article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
skeletal and dental fluorosis is an endemic public health problem in some regions of various countries around the world.13 fluoride is mainly incorporated into calcified tissues (i.e., bones and teeth) because of its high affinity for calcium. it replaces the hydroxyl group of hydroxyapatit crystals to form fluorapatit which is less soluble and more compact. 1.5 mg / l) for a prolonged period is known to cause dental and skeletal fluorosis while 1 ppm (parts per million) of sodium fluoride were reported to be safe level in drinking water.4 during research in the heavily fluoride - polluted area of the ore mountains and their southern foreland, a high prevalence of pathological bone changes was also found in the mandibles of fluorotic red deer.5,6 xu reported articular calcification and necrosis of articular chondrocytes in skeletal fluorosis. czarnowsky showed that increased fluoride intake affects the fluoride levels in urine and hair and also has an impact on bone density. in mice exposed to a wide range of fluor in their diet, tooth fluoride concentration, confirms the use of tooth as a biomarker of skeletal exposure.9 in turkey, the city of isparta, located in the south mediterranean region of turkey, is one of the severe endemic fluorosis regions. the amount of fluoride in drinking water at some regions of the city is determined as high as 1.83.8 mg / l with a mean level of 2.7 ppm. because of high fluoride intake, severe dental fluorosis is commonly encountered.3 skeletal and joint deformities were also reported in the city.2 orthodontic treatment in the early permanent dentition is a common treatment modality. relative cephalometric normative standards for young individuals are essential in the diagnosis of and treatment planning for these age groups. the purpose of the study was to evaluate the craniofacial characteristics of children with fluorosis in the early permanent dentition period using bjrk analysis10 and to investigate certain differences connected with the high fluor intake. we compared turkish children with and without fluorosis living in different environmental conditions in different regions to determine the craniofacial differences. a total of 216 (girls:121, boys:95) children in the early permanent dentition were included in the present study. the study group was composed of 124 children (girls:75, boys:49) who referred to clinics of dental faculty, suleyman demirel university (in isparta, endemic fluorosis region). ninety two children (girls:46, boys:46) who applied to okmeydani dental hospital (in istanbul, non - endemic fluorosis region) was selected as the control group. patients who had undergone orthodontic treatment or with parafunctional habits were also excluded from the study (table 1). the clinical diagnosis and classification of dental fluorosis was established using the thylstrup fejerskov fluorosis index.11 representative photographs showing different levels of dental fluorosis were presented in figure 1. the cephalometric radiographs were taken with the subjects standing with their teeth occluded and the lips in a relaxed position. angular (figure 2) and linear (figure 3) measurements were performed to determine the facial characteristics of the children with and without fluorosis. data were analyzed using the spss (version 11) for windows (spss ; chicago, illinois, usa) statistical package. the results were expressed as the minimum, maximum, mean and standard deviation for quantitative variables and as frequencies for categorical findings. independent samples t test analysis was used to compare the angular and linear measurements of children with and without fluorosis. the difference between angular measurements on male population in bjrk study and in our study group was done by using one sample t test. the association between two quantitative variables was evaluated with pearson s correlation coefficient (rho). a replicate measurement trial was performed on 10 randomly selected cephalograms of children in the early permanent dentition period. a second set of tracings was carried out after an interval of at least two weeks. in order to estimate the measurement error, dahlberg s formula se=(d / n) was used, where d is the difference between repeated measurements and n is the number of paired measurement.12 a total of 216 (girls:121, boys:95) children in the early permanent dentition were included in the present study. the study group was composed of 124 children (girls:75, boys:49) who referred to clinics of dental faculty, suleyman demirel university (in isparta, endemic fluorosis region). ninety two children (girls:46, boys:46) who applied to okmeydani dental hospital (in istanbul, non - endemic fluorosis region) was selected as the control group. patients who had undergone orthodontic treatment or with parafunctional habits were also excluded from the study (table 1). the clinical diagnosis and classification of dental fluorosis was established using the thylstrup fejerskov fluorosis index.11 representative photographs showing different levels of dental fluorosis were presented in figure 1. the cephalometric radiographs were taken with the subjects standing with their teeth occluded and the lips in a relaxed position. angular (figure 2) and linear (figure 3) measurements were performed to determine the facial characteristics of the children with and without fluorosis. data were analyzed using the spss (version 11) for windows (spss ; chicago, illinois, usa) statistical package. the results were expressed as the minimum, maximum, mean and standard deviation for quantitative variables and as frequencies for categorical findings. independent samples t test analysis was used to compare the angular and linear measurements of children with and without fluorosis. the difference between angular measurements on male population in bjrk study and in our study group was done by using one sample t test. the association between two quantitative variables was evaluated with pearson s correlation coefficient (rho). a replicate measurement trial was performed on 10 randomly selected cephalograms of children in the early permanent dentition period. a second set of tracings was carried out after an interval of at least two weeks. in order to estimate the measurement error, dahlberg s formula se=(d / n) was used, where d is the difference between repeated measurements and n is the number of paired measurement.12 in general, measurement errors were small ; no variable reached the 5 per cent level of significance in the paired t - test. the mean age of the children included in the study was 13.81.2 (14.40.9 for children with fluorosis ; 12.91.2 for children without fluorosis). the mean dental fluorosis level was found 4.61.8 (minimum 2 ; maximum 9) according to thylstrup fejerskov fluorosis index for children with fluorosis. values of cephalometric measurements of children with and without fluorosis are given in tables 25. table 2 shows the differences of angular and linear measurements of the two groups according to gender. differences of craniofacial morphology of individuals with and without fluorosis were shown in table 3 and separately for girls and boys, in tables 4 and 5. the results showed that angular or linear measurements were not statistically significant between children with and without fluorosis. the only exception was the angle of convexity (napog) which was significantly higher in children without fluorosis than children with fluorosis (tables 35). for all angular measurements, the differences between the genders were not statistically significant for children with and without fluorosis except saddle (nsar) and gonial angle (argogn) (p<.05). linear variables, such as anterior cranial base (sn) (p<.05), posterior cranial base (sar) (p<.01), anterior facial height (nme) (p<.01), lower facial height (mepme) (p<.01) were consistently larger in boys than in girls at both groups having and not having dental fluorosis (table 2). girls showed statistically significant difference in nsar (p<.05), napog (p<.05), and ramus height (arkk) (p<.01) in between two groups (table 4) whereas articular angle (sargo) (p<.001), argogn (p<.05), chin angle (idpog - mgo) (p<.001) and na - pog (p<.01) (table 5) showed significant difference in boys for different groups. comparison of craniofacial angular values of boys with and without fluorosis with bjrk s mean values shows different significance for nsar, sar - go, mandibular prognathism (snid) and napog (table 6). correlations of angles for children with fluorosis in the early permanent dentition period are shown in table 7. nsar shows negative correlation with sargo, snpr, snid angles for boys and girls. for total children and girls arnpr is positively correlated with snpr, snid, idpog - mgo whereas it is negatively correlated with napog. endemic fluorosis is a chronic metabolic bone and joint disease caused by intake of large amounts of fluoride. marked increase in bone formation, with irregular deposition of osteoid tissue, induced by fluoride results in osteosclerosis, exocytose formation and calcification of tendons and ligaments.2 skeletal fluorosis may cause pain, deformities, and limited movement of the joints of the spinal skeleton and major joints of extremities. savas observed that high number of female patients living in isparta who had dental fluorosis also complained of knee pain. they found that radiological severity of knee osteoarthritis was greater and atypically located osteophytes were more frequent in patients with endemic fluorosis. they implied that endemic fluorosis might be responsible for the increased severity of degenerative changes in the bone. washington, dc : national academy13 concluded that the severity of the disease appears to be directly related to the magnitude and duration of high - fluoride exposure. in an animal model, it was shown that tooth fluoride content was correlated with bone fluoride content where animals were exposed to a wide range of fluor in their drinking water. however, in the same study it was also shown that in humans and mice exposed to narrow ranges of fluoride ingestion, no correlation existed between tooth fluor concentration and bone fluoride concentration. a strong positive correlation between the degree of dental fluorosis and mandibular bone fluoride content was found in a sample of red deer exposed to elevated levels of fluoride, thus demonstrating the usefulness of dental fluorosis as a biomarker of increased fluoride exposure for biomonitoring studies.14 as for shown in clinical and experimental animal studies, prolonged uptake of increased amounts of fluoride leads to osteomalacia and decreased biomechanical competence of bone.1519 miyagi examined the effect of fluoride intake on the mineral content in rat alveolar bone. they concluded that fluoride intake might have a protective effect on rapidly progressing alveolar bone resorption. however, laboratory studies have demonstrated that fluoride does not readily diffuse into already - formed bone but is incorporated as bone remodels or develops in children.21 therefore, dental fluorosis was used as a biomarker to evaluate the effects of high fluoride intake on bony components of face. for this reason, our experimental group was selected from children living in endemic fluorosis region ; isparta, since birth. in this study, craniofacial morphology of children with severe dental fluorosis in the early permanent dentition period were investigated. boys consistently showed larger values for all of the linear variables, but the angular variables were usually not found to be different between the sexes (table 2). this finding is in agreement with other studies dealing with children of the same age.2223 in children with fluorosis, arnpr and snid shows negative correlation with nsar which are frequently used in cephalometric tracings.24 maxilla and mandible indicated anterior displacement when nsar decreases in children with fluorosis, which shows parallelism with bjrk s standarts.10 none of the angular values showed statistical difference between boys and girls in the fluoridated group at the early permanent dentition period which might imply that systemic fluorosis had similar effect in both gender in the early permanent dentition period (table 2). facial and maxillary prognatism were slightly higher in the girls than in the boys both for children with and without fluorosis but the differences were not statistically significant which is comparable to the results reported by johannsdottir.23 regarding the linear measurements, the significantly larger sn, sar, nme and mepme in boys (p=.001) both with and without fluorosis shows parallelism with the study of johannsdottir (table 2). negative correlation of sargo for children with fluorosis with arnpr, idpog - mgo showed parallelism with bjrk analysis. in our study in which a possible reduction of the angle between the rear portion, or vertical part, of the cranial base and the ramus (sargo), would be accompanied by an equal increase in the degree of prognathism, as the ramus and the profile are nearly parallel. a diminution of the sargo would have the secondary effect of shortening the frontal facial height, thus diminishing the change in the angle of prognathism.25 according to bjrk, a possible reduction in argogn had little effect on the degree of prognathism. negative correlation was found between argogn and idpog - mgo. a change in idpog - mgo, the angle between the lower horizontal and anterior vertical boundaries on the cephalogram, would have a pronounced effect on the alveolar section. how great the effect on the angle of prognathism will be, depends upon whether the change in the chin angle is accompanied by a corresponding change in the upper jaw. chin angle showed positive correlation with facial prognatism and maxillary prognathism as in bjrks.10 the reason may be the posterior growth of condyles and the resorption in the anterior bone surface of mandibular incisors as mentioned in bjrk and skiller s study.25 mandibular prognathism increases by the increment of facial and maxillary prognatism as bjrk mentioned in his thesis. schudy26 and bjrk10 explained this situation like this : the growth of corpus antero - posteriorly more than expected yield to the inclination of gonial angle downwards so as the large mandible can be placed. this is accepted as naturally compensation mechanism so as the anatomical complex can be harmonized. but in our study, gonial angle did not increase with the increment of facial and maxillary prognathy which might be the result of posterior growth of condyle as in the second theory of bjrk s growth development. the increment of idpog - mgo is the other important compensation mechanism for the decrement of napog by the increment of prognathy angles. although studies relating fluoride to bone have been rather inconclusive, it has been stated that sodium fluoride has clearly been shown to have pronounced effects on the skeleton.27 for this reason, studies of this type continue to be important especially on facial growth and development studies.28 craniofacial morphology of children with fluorosis did not show great diversity than the ones without fluorosis in the early permanent dentition period. none of the angular measurements were significantly different between boys and girls in the fluoridated group which might imply that systemic fluorosis did not show gender difference in the early permanent dentition. | objectiveshigh intake of fluoride (> 1.5 mg / l) for a prolonged period may lead to skeletal fluorosis as well as dental fluorosis. the aim of this study was to compare the craniofacial characteristics of children with dental fluorosis in early permanent dentition period to those without fluorosis.methodstwo hundred and sixteen children in early permanent dentition (girls:121, boys:95) were included in the study. study group was composed of 124 children with dental fluorosis who was born and grew up in isparta (girls:75, boys:49) whereas control group of children (n=92 : 46 girls and 46 boys) had no dental fluorosis. dental fluorosis was classified using thylstrup fejerskov fluorosis index. radiological evaluation was performed by cephalometric tracing using bjrk analysis. statistical evaluation in between study and control groups was done by independent samples t test and comparison with bjrk s standards was done by one sample t test analysis. the association between two quantitative variables was evaluated with pearson s correlation coefficient (rho).resultsthe mean dental fluorosis level was 4.61.8 for children with fluorosis. systemic fluorosis affect girls no different than boys in the early permanent dentition period because none of the angular measurements show significant difference between boys and girls in the fluoridated group. comparison of craniofacial angular values of boys with fluorosis show greater diversity compared to boys without fluorosis against bjrk s mean values for boys.conclusionscraniofacial morphology of children with fluorosis did not show great diversity than the ones without fluorosis in the early permanent dentition period. none of the angular measurements were significantly different between boys and girls in the fluoridated group which might imply that systemic fluorosis did not show gender difference in the early permanent dentition. (eur j dent 2009;3:304313) |
the mtdna encodes genes for two types of rrna, 22 types of trna and 13 proteins. the encoded light chain genes are merely the eight types of trna genes and one of the complex i of the respiratory chain (mt - nd6). the heavy chain of other genes encodes complex i (mt - nd1, mt - nd2, mt - nd3, mt - nd4, mt - nd4l and mt - nd5) and the rest of the 13 proteins are involved in the mitochondrial oxidative phosphorylation (oxphos). in mtdna the first mutation associated with cancer was described in renal cell carcinoma (rcc). the importance of changes taking place in the mitochondria in the process of carcinogenesis suggests linking mev 1 mutations in a gene sdhc in caenorhabditis elegans are connected with an increased production of reactive oxygen species (ros), which are very important factors in the inactivation of proteins associated with apoptosis and neoplasia, such as p 16ink4a and p53 (grzybowska - szatkowska and slaska 2012a). the purpose of this study was to analyze mutations in mt - nd1, mt - nd2, mt - nd3 and mt - nd6 genes and their effect on the biochemical properties, structure and functioning of proteins in patients with breast tumours. the tested material was dna isolated from specimens of ductal carcinoma (carcinoma ductale) tp1 - 2 np0 - 1mp0 and blood sampled from 50 patients who had also undergone surgery for breast cancer. the blood was taken from each patient and placed in sterile vacuum test tubes containing dipotassium ethylenediaminetetraacetic acid anti - coagulant. the dna was isolated with the use of an automated nucleic acid extraction system - qiacube (qiagen, hilden, germany). it was extracted from whole peripheral blood with the qiaamp dna blood mini kit (qiagen), and the qiaamp dna blood kit (qiagen) was used for dna extraction from the tissue. sequences of mt - nd1, mt - nd2, mt - nd3, and mt - nd6 genes were analysed (table 1). based on the homo sapiens mitochondrion, the complete genome (ac_000021) sequence, primers for the fragments of test genes (table 1) were designed with the use of the primer3 programme (http://frodo.wi.mit.edu/). amplicons were sequenced using the bigdye terminator cycle sequencing kit (applied biosystem, foster city, ca, usa) in the geneamp pcr system 9700 (applied biosystem). the samples were subsequently purified on centrisep columns according to the manufacturer s protocol or precipitated with ethanol and sodium acetate according to the protocol of the bigdye kit manufacturer. the extension products were separated on the abi 377 automated sequencer (applied biosystem). after establishing the consensus sequence for each analysed sequence, the sequences of the genes were compared with the cambridge reference sequence of the human mitochondrial dna (ac_000021). polymorphisms were considered to be changes that occur in both blood / normal breast cell and tumour cells in the same patient. mutation is a change characteristic only for cancer cells and not occurring in a patient s blood / normal breast cell.table 1primer sequences used in pcr amplification and sequencinggenegene namegene position in mtdna (bp) ac_000021primer position (bp)primer sequence 5-3 mt - nd1 mitochondrially encoded nadh dehydrogenase 13307.. 42623170.. 3190cccgtaaatgatatcatctca3569.. 3488aggggctctttggtgaagag3868.. 3889tccacactagcagagaccaac3520.. 3539atcaccgccccgaccttag4517.. 4539gcttagcgctgtgatgagtgtg mt - nd2 mitochondrially encoded nadh dehydrogenase 24470.. 55115049.. 5074ctaccgtacaaccctaacataacca5420.. 5439gggtgggttttgtatgttca4885.. 4911gggagagatttggtatatgattgaga5531.. 5576aattaagtattgcaacttactgagg4394.. 4416catcctaaagtaaggtcagcta mt - nd3 mitochondrially encoded nadh dehydrogenase 310059.. 104049917.. 9935cgccgcctgatactggcat10511.. 10530ctagtattcctagaagtgag mt - nd6 mitochondrially encoded nadh dehydrogenase 6complement (14149.. 14673)14051.. 14073ccacctccatcatcacctcaac14716.. 14743gttcttgtagttgaaatacaacgatgg primer sequences used in pcr amplification and sequencing the impact on the physical and biochemical peptide properties. the probability of deleterious mutations, i.e. the functional effect of the non - synonymous (amino acid - changing) protein coding snp, was determined using the panther classification system (http://www.pantherdb.org/), which estimates the value of substitution position - specific evolutionary conservation (subpsec) and the probability of a deleterious effect on protein function (pdeleterious, probability of functional impairment) on the basis of the alignment of evolutionarily determined proteins. panther subpsec scores are continuous values from 0 (neutral) to about 10 (most likely to be deleterious) ; -3 is the previously identified cutoff point for functional significance. a cutoff of 3 corresponds to a 50 % probability that a score is deleterious. from this, the probability that a given variant will cause a deleterious effect on protein function is estimated by pdeleterious, such that a subpsec score of 3 corresponds to a pdeleterious of 0.5. the determination of helicity per residue for the peptides was performed using the agadir program (http://agadir.crg.es/). the gravy and the theoretical pi were obtained using the software program protparam tool (http://web.expasy.org/). the incidence of amino acid in each position of a protein sequence was assessed using position specific scoring matrix (pssm). positive scores indicate that a given amino acid substitution occurs more frequently in an alignment than expected by chance, while negative scores indicate that a substitution occurs less frequently than expected. large positive scores often indicate critical functional residues, which may signify active site residues or residues required for other intermolecular interactions (http://www.ncbi.nlm.nih.gov/class/structure/pssm/pssm_viewer.cgi). the results are shown in tables 2, 3, 4 and 5. in the study, 50 patients had a total number of 28 polymorphisms and five mutations (table 2). most polymorphisms (50 %, 14/28) occurred in the mt - nd2 gene sequence. five polymorphisms (m.g3916a, m.c4888 t, m.a4918 g, m.c5363 t, m.c10283 t) did not exist in the database. polymorphisms m.g3916a, m.c4888 t, m.a4918 g, m.c10283 t are of the missense type and in the case of two of them pdt was above 0.5 which indicates that those changes are not indifferent to the function of the protein (table 4). a total of five mutations were detected in 13 patients (13/50), including two not described in the literature (m.c4987 g, m.t10173c). only a change of p.c39r in mt - nd3 seems to have an impact on the functioning of the protein, pdt subpsec = 0.86366 -4.84604 (table 4). the amino acid of cysteine containing sulfhydryl group, which is also very uncommon in proteins, was replaced here with arginine containing the guanidine group. this mutation converts a highly conserved cysteine (pssm score = 11) to argnine (pssm score = 5) (table 5).table 2differences in mt - nd1, mt - nd2, mt - nd3 and mt - nd6 genes sequences between reference cambridge sequence and examined materialnumber of patients (patient s no)frequency (mtdb)mitochondrial haplogroup : according to van oven and kayser (2009)cambridge reference sequencessequences in breast cancer cellsequences in patient s bloodsequences in normal breast cellaminoacid changeagctdel mt - nd1 polymorphism 1(1)202684u6a1h, u1a1,u6a5,h9a, i2e, m27b, m38b, c5a, g2b2cm.g3591m.g3591am.g3591am.g3591asynonim 1(213)26986l0a2c, p10,u8a1m.c3738m.c3738tm.c3738tm.c3738tsynonim 1(5)112692k1b1a2,u9,hv4c, h2a1c, t2c1c1,t2g1, t2g2,n - y1, d4a3b2, l0a2a1bm.g3834m.g3834am.g3834am.g3834asynonim 3(19,20,21)m.g3916m.g3916a m.g3916a m.g3916a p.e204k 1(20)268024h3g1,h4,t2b4c, l3km.c3992m.c3992tm.c3992tm.c3992tp.t229 m 4(15,32,82,213)2442460l1b1a3b, l4b1,m2a1b, m2c, m.t4216m.t4216cm.t4216cm.t4216cp.y304hm14,d5c, x2b7,r2jt, p4a, k1a2c, h1bm, h10a 1(217)27031l0,l3c, v15,h1n6,h73m.c4221m.c4221am.c4221am.c4221asynonim mt - nd1 mutation 1(31)26771017l1c1,m21a, b2f, h1b1m.a3796m.a3796gm.a3796am.a3796ap.t164a mt - nd2 polymorphism 1(3,212)2669233n1ab1m.a4529m.a4529tm.a4529tm.a4529tsynonim 3(4,26)772627m3a, vm.g4580m.g4580am.g4580am.g4580asynonym 1(4)222682m22 v1a, h1a1,h13a2b1m.t4639m.t4639cm.t4639cm.t4639cp.i57 t 47(119,22 - 40, 202,203,212,213,217,82,83,84,81269596h6a1,h13a1bm.a4727m.a4727gm.a4727gm.a4727gsynonym 27(12,4,6 - 11,15 - 16,18,20 - 23,27 - 35,203, 212, 213, 217,219)302674r2,j2b1d,,f2e, b4a1a1a3,h2a, h2a1d, m.a4769m.a4769gm.a4769gm.ag4769gsynonim 1(32)122692l2a5,l3e2a, t2c1c,,b4a2a, u5a1d2a1,k1a1b1fm.t4823m.t4823 cm.t4823 cm.t4823csynonym 1(6)12703z7m.g4841m.g4841am.g4841am.g4841asynonym 1(26)m.c4888m.c4888 t m.c4888 t m.c4888 t p.s140l 4(13,15,87,32)m.a4918m.a4918 g m.a4918 g m.a4918 g p.n150s 1(1)152689m63,d2a2,j1b6a, t1a, u1am.g4991m.g4991am.g4991am.g4991asynonim 3(27,32,213,)2569135l2a4,l0a2,l5a, l2a1,l3d, m30b, m5b1,m5c2,m75, n9b, y2,t2b, f1b1,hv2a, h3b1,u1c, u2d2,u5b3g, u6d1am.g5147m.g5147am.g5147am.g5147asynonim 1(35)26986u8a1m.a5240m.a5240gm.a5240gm.a5240gsynonim 1(4)m.c5363m.c5363 t m.c5363 t m.c5363 t synonim 1(23)1762528k1a12, u2d2, h1e, h2a2b4, h6a1a1, h41a, j1b1,j2b2, b2k, b4e, p4,p4b1,w, a2af, a2a1b2,o1a, m7bd, m5258,m7f, c4a1e, g4, q4,q12, q2b, q3b,,l3e1c, l3h2,l0a, l0d3,l1c1d, l4,l4b2m.g5460m.g5460am.g5460am.g5460ap.a331 t mt - nd2 mutation 1(30)m.g4580m.g4580a m.g4580gm.g4580gsynonim 10(6,7,20,26,27, 34,82,203,217, 219)m.c4987m.c4987 g m.cc4987m.cc4987p.t173s mt - nd3 polymorphism 1(203)14611242822621n1,b4a1,r0a2k1,r1221,p4,j, j1c8, r11, k1, b4c1,b5 n, n1a1, n8, y, s3, l3e1a, l1c1a1m.t10238m.a10398m.t10238cm.a10398gm.t10238cm.a10398gm.t10238cm.a10398gsynonimp.t114a 1(32)m.c10281m.c10281tm.c10281tm.c10281tp.l75v 1(17)26995q2b, f1a1c1, hv11a, h59a, u5b1em.a10283m.a10283 g m.a10283 g m.a10283 g synonim 2(23,212)14611242r0a2k1,r1221,p4,j, j1c8, r11, k1, b4c1,b5 n, n1a1, n8, y, s3, l3e1a, l1c1a1m.a10398m.a10398gm.a10398gm.a10398gp.t114a mt - nd3 mutation 1(213)m.t10173m.t10173c m.t10173m.t10173p.c39r mt - nd6 polymorphism 1(35)2700269864b5a2a,,h44am7a1a4,r2c, h6c1m.c14149m.a14185m.c14149a m.a4185cm.c14149am.a14185cm.c14149am.a14185csynonimsynonim 1(27)27002613914m7a1a4,r2c, h6c1i5,t2,t5,m72,m.a14185m.a14233m.a14185cm.a14233gm.a14185cm.a14233gm.a14185cm.a14233gsynonimsynonim 2(26,32,213)261391i5,t2,t5,m72m.a14233m.a14233gm.a14233gm.a14233gsynonim 1(1)582646l012,m7a1,d1b, n3ab, a2c, h18,u1ac, u6a3a1m.g14364m.g14364am.g14364am.g14364asynonim 1(2)27004m3c1b, m18b, n22a, x1,b4b1c, hv1a2a, h11a2, l3c, l3h1a2am.a14587m.a14587gm.a14587gm.a14587gsynonim mt - nd6 mutation 1(35)m.t14166m.t14166cm.t14166m.t14166p.i170v positions in which mutations or polymorphisms were described in literature for the first timetable 3comparison of protein properties in non - synonymous protein - coding snp in females with breast canceramino acid changetheoretical pi (isoelectric point)aliphatic indexinstability indexgrand average of hydrophobicity (gravy)percentage helix (h) (start and end of helix) mt - nd1 p.t164a6.11123.4041.940.690h4 = 0.49 (146166) p.e204k7.85123.0841.310.681mitochondrial matrix p.t229m6.11123.0844.060.690mitochondrial matrix p.y304k6.29123.0842.690.676h8 = 3.71 (294314) normal6.11123.0841.940.682h4 = 0.48h8 = 6.59 mt - nd2 p.i57t9.84118.1034.590.621h2 = 2.91 p.s140l9.84120.0634.100.651h4 = 0.97 (123143) p.n150s9.84119.2234.350.644h5 = 3.74 (149169) p.t173s9.84119.2236.380.636mitochondrial matrix p.a331t9.84118.9334.350.629h10 = 0.37 (326345) normal9.84119.2234.350.636h2 = 12.89h4 = 0.95h5 = 3.92h10 = 0.30 mt - nd3 p.c39r4.5646.06140.000.931mitochondrial matrix p.l75v4.3352.30139.130.996h2 = 4.19 (5575) p.t114a4.3348.95140.871.014mitochondrial matrix normal4.3350.62140.000.992h2 = 4.20 mt - nd6 p.i170v4.1828.38125.171.069h6 = 0.23 (151171) normal4.1829.48125.751.071n6 = 0.23table 4probability of a functional effect on the non - synonymous protein - coding snpsubpsecpdeleterious substitutionmsa positionpwt psubstituted nic mt - nd1 1.557460.19115p.t164a1360.114210.060062.788 2.972150.49304p.e204k1760.462020.047712.729 1.764260.22518p.t229m2010.09940.041192.768 0.926870.11174p.y304h2760.104880.069681.777 mt - nd2 2.299980.33181p.i57t520.261640.11345.16 3.708330.67003p.s140l1290.117880.0263312.218 3.067540.51688p.n150s1400.110180.0452911.003 2.826750.4568p.t173s0.812260.006781.8630.81226 2.466890.36979p.a331t3440.119390.1473511.076 mt - nd3 4.846040.86366p.c39r0.812260.006781.8630.81226 2.643290.41176p.l75v710.592870.058431.845 0.648430.08694p.t114a1100.245870.298841.636 mt - nd6 0.882470.1074p.i170v0.362720.271091.920.36272table 5residue frequencies and pssm score determined by using pssm viewer programresidueraw frequencyweighted frequencypssm score mt - nd1-mth00104 p.t164a t0.770.635 a0.050.080 p.e204k e1.001.007 k0 p.t229 m t0.250.274 m0.110.174 p.h304y h0.690.548 y0.240.326 mt - nd2-mth00105 p.i57 t t0.790.737 i0.170.233 p.s140l s0.920.876 l0.010.013 p.n150s n0.940.908 s0.000.011 p.t173s t0.980.957 s0.000.010 p.a331 t t0.100.132 a0.010.013 mt - nd3-mth00106 p.c39r c1.000.9911 r5 p.l75v l0.990.936 v1 p.t114a t0.600.555 a0.180.151 mt - nd1-mth00109 p.i170v v0.710.525 i0.270.446 differences in mt - nd1, mt - nd2, mt - nd3 and mt - nd6 genes sequences between reference cambridge sequence and examined material positions in which mutations or polymorphisms were described in literature for the first time comparison of protein properties in non - synonymous protein - coding snp in females with breast cancer probability of a functional effect on the non - synonymous protein - coding snp residue frequencies and pssm score determined by using pssm viewer program mutations in the oxphos genes in mtdna cause disturbances in the transport of electrons through the respiratory chain. the purpose of the complex is to transport reducing equivalents from the reduced form of nadh to ubiquinone (coenzyme q - coq). mutations in the genes in mtdna oxphos cause disturbances in the transport of electrons through the respiratory chain leading to optic nerve death and complete blindness (brown. 1992). the severity of the symptoms depend on the scope and location of the mutation (komaki. 2003 ; mitchell. 2006 ; grzybowska - szatkowska and slaska 2012a). although most of the pathogenic mutations in mitochondrial diseases are described as homoplasmic, some are also heteroplasmic. most occur in lhon (leber s hereditary optic neuropathy), kearns - sayre syndrome (moraes. 1989 ; brown. 1992) and in non - insulin dependent diabetes (perucca - lostanlen. 2002). (2002) reported in breast cancer four somatic changes in the oxphos system. in three cases they were related to mt - nd2 (silent mutations). the change in the position m.t3398c of mt - nd1 described in breast cancer is also observed in patients with progressive external ophtalmoplegy and cardiomyopathy (jaksch. 1996 ; carelli. 2004). on the other hand, bai. (2000) have found a reduced expression of mrna for this complex in the case of mutations in mt - nd5 complex i in murine lung cancer cells. the authors believe that it might be caused by disturbances of the regulation of transcription (up- regulation), mrna stability or impairment of selective degradation of the mutant mrna. in breast cancer carcinoma, sequence analysis of all genes encoding mt - trna revealed eight polymorphisms and two mutations detected in 34 % of the patients (grzybowska - szatkowska and slaska 2012b). transitions m.a15924 g and m.a12308 g took place only in neoplastic cells, but not in the blood, so the mutations can be attributed strictly to a neoplastic process. the authors suggest that it may be a result of the secondary and tertiary trna structure and that the polymorphisms may lead to mitochondrial dysfunction and contribute to revealing other changes in mtdna (grzybowska - szatkowska and slaska 2012b). two other polymorphisms m.g10398a and m.t10400c are also connected with a high risk of breast cancer (mims. (2008) deny the link between the m.g10398a polymorphism and breast cancer. also, the polymorphism of mt - nd2 : m.a4769 g and m.g5460a are found in breast cancer (czarnecka. 2010). in this paper, the m.g10398a polymorphism was observed in three patients in the material while m.a4769 g was present in 27 cases, and m.g5460a only in one patient (table 2). the polymorphism m.a4769 g in contrast to the other two is synonymous, and does not change the amino acid into the protein. both the transition m.g10398a (resulting in the amino acid change p.t114a) and m.g5460a (resulting in the amino acid change p.a331 t) are not present in a high conservation region and, by panther pdt, it is less than 0.5 (table 4). replacement of polar threonine with alanine causes a reduction in the non - polar aliphatic index of the protein and the amino acid alanine is less preferred in that position than the threonine (table 5). the m.g5460a polymorphism is described in alzheimer s disease (ad), although the relationship between ad and the polymorphism is being discussed (mitchell. the test material (table 2) also detected two polymorphisms described in lhon (johns. 1991 mitochondrial haplogroup j / t (herrnstadt. 2002) is defined by the transition at position m.t4216c. this polymorphism has been described as a secondary mutation in lhon (carelli. 2004) and also to be associated with insulin resistance and type 2 diabetes (crispim. 2006). this polymorphism relates to helix 8 and changes its percentage of 6.59 to 3.71 (table 3). in insulin resistance and type 2 diabetes it often occurs together with transitions in mt - nd2 at position 4917 (johns., there was no transition at position 4917, but at position m.a4918 g (table 2), which resulted in an amino acid change in the same codon (p.n150s) (johns. this transition was accompanied by a polymorphism in m.t4216c in two patients (table 2). transition m.a4918 t is described in the literature as a natural variant of mtdna (marzuki. 1991) and it converts a highly conserved arginine containing an amide group to the serine with a hydroxyl group. also, the evolutionary analysis of coding snps subpsec was below 3, indicating that the polymorphism has an impact on the functioning of the protein (table 4). the polymorphism m.t4639c refers to a highly conserved region and occurs in haplogrup m22 (table 2), and also relates to the codon described in lhon. in lhon, polymorphism in that codon concerns mtdna position 4640 and there is a replacement of isoleucine with methionine there (p.i57 m) (volodko. 2006 ; pereira. it should be noted that the substitution of isoleucine for thereonine will change the percentage of the second helix down to 2.91 from 12.89 (table 3). transition at mtdna position 4888 on the mt - nd2 occurred in both tumour cells and blood so it should be taken as a polymorphism (table 2). the polymorphism has not been described so far in the literature and is not present in the database. it causes a conversion of polar leucine to nonpolar serine and the evolutionary analysis of coding snps subpsec was less than 3 (table 4), which indicates that the polymorphism is not indifferent to the functioning of the protein. the polymorphism m.c3992 t is relatively rare in the general population and when associated with the mitochondrial haplogrups of h, t, l (table 2) it appeared as a mutation in thyroid cancer (maximo. we currently know mtdna genes and regions in which polymorphisms and mutations are associated with similar types of cancer in the corresponding tissues of humans and dogs (laska. including breastcancer, there are a number of polymorphisms described in the d - loop region, mt - cytb, mt - coi and mt - nd1 gene, and a missense mutation in epithelioma glandulae sebacei resulting in the amino acid change p.t193n leading to a change in mt - nd1 (slaska. heteroplasmic changes were found in mt - nd1 and mt - cytb in epithelioma glandulae sebacei and in mt - cytb in lymphoma centroblasticum (slaska. 2013). out of the five detected, the m.a3796 g mutation (resulting in the amino acid change p.t164a), which is present in the literature, was described in adult onset dystonia (simon. both the mutation m.c4987 g (resulting in the amino acid change p.t173s) and the m.t10173c (resulting in the amino acid change p.c39r) concern highly conserved aminoacids. the m.c4987 g mutation occurred in up to ten patients (table 2). those were related to position 4986. that mutation caused replacement of threonine with alanine. in the cells of intestinal crypts (taylor. 2003) and in the case of oral cancer by proline (tan. the mutation m.t14166c (resulting in the amino acid change p.i70v) was described in neurogastrointestinal mitochondrial encephalomyopathy (mngie) (nishigaki. mngie is an autosomal recessive disorder caused by loss - of - function mutations in the gene encoding thymidine phosphorylase. all changes detected in our study were homplasmic (table 2). in case of changes in tumours the dominance of one type of mtdna occurs in a mitochondrion, a so - called functional advantage (augenlicht and heerdt 2001 ; jones. 2001 ; grzybowska - szatkowska and slaska 2012a). during cell division the cell strives to obtain a prevalence of one type of mrna (a homoplasmy - a replicative segregation) (augenlicht and heerdt 2001 ; jones. the period required for the replication of segregation to occur would correspond with the phase of neoplastic transformation. the homoplasmy can also occur as a result of a random segregation of mitochondria during cell division (coller. heteroplasmy may persist, or by a genetic drift a homoplasmy may occur (coller. as a result of genetic drift either elimination or stabilisation of rare variants of mtdna occurs. the occurrence and severity of symptoms in mitochondrial diseases depends on the ratio between the normal and mutated dna. the dominance of mutant mtdna in a cell leads to disturbances in the production of energy in the process of oxidative phosphorylation, which may lead to cell and tissue damage. the clinical manifestations of those disorders depends on the type of defects in the mitochondrial dna and on the degree of sensitivity of the heteroplasmic tissue disorders related to cellular respiration. when there is an advantage of mutant mtdna changes in mtdna accumulate with age due to long - term exposure to free radicals generated in the mitochondria (liu. 1998 ; czarnecka and bartnik 2011). the delayed onset and progressive nature of mitochondrial diseases indicate a progressive deterioration with age in the mitochondrial function (liu. this is why some mitochondrial diseases occur in middle or old age (brown. 2004). in the studied material we detected polymorphisms occurring in patients with lhon syndrome and in adult onset dystonia. in the phase of clinical detection cancer has about 1 cm volume and contains 10 cells. the average time of the preclinical phase lasts from 15 to 20 years, or much longer, even 50 years. this raises the question of whether the mutations present in the mitochondrial dna are primary in relation to cancer or are the result of changes produced and processes occurring during carcinogenesis. their original character is indicated by their disclosure in the form of clinical signs after a long period of occurrence (upon reaching the prevalence of the mutant mtdna) and the slow progressive nature of the symptoms as is the case with the mitochondrial diseases. | complex i nadh - oxidoreductase - ubiquinone transports reducing equivalents from the reduced form of nadh to ubiquinone (coenzyme q - coq). the purpose of this study was to analyze mutations in mt - nd1, mt - nd2, mt - nd3 and mt - nd6 genes and their effect on the biochemical properties, structure and functioning of proteins in patients with breast tumours. in research materials, in 50 patients, 28 total polymorphisms and five mutations were detected. most detected polymorphisms (50 %, 14/28) were observed in mt - nd2 gene. most of them were silent mutations. five polymorphisms (m.g3916a, m.c4888 t, m.a4918 g, m.c5363 t, m.c10283 t) do not exist in the database. a total of five mutations in 13 patients (13/50) were detected, including two not described in the literature : m.c4987 g and m.t10173c. it can not be excluded that, through the mutations and polymorphism impact on the protein structure, they may cause mitochondrial dysfunction and contribute to the appearance of other changes in mtdna. the results of our study indicate the presence of homological changes in the sequence of mtdna in both breast cancer and in some mitochondrial diseases. mutations in the examined genes in breast cancer may affect the cell and cause its dysfunction, as is the case in mitochondrial diseases. |
the study by mutschler and colleagues compares the accuracy of the current advanced trauma life support (atls) classification system for hypovolemic shock with a system based on alterations in base deficit. the impetus for this study is recent data questioning the clinical accuracy of the atls classification system. the atls system currently relies on alterations in vital signs (systolic blood pressure, heart rate) and mental status to estimate the patient 's degree of blood loss (class i to iv), and to guide fluid administration. the concern raised by these studies is that the current system 's reliance on vital signs and mental status may lead to inaccurate assessment and treatment of patients with shock. in response to these concerns, the authors have proposed an easily quantifiable measurement of hypovolemic shock based solely on initial base deficit. the current atls system was designed to standardize the initial management of severely injured trauma patients and has become the unofficial gold standard worldwide. a key focus of initial management is the early recognition and treatment of hypovolemic shock. delayed treatment of hypovolemic shock has been linked to adverse outcomes, including increased organ dysfunction and mortality. thus, for each class of shock (class i to iv), atls recommends a specific intervention (crystalloid blood) to mitigate the presumed level of hemorrhage. however, multiple studies have shown that the atls classification system may not accurately reflect the degree of hemorrhage. two studies by guly and colleagues demonstrated that inter - relationships existed between components (heart rate, systolic blood pressure, respiratory rate, glasgow coma scale) of the atls system, but these associations did not correlate to the levels used to define the atls classes of shock. these findings, in combination with an earlier report by mutschler and colleagues, suggest that the current system may overestimate the degree of tachycardia in relation to hypotension and underestimate mental status changes. in addition, individual components of the system appear to be poor predictors of hemorrhage. for example, tachycardia (one of the earliest signs of shock in the atls system) has been shown to be an inaccurate predictor of hypovolemic shock in several studies. the atls classification system, either in part or as a whole, may not accurately reflect a patient 's degree of hypovolemic shock. this discrepancy makes mutschler and colleagues ' effort to identify a more reliable classification system particularly relevant to the successful management of the severely injured patient. base deficit has been frequently used to determine endpoints of resuscitation and has been predictive of both morbidity and mortality. as early as 1988, davis and colleagues demonstrated a correlation between increasing base deficit and ongoing hemorrhage. since that time, multiple studies have shown a relationship between worsening base deficit and negative outcomes, including increased transfusion requirements, multiple organ failure, acute respiratory distress syndrome, and mortality. in addition, the role of base - deficit measurement may take on new importance given the recent focus by the trauma community on the acute coagulopathy of trauma. a recent study by sixta and colleagues demonstrated among operative trauma patients that base deficit was independently associated with the development of acute coagulopathy of trauma, an entity that contributes to ongoing hemorrhage. mutschler and colleagues ' paper reflects several of these earlier findings but also appears to be the first study to define and validate a base - deficit - oriented classification system. despite its interesting conclusions, mutschler and colleagues ' paper the traumaregister dguconsisted largely of blunt trauma patients (92.3 to 96%) and thus it is unclear how well the base - deficit classification system would function when applied to penetrating injuries. however, a recent article by caputo and colleagues may provide some insight into this issue. in caputo and colleagues ' study, there was no correlation between triage vital signs and lactate or base - deficit levels among penetrating trauma patients. however, serum lactate but not base deficit was correlated with the need for operative intervention. this study lends credence to the idea that vital signs are not reflective of shock in both penetrating and blunt injury but may call into question the applicability of base deficit in penetrating trauma. owing to the small number of penetrating trauma patients examined in both studies, a true assessment can not be determined without further study in a larger population. another concern regarding the use of base deficit is the need for invasive testing via the procurement of an arterial blood sample. practitioners often deem it too difficult to obtain an arterial sample in the midst of triage activities and the results are often delayed by the need for laboratory analysis. however, the increased availability of point - of - care testing in emergency departments has significantly increased the speed with which blood gas results can be obtained. in addition, there is also some evidence that an arterial blood sample is not necessary and that a venous sample, which is routinely drawn during triage, can be used in its place. arnold and colleagues compared base - deficit measurements between arterial and venous blood samples obtained from trauma patients in the emergency department. the results obtained from the arterial and venous samples showed good correlation and the variations were within clinically acceptable ranges. sample collection should therefore not significantly limit the use of base deficit in the classification of shock unless assessment is being performed in a resource - limited environment. in conclusion, mutschler and colleagues express a valid concern regarding the accuracy of the atls shock classification system and have offered a reasonable alternative. base - deficit measurement can be reasonably incorporated into the initial triage of trauma patients in all settings where point - of - care testing is readily available. owing to the increasing availability of such tests and the significant benefits to be gained by earlier recognition of hypovolemic shock, the use of base deficit in shock classification should be further investigated and incorporated into the early triage and management of trauma patients. | base deficit has frequently been utilized as an informal adjunct in the initial evaluation of trauma patients to assess the extent of their physiologic derangements. however, the current advanced trauma life support (atls) classification system for hypovolemic shock does not include base - deficit measurements and relies primarily on alterations in vital signs (heart rate, systolic blood pressure) and mental status (glasgow coma scale) to estimate blood loss. the authors of this paper propose that the current atls system may not accurately reflect the degree of hypovolemic shock in many patients and that base - deficit measurements should be used in its place. the proposed system showed a greater correlation with transfusion requirements, need for massive transfusion, and mortality when compared with the atls classification system. based on these findings, base - deficit measurement should be strongly considered during the initial trauma evaluation to identify the presence of hypovolemic shock and to guide blood product administration. |
a cross - sectional study was made by administering a questionnaire to hcw in 7 spanish regions (andalusia, castile and leon, catalonia, valencia community, madrid, navarre, and the basque country), which represent 70% of the spanish population. the questionnaire was conducted anonymously between march 1 and may 25, 2012 via the internet. the target population was any hcw providing direct patient care (physicians and nurses) in primary care centers. the questionnaire was accessible for a month and an email reminder was sent every 10 d to workers who had not accessed the questionnaire or had not completed the survey. the questionnaire was developed after reviewing the scientific literature on the subject, especially the questionnaire used in a canadian study. the questions were adapted to the specific circumstances of the spanish national health system and were tested on 3 occasions in a group of 20 hcw. on the first 2 occasions, the survey was administered by paper in order to identify questions that might have been confusing and determine the response time required (mean 9.75 min ; range 4.5 to 18.5 min). once the potential misunderstandings were resolved, the online survey was designed and a third pilot test performed to ensure that the survey was understood and the time required for the online response remained within the estimated range. the following sociodemographic and professional variables were collected for each hcw : profession, age, sex, years of work, and type of population (according to the spanish institute of statistics (ine), rural and intermediate 10 000 and urban > 10 000). we also collected data on medical risk conditions for influenza, contraindications to influenza vaccination, cohabitation with children aged 10 000). we also collected data on medical risk conditions for influenza, contraindications to influenza vaccination, cohabitation with children aged < 15 y, people with chronic disease and people aged 65 y, influenza vaccination in the 20112012 season and the 3 preceding seasons, and information on knowledge of and attitudes to influenza and influenza vaccination. variables related to knowledge of and attitudes to influenza vaccination were covered by a set of questions evaluated on a likert scale with 5 categories : totally agree, agree quite a lot, neither agree or disagree, disagree quite a lot, and totally disagree. the data analysis included hcw not vaccinated in the 20112012 season who answered the survey. workers with contraindications to vaccination and those in whom vaccination was indicated due to risk medical conditions were excluded from the analysis. a bivariate comparison using the chi - square test was made between unvaccinated physicians and nurses considering the sociodemographic variables and the answers to questions about knowledge and attitudes. to assess associations between the type of hcw (dependent variable : unvaccinated physician or unvaccinated nurse) and independent variables in the bivariate analysis, the odds ratios (or), and their 95% confidence intervals (ci) were calculated. the answers to questions about knowledge and attitudes were dichotomized in 2 categories : positive (totally agree, agree quite a lot) and negative (neither agree or disagree, disagree quite a lot, and totally disagree). a multivariate analysis was performed using logistic regression with backward selection of variables and a cut - off point of < 0.2 to estimate the association between type of hcw and knowledge of influenza and influenza vaccination. all information collected was treated as confidential, in strict observance of legislation on observational studies. an email was sent to primary hcw inviting them to participate. by clicking on the link to the questionnaire, workers implied consent to participate. as the survey was answered online, the initial email explained that all answers would be anonymous. in the stored data, the study protocol was approved by the ethics and clinical research committee of the jordi gol institute for research in primary care. this study was supported by the ministry of science and innovation, institute of health carlos iii, programme of research on influenza a / h1n1 (grant gr09/0030), and the catalan agency for the management of grants for university research (agaur grant number 2009/ sgr 42). the funders had no role in the study design, data collection, analysis, the decision to publish, or the preparation of the manuscript. jordi alonso (institut municipal de investigaci mdica, barcelona and ciberesp), maretva baricot (ciberesp), joan cayl and sara lafuente (agncia de salut pblica de barcelona and ciberesp), manuel garca cenoz, ivn martnez baz (instituto de salud pblica de navarra, pamplona), jos mara quintana (unidad de investigacin, hospital galdakao - usansolo), amaia bilbao gonzlez (unidad de investigacin, hospital basurto). | primary healthcare workers, especially nurses, are exposed to the vast majority of patients with influenza and play an important role in vaccinating patients. healthcare workers misconceptions about influenza and influenza vaccination have been reported as possible factors associated with lack of vaccination. the objective of this study was to compare the characteristics of unvaccinated physicians and unvaccinated nurses in the 20112012 influenza season. we performed an anonymous web survey of spanish primary healthcare workers in 2012. information was collected on vaccination and knowledge of and attitudes to the influenza vaccine. multivariate analysis was performed using unconditional logistic regression. we included 461 unvaccinated physicians and 402 unvaccinated nurses. compared with unvaccinated nurses, unvaccinated physicians had more frequently received seasonal influenza vaccination in the preceding seasons (aor 1.58 ; 95% ci 1.112.25), and more frequently believed that vaccination of high risk individuals is effective in reducing complications (aor 2.53 ; 95% ci 1.304.95) and that influenza can be a serious illness (aor 1.65 ; 95% ci 1.172.32). in contrast, unvaccinated physicians were less concerned about infecting patients (aor 0.62 ; 95% ci 0.400.96). unvaccinated nurses had more misconceptions than physicians about influenza and the influenza vaccine and more doubts about the severity of annual influenza epidemics in patients with high risk conditions and the prevention of complications by means of the influenza vaccination. for unvaccinated physicians, strategies to improve vaccination coverage should stress the importance of physicians as a possible source of infection of their patients. the effectiveness of influenza vaccination of high risk persons should be emphasized in nurses. |
