducing recall bias, as did the use of diary recording sheets to obtain data related to health care costs. in addition, we used hospital accounting reports to estimate costs for inpatient and outpatient treatment based on government reimbursement logs. this study contributes in part to the knowledge required to prioritize work - injuries in the health policies of developing or emerging countries, where they are largely under - reported, giving rise to underestimated mortality or morbidity data3, 6. work - related injuries may be devastating to poor families because of the consequent socio economic burden. such injuries are rarely the focus of prevention programs, particularly given that resources for health care are insufficient to both need and demand. we also demonstrated the burden of the direct costs of work injury care on workers, their families and the government, as well as the need for greater employer involvement in supporting workers and families. informal workers are a special case, and strategies to provide full coverage for occupational health services, including surveillance and primary prevention initiatives, need to be implemented in order to achieve a more equitable society and healthier and safer work environments. | work injuries are a worldwide public health problem but little is known about their socioeconomic impact. this prospective longitudinal study estimates the direct health care costs and socioeconomic consequences of work injuries for 406 workers identified in the emergency departments of the two largest public hospitals in salvador, brazil, from june through september 2005. after hospital discharge workers were followed up monthly until their return to work. most insured workers were unaware of their rights or of how to obtain insurance benefits (81.6%). approximately half the cases suffered loss of earnings, and women were more frequently dismissed than men. the most frequently reported family consequences were : need for a family member to act as a caregiver and difficulties with daily expenses. total costs were us$40,077.00 but individual costs varied widely, according to injury severity. out - of - pocket costs accounted for the highest proportion of total costs (50.5%) and increased with severity (57.6%). most out - of - pocket costs were related to transport and purchasing medicines and other wound care products. the second largest contribution (40.6%) came from the public national health system sus. employer participation was negligible. health care funding must be discussed to alleviate the economic burden of work injuries on workers. |
established in september 2010, the oxford discovery cohort (http://opdc.medsci.ox.ac.uk) comprises patients with idiopathic pd diagnosed in the previous 3.5 years according to uk pd society brain bank diagnostic criteria27 who were recruited from a 2.9 million population. pd patients were prospectively recruited over 2 years after ethics committee approval and verbal / written consent from participants. patients underwent standardized assessment by a movement disorders neurologist / research nurse ; then, the patients were diagnosed pd, and an estimated clinical probability for this diagnosis was made by the neurologist. atypical parkinsonian features were screened using the national institute of neurological disorders and stroke parkinson s tool (ninds, bethesda, md, usa). patients were excluded from subsequent analysis if they had a 10 years. our results, by contrast, suggest that the moca may be more sensitive than the mmse in detecting longitudinal changes and at baseline, in keeping with other studies.6,20,21,23 furthermore, only one mmse domain showed deterioration compared with three moca domains. our finding that the semantic domain rather than the phonemic fluency domain may be more sensitive to disease progression is consistent with another investigation that reported similar associations.15 we observed that 25.8% of patients deteriorated across the moca classification boundaries, whereas 13.5% improved over 18 months. by comparison, 23.9% deteriorated but 25.2% improved using mmse thresholds, suggesting a greater degree of misclassification with the mmse than with the moca. in particular, no patients shifted from normal cognition to dementia according to the moca, whereas 11 patients had a similar shift according to the mmse, suggesting either very rapid deterioration or that the mci range for mmse may be too narrow to capture the transitional phase. the improvement in cognition seen with both instruments may represent a combination of regression to the mean and/or learning effects observed with repeated cognitive testing or changes in performance due improvement in mood. the apparent contradictory findings between this study and a previous longitudinal study26 may reflect population differences, because patients in the latter study had longer disease duration than our cohort (mean sd, 6.7 5.4 years vs. 1.5 1.0 years), raising the possibility that the moca may track cognitive decline better in early pd, whereas the mmse may be better for tracking patients with longer disease duration although the moca appeared to be more sensitive to change, it is possible that was is due to a greater proportion of false - positives, and only further follow - up of this cohort, which is planned, will confirm or refute this hypothesis. consistent with previous studies,46 patients with who screened in the dementia range scored worse on activities of daily living (adl) scales. we observed a stronger correlation between the s&e scale and updrs / hoehn and yahr staging, suggesting that motor function has a bigger impact on adl than cognition. only modest (albeit significant) reductions were found in the s&e scale when patients with pd in the demented range were compared with those in the non - demented / mci range, suggesting that an arbitrary cutoff in this adl scale may not be helpful in distinguishing demented from non - demented patients with pd. moca total scores correlated with the purdue pegboard total score, the timed up and go test score, educational years, age, the sniffin sticks odour identification test score, male gender, and anxiety (table3). the purdue pegboard assembly has excellent test - retest reliability,47 and patients with mci and early alzheimer s disease perform worse on such fine motor tasks, indicating that higher level hand motor impairment is an important aspect of elderly cognitive decline48,49 and may also be a sensitive marker of early pd cognitive impairment. consistent with previous studies,50 worsening motoric parkinsonism predicted impaired cognition in our cohort, although only a slower timed up and go test was a significant predictor in our final model, possibly because it is a more objective marker of gait difficulty. dementia is a known significant predictor of falls in pd,51,52 and pd fallers have reduced thalamic cholinergic innervation compared with non - fallers.53 hyposmia is common in pd5456 and predicts cognitive decline in elderly57 patients with pd and alzheimer s disease,5860 because it is linked to cholinergic impairment.61,62 because they are associated with cortical cholinergic denervation,6367 depression and anxiety increase the risk of dementia. the correlation between cognitive impairment and motor / non - motor indices in our study may reflect a generalized effect of central cholinergic denervation characterizing prodromal pdd ; however, a variety of other neural pathways may also be involved. the findings that reduced educational years, older age, and male gender predict impaired cognition are consistent with previous studies.6871 a limitation of our study is that we examined patients using cognitive screening instruments and did not have a gold standard clinical diagnosis or a detailed neuropsychological assessment. therefore, it is possible that the moca overestimates mci and dementia rather than the mmse under - diagnosing them. we suspect this alternative explanation is unlikely because, if anything, the larger reverse classification observed with the mmse due to improved scores suggests that it is less specific. however, further follow - up of this cohort is necessary to validate the predictive value of these instruments against a clinical diagnosis. the role of longitudinal testing for level 1 and level 2 diagnostic criteria for pd - mci and pdd will require future review. our results are not intended to reflect detailed cognitive subdomains, and further studies comparing the mmse / moca with detailed neuropsychology in the same patients are needed to better delineate the cognitive substrate of pd - mci. early detection of cognitive decline, we believe, will be an important strategy for understanding phenotypic heterogeneity and targeting therapies. | the impact of parkinson s disease (pd) dementia is substantial and has major functional and socioeconomic consequences. early prediction of future cognitive impairment would help target future interventions. the montreal cognitive assessment (moca), the mini - mental state examination (mmse), and fluency tests were administered to 486 patients with pd within 3.5 years of diagnosis, and the results were compared with those from 141 controls correcting for age, sex, and educational years. eighteen - month longitudinal assessments were performed in 155 patients with pd. the proportion of patients classified with normal cognition, mild cognitive impairment (mci), and dementia varied considerably, depending on the moca and mmse thresholds used. with the moca total score at screening threshold, 47.7%, 40.5%, and 11.7% of patients with pd were classified with normal cognition, mci, and dementia, respectively ; by comparison, 78.7% and 21.3% of controls had normal cognition and mci, respectively. cognitive impairment was predicted by lower education, increased age, male sex, and quantitative motor and non - motor (smell, depression, and anxiety) measures. longitudinal data from 155 patients with pd over 18 months showed significant reductions in moca scores, but not in mmse scores, with 21.3% of patients moving from normal cognition to mci and 4.5% moving from mci to dementia, although 13.5% moved from mci to normal ; however, none of the patients with dementia changed their classification. the moca may be more sensitive than the mmse in detecting early baseline and longitudinal cognitive impairment in pd, because it identified 25.8% of those who experienced significant cognitive decline over 18 months. cognitive decline was associated with worse motor and non - motor features, suggesting that this reflects a faster progressive phenotype. |