in june 2006, we recruited workers from a large poultry industry farm located in pacasmayo, peru to participate in this study. site selection was based upon the first author s contacts and opportunities to invite poultry workers to participate. the study was approved by the university of iowa s institutional review board, the us naval medical research center institutional review board, the universidad peruana cayetano heredia institutional review board and the peruvian ministry of health. workers were eligible to participate if they were at least 18 years old, currently worked on the farm and were without immunocompromising conditions. poultry farm workers who were in direct contact with chickens were classified as poultryexposed (n = 132). workers who reported no direct occupational or home contact with poultry were classified as nonexposed controls (n = 17). after providing informed consent the questionnaire, available in spanish, captured demographic, medical, and occupational data including influenza immunization history, occupational exposures, and use of protective equipment (gloves, masks, glasses, and aprons). as per our previous reports,, serum samples were studied for human influenza virus exposure using a hemagglutination inhibition (hi) assay against three recently circulating human influenza virus strains : a / new caledonia/20/99 (h1n1), a / nanchang/933/95(h3n2), and a / panama/2007/99(h3n2). hi titer results were reported as the reciprocal of the highest dilution of serum that inhibited virusinduced hemagglutination of a 0.65% solution of guinea pig red blood cells. microneutralization assays, adapted as per rowe., were performed on all serum samples to detect antibodies against prototypic ai strains h4 through h12. jude children s research hospital, memphis, tn, usa, alexander klimov from us centers for disease control and prevention, atlanta, ga, and dennis senne of the national veterinary services laboratories, ames, ia : a / duck / cz/1/56(h4n8), a / chucker / mn/145917/98(h5n2), a / turkey / ma/65(h6n2), a / turkey / va/4529/02(h7n2), a / turkey / ontario/68(h8n5), a / turkey / mn/383916/95(h9n2), a / chicken / germany/49(h10n7), a / duck / memphis/546/76(h11n9), and a / duck / alberta/60/76(h12n5). all serum samples were first screened at a dilution of 1:10, and full titers (sera dilutions 1:101:1280) run for all that screened positive. twofold serial dilutions in 50 l of virus diluent (prepared inhouse and containing bovine serum albumin) were performed in flat bottom 96wells tissue culture plates (becton dickinson, franklyn lakes, nj, usa). virus neutralization was performed by adding 50 l of virus at 100 tcid50 to the sera. the plates were then covered and incubated for 2 h at 37c and 5% co2. following this incubation, 100 l of freshly trypsinized mdck cells diluted to a concentration of 2 10cells / ml was added to the plates. the plates were then incubated at 37c and 5% co2 for 24 h. after this incubation, the fluid was discarded and the plates were washed twice with phosphatebuffered saline. the monolayers were fixed with cold 80% acetone for 10 min. elisa was performed with mousederived antiinfluenza a as primary antibody and goat antimouse igg conjugated to horseradish peroxidase as secondary antibody. the absorbance was read after 10 min at 450 nm wavelength using an automated reader (versamax ; molecular devices, sunnyvale, ca, usa). the back titer was run in duplicate and was accepted only when it produced positive results in five to seven wells containing the lowest dilution of test virus. specimen laboratory results were studied for their statistical association with demographic, immunization, occupational, and other behavioral risk factors. differences in titer distribution between exposed groups were tested using the wilcoxon ranksum test. the fisher exact test was used for initial bivariate examinations of potential risk factors with antibodies against ai viruses. proportional odds modeling was used to examine the entire spectrum of serologic results for associations with potential risk factors. the distribution of age and ethnicity was similar in both groups most subjects were male and the exposed subjects reported more influenzalike symptoms during the past 12 months (table 1). the use of protective equipment (gloves, mask, apron, or glasses) was low. one poultryexposed subject had a 1:10 antibody titer against avian h5 influenza and another had a 1:10 antibody titer against avian h12 influenza (table 2). as microneutralization titers of 1:80 are often considered as evidence of previous ai virus infection, these minimally elevated titers could be explained by crossreactivity with human influenza antibodies, laboratory error, or chance. study populations characteristics, poultry farm workers, pacasmayo, peru, june 2006 statistically different between groups with fisher exact test at 95% confidence level. distribution of antibodies titers and geometric mean titers against avian influenza viruses, poultry farm workers, pacasmayo, peru, june 2006 they have included serosurveys of bird cullers, open bird market workers, swine workers, duck hunters, meat processing workers, veterinarians and poultry workers, concluding that these populations are indeed at greater risk of infection with zoonotic influenza virus.,,,,,,, our study is unique in that it constitutes the first serologic examination of poultry workers in central or south america. we recognize that the experience of workers on this one large poultry farm in peru may be quite different than the experience of other workers in the poultry industry. however, the results were reassuring in that no workers had strong evidence of ai infection. our findings should be tempered with the knowledge that the study farm is known to have a good biosecurity program. at this farm, birds are raised from eggs, and the chicks are isolated from any external contact ; vehicles are disinfected before entering the farm, and employees in some areas are required to shower and change clothing when they enter and exit the farm. since 2002, this farm has implemented an active surveillance program that consists of testing poultry for aiv every 3 months, through serologic study of broilers and breeders. thus far taking into account that much of latin america has numerous informal poultry businesses and backyard husbandry is a common activity (an estimated 4 million birds in peru alone), with little biosecurity (figure 1), there seems much potential for high pathogenic ai transmission in central and south america. recognizing the need to include all sectors of poultry production, the national agrarian health service of (senasa) in peru is implementing active and passive ai surveillance programs among formal poultry farms, backyard husbandry, and fighting birds. example of one of many informal poultry businesses with poultry, pigs and humans in close contact, peru, june 2006 (photo courtesy of dr. prior to entering the study, a free and informed consent was obtained from each subject. the naval medical research center institutional review board, in compliance with all federal regulations governing the protection of human subjects, approved the study protocol occupational risk of avian influenza infection among peruvian poultry workers none of the authors has a financial or personal conflict of interest related to this study. the corresponding author had full access to all data in the study and final responsibility for the decision to submit this publication. the views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the department of the navy, department of defense, nor the u.s. government. 105 provides that copyright protection under this title is not available for any work of the united states government. title 17 u.s.c. government work as a work prepared by a military service members or employees of the u.s. | background currently numerous countries in asia, africa and europe are encountering highly pathogenic avian influenza (ai) infections in poultry and humans. in the americas, home of the world s largest poultry exporters, contingency plans are being developed and evaluated in preparation for the arrival of these viral strains. objectives with this crosssectional study, to our knowledge the first in its kind in central or south america, we sought to learn whether peruvian poultry workers had evidence of previous ai infection and if so, to determine the risk factors for infection. methods we performed a crosssectional seroprevalence study among 149 workers on a peruvian poultry farm (132 exposed to poultry and 17 nonexposed controls), serum samples were tested for human influenza virus exposure using a hemagglutination inhibition (hi) assay. microneutralization assays were performed on all serum samples to detect antibodies against prototypic ai strains h4 through h12. results using multivariate proportional odds modeling we found that the prevalence of elevated titers against ai viruses was low in both groups, exposed and nonexposed controls. conclusions no evidence of previous ai infection among peruvian poultry workers was found in this first crosssectional study performed in south america. this first occupational study of ai in latin america was encouraging, but it likely reflects the sector of poultry production with higher biosecurity. |
lack of understanding is probably one of the most widespread demarcation criteria for discerning groups. women do not understand men, adults do not understand adolescents, citizens do not understand politicians and laymen do not understand scientists. it is important to investigate what this lack of understanding between the groups might happen to be about. this is exactly what anna mikulak is attempting at in her article mismatches between scientific and non - scientific ways of knowing and their contributions to public understanding of science (ipbs 2011). one of the most interesting aspects of this article is the author s perspective on narratives and their structure as having a role in creating conflicts between these groups. one dramatic framing device that easily fits within a typical narrative structure is that of conflict or controversy between two well - defined groups (mikulak 2011 p. 16). this is of course a fundamental aspect of narratives in general, and it is adopted in media discourses in several ways. we find it in fiction series, in commercials, in feature articles and even in the news. wakefield., (1998) noted that for eight of the twelve children studied, parents reported that behavioral symptoms of developmental disorder emerged shortly after mmr vaccination since media also reported this article a deep conflict was established between the authorities who had made this vaccination obligatory and the population. this conflicted lasted for a while, but in february, 2010, the lancet officially retracted the 1998 wakefield study (mikulak 2011 p. 8). the conflict was not between wakefield. and the population, but all the other researchers and the authority on the one hand and wakefield. and the population on the other. the narrative structure that is stated in this example therefore is the conflict resolution structure. the conflict in other words lasted for a long time, and it was kept alive by bringing in new perspectives that either supported the one or the other side of the conflict. this is touching another requirement of contriving a balanced presentation. a feature in a newspaper is not properly balanced unless it manages to follow up with presenting several arguments from both sides. it is not the same group that prevails with their arguments all the time, it is rather new groups of researchers or offended that are introduced to support the one or the other perspective, and often with new arguments for the same. the narrative structure therefore is also characterized by an element of variation. by the terms, conflict, repetition, variation and reconciliation, the structure of the mediated narrative in this case seems to be captured. these terms however are exactly what the anthropologist claude lvi - strauss characterized as mythical (lvi - strauss, 1963, 1979, 1981). and of course there are studies that conclude that the mythical structure is a fundamental and uniting characteristic of different mediated communicational forms (klempe 1993). his theories are depending very much on ernst cassirer, who introduced the myth in his studies on symbolic forms. cassirer s neo - kantian perspective is very much dealing with epistemological issues, which include understanding. on the other hand there is traditionally a sharp distinction between myths and science, despite the fact that popper admitted that many remarkable scientific discoveries have had their origin in mythical thinking (popper 1961). in mikulak 2011 the narrative structure that characterizes the mediated presentation this implies that the mythical can be understood as a negative demarcation criterion for scientific discourse. this is exactly what will be focused on in my paper, namely to examine to what extent mythical thinking can be regarded as a negative demarcation criterion for science. the assumption of a certain criterion that can discern scientific from non - scientific statements is highly associated with logical positivism. rudolph carnap was one of the main figures in that philosophical movement, and he presented the so - called criterion of verification as the criterion for scientific knowledge (carnap 1968). however carnap was not the first scholar to make a clear and explicit distinction between scientific and non - scientific knowledge. this has been a part of the whole history of the theory of science, and can be traced back to aristotle. his understanding of the demarcation criterion was very different from how carnap defined it, and one may even say that their definitions contradicted each other. according to aristotle this may probably sound as coinciding with carnap, but it does not. despite the fact that both advocated general knowledge as a characteristic of scientific knowledge, they had very different opinions about how this was achieved. carnap argued for an empirical approach, which implied that general knowledge was based on observations of the particular. aristotle on the other hand stated that the particulars can not be objects of scientific knowledge thus the difference between carnap and aristotle is both crucial and critical when it comes to the question of demarcation. the fundamental question is to what extent science can be defined in terms of the particular or the universal, i.e. which of them that may count as a point of departure. this implies that the particular is included, but never as a point of departure. this aristotelian logic therefore is characterized by deduction, which is to start with the general and universal and deduce to the singular and particular, and never the opposite way round. the latter contradicts deduction, and is called induction, which is to infer from the singular and particular to the general. aristotle also often discusses induction, but in the analytics, induction has a quite peripheral role. the reason is quite simple, namely that it is only valid as an inference in two different contexts, one is in practical learning and the other is in mathematics. in both cases that is easy to do in mathematics because universals are already embedded in the particular. if a certain number is mentioned, the whole mathematical system, in which it is a part of, is presupposed at the same time. when it comes to practical knowledge, we just learn from trial and error ; from our experiences through sensation, and the more we know from sensational experiences, the better we are in practical skills. induction, therefore can give us knowledge, but according to aristotle, this knowledge is not scientific, but practical and strongly connected to sensation. in the carnapian logic, observations form the point of departure. an observation is always given through the senses, which implies that an observation is defined in terms of the particular. thus induction is with necessity a part of this logic, and this is the core aspect of the carnapian demarcation criterion, namely that verification is depending on observations that can proof that something is true or not. by this carnap the universals do not form the point of departure, but it is regarded as an outcome. there are however two important elements carnap introduces and includes in science that contrast aristotle, and those are the role of sensations and the particular. also aristotle mentions these aspects, but not as a point of departure for logical and scientific inferences. the places where aristotle is investigating and elaborating sensation and induction as a basis for gaining knowledge is in on the soul and in his rhetorics, respectively. those two theses of aristotle form the basis for what we today would call psychology and humanities respectively. thus the logic carnap presented was not a result of isolating natural sciences from other dubious sciences. this was probably his aim, but his scientific approach was first of all based on observations, which is historically based on classical psychology and induction, of which the latter according to aristotle primarily belonged to rhetoric ; the art of persuasion. logical positivism, in other words, represented an approach that was far away from the traditions of natural sciences, and some of this network s members took the consequences. the norwegian philosopher arne naess, who was close to this circle when he wrote his doctoral thesis in the 1920s, developed the unending regress of observations in his contribution to the philosophy of science. the point was that research could not be objective unless there is an observer of the scientist s behaviour and an observer of the observer etc. in other words, he brought the whole problem back to psychology again, and carnap gave at least up defending verification as a criterion for demarcation (carnap 1966). thus the belief in induction as a basis for scientific knowledge is from a logical point of view rather to be regarded as a qualitative than a quantitative approach. this demolishes at least one important aspect of the notion of demarcation, namely that modern natural sciences can be regarded as a model for social sciences and humanities. the one that really introduced myths and mythical thinking as a part of a general epistemological discussion was ernst cassirer (18741945). out of his three volumes which present the philosophy of symbolic forms, the second from 1925 is dedicated to cassirer is often presented as a neo - kantian, and this is true in the sense that he refers very much to kant, but it is not true if one think that these references are limited just to critique of pure reason. all the other theses of kant are much more referred to, especially critique of judgment and not at least his writings in metaphysics. hence critique of pure reason is regarded in a broader context, which implies that the categorical understanding of what is and what is not science is omitted. what is prevailed however is the fundamental change in thinking that kant represented ; the copernican revolution, which implied that acquired knowledge is not regarded as depending on external, but rather on internal constraints. with these volumes on symbolic forms cassirer aims at following up kant s copernican revolution, but he also strives to broaden it (cassirer 1955 p. 29). this implies first of all that he wants to highlight the internal and subjective constraints that form our knowledge, but in addition he thinks that mythical thinking is the best pathway in an investigation of this. what characterizes mythical thinking, however, is the intuitive understanding of wholeness. for mythical thinking all contents crowd together into a single plane of reality ; everything perceived possesses as such a character of reality ; the image like the word is endowed with real forces. representation and real perception, between wish and fulfilment, between image and thing (cassirer 1955 p. 36). the mythical perspective therefore eliminates any clear distinctions between what is true and what is not true knowledge or what is science and what is not science. thus when mythical thinking is introduced as a part of epistemology, the demarcation criterion in theory of science seems to having been eliminated completely. if all distinctions are eliminated and we stand left with a pure united wholeness, then all the elements will necessarily refer to everything and everything will be the same. this implies a sort of meaningless situation, because meaning in words are depending on distinctions and oppositions between them. kant aimed at starting with exactly this united wholeness in his investigation of the pure reason, but he had no intention of ending up there. he operates with distinctions, but these distinctions are not given as universals, but are given in their particularities. when he talks about fixations of beliefs, and when he according to mikulak describes four different, but lateral approaches to fix our beliefs : tenacity, authority, a prioi [sic. ], and science mikulak 2011 p. 4), there are different forms of knowledge that are situated differently, but without different values. carnap too made a close relationship between making meaning and demarcation criteria ; not verifiable statements were regarded as meaningless (carnap 1968). one criterion was supposed to be sufficient for drawing a conclusion, and this criterion was regarded as having universal significance. in semiotics however whether this is peircian or saussurian based thus to make meaning out of language is a result of how language is used in terms of its perceived consequences or oppositions. this implies that meaning is not a consequence of a universal criterion, but rather of its actual use. thus from a semiotic, but also from a mythical perspective, a dichotomization of understandings, which a demarcation criterion is supposed to create, will occur as absurd by necessity. this is also true for a negative demarcation criterion, which the mythical very often is regarded to be. it shows very clearly that the fundamental conflict is not primarily between scientists and non - scientists, but rather among scientists. this coincides not only with a semiotic perspective on meaning, but also with the kuhnian understanding of how scientific knowledge is progressing. the basic suggestion in the logic of scientific revolutions is that also scientists prefer stability. however both the pragmatic thesis of peirce and the saussurian thesis of the arbitrary sign imply that stability is only achievable within a limited group for a limited span of time. our conceptions of terms are changing, but the closer a group is, the slower will changes occur. no one can escape from changes, but well - defined groups can prevent themselves for a while, and through this apparently obtain stability. if scientific groups manage to do this, they will easily appear as trustworthy and reliable and by this be well accepted by governmental institutions. this will of course give them a kind hegemony and they will easily dominate the picture of research disseminations. in this perspective there are many of them, but some few seem to dominate, because experts are apparently representing one group, laypeople will consequently form another. in this respect it says that the reason people do not understand a particular scientific concept, or science more generally, is because they do not have sufficient information to do so this understanding of media is what scholars have regarded as historically limited to the first half of the twentieth century ; the phase of all - powerful media (mcquail 1994). however also the audience are acting, and therefore understanding arises from a two - way negotiation of meaning between expert approaches to knowledge and lay approaches to knowledge (mikulak 2011 p.10). this is an important correction of the deficit model, and it underlines what is the semiotic and mythical understanding of the relationship between researchers and non - researchers, namely that there are no general principle that can tell the differences, but the differences in understandings appear between individuals. thus an attempt at making a clear distinction between scientific discourse and research dissemination is embedded with the same problems as demarcation criteria. on the one hand there is of course an immense difference between scientific and mythical discourses. however what both of the two also underline is that mythical thinking is fundamental to all human being. the question therefore is rather how far a discourse can be distanced from mythical thinking, than getting completely rid of it. thus we may easily find some reminiscences of mythical structures in scientific discourses too. on a more abstract level scientific discourses because scientific discourse is characterized by preciseness each contribution does not reflect much more of mythical thinking than exactly these initial mythical aspects. in a bigger scale the elements of conflict, repetition, variation and resolution this is not so much because of the genres themselves, but rather because a considerable growth in quantum may have influenced the form of these scientific genres. a vast amount of scientific articles will with necessity bring in an aspect of repetition, but also variation. a similar growth of journals presupposes and produces an aspect of conflict between different research groups. resolutions may also occur, like the withdrawal of an article in lancet mikulak referred to. thus one of the most fundamental problems with lack of understanding between scientists and non - scientists is probably more connected to a deficient in self - reflection in both groups. by not realizing all the irrational elements that unavoidably permeates discourses, either they are scientific or non - scientific | this article focuses on some principles for understanding. by taking anna mikulak s article mismatches between scientific and non - scientific ways of knowing and their contributions to public understanding of science (ipbs 2011) as a point of departure, the idea of demarcation criteria for scientific and non - scientific discourses is addressed. yet this is juxtaposed with mythical thinking, which is supposed to be the most salient trait of non - scientific discourses. the author demonstrates how the most widespread demarcation criterion, the criterion of verification, is self - contradictory, not only when it comes to logic, but also in the achievement of isolating natural sciences from other forms of knowledge. according to aristotle induction is a rhetorical device and as far as scientific statements are based on inductive inferences, they are relying on humanities, which rhetoric is a part of. yet induction also has an empirical component by being based on sense - impressions, which is not a part of the rhetoric, but the psychology. also the myths are understood in a rhetorical (lvi - strauss) and a psychological (cassirer) perspective. thus it is argued that both scientific and non - scientific discourses can be mythical. |
the institutional animal ethical committee clearance (yu - iaec 2/9.6.2016) was obtained before the initiation of the research work. four - month - old healthy swiss albino male mice with an average weight of 25 g were selected for the study. they were kept under standard housing conditions in the animal house (reg no : 347/cpcsea). the mice were divided into five groups of six animals each as follows : group i : distilled water (0.5 ml/25 g) group ii : paracetamol (200 mg / kg) group iii : levodopa (10 mg / kg) + paracetamol (200 mg / kg) group iv : bromocriptine (5 mg / kg) + paracetamol (200 mg / kg) group v : olanzapine (2 mg / kg) + paracetamol (200 mg / kg) all drugs were administered orally for 14 days. the drugs levodopa, bromocriptine, and olanzapine were selected because they are known to have modulatory role on dopaminergic system. first two are dopamine facilitator / agonist ; the third one is a blocker of dopamine with low potency. on 14 day, after 1 h of drug administration of test compounds, the animals were taken for the following tests for screening their central analgesic role. the mouse was placed on the eddy 's hot plate, with a temperature of 55c. time taken by the mouse to lick its paw or to jump was noted as reaction time. the cut off time was kept as 15 s to prevent injury to the paw. the mouse was held by the left hand gently and the tip of its tail (the last 1.5 cm, which was marked earlier) was dipped in hot water bath of temperature 48c 0.5c. the time taken for tail curling or flicking was recorded. on 14 day, after the pharmacological experiments, animals were euthanized and brain dopamine levels were estimated using the method described by bhat. 1 ml aliquot of supernatant phase was removed and then added to centrifuge tube containing 2.5 ml hexane and 0.3 ml of 0.1 m hcl. the aqueous phase (0.2 ml) was then used for dopamine estimation. all steps were carried out at 0c. to the 0.2 ml of aqueous phase, 0.05 ml of 0.4 m hcl, and 0.1 ml of sodium acetate buffer (ph 6. 9) were added, followed by 0.1 ml iodine solution (0.1 m iodine in ethanol) for oxidation. after 1.5 min, 0.1 ml 10 m acetic acid is added. the solution was then heated to 100c for 6 min. when the sample again reached room temperature, excitation and emission spectra were read from the spectrofluorimeter at 330 to 375 nm. tissue blanks for dopamine were prepared by adding the reagents of the oxidation step in reversed order (sodium sulfite before iodine). xdopamine = (sample o.d blank o.d standard o.d blank o.d) concentration of standard (500 g / ml) where, o.d is optical density. one - way analysis of variance was carried out and the statistical comparisons among the groups were performed with tukey - kramer test with the help of instat graphpad software (graph pad software inc., four - month - old healthy swiss albino male mice with an average weight of 25 g were selected for the study. they were kept under standard housing conditions in the animal house (reg no : 347/cpcsea). the mice were divided into five groups of six animals each as follows : group i : distilled water (0.5 ml/25 g) group ii : paracetamol (200 mg / kg) group iii : levodopa (10 mg / kg) + paracetamol (200 mg / kg) group iv : bromocriptine (5 mg / kg) + paracetamol (200 mg / kg) group v : olanzapine (2 mg / kg) + paracetamol (200 mg / kg) all drugs were administered orally for 14 days. the drugs levodopa, bromocriptine, and olanzapine were selected because they are known to have modulatory role on dopaminergic system. first two are dopamine facilitator / agonist ; the third one is a blocker of dopamine with low potency. on 14 day, after 1 h of drug administration of test compounds, the animals were taken for the following tests for screening their central analgesic role. the mouse was placed on the eddy 's hot plate, with a temperature of 55c. time taken by the mouse to lick its paw or to jump was noted as reaction time. the cut off time was kept as 15 s to prevent injury to the paw. the mouse was held by the left hand gently and the tip of its tail (the last 1.5 cm, which was marked earlier) was dipped in hot water bath of temperature 48c 0.5c. the time taken for tail curling or flicking was recorded. on 14 day, after the pharmacological experiments, animals were euthanized and brain dopamine levels were estimated using the method described by bhat. 1 ml aliquot of supernatant phase was removed and then added to centrifuge tube containing 2.5 ml hexane and 0.3 ml of 0.1 m hcl. the aqueous phase (0.2 ml) was then used for dopamine estimation. all steps were carried out at 0c. to the 0.2 ml of aqueous phase, 0.05 ml of 0.4 m hcl, and 0.1 ml of sodium acetate buffer (ph 6. 9) were added, followed by 0.1 ml iodine solution (0.1 m iodine in ethanol) for oxidation. after 1.5 min, 0.1 ml 10 m acetic acid is added. the solution was then heated to 100c for 6 min. when the sample again reached room temperature, excitation and emission spectra were read from the spectrofluorimeter at 330 to 375 nm. tissue blanks for dopamine were prepared by adding the reagents of the oxidation step in reversed order (sodium sulfite before iodine). xdopamine = (sample o.d blank o.d standard o.d blank o.d) concentration of standard (500 g / ml) where, o.d is optical density. one - way analysis of variance was carried out and the statistical comparisons among the groups were performed with tukey - kramer test with the help of instat graphpad software (graph pad software inc., ca, usa). the eddy 's hot plate test [table 1 ] showed that the withdrawal time of the paw was significantly prolonged (p < 0.001) in the paracetamol, paracetamol + levodopa, and paracetamol + bromocriptine groups (groups ii effect of drugs on paw withdrawal time of mouse in eddy 's hot plate when comparing the analgesic activity among the groups ii, iii, and iv, it was seen that analgesic activity was more in paracetamol + levodopa (group iii), followed by paracetamol + bromocriptine (group iv) than paracetamol alone (group ii) treated animals. similar results were seen in tail immersion test, where latency of curling or flicking of the tail in contact with the hot water was significantly prolonged (p < 0.001) in groups ii, iii, and iv [table 2 ]. effect of drugs on tail curl / flick time of mouse in tail immersion test the eddy 's hot plate test [table 1 ] showed that the withdrawal time of the paw was significantly decreased (p < 0.05) in the paracetamol + olanzapine group (group v) on comparing with normal group (group i). similar results were seen in tail immersion test, where latency of curling or flicking of the tail in contact with the hot water was significantly decreased (p < 0.05) in group v on comparing with normal group [table 2 ]. the levels of dopamine was significantly increased in the brains of animals which received paracetamol (p < 0.05), paracetamol + levodopa (p < 0.001), and paracetamol + bromocriptine groups (p when dopamine levels among the groups ii, iii, and iv were compared, it was seen that dopamine levels were more in paracetamol + levodopa (group iii), followed by paracetamol + bromocriptine (group iv) than paracetamol alone (group ii) treated animals [table 3 ]. effect of drugs on mouse brain dopamine levels the levels of dopamine were significantly decreased (p < 0.001) in the brains of animals which received paracetamol + olanzapine (group v), on comparing with normal group (group i) [table 3 ]. the eddy 's hot plate test [table 1 ] showed that the withdrawal time of the paw was significantly prolonged (p < 0.001) in the paracetamol, paracetamol + levodopa, and paracetamol + bromocriptine groups (groups ii effect of drugs on paw withdrawal time of mouse in eddy 's hot plate when comparing the analgesic activity among the groups ii, iii, and iv, it was seen that analgesic activity was more in paracetamol + levodopa (group iii), followed by paracetamol + bromocriptine (group iv) than paracetamol alone (group ii) treated animals. similar results were seen in tail immersion test, where latency of curling or flicking of the tail in contact with the hot water was significantly prolonged (p < 0.001) in groups ii, iii, and iv [table 2 ]. the eddy 's hot plate test [table 1 ] showed that the withdrawal time of the paw was significantly decreased (p < 0.05) in the paracetamol + olanzapine group (group v) on comparing with normal group (group i). similar results were seen in tail immersion test, where latency of curling or flicking of the tail in contact with the hot water was significantly decreased (p < 0.05) in group v on comparing with normal group [table 2 ]. the levels of dopamine was significantly increased in the brains of animals which received paracetamol (p < 0.05), paracetamol + levodopa (p < 0.001), and paracetamol + bromocriptine groups (p < 0.001) (groups ii when dopamine levels among the groups ii, iii, and iv were compared, it was seen that dopamine levels were more in paracetamol + levodopa (group iii), followed by paracetamol + bromocriptine (group iv) than paracetamol alone (group ii) treated animals [table 3 ]. the levels of dopamine were significantly decreased (p < 0.001) in the brains of animals which received paracetamol + olanzapine (group v), on comparing with normal group (group i) [table 3 ]. one of the important highlighting features of this drug is its minimal toxic profile. because of its efficacy and high therapeutic index, it is an astonishing fact, even after several years of its discovery and clinical utility, the exact mechanism responsible for the therapeutic beneficial of paracetamol is not completely known. due to several research works carried out to reveal its unknown mechanisms of action, several new mechanisms have come to the limelight apart from its conventional prostaglandin blocking theory responsible for analgesic activity. these include its effect on serotonergic system, cholinergic, opioid, no, and cannabinoid pathways. this preclinical study is the first of its kind, where a possible role of dopaminergic system involved in the analgesic action of paracetamol is investigated. from our results, it is clear that modulation of dopaminergic system is also involved in the analgesic action of paracetamol. as seen in the eddy 's hot plate test and tail immersion test, analgesic activity of paracetamol was increased when combined with drugs which facilitate or increase the dopaminergic activity in the brain. on the other hand, the antinociceptive activity of this unconventional nonopioid was diminished when combined with olanzapine, a dopamine blocker in the central nervous system. analgesic activity was more in paracetamol + levodopa group, in which the dopamine levels were higher than the other groups. whereas analgesic activity was diminished in paracetamol + olanzapine group, in which the brain dopamine levels were lower than the other groups. it was surprising that the animals which received only paracetamol also have an elevated dopamine levels in their brains. the elevation of brain dopamine levels by paracetamol can be answered by the following two mechanisms. once administered into the body, this intermediary undergoes conjugation in the brain with arachidonic acid in the presence of fatty acid amide hydroxylase to release n - arachidonoyl phenolamine (am404), an active metabolite. anandamide in turn can increase the levels of endogenous dopamine by regulating dopamine transporter function. another mechanism by which paracetamol can increase dopamine levels is by inhibiting the inducible nitric oxide synthase expression, which in turn decrease the synthesis of a pronociceptive, (no). this regulatory molecule which has an important role in homeostasis process can induce oxidative stress in cerebral neurons if produced in excess leading to neurotoxicity. studies have shown that it has role in the pathogenesis of parkinsonism, a neurodegenerative disease associated with the damage of dopaminergic neurons. apart from its direct effect on dopaminergic neurons, no also can activate endocannabinoid transporter leading to a decrease in the level of anandamide, which in turn adds up to the decrease in brain dopamine levels. our results are further underlined by the previous facts that analgesic action of paracetamol at submaximal doses was potentiated when combined with selective and nonselective nos inhibitors. it was also seen that analgesic activity of paracetamol was diminished when combined with endocannabinoid antagonists. one of the common factors where endocannabinoid and no system converge is their role in dopaminergic system. indeed, latest findings have proven that dopamine at spinal and supraspinal levels has a role in analgesia. numerous clinical data indicate that dopamine diminution by 6-ohda injection into the brain results in hyperalgesic responses, whereas the injection of the dopamine reuptake inhibitor gbr12935 into the brain increased pain thresholds. in another study, it was also reported that intrathecal administration of dopamine has shown antinociceptive effects in rat tail flick test. from the above facts and findings, it is summarized that paracetamol acting through endocannabinoid and no system increases the levels of dopamine, which in turn add up to the analgesic action of this commonly used nonopioid [figure 1 ]. further studies are ongoing to unearth the exact mechanism by which this commonly used analgesic increases dopamine levels in the brain. simultaneously, further research works are also required to see whether paracetamol has any role in parkinsonism or other neurodegenerative diseases by increasing the levels of dopamine through modulating endocannabinoid and no pathways. | objective : even after 100 years of discovery, the exact mechanisms for the analgesic action of paracetamol are under scanner. it was recently proposed that paracetamol may act through different mechanisms, especially altering the serotoninergic system. the main objective of this preclinical study was to verify the role of drugs modulating dopaminergic system (l - dopa, bromocriptine, olanzapine) on the analgesic effect of paracetamol.materials and methods : thirty adult male albino mice were divided into five groups : distilled water (0.5 ml/25 g), paracetamol (200 mg / kg), levodopa (10 mg / kg) + paracetamol, bromocriptine (5 mg / kg) + paracetamol (200 mg / kg), and olanzapine (2 mg / kg) + paracetamol (200 mg / kg). all drugs were administered orally for 14 days. eddy 's hot plate and tail immersion tests were used to determine analgesic activity. tests were conducted 1 h after the drug administration on the 14th day. after that, animals were sacrificed and brains were dissected out, to measure the levels of dopamine. statistical comparisons among the groups were performed by one - way analysis of variance followed by tukey - kramer test.results:coadministration of l - dopa and bromocriptine with paracetamol increased the antinociceptive activity of paracetamol significantly, whereas coadministration of olanzapine with paracetamol decreased the analgesic activity of paracetamol in the eddy 's hot plate and tail immersion tests considerably. there was a significant increase (p < 0.001) in the levels of dopamine in the brains of mice, which received levodopa, bromocriptine, and paracetamol. however, it was opposite in the brains of animals which received olanzapine.conclusion:the results suggest that analgesic action of paracetamol is influenced by dopaminergic system. |
granulomas form by an aggregation of activated macrophages that undergo a morphological transformation into epithelial - like cells. granulomas may result from a chronic inflammatory response incited by persistent or non - degradable antigens. identification of bone marrow granulomas is significant because they are usually a result of a limited number of conditions including malignant lymphomas, sarcoidosis, and atypical infections. additional rarer causes include autoimmune disorders such as rheumatoid arthritis, systemic lupus erythematosus, and other malignancies. a variety of drugs have been reported to cause bone marrow granulomas, including procainamide, sulfonamide, and ibuprofen. more recently, amiodarone has been implicated as a potential cause of bone marrow granulomas and variable cytopenias, but rarely pancytopenia. a 73-year - old man with severely symptomatic ischemic and valvular cardiomyopathy was found to have moderately severe pancytopenia (white blood cells, 2.410/l ; absolute neutrophils, 1.3910/l ; platelets, 6510/l ; hemoglobin, 9.8 g / dl with a normal mcv) during a preoperative evaluation, prior to planned tricuspid valve replacement surgery. the physical examination was consistent with tricuspid valve regurgitation, but notably splenomegaly and lymphadenopathy were absent. a bone marrow biopsy was performed to clarify the etiology of the pancytopenia prior to surgical intervention. cytogenetics and flow cytometry were likewise normal. surprisingly, multiple small non - caseating granulomas were present (figure 1). special stains, cultures, and serological testing for associated infectious causes of bone marrow granulomas, including mycobacterial, fungal (aspergillus, cryptococcus, histoplasmosis, sporothrix, coccidioides, blastomyces), aerobic and anaerobic bacteria (particularly brucellosis and q - fever), were negative. there was no clinical evidence for a viral infection such as hiv, epstein - barr virus, or cytomegalovirus, nor for an autoimmune disorder such as rheumatoid arthritis or systemic lupus erythematosus. inflammatory markers including sedimentation rate and c - reactive protein were both normal. computed tomography of the chest and angiotensin converting enzyme levels were also unremarkable. figure 1non - caseating granulomas on bone marrow biopsy (hematoxylin and eosin stain ; magnification : 400). non - caseating granulomas on bone marrow biopsy (hematoxylin and eosin stain ; magnification : 400). a review of our patient 's history revealed that amiodarone had been started several years earlier for ventricular tachyarrhythmias, and mild cytopenias had been noted several months after initiation of this drug. careful review of all other medications failed to reveal an obvious temporal association with his cytopenias. as such, amiodarone was thought to be a potential causal agent for the bone marrow granuloma formation and pancytopenia, and was discontinued. within six weeks after stopping amiodarone, with no other medication changes, our patient 's blood counts improved significantly. he then underwent successful tricuspid valve replacement without postoperative complications related to cytopenias, despite the initiation of warfarin anticoagulation. at the four month follow - up, our patient 's complete blood count returned to near normal levels (white blood cells, 4.210/l ; absolute neutrophils, 2.3610/l ; platelets, 10610/l ; hemoglobin, 12.8 g / dl ; table 1) and he remained asymptomatic at the last outpatient follow - up. table 1timeline of complete blood count recovery following cessation of amiodarone.weeks after cessationhg (g / dl)wbc(10/l)platelets (10/l)0 weeks9.82.5696 weeks10.83.08611 weeks11.63.39716 weeks12.84.2106hg, hemoglobin;wbc, white blood cell. amiodarone is a commonly prescribed class iii antiarrhythmic medication that increasingly has been recognized in sporadic case reports as a potential cause of bone marrow granulomas. in several reports, amiodarone was not stopped because the treating physicians determined that the cardiac benefits outweighed the potential hematologic risks. boutros. and moran and manoharan observed an improvement in cytopenias that paralleled a partial or complete resolution of bone marrow granulomas by three to eight months after cessation of amiodarone. reported a patient with leukopenia and thrombocytopenia that improved by six months after discontinuation of amiodarone. similarly, our patient 's hemoglobin, white blood cells, and platelets began to increase at six weeks after cessation of this drug and all three cell lines reached near normal levels by four months. close follow - up and regular blood count monitoring allowed us to define the expected temporal association between amiodarone cessation and blood count recovery (table 1). the gradual improvement observed in both our patient 's blood counts and previous published reports is consistent with the exceptionally long half - life of amiodarone. although a repeat bone marrow biopsy after its discontinuation would offer definitive proof, this was not done as it was not clinically indicated. similarly re - exposure to the drug to illicit a relapse was not ethically justifiable. nevertheless, our patient 's clinical evolution suggests an association between amiodarone, bone marrow granuloma formation, and resultant pancytopenia. our case implicates amiodarone as a cause of bone marrow granulomas with associated pancytopenia, and helps guide clinicians in an expected time course for improvement after drug cessation. although reversible, the long half - life of amiodarone did result in a protracted duration of our patient 's pancytopenia. early recognition and diagnosis might limit the severity of the associated cytopenias, and mitigate the subsequent bleeding and infectious complications, and potentially reduce the need for transfusions. amiodarone should be included in the differential diagnosis of patients who present with bone marrow granulomas and secondary cytopenias, and pancytopenia should be added as an additional reversible side effect of this commonly prescribed antiarrhythmic drug. | bone marrow infiltration by granulomas rarely presents with cytopenias and is usually a result of atypical infections, lymphomas, or sarcoidosis. drugs are also an important but often overlooked causal agent of bone marrow granulomas. although rare, amiodarone has been associated with bone marrow granuloma formation. this case report describes a 73-year - old male who presented with pancytopenia during a preoperative evaluation. amiodarone therapy was suspected to be the causal agent after diagnostic evaluation and exclusion of other causes. after cessation of amiodarone, the patient 's pancytopenia gradually resolved over a period of several months. our report illustrates an often overlooked yet important cause of reversible pancytopenia owing to suspected amiodarone - induced bone marrow granuloma formation, and guides clinicians in an expected timeline for blood count improvement after cessation of this drug. |
dry eye is defined as a disorder of tear film due to tear deficiency or excessive tear evaporation which causes damage to inter - palpebral ocular surface and is associated with symptoms of ocular discomfort. deficiencies in pre - corneal tear film production, quality and replenishment cause dry eye. in addition to providing nutrition to cornea, it also protects the ocular surface from injury and infection. it consists of three layers from anterior to posterior lipid, aqueous, and mucus layers. lipid layer is approximately 0.1 nm in thickness and retards the ocular surface water evaporation, preventing the dry eye. 90% of tear film is due to aqueous layer which is formed by the secretion of lacrimal glands. prevalence of dry eye is variable due to lack of uniformity in criteria, questionnaire and tests. a study done in usa in 3722 subjects aged 4891 years, based on symptoms, showed a prevalence of 14.4%, while another study done at jaipur by sahai. in 200 patients based on questionnaire and tests showed a prevalence of 18.4%. schein. in their study on elderly americans (> 65 years), dry eye diagnosis is based on subjective symptoms like ocular discomfort, foreign body sensation, itching, tearing, and photophobia. various questionnaires used are ocular surface disease index (osdi), bandeen roche and mcmonnies. patients are given four options to answer, i.e. never, rarely, sometimes, often / all the times, and are asked to report the frequency of each symptom. patients reporting one or more symptoms as often / all the times are considered as symptomatic patients. various tests include analysis of lacrimal secretion (schirmer test, jones test), the stability of lacrimal film by tear film break up time (but), noninvasive tear break up time (nibut), integrity of tear film (using vital stains like fluorescein, rose bengal, lissamine green, phenol red), oil gland assessment and meibometry and interferometry of tears. the present study was approved by the institute 's postgraduate board of studies and the institution ethical committee. after taking informed consent, patients aged 40 years and above, attending out - patient department, and pre - operative indoor patients at a regional ophthalmology institute of a tertiary care teaching hospital attached to a medical college were enrolled in the study. patients who had undergone some previous ocular surgeries (cataract, lasik, etc.), patients on topical medications (beta blockers, brimonidine, artificial tears, aminoglycosides), or systemic medication (amytriptyline, loratidine, diuretics, estrogen supplements, cyclophosphamide) and those seriously ill were not included in the study. after taking the history of dry eye symptoms (ocular discomfort, foreign body sensation, dryness, itching, photophobia, hyperlacrimation, redness, and burning) and grading their symptoms as mild, moderate and severe according to the grading table, six - question bandeen roche questionnaire was administered to the patients who complained of dry eye symptoms. questions included in the questionnaire were : do your eyes feel dry, do you ever feel a gritty or sandy sensation in your eyes, do your eyes ever have a burning sensation, are your eyes ever red, do you notice much crusting on your eye lashes, and do your eyes ever get stuck shut in the morning ? of the given four responses, i.e. never, rarely, sometimes, often / all the time, the patients whose response to any of the questions was often / all the times were finally registered for the study. the standard clinical examination including general physical examination, best corrected visual acuity, intraocular pressure, slit - lamp examination and physical signs of dry eye, dry eye tests were done. randomization for the selection of eye (right or left) and for the test to be done first out of the two tests [schirmer and phenol red thread (prt) ], was done by using randomized card system. both the tests were done on the same eye, after a gap of 15 minutes, without using any anesthetic agent. schirmer test was done by using autoclaved, 35-mm - long and 5-mm - wide schirmer strip. one millimeter of rounded end of strip was folded and inserted into lower fornix and the patient was asked not to close the eyes, and blink normally. the strip was removed after 5 minutes and the wet portion below the folded end was immediately measured. results were interpreted as follows : 5 mm as severe dry eye, 10 mm as borderline dry eye and > 10 mm as normal tear production. for prt test, autoclaved, 75-mm - long phenol - red impregnated thread with 3-mm bent end was placed in lower fornix for 15 seconds. when the phenol red comes in contact with alkaline tears, it changes color from white to yellow - orange, yellow and then to red. the thread was removed after 15 seconds and the red portion was measured from the very tip regardless of the fold. the results were interpreted as follows : wet length 20 mm as normal tear production. maximum prevalence of dry eye was observed in the age group of 6069 years (16, 32%) followed by 5059 years (15, 30%). females had higher prevalence (28, 56%) of dry eye than males (22, 44%) as per the questionnaire. it was followed by feeling of discomfort / irritation (98%), dryness (6%), redness (74%), photophobia (44%), itching (22%) and hyperlacrimation (16%). regarding grades of severity, foreign body sensation was the most common symptom (70%), followed by dryness of severe grade (48%) and discomfort / irritation of severe grade (34%) [table 1 ]. distribution of symptoms of dry eye according to grades of severity severe dry eye was detected by schirmer test in seven patients (14%), while prt detected severe dry eye in nine patients (18%). schirmer test detected borderline dry eye in 25 (50%) patients, while prt detected this in 22 (44%) patients [table 2 ]. of the patients detected borderline dry eye by schirmer, 10 (20%) were positive for severe dry eye by prt, and of those detected borderline dry eye by prt, nine (18%) were positive for severe dry eye by schirmer test. kappa value between prt and schirmer test was found to be 0.96, showing a strong agreement between the two tests. moreover, there was no statistically significant difference (p < 0.05) between the two tests in diagnosing dry eye. symptoms of dry eye are relatively common in the ophthalmic practice, especially in elderly population. dry eye affects the quality of life and may also be sight threatening. despite many studies on dry eye, a quartet of diagnostic tests has been universally applied, i.e. to assess symptoms, tear stability, ocular surface staining and reflex tear flow. this study showed that foreign body sensation was the most common symptom present in all patients, followed by discomfort / irritation in 98% of patients. this is in accordance with the findings of bandeen rosche., who found gritty or sandy sensation followed by burning sensation which compelled the patient to seek advice. it was developed to overcome the disadvantages of schirmer test, including variable results, low sensitivity and failure to measure basal secretions even when used without anesthesia. although the method of conducting the test is almost similar to schirmer test, but there are major differences. there is little or no sensation of thread ; so, reflex tear secretion is minimal. test time required per eye is only 15 seconds as compared to 5 minutes for schirmer test and causes less discomfort to the patient. a hospital - based cross - sectional study conducted by sahai. in jaipur found 18.4% prevalence of dry eye, with maximum occurrence among those above 70 years of age (36.1%), followed by patients of 3140 years (20%). it was more in females (22.8%) than in males (14.9%). in the present study, maximum prevalence was seen in 6069 years age group, followed by 5059 years, with more prevalence in females. asbell and chiang showed that prt test is more repeatable and statistically reliable, with lesser intra - individual variation than schirmer test. the present study showed that prt is equally sensitive in detecting dry eye as schirmer test. although prt detected dry eye in 62% as compared to 64% by schirmer, it is more efficient in detecting severe dry eye (18%) as compared to schirmer (14%). prt detected dry eye in 20% patients having detected normal / borderline by schirmer, while schirmer test detected 18% as dry eye having detected normal / borderline by prt. so, prt is almost comparable with schirmer test, and in addition, it has many advantages as compared to schirmer. prt is simpler and more comfortable to the patient and can also be done in children. most important is the lesser time consumed (15 seconds) in comparison to schirmer (5 minutes). the kappa value between prt and schirmer was found to be 0.96 in this study and shows a strong agreement between the two, and also, p < 0.05 showed that the agreement is statistically significant. so, prt can be considered as good as schirmer test in detecting dry eye. | background : dry eye is the most common ocular morbidity found in elderly patients. there is no gold standard / standard test for diagnosing dry eye.objectives:the present study was conducted to compare the potential of phenol red thread (prt) test versus schirmer test in diagnosing dry eye.materials and methods : the study was conducted on 50 patients, aged 40 years and above. history of dry eye symptoms was taken and the symptoms were graded. six - questions bandeen rosch questionnaire was administered to those having symptoms of dry eye. patients whose response to any of the questions was often / all the time were included in the study. after performing standard clinical examination, schirmer and prt tests were done.results:prt is equally sensitive in detecting dry eye, and in addition, it has many advantages as compared to schirmer. prt is simpler and more comfortable to the patient and can be done in children. it causes less reflex tearing. most important is the lesser time consumed (15 seconds) in comparison to schirmer (5 minutes).conclusion : kappa value between prt and schirmer was found to be 0.96 in this study and shows a strong agreement between the two. so, prt can be considered equally good in detecting dry eye. |
broadly, there are five areas which are available for a bams graduate to build a career successfully viz. clinical practice, academic (teaching), management & administration, drug manufacturing and research. research is a process of searching the knowledge by systematic investigation and to establish novel facts by scientific methods. medical research has lot of importance as it is much needed for the addition of knowledge and thereby to improve health care. it can be achieved by various methods of research ranging from drug trials to community surveys and from trends in the past years to unusual cases in the hospital. even though variety of approaches are available, the scenario of medical research in india is not encouraging. there are reports available mentioning facts & figures about the modern medical undergraduate students level research and also discussing the potential reasons behind this apathy,. considering the global scenario, the medical council of india is focusing more on the improvement of medical research and emphasizing the same even at undergraduate level. in case of ayurveda, although the research culture is slowly gaining pace, the undergraduate students are not educated or motivated in this direction. the present study reports the attitude of interns in an ayurveda teaching hospital about research as a career. we carried out a cross sectional study among the interns of the kleu 's bmk ayurved mahavidyalaya, belgaum, wherein the interns (n = 40) were asked to prioritize their career options from research, teaching and clinical practice. lastly, the interested candidates were asked to enroll their names for the ongoing research projects in the college. this whole exercise was done at the end of a lecture, which was arranged as a part of routine activities for the interns as an institutional norm. out of 40 interns, 36 preferred clinical practice as first career priority, whereas 4 selected teaching as option. research was chosen as second priority by 18 and third priority by 22 interns. when asked about the rationale behind this priority, they unanimously opined that ayurveda is a clinical science and they have opted for a medical degree, hence clinical practice obviously becomes their first preference. they also feel that treating the patients and thereby helping mankind is a noble job and they would be happier to take up this job. further, they have experienced that the physician who treats the patients receives high regards in the society and that is why their preference is towards clinical practice. interestingly, although they could justify their first preference towards clinical practice reasonably well ; they could not provide any justification for their preference towards research. rather, they expressed their inability to comment anything about research. regarding enrollment to the research projects the present study was carried out to know the attitudes of the interns towards research as career option in an ayurvedic teaching hospital. this may be because they are not exposed to the research methodology and importance of research during their undergraduate studies. further, the current curriculum does neither include terms like evidence base, data generation nor the introduction to findings of major nationwide research projects such as csir - nmitli, a science initiative in ayurveda. the central council for indian medicine (ccim) has introduced research as a subject in final year ayurvedic (bams) students, which is welcoming step. although this will impart theoretical knowledge, it would prove more impactful if coupled with practical training. the students during their undergraduate studies rarely get an opportunity to visit a research institute or get hands - on - training in certain techniques. the same thing is reflected in the career options prioritized by the interns participated in our study. we therefore suggest that an elective module exclusively in research can be introduced during the internship tenure, wherein the interested students can be posted at a research institute for a period of two months or so. for the students of modern medicine (mbbs), various schemes and programmes are available such as icmr short term studentship (sts), kvpy (kishore vaigyanik protsahan yojana), conferences for medical students and so on. mbbs students are eligible to get srf through which they can work on a research project for three years and can extend the work by registering to phd. it is offered by indian council of medical research (icmr), council of scientific and industrial research (csir) and university grants commission (ugc). we further feel that if the students are exposed to the research methodology in their undergraduate days, they will be in a better position to conduct full - fledged research studies during their postgraduate tenure. this will certainly help to improve the standards of md / ms dissertations and phd theses. vaidya - scientist fellowship programme to train the candidates in the shastras, science and medicine along with exposure to appropriate research methodology is an ambitious programme, which not only needs to be continued but also to be strengthened by increasing intake capacity. our study thus highlights the ignorance (and therefore apathy) of interns towards research as career option. however, it must be noted here that the study has not been conducted in structured way. this makes the results less generalizable and it would be desirable to carry out such study in different colleges across the country involving a larger sample size. to sum up, the career preferences given by interns in our study indicates conventional approach towards medical education. there is need to change their attitudes through appropriate training and by introducing different programmes to foster the research culture. | although today 's ayurvedic graduates have many career options to select from, they are not given any exposure to these options during their study. this results in apathy towards selection of any career apart from clinical practice. the present study carried out amongst interns of one ayurvedic college highlights this fact and underlines the importance of introducing research as a subject in the curriculum. |
a 49-year - old male had undergone artificial disc insertion at the 5th and 6th cervical levels because of disc rupture after a car accident. immediately after that operation, he developed severe left neck and arm pain, of vas 10. one year postoperatively he presented to us with posterior neck and left arm pain accompanied by headache. on physical examination, pain management consisted of physical therapy, analgesics, epidural steroid injection, nerve block, and ketamine injection therapy. the pain gradually worsened, and the pain area expanded to the right arm and both occipital areas. we decided upon neuromodulation, and he underwent surgery to insert a cervical scs with a dual eight - contact lead (octrode ; eon rechargeable implantable pulse generator system ; advanced neuromodulation systems, plano, tx) (fig. however, he continued to experience constant shoulder, neck, and occipital area pain. the treatments used included pulsed rf of the c2 dorsal root ganglion, a third occipital nerve block, a medial branch nerve block, trigger point injection at the c4 - 6 level, ketamine therapy, and oral medication. approximately 1 year after scs insertion, we decided to treat the residual suboccipital and upper neck pain by rf ablation to the left third occipital nerve and left third cervical medial branch. the patient was placed in a supine position, the implantable pulse generator system (ipg) was turned off, and an rf electrode was inserted under x - ray guidance after local infiltration with 1% lidocaine. rf ablation (neurotherm jk3 instrument ; rdg medical, surrey, united kingdom) at the third cervical medial branch was performed twice for 60 seconds at 60 without any complications. however, when rf ablation was performed at the left third occipital nerve, the patient suddenly complained of severe pain when the probe temperature was 40. the patient given administered an injection of 2 ml 1% lidocaine, and rf ablation was again attempted. within 10 seconds, the temperature of the probe suddenly increased from 40 to 60, and the patient complained of severe pain and showed paresthesia in both hands. the procedure was immediately halted, but the patient remained in pain and parasthesia, and said he felt the same symptoms as if the scs was on. we decided against any further rf treatment and placed the patient in a sitting position. at the 1-month follow - up, the patient reported about 20% pain relief in the upper neck area, and there were no specific changes to the scs parameter settings. scs has been established since the late 1970s as an advanced treatment for chronic intractable pain. spinal electrical neuromodulation is increasingly used, both in terms of the number of patients being treated and the number of conditions for which the procedure is indicated. therefore, the number of patients who have scs implants and who may also require other types of therapy, or procedures for other conditions, is increasing. for example, scs patients may require implantation of permanent pacemakers (ppm) for arrhythmia, or may need to undergo magnetic resonance imaging (mri). in the present case, the patient required rf ablation for the treatment of residual pain. whereas a number of studies have reported on issues relating to ppm implantation and mri in scs patients, a combination of scs and ppm has been considered hazardous because of the risk of interdevice interference causing severe bradycardia or cardiac arrest. mri is considered unsuitable or contraindicated for scs patients according to the two largest scs manufacturers. mri involves three energy fields, namely a strong static magnetic field and its associated spatial gradient, a pulsed gradient magnetic field, and a pulsed radiofrequency field. any one, or a combination, of these fields may affect scs function. the static field can affect the scs extension cable or the ipg. tronnier and associates found that ipgs were automatically switched on or off in patients who had plate electrodes connected to an ipg, and that the turning on resulted in abrupt severe pain. in addition, the fields can induce a rotational force (torque) on the scs device, resulting in adverse events including lead movement, lead dislodgement, and neural tissue activation. however, several case reports have demonstrated that mri can be safely performed on scs patients [9 - 11 ]. a key reason is that modern implanted electrodes, extensions, and ipgs do not contain ferromagnetic materials, and are therefore not susceptible to mri field effects. applying rf currents to nerves to treat pain has been practiced for more than 30 years. however, few reports have examined the safety of rf neuroablation in scs patients, or the effect of the rf ablation electromagnetic field on the scs system. many pain clinicians feel confident performing rf neuroablation as their experience indicates that the procedure is safe and has no effect on scs systems. but the present case indicates that physicians must be aware that there is a risk of complications when the rf needle is placed close to the electrode, because of an effect of the rf field on the stimulator device. ruggera and colleagues stated that electromagnetic energy from a diathermy applicator was collected by the conductive implant and redistributed in the form of a radiofrequency electrical current that was conducted into tissue surrounding the conductive surface of the implant. in the present case, it appears that such an electromagnetic current caused a malfunction that resulted spontaneous activation of the device. because parameters were set with the patient in an upright position, severe pain was experienced in the supine position. changes of posture or abrupt movements may vary the degree of stimulation and cause unpleasant sensations or pain. in summary, we believe that great care should be taken when performing rf neuroablation on scs patients because of possible rf field effects on the stimulator device. an rf probe placed too close to the device may generate enough electromagnetic power to interfere with neurostimulator function. however, complications are unlikely if the rf probe is positioned some distance from an ipg or electrode. in our case, no long - term adverse effects were noted. therefore, we recommend that physicians keep an appropriate distance between the rf probe and the electrode to minimize the risk of complications. further studies are required to better characterize the safety issues surrounding rf neuroablation in scs patients. | the implantation of spinal cord stimulators (scss) to treat chronic intractable pain is steadily increasing. and there is an increased likelihood of instances where other therapies or procedures are found to interfere with scs function, which in turn may result in pain. since scs utilize electric impulses as well as magnets, special considerations need for patients with a scs in situ who require these procedures. the present report describes a case where radiofrequency (rf) ablation of the third occipital nerve resulted in spontaneous activation of a cervical scs device. |
atmospheric pollutants represent an important source of oxidative and nitrosative stress to both terrestrial plants and to animals. the exposed biosurfaces of plants and animals are directly exposed to these pollutant stresses. not surprisingly, living organisms have developed complex integrated extracellular and intracellular defense systems against stresses related to reactive oxygen and nitrogen species (ros, rns), including o3 and no2. plant and animal epithelial surfaces and respiratory tract surfaces contain antioxidants that would be expected to provide defense against environmental stress caused by ambient ros and rns, thus ameliorating their injurious effects on more delicate underlying cellular constituents. parallelisms among these surfaces with regard to their antioxidant constituents and environmental oxidants are presented. the reactive substances at these biosurfaces not only represent an important protective system against oxidizing environments, but products of their reactions with ros / rns may also serve as biomarkers of environmental oxidative stress. moreover, the reaction products may also induce injury to underlying cells or cause cell activation, resulting in production of proinflammatory substances including cytokines. in this review we discuss antioxidant defense systems against environmental toxins in plant cell wall / apoplastic fluids, dead keratinized cells / interstitial fluids of stratum corneum (the outermost skin layer), and mucus / respiratory tract lining fluids.imagesfigure 1figure 3 |
|
a 55-year - old female patient (weight 52 kg, height 155 cm) with multiple myoma was admitted for transabdominal hysterectomy (tah). the patient had reported intermittent chest tightness, feeling of palpitations and a headache prior to admission. she had no history of diabetes, hypertension or any other systemic disease. at admission she had vital signs of blood pressure 130/75 mmhg, pulse rate 81 beats / min, respiratory rate 20 times / min and body temperature 36.3. preoperative laboratory tests were within normal limit with the exception of severe anemia (hemoglobin = 5.1 g / dl, hematocrit = 19.5%). an abdominal magnetic resonance imaging (mri) showed multiple and variable sized myomas and two simple hepatic cysts (fig. she received 4 pints of packed red cells (prc) for over three days to correct the anemia in preparation for surgery. upon arrival to the operating room standard monitoring with electrocardiogram, pulse oximetry, and noninvasive blood pressure were applied before the induction of anesthesia. the initial vital signs were a blood pressure (bp) of 180/105 mmhg, pulse 77 beats / min, normal sinus rhythm on electrocardiogram (ecg) and arterial saturation of 99%. to reduce anxiety, 3 mg of midazolam was injected and general anesthesia was induced with propofol and remifentanil using a target - controlled infusion (tci) system. after lidocaine administration, the target effect - site concentration (ce) of propofol 4 g / ml and remifentanil 4 ng / ml were started with 100% o2 and rocuronium 0.6 mg / kg was administered and used to facilitate tracheal intubation. total intravenous anesthesia (tiva) with propofol - remifentanil-50% n2o in o2 was used for anesthetic maintenance. the target ce of propofol was 2.5 - 3.5 g / ml and of remifentanil 2.5 - 3.0 ng / ml, respectively. the value of bispectral index (bis) was maintained in the 35 - 45. during the surgical exploration for tah, a retroperitoneal encapsulated hard mass measuring 5.5 4.5 5 cm sized was found incidentally with huge uterine myomas (20 18 cm). it lay at the para - arotic space along l3 vertebra with adhesion to the aorta. approximately 135 min after abdominal hysterectomy started, a surgical excision for a retroperitoneal mass was continued a general surgery team. when the surgeon manipulated the retroperitoneal mass, the patient 's bp suddenly increased to 220/130 mmhg with a pulse rate of 140 (beats / min). the depth of anesthesia was deepened by increasing the ce of propofol from 2.5 - 3.5 g / ml to 4.5 - 6.0 g / ml and remifentanil from 2.5 - 3.0 ng / ml to 4.5 - 5.0 ng / ml, respectively. the value of bis decreased from 40 - 50 to the range of 25 - 30. but the blood pressure continued to rise reaching 180 mmhg for systolic and 100 mmhg for diastolic. to control the increased bp and pulse rates, a continuous infusion of nicardipine (2.0 mg / hr) was started and an intermittent bolus of labetalol (15 mg of labetalol in three doses of 5 mg each) with additional esmolol (total 30 mg) also used however these treatments were not effective and the bp still remained at 170 - 180 mmhg for systolic and 95 - 100 mmhg for diastolic with increased heart rates in the range of 115 - 125 (beats / min) whenever the surgeon directly manipulated the mass. radial arterial line was inserted after a modified allen 's test to monitor the labile bp and arrhythmia and to draw arterial blood gas (abg) analysis sample. the abg analysis revealed ph of 7.46, paco2 33 mmhg, pao2 246 mmhg, and oxygen saturation 98% on fio2 0.5. despite the increased anesthetic depth and anti - hypertensive therapy, the bp remained a wide range bp of 170 - 100 mmhg/60 - 80 mmhg. the bp decreased to as low as 75 - 85 mmhg/45 - 50 mmhg and there was a slight increased heart rate 90 (beats / min) but it remained as low state despite fluid administration. when 2100 ml of fluid was administered during the whole period of anesthesia (300 min), 420 ml of crystalloid was administered at the time of retroperitoneal paraganglioma removal. after the removal of retroperitoneal mass, we administrated 500 ml of volume expander and 2 pints of prc and started a continuous dopamine infusion (5 mcg / kg / min) with intermittent phenylephrine 50 - 100 mcg bolus injection to improve the patient 's hemodynamic status. the estimated blood loss during the tah was about 250 ml and 200 ml for the retroperitoneal mass. the mean urine output was 140 ml / hr and the total was 700 ml. after surgery, the patient showed bp 80 - 85 mmhg for systolic and 50 - 60 mmhg for diastolic and pulse 90 beats / min and the patient sent to the intensive care unit for close monitoring. the mass confirmed histopatholgically as an extra - adrenal paraganglioma a week later (fig. extra - adrenal paraganglia are rare chromaffin cell tumors that develop from neural crest cells. those that grow within the adrenal medulla are known as pheochromocytoma whereas extra - adrenal pheochromocytoma arise outside of the adrenal gland. extra - adrenal paraganglioma represent 10 - 18% of all chromaffin tissue - related tumors. pheochromocytoma and secreting extra - adrenal paraganglioma are the cause of the secondary hypertension in approximately 0.1% of hypertensive patients and the prevalence is estimated to be 1 per 100,000 persons per year or less. unlike pheochromocytoma, which have been described as having a 10% malignancy rate, paraganglioma, especially the abdominal extra - adrenal have a higher rate of malignancy ranging from 14% to as high as 50% and retroperitoneal paragangliomas have a more genetic background. therefore genetic testing should be offered to patients diagnosed with extra - adrenal paraganglioma, particularly in patients who are young, have multiple tumors, or have a family history of malignancy. however, in the absence of typical hypertension or for its rarity and nonspecific signs and symptoms, and diagnosis may be delayed or overlooked. instead, most patients presented with mass effect related symptoms or incidentally from imaging studies such as a ct or mri for other clinical conditions. only 20% of extra - adrenal paragangliomas have been discovered due to hyper - functioning tumors. in the presented case, the retroperitoneal paraganglioma was discovered incidentally in the para - arotic spaces during a surgical exploration. preoperatively the retroperitoneal mass was not recognized due to the fused and huge sized uterine myomas and its anatomic location on mri findings. at first but the location of the retroperitoneal mass was very close to the aorta and it showed severe labile hypertension with mass manipulation, excessive tachycardia (140 beats / min), and cardiac rhythm changes (ventricular premature contracture) occurred due to loaded catecholamines. furthermore, this severe hypertension was not well controlled by commonly used antihypertensive agents. the classic triad of catecholamine excess is sweating, tachycardia and headache but the clinical presentation of extra - adrenal paraganglioma varies widely. they included tremor, pallor, panic attack, weight loss, hyperglycemia or hematuria in bladder paraganglioma. reported a hypertensive crisis experience during a transurethral resection in a paraganglioma of the bladder misdiagnosed as a simple hemangioma. it can sometimes be confused as other disease such as hyperthyroidism, panic attacks, hypoglycemia and alcohol withdrawal symptoms. hypertension is the typical presentation and the majority of patients have some form of hypertension but approximately 5 - 15% are normotensive. hypertension occurs spontaneously or as provoked by physical stress such as pain, anxiety, intubation, skin incision and increased abdominal pressure during surgery. hypertension associated with a secreting paraganglioma is primarily due to increased total peripheral resistance, mainly due to norephinephrine. on the other hand pheochromocytoma may produce either norepinephrine or mainly ephinephrine which act potentially in 2 - adrenal receptors of the skeletal muscle vasculature causing vasodilation that results in hypotension. this difference in secretory pattern is related to the presence of phenylethanolamine n - methyltransferase which converts norepinephrine to epinephrine. the best screening test for a functional extra - adrenal paraganglioma is sampling of 24 hr unine metanephrines. this test has a sensitivity of 89.9% and specificity of 99%. in the presented case, the patient 's level of 24 hr urinary excretion of fractionated metanephrine was 198.5 g / day (normal range : 52.0 - 341.0 g / day) and normetanephrine was 543.0 g / day (normal : 88.0 - 444.0 g / day) at the 7th postoperative day. surgical excision is an effective treatment approach and the prognosis is excellent if complete tumor removal can be achieved. but undiagnosed extra - adrenal paraganglioma without adequate drugs treatment can lead to potentially fatal hypertensive crisis. wide swing in arterial pressure can be occurred as a result of a contracted intravascular volume. therefore the effect of excessive circulating catecholamine and adequate volume status should be reversed to prior state of an operation with combined - and -adrenergic blockade. in the present case, the patient persistently showed low bp after tumor removal even though fluid was administered to compensate blood loss. she needed vasopressors postoperatively as in other cases. this hypotension may be ascribed to abrupt fall in catecholamine which leaded to a sudden dilation of the vasculature and to profound hypotension. the possibility of residual effects of previous used drugs of nicardipine or labetalol can not also be ruled out. we controlled hypertensive responses with deepening of anesthesia levels and calcium channel blockers instead of short - acting agents such as sodium nitoprusside. recently the clinical benefits of a calcium channel blocker due to potent vasodilatory action and partial suppression of catecholamine release from pheochromocytoma have been reported, but use of long - acting vasoactive medications compared to short acting could exacerbate an unstable hemodynamic instability potentially limited patients. when wide and precipitating swing in the bp and heart rate, more short - acting vasoactive drugs rather than long - acting drugs are preferred and recommended. a secreting extra - adrenal paraganglioma may lead to an important life - threatening emergency situation without adequate preparation. in this situation, a thoracic or abdominal incidentaloma should be questioned to be a catecholamine - producing tumor such as pheochromocytoma or secreting extra - adreanl paragnaglioma during surgical manipulation. | retroperitoneal paragangliomas are uncommon neuroendocrine tumors which are derived from extra - adrenal paraganglioma with various clinical signs and symptoms. although most extra - adrenal paragangliomas are histologically benign, some tumors can synthesize and secrete excess catecholamine from the tumor. excessive production of catecholamine causes numerous cardiovascular manifestations such as severe hypertension, cardiomyopathy, cardiac arrhythmias, and even multiorgan failure. it can lead to high risks of morbidity and mortality, especially in patients who are unrecognized or not adequately prepared. we present a female patient who was preoperatively undiagnosed of secreting retroperitoneal paraganglioma that caused cardiac tachyarrhythmia and severe intraopertive hypertension not controlled by usual antihypertensive agents. a secreting extra - adrenal paraganglioma should be included in differential diagnosis for patient who have incidentaloma and show wide range of hypertension with hemodynamic instability that is not well controlled by common antihypertensive drugs. |
. their colouration and patterning of the wings can function for display and/or for concealment (nijhout 1991), and where the colouration is sex - specific, it can serve for intersexual recognition (kemp. 2005 ; rutowski. the two main colouration mechanisms, pigmentary and structural, often simultaneously contribute to the wing colouration (vukusic and sambles 2003 ; kinoshita. pigmentary (or chemical) colouration is due to pigments that selectively absorb light in a restricted wavelength range. structural (or physical) colouration is due to interference of light scattered in nanostructured wing elements. the colouration pattern of butterfly wings is due to the tapestry of scales, where each scale often has a unique colour. a scale commonly consists of two laminae ; a lower lamina, which is approximately flat and solid, and an upper, more elaborate, lamina. the upper lamina is structured by parallel, longitudinal folds, the ridges, which are connected by orthogonal struts, the crossribs (ghiradella 2010). the lower and upper laminae are joined by pillar - like trabeculae (ghiradella 1998 ; vukusic. the components of the upper lamina, i.e. the ridges and crossribs, are often rather irregularly organized, so that in the absence of absorbing pigments the scattering of incident light is wavelength independent, resulting in a white scale colour (mason 1926 ; gilbert. 1988 ; stavenga. 2010). in the presence of pigments that absorb in a restricted wavelength range, the wavelength - selective suppression of scattered light results in coloured wings. these wings are white, because leucopterin absorbs exclusively in the ultraviolet. however, the wings are distinctly coloured for the butterflies themselves, because they have ultraviolet - sensitive photoreceptors (arikawa. xanthopterin and erythropterin absorb up into the blue and green wavelength ranges, respectively, and thus colour the wings yellow and orange or red (descimon 1975 ; morehouse. interestingly, the pterin pigments are deposited in small pigment granules that enhance the reflectance in the long wavelength range by increased scattering, thus creating a brighter wing colour (stavenga. the structural colouration of pierids is located in the so - called cover scales, where the ridge lamellae are elaborated into a multilayered structure, which creates an iridescent colouration (ghiradella. the scale modification is classified as the morpho - type (ghiradella 1998 ; vukusic. 2000) after the striking, in cross - section, christmas - tree - like structures that are encountered in the scale ridges on the upper side of the wings of the neotropical genus morpho. in most morpho species, illumination of the upper wings with white light creates a blue iridescence, but the iridescent, structural colour of most pierid species virtually always peaks in the ultraviolet wavelength range. in the wings of morpho s, the iridescent colours are usually intensified by a basal layer of strongly light - absorbing melanin pigments (vukusic. 2009 ; vukusic and stavenga 2009). a similar intensification of the iridescence is realized in pierid wings by the short - wavelength - absorbing pterins. commonly iridescence is restricted to the males, but in some species also females are iridescent. in members of the subfamily coliadinae, parts of both the forewing and hindwing may be iridescent (kemp. 2005 ; rutowski. 2005, 2007a, b ; kemp and rutowski 2007). in the colotis group, belonging to the subfamily pierinae, but evolutionarily closest to the coliadinae (braby. 2006), iridescence is co - localized and literally superimposed on the pigmentary colouration in the tips of the forewings (stavenga. 2006 ; stavenga and arikawa 2006). however, among the different butterflies of the pierid family little is known of the interplay of the structural and pigmentary colours and specifically of their role in signalling. in order to gain understanding into the topic, we have initiated a comparative study of iridescent pierids. here, we compare the males of two gonepteryx species, the cleopatra brimstone (g. cleopatra) and the common brimstone (g. rhamni), with two members of the colotis group, the great orange tip (hebomoia glaucippe) and the queen purple tip (colotis regina). we applied scanning electron microscopy (sem), to determine their ultrastructure, and (micro)spectrophotometry, to characterize the spectral properties of the wing scales. we found that the scale structures vary among different pierid species and that the iridescence, i.e. the dependence of the colouration on the angle of illumination, can be well understood with the interference condition for multiple layers. specimens of g. cleopatra were caught near argelliers (france), g. rhamni in groningen (the netherlands) and around ljubljana (slovenia), hebomoia glaucippe in taiwan ; colotis regina was obtained from the rmca (tervuren, belgium). single scales or wing patches were glued to the tip of a glass micropipette as described previously (wilts. samples were photographed using a nikon d70 mki camera equipped with an f70 macro objective and a uv - filter (combined schott glasses ug3 and bg17). details of the scale arrangement on the wings and single scales were photographed with a zeiss universalmikroskop equipped with dark - field optics and a kappa dx-40 digital camera. reflectance spectra of the wings were measured with an integrating sphere, with a bifurcated probe, and with an angle - dependent reflectance measurement setup (arms). we used an avantes usb1 or usb2 spectrometer (range 1801,100 nm) equipped with full quartz optics and fibres and a diffuse white reference standard (avantes ws-2). reflectance spectra of single scales were measured with a microspectrophotometer (msp) consisting of a leitz ortholux microscope connected with an avantes spectrometer. the objective was an olympus 20 (na 0.46) (for further methods details, see for instance vukusic and stavenga 2009). prior to observation, samples were sputtered with a thin layer of palladium or gold to prevent charging. for structural analysis of each species, layer thickness and periodicity were measured at minimally ten different spots of different electron micrographs. specimens of g. cleopatra were caught near argelliers (france), g. rhamni in groningen (the netherlands) and around ljubljana (slovenia), hebomoia glaucippe in taiwan ; colotis regina was obtained from the rmca (tervuren, belgium). single scales or wing patches were glued to the tip of a glass micropipette as described previously (wilts. samples were photographed using a nikon d70 mki camera equipped with an f70 macro objective and a uv - filter (combined schott glasses ug3 and bg17). details of the scale arrangement on the wings and single scales were photographed with a zeiss universalmikroskop equipped with dark - field optics and a kappa dx-40 digital camera. reflectance spectra of the wings were measured with an integrating sphere, with a bifurcated probe, and with an angle - dependent reflectance measurement setup (arms). we used an avantes usb1 or usb2 spectrometer (range 1801,100 nm) equipped with full quartz optics and fibres and a diffuse white reference standard (avantes ws-2). reflectance spectra of single scales were measured with a microspectrophotometer (msp) consisting of a leitz ortholux microscope connected with an avantes spectrometer. the objective was an olympus 20 (na 0.46) (for further methods details, see for instance vukusic and stavenga 2009). a philips xl-30 esem was used for sem. prior to observation, samples were sputtered with a thin layer of palladium or gold to prevent charging. for structural analysis of each species, layer thickness and periodicity were measured at minimally ten different spots of different electron micrographs. we investigated four pierid species where the males have a prominent structural colouration : g. cleopatra, g.rhamni, hebomoia glaucippe and colotis regina. the upper sides of the forewings as well as the hindwings of g. cleopatra and g. rhamni have a main yellow colour (fig. 1a, b, left column), due to the presence of the pterin pigment xanthopterin, but a large part of the forewings of g. cleopatra is orange coloured, due to erythopterin (wijnen. 2007). the hindwings of both gonepteryx species have small orange spots. the wings also exhibit a distinct short - wavelength reflection, restricted to the ultraviolet (uv ; fig. 1a, b, right column), which in g. cleopatra is spread out over both forewings and hindwings, but in g. rhamni is restricted to the forewings. the forewings and hindwings of the other two species, h. glaucippe and c. regina, are mainly white, due to the presence of leucopterin (wijnen. the forewings have characteristic, coloured tips ; orange and red - purplish, respectively (fig. the coloured wing tips also reflect strongly ultraviolet and blue light, respectively (fig. 1photographs of the upper sides of the wings of four pierid butterfly species ; left column rgb ; right column uv (ultraviolet). the wing tips of c. regina reflect strongly in the blue wavelength range and little in the uv (bars 1 cm) photographs of the upper sides of the wings of four pierid butterfly species ; left column rgb ; right column uv (ultraviolet). the wing tips of c. regina reflect strongly in the blue wavelength range and little in the uv (bars 1 cm) whereas the different pigmentary colourations are well understood, the structural colourations have been less well studied, and therefore we investigated the organization and structuring of the wing scales of the different species. figure 2 shows the scale organization in the forewings of g. cleopatra and in the wing tips of c. regina as observed with an epi - illumination light microscope. the ground scales can only be recognized where the cover scales have dissociated (fig. interestingly, the colour of the cover and ground scales can distinctly differ. in the orange area of the forewings of g. cleopatra, the cover scales are orange, but the ground scales are yellow, like the cover and ground scales in the hindwings. similarly, in c. regina, the ground scales in the dorsal wing tips are white, like the scales in the main wing area. the cover scales of c. regina have a shimmering blue line (fig. 2b, black arrowheads), which moves when the inspected wing part is rotated under the observation microscope. a dark - field epi - illumination microscopy of the orange area of the forewing of g. cleopatra. a few cover scales are lacking, revealing the yellow ground scales (white arrowhead). one cover scale is lacking, revealing a ground scale (white arrowhead ; bar 100 m). additionally, a blue tinted line is visible on the scales (black arrowheads) organization of the scale array. a dark - field epi - illumination microscopy of the orange area of the forewing of g. cleopatra. a few cover scales are lacking, revealing the yellow ground scales (white arrowhead). one cover scale is lacking, revealing a ground scale (white arrowhead ; bar 100 m). additionally, a blue tinted line is visible on the scales (black arrowheads) we investigated the structural details of the iridescent cover scales by sem (fig. 3). the upper side of the scales has densely packed slender longitudinal ridges, which are folded into a stack of lamellae. the scales were slightly flexed to force some of the ridges into side views of the lamellar stacks. the sem micrographs show that the number of the lamellae varies among the species. whereas the cover scales of h. glaucippe have ridges with 1012 lamellae (fig. 3d), in c. regina, the lamellar stack consists of 67 layers (fig. 3e, f). for both these cases, we studied both the forewings and hindwings of g. cleopatra, because reflectance measurements indicated structural differences (see below). underneath the ridges, a dense layer of pigment granules regina, f sectioned scales of c. regina showing that the ridges are folded into a multilayer. c the ridges were flexed to show the side - view of the lamellar stack (barsa e, f 1 m)table 1structural properties of the multilayer arrangement in the iridescent scales gained from electron microscopyspeciesnumber of layers, narrangementtilt angledc (nm)da (nm)g. regina67parallel097 698 6dc thickness of the cuticle layers, da thickness of the air layers (number of measurements n > 10) scanning electron micrographs of single scales with structural colouration. regina, f sectioned scales of c. regina showing that the ridges are folded into a multilayer. c the ridges were flexed to show the side - view of the lamellar stack (barsa e, f 1 m) structural properties of the multilayer arrangement in the iridescent scales gained from electron microscopy dc thickness of the cuticle layers, da thickness of the air layers (number of measurements n > 10) the organization of the iridescent cover scales and the ground scales appears to be rather different, as shown by the sem micrograph of two scales in the wing tip of h. glaucippe (fig. 4). the ridges are much more closely spaced in the cover scales than in the ground scales ; the ridge distance is about 0.4 and 0.8 m, respectively (fig. the lamellae of the cover scale ridges are elaborate but those of the ground scales are inconspicuous. in both the cover and ground scales, the crossribs, which connect the ridges, are adorned with a large number of beads, the pigment granules (fig. the open structuring of the scales results in scattering of incident light and, together with the pigments in the granules, thus will determine the colouration. as an example, fig. 4b shows the reflectance spectrum of the wing tip of h. glaucippe, which was measured with a bifurcated probe. the distinct reflectance band in the (ultra)violet wavelength range is caused by the multilayered ridges of the cover scales, acting as an interference reflector. the pigment granules of both the cover and ground scales absorb incident light in the short wavelength range, but at the longer wavelengths the scattered light is not absorbed and the granules then even enhance the light scattering (fig. the wavelength - selective pigment absorption and scattering along with wavelength - specific multilayer reflections thus cause the species - characteristic wing colours (wijnen.. 