prostate cancer is diagnosed through prostate needle biopsy when there is an abnormal finding in screening tests such as prostate - specific antigen (psa), digital rectal examination (dre), or transrectal ultrasonography (trus). if the patient shows a consistently abnormal finding in the above screening tests during follow - up observation, even when prostate cancer is not diagnosed at the first needle biopsy, prostate biopsy should be performed again to check for the presence of prostate cancer. however, it is not easy to perform a second biopsy, because of low awareness of the patients, pain associated with the biopsy, and complications such as proctorrhagia, hematochezia, hematuria, acute urinary retention, septicemia, and vasovagal reflex. accordingly, psa velocity (psav) and free - to - total psa ratio have been used as useful predictive factors to reduce the unnecessary prostate biopsy retrials up to now, but there is as yet no clear and definite predictive factor. in the present study, therefore, we aimed to identify the relationship between psa change and the prostate cancer diagnosis rate in patients who had a psa value higher than 4 ng / ml and underwent a second prostate biopsy at this hospital. for the analysis, the patients were classified according to psa change as psa increase, no change, and psa decrease (but still above the normal range). from july 2006 to february 2012, prostate biopsy was performed on 843 patients whose blood psa was elevated over 4 ng / ml. regardless of psa level, patients who underwent biopsy in whom nodularity or asymmetry was shown in the dre or in whom hypoechoic lesions were detected on trus were excluded. among the patients who underwent prostate biopsy, 225 patients (26.7%) were diagnosed as having prostate cancer. out of 618 patients whose prostate biopsy result was reported to be negative, 469 patients had a psa test between 6 and 9 months after the first biopsy, and 289 patients had a blood psa value less than 4 ng / ml. in 186 patients, the blood psa level was still elevated to over 4 ng / ml, and among these patients, 164 underwent a second prostate biopsy. excluding the patients who took 5-alpha - reductase inhibitor agents after the first biopsy (101 patients) or in whom prostatitis was diagnosed from the biopsy (21 patients), 42 patients were selected as the subjects of this study. they were classified as having psa increase, no change in psa, or psa decrease but still over the normal range. psa change was calculated by comparing the psa value before the first biopsy with that before the second biopsy measured between 6 and 9 months after the first biopsy. a change of less than 10% was ignored and was defined as no change, an increase of over 10% was regarded as psa increase, and a decrease of more than 10% was regarded as psa decrease. to measure blood psa, the clia (chemiluminescence immunoassay, abbott laboratories, abbott park, il, usa) method was used. prostate biopsy was executed by using an 18-gauge needle under transrectal ultrasound guidance, and for both biopsy trials a 12-core biopsy was performed. for the statistical analysis, independent t - test and analysis of variance were performed. results were judged statistically significant if the p - value was less than 0.05. for the statistics, spss ver. the mean age of the patients who underwent a second prostate biopsy was 65.2 years, and their mean prostate volume was 72.5 g. the prostate cancer detection rate in the second biopsy was 11.9%. there was a meaningful difference in mean age, prostate volume, and psa density (psad) between the prostate cancer group and the noncancer group (table 1). the prostate cancer detection rate in the psa increase group was 20%, that in the no change group was 8.3%, and that in the psa decrease group was 0% (table 2). there were no significant differences between groups in average age, prostate volume, mean psa before the first biopsy (psa1), mean psa before the second biopsy (psa2), or mean psad (table 3). up to now, psa level, dre, and trus have been used as screening tests for prostate cancer. when the psa level is over 4 ng / ml, the dre shows prostate nodules or asymmetry, or trus detects hypoechoic lesions in the peripheral zone, prostate cancer can be clinically present and trus - guided needle biopsy should be performed to diagnose prostate cancer. it is known that a second prostate biopsy must be done if the blood psa level shows a constant increase, if there are continuously abnormal findings in the dre or trus, if there is high - grade prostatic intraepithelial neoplasia or atypical cells in the first prostate biopsy, or if the patient has a prostate cancer family history, even if the result of the first prostate biopsy is negative. in these cases, a prostate cancer detection rate of 10 to 31% has been reported, and although some differences were noted by reporters, the necessity of the second prostate biopsy was strongly supported. according to durkan and greene, 15 of 48 patients (31%) who showed a consistently abnormal psa level after a negative finding on the first biopsy were diagnosed as having prostate cancer in the second prostate biopsy. according to okada., 36% of patients who were not diagnosed as having prostate cancer at the first prostate biopsy were diagnosed as having prostate cancer when the second biopsy was performed at a 2-year interval. in korea, according to park., 25 of 243 prostate cancer patients (10.3%) were diagnosed as having prostate cancer in the second or third biopsy after a negative result on the first biopsy. the detection rate in the patients whose psa was in the gray zone before the second biopsy was 13.1%, which is consistent with the results of this study (15.15%). although psa is an important serum tumor marker for diagnosing prostate cancer with dre, it has limitations in clinical usefulness, showing 79% sensitivity and 59% specificity. to compensate for the limitations of psa, psad and psav psad is the corrective value of the prostate volume, and its clinical usefulness is being studied in differentiating benign prostatic hyperplasia (bph) and prostate cancer. bazinet. diagnosed prostate cancer in 23 patients out of 42 who did not have prostate cancer - suspicious results on the dre or trus but in whom the psa level was 4 to 10 ng / ml. the overall prostate cancer diagnosis rate was 16%. they reported that it would be ideal to perform prostate biopsy when the psad is over 0.15 ng / ml / cc. on the other hand, littrup. proposed that prostate biopsy be performed when the psad is over 0.12 ng / ml / cc. in this study, the mean psad of the prostate cancer group was 0.206, whereas the mean psad of the normal group was 0.107, which is consistent with the aforementioned study results with a statistically significant difference. contrarily, hayek. addressed that the volume of the prostate measured by trus could vary by the inspector and that psad would not have statistical meaning as a prostate cancer predictive factor in the second biopsy group. psav is the annual speed of increase of the serum psa level, and stamey. reported that psav could be used for the differential diagnosis of the two because bph showed a psav of 0.3 ng / ml / yr, whereas prostate cancer showed a psav of 3.5 ng / ml / yr. according to carter., serum psa increased significantly according to time from 5 years before prostate cancer diagnosis when compared with healthy people. they reported that the specificity of a cutoff value of 0.75 ng / ml / yr was over 90% when the psa was in the gray zone and less than 4. the sensitivity of a cutoff value of 0.75 ng / ml / yr was reported to be 79% when psa was in the gray zone and 11% when psa was less than 4.. addressed that psav would be a very useful index in prostate cancer early diagnosis because it could the improve prostate cancer detection rate if psav were considered additionally at the time of biopsy in patients with a psa of less than 4 ng / ml who showed abnormal findings in dre, and positive predictive value could be improved even in cases with psa of 4 to 6 ng / ml. we could not confirm their proposal in the present study because we did not measure psav and classified the patients according to the increase or decrease in psa over a period of 6 to 9 months, which was relatively shorter than 1 year. there are reports regarding the relationship between serum psa change and prostate cancer diagnosis as analyzed by the difference between psa in the first biopsy and that in the second biopsy. durkan and greene reported that prostate cancer patients showed significantly higher serum psa in the second biopsy (24.7 ng / ml) than in the first biopsy (18.9 ng / ml). in this study, we found that the prostate cancer detection rate was 20.0% in the psa increase group and was higher than in the plateau group (8.3%) and psa decrease group (0%), which is consistent with other studies. transrectal prostate biopsy, a diagnosis method of prostate cancer, may cause pain in 65 to 90% of patients, and thus patients may be hesitant to