4scale anatomy and reflectance of the wing tip of the great orange tip, h. glaucippe. a scanning electron micrograph of a cover scale, with slender ridges consisting of a stack of parallel lamellae (black arrow), overlying a ground scale, with undifferentiated ridges (white arrow) and the edge of another ground scale. the ridges of both scale types are connected by crossribs with pigment granules (bar 2 m). b diagram showing the three mechanisms that determine the reflectance spectrum of the wing tip. the multilayers of the cover scale determine the reflectance band in the (ultra)violet ; the pigment granules absorb the light scattered in the short wavelength range, up to about 550 nm ; and the reflectance in the long wavelength range is determined by light scattering by the pigment granules and other scale components scale anatomy and reflectance of the wing tip of the great orange tip, h. glaucippe. a scanning electron micrograph of a cover scale, with slender ridges consisting of a stack of parallel lamellae (black arrow), overlying a ground scale, with undifferentiated ridges (white arrow) and the edge of another ground scale. the ridges of both scale types are connected by crossribs with pigment granules (bar 2 m). b diagram showing the three mechanisms that determine the reflectance spectrum of the wing tip. the multilayers of the cover scale determine the reflectance band in the (ultra)violet ; the pigment granules absorb the light scattered in the short wavelength range, up to about 550 nm ; and the reflectance in the long wavelength range is determined by light scattering by the pigment granules and other scale components we compared the spectral properties of the structurally coloured wing areas of the studied species by measuring the reflectance spectra from small circular areas (diameter 4 mm) with an integrating sphere (fig. all spectra had a similar appearance ; a short - wavelength reflectance band, with a rather variable amplitude, was separated by a reflectance minimum from a high reflectance plateau at long wavelengths, where the reflectance reached a value of about 0.5. the short - wavelength reflectance bands had a peak wavelength between 340 and 390 nm, except for that of c. regina, where the reflectance band peaked near 450 nm (fig. 5reflectance spectra of the iridescent wing areas of the pierid butterflies of fig. 1, measured with an integrating sphere (fw forewing ; hw hindwing) reflectance spectra of the iridescent wing areas of the pierid butterflies of fig. 1, measured with an integrating sphere (fw forewing ; hw hindwing) the measured wing reflectance is the cumulative result from both cover and ground scales. to distinguish both contributions, we used a microspectrophotometer to measure the reflectance spectra from individual cover and ground scales in the wing areas with structural colouration of g. cleopatra, h. glaucippe and c. regina (fig., we also measured from scales in adjacent, non - structurally coloured wing areas (fig. the reflectance of the ground scales was always low at short wavelengths and high at long wavelengths and only the cover scales had an additional reflectance band in the short - wavelength range, and. 6c), the measured ground scale, which was located in the wing tip, embedded in the lattice of cover scales, had a reddish reflection, showing that red light transmitted by the cover scales is partly reflected by the ground scales. in the intact wing, the light transmitted by the cover scales will be reflected by the ground scale and thus will increase the total reflectance signal.fig. 6reflectance spectra of cover and ground scales of the iridescent wing areas, together with spectra from a few other scale types, measured with a microspectrophotometer. ag. the cover scale is orange, because of a pterin pigment, and it has in addition a reflectance peak in the uv, due to multilayered ridges. the ground scale is yellow orange coloured, because of a slightly different pterin pigment composition. have the same pigmentation, but only the cover scale has a reflectance band in the violet. the brown scales in the wing margin (fig. the reflectance rise in the long - wavelength range is a clear sign of melanin pigment. the cover scale has a red colour due to a pterin pigment absorbing in most of the visible wavelength range and a blue colour due to the iridescent ridges, making together a purplish colour (rotated indicates that the cover scale was rotated away from the iridescence). the measured ground scale was located in the wing tip area where the cover scales were missing (see fig. the ground scale itself was white, but the increased reflectance in the red, above 600 nm, originated from red light scattered by the adjacent cover scales that was subsequently scattered by the white ground scale reflectance spectra of cover and ground scales of the iridescent wing areas, together with spectra from a few other scale types, measured with a microspectrophotometer. the cover scale is orange, because of a pterin pigment, and it has in addition a reflectance peak in the uv, due to multilayered ridges. the ground scale is yellow orange coloured, because of a slightly different pterin pigment composition. have the same pigmentation, but only the cover scale has a reflectance band in the violet. the reflectance rise in the long - wavelength range is a clear sign of melanin pigment. the cover scale has a red colour due to a pterin pigment absorbing in most of the visible wavelength range and a blue colour due to the iridescent ridges, making together a purplish colour (rotated indicates that the cover scale was rotated away from the iridescence). the measured ground scale was located in the wing tip area where the cover scales were missing (see fig. the ground scale itself was white, but the increased reflectance in the red, above 600 nm, originated from red light scattered by the adjacent cover scales that was subsequently scattered by the white ground scale the spectra of figs. 5 and 6 give only limited information about the reflection properties of the wing scales. in the integrating sphere, the illumination was a narrow beam, hitting the wing approximately normally (beam direction ~8 off normal), and the integrating sphere integrated the light backscattered into the hemisphere above the wing plane (fig. 5). in the case of the microspectrophotometer, an objective with a limited aperture delivered the incident light and collected the backscattered light (fig., we measured the angle - dependent reflectance of the iridescent wing areas in a plane perpendicular to the wing surface and parallel to the local scale ridges. the investigated wing part was positioned at the cross - section of the measurement plane and the shared rotation axis of both illumination and measurement fibres. the angle of illumination was varied in discrete steps, and the detection angle was varied until a maximal signal for the short - wavelength reflection was obtained. for all investigated specimens, this resulted in an angle - dependency, which was mirror symmetric around a fixed offset - angle () where the angle of illumination and detection were identical. figure 7a, b present the reflectance spectra obtained from h. glaucippe and c. regina. the spectral position of the short - wavelength bands progressively changed with increasing angle of light incidence, thus confirming that the wing tips of h. glaucippe and c. regina are iridescent. figure 7c shows the dependence of the reflectance peak wavelength of the short - wavelength band on the angle of incidence. estimation of the peak wavelengths was slightly ambiguous for h. glaucippe, because the short - wavelength reflectance band became multipeaked with increasing angle of incidence. nevertheless, in all studied species, the reflectance peak - wavelength showed a clear dependence on the angle of light incidence, very similar to that for multilayered structures, where the value of the reflectance peak wavelength is maximal for normal light incidence and decreases with increasing angle of incidence. however, the maximal peak wavelengths for h. glaucippe (380 nm) and c. regina (480 nm) were found for an offset - angle of 15 and 35 against the wing normal, respectively (fig. 7c ; here a positive angle indicates a direction inclined towards the wing apex). apparently, therefore, the lamellae of the cover scales have an inclination angle of 15 and 35 with respect to the wing plane. figure 7c also includes the dependence of the reflectance peak wavelength on the angle of incidence for the structurally coloured wing areas of the two gonepteryx species.fig. = 15 indicates the angle of incidence where the uv - reflectance was maximal. the uv - reflectance band shifts towards shorter wavelengths, as expected for a multilayer reflector. the blue reflectance band is maximal for an angle of incidence = 35. the dependence of the reflectance spectra on the angle of incidence is essentially identical to that of h. glaucippe. c peak wavelength of the iridescence band as a function of angle of incidence, with negative angles signifying a tilt of the ridge multilayers towards the wing base. the values for h. glaucippe (orange circles) and c. regina (red squares) were derived from a and b. similar measurements yielded the peak wavelengths for g. cleopatra (black left triangles, blue down triangles) and g. rhamni (green up triangles). the smooth curves are fits with the interference condition angle - dependent spectra showing iridescence. ah. = 15 indicates the angle of incidence where the uv - reflectance was maximal. the uv - reflectance band shifts towards shorter wavelengths, as expected for a multilayer reflector. the blue reflectance band is maximal for an angle of incidence = 35. the dependence of the reflectance spectra on the angle of incidence is essentially identical to that of h. glaucippe. c peak wavelength of the iridescence band as a function of angle of incidence, with negative angles signifying a tilt of the ridge multilayers towards the wing base. the values for h. glaucippe (orange circles) and c. regina (red squares) were derived from a and b. similar measurements yielded the peak wavelengths for g. cleopatra (black left triangles, blue down triangles) and g. rhamni (green up triangles). the smooth curves are fits with the interference condition scale lamellae inclined with respect to the wing plane can be due to the scale being at an angle with respect to the wing surface and/or due to the scale multilayers being tilted at an angle with respect to the plane of the scale. 3 show that the tilt angle between the lamellae and the scale surface differs among the species. in h. glaucippe (fig. the inclination angles for these species of 15 and 35, respectively, concluded from the arms (fig. 7c), hence must be due to tilting of the cover scales with respect to the wing plane. visual inspection of the wings of the two species confirmed a clearly different - angled rooting of the scales in the wing plane for the two species. in g. cleopatra and g. rhamni, the lamellae are tilted with respect to the scale plane, with an angle of approximately 46 (table 1). presumably the different structure of the ridges, i.e. parallel versus angled lamellae, is related to the different steepness of the iridescence curves for the different species of fig. the reflectance spectra of reflecting multilayers are determined by the refractive indices of the layers and their thicknesses. the reflecting ridges of the cover scales consist of layers of air and cuticle, which have refractive indices of na = 1.0 and nc = 1.56, respectively (vukusic. the layer thicknesses of the cover scale lamellae can be derived from the sem data (fig. 3). in the case of the blue - reflecting scales of c. regina, the thickness of the air layers was da 100 nm and that of the cuticular layers was dc 95 nm. in the lamellae of the cover scales of the other species, reflecting maximally in the uv, the thickness of the air and cuticular layers was da 70 nm and dc 65 nm, respectively. the interference condition for reflecting multilayers predicts how the reflectance peak wavelength depends on the layer thickness and the angle of light incidence : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ \lambda_{\max } = 2(n_{\text{a } } d_{\text{a } } \cos \theta_{\text{a } } + n_{\text{c } } d_{\text{c } } \cos \theta_{\text{c } }) $ $ \end{document } ; a and c are the angle of incidence at the layers, which are related to each other by snell s law : \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ n_{\text{a } } \sin \theta_{\text{a } } = n_{\text{c } } \sin \theta_{{_{\text{c } } } } $ $ \end{document } (land 1972 ; kinoshita 2008). we have implemented the interference condition in fig. reasonable fits of the experimentally derived peak wavelengths with values following from the interference condition were obtained for h. glaucippe with da = dc = 75 nm, for c. regina with da = dc = 93 nm, for g. cleopatra fw with da = 71 nm and dc = 65 nm, for g. cleopatra hw with da = 74 nm and dc = 67 nm, and for g. rhamni with da = 69 nm and dc = 71 nm (fig. figure 8 shows the maximal reflectance of the iridescence bands, derived from the integrated sphere spectra (fig. 5), plotted as a function of the number of lamellae in the cover scale ridges, derived from sem micrographs (fig. such a simple connection might have been predicted when the area of the lamellae in the scales of the different species is the same. sem data indeed suggests that the average width of the lamellae is approximately constant, 300 nm.fig. 8dependence of the peak integrated reflectance in the short - wavelength band, rmax, on the number of layers in the ridges, n, fitted with a linear function : rmax = sn, with slope s = 0.029 (dashed line) dependence of the peak integrated reflectance in the short - wavelength band, rmax, on the number of layers in the ridges, n, fitted with a linear function : rmax = sn, with slope s = 0.029 (dashed line) in this study, we have investigated the wing colours of the males of four pierid butterfly species. the wings contain pterin pigments responsible for pigmentary colouration, and the stacked lamellae of cover scales create structural colouration. the ridges act as iridescent reflectors, that is, the reflectance spectra shift to shorter wavelengths when the angle of light incidence increases. this phenomenon has been described before for a number of species of the pierid subfamily coliadinae : anteos clorinde, eurema candida, e. hecabe and e. lisa (ghiradella. 1972 ; rutowski. the wings of both male and female a. clorinde and e. hecabe have reflectance spectra with bands in the uv, also due to multilayered ridge lamellae, but in e. candida only males have iridescent wings. the reflectance spectra of the structural - coloured wings were shown to exhibit specific bands, and the dependence of the peak wavelength of the spectral bands on the angle of incidence was fitted with a linear function (rutowski. we have found here that the angle - dependence is cosine - like (fig. the ridge lamellae of morpho and pierid butterflies seem to behave as multilayers, but classical multilayer theory can not be fully applied, of course, because the layer planes must then be large with respect to the light wavelength. in h. glaucippe and c. regina, the longitudinal dimension of the lamellae is certainly sufficiently large, but the width of the lamellae is much smaller than the light wavelength. this will result in considerable diffraction in a plane perpendicular to the longitudinal axis of the ridges. 1999 ; kinoshita. 2002 ; stavenga. 2009 ; vukusic and stavenga 2009). in both the reflectance spectra measurements with the integrating sphere (fig. 7a, b), the incident illumination was about normal to the wing surface, but the resulting spectra for h. glaucippe and c. regina were far from identical. the reason is that in the former case all hemispherically scattered light was measured, while in the latter case only light reflected in a rather small angle near the normal was captured. the spectra of the light diffracted into larger angular directions (that is, in the plane normal to the ridge axis) is increasingly short - wavelength shifted (not shown here, but see for this diffraction phenomenon in morphoaega, fig. the space averaged iridescence reflectance band of c. regina therefore peaks at about 460 nm. interestingly this value corresponds closely to the peak wavelength of blue - sensitive photoreceptors of pierid butterflies (arikawa. whereas in c. regina (and some other members of the colotis group), the wing reflectance spectra have a blue - peaking spectral band (wijnen. 2007 ; 2008), in virtually all studied species, the structural colouration bands are restricted to the uv (ghiradella. 1972 ; silberglied and taylor 1973 ; kemp. 2005 ; rutowski. 2007a ; wijnen. the dominant presence of the uv - peaking reflectance bands suggests that a uv reflector creates a signal that strongly contrasts with that from common objects in the environment. the uv reflectance bands also seem to match well the sensitivity spectra of the uv photoreceptors of pierids, peaking at around 360 nm (stavenga and arikawa 2006 ; pirih. presumably, the structural colouration is designed to enhance the visibility for intraspecific chromatic signalling. as opposed to morpho butterflies, which have a single - peaked blue reflectance, most iridescent pierid butterflies seem to use the strategy of shifting the iridescence to the uv and complementing it with a diffuse yellow red pigmentary colouration. in the two gonepteryx species as well as most other studied coliadinae, the ridge lamellae are tilted with respect to the scale plane (ghiradella. parallel lamellae were also shown for eroessa chiliensis (ingram and parker 2008), a member of the tribe anthocharidini, belonging to the pierid subfamily pierinae (another member of the same tribe with iridescence is anthocharis sara ; scott 1986). iridescence and the peak intensity of the created signal proved to be an important factor for mating success in the pierid eurema hecabe (kemp 2006) and also in the nymphalid hypolimnas bolina (kemp 2007). in the investigated pierids, the structural colouration is most visible when seen from above, near the multilayer structure s normal. this normal can be tilted with respect to the scale s surface, which itself can be tilted with respect to the wing plane. the sum of the tilt angles can lead to a very restricted visibility of the butterflies, as was shown in ancyluris meliboeus (vukusic. | the wings of most pierid butterflies exhibit a main, pigmentary colouration : white, yellow or orange. the males of many species have in restricted areas of the wing upper sides a distinct structural colouration, which is created by stacks of lamellae in the ridges of the wing scales, resulting in iridescence. the amplitude of the reflectance is proportional to the number of lamellae in the ridge stacks. the angle - dependent peak wavelength of the observed iridescence is in agreement with classical multilayer theory. the iridescence is virtually always in the ultraviolet wavelength range, but some species have a blue - peaking iridescence. the spectral properties of the pigmentary and structural colourations are presumably tuned to the spectral sensitivities of the butterflies photoreceptors. |
lightning provides the most powerful natural accelerator available on earth for producing high - energy particles. intense millisecond - scale bursts of gamma - rays produced by upward moving electrons accelerated to energies of tens of mev or more have been detected with satellite instruments. these terrestrial gamma flashes (tgfs) have been shown to be associated mainly with positive polarity intracloud lightning, with the particle acceleration occurring at altitudes of 1015 km. we show here that negative polarity cloud - to - ground lightning accelerates particles downward and produces gamma - rays with energies of at least 2 mev. we present a sample of 24 tgfs detected at ground level associated with nearby (50 kev events in a single detector box for 1 day. the total count rate, plotted in counts per minute, is reasonably constant for the first 17 h and then increases by a factor of approximately 2 beginning at about 1800 cst. the small peak in the count rate seen at about 1200 cst is due to noise in the system seen only in a single pmt on a 60 s timescale. the thin black histogram near the bottom shows the local radar reflectivity in decibels acquired from www.wunderground.com, indicating rain, thunderstorms, hail, or strong winds. the gamma - ray spectrum, measured during a rain event with the high - resolution labr3:ce detector mounted together with the nai detectors in one of the detector boxes, shows a clear indication of 295, 352, 609, 1120, and 1764 kev bi and pb lines characteristic of radon decay (figure 2). summed nai counting rate per minute in box 3 on 18 august 2011 (heavy black line, left - hand scale). thin black histogram near the bottom (right - hand scale) shows radar reflectivity. the row of filled circles near the top marks intervals in which the count rate in 60 s bins exceeds the day 's average by 3 ; the open square marks the tetra trigger, i.e., the interval when the rate in 2 ms bins exceeds the day 's average by 20. labr3:ce rain spectrum. labr3:ce background - subtracted spectrum during a 6 h precipitation event showing radon lines at 295 kev, 352 kev, 609 kev, 1120 kev, and 1764 kev. the filled rectangle near the bottom of figure 1 at approximately 1800 cst marks the times of lightning strikes detected by the u.s. precision lightning network (uspln) unidata program within 8 km of the lsu campus. these are mainly cloud - to - ground events with positions accurate to approximately 0.4 0.8 km. in the upper section of the diagram, the line of filled circles marks 60 s intervals in which the nai detector count rate is 3 standard deviations higher than the average rate for the day ; these are correlated with the peak of the extended rise at the time of the rainstorms. tetra triggers are defined as intervals during which the rate in a 2 ms window exceeds the day 's average by 20. the tetra trigger observed is indicated near the top of the plot as an open square. (for a typical average counting rate of 8900 min in a detector box above 50 kev, a 20 excess corresponds to 10 counts in the three pmts in a detector box within a 2 ms window.). figure 3 shows an expanded view of the data on the same day, illustrating the correlation of the triggers in individual boxes with lightning and cloud density overhead. figure 3b shows the rate per second of lightning strikes within 8 km of the detectors, and figure 3c shows the distance of all lightning strikes recorded by the uspln network within 160 km. (a) triggers detected on 18 august 2011 (nai signals above 50 kev in a single detector box with count rate per 2 ms in excess of 20 above the 18 august 2011 daily mean counting rate). box 1 triggers are indicated by plus signs, box 3 by triangles, and box 4 by squares. (b) rate per second of uspln lightning strikes within 8 km (c) distance to each recorded lightning strike within 160 km (d) overhead cloud density. from july 2010 through february 2013, tetra has recorded a total of 24 events with triggers occurring within several minutes of thunderstorm activity producing at least one lightning flash within 8 km of the detectors. such events are classified as event candidates (ecs) and are listed in table 1. in this table each event trigger time is listed, along with the number of lightning flashes detected within 2.5 min and 8 km and the cloud density above tetra. also listed for each ec is the time difference to the lightning stroke closest in time to the event trigger, the distance to that lightning stroke, the current, the number of gamma - rays detected in the ec, and the t90 duration of the event (i.e., the time over which a burst emits from 5% to 95% of its total measured counts in a single detector box). the number of sigma above the mean is listed in the second to last column for each event. (for the first three events in the table, observed simultaneously in multiple detector boxes, the smallest number of sigma above the mean is listed. these coincident events, labeled coincident event candidates cecs are discussed in more detail below.). properties of the 24 event candidatesa cecs are listed in the top section ; ecs for which the absolute timing uncertainty is known are listed in the middle section ; and ecs for which the absolute timing uncertainty is unknown are listed in the bottom section of the table. the date and time of each ec trigger are listed, along with the properties of the storm associated with each event. the properties of the associated lightning, event duration, number of gamma - rays detected, total energy, and event significance are also listed for each event. the probability of each cec occurring is listed in the last column for the cecs. tetra 's events, with an average of 20 2 photons detected, are significantly smaller than the typical events observed in space. for tetra 's events, the t90 duration was calculated by considering all events detected within a 3 ms window around the trigger time, discarding the first and last 5% of timestamps for each event, and recording the time difference between the first and last events remaining. the uncertainty in the t90 determination is approximately 200 s based on monte carlo simulations of the data. in each of the 24 events, 7 to 45 -rays were detected within a time window of less than 5 ms, with the total energy deposited per event ranging from 2 to 32 mev. the distances to the nearest lightning flashes were 0.64.7 km. for 14 events, absolute timing was available with 2 ms accuracy. for each of these 14 events, lightning was observed within 7 s of the trigger time. nine of these events were associated with cg lightning detected within 6 ms of the trigger. july 2012 during a period when accurate trigger - lightning time differences were not recorded due to network timing difficulties. eight of the ecs during that period were correlated with two intense thunderstorms that passed directly over tetra on 6 june 2012. the accidental rate of triggers coincident within 7 s of a lightning flash that is less than 8 km distant (i.e., events masquerading as ecs) is calculated based on the rate of tetra triggers (due mainly to cosmic ray showers), the live time, and the duration of storm activity. the storm activity time is taken to be the sum of all time windows where there was lightning within 8 km and 7 s, and there was no electronic noise or other instrumental problems. for a total storm time of 12.65 h, we calculate the expected number of ecs due to accidental triggers to be 0.82. the efficiency of the uspln in our area has not been tested ; however, if we assume a similar sensitivity to that measured by jacques. for cloud - to - ground lightning with peak current in excess of 20 ka of approximately 25% to account for undetected lightning flashes figure 4 compares data acquired within 7 s of lightning to the remaining data with accurate timing information. the distribution of events versus within 7 s of a uspln lightning strike within 8 km is shown in black. the significance distribution of the remaining data has been normalized to the total storm activity time of the lightning distribution for comparison, shown in grey. the excess of events above 20 sigma in the lightning distribution (black) as compared to the normalized distribution (grey) indicates the association of the gamma - ray events with nearby lightning. (note that since three events involve seven separate coincident triggers in individual detector boxes, there are 18 individual triggers shown in figure 4 compared to the 14 ecs with accurate timing information in table 1.) a kolmogorov - smirnov test of the two distributions results in a d parameter of 0.25, corresponding to high confidence that the two distributions are distinct. distribution of events with significance. distribution of events within 7 s of nearby (20. the dark solid line in figure 5 shows the deposited energy spectrum of the 24 event candidates, with events observed up to 2.7 mev deposited energy. it should be emphasized that with tetra 's thin detectors, only a portion of the incident gamma - ray energy is actually detected. between 200 kev and 1.2 mev, the ec spectrum is fit with a power law e, with = 1.20 0.13 and /degree of freedom = 0.4 (dashed dark line). on the same figure, the grey line shows the spectrum of non - ec triggers (i.e., triggers not associated with lightning within 5 mi and 7 s) ; this spectrum is softer, with a best fit power law index = 1.79 0.04 and /degree of freedom = 1.0 (dashed grey line). the associations of the events reported here with negative polarity lightning strikes and the low likelihood that these are background events, along with the durations observed, are indicative of downward directed tgfs produced by the rrea mechanism. spectrum of non - ec tetra triggers (triggers not associated with lightning nearby in time and distance) is shown in grey. power law fits between 200 kev and 1200 kev of the form e are shown with dotted lines, where = 1.20 0.13 and 1.79 0.04 for ec and non - ec events, respectively. in three of the 24 ecs, triggers were recorded in two or more boxes separated by 1000 m within less than 2 ms. all three of these coincident event candidates (cecs) occurred in july and august of 2011, when storms in southern louisiana tend to be associated with disturbances in the gulf of mexico rather than frontal lines. the plot shows a 50 ms window centered on the event trigger time, defined as the center of the first 2 ms bin containing a trigger. the counts for each box (i.e., the number of phototubes detecting a signal with amplitude in excess of 50 kev within the 1 s pmt anode output integration time) are plotted versus time relative to the event trigger time. for the two events on 31 july 2011 (figures 6a and 6b), the lightning strikes closest in time occurred within approximately 6 and 4 ms of the event trigger. for those cases, the time of the lightning strike is shown as a cross with a timing uncertainty of 2 ms near the top of the plot. in the first 31 july 2011 event (figure 6a), one pmt in box 3 fired, followed by two pmts in box 4 2.3 ms later. the distance between the two boxes was 1500 m, corresponding to a gamma - ray travel time difference of up to 5 s. in fact, we believe the differences between the event times in the separate boxes in figure 6 are a direct measure of the absolute timing differences between the boxes. nai time histories over 50 ms window centered on the trigger time for each cec. lightning strikes within 8 km in the 50 ms window have a 2 ms timing uncertainty and are shown with crosses. the box 3 time history is centered at 0 ms and box 4 at 2 ms. a uspln lightning strike within 8 km is indicated by the cross at 6 ms. the box 3 time history is centered at 0 ms and box 4 at 2 ms. a uspln lightning strike within 8 km is indicated by the cross at 4 ms. (c) the event on 18 august 2011 at 17:57:38.984 cst with the box 3 time history centered at 0 ms, box 1 at 2 ms, and box 4 at 4 ms. no uspln lightning was detected within 8 km within this 50 ms window. the expected number of cecs due to random triggers is small : given an initial ec with counting rate in one box in excess of 20 above the daily average, the likelihood that a second or third trigger occurred at random in another box within the timing uncertainty of 2 ms on the same day is estimated as (4 ms n/86,400 s), where n is the total number of random 20 triggers detected per day through february 2013 and b is the number of boxes triggered in the event. (for simplicity, we neglect here the increase in trigger rate during a thunderstorm shown in figure 1.) multiplying by the number of ecs then gives the expected number of spurious cecs involving two boxes occurring by chance as 1.7 10, as listed in table 1. a composite energy spectrum summed over the three cecs is shown in figure 7. a total of 80 gamma - ray pulse heights above 50 kev and within the t90 interval of each coincidence trigger are shown. the average photon energy detected is approximately 0.5 mev, an energy at which the fraction that passes through a nominal 1.6 km of atmosphere at ground level (stp) without interaction is 10. this average energy is low compared to the typical energies observed by the orbiting detectors [dwyer., 2012a ] and is presumably biased to low energies by the 0.5 cm thickness of the tetra nai scintillators. eighty photons were detected within the t90 interval of each individual detector box 's trigger time. figure 8 shows the distance from the detectors and the measured current for each lightning flash within 8 km of tetra from 1 july 2010 to 28 february 2013. there were a total of 5360 flashes within 8 km. for each of the 10 ecs and cecs with lightning within 8 km and 100 ms of the trigger time, although all the tetra events correspond to lightning less than 5 km away, the two lightning flashes within 100 ms of a cec are both more than 2 km away. if all discharges produce tgfs [stgaard., 2012 ], then the rate of detection and the cec distances point to either a range of intensities extending below the sensitivity limit of tetra, strongly nonisotropic emission, or the possibility that the gamma - ray emission is only indirectly associated with the lightning [connaughton., 2013 ]. this can also occur if some gamma - ray events are produced by intracloud (ic) strikes, since the uspln data record primarily cloud - to - ground strikes. all lightning activities within 8 km of tetra from 1 july 2010 to 28 february 2013. the current and distance for all uspln lightning flashes within 8 km of tetra are indicated by grey crosses. lightning strikes that are within 8 km and 100 ms of an ec or cec are considered coincident strikes and are plotted with black crosses. the vertical line at 0 ka indicates ic lightning. out of the 10 ecs shown in figure 7, nine were found to be within 6 ms of a negative polarity cg lightning strike within 5 km with current above 20 ka (table 1). for the two cecs that occurred on 31 july 2011, lightning strikes are recorded at 6 ms and 4 ms before the tetra triggers. in both cases, these were nearby, cloud - to - ground events at 2.3 km distance with current 43.6 ka and 2.9 km distance with current 29.1 ka. for four ecs with accurate timing information, the lightning strikes closest in time to the tetra triggers were in excess of 100 ms before or after the nai signal and so are not considered coincident with a uspln observed strike. again, this can occur if some gamma - ray events are produced by intracloud (ic) strikes or if the gamma - rays are not all directly associated with the lightning. the gamma - ray events described here have durations ranging from 24 s to 4.2 ms. the similarity of these event durations observed by tetra to those reported by batse, rhessi, agile, fermi, and iclrt suggests that the tetra events are also generated by the rrea mechanism. dwyer. [2012b ] compared the spectrum of x - rays from lightning to gamma - rays from tgfs, showing a marked difference above 2 mev, but the restricted energy range of tetra and the low statistics make it impossible to draw strong conclusions from the observed tetra spectra. fermi gbm data suggest that wwlln detects shorter duration tgfs more efficiently than the longer ones because of the frequency constraints of the network (between 6 and 18 khz). for the sferic signals found within a 400 s window around the tgf gammas, the stronger sferics appear due to the tgf itself while the weaker sferics are due to associated + ic lightning [connaughton., the brightest tgfs seen by batse, rhessi, and gbm produce 10 runaway electrons with a source altitude 13 km [briggs., in contrast, the two tgfs previously reported from the ground by iclrt are associated with cg lightning [dwyer., 2004, 2012b ]. the 2009 iclrt event produced 10 runaway electrons and was observed at a distance of 2 km. if the tetra events are characterized by typical energy 500 kev and distance 1.6 km, then atmospheric absorption attenuates the flux by a factor of 4 10 at sea level. assuming isotropic emission at a distance of 1.6 km, a typical total of 20 photons observed in an event by tetra then requires in excess of 10 photons at the source. either the ground level tetra events are beamed or they are distinctly different from the iclrt events. here we have presented data for a series of gamma - ray events observed with a self - triggered ground array, suitable for observing weak events from nearby distances without a bias caused by a lightning trigger, and find that events with durations < 5 ms and detected individual photon energies up to at least 2 mev appear to be produced in conjunction with nearby cg lightning. in two cecs, these are most closely associated with cg events 2.3 and 2.9 km away. in the other cec event, the nearest detected lightning strike in time is more than 6 s after the gamma - ray event. either this gamma - ray event is not correlated with nearby lightning, the associated cg lightning strike was missed by the lightning network, or the event was due to ic lightning that was not detected by the lightning network. | [1 ] terrestrial gamma - ray flashes (tgfs)very short, intense bursts of electrons, positrons, and energetic photons originating from terrestrial thunderstorms have been detected with satellite instruments. tgf and energetic thunderstorm rooftop array (tetra), an array of nai(tl) scintillators at louisiana state university, has now been used to detect similar bursts of 50 kev to over 2 mev gamma - rays at ground level. after 2.6 years of observation, 24 events with durations 0.024.2 ms have been detected associated with nearby lightning, three of them coincident events observed by detectors separated by 1000 m. nine of the events occurred within 6 ms and 5 km of negative polarity cloud - to - ground lightning strokes with measured currents in excess of 20 ka. the events reported here constitute the first catalog of tgfs observed at ground level in close proximity to the acceleration site. |
decompressive craniectomy is widely performed to reduce uncontrollable intracranial pressure (icp) which is difficult to treat by medical management alone5). to date, only a few cases of paradoxical herniation have been reported, and to our knowledge, only one report on paradoxical herniation after decompressive craniectomy for traumatic brain injury has been issued in korea3). in that case, however, it was not related to lumbar puncture. measures are needed to raise intracranial pressure against the forces generated by atmospheric pressure and herniation. here, we present an uncommon case of paradoxical transtentorial herniation after lumbar puncture, which was reversed by the trendelenburg position and sufficient hydration. two hours after the accident, he became stuporous with glasgow coma scale of 9. brain computed tomography (ct) revealed a hemorrhagic contusion in the right frontotemporoparietal region and acute epidural hematoma in the left temporo - occipital region (fig. routine laboratory tests, which included platelet count, prothrombin time, and activated partial thromboplastin time were within normal limits. the patient underwent emergent decompressive craniectomy on right frontotemporoparietal region, followed by craniotomy for removal of epidural hematoma on the left side (fig. postoperatively, he became conscious and was able to obey commands without any neurologic deficit. five weeks later, he complained of a febrile sensation and had fever by 38.0. brain ct scan showed no midline shift (fig. he underwent an uncomplicated lumbar puncture with an 18-gauge spinal needle followed by the drainage of only 20 ml csf. csf analysis revealed 4 wbc cells / mm with glucose level of 50 mg / dl. two days later he was found to be deeply drowsy with left hemiparesis to the extent of having difficulty to obey commands. cranioplasty was performed 4 months after the head injury and brain ct after cranioplasty showed complete resolution of the shift (fig. the indications of decompressive craniectomy are expanding1). these include traumatic brain injury with medically refractory intracranial pressures, subdural hematoma, and cerebral swelling due to vasospasm after a subarachnoid hemorrhage. due to the fact that the cranium of the patients who have undergone craniectomy does not provide a rigid structure, the ' invisible ' mass effects of atmospheric pressure and gravity can overwhelm the intracranial contents and transtentorial herniation is possible even in the absence of increased icp7). paradoxical herniation has been referred to as the herniation of a brain that has been decompressed surgically, without any extra - axial lesion that could account for the herniation7,11). those treatments for lowering icp, such as mannitol, csf drainage, and hyperventilation, all of which follows the monro - kellie doctrine will exacerbate paradoxical herniation, because lowering intracranial pressure increases the pressure gradient across the craniectomy defect6,7). this phenomenon is related to the negative gradient between atmospheric and intracranial pressures, which can be exacerbated by an upright posture, csf leakage, or dehydration4). patients who have undergone csf drainage, such as, external ventriculostomy, ventriculoperitoneal shunt placement, or lumbar puncture are more susceptible to this phenomenon, for these conditions can lower icp states relatively than that of extra - cranial pressures. in these situations, the brain is sucked down through the tentorial incisural notch essentially and the foramen magnum potentially6). several authors have claimed that skull defects may create a siphon effect on csf dynamics, which distorts the dura, underlying cerebral cortex, and venous return, due to scarring and direct pressure to the brain2,9). symptoms may include focal deficits, brainstem release signs, autonomic instability, changes in level of consciousness, and pupil changes3,4). there are few cases of paradoxical transtentorial herniation after lumbar puncture causing negative pressure gradient between the intracranial space and the spinal canal7,11). because it is exacerbated by a negative pressure gradient,, we could obtain immediate neurological recovery by placing the patient in the trendelenburg position and by hydrating adequately. furthermore, cranioplasty, conceptual conversion of an ' open box ' to ' closed box ' can sometimes be the definitive treatment for paradoxical herniation. the striking neurological improvements observed in some cranioplasty patients with deteriorated consiousness, particularly in those with sunken scalp flaps, lead to the recognition of ' the syndrome of the trephined'5). schiffer.10) and liao and kao6) reported that focal neurological deterioration could be improved after skull defect reconstruction in some hemicraniectomy patients. we successfully managed our patient by adopting the trendelenburg position and sufficient hydration and by performing early cranioplasty. we advise that the possibility of paradoxical herniation in patients who have undergone decompressive craniectomy when lumbar puncture is performed and lumbar puncture should be carried out carefully in patients with decompressive craniectomy. although it has been rare, neurosurgeons should keep in mind the possibility of paradoxical herniation in patients that have undergone decompressive craniectomy whenever lumbar puncture is inevitable. we recommend that the trendelenburg position with adequate hydration and subsequent cranioplasty should be considered as a preferential treatment option. | although decompressive craniectomy is an effective treatment for various situations of increased intracranial pressure, it may be accompanied by several complications. paradoxical herniation is known as a rare complication of lumbar puncture in patients with decompressive craniectomy. a 38-year - old man underwent decompressive craniectomy for severe brain swelling. he remained neurologically stable for five weeks, but then showed mental deterioration right after a lumbar puncture which was performed to rule out meningitis. a brain computed tomographic scan revealed a marked midline shift. the patient responded to the trendelenburg position and intravenous fluids, and he achieved full neurologic recovery after successive cranioplasty. the authors discuss the possible mechanism of this rare case with a review of the literature. |
ulcerative colitis (uc) is defined as chronic idiopathic inflammatory condition of gastrointestinal tract characterized by presence of blood in diarrhoeal stool. the other diseases included under ibd, that is, crohn 's disease (cd) and irritable bowel syndrome (ibs), are also of unknown aetiology. efforts are being made for last few decades to find out specific pathogen / s causing uc but without any success. the incidence of uc has been observed to be varying with socioeconomic and geographical conditions. while uc is more prevalent in developing tropical countries, prevalence of cd dominates in developed temperate climate countries [4, 5 ]. recent trends indicate that in western europe and north america (with better hygiene) the figure for incidence of uc is either stabilized or decreasing, and developing countries are now being reported to have very high prevalence of uc. it is very well known that many of the enteric pathogens, that is, salmonella spp., yersinia enterocolitica, listeria monocytogenes, mycobacterium species, clostridium difficile, and so forth, and several of parasitic, viral, and fungal agents are highly prevalent in countries with poor sanitary conditions [611 ]. further, very recently a study from north india has reported that low hygiene and exposure to infections may be associated with increased risk of uc. the predominance of uc over cd in underdeveloped countries along with the reports showing increased short- and long - term risk of inflammatory bowel diseases after salmonella and campylobacter enteritis infections [911 ] suggests possible role of infectious agents causing uc. therefore, we can say that a specific pathogen has not been detected yet in ibd cases. however, we can say that failure in detection of such pathogens may be due to inadequacy of methods or complexity of gastrointestinal microbial flora. as far as inadequacy of methods is concerned, bacteria implicated may be in viable but not cultivable form as happens in most of the chronic infections. further, less sensitive conventional methods of detection may be the reason for the nondetection of specific pathogen / s in uc cases. however, in the recent past extremely sensitive molecular method, nested pcr in particular has been found to detect as low as 3 microbes per clinical specimen. nested therefore, we decided to see the presence of salmonella species in antral biopsy and stool specimens collected from uc, ibs, colon cancer, and healthy control to explore the possibility of its association with uc in the eastern part of northern india. a total of 404 samples having mean age 36.21 (13.639) were taken among which 59 cases of ulcerative colitis, 28 of colon cancer, 127 of irritable bowel syndrome, and 190 cases of apparently healthy controls were included in the present study conducted from july 2009 to february 2015 from inpatients and outpatient department of s. s. hospital, banaras hindu university, varanasi. the diagnosis of the patients with uc and colon cancer was done by lower gastrointestinal endoscopy, histopathology of rectal biopsy, and ct scan. diagnosis of ibs was done by lower gastrointestinal endoscopy and rome iii classification / criteria. patients having comorbid systemic illness, hiv, and mental and emotional disorders were excluded from the study. rectal biopsies of the patients having positive endoscopic finding and stool samples from healthy control were taken after well informed written consent. about 5 ml of blood was collected by venipuncture aseptically in a sterile clot activator vial. serum was separated and subjected for widal and indirect haemagglutination assay (iha) and specimens were preserved at 80c for further use. widal test was performed by using standard protocol given by manufacturer 's guideline (span diagnostics, india). the antibodies titre 1 : 160 against to, th, and ah antigen was considered significant in the present study. for the iha test, antibodies against vi antigen (viab) were measured following the method described by barrett and a titer of 160 was considered as significant to diagnose chronic typhoid carriers. extraction of genomic dna from rectal biopsies and stool samples was done using modified phenol - chloroform and proteinase - k method described by sambrook and russell and van zwet., about 100 ng quantity of extracted genomic dna from rectal biopsy and stool specimens were subjected to specific gene sequences amplification of typhi and paratyphi a. the primers used in this study were designed by song. which was further modified by frankel. however, for staa gene of s. typhi and stkg gene of s. paratyphi a, primers used were taken from the previous studies [19, 20 ] (table 1). the reaction mixture for the first - round pcr contained 2.5 l of 10x pcr buffer (100 mm tris - hcl, 1.5 mm mgcl2, 50 mm kcl) (genei, india), 10 pmol of each primer (staa f1, staa r1 and st1, st2 for s. typhi ; stkg f1, stkg f2 for s. paratyphi a) (sbs genetech co., ltd., china), 2 l (2.5 mm each) of dntps mix (genei, india), 0.33 l (1 unit) of taq dna polymerase (genei, india), and 5 l of dna template (100 ng), and final volume of 25 l was adjusted with hplc - grade sterile water. the nested pcr master mix was the same as that of the first - round pcr, except that it contained 10 pmol of each of the primers staa f2, staa r2 (st1 and st2) for s. typhi and stkg f2 and stkg r2 for s. paratyphi a and 2 l of dna template (1 : 5-diluted product of the primary cycle). thermal cycling was carried out as described for first - round pcr, except that the annealing temperature was set to 65c (63c for st3 and st4) and 61c, respectively (table 1). the amplification was repeated 2 - 3 times to ensure that the amplification obtained with the primers is reproducible and consistent. the amplified dna fragments were resolved through electrophoresis in 1.5% agarose gel prepared in tbe buffer and visualized in a gel documentation system (alfa imager 2200, alfa innotech corporation, usa). statistical analysis was done by using z - test to analyze the level of significance between two proportions, that is, nested pcr and serological test in the diseases of ulcerative colitis, colon cancer, and irritable bowel syndrome and healthy controls. ulcerative colitis (uc) patients were found to have highest pcr positivity (79.7%) for the salmonella enterica serotypes (typhi and paratyphi a both) followed by ibs (66.1%), cc (53.6%), and hc (16.3%) in descending order. while the positivity rates for the salmonella serotypes were statistically comparable, uc had significantly higher prevalence (p < 0.001) when comparing positivity rates in ibs, cc, and hc groups (table 2, figures 1 and 2). the positivity by pcr in healthy individuals shows 16.3% due to asymptomatic infection of the organism because pcr and serological based detection of salmonella bacteria, the antibody titre, and positivity rate by molecular methods increase simultaneously in healthy individuals living in this endemic area. antibody titre (1 : 160) against vi antigen usually showing chronic carrier state was lowest in uc (6.8%) compared to hc (12.1%) and this difference was statistically significant (p < 0.05) (table 2). antibody response at the titres (1 : 160) against somatic (to), flagellar antigens of serotypes typhi (th) and paratyphi a either in combination or alone was observed to be lowest again in uc patients (54.2%) in comparison with ibs (70.1%) and cc (71.4%). healthy controls had the lowest percentage of individuals with positive widal test (15.2%) (table 3). on statistical analysis, it was observed that all the 3 diseases groups had significantly higher (p < 0.001) positivity rates as compared to healthy controls (hc). when antibody titre against to was taken into account, 35.5% of patients with cc were observed with titre of 1 : 160 followed by uc (18.7%), hc (15.3%), and ibs (12.6%). on statistical analysis, the positivity percentage of cc was significantly higher than ibs (p < 0.001). contrary to this the antibody titre at 1 : 160 against th, ibs group had highest positivity rate (67.7%) followed by cc (57.0%), uc (39.0%), and hc (12.6%). uc patients were observed with significantly lower percentage of patients with significant titre against th (p < 0.001) when compared with ibs. while uc and cc had comparable proportions of the patients with significant titre against th, all the diseased groups showed significant titre (p < 0.001) (table 2). the antibody titre against ah was observed at very low levels in all the 3 diseased groups and hc and these positivity percentages were comparable. the higher titers in diseased group indicate that these patients are more susceptible to either salmonella infection or more responses to the salmonella antigens resulting in autoimmune type of injury. in the previous report from our centre we have already established that pcr based detection of salmonella bacteria and antibody responses including against viab go parallel in healthy individuals living in this endemic area. the age - old definition of uc includes the phrase presence of bloody diarrhea and mucous associated with negative stool culture for bacteria, ova, or parasites with the diagnostic facilities available at that time. in the recent time with the advent of extremely sensitive and specific tools this definition may not be true. in the present study, efforts were made to look for salmonella enterica serotypes typhi and paratyphi a (known causative agents of enteric fever) in patients with chronic gut diseases like uc, ibs, and cc, a malignant condition. by using nested pcr for detection of s. typhi and paratyphi a serotypes in stool samples, almost 80% of the uc patients were found to have the dna of the bacterium which was significantly higher than the ibs and cc. it is well established that, due to lacunae in our isolation techniques and ignorance about growth triggering factors, the isolation rate from any clinical specimens including stool and colonic biopsies usually remains < 40% [22, 23 ]. such a high level of association with uc indicates two possibilities ; that is, firstly salmonella either is an aetiological agent or may be associated with this disease due to increased susceptibility to the infection due to loss of mucosal integrity. the possibility of salmonella being one of the causative agents seems to be quite likely. this hypothesis is well supported by the observation that antibody titre against vi antigen was lowest in uc patients (6.8%) suggesting active infection rather than chronic carrier state as vi antibody response is usually more pronounced in chronic typhoid carriage. the possibility of the specific immunosuppression against salmonella in uc patients can not be ignored on the basis of this observation. the later speculation is further supported by quite low widal positivity in uc cases (54.2%) as compared to ibs (70.1) and cc (71.4%). it is interesting to note that, despite the highest positivity rate for the presence of salmonella dna in uc, the antibody titre against somatic antigen (to) of salmonella was simply comparable to cc and ibs. somatic antigen of the salmonella is known to induce short lasting igm response usually in acute infections. following similar pattern, the antibody titre against flagellar antigen (th) which is known to induce prolonged igg response in uc patients was observed to be minimum (39.0%) amongst the diseased groups when compared with ibs (67.7%) and cc (57.0%). therefore, the significantly higher positivity rate for salmonella nucleic acid along with relatively poor immune response strongly suggests the aetiological role of the enteric pathogens in uc. these observations were supported by previous studies reporting the higher prevalence of enteric pathogens and uc in developing countries [611 ]. further, there is report from north india showing association between poor hygiene and uc. there are many reports implicating salmonella and campylobacter enteritis with increased short- and long - term risk for inflammatory bowel diseases including uc enteritis [9, 10 ]. there are few case reports published in 70s showing the isolation of salmonella serotypes (typhi, typhimurium, and agona) from patients who were initially admitted to infectious disease hospital during acute attacks of uc. but the question that may be asked is why not is it merely an association rather than a causation which is quite likely in population with poor hygiene as is in the present study subjects ? the point goes in favor of this speculation : why antibiotics alone are not giving the remission ? however, the autoimmunity might have been induced by some facultative / obligate intracellular microbial agent / s causing chronic infection and salmonella spp we can not deny the inadequacy of diagnostic methods and shooting in dark as far as uc is concerned. nested pcr based technique is known for its sensitivity and specificity, though sensitivity also brings in the risk of pcr contamination. however, if we analyze the data regarding ibs, it may be appreciated that this entity is more likely due to immunological reaction rather than bacterial invasion itself as immune response follows closely with the rate of detection of salmonella serotypes by pcr in this group. chronic typhoid carriage is sometimes implicated in causation of cc apart from cancer of gallbladder and pcr based detection and immunological response might be the reflection of typhoid carriage itself. however, we hypothesize that direct invasion by some microbial agents is associated with hypersensitive state of immunological response in ulcerative colitis at least. | ulcerative colitis (uc) is characterized by presence of ulcer in colon and bloody diarrhea. the present study explores the possibility of association between salmonella and ulcerative colitis. the present study comprised 59 cases of uc, 28 of colon cancer (cc), 127 of irritable bowel syndrome (ibs), and 190 of healthy control. the serological study was done by widal and indirect haemagglutination assay (iha) for viab. nested pcr was performed targeting flic, staa, and stkg gene for typhi and paratyphi a, respectively. a total of 15.3% patients were positive for salmonella o antigen among them 18.6% uc, 35.5% cc, 12.6% ibs, and 15.3% healthy control. a total of 36.9% patients were positive for h antigen including 39.0%, 57.1%, and 67.7% uc, cc, and ibs, respectively. about 1.73% show positive agglutination for ah antigen including 3.4%, 3.6%, and 1.6%, uc, cc, and ibs. a total of 10.89% were positive for viab. while 6.8% of uc, 10.7% of cc, 11.0% of ibs, and 12.1% of healthy subjects were positive for the antibody, the pcr positivity rates for salmonella specific sequences were 79.7% in uc, 53.6% in cc, 66.1% in ibs, and 16.3% in healthy controls. the present study suggested that higher prevalence of salmonella might play important role in etiopathogenesis of uc, ibs, and cc. |