undergo a repeat biopsy by this method. the pain in prostate biopsy occurs when the biopsy needle is injected to the prostatic capsule or when the ultrasound probe is inserted. at present, to reduce the pain associated with biopsy, 1% lidocaine or endorectal topical anesthetic jell injection are administered before prostate biopsy periprostatic nerve block. other methods are also used, such as nonsteroidal anti - inflammatory drug injection, intravenous anesthesia using propofol, and general anesthesia using inhalation anesthetics such as n2o. in the hospital of this study, acetaminophen 650 mg is given in the form of oral administration and endorectal anesthetic is injected to adjust for pain after the intravenous injection of tramadol, which gives satisfactory results. the other important point in repetitive trials of prostate biopsy is a psa cutoff value. generally, 4.0 ng / ml has been accepted as the psa cutoff value. in this study, prostate biopsy was performed with the normal value of psa, which is 4. however, according to schmid. in 2004, the prostate cancer detection rate according to psa range was 10 to 20% for psa of 2.5 to 4.0 ng / ml, 25% for psa of 4 to 10 ng / ml, and 50 to 60% for psa over 10.0 ng / ml. therefore, some have suggested reducing the psa cutoff value to 2.5 ng / ml for the early detection of prostate cancer that can be completely cured, because 20% of prostate cancer patients have a psa value in the range of 2.6 to 4.0 ng / ml. on the other hand, others assert that reducing the psa cutoff value will cause unnecessary prostate biopsies and increase the number of clinically meaningless prostate cancer cases. in korea, cho. reported in 2008 that the number of patients undergoing prostate biopsy would increase 1.75 times and 2.49 times, respectively, if the psa cutoff value were reduced from 4.0 ng / ml to 3.0 ng / ml and 2.5 ng / ml. some propose that the decision should be made carefully because of the additional financial expenses. additionally, it is not clear whether psa screening test and psa cutoff value adjustment would decrease the mortality rate of prostate cancer. psa age - specific reference values are one method for increasing the specificity of prostate cancer screening test diagnosis. according to oesterling., there was significant correlation between age and psa in 3 years ' psa follow - up observation of 537 patients aged 40 to 79 years whose psa increased 3.2% (0.04 ng / ml per year) every year. they proposed reference values of 0.0 to 2.5 ng / ml for ages 40 to 49, 0.0 to 3.5 ng / ml for ages 50 to 59, 0.0 to 4.5 ng / ml for ages 60 to 69, and 0.0 to 6.5 ng / ml for ages 70 to 79. they proposed that the rate of diagnosis of curable prostate cancer could be improved among the younger population by improving the sensitivity and that unnecessary prostate biopsy could be removed in the older population by improving the specificity. however, because there are reports showing that age - specific reference values differ by race, and that the clinical usefulness of age - specific references has been reported with different efficiency, there is as yet no accepted standard. in korea, jeon. reported the psa reference by age based on the psa value in 120,439 domestic males in their 30s to 70s. according to jeon., the psa reference value for korean males is 1.88 ng / ml for men in their 30s, 1.92 ng / ml for men in their 40s, 2.37 ng / ml for men in their 50s, 3.56 ng / ml for men in their 60s, and 5.19 ng / ml for men in their 70s. in the hospital of the study, prostate biopsy was performed if the psa level was over 3.0 ng / ml in the population younger than 60 years of age considering the age - specific reference value. in this study, the prostate cancer detection rate in the psa increase group was 20%, that in the no change group was 8.3%, and that in the psa decrease group (psa decreased but was still higher than the normal rage) was 0%. there were no significant differences in average age, prostate volume, mean psa before the first biopsy, mean psa before the second biopsy, or mean psad among the groups. however, in the comparison between the cancer group and the noncancer group, it was found that those who were older, had smaller prostate volume, and had higher psad were more likely to have prostate cancer. therefore, if psa does not show a change or increases, if the patient 's age is comparatively higher, or if the patient 's prostate volume is comparatively lower or the psad is higher, repeat biopsy is strongly recommended. however, this study included a very small population of subject ; accordingly, large - scale follow - up study should be performed in the future. | purposeto identify the prostate cancer detection rate on the patients who had second prostate biopsy out of the patients who were reported negative in their first biopsy.materials and methodsfrom july 2006 to february 2012, prostate biopsy was performed on 843 patients with over 4 ng / ml and on 618 biopsy negative patients psa was performed from between 6 months and 9 months after biopsy. on 164 patients, second biopsy was performed, and 42 patients were selected. if there was less than 10% change between psa before the prostate biopsy and psa measured during 6 to 9 months after the first biopsy it was considered as no change. if above 10% increase, it was considered increase and if above 10% decrease it was considered as decrease.resultsthe cancer detection rate in psa increase group was 20%, the detection rate in no change in psa level but still over the normal range group 8.3%, and that in the psa decrease group was 0%. when comparing prostate cancer group and non - cancer group, it is more probable to have prostate cancer when they are older, prostate volume is smaller and psa density is higher.conclusionsthe second biopsy is strongly recommended when psa level shows no change or increase, age is older, prostate volume is smaller or psa density is higher. |
through july 10, 2007, we investigated 52 outbreaks caused by hpai virus (h5n1) and 3 outbreaks caused by low - pathogenicity avian influenza (lpai) virus (h9n2) in chickens in bangladesh. after a high number of chicken deaths on a farm was reported to an upazila (a lower administrative unit of bangladesh) veterinarian, the sick chickens on the farm were examined. from each of 55 outbreaks, 2 dead chickens were sent to a field disease investigation laboratory or to the central disease investigation laboratory, where oropharyngeal swabs were tested for avian influenza a virus antigen. from cases with positive results, tracheal samples were referred to the national reference laboratory for avian influenza (nrl - ai) for viral rna extraction and purification (3), reverse transcription pcr that used a primer set of hemagglutinin (h) genes (4), and end - product visualization. when nrl - ai confirmed h5, the farm was considered hpai affected and was reported to the department of livestock services. tracheal samples from chickens involved in 37 outbreaks, including those that were a - antigen positive but h5 negative, were sent to the veterinary laboratory agency in the united kingdom for confirmation. all farms affected with hpai or lpai virus were called avian influenza affected farms. a district or upazila with at least 1 avian influenza affected farm was considered an infected district or infected upazila. to collect information about the farms the form had space where veterinarians could add additional comments on the probable virus sources for infections by backward tracing (window 21 days before clinical onset of hpai. on may 22, 2008, the directorate general of heath services, bangladesh, declared that a sample collected from a child in january 2008 was diagnosed by the us centers for disease control and prevention as positive for influenza virus (h5n1). before this time, no human infection with influenza virus (h5n1) had been reported in bangladesh. lack of human cases may have resulted from early immunologic response (6,7), genetic variation in receptors (810), poor surveillance of disease in humans, or using antiviral drugs during culling of birds. our investigation showed that the epicenter of the hpai outbreaks in bangladesh was the sarishabari upazila of jamalpur district and that the primary source of infection was backyard chickens. phylogenetic analysis on 1 influenza virus (h5n1) isolate showed that it belongs to the subclade 2.2 of the qinghai lineage (11), most closely related to viruses isolated from afghanistan, mongolia, and russia (11). the presence of influenza virus subtype h9n2 in chickens on 3 farms, however, raises the question of when this virus was introduced to bangladesh. an earlier introduction or emergence of lpai virus (h9n2) in backyard chickens can not be ruled out because 18% of backyard chickens tested during 20002003 were seropositive for avian influenza virus (15). | to determine the epidemiology of outbreaks of avian influenza a virus (subtypes h5n1, h9n2) in chickens in bangladesh, we conducted surveys and examined virus isolates. the outbreak began in backyard chickens. probable sources of infection included egg trays and vehicles from local live bird markets and larger live bird markets. |