http://www.ncbi.nlm.nih.gov/sra/srx883521 random mutagenic events followed by natural selective pressure, inflames the evolutionary mechanism to give rise new lineages of microorganisms in the microbial world at an alarming high frequency. this new groups of microorganisms are so nascent to the environment that currently available bacterial culture procedures are completely inept at confining them. due to the uniqueness in physicochemical characteristics and exclusivity in nutrient composition of a pristine ecosystem, the studies of complex microbial communities have considerably advanced in recent years, mainly facilitated by metagenomics and other omics coupled with high - throughput dna sequencing technologies and bioinformatics,,. studies using high throughput sequencing conducted in mangrove sediments in brazil, china and india have enlarged our knowledge on the microbial taxonomic diversity and functional potential,,,, however there are still challenges to be overcome regarding the factors involved in shaping the microbial biogeography in mangroves. sundarbans is the world 's largest tidal halophytic mangrove ecosystem situated in the delta of ganges, meghna, and brahmaputra rivers on the bay of bengal, and has been recognized as a unesco world heritage site, plays critical roles on the sea microbial communities play an important role in the generation of detritus in mangrove areas and involved in biogeochemical cycling of the nutrients,. however, no data are yet available regarding the abundance and diversity of bacterial in dhulibhashani, sundarbans despite global advancement in understanding the microbial diversity and role of microbes in different mangrove environments, little has been performed in sundarbans. in order to gain new insight into the bacterial community, we examined temporal changes in the microbial diversity of the sampling station during the monsoon (july 2013) and post - monsoon (december 2013) seasons mainly to understand the role of climate and other parameters in shaping the sediment microbial communities in sundarbans to build foundational information for future research employing 454-pyrosequencing. this study comprised of dhulibhashani (213740.837n 883347.762e) mangrove, which is located on the north eastern coast of india. sediments were collected from inside of the mangroves during the monsoon (july 13) and post - monsoon season (dec 2013, aiming to cover the typical habitats in the ecosystems. samples were collected in triplicate in a sealed sterile container from surface (2 cm) and subsurface (32 cm) sediments of the sundarbans mangrove wetland. metagenomic dna was extracted from soil subsamples using mo - bio dna power soil kit (mobio laboratories, carlsbad, ca). to analyze bacterial diversity, pyrosequencing was performed for 200 cycles on a roche 454 gs - junior sequencing instrument according to the manufacturer 's protocol (454 life sciences, usa). the raw data were subjected to initial quality trimming using the mothur software and chimeric sequences were removed by using uchime algorithm. the output was 1,53,926 sequences with size 108.8 mbp and 55 2% g + c. after the analysis of metagenome sequences, a total of 44 phyla were present in two seasons (july 13 and dec 13) of dhulibhashani, sundarbans. in the monsoon sample (july 13) 42 different phyla were recorded whereas 39 phyla were observed at post - monsoon (dec 13) respectively (fig. 1). interestingly a less number of phyla were observed in the soil sample of post - monsoon, possibly due to change in the physico - chemical parameters (salinity, conductivity, and water level). proteobacteria is the most dominating phyla in both sampling seasons. out of this experimental data, the abundance of proteobacteria was found to be 53% at 2 cm_dec 2013 and 31% at 32 cm_dec 2013 (post - monsoon) and 44% at 2 cm _ july 13 and 38% at 32 cm_july 13 (monsoon) respectively. besides proteobacteria, bacteroidetes formed 15% and 5% bacterial population in post - monsoon (dec 13) and 19% and 2% in monsoon (july 13) respectively (fig. most interesting phyla, actinobacteria accounted 7% for the post - monsoon at two different depth samples (2 cm_dec 13 and 32 cm_dec 13) and only 5% for monsoon sample only in surface sample (2 cm_july 13). planctomycetes were found to be the less abundant phyla for both seasons (dec : 6% and july : 5%). in summary, the use of 454-pyrosequencing platform allowed us to elucidate the bacterial diversity of this pristine mangrove environment of dhulibhashani, sundarbans, and indicates the potentiality to explore new bioactive compounds from the mangrove environment leading immense benefit human kind. our results showed that the microbiomes from the north eastern coast of india, shaped by the enormous characteristics of the bacterial community suggesting potential abundance of microbial products. despite the shifts in bacterial composition, mainly represented by the enrichment of proteobacteria, the potential metabolic functions remain unchanged, and emphasize the importance of the functional redundancy for the resilience of these environments. in summary, the sedimentary bacterial diversity has been studied in the dhulibhashani island of sundarbans mangrove ecosystem for the first time by means of 16s rrna454-pyrosequencing. this will be helpful in cataloguing and describing the bacteria diversity of the mangrove sediment of sundarbans, india that needs to be conserved and simultaneously could be the habitat for large number of economically important microbes. further research including analyses of expression of functional genes and determination of the active bacterial population within the sediment might unravel the role of bacteria in maintenance of biogeochemical cycle and discovery of bioactive compounds of sundarbans mangrove ecosystem. all 454-gs junior sequence data from this study were submitted to the ncbi sequence read archive (sra) under accession numbers srr2061029 (dhulibhashani_2 cm_july 13), srr2061030 (dhulibhashani_32 cm_july 13), srr2061032 (dhulibhashani_2 cm_dec 13) and srr2061033 (dhulibhashani_32 cm_dec 13). all 454-gs junior sequence data from this study were submitted to the ncbi sequence read archive (sra) under accession numbers srr2061029 (dhulibhashani_2 cm_july 13), srr2061030 (dhulibhashani_32 cm_july 13), srr2061032 (dhulibhashani_2 cm_dec 13) and srr2061033 (dhulibhashani_32 cm_dec 13). | the global knowledge of microbial diversity and function in sundarbans ecosystem is still scarce, despite global advancement in understanding the microbial diversity. in the present study, we have analyzed the diversity and distribution of bacteria in the tropical mangrove sediments of sundarbans using 16s rrna gene amplicon sequencing. metagenome is comprised of 1,53,926 sequences with 108.8 mbp data and with 55 2% g + c content. metagenome sequence data are available at ncbi under the bioproject database with accession no. prjna245459. bacterial community metagenome sequences were analyzed by mg - rast software representing the presence of 56,547 species belonging to 44 different phyla. the taxonomic analysis revealed the dominance of phyla proteobacteria within our dataset. further taxonomic analysis revealed abundance of bacteroidetes, acidobactreia, firmicutes, actinobacteria, nitrospirae, cyanobacteria, planctomycetes and fusobacteria group as the predominant bacterial assemblages in this largely pristine mangrove habitat. the distribution of different community datasets obtained from four sediment samples originated from one sampling station at two different depths providing better understanding of the sediment bacterial diversity and its relationship to the ecosystem dynamics of this pristine mangrove sediment of dhulibhashani in, sundarbans. |
free - living amoebae are ubiquitous in the environment, especially water. in case of unfavourable growth conditions, such as starvation or desiccation, these protists can exhibit a resistant form, termed cysts. thus, amoebae may bypass all the barriers present in drinking water treatment plants and may reach the water distribution system, where they may colonize biofilms and sediments. amoebae have been shown to be natural hosts of different bacteria that can resist intracellular killing through several mechanisms. some of these amoeba - resisting bacteria (arb) have been shown to reside in the amoebal cyst, where they are protected from biocides and disinfection treatments,,. the evolution of traits that result in bacterial resistance to amoebae may explain the ability of some arb to also resist other phagocytic cells, such as macrophages,,,. the observation that some arb are able to infect both amoebae and macrophages supports this hypothesis,. humans may be exposed to these arb through various water systems such as cooling towers, humidifier aerosols, drinking water, spas or swimming pools, all of which have previously been shown to be reservoirs of arb. for instance, the arb legionella pneumophila was discovered after an outbreak of pneumonia in 1976 in philadelphia in which dozens of people were infected by a contaminated air - conditioning system.. later showed a correlation between legionnaire 's disease due to legionella pneumophila and the use of showers. newly discovered arb are emerging as potential respiratory pathogens, such as parachlamydia acanthamoebae and simkania negevensis, both able to replicate in amoebae,,. however, the mode of transmission of these chlamydia - related bacteria remains to be determined. recently a chlamydiales - specific quantitative pcr was developed and was applied to 422 nasopharyngeal swabs from patients. this study showed that 48 patients were positive for a member of the chlamydiales order, among which 38 corresponded to chlamydia - related bacteria, demonstrating that these bacteria can reach the human respiratory tract. thus, in the present work, domestic drinking waters and biofilms from plumbing systems were investigated for the presence of chlamydiales by pcr and culture methods. these samples were also screened for other arb belonging to the families legionellaceae and mycobacteriaceae, from which several members are established as human pathogens. finally, the screening of potential amoebal hosts was also performed. water (n = 48) and biofilm (n = 48) samples were collected from 48 different domestic water systems in the regions of geneva (n = 37), lausanne (n = 7) and sion (n = 4), switzerland. one litre of first - flow water was first sampled from the shower, filtered through a 0.22 m membrane, which was then resuspended in 10 ml of filtrated water. then, using a sterile swab, biofilms were collected from the flexible pipe connected to the shower head (after unscrewing the shower head) and was then resuspended on site in about 3 ml of shower water. aliquots of 100 l of concentrated water and 100 l of resuspended biofilm were kept at 20c for dna extraction (fig. 3) while the samples were processed immediately for analyses. acanthamoeba castellanii atcc 30010 was used to cultivate arb. a. castellanii was grown in the rich peptone yeast - extract glucose (pyg) medium,, at 28c without co2, in 75 cm surface cell culture flasks (becton dickinson, allschwil, switzerland). amoebae were collected by centrifugation (1500 g, 10 minutes) and washed with phosphate - buffered saline and finally resuspended in poor medium page amoeba saline (pas), to avoid extracellular overgrowth of bacteria. amoebae were seeded in a 24-well culture microplate (milian, wohlen, switzerland) at 5 10 amoebal cells / ml. an aliquot (100 l) of biofilm or concentrated water sample was then inoculated, and tenfold serial dilutions were performed. the microplates were immediately centrifuged at 1790 g for 15 minutes, and the cells were incubated for 1 hour at 28c. cells were gently washed once with pas and incubated at 32c in a humidified atmosphere without co2. amoebae were observed daily for amoebal lysis, and the co - cultures were reseeded on fresh confluent amoebae in pas after 7 and 14 days. at day 7 and day 14, 100 l of each amoebae - containing well was collected and stored at 20c until dna extraction. about 20 l of concentrated water or biofilm samples was seeded onto the agar and incubated at 28c in a humidified atmosphere. plates were observed daily under an optical microscope for the presence of amoebae. when positive, subcultures were performed, and amoebae were collected and frozen at 20c until dna extraction. dnas were automatically extracted by the lc automated system (roche, rotkreuz, switzerland) and the magna pure lc dna isolation kit 1 (roche) using 100 l of water and 100 l of biofilm sample. for each run of extraction, water samples (n = 48) and biofilm samples (n = 48) were analysed by 16s rrna gene - directed pcr for the presence of dna from legionella spp. (tb285f / tb264r primers) and chlamydiales (panch16f2/panch16r2 primers and panch16s probe). finally, amoebae were identified by sequencing a part of the 18s rrna gene, amplified using the ami6f1/ami9r primers. the chlamydiales - specific real - time pcr targeting the 16s rrna gene was performed as previously described. briefly, using the primers panch16f2, panch16r2 and a probe panch16s, 5 l of dna was analysed in duplicate with 50 cycles consisting of denaturing for 15 seconds at 95c, annealing for 15 seconds at 67c and amplification for 15 seconds at 72c. when the pcr or quantitative real - time pcr was positive, the pcr product was purified with the msb spin pcrapace kit and sequenced with the same primers. in the case of positive samples for mycobacteria with the 16s rrna pcr, a second pcr targeting the rpob gene and using the primers mycof / mycor was used for precise identification by sequencing. concerning the pcr products obtained with the chlamydiales - specific real - time pcr, they were purified using the genelute pcr clean - up kit (sigma, buchs, switzerland), and sequencing was performed with inner primers as described elsewhere. all newly generated nucleotide sequences were submitted to genbank ; the accession numbers may be found in the supplementary tables. amoebal co - culture wells were screened by pcr for the presence of legionella spp., mycobacterium spp. and chlamydia - related bacteria after 1 and 2 weeks of incubation. dna was extracted from 100 l of the culture using the wizard genomic dna purification kit (promega, duebendorf, switzerland) in the presence of proteinase k (20 mg / ml) following the manufacturer 's protocol for animal tissues. for each run of extraction, detection by pcr and sequencing of mycobacteria, legionella and amoebae was performed as described above. for the chlamydiales, the number of bacteria and amoebae detected in this study are represented in fig. 1. in addition, for each domestic water system, all bacterial and amoebal species identified by sequencing are presented in table 1. among the 48 domestic water systems investigated, 35 (72.9%) were positive for chlamydiales detected by specific real - time pcr (rtpcr) in the water, the biofilm or both samples (fig. 1 and table 1). sequencing of the rtpcr products gave a sequence of about 200 bp that was used to classify the bacteria at the family level following the criteria of everett.. a total of 55 chlamydiales sequences could be obtained for 33 of these 35 positive households. the classification could be achieved for 51 dna sequences (table 1 and supplementary table s1), and four remained unclassified. among these 55 sequences, 28 (50.9%) may correspond to new species - level lineages if fully characterized because the sequences exhibit a similarity with a previously reported species below 97%. figure 2 illustrates the number of bacteria detected in biofilm or water samples, based on the number of 16s rrna gene copies quantified by the chlamydiales - specific rtpcr. the majority of the sequences corresponded to members of the parachlamydiaceae family (n = 30 sequences), which were detected in 20 different water systems. criblamydiaceae dnas were also amplified (18 sequences from 14 different domestic water systems) as well as two sequences of the waddliaceae family and one sequence from the simkaniaceae family. the highest number of bacteria was detected in biofilms and corresponded to members of the parachlamydiaceae family (fig. 2). in total, the presence of legionella was found in 21 (43.8%) drinking water systems. legionella was detected by pcr and/or by amoebal co - culture (but never as an amoebal endosymbiont of amoebae grown using the amoebal enrichment method). the results are shown in table 1, and the identification of legionella species is detailed in supplementary table s2. by pcr and/or amoebal co - culture, legionella was detected in 29 samples (ten biofilms and 19 waters) ; it corresponded to 15 different species (table 1 and supplementary table s2). the most common species were legionella waltersii (present in eight water systems) and l. pneumophila (present in three water systems). using pcr and amoebal methods, 15 (31.3%) domestic water systems were positive for mycobacterium species such as mycobacterium gordonae, chelonae or mucogenicum. the results are summarized in table 1, and complete identification can be found in supplementary table s3. of particular note, two different mycobacteria (m. iranicum strain ccug52297 and m. phocaicum) were found within the amoeba hartmannella vermiformis, recovered from water and biofilm samples of the same domestic water system (ge10037). using both pcr and amoebal enrichment, the presence of amoebae amoebae were present in water and/or biofilm samples (fig. 1), with hartmannella vermiformis being predominantly detected in 16 water systems (table 1). two stenamoeba species were also isolated from two different biofilms, one being a potential new amoebal species. finally, in a biofilm already positive by pcr for h. vermiformis, an uncultured eukaryote strain related to the prostelium nocturnum amoeba was isolated by culture (water system ge10174). the complete identification of amoebae per type of sample can be found in supplementary table s4. in this study, the presence of arb belonging to the chlamydiales order as well as to the legionellaceae and mycobacteriaceae families was investigated using amoebal culture methods and pcr on water and biofilm samples collected from domestic water systems of 48 different households. overall, 39 (81.3%) of the investigated domestic water systems were positive for the presence of a chlamydiales, a legionellaceae and/or a mycobacteriaceae. in 18 (46.2%) of these systems, a chlamydiales - specific rtpcr was used and allowed for the first time to observe such a high prevalence and diversity of chlamydiales in domestic drinking water. the high sensitivity of the rtpcr allowed the detection of a chlamydiales in 35 (72.9%) different domestic water systems, corresponding to members of at least four different family - level lineages of the chlamydiales order. the high prevalence of strains belonging to this family compared to other chlamydia - related bacteria was also previously observed when using the same chlamydiales - specific rtpcr on nasopharyngeal swabs taken from children. the presence of criblamydiaceae species in water and biofilm samples was not surprising because these bacteria have been previously isolated from water and/or sediment samples,,. this result is particularly interesting because serologic evidence indicates that criblamydiaceae may be associated with cases of pneumonia (lienard., personal communication). to our knowledge, this is the first documentation of waddliaceae in drinking water systems. although the bacterium waddlia chondrophila was previously associated with human and bovine hosts,,,, its potential presence in water was suggested by its ability to also grow and survive in amoebae,. only one sequence corresponding to the simkaniaceae family was detected, which did not correspond to the species simkania negevensis. this result contrasts with a previous work where s. negevensis was detected by pcr in the majority of tap water samples. however, this latter study was performed in israel, where the microbial ecology and drinking water treatment processes may be different from those in switzerland. among the 55 sequences of chlamydiales bacteria obtained in this work, only two corresponded to bacteria currently grown in our laboratory, which indicated that the sequences obtained here did not result from a pcr contamination. overall, 28 different sequences showed less than 97% similarity with a previously reported species. considering this 97% cutoff,, these latter 28 sequences may correspond to putative new species, highlighting the broad and underestimated biodiversity of the chlamydiales order. this report suggests that man - made drinking water could represent an important ecological niche for chlamydiales bacteria. another study on drinking water failed to detect any chlamydiales, either by amoebal co - culture with a. castellanii or by classical pcr. detected simkania negevensis in tap water but only by pcr and membrane immunoassay. in the present work, the chlamydiales - specific quantitative pcr, which is more sensitive than regular pcr, revealed the common occurrence of chlamydiales dna in domestic drinking water systems the growth of chlamydiales bacteria from environmental samples could have been restricted here by the overgrowth of other environmental bacteria within the co - cultures in a. castellanii. furthermore, in some cases, chlamydiales bacteria were probably initially dead or not cultivable. the amoebal co - culture using a. castellanii was previously shown to be effective to recover chlamydiales, including criblamydiaceae and parachlamydiaceae,, but is clearly inadequate to grow all chlamydiales. indeed, considering the large biodiversity of the chlamydiales order highlighted in the present study, only a few members have been isolated by amoebal co - culture,,,,. in addition, a restricted amoebal host spectrum has already been shown for several chlamydiales bacteria,,,, which suggests that multiple amoebal strains should ideally be used to recover a higher biodiversity of these strictly intracellular bacteria in culture. in this work, an acanthamoeba species was used, which is more suitable for the amoebal co - culture method, as it is less prone to encystment compared to hartmannella spp. are known to be permissive to a large number of bacteria,,,,,. thus, other amoebae such as hartmannella and naegleria should also be included in future studies. finally, several growth parameters such as temperature and media can also be optimized to increase the number of recovered arb. legionella waltersii, which was previously associated with severe pneumonia, was the most prevalent species, followed by l. pneumophila, among all legionella found in this study. in addition, legionella species considered as potential respiratory pathogens such as l. anisa,,, l. longbeachae,, or l. fallonii were also recovered. in all water systems positive for l. pneumophila, the amoeba h. vermiformis was systematically isolated by amoebal enrichment, supporting the importance of this amoeba as a reservoir for l. pneumophila. in addition, various nontuberculous mycobacteria have been recovered using amoebal co - culture and amoebal enrichment, including several human pathogens, such as m. mucogenicum and m. chelonae, which have mainly been shown to cause respiratory, and soft tissue infection. m. gordonae, which is also sometimes considered pathogenic,,,,, has been previously isolated from drinking water, and was isolated in our study from water and biofilm samples. other nontuberculous mycobacteria were also recovered in the present work, including m. conceptionense,,,, m. barrassiae and m. neoaurum,,. finally, one of the two mycobacteria recovered within the amoeba h. vermiformis was m. iranicum. this species was recently described as a new human pathogen ; it was isolated from clinical samples such as cerebrospinal fluid and sputum samples from patients from different continents,. however, the source of infection has not been determined for these previously reported cases ; drinking water should thus be considered. using amoebal enrichment and pcr, although the number of recovered amoebae is particularly variable between studies, the number of amoebae cultivated in this study (n = 15) is higher compared to a previous study using the same culture method. however, the difference of water temperatures between the present and the previous study, with mean temperatures of 20.6c and 56c, respectively, may explain these results. most of the amoebae isolated in this work corresponded to h. vermiformis, which is congruent with a previous investigation of drinking water by amoebal enrichment. in conclusion, the current study highlighted the large colonization of drinking water points of use by arb and amoebae. this work also demonstrated the common occurrence and large biodiversity of chlamydiales bacteria in drinking water. thus, drinking water represents a potential infection source for some chlamydia - related bacteria. because parachlamydia acanthamoebae is associated with respiratory infections, the common occurrence of parachlamydiaceae observed here is important in terms of public health. larger prospective studies including different settings are needed to better investigate the role of domestic water systems or other systems generating aerosols, such as cooling towers, in the transmission of chlamydiales to humans and other susceptible hosts. | a growing number of human infections incriminate environmental bacteria that have evolved virulent mechanisms to resist amoebae and use them as a replicative niche. these bacteria are designated amoeba - resisting bacteria (arb). despite the isolation of these arb in various human clinical samples, the possible source of infection remains undetermined in most cases. however, it is known that the arb legionella pneumophila, for instance, causes a respiratory infection in susceptible hosts after inhalation of contaminated water aerosols from various sources. the chlamydiales order contains many arb, such as parachlamydia acanthamoebae or simkania negevensis, previously implicated in human respiratory infections with no identified contamination sources. we thus investigated whether domestic water systems are a potential source of transmission of these chlamydiales to humans by using amoebal culture and molecular methods. other important arb such as mycobacteria and legionella were also investigated, as were their possible amoebal hosts. this work reports for the first time a very high prevalence and diversity of chlamydiales in drinking water, being detected in 35 (72.9%) of 48 investigated domestic water systems, with members of the parachlamydiaceae family being dominantly detected. furthermore, various legionella and mycobacteria species were also recovered, some species of which are known to be causal agents of human infections. |
a total of ninety eight a. baumannii isolates were collected from burn infection in motahari hospital (65 isolates) and vap in rasoulakram hospital (33 isolates) in tehran during august 2010 to july 2011. bacterial isolates were identified as a. baumannii using biochemical reactions, including oxidase test, triple sugar iron (tsi), sim and oxidation - fermentation (of) test and finally confirmed by pcr amplification of blaoxa-51-like gene. the susceptibility of a. baumannii isolates to tetracycline (30 g) (mast, merseyside, u.k) was tested using the standard agar disk diffusion and minimum inhibitory concentration (mic) of tetracycline was performed by agar dilution method on mueller - hinton (m - h) agar (merck, germany) according to the clinical and laboratory standard institute (clsi). a. baumannii atcc 19606 and pseudomonas aeruginosa atcc 27853 strains was used as quality control references for susceptibility testing. the standard pcr assay was performed using specific primers for detection of structural adeb gene and two regulatory genes, ader and ades belong to adeabc system in tetracycline - resistant a. baumannii isolates the dna amplification instrument mastercycler gradient to detect one structural (adeb) and two regulatory (ader and ades) genes of adeabc. the pcr was performed in a reaction mixture with total volume of 25 l containing 2x master mix red (ampliqon, denmark) (containing 10 pmoltaq dna polymerase), 0.5 mm of each primer and 1 l of dna suspension. the pcr program was performed as follows : initial denaturation at 94c for 5 minutes ; 30 cycles containing of denaturation at 94c for 1 minute, annealing at 57c for 1 minute, and extension at 72c for 1 minute ; followed by a final extension at 72c for 5 minute. primers used for pcr amplification efflux pump system function was evaluated by mics to tetracycline with and without treatment of efflux pumps inhibitor carbonyl cyanide 3-chlorophenylhydrazone (cccp) (sigma - aldrich germany) according to modified method performed in previous studies. briefly, 50 g / ml of cccp was added into each m - h agar plate containing tetracycline concentration from 0.5 to 1024 g / ml. a. baumannii atcc 19606 was used as a control and plates without cccp were used as negative control. the inhibitory effect of cccp on efflux pump should be determined by two - fold or greater reduction in mics value after treatment with cccp. a total of ninety eight a. baumannii isolates were collected from burn infection in motahari hospital (65 isolates) and vap in rasoulakram hospital (33 isolates) in tehran during august 2010 to july 2011. bacterial isolates were identified as a. baumannii using biochemical reactions, including oxidase test, triple sugar iron (tsi), sim and oxidation - fermentation (of) test and finally confirmed by pcr amplification of blaoxa-51-like gene. the susceptibility of a. baumannii isolates to tetracycline (30 g) (mast, merseyside, u.k) was tested using the standard agar disk diffusion and minimum inhibitory concentration (mic) of tetracycline was performed by agar dilution method on mueller - hinton (m - h) agar (merck, germany) according to the clinical and laboratory standard institute (clsi). a. baumannii atcc 19606 and pseudomonas aeruginosa atcc 27853 strains was used as quality control references for susceptibility testing. the standard pcr assay was performed using specific primers for detection of structural adeb gene and two regulatory genes, ader and ades belong to adeabc system in tetracycline - resistant a. baumannii isolates the dna amplification instrument mastercycler gradient to detect one structural (adeb) and two regulatory (ader and ades) genes of adeabc. the pcr was performed in a reaction mixture with total volume of 25 l containing 2x master mix red (ampliqon, denmark) (containing 10 pmoltaq dna polymerase), 0.5 mm of each primer and 1 l of dna suspension. the pcr program was performed as follows : initial denaturation at 94c for 5 minutes ; 30 cycles containing of denaturation at 94c for 1 minute, annealing at 57c for 1 minute, and extension at 72c for 1 minute ; followed by a final extension at 72c for 5 minute. efflux pump system function was evaluated by mics to tetracycline with and without treatment of efflux pumps inhibitor carbonyl cyanide 3-chlorophenylhydrazone (cccp) (sigma - aldrich germany) according to modified method performed in previous studies. briefly, 50 g / ml of cccp was added into each m - h agar plate containing tetracycline concentration from 0.5 to 1024 g / ml. a. baumannii atcc 19606 was used as a control and plates without cccp were used as negative control. the inhibitory effect of cccp on efflux pump should be determined by two - fold or greater reduction in mics value after treatment with cccp. antibiotic resistance is a major challenge in treating infections caused by gram negative bacteria, including a. baumannii. according to various studies, the rate of mortality because of mdr a. baumannii infections in patients hospitalized in burn and intensive care units has been increased. in fact, the huge spread of these bacteria that are responsible for nosocomial infections is of great concern worldwide. as shown in tables 1 and 2, approximately 48% (47out of 98) of isolates showed resistance to tetracycline which 14 (14.2%) isolates were corresponded to burn infection and the remaining 33 (33.8%) strains were isolated from vap [tables 2 and 3 ]. in the present study, the rate of resistance among burn samples was lower than ventilator associated pneumonia (vap). resistance rate observed in this study was much lower than other reports from usa, uk and italy with 85.5%, 84% and 75%, respectively, but was more than the rate (34.7%) reported by asadollahi and colleagues. nevertheless, our susceptibility test results are similar to the results (55%) reported by yagang chen and colleagues. although the widespread prevalence of resistant acinetobacter spp. in hospital particularly in intensive care units (icus) is due to high resistance rate of these organisms to environmental conditions but there are predisposing factors in acquisition of resistant strains infections significantly including mechanical ventilation and surgical procedures. distribution of the mic for tetracycline in burnclinical isolates of a. baumannii before and after treatment with cccp distribution of the mic for tetracycline in vap clinical isolates of a. baumannii before and after treatment with cccp the adeabc efflux pump is one of the principle antibiotic resistance mechanisms which are applied by gram - negative bacteria such as a. baumannii. genetic detection of rnd genes can be used for identification of resistant acinetobacter spp. and a. baumannii strains with lack of adeabc genes possibly are susceptible to antimicrobial agents. in vitro studies showed that tetracycline has efficient activity against a. baumannii nevertheless is not prescribed in clinical use or for vap treatment commonly. in recent studies, it has been proved that 80% of mdr a. baumannii isolates showed close correlation between resistance and adeabc pump genes. it was proved that adeabc pump is responsible for increasing resistance to common antibiotics which are as substrates for efflux pump such as tetracycline. pcr assay was performed with specific primers as described above. the expected amplification fragment with sizes of approximately 541 bp, 447 bp and 544 bp were detected on agaros gel corresponded to adeb, ader and ades genes, respectively in all tetracycline resistant isolates [figure 1 ]. in the present study harboring the tetracycline resistance genes (adeb, ader, ades) was confirmed in all resistant strains. pcr amplification of adeb, ades and ader genes in five selected isolates of a. baumannii. (a) lane1 : positive control for adeb ; lane 2 - 5 : pcr product of adeb gene (541 bp) ; m : 1 kb dna size marker. (b) lane1 : positive control for ader ; lane2 - 5 : pcr product of ader gene (447 bp) ; m : 1 kb dna size marker. (c) lane1 : positive control for ades lane 2 - 5 : pcr product of ades gene (544 bp) ; m : 1 kb dna size marker moreover, we found that mics of tetracycline decreased mainly 2 to 8 fold in the most resistant isolates (44 out of 47) in the presence of cccp. these results suggested that active efflux pumps contribute in resistance to tetracycline in a. baumannii isolates. the mic range of tetracycline in all resistant a. baumannii isolates were between 32 to 1024 g / ml. in burns samples, the mic of 6 (43%) and 8 (57%) of isolates were 128 and 256 g / ml respectively. the reduction of tetracycline mics by using 50 g / ml cccp were as follows : in 8 (57%) isolates 2 - 4 fold reduction in mics, 4 (29%) isolates showed 8 fold reduction, 1 (7%) isolate showed 32 fold and the remaining 1 (7%) isolate showed 128 fold reduction in mics [table 2 ]. mics values of tetracycline in vap isolates were 32 g / ml in 2 out of 33 (6%) isolates and for the remaining 31 (94%) isolates were 256g / ml. tetracycline mics with using cccp were measured in vap and the results indicated 2 - 4 fold reduction in 10 isolates, 8 fold reduction in 22 isolates and 16 fold reduction in the remaining 1 isolate [table 3 ]. it is worth mentioning that burn isolates showed 2 - 128 fold reduction while vap isolates showed 2 - 16 fold reduction in tetracycline resistance. our comprehensive analysis revealed that criteria of infection diagnosis and antibiotic consumption play an important role in prevention and control of a. baumannii infections. there are significant factors needs to be measured in order to control the appearance of mdr a. baumannii strains including survey resistance mechanisms, use of new drugs, and avoidance of the widespread of multiresistant isolates. using standard assays for susceptibility test and mic breakpoint acinetobacter baumannii is one of the most principle agents in nosocomial and burn infection thus exact diagnosis of isolates, antibiotic resistant pattern and the mechanisms of resistant can be so helpful for prevention or controlling the infections. antibiotic resistance is a major challenge in treating infections caused by gram negative bacteria, including a. baumannii. according to various studies, the rate of mortality because of mdr a. baumannii infections in patients hospitalized in burn and intensive care units has been increased. in fact, the huge spread of these bacteria that are responsible for nosocomial infections is of great concern worldwide. as shown in tables 1 and 2, approximately 48% (47out of 98) of isolates showed resistance to tetracycline which 14 (14.2%) isolates were corresponded to burn infection and the remaining 33 (33.8%) strains were isolated from vap [tables 2 and 3 ]. in the present study, the rate of resistance among burn samples was lower than ventilator associated pneumonia (vap). resistance rate observed in this study was much lower than other reports from usa, uk and italy with 85.5%, 84% and 75%, respectively, but was more than the rate (34.7%) reported by asadollahi and colleagues. nevertheless, our susceptibility test results are similar to the results (55%) reported by yagang chen and colleagues. although the widespread prevalence of resistant acinetobacter spp. in hospital particularly in intensive care units (icus) is due to high resistance rate of these organisms to environmental conditions but there are predisposing factors in acquisition of resistant strains infections significantly including mechanical ventilation and surgical procedures. distribution of the mic for tetracycline in burnclinical isolates of a. baumannii before and after treatment with cccp distribution of the mic for tetracycline in vap clinical isolates of a. baumannii before and after treatment with cccp the adeabc efflux pump is one of the principle antibiotic resistance mechanisms which are applied by gram - negative bacteria such as a. baumannii. genetic detection of rnd genes can be used for identification of resistant acinetobacter spp. and a. baumannii strains with lack of adeabc genes possibly are susceptible to antimicrobial agents. in vitro studies showed that tetracycline has efficient activity against a. baumannii nevertheless is not prescribed in clinical use or for vap treatment commonly. in recent studies, it has been proved that 80% of mdr a. baumannii isolates showed close correlation between resistance and adeabc pump genes. it was proved that adeabc pump is responsible for increasing resistance to common antibiotics which are as substrates for efflux pump such as tetracycline. the expected amplification fragment with sizes of approximately 541 bp, 447 bp and 544 bp were detected on agaros gel corresponded to adeb, ader and ades genes, respectively in all tetracycline resistant isolates [figure 1 ]. in the present study harboring the tetracycline resistance genes pcr amplification of adeb, ades and ader genes in five selected isolates of a. baumannii. (a) lane1 : positive control for adeb ; lane 2 - 5 : pcr product of adeb gene (541 bp) ; m : 1 kb dna size marker. (b) lane1 : positive control for ader ; lane2 - 5 : pcr product of ader gene (447 bp) ; m : 1 kb dna size marker. (c) lane1 : positive control for ades lane 2 - 5 : pcr product of ades gene (544 bp) ; m : 1 kb dna size marker moreover, we found that mics of tetracycline decreased mainly 2 to 8 fold in the most resistant isolates (44 out of 47) in the presence of cccp. these results suggested that active efflux pumps contribute in resistance to tetracycline in a. baumannii isolates. the mic range of tetracycline in all resistant a. baumannii isolates were between 32 to 1024 g / ml. in burns samples, the mic of 6 (43%) and 8 (57%) of isolates were 128 and 256 g / ml respectively. the reduction of tetracycline mics by using 50 g / ml cccp were as follows : in 8 (57%) isolates 2 - 4 fold reduction in mics, 4 (29%) isolates showed 8 fold reduction, 1 (7%) isolate showed 32 fold and the remaining 1 (7%) isolate showed 128 fold reduction in mics [table 2 ]. mics values of tetracycline in vap isolates were 32 g / ml in 2 out of 33 (6%) isolates and for the remaining 31 (94%) isolates were 256g / ml. tetracycline mics with using cccp were measured in vap and the results indicated 2 - 4 fold reduction in 10 isolates, 8 fold reduction in 22 isolates and 16 fold reduction in the remaining 1 isolate [table 3 ]. it is worth mentioning that burn isolates showed 2 - 128 fold reduction while vap isolates showed 2 - 16 fold reduction in tetracycline resistance. our comprehensive analysis revealed that criteria of infection diagnosis and antibiotic consumption play an important role in prevention and control of a. baumannii infections. there are significant factors needs to be measured in order to control the appearance of mdr a. baumannii strains including survey resistance mechanisms, use of new drugs, and avoidance of the widespread of multiresistant isolates. using standard assays for susceptibility test and mic breakpoint in addition, acinetobacter baumannii is one of the most principle agents in nosocomial and burn infection thus exact diagnosis of isolates, antibiotic resistant pattern and the mechanisms of resistant can be so helpful for prevention or controlling the infections. | purpose : acinetobacter baumannii is the most prevalent nosocomial pathogen which have been emerged in the past three decades worldwide. the aim of this study was to assess the distribution of the adeabc efflux pump genes, associated with tetracycline resistance in acinetobacter baumannii isolates collected from burn infection and ventilator associated pneumonia (vap).materials and methods : ninety - eight a. baumannii isolates were collected from two different hospitals in tehran, iran. tetracycline susceptibility testing was performed by disk diffusion and agar dilution methods according to the clsi guidelines. the presence of adesr, adeb, drug efflux system genes in resistant isolates was assessed by polymerase chain reaction (pcr). carbonyl cyanide 3-chlorophenylhydrazone (cccp) was used as a chemical inhibitor agent to assess the contribution of adeabc efflux pump in tetracycline resistance isolates.results:approximately 48% (47 out of 98) of isolates showed resistance to tetracycline which 14 (14.2%) isolates were corresponded to burn infection and the remaining 33 (33.8%) strains were isolated from vap. all tetracycline resistant isolates have adeabc in pcr assay. the reduction of tetracycline mics by using 50 g / ml cccp were as follows : in 18 isolates 2 - 4 fold reduction in mics, 26 isolates showed 8 fold reduction,1 isolate showed 16 fold, 1 isolate showed 32 fold and the remaining 1 isolate showed 128 fold reduction in mics.conclusion:the results showed significant correlation between tetracycline resistance and adeabc efflux pump genes in resistant a. baumannii isolates. |
zika virus (zikv) is a member of the flaviviridae family, and was initially isolated in uganda in 1947. along with the other members of that family, infection by zikv is usually asymptomatic, but when symptoms develop, they are usually minor such as fever, rash, arthralgia and headache, making the differentiation from other tropical mosquito - borne diseases, mostly dengue, clinically difficult. it is transmitted by the aedes species mosquitoes, but transmission may also occur sexually and transplacentally, and has been recently associated with congenital neurologic birth defects in countries of south and central america,,,. since most of the population of the planet lives in areas infested by aedes mosquitos, including southern europe, and infection by zikv is usually asymptomatic or mildly symptomatic, it is obvious that zikv infection poses a public health threat, even for countries far away from south and central america. a newly married man and woman were examined in november 2016 at the infectious diseases clinic of university hospital of heraklion in crete island, greece, 24 h after returning from their honeymoon in cuba. the woman reported sudden onset of fever, malaise, headache, myalgias and a skin rash on her torso on the sixth day of her stay in cuba, for which she was admitted in a local hospital and was discharged 24 h later in order to return to greece. the man reported only fever and a mild skin rash, which he omitted to inform the doctors in cuba. upon presentation, they were both afebrile. the man had an unremarkable physical examination, while the woman had mild non - tender cervical lymphadenopathy. due to their recent travel to the caribbean and their symptoms of fever and rash, serology and reverse transcription pcr (rt - pcr) were ordered for flaviviruses on the 8th day from the symptom onset, during a second visit in our clinic one week later. zika virus (zikv) rna was detected in woman 's first samples of blood and urine ; the pcr was still negative in the blood taken one week later (table 1). zikv rna was also detected in man 's urine taken upon first examination, while it was not anymore detectable one week later (16th day from woman 's symptoms onset) implying a lower viral load. additionally, the real time rt - pcr was negative for dengue virus (denv) and chikungunya virus (chikv). cross - reactivity with denv was seen, while the detection of denv igg antibodies in the woman is additionally explained by cross - reactivity with yellow fever virus for which she was vaccinated in 2010 (table 1). the hellenic center for disease control and prevention was notified, the couple s neighborhood in greece was disinfected in order to eliminate mosquitoes, and advice was given to the couple for protected sexual contact, as well as avoidance of pregnancy for at least six months after their return from cuba.table 1laboratory serological and molecular results from the examination of the blood and urine samples from the newlywed couple upon examination at the infectious diseases clinics (1st sample) and one week later (2nd sample).table 1woman1st samplewoman2nd sampleman1st sampleman2nd samplezikv igm cut - off : 1.14.063.064.422.2zikv igg cut - off : 1.1negative1.45negative1.98denv igm cut - off : 13.872.472.211.20denv igg cut - off : 1positivepositive1.32.35denv - ns1 ag cut - off : 1negativendnegativendreal time rt - pcr zikvin bloodpositivepositivenegativenegativereal time rt - pcr zikv in urinepositivenegativepositivenegativereal time rt - pcr denv in bloodnegativendnegativendreal time rt - pcr denv in urinenegativendnegativendreal time rt - pcr chikv in bloodnegativendnegativendreal time rt - pcr chikv in urinenegativendnegativend laboratory serological and molecular results from the examination of the blood and urine samples from the newlywed couple upon examination at the infectious diseases clinics (1st sample) and one week later (2nd sample). zikv has recently emerged as an important cause of congenital neurologic birth defects, and, more specifically, microcephaly, after the occurrence of an outbreak in brazil in 2015, which caused a twenty - fold increase in microcephaly cases at that time,,,. since then, many confirmed zikv infections have been imported from central and south america and the caribbean,,. herein, we report the first two cases of zikv infection in greece, the southeastern border of europe. neveretheless, the region is infested with mosquitoes of the genus aedes, like aedes albopticus, which could serve as vectors for zikv. this could imply the possibility of establishing a mosquito population capable to cause autochthonous cases. the two infected patients were newly married and travelled for honeymoon to cuba where zikv is endemic. zikv poses a worrisome threat for people of reproducing age, who are the ones that mostly take advantage of the diminished distances current travel modalities offer. indeed, through 27 march 2017, 2.141 cases of zikv infections were documented in the european union, while 108 of those were in pregnant women. as such, the spread of zikv poses an important threat to public health, even for distant european countries. this is not adequately managed by educating potential travelers to areas where zikv is endemic to avoid exposure to mosquitoes, or by screening returning travelers for arboviral infections based on the presence of symptoms, since avoidance of this day feeding mosquito is quite difficult and testing all symptomatic returning travelers from endemic areas for zikv antibodies and rna would neither be a viable option from a financial perspective, nor it would not be quite effective either, since zikv infection can present with minimal symptoms. thus, the possibility of infection of a person in reproductive age in europe leading to transplacental transmission of zikv to the fetus in the event of a pregnancy, even months after travel, could not be effectively ruled out, even if the woman is not the returning traveler, due to the long - term persistence of zikv in semen,. this has clear implications for public health, urging the implementation of family planning education as a method of eliminating the possibility of neurological complications at the fetus in the event of a pregnancy. in conclusion, zikv infection poses a threat for public health worldwide, since travelers to areas where zikv infection is endemic could be asymptomatic carriers of the virus, leading to risk of neurologic birth defects for their offspring, as well as increased risk of infestation of the virus to mosquitos of their country, having as a consequence the establishment of nests of zikv persisters even in countries very far from the ones that the zikv epidemic first occurred. written informed consent was obtained from the patients for publication of this case report and any accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal. on behalf of all authors, the corresponding author states that there is no conflict of interest. this research did not receive any specific grant from funding agencies in the public, commercial, or non - for - profit sectors. | zika virus (zikv) is a member of the flaviviridae family causing asymptomatic or mildly symptomatic infections with fever, rash, arthralgia and headache. it is transmitted by the aedes species mosquitoes and also sexually and transplacentally, and has been recently associated with congenital neurologic birth defects in south and central america. we report the case of a newly married couple from greece who travelled to cuba for their honeymoon and developed mild symptoms consistent with arboviral infection. after returning to greece, they were found to have been infected by zika virus during their honeymoon. these are the first two cases of zika virus infection in greece, the southeastern border of europe, denoting that zika virus infection poses a threat for public health worldwide, since returning travelers could be asymptomatic carriers of the virus, not only leading to risk of neurologic birth defects for their offspring but also the real risk of transmission of the virus in their country by local aedes mosquitoes. |