we used data from the danish cohort of the eyhs, an international, population - based, multicenter study that addresses cardiovascular disease risk factors in children and adolescents. a detailed description of the eyhs has been published elsewhere (9). in this study, a random sample of 658 15-year - olds was invited to participate in 19971998, of whom 429 (65%) agreed to take part in the study. isometric muscle strength was assessed in a subgroup of 243 participants in 19971998. in 20032004, another random sample of 771 15-year - olds was invited, of whom 444 (58%) agreed to take part, and 441 of these participants had isometric muscle strength evaluated. in 20092010, a 6- or 12-year follow - up was conducted in which all originally invited participants from the 19971998 and 20032004 studies were reinvited. in this study, the local scientific ethics committee approved the study, and all participants gave informed consent to participate. we obtained isometric muscle strength during maximal voluntary contraction of abdominal and back muscles using a strain - gauge dynamometer (10). the participants were standing upright and positioned with a strap around the shoulders connected to the dynamometer. abdominal maximal voluntary contraction was performed with the back against the dynamometer performing maximal forward flexion. for maximal voluntary contraction of the low back muscles, the participants were positioned with the front against the dynamometer, performing maximal backward extension. isometric muscle strength was expressed as the mean of abdominal and back strength relative to body weight. high reliability of these particular isometric strength measures (intraclass correlation coefficient > 0.9) has been reported in a previous study among danish adults (11). crf was assessed during a progressive maximal ergometer bicycle test (ergomedic 839 ; monark, varberg, sweden) as previously described (9). during the test, heart rate was recorded every 5 s using a heart rate monitor (polar vantage). criteria for maximal effort were heart rate of 185 bpm and a subjective judgment by the observer that the participant could no longer continue, even after encouragement. maximal power output (wattmax) was used to estimate maximal oxygen uptake using the following equation : vo2max (ml) = 0.465 + (0.0112wattmax) + (0.172sex), where sex represents boys = 1 and girls = 0 (12). furthermore, a validation study among 15-year - olds has shown that this measure is highly correlated with vo2max assessed directly (r > 0.90 ; p 2,000 counts / min (equivalent to walking 4 km / h) was defined as mvpa and expressed as percentage of total registered time. weight - bearing activity such as resistance exercise is grossly underestimated when using accelerometry - measured activity. a fasting blood sample (overnight) samples were aliquoted and separated within 30 min and then stored at 80c until they were transported to world health organization certified laboratories in bristol (u.k.) for analysis of baseline samples and cambridge (u.k.) for analysis of follow - up samples. glucose was analyzed using the hexokinase method (olympus au600 autoanalyzer ; olympus diagnostica, hamburg, germany) at baseline and on a dade behring dimension rxl autonalyzer (siemens healthcare, camberley, u.k.) at follow - up. insulin was analyzed using enzyme immunoassay (microtiter plate format, dako diagnostics [at baseline ] ; 1235 autodelfia automatic immunoassay [at follow - up ]). between - laboratory correlations for glucose and insulin for 30 randomly selected samples analyzed at both laboratories were 0.940.98 at baseline (16). the homeostasis model assessment of insulin resistance (homa - ir ; fasting glucose [mmol / l ] insulin [u / ml ] / 22.5) and homeostasis model assessment of -cell function (homa - b ; insulin [u / ml ] 20 / glucose [mmol / l ] 3.5) were used to quantify the level of insulin resistance and secretion (17). both these measures have been validated as indices of insulin resistance and pancreatic -cell function in healthy adolescents (18). we analyzed the associations of isometric muscle strength and crf in adolescence with fasting glucose, insulin, homa - ir, and homa - b in young adulthood using multiple linear regression analyses with baseline levels of respective variables included as a covariate. in basic models, age in adolescence, age in young adulthood, sex, and recruitment period were adjusted for. values of insulin, homa - ir, and homa - b were natural log transformed. thus, regression coefficients from these models were exponentiated to give ratios of geometric means (expressed in percent) per sd difference in isometric muscle strength and crf. in multivariable analyses, we additionally adjusted for parental educational level, current smoking, family history of diabetes, frequency of intake of soft drinks, and intake of fruit and vegetables. muscle strength and crf in youth also were included in the same model to examine their independent influence on glucose, insulin, homa - ir, and homa - b in young adulthood. we then analyzed the association of muscle strength with the odds of insulin resistance, defined as homa - ir value > 75th percentile in young adulthood (19), using multiple logistic regression adjusting for the same covariates as in the linear models including homa - ir at baseline. finally, we assessed the joint association of muscle strength and crf by constructing a joint variable of tertiles of muscle strength and crf, respectively, and associated that with the outcomes in multivariable models. because no sex - dependent or recruitment period dependent associations for any outcomes were observed, we present all analyses for men, women, and recruitment period (follow - up time) combined, but with appropriate statistical adjustment. standard linear regression diagnostics were performed, including examining linearity and normality of residuals. in sensitivity analyses, we imputed missing information for covariates and outcomes (n = 12 to n = 556, depending on variable) among the total sampled population at baseline (n = 873) using chained equations (mi impute chained in stata) (20). all covariates and respective outcomes were included in the imputation approach. we also performed an analysis additionally adjusting for accelerometry - measured mvpa to examine if any residual confounding by mvpa remained that crf may not have captured. because 35% of the participants with otherwise full data had missing information regarding accelerometer - measured mvpa, we imputed missing values for mvpa using a multiple linear regression imputation approach including all covariates and the outcome. all statistical analyses were performed in stata 12.1 with = 0.05 (two - sided). we used data from the danish cohort of the eyhs, an international, population - based, multicenter study that addresses cardiovascular disease risk factors in children and adolescents. a detailed description of the eyhs has been published elsewhere (9). in this study, a random sample of 658 15-year - olds was invited to participate in 19971998, of whom 429 (65%) agreed to take part in the study. isometric muscle strength was assessed in a subgroup of 243 participants in 19971998. in 20032004, another random sample of 771 15-year - olds was invited, of whom 444 (58%) agreed to take part, and 441 of these participants had isometric muscle strength evaluated. in 20092010, a 6- or 12-year follow - up was conducted in which all originally invited participants from the 19971998 and 20032004 studies were reinvited. in this study, the local scientific ethics committee approved the study, and all participants gave informed consent to participate. we obtained isometric muscle strength during maximal voluntary contraction of abdominal and back muscles using a strain - gauge dynamometer (10). the participants were standing upright and positioned with a strap around the shoulders connected to the dynamometer. abdominal maximal voluntary contraction was performed with the back against the dynamometer performing maximal forward flexion. for maximal voluntary contraction of the low back muscles, the participants were positioned with the front against the dynamometer, performing maximal backward extension. isometric muscle strength was expressed as the mean of abdominal and back strength relative to body weight. high reliability of these particular isometric strength measures (intraclass correlation coefficient > 0.9) has been reported in a previous study among danish adults (11). crf was assessed during a progressive maximal ergometer bicycle test (ergomedic 839 ; monark, varberg, sweden) as previously described (9). during the test, heart rate was recorded every 5 s using a heart rate monitor (polar vantage). criteria for maximal effort were heart rate of 185 bpm and a subjective judgment by the observer that the participant could no longer continue, even after encouragement. maximal power output (wattmax) was used to estimate maximal oxygen uptake using the following equation : vo2max (ml) = 0.465 + (0.0112wattmax) + (0.172sex), where sex represents boys = 1 and girls = 0 (12). furthermore, a validation study among 15-year - olds has shown that this measure is highly correlated with vo2max assessed directly (r > 0.90 ; p 2,000 counts / min (equivalent to walking 4 km / h) was defined as mvpa and expressed as percentage of total registered time. weight - bearing activity such as resistance exercise is grossly underestimated when using accelerometry - measured activity. a fasting blood sample (overnight) was taken in the morning from the antecubital vein. samples were aliquoted and separated within 30 min and then stored at 80c until they were transported to world health organization certified laboratories in bristol (u.k.) for analysis of baseline samples and cambridge (u.k.) for analysis of follow - up samples. glucose was analyzed using the hexokinase method (olympus au600 autoanalyzer ; olympus diagnostica, hamburg, germany) at baseline and on a dade behring dimension rxl autonalyzer (siemens healthcare, camberley, u.k.) at follow - up. insulin was analyzed using enzyme immunoassay (microtiter plate format, dako diagnostics [at baseline ] ; 1235 autodelfia automatic immunoassay [at follow - up ]). between - laboratory correlations for glucose and insulin for 30 randomly selected samples analyzed at both laboratories were 0.940.98 at baseline (16). the homeostasis model assessment of insulin resistance (homa - ir ; fasting glucose [mmol / l ] insulin [u / ml ] / 22.5) and homeostasis model assessment of -cell function (homa - b ; insulin [u / ml ] 20 / glucose [mmol / l ] 3.5) were used to quantify the level of insulin resistance and secretion (17). both these measures have been validated as indices of insulin resistance and pancreatic -cell function in healthy adolescents (18). we analyzed the associations of isometric muscle strength and crf in adolescence with fasting glucose, insulin, homa - ir, and homa - b in young adulthood using multiple linear regression analyses with baseline levels of respective variables included as a covariate. in basic models, age in adolescence, age in young adulthood, sex, and recruitment period were adjusted for. values of insulin, homa - ir, and homa - b were natural log transformed. thus, regression coefficients from these models were exponentiated to give ratios of geometric means (expressed in percent) per sd difference in isometric muscle strength and crf. in multivariable analyses, we additionally adjusted for parental educational level, current smoking, family history of diabetes, frequency of intake of soft drinks, and intake of fruit and vegetables. muscle strength and crf in youth also were included in the same model to examine their independent influence on glucose, insulin, homa - ir, and homa - b in young adulthood. we then analyzed the association of muscle strength with the odds of insulin resistance, defined as homa - ir value > 75th percentile in young adulthood (19), using multiple logistic regression adjusting for the same covariates as in the linear models including homa - ir at baseline. finally, we assessed the joint association of muscle strength and crf by constructing a joint variable of tertiles of muscle strength and crf, respectively, and associated that with the outcomes in multivariable models. because no sex - dependent or recruitment period dependent associations for any outcomes were observed, we present all analyses for men, women, and recruitment period (follow - up time) combined, but with appropriate statistical adjustment. standard linear regression diagnostics were performed, including examining linearity and normality of residuals. in sensitivity analyses, we imputed missing information for covariates and outcomes (n = 12 to n = 556, depending on variable) among the total sampled population at baseline (n = 873) using chained equations (mi impute chained in stata) (20). all covariates and respective outcomes were included in the imputation approach. we also performed an analysis additionally adjusting for accelerometry - measured mvpa to examine if any residual confounding by mvpa remained that crf may not have captured. because 35% of the participants with otherwise full data had missing information regarding accelerometer - measured mvpa, we imputed missing values for mvpa using a multiple linear regression imputation approach including all covariates and the outcome. all statistical analyses were performed in stata 12.1 with = 0.05 (two - sided). baseline characteristics adjusted for sex by tertiles of isometric muscle strength in adolescence are shown in table 1. isometric muscle strength in adolescence was inversely associated with adolescence bmi, waist circumference, fasting glucose, fasting insulin, homa - ir, and television viewing and was positively associated with cardiovascular fitness and intake of fruits and vegetables at baseline. baseline characteristics adjusted for sex by tertiles of maximal voluntary isometric trunk muscle strength in adolescence isometric muscle strength and crf in youth were both significantly inversely associated with fasting insulin, homa - ir, and homa - b in young adulthood in multivariable - adjusted analyses (table 2). although associations of adolescent muscle strength and crf with fasting glucose in young adulthood were in the expected inverse direction, these did not reach statistical significance. when muscle strength and crf were included in the same multivariable models, associations with insulin, homa - ir, and homa - b for each 1-sd difference in muscle strength (0.16 n / kg) in youth, fasting insulin, homa - ir, and homa - b in young adulthood changed by 11.3, 12.2, and 8.9%, respectively. the magnitudes of associations for crf were fairly similar ; for each sd difference in crf in youth, fasting insulin, homa - ir, and homa - b in young adulthood changed 12.8, 13.3, and 10.0%, respectively. when we additionally adjusted our analyses for waist circumference measured at baseline, estimates of associations were only slightly attenuated for both exposures (table 2, model 4). using bmi instead of waist circumference as a confounder or mediator gave the same results (data not shown). furthermore, additional adjustment for accelerometer - measured mvpa did not materially change the associations (data not shown). when we repeated the analyses based on imputed samples (n = 873), associations were essentially similar to the nonimputed analyses (supplementary table 1). analyzing isometric abdominal and back strength separately also yielded fairly similar associations compared with using the mean of abdominal and back isometric strength (supplementary table 2). isometric trunk muscle strength and cardiorespiratory fitness in youth and fasting glucose, insulin, homa - ir, and homa - b in young adulthood for the association of muscle strength and crf in youth (in the same multivariable - adjusted model) with the odds of insulin resistance in young adulthood, each 1-sd difference in muscle strength (0.16 n / kg) and crf (6.8 ml o2/min / kg) in youth was significantly associated with 0.56 (95% ci 0.390.81) and 0.63 (0.430.94) lower odds of adverse levels of homa - ir in young adulthood, respectively. participants in the third sex - specific tertile of isometric muscle strength had 0.31 (0.150.66) lower odds of insulin resistance in young adulthood. furthermore, participants in the third sex - specific tertile of crf had 0.48 (0.231.01) lower odds of insulin resistance in young adulthood. there were no indications of the associations of muscle strength or crf with homa - ir being nonlinear in these models. finally, table 3 shows the joint associations of isometric muscle strength and crf in adolescence with fasting glucose, insulin, homa - ir, and homa - b in young adulthood. the inverse associations of isometric muscle strength with insulin, homa - ir, and homa - b in young adulthood were generally observed in each tertile of crf. there was no statistical evidence of multiplicative interactions between muscle strength and crf on these outcomes, and results suggested an additive effect of muscle strength and crf on glucose metabolism outcomes. joint association of sex - specific tertiles of isometric trunk muscle strength and cardiorespiratory fitness in adolescence with fasting glucose, insulin, homa - ir, and homa - b in young adulthood in this prospective study of a population sample of danish men and women, isometric muscle strength and crf in youth were inversely associated with fasting insulin and inversely associated with markers of insulin resistance and -cell function in young adulthood. these associations were independent of adiposity and demographic, personal, and lifestyle factors, and they suggest that muscle strength in youth is equally important as crf for maintaining healthy insulin sensitivity and -cell function later in life. the current guidelines for physical activity among children and adults recommend participation in activities that maintain or increase muscular strength and endurance for 2 days (adults) or 3 days (children and adolescents) each week in addition to participation in aerobic mvpa (30 min / day for adults and 60 min / day for youth) (21,22). our results generally support these guidelines ; however, they also suggest that an even greater emphasis could be placed on maintaining or increasing muscle strength among youth. because associations between crf and strength with insulin resistance and -cell function were independent of each other, this supports the view that aerobic activities and muscle strengthening activities should be targeted separately. furthermore, the analyses of continuous trait and binary outcomes suggested that muscle strength and crf were linearly associated with fasting insulin, insulin resistance, and -cell function, indicating that there is no clear threshold effect of an increase in insulin secretion or action at a particular low level of fitness or muscle strength. efforts to shift the population distribution of muscle strength and crf upwards are therefore likely to be valuable for primordial prevention of type 2 diabetes. we are aware of three randomized controlled trials conducted among youth comparing the effect of resistance training on insulin resistance or glycemic control with a pure control group. a small - scale trial among 22 overweight latino adolescent males found that 16 weeks of resistance training performed twice per week markedly increased insulin sensitivity (23). another randomized trial among 78 overweight or obese children and adolescents from new zealand reported that the effect of 8 weeks of resistance training performed twice per week had no significant effect on insulin resistance ; however, results were in the expected direction and the training improved abdominal and general adiposity (24). a recent efficacy trial among 45 obese adolescent boys reported that both aerobic exercise and resistance training were effective for reducing adiposity, but only the resistance exercise group improved insulin sensitivity (25). although we have no data to support that participants with high isometric muscle strength of the abdomen and back engage more often in muscle - strengthening activities compared with participants with low muscle strength, findings from these and other exercise training studies clearly indicate that resistance training increases muscular strength (26). our results are also largely in agreement with three previous cross - sectional studies among children and adolescents. a population - based study among norwegian children and adolescents found that muscle fitness indicated by handgrip strength, standing broad jump, abdominal muscle endurance, and back muscle endurance were inversely associated with insulin resistance independent of crf (27). a study among european children and adolescents have reported inverse associations of handgrip strength and standing long jump with insulin resistance ; however, it was not reported whether these associations were independent of cardiovascular fitness (28). finally, in a cross - sectional study among children and adolescents from new zealand, maximal upper body muscle strength (bench press) was inversely associated with insulin resistance independent of crf (29). our results extend these previous observations by the prospective nature of our study and the adjustments for putative lifestyle behaviors and sociodemographic confounders. the finding that crf in childhood or youth is important for the prevention of insulin resistance in adulthood is supported by a previous study among australian children and adolescents followed up for a period of 20 years (8). the similar magnitude of association of muscle strength and cardiovascular fitness with insulin resistance that we observed in the current study is in agreement with findings from experimental and observational studies among adults. the two largest trials among individuals with type 2 diabetes have not provided clear evidence that aerobic exercise is superior to resistance exercise for glycemic control (30,31). however, these studies indicated that the combination of aerobic and resistance exercise results in greatest improvement in glycemic control compared with either type of activity alone. the comparable effects of these two exercise regimes are also supported by a recent experimental study reporting that a single session of either aerobic or resistance exercise provided similar effects on 24-h postexercise glycemic control in insulin - resistant individuals with and without type 2 diabetes (32). finally, in a prospective study of men from the health professionals follow - up study, engagement in weight training and aerobic mvpa were both independently associated with reduced risk of incident type 2 diabetes with fairly comparable risk reduction sizes (33). an important strength of the current study was that we were able to examine the independent associations for strength and crf, and we were able to control for important confounding factors. furthermore, all participants were young and healthy at baseline and, therefore, very likely to be free from subclinical conditions that may have affected muscle strength at baseline and progression of insulin resistance and -cell dysfunction during follow - up. first, the attrition analyses indicated a possibility of selective nonresponse ; however, associations were very similar in imputed and nonimputed samples, which suggests that associations are unaffected by selection bias, and our results may have wider external validity. third, although we used a standardized test for the assessment of isometric muscle strength of the abdomen and back, additional components of strength such as dynamic strength also may be important and their assessment would have provided more extensive information on overall muscle strength. fourth, the observational nature of our study precludes us from excluding the possibility that unknown confounders or residual confounding explain our results. one such likely factor is diet, because the assessment of dietary intake was relatively crude in this study. finally, a caveat of the study was that we assessed insulin resistance and -cell function via homa - ir and homa - b, which mainly describe hepatic insulin resistance and steady - state insulin secretion, and generalizability to peripheral insulin resistance and insulin secretion in the stimulated state is uncertain (34). in conclusion, our results show that lower isometric muscle strength and crf in youth were independently associated with adverse levels of fasting insulin, insulin sensitivity, and -cell function in young adulthood. the magnitude of associations for isometric muscle strength and for crf were very similar, suggesting that participation in muscle - strengthening activities may be equally important as participating in aerobic activities in youth for maintaining healthy insulin sensitivity and -cell function later in life. furthermore, because associations for isometric muscle strength and crf with these outcomes appeared additive, it may be beneficial to increase muscle strength at any level of crf. further studies are warranted to examine which specific physical activities explain the associations of isometric muscle strength with insulin sensitivity and -cell function, and to what extent these associations are explained by skeletal muscle mass relative to body size. in addition, further studies should investigate whether the effects of strength and fitness in adolescence persist in adulthood despite changes in these physical fitness characteristics in adulthood. | objectiveto examine the independent and combined association of isometric muscle strength of the abdomen and back and cardiorespiratory fitness (crf) in youth with indices of glucose metabolism in young adulthood among boys and girls from the european youth heart study.research design and methodswe used data from a population - based prospective cohort study among youth followed up for up to 12 years (n = 317). in youth, maximal voluntary contractions during isometric back extension and abdominal flexion were determined using a strain - gauge dynamometer and crf was obtained from a maximal cycle ergometer test. insulin resistance (homeostasis model assessment of insulin resistance [homa - ir ]) and -cell function (homeostasis model assessment of -cell function [homa - b ]) were estimated from fasting serum insulin and glucose that were obtained in youth and at follow - up in young adulthood.resultsfor each 1-sd difference in isometric muscle strength (0.16 n / kg) in youth, fasting insulin, homa - ir, and homa - b in young adulthood changed by 11.3% (95% ci 17.0 to 5.2), 12.2% (18.2 to 5.7), and 8.9% (14.4 to 3.0), respectively, in young adulthood after adjustment for crf and personal lifestyle and demographic factors. results for crf were very similar in magnitude, and the magnitude of associations for both exposures was unchanged with additional adjustment for general or abdominal adiposity in youth. combined associations of muscle strength and crf with fasting insulin, homa - ir, and homa - b were additive, and adolescents in the highest sex - specific tertile for both isometric muscle strength and crf had the lowest levels of these glucose metabolism outcomes.conclusionsincreasing muscle strength and crf should be targets in youth primordial prevention strategies of insulin resistance and -cell dysfunction. |
transition metal - catalyzed transformations proceed through a series of fundamental steps, i.e., oxidative addition, migratory insertion, and reductive elimination. to minimize deleterious side reactions and maximize overall catalyst efficiency a fundamental understanding of the factors that affect the selectivity of these elementary steps is critical in designing and improving new metal - catalyzed transformations. we have recently shown that complexes of the type (ph3p)au(aryl) (aryl = 4-f - c6h4, 4-me - c6h4) undergo a photochemical oxidative addition to cf3i to give the air- and moisture - stable au(iii) complexes (ph3p)au(cf3)(aryl)(i). although this step demonstrates the oxidizing ability of au(iii) cations, a reliance on stoichiometric ag(i) salts to generate the reactive cation is ultimately impractical if a catalytic process involving such au(iii) intermediates is to be realized. due to our failed efforts to induce iodide dissociation either photochemically or with lewis acids, we also investigated thermolytic routes, and found that neutral (ph3p)au(aryl)(cf3)(i) underwent solely caryl i reductive elimination at high temperatures (122 c) (scheme 1). i reductive elimination from these complexes is facile, the factors controlling selectivity of c x versus c c bond formation are unclear due to a lack of other members of the halide family that could allow a comparative study. in a seminal study, hartwig has shown that the rates of reversible caryl x reductive elimination from three - coordinate pd(ii) increase with halide polarizability (x = cl br > cl, we observed no 4-me - c6h4f upon heating 1-f. the formation of significant amounts of d isotopologues of 2,4-, 3,4-, and 4,4-dimethylbiphenyl (biaryl - d) and equimolar ph3paucf3 suggest competitive activation of toluene - d solvent and caryl caryl reductive elimination from a putative species au(4-mec6h4)(aryl - d)(cf3). since the ratio [4-me - c6h4cf3]/[biaryl - d ] remained constant (3.6:1) throughout the reaction, the rate laws for both caryl cf3 and caryl caryl reductive elimination must have the same molecularity to first approximation. i reductive elimination from 1-i stands in contrast to the selective caryl cf3 reductive elimination from 1-f, the kinetic behavior for both thermolyses are notably similar. for instance, the thermolysis of 1-f exhibited zero - order behavior (up to 80% conversion) (figure 5) and was dramatically inhibited by pph3, consistent with slow caryl cf3 reductive elimination and slow solvent activation from three - coordinate intermediate 3-f, which can be trapped by starting material (scheme 3). although solvent activation is in all