dna cytosine methyltransferases deaminate cytosine (c, 1) to uracil (u, 3), and cytosine deamination also can be effected by nitrosation [2, 3 ]. c - to - u damage can be repaired via enzymatic base excision and, if left unrepaired, causes the g : ca : t mutation [5, 6 ]. the nitrosative c - to - u process had been thought to occur via the transient cytosinediazonium ion 2 and its hydrolysis by direct nucleophilic aromatic substitution (fig. 1), which is very much sn1ar - like. however, theoretical study of the unimolecular dediazonation of cytosinediazonium ion showed that the classical diazonium ion 2 (5nn) is merely a shallow minimum and less stable than free 5 and n2 and that an electrostatic complex 4 (5nn) is bound by only 5.4 kcal mol. the ho - tautomer of cytosinediazonium ion 2 (not shown in fig. 1) is 3.7 kcal mol more stable than 2 itself. 2 has a classical diazonium - ion structure and it is bound by 10.8 kcal mol relative to 5 and n2. hence, cytosine deamination essentially produces a free cation, 5 or 5. more recently, it has been shown that the ions 5 or 5 are best described as cyclic nitrilium ions 6 and 6 and that the dative bond easily breaks to form the more stable ring - opened cations 7 and 7. these results seriously put in question whether uracil is the only product of nitrosative cytosine deamination. 1nitrosative deamination of cytosine and cytidine nitrosative deamination of cytosine and cytidine if the r - group is ribose or 2-deoxyribose, 6 and 7 are the appropriate models for the deamination of cytidine, its nucleotides cmp, cdp, and ctp, and their 2-deoxy derivatives. ubiquitous water may react with 7 by addition, substitution (rh), or deprotonation (r = h). water addition forms of carbamic acid and subsequent decarboxylation leads to (z)-3-aminoacrylonitrile 9. (z)-3-aminoacrylonitrile is susceptible to base- [12, 13 ] and acid - catalyzed nucleophilic addition to the c = c and cn bonds and this chemistry also might lead to dna adducts. alternatively, deglycation by substitution (rh) or deprotonation (r = h) would lead to (z)-3-isocyanatoacrylonitrile 10. unsaturated isocyanates are toxic and 3-isocyanatoacrylonitrile can form adducts and cross - links [16, 17 ]. here, we report the results of a study of the formation of 10 by deprotonation of 7 and 7, of the e / z - preferences of 3-isocyanatoacrylonitrile 10 and 11 and of their conformers 12 and 13, and of cn rotation inversion in both e / z - isomers via ts1 and ts3 (fig. 2). geometry optimizations and vibrational analyses were carried out at the mp2(full)/6 - 31 g level with the program gaussian03. we employed perturbation theory deliberately because it is preferable to (hybrid) density functional theory for the present purpose. structure (z, s - cis)-10 benefits from through - space interaction and such dispersion interactions are not properly accounted for by the standard dft models. atomic charges were calculated with the natural bond orbital (nbo) method [21, 22 ] at the same level. molecular models of the minima and major structural data and atom and fragment charges are reported in figs. 3 and 4, respectively. 3mp2(full)/6 - 31 g structures of 713fig. 4nbo analysis of 713. 5molecular models of the mp2(full)/6 - 31 g structures of ts1 and ts3 mp2(full)/6 - 31 g structures of 713 nbo analysis of 713. numbers printed in bold are fragment charges molecular models of the mp2(full)/6 - 31 g structures of ts1 and ts3 total energies e (in hartrees), vibrational zero - point energies vzpe (kcal mol), thermal energies te (kcal mol, 298.15 k), and entropies s (cal mol k) are reported in table 1. in tables 2 and 3 are reported the values e, e0 = e + vzpe, h298 = e + te + rt, and g298 = h298 0.29815s. table 1total energies and thermodynamical datamoleculesym.evzpetesn(z,s-cis)-7c1337.69220641.9846.2982.390(z,s-cis)-7c1337.67379841.1445.8285.890(z,s-cis)-10cs337.40562034.7338.8381.510(z,s-trans)-12cs337.40467534.6038.7482.100(e,s-cis)-11cs337.40385834.6338.8382.130(e,s-trans)-13cs337.40523034.4938.7381.820(z)-ts1c1337.40173734.4738.1578.291cs337.40051634.3137.6175.622(e)-ts3c1337.40152834.3538.1578.861cs337.40035834.2037.6075.152table 2relative energies, trans - preferences, z - preferences and proton affinities (kcal mol)parameteree0h298g298(z, s - trans)-12vs. (z, s - cis)-100.240.010.140.05s - trans - preference of z - isomers0.590.460.510.33s - trans - preference of e - isomers0.870.990.960.87z - preference of s - cis - conformers1.111.001.100.92z - preference of s - trans - conformers0.350.450.370.28pa(10 7) 179.84172.59173.27166.41pa(10 7) 168.28161.88162.18156.70table 3activation barriers for cn rotation inversion (kcal mol)processee0h298g298(z, s - cis)-10 (z, s - trans)-122.442.171.722.721.841.711.252.39(e, s - cis)-11 (e, s - trans)-131.461.180.781.752.322.181.742.62 total energies and thermodynamical data relative energies, trans - preferences, z - preferences and proton affinities (kcal mol) activation barriers for cn rotation inversion (kcal mol) stereochemical preferences studies of,-unsaturated isocyanates are scarce [23, 24 ] and the stereochemistry of vinyl isocyanates with additional functionality remains unexplored. (z, s - cis)-10 is the most stable isocyanatoacrylonitrile and the relative energies of isomers and conformers only are 0.10.9 kcal mol. z - preferences occur for the s - cis- and s - trans - conformers and they are higher for the s - cis - structures. if steric interactions dominated, one would expect preferences for the e - configuration and the s - trans conformation ; (e, s - trans)-13. the calculated relative energies of 0.87 kcal mol for (e, s - cis)-11vs. (e, s - trans)-13 and of 0.28 kcal mol for (z, s - trans)-11vs. (e, s - trans)-13 are in line with expectation based on steric demand. assuming additivity, one would thus estimate an energy of about 1.15 kcal mol for (z, s - cis)-10 relative to (e, s - trans)-13 for steric reasons. yet, (z, s - cis)-10 is 0.05 kcal molmore stable than (e, s - trans)-13 and, hence, 10 benefits from through - space neighboring group attraction of about 1.2 kcal mol. electronic structures and through - space interactions the nbo analysis shows highly polar electronic structures and the main effect of the isocyanato group on the acrylonitrile is an increase of the electron - deficiency of the ch group to which it is attached (fig. 4). the cn groups in 1013 are highly dipolar but their overall charge is very small. on the other hand, the nco groups in 1013 are charged significantly, they carry charges of about 0.2, and they are extremely quadrupolar. these findings suggest that the attractive neighboring - group interaction in 10 is due in part to polarization of the cyano group in the field of the overall charge of the isocyanato group and in part to dipole the dipole - dipole attraction between the cn bond dipoles in the nco and cn groups appears to dominate the repulsion between co bond dipole of the nco group and the cn group dipole. the nbo charge analysis thus provides a consistent rationale based on simple and widely accepted concepts of interaction and reactivity. the proposed interactions can be quantified via fragment - interaction analysis [26, 27 ] and recent progress in the development of orbital deletion analysis [22, 28 ] also might provide for interesting tests of the proposed rationale and any possible hyperconjugation.the major effect of the protonation of the nco group is a withdrawal of electron density from the alkene fragment ; in the cations the hnco and alkene fragments carry charges of about 0.6 and 0.4, respectively. note that the protonation of either one of the heteroatoms of the nco group does very little to increase the electrophilicity of the heterocumulene s center. instead, there is a rearrangement of electron density from one heteroatom to the protonated one. rotation - inversion a priori the s - cis / s - trans interconversion might involve in - plane n - inversion or rotation about the ocn ch bond. the n - inversion would involve an n - hybridization change from sp to sp and shorten both bonds to n. hybridization changes would be small along the rotation path and there would be some loss of -conjugation.the ideal inversion process would involve a planar transition - state structure. we searched for these transition - state structures under the constraint to cs - symmetry, and found the resulting structures cs - ts1 (i118, i101 cm) and cs - ts3 (i119, i81 cm) to be second - order saddle points on the potential - energy surface. the true transition - state structures ts1 and ts3 were located (fig. 5) and the activation barriers are less than 3 kcal mol (table 3).the (ccnc) dihedral angles in ts1 and ts3 are 93.4 and 84.3, respectively, and close to 90. however, the (cnc) angles in ts1 and ts3 are 144.1 and 144.5, respectively, and it is clear that these are not the structures of pure rotational transition states.the rotation inversion paths are illustrated schematically in fig. pure rotation would leave 120 relatively unchanged as the rotation proceeds from =0 to =180. the pure inversion would change from 120 to 180 while =0 and then from 180 to 120 while =180. the change in at =180 causes the discontinuity on the right in fig. 6illustration of the rotation inversion paths and the position of the transition state structures in the (,)-map. inversion paths and the position of the transition state structures in the (,)-map. (horizontal axis is not drawn to linear scale) proton affinities isocyanate 10 shows a pronounced preference of about 10 kcal mol for protonation at n rather than at o (table 2). the proton affinity for n - protonation is 166.4 kcal mol and very close to the proton affinity of water, which is about 167 kcal mol. given that 7 is formed in aqueous solution, this result provides strong evidence that the reaction h2o + 7 10 + h3o occurs under typical conditions of nitrosative deamination. pyrimidine ring - opening in nitrosative deamination of guanine, guanosine, and its nucleotide derivatives has been well established by theoretical study [20, 30, 31 ] and experimentation [32, 33 ]. the unimolecular dediazoniations of adeninediazonium and cytosinediazonium ions can proceed without ring - opening and it was realized only more recently that the cations which are produced by dediazoniation of adeninediazonium ion and cytosinediazonium ion can ring - open with very little kinetic hindrance. the proton affinity of 10 suggests that 10 and its isomers and conformers are formed in nitrosative cytosine deamination in aqueous solution. the possibility for recyclization of 10 to uracils has been explored experimentally and it is not likely. thus, toxicological studies of nitrosative cytosine deamination need to direct attention at 3-aminoacrylonitrile 9 and 3-isocyanatoacrylonitrile 10. it remains to be seen whether 10 can be formed by hydrolytic deglycation from the respective cytidine derivatives. once 10 is formed, it can react with water to carbamic acid 8, with alcohols to carbamates 14, with amines to ureas 15, and with thiols to carbamothioates 16, etc. as shown in fig. 7 for conformer 12. note that this is a second path to 8 and on to 9, and this path differs from the sequence 7 8 9 in one very important way : 10 has some lifetime and 8 and 9 would be formed at some distance from the site of the deamination event while 7 survives merely until a nucleophile diffuses to it (usually water). the 3-isocyanatoacrylonitrile thus has the potential to cause biological damage in a larger region around the site of nitrosation and this neutral carcinogen can be much more selective in its reactions. in addition to the types of isocyanate adducts shown in fig. 7 (and their isomers and conformers), there also exist further possibilities for additions to the acrylonitrile moiety, either alternatively or subsequently. 7 provides an example for a urea adduct formation with dg and subsequent intrastrand dg - to - da cross - link formation. 7possible products of nucleophilic addition to 12 and examples for adduct and cross - link formation possible products of nucleophilic addition to 12 and examples for adduct and cross - link formation | uracil has long been known as the main product of nitrosative cytosine deamination in aqueous solution. recent mechanistic studies of cytosinediazonium ion suggest that the cation formed by its dediazoniation can ring - open to n - protonated (z, s - cis)-3-isocyanatoacrylonitrile 7. stereochemical preferences are discussed of the 3-isocyanatoacrylonitriles (z, s - cis)-10, (e, s - cis)-11, (z, s - trans)-12, and (e, s - trans)-13. the electronic structures of 7 and 1013 have been analyzed and a rationale is provided for the thermodynamic preference for (z, s - cis)-10. it is shown that s - cis / s - trans - interconversion occurs via cn rotation inversion paths with barriers below 3 kcal mol1. the proton affinities of 3-isocyanatoacrylonitrile 10 and water are nearly identical and, thus, 3-isocyanatoacrylonitriles can and should be formed in aqueous media from 7 along with 3-aminoacrylonitriles 9. the results highlight the relevance of the chemistry of 3-isocyanatoacrylonitriles for the understanding of the chemical toxicology of nitrosation of the nucleobase cytosine.electronic supplementary materialsupplementary material is available for this article at http://dx.doi.org/10.1007/s00894-005-0048-0 |
quercetin, which is considered as a health - promoting antioxidant, belongs to the broad flavonoids group.[13 ] flavonoids present in a variety of natural fruits and vegetables ranging from apple, cranberry to onion, broccoli and teas,[47 ] and along with some nutrients may have positive effects in athletes. a large number of epidemiological studies have demonstrated that quercetin provides anti - inflammatory and antioxidant properties.[1012 ] endothelial function is one of the exercise performance determinants and its dysfunction caused by oxidative stress and may induces atherosclerosis. within a clinic - based study, it has been proved that quercetin improves oxidant status among renal patients through raised serum paraoxonase. paraoxonase is known as a marker of high - density lipoprotein antioxidant activity which inhibits low - density lipoprotein oxidation. yi., reported that quercetin can reduce oxidized - low - density lipoprotein level and prevent atherosclerosis. in 2011, yeekh., demonstrated that quercetin supplementation significantly alleviates low - density lipoprotein cholesterol concentration and increases serum high - density lipoprotein in the study group. cadmium oral administration results in an increase in low - density lipoprotein, three acylglycerol, free fatty acids and phospholipids and decrease in high - density lipoprotein. after an experimental investigation, it declared that quercetin can escalate serum high - density lipoprotein and reduce low - density lipoprotein and tg among rats. lack of well - documented information about quercetin and vitamin c supplementation containing comprehensive laboratory measurements among athletes draws attention to design more clinical trials in order to define mechanisms. the present study aimed at conducting a research on the effects of both quercetin and vitamin c on lipid profile and muscle damage in human subjects. a randomized, placebo - controlled, double - blind clinical trial was carried out on 60 male athletes who were active, but not involved in professional sports. the exclusion criteria were consumption of quercetin or any other dietary supplements for at least 3 months before the study onset. participants were requested to abstain from exhaustive exercise 24 h before the beginning of the trial and to keep a record of their recent physical activity and dietary intake. this trial was done in order to test the hypothesis of the beneficial effects quercetin and vitamin c supplementation on male athletes within eight weeks. participants were randomly assigned to one of four groups including quercetin + vitamin c (500 mg / day quercetin + 200 mg / day vitamin c), quercetin (500 mg / day quercetin + 200 mg / day placebo), vitamin c (500 mg / day vitamin c + 200 mg / day placebo) and placebo (500 mg / day placebo + 200 mg / day placebo). all supplements were orally administrated in capsule form including 500 mg quercetin (solaray, usa, inc), 200 mg vitamin c (razi, iran, inc) and placebo (pharmacy faculty, isfahan university of medical science, iran) each day after meals. blood samples were obtained from all subjects between 5:00 pm and 6:00 pm, after intensive exercising, at the outset and after intervention. all measurements were taken at the beginning of the supplementation and end of intervention. body weight and percentage of body fat in addition, plasma samples were collected for the determination of serum lipid profile containing high - density lipoprotein and low - density lipoprotein concentration. high - density lipoprotein and low - density lipoprotein were measured at baseline and again at eight weeks utilizing the cholestech ldx system (hayward, ca), according to the manufacturer 's instructions. ldh concentrations were measured by the elisa method, according to the manufacturer 's protocol. statistical analyses were conducted using the statistical program for social sciences (spss version 13, inc., one - way multivariate analysis of covariance (mancova) controlling for the pre - test differences followed by dunnett 's post hoc comparison was used for multiple comparisons between groups. due to non - normality of the studied variables (positive skewed distribution) logarithmic transformation was done and homogeneity of covariance matrix was tested via box'm statistics. analyses were performed with the spss version 16 (spss inc, chicago, il) statistical package. the general mean sd of subjects for age (years), weight (kg) and body mass index (bmi, kg / m) was 21.0 1.6, 67.5 10.8 and 22.3 3.3 respectively. table 1 shows the mean sd values of high - density lipoprotein (hdl), and lactate dehydrogenase (ldh) pre and post supplementation. we did not detect any significant changes in high - density lipoprotein levels between groups and in the four groups before and after supplementation. while ldh values decreased significantly (p = 0.048) in quercetin + vit c group it was not considerable in other treatments and between groups. the comparison of lactate dehydrogenase and high - density lipoprotein levels between 4 groups the comparison of mean nutrient intakes between 4 groups the results of our study represent that supplementation with quercetin and vitamin c did not improve the lipid profile as measured by high - density lipoprotein., in a clinical trial study, observed an improved high - density lipoprotein level among renal patients. different study populations and supplementation dosages might be the possible reasons for the differences in results between the two studies. in line with the previous study, yeekh., reported a significant increase in high - density lipoprotein and decrease in low - density lipoprotein after quercetin supplementation. the anti - inflammatory and antioxidant properties of quercetin result in reduction of exercise - induced muscle damage. in accordance with this fact, we observed significant muscle damage as measured by ldh in the quercetin and vitamin c group. the attainable mechanism is that quercetin alleviates the free radical generation during physical activity in skeletal muscle.[1821 ] however, in our study, we detected an increase in nutrient intake, notably the fat - soluble vitamins, calcium and folic acid. that may be owing to a gain in dietary intake among all groups. to provide an overview, intake of quercetin and vitamin c supplementation may not be beneficial in lipid profile improvement, although it would probably induce reduction of muscle damage. hence, more controlled clinical trials considering longer periods of supplementation and larger dosages are needed. the limitations of our study were the limited study population and different physical activity history of athletes. the strengths of this study were human nature of samples and accurate follow - up. | background : quercetin, which is considered as a health - promoting antioxidant, belongs to the broad flavonoids group. numerous experimental studies have proved that quercetin and vitamin c provide anti - inflammatory and antioxidant properties. the aim of this study is to assess the effects of both quercetin and vitamin c on lipid profile and muscle damage in human subjects.methods:a randomized, placebo - controlled, double - blind clinical trial was carried out on 60 males for eight weeks. the subjects were randomly assigned to one of the four groups : 1) quercetin + vitamin c (500 mg / day quercetin + 200 mg / day vitamin c) 2) quercetin (500 mg / day quercetin + 200 mg / day placebo) 3) vitamin c (500 mg / day vitamin c + 200 mg / day placebo) and 4) placebo (500 mg / day placebo + 200 mg / day placebo). blood samples, body weight and percent of body fat were measured before and after intervention. in addition, dietary intake was estimated using 24-h recall.results:no significant changes occurred in high - density lipoprotein levels between groups and in the four groups before and after supplementation. low density lipoprotein values decreased significantly (p = 0.048) in the quercetin + vit c group but decrease was not considerable in other groups before and after intervention and among groups. fat - soluble vitamins ' intake was significantly high among 4 groups.conclusions:quercetin and vitamin c supplementation may not be beneficial in lipid profile improvement, although it may reduce induce muscle damage and body fat percent. |
mammalian epithelial cells have junctional complexes between cells that are composed of adherens junctions, desmosomes, and tight junctions (farquhar and palade, 1963). tight junctions are responsible for sealing of the intercellular space and for controlling paracellular transport (tsukita., 2008 ; lal - nag and morin, 2009). tight junctions are composed of several protein components, among which claudins are essential for their formation and function (tsukita., 2008). in mammals, humans have 23 claudin genes, whereas rats and mice have 24 genes (lal - nag and morin, 2009). dynamics of tight junction proteins are not fully understood (gonzlez - mariscal., 2007 ; matter and balda, 2007 ; shen., 2008 ; steed., 2010). although some dynamics of exogenously expressed claudin-1 and internalization of claudins via small vesicles from tight junction are reported (sasaki., 2003 ; matsuda., 2004), no information has been given on the recruitment of claudins from cytoplasm to tight junction. it is known that tooth enamel formation occurs in roughly two stages : the first stage is a secretion stage and the second is a maturation stage. epithelial ameloblasts are responsible for both stages of enamel formation (warshawsky and smith, 1974). secretion ameloblasts and maturation ameloblasts have tight junctions which have been demonstrated in freeze fracture replica studies (warshawsky, 1978 ; sasaki, 1990). the expression of claudins in ameloblasts has also been reported in immunocytochemical and in situ hybridization studies (joo and arana - chavez, 2004 ; bello., 2007 ; ohazama and sharpe, 2007 ; inai., 2008 ; hata., 2010). maturation ameloblasts undergo several modulation cycles, involving two different types of cell morphology, during enamel maturation (josephsen and fejerskov, 1977). these two types of ameloblasts are referred to as ruffle - ended ameloblasts (ra) and smooth - ended ameloblasts (sa), respectively. ras have well - developed tight junctions at the distal junctional area, whereas sas have moderately developed tight junctions at the proximal junctional area (sasaki, 1990). ca autoradiography studies have shown that at least calcium ions can pass through the intercellular space of secretory ameloblasts and sas in a short time, but that these ions pass through the ra layer more slowly (kawamoto and shimizu, 1997). moreover, modulation cycles involve the rapid movement of wave - like bands of ra and sa over the ameloblast layer, that are a result of extensive ra - to - sa or sa - to - ra changes during maturation. such changes may occur up to 45 times in a mandibular incisor (josephsen, 1983 ; smith., 1987). thus, it is of interest to examine how tight junctions form and break during extensive modulation cycles. in this study, unexpectedly, the anti - claudin-1 antibody localized claudin to the golgi apparatus of a sub - population of sa and ra in addition to the distal junctions of ra. localization of claudin-1 in the golgi apparatus may reflect rapid tight junction turnover during enamel maturation. wistar rats were used for the present study (jcl wistar ; clea japan, tokyo, japan). twelve 4-week - old rats were sacrificed by decapitation under deep anesthesia with inhalation of diethyl ether or by intraperitoneal injection of sodium pentobarbital (nembutal ; abbot, north chicago, il, usa). the maxillae and mandibles were dissected and fixed in 4% paraformaldehyde solution in phosphate - buffered saline (pbs) for 20 h. the maxillae and mandibles were further demineralized with 5% edta, ph 7.2 (adjusted with naoh) at 4c for 3 weeks. the tissues were washed with pbs, were infused with 25% sucrose in pbs overnight, and were cut into 6- to 9-m - thick cryosections using a cryotome (hm505e ; microm, walldorf, germany). the cryosections on glass microscope slides were incubated in 1% bovine serum albumin (bsa) in pbs at rt for 30 min. the sections were then incubated with rabbit anti - claudin-1 antibody (jay.8 ; invitrogen, camarillo, ca, usa) at a concentration of 12.5 g / ml in 1% bsa - pbs overnight at 4c. after washing in pbs, the sections were incubated with alexa 488-conjugated donkey anti - rabbit igg diluted 1:100, 0.5 g / ml hoechst 33342 and rhodamine phalloidin diluted 1:50 (molecular probes, eugene, or, usa) at rt for 30 min. control sections were incubated with normal rabbit immunoglobulin (dako, glostrup, denmark) at a concentration of 10 g / ml instead of with the primary antibody, and were processed in the same way as described above. some sections were incubated with mouse monoclonal anti - gm130 antibody (clone 35/gm130, bd biosciences, ca, usa) at a concentration of 12.5 g / ml in 1% bsa - pbs overnight at 4c. the sections were incubated with alexa 647-conjugated goat anti - mouse igg diluted 1:50 at rt for 30 min. control sections were incubated with normal mouse igg (dako) at a concentration of 12.5 g / ml instead of with the primary antibody, and were processed in the same way as described above. fluorescence images were obtained using an epifluorescence microscope (ax-80 ; olympus, tokyo, japan) equipped with a ccd camera (quantix kaf1401e, photometrix, tucson, az, usa). some images were processed using metamorph software (universal imaging, downington, pa, usa). anti - claudin-1 antibodies did not label ameloblasts in the secretion zone of the incisor. however, in the postsecretory transition zone, the supranuclear region of ameloblasts was labeled by these antibodies in a linear pattern. in the maturation zone, ameloblasts were labeled at the distal end of the zone, along the long axis of the incisor. this labeling was then interrupted but labeling could then be again detected further along this axis (figure 1). in addition, the supranuclear region of some of the ameloblasts was intensely labeled with these antibodies. immunofluorescent localization of claudin-1 at the distal end and at the supranuclear region of maturation ameloblasts. the tissue at the right end of the micrographs in (a) and (b) is continuous with the tissue shown at the left end of the micrographs in (b) and (c), respectively. single and double asterisks show regions of the sa bands with and without supranuclear reactivity of claudin-1, respectively. ra, ruffle - ended ameloblast ; sa, smooth - ended ameloblast. bar = 100 m. to determine the characteristics of the maturation ameloblasts with or without distal labeling of anti - claudin-1, the sections were triply stained for claudin-1, f - actin and nuclear dna using anti - claudin-1, rhodamine the distal end of ameloblasts that stained with anti - claudin-1 were co - stained with rhodamine phalloidin (figures 2a, c, d, f, g, i), whereas ameloblasts that did not stain with anti - claudin-1 at the distal cell end were not labeled with rhodamine phalloidin (figures 2b, e, h). since f - actin is abundant at the distal end of ras in which a junctional complex is well developed, but is not expressed at the distal end of sas, which have poorly developed intercellular junctions at the proximal end (nishikawa and josephsen, 1987), the ameloblasts stained at the distal end with anti - claudin-1 are considered to be ras. no anti - claudin-1 staining was observed at the proximal end of either ras or sas. cryosections of rat mandibles were triply labeled with anti - claudin-1 [(a c), green ], rhodamine phalloidin [(d f), red ] and hoechst 33342 [(a i), blue ], to co - stain claudin, actin and nuclei respectively. (g), (h), and (i) show merged images of (a, d), (b, e), and (c, f), respectively. the incisal region of an ra band (a, d, g), a part of one sa band (b, e, h), and the apical region of another ra band (c, f, i) are shown. the distal end of the ameloblasts of ras exhibits both anti - claudin-1 and rhodamine phalloidin fluorescence (a, c, d, f, g, i). in addition, small round positive fluorescent foci (small arrows) are visible in the supranuclear cytoplasm of the incisal region of the ra and in some of the sa [arrows in (a, b, g, h) ]. bars = 30 m. some of the maturation ameloblasts also showed positive anti - claudin-1 staining in the supranuclear region. with progression in an incisal direction these ameloblasts then formed part of an adjacent sa band. during this progression the ameloblasts gradually lost their anti - claudin-1 immunoreactivity in the supranuclear region (figures 1 and 2a, b). to clarify the nature of the anti - claudin-1-positive supranuclear structure, double labeling with anti - golgi matrix protein gm130 and the result showed that gm130 and claudin-1 co - localized in the maturation ameloblasts, but that only gm130 could be detected in the papillary layer cells (figure 3). to confirm the specificity of anti - claudin-1 antibody used in this study, perineurium of nerve fibers in incisor periodontal ligaments and molar gingival epithelia were examined, since claudin-1 has localized in perineurium (pummi., 2004) and junctional epithelia of gingiva (fujita., 2010). the result showed the bright labelings in the perineurium surrounding nerve fibers (figure 4a) and cell periphery of junctional epithelia (figure 4b). in mandibular incisors the modulation wave of ras and sas moves in an incisal direction at a speed of 243 m / h. thus, each ameloblast on the maturation enamel continuously changes its shape from an ra type to an apically adjacent sa type, and from an sa type to an apically adjacent ra type, when a particular modulation band moves in the incisal direction of the incisor (figure 5). these changes would explain why, in a particular ra band, a maturation ameloblast reacts positively with anti - claudin-1 in the distal tight junctions but shows no supranuclear labeling (figure 5a, ng). furthermore, they would explain why, in an apically located sa band, maturation ameloblasts initially show no anti - claudin-1 immunoreactivity, but later display immunoreactivity in the supranuclear region (figure 5b, pg). when the section is viewed from a more apical direction, ameloblasts are observed to change to an ra shape and to develop distal end - labeling of claudin-1 in addition to claudin-1 supranuclear labeling (figure 5c). this supranuclear labeling is transient and disappears at a later stage (figure 5a). cryosections of rat mandibles were doubly labeled with anti - claudin-1 (a) and anti - gm130 (b). a merged image is shown in (c). some anti - claudin-1-positive thread - like clusters co - localize with the golgi apparatus that is labeled with anti - gm130 in maturation ameloblasts (arrows). immunofluorescent staining of claudin-1 in the nerve fibers in incisor periodontal ligaments (a) and gingiva of mandibular third molar (b). the perineurium [arrows in (a) ] and the cell periphery of junctional epithelia [arrows in (b) ] were labeled with anti - claudin-1. a modulation wave moves from one ruffle - ended ameloblast (ra) to the next ra through smooth - ended ameloblasts (sa) in an incisal direction. the first ra exhibits distal tight junctions and a ruffled border but no claudin-1-positive golgi apparatus staining (a). this ra then changes its shape to an sa morphology, where it loses the distal tight junctions and ruffled border but where the golgi apparatus now stains positively for claudin-1 (b). the cell morphology then changes again to an ra shape, which exhibits distal tight junctions and a ruffled border but which also retains the positive staining of the golgi with anti - claudin-1 (c). the golgi apparatus may periodically provide tight junction precursors to the distal tight junction area. the length of sas in mandibular incisors that showed positive supranuclear labeling of anti - claudin-1 was 177 24 m (mean sd, if the modulation wave moves at a speed of 243 m / h it may take 43.6 6.0 min for claudin to move from the golgi apparatus to the distal junctional plasma membrane. in this paper we have further clarified the role of claudin and tight junction formation during cyclic alternation of ameloblasts between an ra and an sa morphology in the process of enamel maturation in rat incisors. we found that claudin-1, which is critical for tight junction formation, is localized in distal junction area in ras. this finding is consistent with previous data regarding the importance of tight junctions, and of claudins, for enamel formation. tight junctional strands have been observed in the proximal and distal junctional complexes of secretion ameloblasts (warshawsky, 1978) as well as in maturation ameloblasts (sasaki, 1990). in particular, ras have well - developed tight junctional strands at their distal end which limit the permeability of the intercellular space, whereas sas have less developed tight junctional strands (sasaki, 1990). several claudin protein species have been found in tooth bud epithelia and ameloblasts in studies using in situ hybridization probes and antibodies against tight junction proteins (bello., 2007 ; ohazama and sharpe, 2007 ; inai., 2008 ; hata., 2010). of these claudins, claudin-1, -4, and -7, and occludin have been detected in ameloblasts by immunocytochemistry, and claudin-1 and -4 have been localized at the distal end of ras, but not of sas, in the maturation zone of incisors (inai. although claudin-1 has been detected in presecretory and secretory ameloblasts in addition to maturation ameloblasts (joo and arana - chavez, 2004 ; inai., 2008 ; hata., 2010), in this study ameloblasts anterior to postsecretory transition stage were not labeled by anti - claudin-1. this discrepancy may reflect the different fixation conditions : 4% paraformaldehyde (pfa) for 20 h in this study versus zamboni 's fixative including 2% pfa for 4 h (joo and arana - chavez, 2004), 1% pfa for 4 h (inai., 2008), and cold ethanol for 30 min and acetone for 1 min (hata., 2010). although milder fixation condition may recover the antigenicity of ameloblast claudin-1 at the earlier stages, the labeling pattern of distal end of maturation ameloblasts observed in this study is consistent with a previous report (inai., 2008). specificity of the anti - claudin antibody used in this study was confirmed by using positive control sections of perineurium and junctional epithelium. it is noteworthy that, in the present study, claudin-1 was localized in maturation ameloblasts, since epidermal claudin-1, but not claudin-4, plays a role in the tight junction barrier against water loss from mouse skin (furuse., 2002). during enamel maturation, the control of protein and water resorption from enamel and the subsequent increased mineralization of enamel are essential. although the ameloblasts themselves are fixed on the enamel surface, they continuously alternate between an ra and an sa morphology, which has been described as modulation bands. (1987) reported that these modulation bands move in an incisal direction at a rate of 243 m / h in mandibular incisors and at 188 m / h in maxillary incisors. by the end of enamel maturation in mandibular incisors, a group of maturation ameloblasts may have undergone 45 ra / sa modulation cycles (smith., 1987), suggesting rapid and extensive turnover of tight junctions. to understand tight junction turnover in maturation ameloblasts, we examined claudin-1 localization in ras and sas using immunocytochemistry. the results showed that claudin-1 localized at the distal end of the ras but not the sas. ras and sas were distinguished by f - actin localization after double labeling with rhodamine phalloidin and anti - claudin-1, based on a previous study that f - actin is abundant in the distal end of ras but not in the distal end of sas (nishikawa and josephsen, 1987). these data suggest the model that an sa might convert to an ra by first forming a claudin-1-positive tight junction precursor in the golgi apparatus. although the golgi - derived vesicular precursor of tight junction has not been described, vesicular transport of tight junction protein has been proposed (matsuda., 2004 ; this precursor might then move to the distal junction area, at which point the sa becomes an ra that forms tight junctions and extensive membrane ruffles and in which both the golgi apparatus and the distal cell end stain positively with anti - claudin-1 antibodies. however, further investigation is required to confirm the presence, and nature, of tight junction precursors in the golgi area. in support of this model, we found that ameloblasts in the apical part of the ra band, where ras are changing back into sas, had lost anti - claudin-1 immunoreactivity of the golgi apparatus, and only their distal end was reactive to anti - claudin-1 (figures 1 and 2). ultimately, the anti - claudin-1-positive tight junction may be lost at the distal end of these ameloblasts and instead the cells may make proximal junctional complexes, thereby turning into an sa. in this sa, the tight junction precursor may then again start to form in the golgi, thereby beginning a new modulation cycle. by measurement of the length of the sa band that displayed supranuclear anti - claudin-1 labeling, the time it would take for the tight junction precursor structure to move from the golgi apparatus to the distal junctional plasma membrane was calculated as 43.6 6.0 min. this time is consistent with the dynamic properties of the tight junction strand network which has been shown to reorganize within several minutes in l cells in which claudin-1 was exogenously expressed (sasaki., 2003). however, a second study indicated that individual tight junction strands are relatively stable after photobleaching of a section of a fluorescent tight junction strand (sasaki., 2003). although more studies are clearly needed, it was shown in this study that the rapid alteration of the tight junction of ameloblasts during enamel maturation was accompanied by golgi complex activities, which imply the involvement of the formation and destruction of tight junction membrane - protein complexes during sa / ra modulation cycles. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | claudin-1 is a tight junction transmembrane protein. its localization in the maturation ameloblasts of rat incisors was examined by immunofluorescence microscopy. distal junction area of ruffle - ended ameloblasts (ra) and the golgi apparatus of a sub - population of smooth - ended ameloblasts (sa) and ras stained positive with anti - claudin-1 antibodies. since it has been shown that ameloblasts repeatedly alternate between an sa and an ra morphology during enamel maturation, the presence of claudin-1 in the golgi cisterns may indicate the presence of tight junction precursors before transportation to the junctional area. |
papillary fibroelastomas (pfes) are frondlike papillary growths that typically occur on the cardiac valves but can also be found on the papillary muscles, chordae tendenae, the ventricular septum, or the endocardial surface.1 the prevalence of primary cardiac tumors range from 0.0017% to 0.28%, but they are the second most common benign neoplasm of the cardiac valves after myxomas.2 their prompt detection is of great importance as they are the potential causes of systemic emboli, stroke, myocardial infarction, and sudden death. we present a case of a pfe causing two embolic strokes, reminding us of the importance of keeping this as an important differential when determining the cause of shower emboli in an otherwise negative workup. the patient was a 64-year - old male with a past medical history of hypertension and coronary artery disease and is currently a 1 pack per day smoker and has been recently treated for transient ischemic attack 2 months prior. he presented with new onset aphasia and unsteady gait for 23 days. upon arrival to the emergency department, he was found to be afebrile with a heart rate of 4854 bpm, a respiratory rate of 18 bpm, and a blood pressure of 142/66 mm hg. on examination, the patient was awake, alert, and oriented. other than some mild right upper extremity ataxia on the finger - to - nose test, the rest of the neurological examination was within normal limits. magnetic resonance imaging of brain showed multiple areas of restricted diffusion in the left middle cerebral artery territory in the medial and lateral left temporoparietal cortex and subcortical and periventricular white matter consistent with acute hemorrhagic infarcts, probably embolic. there were also multiple areas of restricted diffusion in the left frontoparietal periventricular centrum semiovale region consistent with acute watershed infarcts (figures 1 and 2). the patient was immediately started on aspirin, high - dose statin, clopidogrel, and fluids to allow for permissive hypertension. as part of the workup to determine the cause of his embolic stroke, the patient would have been sent for a trans - thoracic echocardiogram (tte), but since he was recently worked up for a stroke just 2 months prior to this admission with a tte, he was sent for a transesophageal echocardiogram (tee). the tee showed a fairly large (123 mm), bulky, and highly mobile mass on the aortic aspect of the aortic valve, consistent with a fibroelastoma (figures 3 and 4). after completing the rest of the workup, it was determined that this was likely the cause of his stroke. because of recent plavix (clopidogrel ; bristol - myers squibb, new york, ny, usa) use, the surgery was postponed for a couple of days while he remained on heparin. surgery was able to remove the growth using a minimally invasive hemisternotomy approach with only 66 minutes of bypass time. otherwise, the patient s neurological status returned back to normal and he continues to improve with intensive physiotherapy. the maimonides medical center (mmc) irb decided that neither irb approval nor a health insurance portability and accountability act of 1996 (hipaa) waiver / hipaa authorization required for case report that involves no more than three patients, provided the presentation or publication does not have identifiable information and the activity is not considered fda regulated research. pfes are rare, benign primary cardiac tumors. their nomenclature have sometimes been confusing as several names have been used to identify them in the past, but pfe is the most widely accepted name.3,4 they are considered the most frequent primary cardiac tumor originating from the valvular endocardium. the valvular distribution predominates on the left side of the heart, with 29% of the cases on the aortic valve, 25% on the mitral valve, 17% on the tricuspid valve, and 13% on the pulmonary valve.1 pfes are characteristically small avascular solitary tumors with multiple arms that resemble the sea anemone.5 several mechanisms behind the development of pfes exist, but none have been scientifically proven. the most commonly accepted explanation for its origin is the microthrombus theory, which hypothesizes that they originate as small thrombi that coalesce on the coopting margins of the valve at the site where some minor endothelial damage may have occurred previously.6 pfes resemble chordae tendineae and have two layers, an outer hyperplastic endothelial layer and a dense central core, that are contiguous with the valve leaflet. their surface is covered with numerous filiform projections with an intermediate layer of loose, mucopolysaccharide - rich connective tissue, which is sandwiched between the outer endothelium and the central core. the central core contains an acellular fibrous axis that forms a concentric granular pattern with layers of fibrin and a mucopolysaccharide matrix that is usually acidic.7 the clinical presentation of pfes can vary between being asymptomatic to symptomatic based on the consequences of severe thromboembolic complications such as myocardial infarction and stroke. pulmonary embolism, congestive heart failure, near syncope, ventricular fibrillation, and sudden death, while rare, have also been reported.1,8 the embolic potential of the tumor results from fragmentation of the papillary spikelets or even from thrombi formed by platelets and fibrin, which occasionally adhere to the surface of the tumor as is also thought to be the mechanism for stroke in cases of cardiac myxomas.9 most pfes are located on the left side of the heart, which increases the risk of systemic embolization.10 in reality, an embolic cerebral stroke in a young patient with no evidence of cerebrovascular disease, particularly in the presence of sinus rhythm, should prompt investigation into the presence of a cardiac tumor along with infective endocarditis and mitral valve prolapse.11 in 2016, saver12 published a review in which he defined cryptogenic strokes as strokes with an unidentified cause following standard evaluation. the purpose for trying to go beyond the standard evaluation to figure out a cause has to do with recurrence rate. in one study, the recurrence rate was 1.9% in the first year following the stroke, and 0.8% per year in years 24.13 because of the impact on recurrence, all efforts should be made to try and identify the source of an embolic stroke prior to labeling them as cryptogenic. in our patient, the presentation of a second episode of stroke - like symptoms within 2 months prompted a more thorough workup given the evidence of an embolic source seen on magnetic resonance imaging. as a tte was performed as part of the workup during his initial presentation, our patient was sent straight for the tee for a better look at the valves and cardiac chambers. it was only with this a more thorough look that the pfe was found, prompting immediate surgical removal. as with pfes, ischemic cerebral infarction is one of the most common as well as serious presentations of cardiac myxoma.14 however, there are no clear guidelines for immediate medical management following stroke due to atrial myxoma. the treatment of acute ischemic strokes caused by embolic atrial myxoma is controversial, largely because the embolus could be composed of the tumor itself or thrombus, adhered thrombotic material, or a combination of both.15 it is reasonable to argue that the best possible course of action is thrombolytic therapy, depending on the composition of the emboli. studies have reported that patients with sudden cerebral infarction associated with myxoma in whom thrombolytic therapy was highly effective and pathologic findings suggest thrombotic embolism are increasing.16 however, it remains difficult to draw a firm conclusion from the paucity of existing data, which consists of single - case reports employing a variety of methods. therefore, once the diagnosis of a pfe is established, prophylactic intravenous anticoagulation should be initiated, to guard against thrombi until surgical resection is accomplished, as was performed with our patient in the form of therapy with heparin. the optimal surgical procedure for pedunculated tumors is valve - sparing resection of the tumor. more than 80% of aortic valve pfes can be treated only with shave excision.17 aortic valve resection or replacement is generally not needed unless there is underlying degeneration or extensive destruction of the native valve. evidence from tee | papillary fibroelastomas (pfes) are the second most common benign neoplasms of the cardiac valves and are being recognized more frequently because of higher resolution imaging technology. pfes are associated with substantial complications that are secondary to systemic embolism. surgical resection should be offered to all patients who have symptoms and to asymptomatic patients who have pedunculated lesions or tumors larger than 1 cm in diameter. herein, we present a patient who presented for a second time in 2 months with stroke symptoms. during his first admission, a transthoracic echocardiogram was performed and he was sent home after resolution of his symptoms and a grossly negative workup. during his second admission, a transesophageal echocardiogram was performed and the pfe was found and later excised. while this discussion reviews the literature with regard to detection and management, it will hopefully serve as a reminder to keep this on the differential when the workup has remained without an obvious source. |