likelihood a bimolecular process, [toluene - d ] is essentially constant (8.3 m at 122 c in a sealed tube), and the ratio of products expressed as rate terms kc cf3/(kar[toluene - d ]) is also constant (3.6) (scheme 5). that 3-f can activate solvent implicates an ionic au(iii)f bond that imparts sufficient lewis acidity for formal c h activation by electrophilic aromatic substitution, fluoride - assisted deprotonation, or -bond metathesis. time course for thermolysis of au(iii)fluoride 1-f exhibiting product catalysis. obtained by monitoring [ph3paucf3 ]. like 1-i, addition of 0.1 equiv pph3 (1.4 mm) slowed the reaction (t1/2 = 300 min) and altered the order in 1-f from zero to first (see supporting information). however, only biaryl - d was formed under these conditions, suggesting an alternative, slower solvent activation pathway that does not involve 3-f. although the au(iii) center in 1-f is less electron - deficient and more sterically shielded than in 3-f due to coordinative saturation, it may still be sufficiently lewis acidic to activate solvent (scheme 6). consistent with this proposal, the reaction rate was independent of [pph3 ] (from 1.4 to 14 mm), and the more electron - rich, sterically encumbered 2-f did not react with toluene - d. a rate law consistent with the mechanism of 1-f thermolysis is shown in eq 3 where the zero - order term is significantly larger than the pseudo - first - order term in the absence of pph3, and k1(kc cf3 + kar[tol - d])/k2 = 3.9 10 m s (see supporting information for derivation).3 these kinetic investigations reveal that selectivity for caryl x versus caryl cf3 reductive elimination from au(iii) decreases in the order x = i > br > cl > f (figure 6). while rate of caryl x bond formation corresponds to halide polarizibility, thermodynamic studies were necessary to determine the role of ground state effects in the reaction selectivities. distributions of products of reductive elimination from au(iii) halides 1-x. for 1-br and 1-cl, these values represent the distributions of the nonaccelerated pathway. to gain insight into what extent thermodynamics govern reductive elimination selectivity, vant hoff analyses between 2-x and trityl halides were carried out. the halide metathesis equilibria were monitored in toluene - d by f nmr at temperatures between 25 and 78 c. complexes 2-i and 2-br were treated with an excess of ph3c cl (30 equiv) to ensure fast approach to equilibrium, and to hold [ph3c cl ] constant for determination of the equilibrium constant. the equilibrium between 2-cl (+ ph3c i) and 2-i (+ ph3c cl) was moderately exothermic (h = 4.8 kcal / mol) with a negligible loss of entropy (s = 2.1 e.u.) similarly, the equilibrium between 2-cl (+ ph3c br) and 2-br (+ ph3c cl) also lies to the right (h = 3.1 kcal / mol) with a negligible entropy loss (s = 1.8 e.u.) (figure 8). vant hoff plot of the equilibrium of 2-cl (+ ph3c i) and 2-i (+ ph3c cl) (shown above) in toluene - d between 25 and 78 c. vant hoff plot of the equilibrium of 2-cl (+ ph3c br) and 2-br (+ ph3c cl) (shown above) in toluene - d between 25 and 78 c. initial conditions : 2-br + ph3c cl (30 equiv). using the thermodynamic parameters above, and differences in benson group increments for tertiary alkyl halide groups (see supporting information for derivation), we obtain the differences in heats of formation (hf) of 2-cl, 2-br, and 2-i : hf(2-i) is 13 kcal / mol greater than hf(2-br), and 21 kcal / mol greater than hf(2-cl). the differences in bond dissociation energies (bde) of each au(iii)x bond are functions of hf (2-x) and bdes of the diatomic halogens (see supporting information for derivation). although rough approximations, these values suggest that the au(iii)i bond in 2-i is 18 kcal / mol weaker than the au(iii)br bond in 2-br, and 33 kcal / mol weaker than the au(iii)cl bond in 2-cl. the trend in au(iii)x bond strengths follows caryl x bond strengths, with the variation in au(iii)x bdes only slightly greater. au(iii)i suggests that selectivities for caryl x and caryl cf3 reductive elimination are strongly influenced by the strength of the au(iii)x bond in the starting material (figure 8), and that au x bonding must be substantially diminished in the transition state to caryl x reductive elimination. halide polarizability, or softness, is correlated with nucleophilicity, and may also play a role in dictating relative rates of caryl x bond formation, as noted by hartwig for pd(ii) systems. we have accessed full au(iii) halide families through formal oxidative addition of cf3i to au(i) followed by halide metathesis, and have systematically studied the thermolysis of 1-x (x = f, cl, br, i) and the competitive caryl x and caryl cf3 reductive eliminations from au(iii). the mechanisms and kinetic selectivities for these steps are highly dependent on the identity of the halide ligand. when x = i, thermolysis exclusively generates the products of caryl i bond formation. the selectivity for caryl cf3 reductive elimination increases in the order x = i < br < cl < f, and is completely selective for caryl cf3 bond formation when x = f (figure 6). thermodynamic studies reveal that the au(iii)x bond strength increases in the order x = i < br < cl, a trend that mirrors selectivity for caryl cf3 reductive elimination. these observations suggest that selectivity for reductive elimination is strongly dictated by the au(iii)x bond strength in the reactant, and possibly halide polarizability. highlighting stark reactivity differences between fluoride and higher halide ligands, we have also shown that the au(iii)f bond is relatively ionic, and can activate c surprisingly, the thermolyses of 1-br and 1-cl are accelerated by ph3paucf3, presumably via coordination of ph3paucf3 to the au(iii)bound halide. in conclusion, caryl x reductive elimination can be facile from au(iii) at elevated temperatures, a process that is rarely observable and probed systematically at other d metal centers. depending on the nature of the halide ligand, this process can outcompete caryl cf3 bond formation. thus, irreversible caryl x reductive elimination should not be discounted as a possible, deleterious thermodynamic sink in studies of organometallic au(iii) halides or au(i) under oxidative conditions. c reductive elimination from au(iii) halides is favored when x = cl or f, due to relatively stronger au(iii)x bonds compared to the higher halides. more broadly, reductive elimination is a fundamental step in many catalytic cycles, and judicious choice of halide, often considered a spectator ligand, may in fact be essential to achieving challenging c c bond formation. unless otherwise stated, all manipulations were carried out at ambient temperature (20 c) under an atmosphere of purified nitrogen in a vacuum atmospheres corp. solvents were dried by passage through a column of activated alumina under nitrogen pressure and degassed by sparging with dry nitrogen. cf3i was purchased from oakwood and connected to a double - manifold vacuum line fitted with hg manometers to regulate pressure. agi, agbr, and agcl were prepared by treating agno3 with the respective nax (x = halide) salt in water at room temperature, then filtering and drying. cl and ph3c br were purchased from sigma - aldrich and used as received. (ph3p)au(4-me - c6h4)(cf3)(i) (1-i), (cy3p)au(4-f - c6h4)(cf3)(i) (2-i), and ph3paucf3 were prepared according to a recent publication from our lab. nmr spectra were recorded using bruker avq-400, drx-500, av-500 or av-600 spectrometers, and chemical shifts are referenced to residual nmr solvent peaks (h and c), 1-cf3-naphthalene (f), or h3po4 elemental analyses were performed at the college of chemistry microanalytical laboratory, university of california, berkeley. x - ray structural determinations were performed at chexray, university of california, berkeley on bruker smart 1000 or smart apex diffractometers. a 25 ml pyrex schlenk tube was charged with ph3pau(4-me - c6h4) or cy3pau(4-f - c6h4) (up to 3 mmol) and the solid was dissolved in ch2cl2 to give a 0.2 m solution. the tube was sealed and degassed with three freeze pump thaw cycles. cf3i gas was introduced (1 atm) and the reaction vessel was sealed and placed in direct sunlight for 15 min. after irradiation, the excess cf3i was vented and the reaction mixture adsorbed to neutral alumina and concentrated to dryness. the alumina mixture was then loaded onto a silica column and the desired au(iii) compounds were eluted in benzene / hexanes (1:1 (v / v), rf = 0.2 for 1-i ; rf = 0.55 for 2-i). 1-i (75 mg, 0.10 mmol) or 2-i (77 mg, 0.10 mmol) was dissolved in ch2cl2 (5 ml) in a vial. agx (x = br, cl, f) (1.0 mmol) was added at once, and the reaction was capped and sonicated for 5 min in the dark, followed by a second addition of agx (1.0 mmol) and further sonication for 5 min. when x = br or cl, the solid turned increasingly yellow with the formation of agi. the suspension was filtered through a bed of celite and concentrated in vacuo to a white powder that was recrystallized twice in 1:3 ch2cl2/pentane to afford 1-br (52 mg, 0.074 mmol), 2-br (61 mg, 0.081 mmol), 1-cl (51 mg, 0.078 mmol), 2-cl (60 mg, 0.089 mmol), 1-f (45 mg, 0.071 mmol), or 2-f (55 mg, 0.083 mmol) in analytical purity as white solids. h nmr (cd2cl2, 500 mhz,) : 7.547.49 (m, 3h), 7.467.35 (m, 12h), 6.77 (d, j = 8.4 hz, 2h), 6.64 (d, j = 8.4 hz, 2h), 2.15 (s, 3h). c{h } nmr (cd2cl2, 125 mhz,) : 135.9, 134.9 (d, j = 10 hz), 132.2 (d, j = 3 hz), 130.7 (d, j = 3 hz), 130.6, 129.1 (d, j = 11 hz), 126.2, 125.7, 20.6. ipso - c signals not observed due to heteroatom coupling. p{h } nmr (cd2cl2, 162 mhz,) : 24.2 (q, jp f = 68 hz). f nmr (cd2cl2, 376 mhz,) : 27.6 (d, jp calcd for c26h22aubrf3p : c, 44.66 ; h, 3.17. found : c, 44.94 ; h, 3.33. h nmr (cd2cl2, 500 mhz,) : 7.317.26 (m, 2h), 7.016.96 (m, 2h), 2.382.26 (m, 3h), 1.911.76 (m, 12h), 1.731.55 (m, 9h), 1.321.20 (m, 3h), 1.141.00 (m, 6h). c{h } nmr (cd2cl2, 125 mhz,) : 161.7 (d, j = 246 hz), 139.3139.1 (m), 133.0 (dd, j = 6 hz, j = 1 hz), 116.3 (d, j = 20 hz), 34.1 (d, j = 25 hz), 29.8 (d, j = 3 hz), 27.6 (d, j = 11 hz), 26.3 (d, j = 1 hz). p{h } nmr (cd2cl2, 162 mhz,) : 28.0 (q, jp f nmr (cd2cl2, 376 mhz,) : 29.5 (d, jp cf3), 117.3 117.4 (m, ar - f). anal. h nmr (cd2cl2, 500 mhz,) : 7.557.50 (m, 3h), 7.447.35 (m, 12h), 6.79 (d, j = 8.1 hz, 2h), 6.64 (d, j = 8.1 hz, 2h), 2.15 (s, 3h). c{h } nmr (cd2cl2, 125 mhz,) : 140.0, 134.8 (d, j = 11 hz), 132.2 (d, j = 3 hz), 131.0 (d, j = 3 hz), 130.7, 129.2 (d, j = 11 hz), 125.8, 125.3, 20.6. p{h } nmr (cd2cl2, 162 mhz,) : 25.6 (q, jp f = 69 hz). f nmr (cd2cl2, 376 mhz,) : 30.5 (d, jp calcd for c26h22auclf3p : c, 47.69 ; h, 3.39. found : c, 47.75 ; h, 3.51. h nmr (cd2cl2, 500 mhz,) : 7.347.30 (m, 2h), 7.006.96 (m, 2h), 2.332.22 (m, 3h), 1.901.76 (m, 12h), 1.731.58 (m, 9h), 1.321.21 (m, 3h), 1.141.02 (m, 6h). c{h } nmr (cd2cl2, 125 mhz,) : 161.6 (d, j = 243 hz), 136.6136.4 (m), 133.2 (dd, j = 7 hz, j = 1 hz), 116.4 (d, j = 21 hz), 33.5 (d, j = 25 hz), 29.6 (d, j = 2 hz), 27.7 (d, j = 11 hz), 26.3 (d, j = 1 hz). p{h } nmr (cd2cl2, 162 mhz,) : 28.7 (q, jp f = 64 hz). f nmr (cd2cl2, 376 mhz,) : 32.8 (d, jp h nmr (cd2cl2, 500 mhz,) : 7.567.51 (m, 3h), 7.497.43 (m, 6h), 7.437.37 (m, 6h), 6.77 (dd, j = 8.2 hz, j = 3.3 hz, 2h), 6.60 (d, j = 8.0 hz, 2h), 2.15 (s, 3h). c{h } nmr (cd2cl2, 125 mhz,) : 135.9, 134.6 (dd, j = 11 hz, j = 2 hz), 132.4 (d, j = 3 hz), 131.3 (dd, j = 5 hz, j = 2 hz), 130.2 (d, j = 5 hz), 129.4 (d, j = 11 hz), 125.5, 125.0, 20.6. ipso - c signals not observed due to heteroatom coupling. p{h } nmr (cd2cl2, 162 mhz,) : 25.4 (qd, jp f nmr (cd2cl2, 376 mhz,) : 36.6 (dd, jp h nmr (cd2cl2, 500 mhz,) : 7.307.24 (m, 2h), 6.966.90 (m, 2h), 2.242.12 (m, 3h), 1.921.76 (m, 12h), 1.751.53 (m, 9h), 1.341.21 (m, 3h), 1.171.05 (m, 6h). c{h } nmr (cd2cl2, 125 mhz,) : 161.7 (d, j = 244 hz), 133.4133.2 (m), 116.1 (dd, j = 21 hz, j = 5 hz), 32.6 (d, j = 24 hz), 29.4 (d, j = 2 hz), 27.6 (d, j = 11 hz), 26.2 (d, j = 1 hz) ispo - c signals not observed due to heteroatom coupling. p{h } nmr (cd2cl2, 162 mhz,) : 33.2 (qd, jp f nmr (cd2cl2, 376 mhz,) : 39.3 (dd, jp cf3), 117.8 117.9 (m, ar - f), 249.0 249.2 (m) calcd for c25h37auf5p : c, 45.46 ; h, 5.65. found : c, 45.21 ; h, 5.36. a 1416 mm solution of 1-x in tol - d was prepared in an inert atmosphere glovebox. standard (1-trifluoromethylnaphthalene) was added by microsyringe, and 500 l aliquots of the solution were transferred to oven - dried nmr tubes. when appropriate, pph3 or ph3paucf3 were added directly to the nmr tube as a solid prior to injection of the tol - d solution of 1-x and standard. the thermolyses of 1-i and 1-f were carried out in a bruker drx-500 nmr probe that was temperature calibrated using ethylene glycol and preheated to 122 c for 30 min. the spectrometer was shimmed and tuned with a solution of standard, then the nmr tube containing the solution of interest was lowered into the probe. all other reactions were carried out at 122 c in an oil bath shielded from light and the samples were periodically removed from the bath, cooled to room temperature, and monitored by f nmr. a 1416 mm solution 2-x in tol - d standard (3,5-ditrifluoromethyl-1-bromobenzene) was added by microsyringe, and 500 l aliquots of the solution were transferred to oven - dried nmr tubes charged with ph3c cl (63 mg, 0.23 mmol). all experiments were heated in an nmr probe that was calibrated as described above. the equilibria were first monitored at 25 c after 10 min at room temperature. after each increase in temperature, the probe was recalibrated, and the solution of interest was heated in the probe for 10 min. after equilibrium at maximum temperature (78 c) was reached, the reaction was cooled to 25 c and the equilibrium was measured. | two unique organometallic halide series (ph3p)au(4-me - c6h4)(cf3)(x) and (cy3p)au(4-f - c6h4)(cf3)(x) (x = i, br, cl, f) have been synthesized. the pph3-supported complexes can undergo both caryl x and caryl cf3 reductive elimination. mechanistic studies of thermolysis at 122 c reveal a dramatic reactivity and kinetic selectivity dependence on halide ligand. for x = i or f, zero - order kinetic behavior is observed, while for x = cl or br, kinetic studies implicate product catalysis. the selectivity for caryl cf3 bond formation increases in the order x = i < br < cl < f, with exclusively caryl i bond formation when x = i, and exclusively caryl cf3 bond formation when x = f. thermodynamic measurements show that au(iii)x bond dissociation energies increase in the order x = i < br < cl, and that ground state au(iii)x bond strength ultimately dictates selectivities for caryl x and caryl cf3 reductive elimination. |
foreign bodies that could lead to subsequent perforation or obstruction of the gastrointestinal tract are swallowed, usually accidentally, by children or adults. for the vast majority of patients, treatment is conservative, allowing safe passage of these objects through the intestinal tract. morbidity associated with ingestion is rare, and depends on the type of foreign body ingested. the authors report the case of a rare intestinal complication caused by mischievous ingestion of magnets. a 19-year - old mentally challenged woman presented with abdominal pain of 3 days duration. laboratory investigation results were unremarkable, including normal white blood cell and differential cell counts. a plain abdominal radiograph showed the shadow of a string of small beads in lower abdomen (fig. abdominal computed tomography scan revealed foreign bodies of probable metallic origin within the small bowel. as there was no evidence of serious complications, initially, expectant treatment was planned awaiting spontaneous passage. however, after 2 days, the shadow of the foreign bodies on serial radiographs remained unchanged, and then, explorative laparotomy was performed. at laparotomy, an adherent jejunal loop containing the foreign bodies was found 20 cm distal to the ligament of treitz (fig. further exploration revealed that these objects were 19 beads of a magnetic necklace which had come in contact with each other, compressing the interposed bowel walls, resulting in necrosis and the formation of a jejuno - jejunal fistula (fig. 3). segmental resection of the fistula formed a jejunal loop and an incidental appendectomy was performed. on inquiring of the patient 's mother of any possible inciting event, she recalled that the patient had played with a magnet necklace during a visit to her cousin 's home 2 weeks prior. her postoperative recovery was uneventful, and she was discharged from the hospital 9 days after surgery. in korea, japan, and china, magnets are employed as a traditional remedy to relieve stiffness in the shoulders and neck, as well as to improve peripheral circulation. unfortunately, in these countries, magnets are easily accessible in local pharmacies, and are produced in a small enough size to swallow, passing through the alimentary tract after accidental ingestion. in many of the toys, the magnets are embedded in plastic parts, though they become easily detached. psychiatric illness in older children and adults, as our case, may also be a risk factor for ingestion of foreign bodies. possible predisposing psychological conditions include autism, developmental delay, mental retardation, attention deficit hyperactivity disorder, angelman syndrome, neurosis, reactive attachment, and anxiety. so parents and doctors should be alerted to the dangers of these toys. although the ingestion of a single magnet may not be problematic, multiple magnets can pass into the lumen of the intestine separately or in groups, and then attract each other, holding the intestinal walls between them. the affected areas of the walls then become compressed and necrotic, resulting in intestinal perforation or fistula. moreover, if the mesenteric vessels are involved between the walls, intraperitoneal hemorrhage may also occur. in an experimental analysis of the actual magnets removed from a patient, the force produced by any two magnets is inversely proportional to the square of the distance between them. this translates to a dramatic drop in force with increasing distances between any two magnets. one can appreciate how these magnetic forces generate such powerful effects and injuries within the intestines. in our case, the magnetic attraction between the components of the necklace resulted in the unusual appearance of ingested foreign bodies on plain radiograph. therefore, the causal relationship between the foreign body and intestinal fistula formation was not recognized preoperatively. in conclusion, psychiatric illness in older children and adults, as in our case, may also be a risk factor for ingestion of foreign bodies. although ingested nonmagnetic foreign bodies are likely to be passed spontaneously without consequence, ingested magnets may attract each other through the intestinal wall and cause severe gastrointestinal complications. thus, close observation and early surgical intervention should be considered after ingestion of magnets. | we describe the case of a 19-year - old mentally challenged woman who developed jejuno - jejunal fistula following ingestion of a magnetic necklace. this case report demonstrates the necessity of prompt treatment when the ingested intestinal foreign body is suspected to be multiple magnets, even if there are no sharp edges ; and even when it seems the object could be evacuated spontaneously. ingested magnets are capable of attracting each other across the bowel wall, leading to serious intestinal complications such as pressure necrosis, perforation, fistula formation, or intestinal obstruction. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.