adult dogs of either sex, with a mean weight of 21.9 0.2 kg at time of study, were housed and fed as described previously (5) and then studied after a 24 h fast. the surgical facility met the standards published by the american association for the accreditation of laboratory animal care, and the protocols met the approval of the vanderbilt university medical center animal care committee. two weeks before experimentation, all dogs underwent a laparotomy to implant sampling catheters into the femoral artery, the portal vein, and the hepatic vein, to place infusion catheters in the splenic and jujenal veins, and to place ultrasonic flow probes (transonic systems, ithaca, ny) around the hepatic artery and the portal vein, as described previously (5). all dogs were healthy, as indicated by 1) leukocyte count 35%, and 3) good appetite and normal stools. each study consisted of an equilibration (150 to 30 min), a basal (30 to 0 min), and an experimental period (0.5, 1, 2, or 4 h). at 150 min, salinized h2o (3 ml / kg ; sigma) was administered intravenously in a subset of animals in each group (n = 3 control and n = 5 experimental) to achieve 0.55% enrichment of body water. all animals were carefully monitored during the experiments, and no adverse effects of h2o administration were detected. at 120 min, a priming dose of [3-h]glucose (35 ci) was given, followed by a constant infusion of [3-h]glucose (0.35 ci / min). at the beginning of the experimental period, somatostatin was infused peripherally (0.8 g kg min ; bachem, torrance, ca) to inhibit the endocrine pancreas, and glucagon was replaced intraportally in basal amounts (0.57 ng kg min ; lilly, indianapolis, in). in the control group (n = 7), insulin (lilly) was infused intraportally at rates matched to basal levels (240 u kg min). in the experimental group (n = 20), insulin was infused intraportally at a rate (2,000 u kg min) that produced an eightfold rise from baseline. in all studies, glucose was infused peripherally as required to maintain euglycemia. in the control group, subsets of experiments were terminated either after 2 h (n = 4) or 4 h (n = 3). in the experimental group, a subset of experiments were terminated after 0.5 h (n = 5), 1 h (n = 4), 2 h (n = 6), and 4 h (n = 5). immediately after obtaining the final blood sample, each animal was anesthetized with pentobarbital and a laparotomy was performed. the hormone and glucose infusions were continued while liver sections from three separate lobes were freeze - clamped in situ and subsequently stored at 70c. initial molecular analysis verified that there were minimal differences in cellular signals between lobes, and as a result, the molecular data reported for all animals were generated from analysis of liver lobe 2. there were no differences between markers assessed in control samples taken after 2 or 4 h of basal insulinemia ; thus, the molecular data reported for the control group reflect pooled data from all control animals. hematocrit levels, glucose, glucagon, insulin, cortisol, and nonesterified fatty acid (nefa) levels in plasma and alanine, glycine, serine, threonine, lactate, glutamine, glutamate, glycerol, and -hydroxybutyrate concentrations in blood were determined using standard procedures as previously described (5). rna extraction, cdna synthesis, real - time pcr, sds - page, and western blotting were performed using standard methods (17). fructose-2,6-bisphosphate (f2,6p2) concentration and enzyme activities of pyruvate kinase, g6pase, glycogen synthase, and glycogen phosphorylase were assessed using established methods (1822). whole - body gng and glycogenolysis were calculated using the h2o method combined with nuclear magnetic resonance (nmr) analysis as previously described (23). briefly, 10-ml plasma samples were deproteinized and lyophilized. to convert plasma glucose to monoacetone glucose, after addition of 5 ml h2o, ph was adjusted to 2 with drop - wise addition of 1.5 mol / l na2co3, and the sample was mixed for 24 h at room temperature. the ph was then further increased to 8 using na2co3, and the sample was dried. monoacetone glucose was extracted (three to four times) by addition of 3 ml hot ethyl acetate. ethyl acetate was removed via vacuum evaporation, and monoacetone glucose was further purified by passage through a solid - phase extraction tube using ethyl acetate as eluant. nmr spectra for monoacetone glucose (dissolved in 100% acetonitrile) were acquired using a 14.0 t bruker magnet equipped with a bruker av - iii console operating at 92.12 mhz for h. all spectra were acquired in 3-mm nmr tubes using a bruker 5-mm tci cryogenically cooled nmr probe. chemical shifts were referenced internally to cd3cn (1.98 ppm). for 1d h nmr, typical experimental conditions included 2k data points, 20 ppm sweep width, a recycle delay of 0.5 s, and 1225k scans, depending on sample concentration. data analysis used an automated program for integration of the h nmr spectra ensuring consistent and reproducible integration areas for all acquired spectra. we determined whole - body gng and glycogenolysis using the following calculations : gluconeogenesis = ra c5/c2 and glycogenolysis = ra gluconeogenesis. ra represents tracer - derived endogenous glucose production calculated using the two - compartment circulatory model described by mari. (24), and c5/c2 represents the ratio of deuterium enrichment at the respective carbon positions of glucose. net hepatic substrate balances were calculated with the arterio - venous (a - v) difference method using the formula : net hepatic substrate balance = loadout loadin, where loadout = [h ] hf and loadin = [a ] af + [p ] pf. [a ], [p ], and [h ] represent substrate concentrations in femoral artery, portal vein, and hepatic vein blood or plasma, respectively, and af, pf, and hf represent blood or plasma flow (as measured using ultrasonic flow probes) through the hepatic artery, the portal vein, and the hepatic vein, respectively. with this calculation, plasma glucose values were multiplied by 0.73 to convert them to blood glucose values as previously validated (25). net hepatic fractional extraction was calculated by dividing net hepatic substrate balance by hepatic substrate load. the approximate insulin and glucose levels in plasma entering the liver sinusoids were calculated using the formula [a ] % af + [p ] % pf, where [a ] and [p ] represent arterial and portal vein concentrations, respectively, and % af and % pf are the respective fractional contributions of arterial and portal blood flow to total hepatic blood flow. we estimated net hepatic gluconeogenic (nhgng) flux by subtracting glycolytic flux from gluconeogenic flux - to - g6p. gng flux - to - g6p was determined by taking the sum of net hepatic uptake rates of gluconeogenic precursors (alanine, glycine, serine, threonine, glutamine, glutamate, glycerol, lactate, and pyruvate) and dividing by 2 to account for the incorporation of two three - carbon precursors into one six - carbon glucose molecule. glycolytic flux was estimated by taking the sum of the net hepatic output rates (when present) of the gluconeogenic substrates noted above (in glucose equivalents) and hepatic glucose oxidation (assumed to be 0.2 0.1 mg kg min). we have verified that glucose oxidation remains at a low and constant rate across wide variations in physiological parameters (26,27). positive nhgng flux reflects net gng flux - to - g6p, whereas negative values represent net glycolytic flux to co2 or lactate. net hepatic glycogenolytic flux was estimated by subtracting nhgng flux from net hepatic glucose balance. positive net hepatic glycogenolytic flux reflects net glycogen breakdown, and negative values represent net glycogen synthesis. there are several assumptions required when using the a - v difference technique in assessment of gng flux - to - g6p. for example, this method assumes that substrate flux is unidirectional at any given point in time. there is negligible production of gluconeogenic amino acids or glycerol by the liver, so for these substrates, the compromise is of little consequence. predominantly gluconeogenic periportal and glycolytic perivenous hepatocytes could simultaneously take up and release lactate, respectively, which could lead to an underestimation of gng flux - to - g6p. it must be noted that simultaneous lactate uptake and release would not, however, affect our estimation of nhgng flux or net hepatic glycogenolytic flux. nhgng flux and net hepatic glycogenolytic flux estimations are subject to error to the degree that intrahepatic gng amino acids contribute to the formation of g6p. the method also assumes 100% conversion of the gng amino acids taken up by the liver into g6p (they are not oxidized or used in the synthesis of proteins). errors arising from the assumptions are difficult to assess but appear to be minimal, as simultaneous assessment of gng flux using the a - v difference technique and other independent methods (that are not subject to the same assumptions) yielded similar estimates of gng flux (5,28). statistical comparisons were carried out using two - way repeated - measure anova (group time) (sigmastat). one - way anova comparison tests were used post hoc when significant f ratios were obtained. adult dogs of either sex, with a mean weight of 21.9 0.2 kg at time of study, were housed and fed as described previously (5) and then studied after a 24 h fast. the surgical facility met the standards published by the american association for the accreditation of laboratory animal care, and the protocols met the approval of the vanderbilt university medical center animal care committee. two weeks before experimentation, all dogs underwent a laparotomy to implant sampling catheters into the femoral artery, the portal vein, and the hepatic vein, to place infusion catheters in the splenic and jujenal veins, and to place ultrasonic flow probes (transonic systems, ithaca, ny) around the hepatic artery and the portal vein, as described previously (5). all dogs were healthy, as indicated by 1) leukocyte count 35%, and 3) good appetite and normal stools. each study consisted of an equilibration (150 to 30 min), a basal (30 to 0 min), and an experimental period (0.5, 1, 2, or 4 h). at 150 min, salinized h2o (3 ml / kg ; sigma) was administered intravenously in a subset of animals in each group (n = 3 control and n = 5 experimental) to achieve 0.55% enrichment of body water. all animals were carefully monitored during the experiments, and no adverse effects of h2o administration were detected. at 120 min, a priming dose of [3-h]glucose (35 ci) was given, followed by a constant infusion of [3-h]glucose (0.35 ci / min). at the beginning of the experimental period, somatostatin was infused peripherally (0.8 g kg min ; bachem, torrance, ca) to inhibit the endocrine pancreas, and glucagon was replaced intraportally in basal amounts (0.57 ng kg min ; lilly, indianapolis, in). in the control group (n = 7), insulin (lilly) was infused intraportally at rates matched to basal levels (240 u kg min). in the experimental group (n = 20), insulin was infused intraportally at a rate (2,000 u kg min) that produced an eightfold rise from baseline. in all studies, glucose was infused peripherally as required to maintain euglycemia. in the control group, subsets of experiments were terminated either after 2 h (n = 4) or 4 h (n = 3). in the experimental group, a subset of experiments were terminated after 0.5 h (n = 5), 1 h (n = 4), 2 h (n = 6), and 4 h (n = 5). immediately after obtaining the final blood sample, each animal was anesthetized with pentobarbital and a laparotomy was performed. the hormone and glucose infusions were continued while liver sections from three separate lobes were freeze - clamped in situ and subsequently stored at 70c. initial molecular analysis verified that there were minimal differences in cellular signals between lobes, and as a result, the molecular data reported for all animals were generated from analysis of liver lobe 2. there were no differences between markers assessed in control samples taken after 2 or 4 h of basal insulinemia ; thus, the molecular data reported for the control group reflect pooled data from all control animals. hematocrit levels, glucose, glucagon, insulin, cortisol, and nonesterified fatty acid (nefa) levels in plasma and alanine, glycine, serine, threonine, lactate, glutamine, glutamate, glycerol, and -hydroxybutyrate concentrations in blood were determined using standard procedures as previously described (5). rna extraction, cdna synthesis, real - time pcr, sds - page, and western blotting were performed using standard methods (17). fructose-2,6-bisphosphate (f2,6p2) concentration and enzyme activities of pyruvate kinase, g6pase, glycogen synthase, and glycogen phosphorylase were assessed using established methods (1822). whole - body gng and glycogenolysis were calculated using the h2o method combined with nuclear magnetic resonance (nmr) analysis as previously described (23). briefly, 10-ml plasma samples were deproteinized and lyophilized. to convert plasma glucose to monoacetone glucose, after addition of 5 ml h2o, ph was adjusted to 2 with drop - wise addition of 1.5 mol / l na2co3, and the sample was mixed for 24 h at room temperature. the ph was then further increased to 8 using na2co3, and the sample was dried. monoacetone glucose was extracted (three to four times) by addition of 3 ml hot ethyl acetate. ethyl acetate was removed via vacuum evaporation, and monoacetone glucose was further purified by passage through a solid - phase extraction tube using ethyl acetate as eluant. nmr spectra for monoacetone glucose (dissolved in 100% acetonitrile) were acquired using a 14.0 t bruker magnet equipped with a bruker av - iii console operating at 92.12 mhz for h. all spectra were acquired in 3-mm nmr tubes using a bruker 5-mm tci cryogenically cooled nmr probe. chemical shifts were referenced internally to cd3cn (1.98 ppm). for 1d h nmr, typical experimental conditions included 2k data points, 20 ppm sweep width, a recycle delay of 0.5 s, and 1225k scans, depending on sample concentration. data analysis used an automated program for integration of the h nmr spectra ensuring consistent and reproducible integration areas for all acquired spectra. we determined whole - body gng and glycogenolysis using the following calculations : gluconeogenesis = ra c5/c2 and glycogenolysis = ra gluconeogenesis. ra represents tracer - derived endogenous glucose production calculated using the two - compartment circulatory model described by mari. (24), and c5/c2 represents the ratio of deuterium enrichment at the respective carbon positions of glucose. net hepatic substrate balances were calculated with the arterio - venous (a - v) difference method using the formula : net hepatic substrate balance = loadout loadin, where loadout = [h ] hf and loadin = [a ] af + [p ] pf. [a ], [p ], and [h ] represent substrate concentrations in femoral artery, portal vein, and hepatic vein blood or plasma, respectively, and af, pf, and hf represent blood or plasma flow (as measured using ultrasonic flow probes) through the hepatic artery, the portal vein, and the hepatic vein, respectively. with this calculation, plasma glucose values were multiplied by 0.73 to convert them to blood glucose values as previously validated (25). net hepatic fractional extraction was calculated by dividing net hepatic substrate balance by hepatic substrate load. the approximate insulin and glucose levels in plasma entering the liver sinusoids were calculated using the formula [a ] % af + [p ] % pf, where [a ] and [p ] represent arterial and portal vein concentrations, respectively, and % af and % pf are the respective fractional contributions of arterial and portal blood flow to total hepatic blood flow. we estimated net hepatic gluconeogenic (nhgng) flux by subtracting glycolytic flux from gluconeogenic flux - to - g6p. gng flux - to - g6p was determined by taking the sum of net hepatic uptake rates of gluconeogenic precursors (alanine, glycine, serine, threonine, glutamine, glutamate, glycerol, lactate, and pyruvate) and dividing by 2 to account for the incorporation of two three - carbon precursors into one six - carbon glucose molecule. glycolytic flux was estimated by taking the sum of the net hepatic output rates (when present) of the gluconeogenic substrates noted above (in glucose equivalents) and hepatic glucose oxidation (assumed to be 0.2 0.1 mg kg min). we have verified that glucose oxidation remains at a low and constant rate across wide variations in physiological parameters (26,27). positive nhgng flux reflects net gng flux - to - g6p, whereas negative values represent net glycolytic flux to co2 or lactate. net hepatic glycogenolytic flux was estimated by subtracting nhgng flux from net hepatic glucose balance. positive net hepatic glycogenolytic flux reflects net glycogen breakdown, and negative values represent net glycogen synthesis. there are several assumptions required when using the a - v difference technique in assessment of gng flux - to - g6p. for example, this method assumes that substrate flux is unidirectional at any given point in time. there is negligible production of gluconeogenic amino acids or glycerol by the liver, so for these substrates, the compromise is of little consequence. predominantly gluconeogenic periportal and glycolytic perivenous hepatocytes could simultaneously take up and release lactate, respectively, which could lead to an underestimation of gng flux - to - g6p. it must be noted that simultaneous lactate uptake and release would not, however, affect our estimation of nhgng flux or net hepatic glycogenolytic flux. nhgng flux and net hepatic glycogenolytic flux estimations are subject to error to the degree that intrahepatic gng amino acids contribute to the formation of g6p. the method also assumes 100% conversion of the gng amino acids taken up by the liver into g6p (they are not oxidized or used in the synthesis of proteins). errors arising from the assumptions are difficult to assess but appear to be minimal, as simultaneous assessment of gng flux using the a - v difference technique and other independent methods (that are not subject to the same assumptions) yielded similar estimates of gng flux (5,28). statistical comparisons were carried out using two - way repeated - measure anova (group time) (sigmastat). one - way anova comparison tests were used post hoc when significant f ratios were obtained. in the control group, insulin was replaced at basal levels, whereas both arterial and hepatic sinusoidal insulin levels increased eightfold in the experimental group (fig. arterial and hepatic sinusoidal glucagon levels were clamped at basal values in all animals (fig. arterial plasma insulin (a), hepatic sinusoidal plasma insulin (b), arterial plasma glucagon (c), and hepatic sinusoidal plasma glucagon concentrations (d) in 24 h fasted conscious dogs during the basal (30 to 0 min) and experimental (0240 min) periods. data are means sem ; n = 7 in control (ctr) and n = 20 in 8 insulin (8x ins) groups. p 80% at 2 h, before any significant increases in stat3 phosphorylation. stat3 inhibits gng mrna expression (29), and in mice, it has been suggested that stat3 is the hepatic effector for insulin - brain - liver signaling required for suppression of gng in vivo (13). regardless of the validity of this concept, which is doubted by some (30), we show here that the repression of gng mrna expression is associated with foxo1 phosphorylation and occurs before stat3-mediated regulation. while we verified that the rodent - derived model of insulin - mediated suppression of gng gene expression is intact and applicable to large animals, these molecular events did not affect the acute regulation of nhgng flux. hyperinsulinemia reduced nhgng flux (resulting in net glycolysis) at 30 min, and this preceded functional changes in gluconeogenic enzymes (pepck, g6pase) or the activation of pyruvate kinase, which is considered to be a key regulatory enzyme of glycolysis (31). on the other hand, it correlated with an increase in hepatic f2,6p2 and a decrease in lipolysis and hepatic fat oxidation. this suggests that hepatic f2,6p2 and hepatic fat oxidation have greater regulatory strength over the insulin - mediated enhancement of glycolysis in vivo than does pyruvate kinase. insulin stimulates the dephosphorylation of 6-phosphofructokinase-2 (pfk-2)/fructose-2,6-bisphosphatase (fbpase-2), increasing pfk-2 activity and inhibiting fbpase-2 activity, the net of which increases the level of f2,6p2, a metabolite that promotes glycolysis and inhibits gng in vitro (31). oxidation of fat by the liver generates intrahepatic metabolites that inhibit glycolysis and promote gng. insulin - mediated suppression of lipolysis therefore results in the removal of these cues (32). indeed, after 30 min, glycolysis was enhanced and glycogenolytically derived carbon entered glycolysis and exited the liver in the form of lactate rather than glucose. as a consequence, the liver switched from a state of net lactate consumption (using lactate as a gng precursor) to an organ of net lactate production. we previously observed that selective peripheral hyperinsulinemia (with no change in insulin at the liver or, presumably, f2,6p2) suppressed hgp due to a reduction in nhgng flux, and the time course of this suppression correlated with decreased lipolysis and increased net hepatic lactate output (33). when arterial nefa levels were clamped at basal levels with intralipid infusion, peripheral hyperinsulinemia could not modify hepatic glycolysis, net hepatic lactate balance, or nhgng flux (33). in another study, selective hepatic hyperinsulinemia (and, presumably, increased f2,6p2, with no change in arterial insulin) suppressed hgp entirely by inhibiting glycogenolysis, without altering nhgng flux (34). taken together, these studies (33,34) suggest that acute regulation of nhgng flux by insulin is caused by the suppression of lipolysis and may be independent of changes in f2,6p2. it must be noted that f2,6p2 was not assessed in these earlier studies (33,34), whereas it was in the present study, so we can not be certain which (increased f2,6p2 or decreased lipolysis) was the dominant factor mediating the transient decrease in nhgng flux. by 240 min, nhgng flux had returned to its baseline value despite an 50% reduction in pepck protein and persisting conditions that favored glycolysis (increased f2,6p2, increased pyruvate kinase activity, and decreased hepatic fat oxidation). theoretically, the transient decrease in nhgng could have reflected enhanced glycolytic flux, decreased gng flux - to - g6p, or both. our observation that gng flux - to - g6p was basal at 240 min suggests that the transient change in nhgng flux was due to an alteration in glycolysis (supplementary fig. gng flux - to - g6p remains active and important to glycogen deposition in the postprandial state in a variety of species, suggesting that the pathway is insensitive to hyperinsulinemia (and insulin - mediated increased f2,6p2) in vivo (3539). conversely, hyperinsulinemia (and the resulting increased f2,6p2) has been shown to enhance glycolysis in vivo, and this has been suggested to be a mechanism by which insulin reduces hgp (4042). the rebound in nhgng flux likely resulted from the cessation of glycogen breakdown and the reduction in substrate for the glycolytic pathway. this, in turn, caused the restoration of net hepatic lactate uptake and the deposition of gluconeogenically derived carbon in glycogen. thus, the complete suppression of hgp observed after several hours of hyperinsulinemia appears to have been a function of the switch from net glycogenolysis to net glycogen synthesis, with nhgng flux being unchanged. the notion that insulin can inhibit gng flux - to - g6p is based largely on experiments carried out using isolated hepatocytes and perfused livers from rats (31). however, these studies typically examined the process in the absence of many factors (hepatic glycogen, neural input, and physiological concentrations of other hormones and circulating fatty acids) that play important roles in the regulation of hgp in vivo (16). for example, in mice, the deletion of crtc2 resulted in reduced pepck and g6pase gene expression in vitro and in vivo ; however, while this impaired glucagon - stimulated hgp in vitro, it did not alter glucose metabolism in vivo (43). additionally, insulin - induced inhibition of glucose output from liver tissue in vitro could reflect changes in glycogen synthesis and glycolysis, as well as alteration in gng flux - to - g6p. thus, in vitro studies of gng are limited in their ability to characterize the physiologic regulation of the pathway in vivo. based on recent rodent studies, it was concluded that hyperinsulinemia in the brain inhibited hgp by reducing gng associated with inhibition of gng gene expression (1315) and stat3 phosphorylation (13). it is possible that the sensitivity and mechanism of insulin - mediated inhibition of hgp may be species - dependent. rodents have 510 the basal hgp rates of large animals, and they exhaust liver glycogen stores after a fairly short fast, whereas canines (and humans) have the capacity to maintain a significant amount of liver glycogen after several days of fasting (44,45). it is also possible that the drive to maintain gng flux - to - g6p during hyperinsulinemia differs between species. however, certain rodent studies have shown that gng flux - to - g6p persists (with carbon redirected to glycogen) during feeding (37,38), which contradicts the notion that hyperinsulinemia can inhibit the pathway. the sensitivity of gng flux - to - g6p to insulin may also vary according to dose and fasting length ; we recently reported that 16-fold hyperinsulinemia could suppress gng flux - to - g6p in prolonged fasted (60 h) dogs in a manner that could not be explained by functional changes in pepck (17). thus, there is uncertainty regarding the physiological and experimental circumstances under which insulin - mediated suppression of gng flux - to - g6p can be detected. several early studies in rats showed that selective pharmacological inhibition (with 3-mercaptopicolinate) of pepck reduced gng from gluconeogenesis precursors in vitro and lowered blood glucose and the gng fraction of glycogen formation in vivo (38,4648). these studies led to the notion that pepck is a dominant point of control in regulating gng. however, these rat data may not be entirely transferable to humans due to the aforementioned differences between species. furthermore, the complete inhibition of pepck activity achieved with 3-mercaptopicolinate is different from physiological inhibition of pepck protein by insulin, which, even after 4 h in our study, only reduced the protein by 50%. this distinction is supported by a recent study using perfused livers from transgenic mice with large variations in hepatic pepck enzyme (49). (49) demonstrated that a 50% reduction in pepck protein content was not associated with a significant decrease in flux through pepck, whereas the complete absence of pepck protein did inhibit the pathway. thus, our data support the notion that, under physiological circumstances in vivo, pepck has low control strength over the process (49). it is possible that gng enzyme activity may exert a higher degree of control on gng in a chronic insulin - resistant state, since rodent models of diabetes typically display elevated hgp associated with increased pepck and g6pase mrna (5052). however, samuel. (53) recently showed that hgp and gng were increased in two rodent models of diabetes despite normal levels of hepatic gng enzyme mrna. furthermore, this group verified that pepck and g6pase mrna levels were not increased in human liver biopsies obtained from individuals with type 2 diabetes. while pepck may have high control strength on other aspects of hepatic metabolism such as tca cycle flux (49), the notion that pepck is rate - determining in the gng process appears to be inaccurate. in summary, physiological hyperinsulinemia rapidly suppressed hgp in the conscious dog, and after 4 h, this inhibition was solely due to profound effects on glycogen metabolism with no alteration in nhgng or gng flux - to - g6p. canonical insulin - mediated signaling mechanisms were rapidly activated, and the switch from glycogenolysis to glycogen synthesis was associated with the activation of glycogen synthase and inhibition of glycogen phosphorylase. hyperinsulinemia led to the phosphorylation of foxo1 and suppression of pepck and g6pase mrna levels, before alterations in other regulatory loci (crtc2/pgc1/stat3). by 30 min, insulin increased hepatic f2,6p2 and decreased hepatic fatty acid oxidation ; these factors stimulated glycolysis, resulting in net lactate production and a transient reduction in nhgng flux. nhgng flux returned to baseline (despite substantially reduced pepck protein) by the end of the study as carbon was redirected to glycogen synthesis. we conclude that acute hyperinsulinemia regulates hgp through transient alterations in glycolysis and persisting effects on glycogen metabolism. physiologic hyperinsulinemia has little or no effect on gluconeogenic formation of g6p despite reduced levels of pepck protein, indicating that pepck has little control over the gluconeogenic pathway. | objectiveinsulin - mediated suppression of hepatic glucose production (hgp) is associated with sensitive intracellular signaling and molecular inhibition of gluconeogenic (gng) enzyme mrna expression. we determined, for the first time, the time course and relevance (to metabolic flux) of these molecular events during physiological hyperinsulinemia in vivo in a large animal model.research design and methods24 h fasted dogs were infused with somatostatin, while insulin (basal or 8 basal) and glucagon (basal) were replaced intraportally. euglycemia was maintained and glucose metabolism was assessed using tracer, 2h2o, and arterio - venous difference techniques. studies were terminated at different time points to evaluate insulin signaling and enzyme regulation in the liver.resultshyperinsulinemia reduced hgp due to a rapid transition from net glycogen breakdown to synthesis, which was associated with an increase in glycogen synthase and a decrease in glycogen phosphorylase activity. thirty minutes of hyperinsulinemia resulted in an increase in phospho - foxo1, a decrease in gng enzyme mrna expression, an increase in f2,6p2, a decrease in fat oxidation, and a transient decrease in net gng flux. net gng flux was restored to basal by 4 h, despite a substantial reduction in pepck protein, as gluconeogenically - derived carbon was redirected from lactate efflux to glycogen deposition.conclusionsin response to acute physiologic hyperinsulinemia, 1) hgp is suppressed primarily through modulation of glycogen metabolism ; 2) a transient reduction in net gng flux occurs and is explained by increased glycolysis resulting from increased f2,6p2 and decreased fat oxidation ; and 3) net gng flux is not ultimately inhibited by the rise in insulin, despite eventual reduction in pepck protein, supporting the concept that pepck has poor control strength over the gluconeogenic pathway in vivo. |
the dr. leo kannerhuis has developed a vision on disease management for people with autism spectrum disorders (asd), the life coaching model. in this light we wanted to develop a digital coach which would enhance empowerment, lead to a possible improvement of the quality of life and a reduction of care consumption. the main research question was : what is the effect of using digital coaching, the ipod coach, on the travelling routine of an adolescent with autism spectrum disorder (asd). does it lead to an improvement of their travelling behaviour ? does it improve the quality of life as experienced by the adolescent and/or the parents ? is it cost - effective ? are the adolescents satisfied with the digital coach ? determining the baseline in skills and a short user training were part of the trial. the trial ends in june but the first data analysis shows an increase in self - esteem and a good match between application and target group. publicity has generated a huge interest in the ipod coach for many daily operations both for people with asd, but also for people with other disorders. further development for other life aspects such as school and work as well as added functionalities are necessary and requested by the users. is it possible to have the ipod coach function as a life coach on all aspects of life ? | contextthe dr. leo kannerhuis has developed a vision on disease management for people with autism spectrum disorders (asd), the life coaching model. in this light we wanted to develop a digital coach which would enhance empowerment, lead to a possible improvement of the quality of life and a reduction of care consumption.purposethe main research question was : what is the effect of using digital coaching, the ipod coach, on the travelling routine of an adolescent with autism spectrum disorder (asd).sub questions were: does it lead to an improvement of their travelling behaviour? does it improve the quality of life as experienced by the adolescent and/or the parents? is it cost - effective? are the adolescents satisfied with the digital coach?case description and data sourcesthe project started with the development of the software and content. the content contains support for problem solving and planning support. it was developed in cooperation with adolescents and the professionals working with them. the research trial was a combination of n=1 study and a small group analysis. determining the baseline in skills and a short user training were part of the trial. data were collected from an experimental group and a small control group.preliminary conclusionsthe trial ends in june but the first data analysis shows an increase in self - esteem and a good match between application and target group. publicity has generated a huge interest in the ipod coach for many daily operations both for people with asd, but also for people with other disorders.discussionfurther development for other life aspects such as school and work as well as added functionalities are necessary and requested by the users. is it possible to have the ipod coach function as a life coach on all aspects of life ? |
cardiovascular diseases (cvd) and osteoarthritis (oa) often co - occur and individually impact adversely on disease - specific symptoms and poor health. yet, their common co - occurrence suggests that there might be shared causal links [46 ], as well as shared consequences in relation to overall health. individual studies, for example of cvd or oa, tend to focus on specific outcomes, which often use a main symptom characteristic as a rationale for distinguishing from broader limitations of disease and health. in ischaemic heart disease, the symptom focus is localised to chest pain as a presenting feature of angina, whilst in heart failure, the symptom focus is on shortness of breath limitations. yet, pain is also a focus for osteoarthritis, but localised to the joint, and shortness of breath is a feature of activity limitation in the older population often associated with the comorbid presence of osteoarthritis. evidence for shared symptoms has shown that generalised pain may influence cardiovascular chest - specific pain and obesity is a shared factor for limitations of cardiovascular or osteoarthritis - related activity. other studies link interventions for understanding shared consequences, such as the use of anti - inflammatory drugs in osteoarthritis in the management of patients with cvd. such in - direct evidence on comorbid links raises the specific hypothesis, as to whether and how comorbidity influences disease specific outcomes, but here the evidence is limited. the stage of a disease provides a mechanism for identifying disease severity and possible outcomes. in hf, for example, the stage of disease as recognized by increasing symptoms, has been associated with poor quality of life, increased hospital admissions and mortality, and in oa, the severity of disease has been associated with increased mortality risk. cvd represents a biological spectrum of linked conditions, from hypertension to end - stage hf and the individual diseases that develop as cvd progresses can provide a notion of disease spectrum severity which our previous work has shown associated with physical limitations. what is less well known is how individual diseases within the cvd spectrum are influenced by the comorbid addition of another chronic disease such as oa. in cvd biological interaction between two diseases which is measured by comparing their combined effects on a specific outcome with the sum of their independent effects is an approach which has the potential for understanding about how one disease impacts on another. in this study we focus on biological interaction, using an a priori epidemiological design, on disease - specific outcomes which are an important consideration for clinical management and treatment decisions. in uk family practice, through 95% population registration, surveys act as a population - level measure of symptoms and linked computer clinical records act as an epidemiological measure of the development of chronic disease. we designed a cohort study, to test two specific hypotheses : (i) increasing cvd severity and comorbid oa is associated with increasing chest pain and shortness of breath physical limitations and (ii) cvd and oa comorbidity increase symptom specific physical limitations additively when compared to index groups. patients aged 40 years and over were recruited from 10 family practices in england, which routinely record morbidity in computer consultations using standard diagnostic and drug classifications. as a result of national pay - for - performance policies, high quality computer disease registers particularly cardiovascular diseases have become an established part of routine clinical practice. the comorbidity cohort (2c) study was designed to investigate the interaction between cvd and oa, using clinical - survey linkage methods. this study had a denominator population registered with ten family practices, which links recorded clinical data for specified cvd cohorts over a 5 year period to investigate healthcare outcomes and a sub - cohort who took part in a survey to provide linkage with patient reported health outcomes. in this study, the 2c survey population was used to investigate the association between cvd and oa comorbidity in relation to cvd - specific symptoms, which were measured using a postal questionnaire to obtain information on general health, pain and specific measures of cvd. ethical approval for the 2c study the study groups were sampled from family practice computerised clinical records covering a three year time - period (november 2006january 2010). in uk family practice, read codes as a standard classification are used to classify the morbidity of patients when they present in consultation or when clinical data is coded, and cvd registers based on these read codes were identified in the three years before the baseline survey. in the same 3-year time period before the baseline survey, patients with oa diagnosis in their clinical records were also identified. using the presence or absence of cvd or oa diagnosis, a total of 8 exclusive groups were constructed : (i) a random reference group of patients without cvd or oa, (ii) three index cvd groups without oa (hypertension, ihd, hf), (iii) a random index oa group without cvd, and (iv) three cvd groups with comorbid oa. severity from hypertension (least severe) (read and daughter codes beginning with g20) to ihd (read and daughter codes beginning with g3) to hf (most severe) (read and daughter codes beginning with g58 and heart failure codes related to nyha classification). therefore, if a patient had a record for more than one of the three cvd conditions they were placed into the most severe group, for example, a patient who had a record for hypertension and hf over the three year time - period would be placed in the hf group. the oa definition was based on any coded clinical data, and included either diagnostic labels for any oa - related joint problem or radiographic - related diagnosis (read and daughter codes beginning with n05 and codes related to oa joint replacement 7 k2 or 7 k3). previous research also shows that the experience of osteoarthritis, which is usually presented as a local joint problem, is in fact commonly associated with multiple pain sites. this approach to define three cvd groups for population severity and a single broader definition of oa enabled the hypothesis testing of specific comorbid groups, without over complicating the design further with sub - groups of oa. our previous work and other evidence support the use of clinical records to measure both cvd population severity and oa. the seattle angina questionnaire (saq) and the kansas city cardiomyopathy questionnaire (kccq) were used as symptom measures of chest pain (cp) and shortness of breath (sob) status respectively, and are widely used validated instruments including for use in the uk population. the saq and kccq questionnaires were used in family practice population samples, so a minor adaptation to the questionnaires was made to focus on the symptom of chest pain or shortness of breath as experienced by wider populations as opposed to the use of the clinical term such as angina or the saq has 3 sub - component scores and kccq has 5 sub - component scores and in this analysis, survey participants were included if they had completed all the components within each questionnaire. the physical limitation (pl) summary score, which is the component shared by both questionnaires was used as a comparable measure of symptom - based limitation. in addition, study data available included age, gender, deprivation, body mass index (bmi), smoking status, alcohol, and hospital anxiety and depression (had) questionnaire on psychological status. the index of multiple deprivation (imd) uses the individual patient postcode to indicate deprivation, and is a weighted score relating to income ; employment ; health ; education, skills and training ; barriers to housing, and access to local services ; crime ; and living environment. study groups were categorised by age, gender, deprivation, bmi, smoking and alcohol status. age was categorised into five groups and imd score into four quartiles, with quartile 1 (least deprived) to quartile 4 (most deprived). smoking was categorised into three groups (never, ex - smoker, smoker) and alcohol into six groups (never, special occasions, monthly, weekly (12), weekly (34), daily). the physical limitation score, generated from the saq and kccq was used as the primary outcome measure in this analysis, with a high score indicating low physical limitations and a low score indicating higher physical limitations. first, symptoms and related mean physical limitations are presented by age bands, gender, deprivation quartiles, bmi, smoking and alcohol. second, for each study group, the mean physical limitation score with 95% confidence intervals was assessed. the associations between the index and comorbid study groups and physical limitations compared with the reference group were estimated using linear regression methods, and expressed as the difference in physical limitation scores. age, bmi, imd, smoking and alcohol were included as continuous variables in the linear regression models. these analyses are presented as unadjusted values with 95% ci, then adjusted first for age, gender, deprivation, smoking and alcohol status, and finally adjusted in addition by bmi. separately we also adjusted for the psychological status as measured by the had scale as a continuous variable (see supplementary table 1). third, we estimated how the observed associations between cvd and oa comorbid study groups and pls differed from the expected estimates for the comorbid groups compared to the reference group. we calculated the observed estimates for the index and comorbid groups in linear regression, and then calculated the expected figures by adding the estimates for the index cvd and index oa groups. the difference between the observed and expected estimates for the cvd comorbid groups in this additive approach would allow the assessment of the potential interaction between cvd and oa. finally, we compared each comorbid group directly with the respective index group, to assess the significance of the oa impact on symptom - specific physical limitation, and each comparison was adjusted for age, gender, deprivation, alcohol, smoking and bmi. first, symptoms and related mean physical limitations are presented by age bands, gender, deprivation quartiles, bmi, smoking and alcohol. second, for each study group, the mean physical limitation score with 95% confidence intervals was assessed. the associations between the index and comorbid study groups and physical limitations compared with the reference group were estimated using linear regression methods, and expressed as the difference in physical limitation scores. age, bmi, imd, smoking and alcohol were included as continuous variables in the linear regression models. these analyses are presented as unadjusted values with 95% ci, then adjusted first for age, gender, deprivation, smoking and alcohol status, and finally adjusted in addition by bmi. separately we also adjusted for the psychological status as measured by the had scale as a continuous variable (see supplementary table 1). third, we estimated how the observed associations between cvd and oa comorbid study groups and pls differed from the expected estimates for the comorbid groups compared to the reference group. we calculated the observed estimates for the index and comorbid groups in linear regression, and then calculated the expected figures by adding the estimates for the index cvd and index oa groups. the difference between the observed and expected estimates for the cvd comorbid groups in this additive approach would allow the assessment of the potential interaction between cvd and oa. finally, we compared each comorbid group directly with the respective index group, to assess the significance of the oa impact on symptom - specific physical limitation, and each comparison was adjusted for age, gender, deprivation, alcohol, smoking and bmi. patients aged 40 years and over were recruited from 10 family practices in england, which routinely record morbidity in computer consultations using standard diagnostic and drug classifications. as a result of national pay - for - performance policies, high quality computer disease registers particularly cardiovascular diseases have become an established part of routine clinical practice. the comorbidity cohort (2c) study was designed to investigate the interaction between cvd and oa, using clinical - survey linkage methods. this study had a denominator population registered with ten family practices, which links recorded clinical data for specified cvd cohorts over a 5 year period to investigate healthcare outcomes and a sub - cohort who took part in a survey to provide linkage with patient reported health outcomes. in this study, the 2c survey population was used to investigate the association between cvd and oa comorbidity in relation to cvd - specific symptoms, which were measured using a postal questionnaire to obtain information on general health, pain and specific measures of cvd. ethical approval for the 2c study the study groups were sampled from family practice computerised clinical records covering a three year time - period (november 2006january 2010). in uk family practice, read codes as a standard classification are used to classify the morbidity of patients when they present in consultation or when clinical data is coded, and cvd registers based on these read codes were identified in the three years before the baseline survey. in the same 3-year time period before the baseline survey, patients with oa diagnosis in their clinical records were also identified. using the presence or absence of cvd or oa diagnosis, a total of 8 exclusive groups were constructed : (i) a random reference group of patients without cvd or oa, (ii) three index cvd groups without oa (hypertension, ihd, hf), (iii) a random index oa group without cvd, and (iv) three cvd groups with comorbid oa. severity from hypertension (least severe) (read and daughter codes beginning with g20) to ihd (read and daughter codes beginning with g3) to hf (most severe) (read and daughter codes beginning with g58 and heart failure codes related to nyha classification). therefore, if a patient had a record for more than one of the three cvd conditions they were placed into the most severe group, for example, a patient who had a record for hypertension and hf over the three year time - period would be placed in the hf group. the oa definition was based on any coded clinical data, and included either diagnostic labels for any oa - related joint problem or radiographic - related diagnosis (read and daughter codes beginning with n05 and codes related to oa joint replacement 7 k2 or 7 k3). previous research also shows that the experience of osteoarthritis, which is usually presented as a local joint problem, is in fact commonly associated with multiple pain sites. this approach to define three cvd groups for population severity and a single broader definition of oa enabled the hypothesis testing of specific comorbid groups, without over complicating the design further with sub - groups of oa. our previous work and other evidence support the use of clinical records to measure both cvd population severity and oa. the seattle angina questionnaire (saq) and the kansas city cardiomyopathy questionnaire (kccq) were used as symptom measures of chest pain (cp) and shortness of breath (sob) status respectively, and are widely used validated instruments including for use in the uk population. the saq and kccq questionnaires were used in family practice population samples, so a minor adaptation to the questionnaires was made to focus on the symptom of chest pain or shortness of breath as experienced by wider populations as opposed to the use of the clinical term such as angina or heart failure. the saq has 3 sub - component scores and kccq has 5 sub - component scores and in this analysis, survey participants were included if they had completed all the components within each questionnaire. the physical limitation (pl) summary score, which is the component shared by both questionnaires was used as a comparable measure of symptom - based limitation. in addition, study data available included age, gender, deprivation, body mass index (bmi), smoking status, alcohol, and hospital anxiety and depression (had) questionnaire on psychological status. the index of multiple deprivation (imd) uses the individual patient postcode to indicate deprivation, and is a weighted score relating to income ; employment ; health ; education, skills and training ; barriers to housing, and access to local services ; crime ; and living environment. study groups were categorised by age, gender, deprivation, bmi, smoking and alcohol status. age was categorised into five groups and imd score into four quartiles, with quartile 1 (least deprived) to quartile 4 (most deprived). smoking was categorised into three groups (never, ex - smoker, smoker) and alcohol into six groups (never, special occasions, monthly, weekly (12), weekly (34), daily). the physical limitation score, generated from the saq and kccq was used as the primary outcome measure in this analysis, with a high score indicating low physical limitations and a low score indicating higher physical limitations. first, symptoms and related mean physical limitations are presented by age bands, gender, deprivation quartiles, bmi, smoking and alcohol. second, for each study group, the mean physical limitation score with 95% confidence intervals was assessed. the associations between the index and comorbid study groups and physical limitations compared with the reference group were estimated using linear regression methods, and expressed as the difference in physical limitation scores. age, bmi, imd, smoking and alcohol were included as continuous variables in the linear regression models. these analyses are presented as unadjusted values with 95% ci, then adjusted first for age, gender, deprivation, smoking and alcohol status, and finally adjusted in addition by bmi. separately we also adjusted for the psychological status as measured by the had scale as a continuous variable (see supplementary table 1). third, we estimated how the observed associations between cvd and oa comorbid study groups and pls differed from the expected estimates for the comorbid groups compared to the reference group. we calculated the observed estimates for the index and comorbid groups in linear regression, and then calculated the expected figures by adding the estimates for the index cvd and index oa groups. the difference between the observed and expected estimates for the cvd comorbid groups in this additive approach would allow the assessment of the potential interaction between cvd and oa. finally, we compared each comorbid group directly with the respective index group, to assess the significance of the oa impact on symptom - specific physical limitation, and each comparison was adjusted for age, gender, deprivation, alcohol, smoking and bmi. first, symptoms and related mean physical limitations are presented by age bands, gender, deprivation quartiles, bmi, smoking and alcohol. second, for each study group, the mean physical limitation score with 95% confidence intervals was assessed. the associations between the index and comorbid study groups and physical limitations compared with the reference group were estimated using linear regression methods, and expressed as the difference in physical limitation scores. age, bmi, imd, smoking and alcohol were included as continuous variables in the linear regression models. these analyses are presented as unadjusted values with 95% ci, then adjusted first for age, gender, deprivation, smoking and alcohol status, and finally adjusted in addition by bmi. separately we also adjusted for the psychological status as measured by the had scale as a continuous variable (see supplementary table 1). third, we estimated how the observed associations between cvd and oa comorbid study groups and pls differed from the expected estimates for the comorbid groups compared to the reference group. we calculated the observed estimates for the index and comorbid groups in linear regression, and then calculated the expected figures by adding the estimates for the index cvd and index oa groups. the difference between the observed and expected estimates for the cvd comorbid groups in this additive approach would allow the assessment of the potential interaction between cvd and oa. finally, we compared each comorbid group directly with the respective index group, to assess the significance of the oa impact on symptom - specific physical limitation, and each comparison was adjusted for age, gender, deprivation, alcohol, smoking and bmi. of the 5426 study population, 1443 (27%) reported chest pain and 2098 (39%) shortness of breath symptom. of the population with either symptom, 395 (16%) patients had chest pain without sob, 1049 (42%) had sob without chest pain, and 1048 (42%) had both symptoms. chest pain and shortness of breath symptoms and limitations increased in prevalence with age, higher deprivation and smoking and decreased in all but the highest alcohol intake group. symptom limitation was higher in women, but chest pain symptom prevalence was lower (table 1). the highest prevalence estimates were in the obese group (32% for chest pain, 50% for sob) and smokers (30% chest pain and 44% sob). both symptoms and physical limitations were highest in the group who did not consume any alcohol (chest pain 32% and sob 48%). the highest mean chest pain physical limitation score was in the reference study group (80.5 ; sd 24.9), and the lowest score was in the hf and oa comorbid group (29.7 ; 21.8) (table 2). with the exception of the index hypertension and oa groups and the comorbid ihd group, all other groups had significant associations with symptom related physical limitations compared to the reference group and these associations increased with cvd severity. the mean differences in physical limitation scores, adjusting for age, gender, deprivation, smoking, alcohol and bmi, for the index cvd groups were : 2.7 (95% ci 3.6, 9.1) for hypertension, 8.1 (13.7, 2.5) for ihd and 17.5 (26.9, 8.1) for hf. the mean difference in physical limitation score for the index oa group was 5.6 (12.7, 1.5). the mean differences in the physical limitation score for the cvd and oa comorbid groups compared to the reference group were larger than for the index groups and showed a similar observed trend with increasing cvd severity (fig. 1). adjusting for age, gender, deprivation, smoking, alcohol and bmi, the differences in cvd comorbid estimates were : 11.6 (95% ci 20.0, 3.2) for hypertension, 7.6 (15.5, 0.3) for ihd and 25.4 (37.6, 13.1) for hf. the adjustment for bmi, diminished the strength of associations between the disease - defined groups and chest pain physical limitations compared to the reference group, but the associations remained significant in all cvd comorbid groups except for the ihd and oa group. the respective mean shortness of breath physical limitation scores were all lower than the respective chest pain pl scores. the highest mean shortness of breath physical limitation score was in the reference study group (75.4 ; sd 25.8), and the lowest score was in the hf and oa comorbid group (27.5 ; 20.8) (table 3). with the exception of the index hypertension group, all other groups had significant associations with physical limitations compared to the reference group and these associations increased with cvd severity. the mean differences in physical limitation score, adjusting for age, gender, deprivation, smoking, alcohol and bmi, for the index cvd groups were : 0.6 (95% ci 5.4, 4.3) for hypertension, 12.9 (17.4, 8.4) for ihd and 22.3 (29.1, 15.6) for hf. the mean difference in physical limitation score for the index oa group was 10.5 (15.2, 5.9). the mean differences in the shortness of breath physical limitation score for the cvd / oa comorbid groups compared to the reference group were larger than for the index groups and as with chest pain physical limitations, increased with cvd severity (fig. the mean differences for the cvd comorbid groups, adjusting for age, gender, deprivation, smoking, alcohol and bmi, were : 11.6 (95% ci 16.9, 6.4) for hypertension and oa, 16.8 (22.9, 10.7) for ihd and oa and 29.5 (39.7, 19.3) for hf and adjustment for bmi again, diminished the strength of associations between the study groups compared to the reference group. additional adjustment for psychological status did not change the estimates for either symptom (supplementary table 1). the mean differences in the shortness of breath physical limitation score for the cvd / oa comorbid groups compared to the reference group were larger than for the index groups and as with chest pain physical limitations, increased with cvd severity (fig. 2). the mean differences for the cvd comorbid groups, adjusting for age, gender, deprivation, smoking, alcohol and bmi, were : 11.6 (95% ci 16.9, 6.4) for hypertension and oa, 16.8 (22.9, 10.7) for ihd and oa and 29.5 (39.7, 19.3) for hf and adjustment for bmi again, diminished the strength of associations between the study groups compared to the reference group. additional adjustment for psychological status did not change the estimates for either symptom (supplementary table 1). the expected estimates for the adjusted associations (age, gender, deprivation, smoking, alcohol and bmi) between cvd and oa comorbid groups and chest pain physical limitations were as follows : hypertension (2.7) and oa (5.6) = 2.9, ihd (8.1) and oa (5.6) = 13.7, and hf (17.5) and oa (5.6) = 23.1. the respective observed estimates were : 11.6, 7.6 and 25.4, which means that the associations between cvd and oa comorbidity with cp limitations were more than additive for hypertension and hf, but less than additive for ihd (fig. the expected estimates for the adjusted associations between cvd and oa comorbid groups and sob physical limitations were as follows : hypertension (0.6) and oa (10.5) = 11.1, ihd (12.9) and oa (10.5) = 23.4, and hf (22.3) and oa (10.5) = 32.8. the respective observed estimates were : 11.6, 16.8 and 29.5, which means that the associations between cvd and oa comorbidity with sob limitations were around additive for hypertension and hf, but less than additive for ihd (fig. 4). the cvd comorbid groups were compared to the respective index cvd groups, to assess the oa for all three cvd groups, there were still significant associations with chest pain physical limitations and for hypertension and ihd groups with sob physical limitations. after adjustment for age, gender, deprivation, smoking, alcohol and bmi, the difference in the chest pain physical limitation score was : 14.7 (95% ci 21.5, 7.8) for hypertension, 5.5 (10.4, 0.7) for ihd and 22.1 (31.0, 6.7) for hf. the cvd comorbid differences for shortness of breath physical limitation estimates were 9.2 (13.8, 4.6) for hypertension, 6.4 (11.1, 1.8) for ihd and 8.8 (19.3, 1.65) for hf. adjustment for bmi made little difference to the estimates of association for either the cp or sob physical limitations. of the 5426 study population, 1443 (27%) reported chest pain and 2098 (39%) shortness of breath symptom. of the population with either symptom, 395 (16%) patients had chest pain without sob, 1049 (42%) had sob without chest pain, and 1048 (42%) had both symptoms. chest pain and shortness of breath symptoms and limitations increased in prevalence with age, higher deprivation and smoking and decreased in all but the highest alcohol intake group. symptom limitation was higher in women, but chest pain symptom prevalence was lower (table 1). the highest prevalence estimates were in the obese group (32% for chest pain, 50% for sob) and smokers (30% chest pain and 44% sob). both symptoms and physical limitations were highest in the group who did not consume any alcohol (chest pain 32% and sob 48%). the highest mean chest pain physical limitation score was in the reference study group (80.5 ; sd 24.9), and the lowest score was in the hf and oa comorbid group (29.7 ; 21.8) (table 2). with the exception of the index hypertension and oa groups and the comorbid ihd group, all other groups had significant associations with symptom related physical limitations compared to the reference group and these associations increased with cvd severity. the mean differences in physical limitation scores, adjusting for age, gender, deprivation, smoking, alcohol and bmi, for the index cvd groups were : 2.7 (95% ci 3.6, 9.1) for hypertension, 8.1 (13.7, 2.5) for ihd and 17.5 (26.9, 8.1) for hf. the mean difference in physical limitation score for the index oa group was 5.6 (12.7, 1.5). the mean differences in the physical limitation score for the cvd and oa comorbid groups compared to the reference group were larger than for the index groups and showed a similar observed trend with increasing cvd severity (fig. 1). adjusting for age, gender, deprivation, smoking, alcohol and bmi, the differences in cvd comorbid estimates were : 11.6 (95% ci 20.0, 3.2) for hypertension, 7.6 (15.5, 0.3) for ihd and 25.4 (37.6, 13.1) for hf. the adjustment for bmi, diminished the strength of associations between the disease - defined groups and chest pain physical limitations compared to the reference group, but the associations remained significant in all cvd comorbid groups except for the ihd and oa group. the respective mean shortness of breath physical limitation scores were all lower than the respective chest pain pl scores. the highest mean shortness of breath physical limitation score was in the reference study group (75.4 ; sd 25.8), and the lowest score was in the hf and oa comorbid group (27.5 ; 20.8) (table 3). with the exception of the index hypertension group, all other groups had significant associations with physical limitations compared to the reference group and these associations increased with cvd severity. the mean differences in physical limitation score, adjusting for age, gender, deprivation, smoking, alcohol and bmi, for the index cvd groups were : 0.6 (95% ci 5.4, 4.3) for hypertension, 12.9 (17.4, 8.4) for ihd and 22.3 (29.1, 15.6) for hf. the mean difference in physical limitation score for the index oa group was 10.5 (15.2, 5.9). the mean differences in the shortness of breath physical limitation score for the cvd / oa comorbid groups compared to the reference group were larger than for the index groups and as with chest pain physical limitations, increased with cvd severity (fig. 2). the mean differences for the cvd comorbid groups, adjusting for age, gender, deprivation, smoking, alcohol and bmi, were : 11.6 (95% ci 16.9, 6.4) for hypertension and oa, 16.8 (22.9, 10.7) for ihd and oa and 29.5 (39.7, 19.3) for hf and oa. adjustment for bmi again, diminished the strength of associations between the study groups compared to the reference group. additional adjustment for psychological status did not change the estimates for either symptom (supplementary table 1). the mean differences in the shortness of breath physical limitation score for the cvd / oa comorbid groups compared to the reference group were larger than for the index groups and as with chest pain physical limitations, increased with cvd severity (fig. 2). the mean differences for the cvd comorbid groups, adjusting for age, gender, deprivation, smoking, alcohol and bmi, were : 11.6 (95% ci 16.9, 6.4) for hypertension and oa, 16.8 (22.9, 10.7) for ihd and oa and 29.5 (39.7, 19.3) for hf and oa. adjustment for bmi again, diminished the strength of associations between the study groups compared to the reference group. additional adjustment for psychological status did not change the estimates for either symptom (supplementary table 1). the expected estimates for the adjusted associations (age, gender, deprivation, smoking, alcohol and bmi) between cvd and oa comorbid groups and chest pain physical limitations were as follows : hypertension (2.7) and oa (5.6) = 2.9, ihd (8.1) and oa (5.6) = 13.7, and hf (17.5) and oa (5.6) = 23.1. the respective observed estimates were : 11.6, 7.6 and 25.4, which means that the associations between cvd and oa comorbidity with cp limitations were more than additive for hypertension and hf, but less than additive for ihd (fig. the expected estimates for the adjusted associations between cvd and oa comorbid groups and sob physical limitations were as follows : hypertension (0.6) and oa (10.5) = 11.1, ihd (12.9) and oa (10.5) = 23.4, and hf (22.3) and oa (10.5) = 32.8. the respective observed estimates were : 11.6, 16.8 and 29.5, which means that the associations between cvd and oa comorbidity with sob limitations were around additive for hypertension and hf, but less than additive for ihd (fig. 4). the cvd comorbid groups were compared to the respective index cvd groups, to assess the oa for all three cvd groups, there were still significant associations with chest pain physical limitations and for hypertension and ihd groups with sob physical limitations. after adjustment for age, gender, deprivation, smoking, alcohol and bmi, the difference in the chest pain physical limitation score was : 14.7 (95% ci 21.5, 7.8) for hypertension, 5.5 (10.4, 0.7) for ihd and 22.1 (31.0, 6.7) for hf. the cvd comorbid differences for shortness of breath physical limitation estimates were 9.2 (13.8, 4.6) for hypertension, 6.4 (11.1, 1.8) for ihd and 8.8 (19.3, 1.65) for hf. adjustment for bmi made little difference to the estimates of association for either the cp or sob physical limitations. first, increasing cvd severity was associated with increased chest pain and sob physical limitations in the index and comorbid groups. second, oa comorbidity added to the symptom - specific physical limitations, irrespective of cvd severity. additionally, we found that oa significantly influenced symptom specific physical limitations in all cvd severity groups. these associations were not explained by age, gender, deprivation, smoking, alcohol and bmi. there was a dose effect was the sum of individual parts, but there were differences between the two symptom limitations. in all cvd severity groups, the mean physical limitation score in relation to sob was lower than for chest pain yet oa had a greater comorbid effect on chest pain physical limitations than sob when the comorbid group was compared directly with the index cvd group. this implies that the impact of comorbidity on physical limitation depends on the symptoms experienced by patients and requires careful consideration within disease management consultations. this study shows uniquely that an unrelated chronic disease of oa has an independent effect in different cardiovascular diseases and on cvd - specific outcomes. much of the current evidence has shown that comorbidity is associated with poor overall health and healthcare outcomes, but very few primary comorbidity studies have investigated the associations with disease - specific common symptoms and limitations. whilst comorbidity may have been considered as an alternative explanation and adjustment in disease - specific outcomes, this approach is crucial if one is to understand how new interventions for improving health outcomes might be developed and whether they are targeted at the index disease or the comorbidity. the clearest analogy here, where there is a substantial evidence base, is the identification and treatment of co - morbid depression in chronic diseases, to improve disease - specific outcomes. the other key findings were that despite cvd severity, oa comorbidity was independently associated with symptom - specific physical limitations. previous research has shown that hypertension and ihd are associated with relatively better health than hf. so an expectation would have been that there was more scope for comorbidity to influence limitations in these cvd groups, than in the most severe hf group. yet, the results show otherwise and there does not appear to be floor effects that are observed in severe hf. also it has been postulated that people with severe disease may become accustomed to poor health and reconfigure their personal conceptualisations of ill - health and its impact. response shift can mean that the perception of symptom limitations might reduce in the presence of more severe disease and comorbidity but we found that in hf the association with specific - limitations was greater with comorbid oa and not less than what might have been expected. there was also the strong effect of bmi on the cvd associations with symptom - specific physical limitations. high bmi is associated with both cvd and oa and separately for lower functional ability. bmi may provide one explanation for the mechanism between the association between cvd severity, comorbid oa and symptom - specific limitations. the study design allowed the a priori assessment of the biological interaction between two common and important chronic diseases. this allowed us to characterise the combined effects and magnitude of two chronic diseases on outcomes. using this design approach we were able to identify that the observed estimates of cvd and comorbid oa compared to the expected estimates were greater for chest pain limitations than sob limitations. the increased influence of oa on chest pain physical limitations for the different cvd groups was further supported by the comparison of the comorbid groups with their respective index cvd groups. the physical limitation score differences when oa was present were greater for chest pain than for shortness of breath. previous studies have identified variations in the statistical level, but not magnitude, of interaction of combined diseases on overall physical health [2022 ]. the study findings show the magnitude of combined effects, by cvd severity and comorbidity as applied to two specific symptoms. the clinical implications are that in cvd management the severity or stage of disease is important in self - reporting of specific symptoms, which are common in the population, but that effective cvd - specific symptom management requires inclusion of comorbidity such as oa. the study design incorporated exclusive cvd groups constructed on the basis of a priori hypothesis, in a large population - based setting. as such the definitions for the cvd groups were based on prevalent cases, but the hypothesis can still test whether the comorbid addition to an index condition is associated with greater symptom limitations. the design with the reference and index groups provides the basis for assessing the comorbid chronic disease interaction, and for the matching potentially of other comorbidity in the study groups. the symptom and physical limitations were measured using validated instruments, and the design provides the method for applying the same instruments to non - index conditions. whilst most disease - specific instruments identify the key symptom or diagnosis in the population of interest, both the cvd measures used in the study in terms of the physical limitations had the same question and related it to common symptoms (chest pain and sob) which occur not only in the cvd population, but also in the non - cvd population. participation selection issues for this study have been previously reported and is in line with similar large population survey studies, but the design still allows for internal hypothesis testing. in cvd severity populations, chest pain and sob are common symptoms and the comorbid addition of oa influences the specific - symptom limitations. clinically it provides evidence that pairs of common chronic disease combinations indicate worse health, the impact of comorbidity remains across different disease severities and the combined effect on health is often the sum of the independent effects even in the most severe disease. the clinical implication is whether such changes as a result of comorbidity influence clinical presentation and clinical decisions. this evidence highlights the importance of comorbidity for specific symptoms and that novel interventions for comorbidity need to be developed for both cvd specific health outcomes. the following are the supplementary data related to this article.supplementary table 1associations between study groups and symptom physical limitations. the study sponsors had no role in the study design ; in the collection, analysis, and interpretation of data ; in the writing of the report ; and in the decision to submit the paper for publication. the views and opinions expressed therein are those of the authors and do not necessarily reflect those of the nihr (uk). | objectivesnon - cardiovascular comorbidity is common in cardiovascular disease (cvd) populations but its influence on chest pain (cp) and shortness of breath (sob) symptom - specific physical limitations is unknown. we wanted to test the a priori hypothesis that an unrelated comorbidity would influence symptom - specific physical limitations and to investigate this impact in different severities of cvd.method and resultsthe study was based on 5426 patients from ten family practices, organised into eight a priori exclusive severity groups : (i) no cvd or osteoarthritis (oa) (reference), (ii) index hypertension, ischaemic heart disease (ihd) and heart failure (hf) without oa, (iii) index oa without cvd and (iv) same cvd groups with comorbid oa. the measure of cp physical limitations was seattle angina questionnaire and for sob physical limitations was the kansas city cardiomyopathy questionnaire. adjusted baseline associations between the cohorts and symptom - specific physical limitations were assessed using linear regression methods. in the study population, 1443 (27%) reported cp and 2097 (39%) sob. cp and sob physical limitations increased with cvd severity in the index and comorbid groups. compared with the respective index cvd group, the cp physical limitation scores for comorbid cvd groups with oa were lower by : 14.7 (95% ci 21.5, 7.8) for hypertension, 5.5 (10.4, 0.7) for ihd and 22.1 (31.0, 6.7) for hf. for sob physical limitations, comorbid scores were lower by : 9.2 (13.8, 4.6) for hypertension, 6.4 (11.1, 1.8) for ihd and 8.8 (19.3, 1.65) for hf.conclusionscp and sob are common symptoms, and oa increases the cvd symptom - specific physical limitations additively. comorbidity interventions need to be developed for cvd specific health outcomes. |
upper and lower airways are considered a unified morphological and functional unit, and the connection existing between them has been observed for many years, both in health and in disease.1,2 more than 2,000 years ago, claudius galenus studied the upper airway and paranasal sinuses as integral parts of the respiratory tract, and he assumed that rhinitis and asthma were caused by secretions dripping from the brain into the nose and lung.3 more recently, the concept of united airway disease (uad) was suggested.46 the nose is situated at the entrance of the airway and protects the lower airway from the harmful effects of the inspired air by acting as efficient air - conditioning. the nose warms, filters, and humidifies the inspired air so that clean air that is fully saturated with water vapor at a temperature of 37c is delivered to the lungs. during nose breathing, the majority of particles with an aerodynamic equivalent diameter (aed) > 15 m are deposited in the upper respiratory tract. particles with aeds > 2.5 m are primarily deposited in the trachea and bronchi, whereas those with lower aeds penetrate into the gas - exchange region of the lungs.7 the nasal and bronchial mucosa present similarities, and one of the most important concepts regarding nose lung interactions is the functional complementarity, which assigns the protector role of the nose to the lungs.4 however, the functions of the upper airway and their interactions with the lower airway are much broader than merely air - conditioning. the allergic rhinitis and its impact on asthma (aria) guidelines published in 20011 achieved some goals : 1) development of a guideline proposing a standardized management plan for allergic rhinitis (ar), 2) establishment of the aria concept, 3) spreading of the guideline to general and specialist physicians, and 4) establishment of a multiprofessional forum to study rhinitis and asthma. there is strong epidemiologic, pathophysiologic, and clinical evidence supporting an integrated view of rhinitis and asthma : uad in the present review. we can also consider uad an airway - hypersensitivity syndrome, because rhinitis and asthma are chronic inflammatory diseases of the upper and lower airways, which are induced and reproduced by allergic or nonallergic hypersensitivity reactions, and present several phenotypes (table 1). ar is the most common of all atopic diseases, and although it can develop at any age, most patients report the onset of symptoms before 30 years of age, making it the most common chronic disorder in children.6 ar can be considered a major public health problem, due to its prevalence and impact on patients quality of life, work / school performance, and productivity economic burden.4,6 it is characterized by the classic symptoms of nasal itching, sneezing, rhinorrhea, and nasal obstruction. in addition, ar is associated with a variety of comorbidities, such as atopic dermatitis, sleep - disordered breathing, conjunctivitis, rhinosinusitis, otitis media, asthma, and emotional problems.6,8 at the same time, ar is a disease that is underdiagnosed and overlooked by patients and physicians.9,10 ar is considered a risk factor for developing asthma.4,6 asthma is a heterogeneous disease characterized by chronic airway inflammation and hyperresponsiveness (ahr) to direct or indirect stimuli, which can persist even when symptoms are absent or lung function is normal but may normalize with treatment.11 asthma is defined by the history of episodic respiratory symptoms, such as wheeze, shortness of breath, chest tightness, and cough, and is associated with variable expiratory airflow limitation.11 allergic asthma is the most prevalent disease phenotype, which often begins in childhood and is associated with a personal and/or family history of allergic diseases, such as eczema and ar.11 in the same way of the allergic phenotype, patients with non - ar (nar) are at increased risk of developing nonallergic asthma. nar presents later in life than ar and is not a single disorder but is composed of a heterogeneous group of diseases.12 according to the international study on asthma and allergy in childhood, the prevalence of ar in europe was found to be 25% and in brazil 15%20%. the prevalence of asthma worldwide was observed to be 20% (global initiative for asthma) and 10%20% in brazil (global initiative for asthma, aria). countries with a very high prevalence of rhinitis had asthma prevalence ranging from 10% to 25%.4,11,13 the management of asthma should include assessment of asthma control, future risks, and any comorbidity that could contribute to symptom burden and poor quality of life. the main associated comorbidities are rhinitis, rhinosinusitis, gastroesophageal reflux, obesity, obstructive sleep apnea, depression, and anxiety.11 we evaluated the prevalence of comorbidities in patients with severe asthma and observed that rhinitis and gastroesophageal reflux disease were the most common, rhinitis being observed in 91% and gastroesophageal reflux disease in 71% of the asthmatic patients.14 interactions between the lower and the upper airways are well known and have been extensively studied since 1990. over 80% of asthmatics have rhinitis, and 10%40% of patients with rhinitis have asthma, suggesting the concept of one airway, one disease.4 rhinitis symptoms have been reported in 98.9% of allergic asthmatics and in 78.4% of nonallergic asthmatics. furthermore, 30% of patients with only ar who do not have asthma present hyperresponsiveness to methacholine or histamine.2,4,15 however, there are large differences in the magnitude of airway reactivity between patients with rhinitis and asthma. patients with perennial rhinitis have greater bronchial reactivity than those with seasonal rhinitis, in whom the presence of hyperresponsiveness was observed especially during the pollen season.4,15,16 ahr, which is a paramount feature of asthma, is a strong risk factor for the onset of asthma in patients presenting with ar.6 several studies suggest that ar and nar are risk factors for new onset of asthma and persistence of asthma.17,18 in a cohort of 690 individuals with a follow - up of 23 years, it was observed that the incidence of asthma was 10.5% in subjects with rhinitis and 3.6% in those without rhinitis. therefore, the development of asthma was tripled in rhinitis patients compared to those without rhinitis.19 in the tucson epidemiologic study of obstructive lung diseases, the odds ratio for developing asthma was 2.59 (95% confidence interval 1.544.34) if rhinitis was present and 6.28 (95% confidence interval 4.019.82) in the presence of rhinitis plus sinusitis.20 a european survey confirmed the presence of perennial rhinitis as a major risk factor for asthma, with odds ratios of 11 for the atopic and 17 for the nonatopic phenotype.21 asthma and rhinitis share common risk factors and present common susceptibility to different agents, such as allergens (atopy) and infections.4,6 the presence of ahr and concomitant atopic manifestations in childhood increases the risk of developing asthma and should be recognized as a marker of prognostic significance, whereas the absence of these manifestations predicts a very low risk of future asthma.22 the upper and lower respiratory tracts form a continuum, allowing the passage of air into and out of the lungs and sharing many anatomical and histological properties.2 they share common structures, including the ciliary epithelium, basement membrane, lamina propria, glands, and goblet cells, forming the so - called united airway.23 on the other hand, differences between the upper and lower airways do exist. nasal mucosa, which is attached to bone, is enriched with vessels, whereas bronchial mucosa, which is attached to cartilage, is enriched with smooth - muscle cells.24 therefore, the major cause of airway obstruction, especially in the early phase of the allergic response, is different : upper airway obstruction is caused by vasodilation and edema, whereas lower airway obstruction arises from smooth - muscle constriction.24 it is reasonable to think that because of anatomic reasons, the upper airway constitutes the first target for allergens and for physical and chemical environmental stimuli ; therefore, they tend to be the first to be affected by the allergic airway disease, and if the intensity of this disease is low, the upper airway may be the only part of the respiratory tract that is affected. however, when the entire respiratory tract is involved, rhinosinusitis and asthma follow a parallel course.25 unfortunately, systematic research in this field has not been performed, and the evidence supporting these postulates is scarce.25 uad presents two main phenotypes : allergic (atopic or extrinsic) and nonallergic (nonatopic or intrinsic). with regard to asthma, most children and at least 50% of adults have the allergic phenotype, in which the disease is associated with allergic sensitization defined by the presence of serum - specific immunoglobulin (ig)e antibodies and/or positive skin tests to the proteins of common inhaled allergens, such as house dust mites, animal dander, fungal spores, pollens, and cochroaches.26 on the other hand, in nonallergic asthma, we do not observe ige reactivity to allergens.26 in the same way, there are two important phenotypes or rhinitis, allergic and nonallergic, both of them associated with increased prevalence of asthma.27 we focus on the allergic pathophysiology of uad. ar and atopic asthma result from an ige - mediated allergic reaction associated with airway inflammation of variable intensity.4 since the first class of ig presented on the surface of b - cells is igm, it is necessary that igm is switched to ige so that allergic inflammation can develop. isotype switching to ige requires antigen presentation and two other signals.28 signal one is provided by interleukin (il)-4 and/or il-13, acting through il-4r and il-13r via stat6, which activate transcription to the ige isotype. signal two is provided mainly by ligation of cd40 on b - cells to cd40l on t - cells, which activates dna - switch recombination.28 the ige - mediated immune response is initiated when the allergens are taken up by antigen - presenting cells via the cell - surface ig receptor. processed fragments are then presented in the context of major histocompatibility complex class ii to t - helper (th) cells, which recognize the allergen the allergen - specific th2 cells produce il-4 and il-13, and express cd154, leading to ige class switching.26,28 although class switching is generally thought to occur in the germinal center of lymphoid tissues, it has also been reported to occur in the respiratory mucosa of patients with ar and atopic asthma and in the gastrointestinal tract in patients with food allergy.28 once ige is produced by b - cells, the ig will bind to the high - affinity receptor fcr1 on mast cells and basophils.28 in future, contacts with the polyvalent sensitizing allergen, these cells will be activated through fcr1, initiating an immediate hypersensitivity reaction that is central in the pathogenesis of ar and allergic asthma.28 the reaction has an immediate phase that is induced by the release of preformed and rapidly synthesized mediators from mast cells and basophils, resulting in erythema, edema, and itching in the skin, sneezing and rhinorrhea in the upper respiratory tract, and cough, bronchospasm, edema, and mucous secretion in the lower respiratory tract.28 a late phase mediated by cytokines and chemokines and characterized by edema and leukocytic influx can occur 624 hours after the immediate phase. eosinophils recruited mainly by il-5 produced by th2 cells stand out and are essential to maintain the chronic inflammatory process and tissue damage.28 eosinophil activation directly contributes to vasodilation, edema, mucous production, bronchoconstriction, and dysfunctional remodeling of the airway.29 these processes are mainly induced by eosinophil - derived products, such as eosinophil peroxidase, which causes ahr and activates dendritic cells.26 murine studies have shown that eosinophils also contribute to airway - wall remodeling and subepithelial membrane thickening via the release of tgf.26 finally, similarly to neutrophils, upon activation, eosinophils undergo cytolysis and release mediators from the eosinophilic granules, such as eosinophil - derived neurotoxin, cationic proteins (eosinophil peroxidase), and major basic protein, which can damage structural cells of the airway.26 it has been demonstrated that humans who died from asthma presented eosinophilic inflammation all over the respiratory tract, from nasal mucosa to lung tissue, showing that the airways really are unique, even in pathologic conditions.30 therefore, ar and asthma share immunopathological features, including a th2-type immune response, thickness of the basement membrane, and goblet - cell hyperplasia.24 in contrast to allergic uad, the pathophysiology of which is well characterized, the etiology of and mechanisms involved in nonallergic uad remain unclear. some of the possibilities include allergy triggered by unknown antigens (fungi), persistent infection (caused by chlamydia trachomatis, mycoplasma spp., or viruses), and autoimmunity. a central concept of uad is the influence of the upper airway in the function of the lower airway, which is particularly evident and relevant in the allergic phenotype.25 the pathological interactions between the upper and lower airways are summarized in figure 1 and can be divided into : air - conditioninginflammationneural reflexes. galen was the first to offer insights on the function of the nose as protector of the lower airway through its ability to clean, warm, and humidify inhaled air.5 in addition, the nasal mucosa, with its abundant submucosal glands, takes part of the innate and adaptive immune defense by releasing antibacterial proteins, such as lysozyme and lactoferrin, chemical defenses, antioxidants, and secretory iga, that can protect the lower airway from pathogens and allergens.25 patients with ar present partial or complete loss of function of the nose due to mucosal congestion, since nasal airways are bypassed during oral breathing.25 in this situation, inhalation of cold and dry air may directly induce bronchoconstriction. therefore, the lower airway would be quite opened to the entrance of allergens and pathogens, increasing the risk of asthma exacerbation. propagation of inflammation from the upper airway to lower airway may occur via postnasal drip and systemic circulation. the concept that inflammatory secretions from the upper airway of patients with rhinosinusitis or even with rhinitis are aspirated into the lower airway with adverse consequences has been viewed as one of the principal mechanisms for lower airway symptoms, especially after an upper respiratory infection.25 it is quite possible that early morning coughing in individuals with rhinitis is associated with accumulation of secretions in the lower pharyngeal area stimulating irritant receptors.25 it is questionable, however, whether these secretions can reach the intrathoracic lower airway in adequate quantities to alter their physiology and to generate exacerbations or chronically worsen lower airway function in patients with asthma.25 the development of sinusitis in rabbits is associated with lower ahr, even after eliminating upper lower airway communication with the use of an inflated endotracheal tube cuff.31 on the other hand, there is good evidence that allergic inflammation developing in the respiratory mucosa may result in systemic inflammatory events.25 blood eosinophilia may be observed in patients with allergic asthma, and can be considered a biomarker of inflammation of the lower airway. there is less evidence that upper airway inflammation can lead to an increase in eosinophil blood count.25,32 moreover, there is no experimental information indicating that nasal inflammation leads to systemic inflammatory signals that induce changes in lower airway physiology,25 even though it seems reasonable to speculate that cytokines released in nasal mucosa could activate bone marrow with chemotaxis of white blood cells to both upper and lower airways.25 the opposite direction for propagation of the inflammatory process, beginning in the lower airway and getting to the upper airway, has been postulated. a study showed that segmental bronchial allergen provocation in patients with nonasthmatic ar can induce nasal inflammation, nasal and bronchial symptoms, and reduction in pulmonary and nasal function.33 however, there are recent data suggesting that this lung in a very elegant murine model of allergic respiratory inflammation induced by ovalbumin, balb / c mice were submitted to intratracheal challenge after sensitization by an intraperitoneal route. this provocation induced lung inflammation and ahr, but no signs of inflammation were found in the nose.34 the existence of a nasobronchial reflex that originates from the sensory nerve endings in the nose, travels to the central nervous system through the trigeminal nerve, and follows an efferent pathway through the vagus nerve to produce airway smooth - muscle contraction has been under debate for years.25 despite being well documented in animal models, its existence and relevance in humans are still controversial. some studies performed in healthy individuals and asthmatics have demonstrated that lower airway resistance increased after nasal inhalation of cold and dry air.35,36 another important study showed an increase in ahr after a nasal allergen provocation in asthmatics who had reported worsening of asthma symptoms following seasonal exacerbations of rhinitis.37 the authors observed that none of the solutions delivered to the nose during allergen provocation could be detected in the lower airway, showing that the increase in ahr was not due to inadvertent inhalation of the allergen.37 it is important to point out that the classic nasobronchial reflex is a component of the diving reflex.38 immersion of the head into cold water leads to immediate suppression of respiration (apnea), laryngospasm, and bronchoconstriction, in order to protect the lower airway from diving.38 nasal inhalation of dust, pollutants, and irritants can induce immediate bronchoconstriction with cessation of respiration in the expiratory phase, due to relaxation of inspiratory muscles.38 therefore, in individuals with allergic respiratory disease, this reflex could lead to an increase in asthma symptoms after nasal injury. it has been demonstrated that inhalation of ultrasonically nebulized distilled water increased nasal airway resistance in patients with ar, without the involvement of parasympathetic efferent reflexes, since patients did not present sneezing or rhinorrhea.39 the clinical relevance of this bronchonasal reflex has yet to be demonstrated. in conclusion, upper and lower airways seem to constitute a unique system, named united airway, that share similarities in terms of histology, physiology, and pathology. uad is triggered by a th2 immune response of the airway, leading to an extended inflammatory process that begins in nasal mucosa and ends in bronchioles and alveoli, particularly in symptomatic asthmatics. galen was the first to offer insights on the function of the nose as protector of the lower airway through its ability to clean, warm, and humidify inhaled air.5 in addition, the nasal mucosa, with its abundant submucosal glands, takes part of the innate and adaptive immune defense by releasing antibacterial proteins, such as lysozyme and lactoferrin, chemical defenses, antioxidants, and secretory iga, that can protect the lower airway from pathogens and allergens.25 patients with ar present partial or complete loss of function of the nose due to mucosal congestion, since nasal airways are bypassed during oral breathing.25 in this situation, inhalation of cold and dry air may directly induce bronchoconstriction. therefore, the lower airway would be quite opened to the entrance of allergens and pathogens, increasing the risk of asthma exacerbation. propagation of inflammation from the upper airway to lower airway may occur via postnasal drip and systemic circulation. the concept that inflammatory secretions from the upper airway of patients with rhinosinusitis or even with rhinitis are aspirated into the lower airway with adverse consequences has been viewed as one of the principal mechanisms for lower airway symptoms, especially after an upper respiratory infection.25 it is quite possible that early morning coughing in individuals with rhinitis is associated with accumulation of secretions in the lower pharyngeal area stimulating irritant receptors.25 it is questionable, however, whether these secretions can reach the intrathoracic lower airway in adequate quantities to alter their physiology and to generate exacerbations or chronically worsen lower airway function in patients with asthma.25 the development of sinusitis in rabbits is associated with lower ahr, even after eliminating upper lower airway communication with the use of an inflated endotracheal tube cuff.31 on the other hand, there is good evidence that allergic inflammation developing in the respiratory mucosa may result in systemic inflammatory events.25 blood eosinophilia may be observed in patients with allergic asthma, and can be considered a biomarker of inflammation of the lower airway. there is less evidence that upper airway inflammation can lead to an increase in eosinophil blood count.25,32 moreover, there is no experimental information indicating that nasal inflammation leads to systemic inflammatory signals that induce changes in lower airway physiology,25 even though it seems reasonable to speculate that cytokines released in nasal mucosa could activate bone marrow with chemotaxis of white blood cells to both upper and lower airways.25 the opposite direction for propagation of the inflammatory process, beginning in the lower airway and getting to the upper airway, has been postulated. a study showed that segmental bronchial allergen provocation in patients with nonasthmatic ar can induce nasal inflammation, nasal and bronchial symptoms, and reduction in pulmonary and nasal function.33 however, there are recent data suggesting that this lung nasal propagation of inflammation might not be relevant. in a very elegant murine model of allergic respiratory inflammation induced by ovalbumin, balb / this provocation induced lung inflammation and ahr, but no signs of inflammation were found in the nose.34 the existence of a nasobronchial reflex that originates from the sensory nerve endings in the nose, travels to the central nervous system through the trigeminal nerve, and follows an efferent pathway through the vagus nerve to produce airway smooth - muscle contraction has been under debate for years.25 despite being well documented in animal models, its existence and relevance in humans are still controversial. some studies performed in healthy individuals and asthmatics have demonstrated that lower airway resistance increased after nasal inhalation of cold and dry air.35,36 another important study showed an increase in ahr after a nasal allergen provocation in asthmatics who had reported worsening of asthma symptoms following seasonal exacerbations of rhinitis.37 the authors observed that none of the solutions delivered to the nose during allergen provocation could be detected in the lower airway, showing that the increase in ahr was not due to inadvertent inhalation of the allergen.37 it is important to point out that the classic nasobronchial reflex is a component of the diving reflex.38 immersion of the head into cold water leads to immediate suppression of respiration (apnea), laryngospasm, and bronchoconstriction, in order to protect the lower airway from diving.38 nasal inhalation of dust, pollutants, and irritants can induce immediate bronchoconstriction with cessation of respiration in the expiratory phase, due to relaxation of inspiratory muscles.38 therefore, in individuals with allergic respiratory disease, this reflex could lead to an increase in asthma symptoms after nasal injury. it has been demonstrated that inhalation of ultrasonically nebulized distilled water increased nasal airway resistance in patients with ar, without the involvement of parasympathetic efferent reflexes, since patients did not present sneezing or rhinorrhea.39 the clinical relevance of this bronchonasal reflex has yet to be demonstrated. in conclusion, upper and lower airways seem to constitute a unique system, named united airway, that share similarities in terms of histology, physiology, and pathology. uad is triggered by a th2 immune response of the airway, leading to an extended inflammatory process that begins in nasal mucosa and ends in bronchioles and alveoli, particularly in symptomatic asthmatics. studies have demonstrated that the presence of severe rhinitis is associated with an increased risk of asthma20 and in patients with asthma a less favorable evolution.4042 it has also been shown that the treatment of rhinitis can be beneficial to the lower airway, reducing symptoms, emergency room visits, and hospitalizations, as well as the severity of bronchial hyperresponsiveness.4347 in protocols of difficult - to - control asthma, rhinitis was included as one of the main comorbidities to be assessed and treated.48 therapy for uad includes avoidance of relevant allergens and irritants, pharmacotherapy, and allergen - specific immunotherapy (sit). allergen avoidance has been suggested not only to prevent uad onset and progression but also to reduce its burden, improving symptoms and quality of life. however, there is a lack of evidence supporting the effectiveness of environmental control.4 the pharmacologic approach of ar includes antihistamines, oral leukotriene antagonists, and intranasal corticosteroids, the last being considered the most efficacious drug.4 agondi reported a decrease in asthma symptoms and ahr after intranasal corticosteroid treatment of rhinitis.43 a recent meta - analysis confirmed the beneficial effect of intranasal steroids in ahr.44 oral and intranasal antihistamines, as well as leukotriene antagonists, are less effective than intranasal corticosteroids in improving the symptoms of ar.4952 a protective effect of cetirizine against ahr measured 6 hours after nasal allergen challenge in patients with ar was shown.53 allergen - sit is defined as a procedure to administer increasing amounts of specific allergens in patients diagnosed with ige - mediated disease, in order to induce immune tolerance.8,54 subcutaneous and sublingual it can reduce symptoms of ar and need of reliever medication, as well as improve the control of comorbid conditions, such as asthma and conjunctivitis.8,55 allergen - sit is indicated in moderate / severe ar for which response to pharmacotherapy is inadequate. other potential indications are adverse effects of medications, coexisting allergic asthma, bad adherence to therapy, and patient preference for it instead of pharmacotherapy.8,56 furthermore, sit has been positioned as the only treatment that can modify the natural course of allergic diseases that includes prevention of new sensitizations and reduction of risk of developing asthma in subjects with ar, even after termination of treatment.5761 the preventive allergy treatment study was a randomized controlled trial that showed clinical benefits and a preventive effect on asthma development in children suffering from seasonal rhinoconjuctivitis undergoing subcutaneous it with grass- and/or birch - allergen extracts for 3 years. this positive effect of sit in preventing the progression from rhinitis to asthma was observed to persist in the same patients for 7 years after the termination of the treatment.5759 another study found that after 3 years of sublingual grass - pollen it in children with ar, eight of 45 actively treated subjects and 18 of 44 controls developed asthma, with 3.8-fold more frequent development of asthma in the untreated patients.62 some studies have shown that it was able to prevent new sensitizations in monosensitized individuals.63 a research assessing the effects of subcutaneous it in 147 house dust mite - monosensitized children over 5 years found similar results : 75.3% in the treated group and 46.7% in the control group had no new sensitizations.64 a randomized controlled study involved 216 children with ar (with or without intermittent asthma) receiving drugs alone or drugs plus sublingual it for 3 years showed new sensitizations in 34.8% of controls and in 3.1% of the it group. moreover, they demonstrated that this protective effect extended to ahr, which significantly decreased in the it group.65 novel targeted therapeutic approaches using biological agents have been studied in the treatment of ar and allergic asthma, especially for the management of severe uncontrolled phenotypes. among these, omalizumab, a humanized monoclonal antibody that binds circulating ige and prevents its attachment to high - affinity ige receptors, is available worldwide. omalizumab improves both upper and lower airway diseases, reducing nasal and asthma symptoms, decreasing exacerbations, and improving quality of life.66 mepolizumab, a monoclonal antibody that blocks the binding of il-5 to eosinophils, has also shown a beneficial effect on severe eosinophilic airway diseases, such as asthma and nasal polyposis in adults.6769 because these treatments have systemic effects, it is not possible to design a study to assess how much the improvement in asthma is, due to direct effects or indirect effects associated with rhinitis improvement. it should consider severity and duration of the disease and patient preference, as well as the efficacy, availability, and cost of medications. therefore, management of rhinitis and asthma must be jointly carried out, including environmental control, pharmacotherapy, and sit. the treatment of rhinitis is indispensable in patients with asthma, since it leads to better control of both diseases, and the lessons of the aria initiative can not be forgotten. further studies regarding uad are needed to better understand the interactions between the upper and lower airways, but there is no doubt that rhinitis and asthma have to be studied and managed in an integrated manner. | upper and lower airways are considered a unified morphological and functional unit, and the connection existing between them has been observed for many years, both in health and in disease. there is strong epidemiologic, pathophysiologic, and clinical evidence supporting an integrated view of rhinitis and asthma : united airway disease in the present review. the term united airway disease is opportune, because rhinitis and asthma are chronic inflammatory diseases of the upper and lower airways, which can be induced by allergic or nonallergic reproducible mechanisms, and present several phenotypes. management of rhinitis and asthma must be jointly carried out, leading to better control of both diseases, and the lessons of the allergic rhinitis and its impact on asthma initiative can not be forgotten. |
sequence assembly is the first challenge encountered in a typical computational genomics pipeline and it involves the merging and the ordering of shorter sequence fragments (reads) with the aim to get as close as possible to the original larger sequence (genome). advent of next - generation sequencing platforms has allowed the sequencing a huge number of organisms and species at reasonable costs. however, many issues regarding the computational assembly of large - scale sequencing data have remained unsolved 1 and, actually, the number of draft genomes in databases greatly overtakes the number of completely sequenced (sometimes referred also as finished or closed) ones (www.genomesonline.org). the output of a de novo assembly is typically a draft genome, consisting of a set of contigs (i.e. contiguous sequence fragments) that may be ordered and oriented into scaffold sequences, with gaps between them, representing regions of uncertainty or missing sequence 2. alternatively, draft genomes can be represented in the form of (de bruijn) graphs, an approach that is currently exploited by a number of assembly algorithms (reviewed in 3). the difficulty in obtaining a closed genome may be due to several causes, including the presence of repetitive fragments along the genome and/or the absence of enough reads to produce a reliable assembly. it is also known that the most rapidly evolving regions are often absent or incorrectly rendered in finished genomes 4. furthermore, from a mathematical viewpoint, the de novo genome assembly problem can be proven to be difficult, falling within a class of problems (np - hard) for which no efficient computational solution is yet known 5. in this context, it must be added that some traditional assemblers like newbler (454 sequencing, roche diagnostics, indianapolis, in, usa) usually perform a trimming of the contig edges depending on the quality of the supporting reads. this conservative procedure, however, may result in a loss of information, discarding many correct bases characterized by a sub - optimal quality. to overcome these limitations, we have developed a tool called enly that allows increasing the length of the contigs deriving from de novo assemblies and the closure of part of the gaps commonly present in the draft genome. enly is sequencing platform - independent since it be used with any kind of sequence type, as long as files are provided in fasta format. accordingly, even hybrid datasets (obtained with different sequencing technologies) can be used as input for enly pipeline. finally, by taking into account scaffold information, enly drastically reduces the probability of generating chimeric assemblies. the overall procedure requires (at least) two multi - fasta files as input, one containing all the contigs deriving from the first assembly and the other all the raw reads resulting from the sequencing run. by applying the strategy described below to each contig in the input file, enly tries to increase their length and (possibly) to merge them into scaffolds. more in detail, the pipeline is based on the iteration of multiple cycles (figure 1) and during each of them : 1) a fragment of length l1 (specified by the user) is detached from the 5'-end of each contig and is used as an input for a blast search 6 against a database embedding all the original reads resulting from the sequencing run ; 2) the blast output is parsed to identify reads that can be used to extend the contig (i.e. those partially aligned at the end of the contig and protruding from its extremity). by default identity threshold among the reads and overlap length between each read and the contig extremity is, instead, specified by the user (with the -s parameter). this means that, for example setting -s to 70%, only reads aligned for at least 70% of their length and sharing more than 97% of their sequence with the contig extremity will be used to extend contigs. intuitively, setting this overlapping threshold to higher values will increase accuracy, although reducing the number of closed gaps (see additional file 1 : supplementary material). the use of higher thresholds (i.e. higher stringency) is, therefore, recommended when a reference genome / scaffold is not available for checking possible chimeric joints (see point 8). when a reference scaffold is present, contigs merging will still be reliable even when low overlap thresholds (e.g. 30%) are selected, although it must be pointed out that the extended contigs not merged into any (sub) scaffold would not be checked for the presence of wrongly incorporated sequence. 3) the selected reads and the original contig are assembled together using either phrap 7 or minimo 8 assemblers, possibly resulting in an enlarged 4) the very same procedure is repeated for the 3'-end of the contig and for all the other contigs of the input file ; 5) the extended contigs are used as inputs for a second step, in which a fragment of length l2 (with l2 < l1) is detached from each contig end and used as an input for a further blast against the reads database, assembling the matching reads with the enlarged contig. this procedure, performed in order to compensate for the presence of reads with a heterogeneous length distribution (resulting from a typical 454 run 9), is repeated for fragments of decreasing length, until the minimum length (specified by the user through -m option) has been reached ; 6) if a reference genome (in fasta format) has been provided by the user, extended contigs are mapped onto it, taking advantage of an ad hoc modified version of the contiguator tool 10, allowing launching this tool in an iterative fashion and storing results from each run in a separate folder. 7) contigs are mapped by blast one against each other for identifying possible overlaps and gaps closure. no threshold for contigs overlap is set in this stage since scaffold information is used (see next point) to discard possible chimeric joints. 8) gap closures are validated against a reference scaffold, provided by the user (-y option) or, alternatively, generated by the contiguator tool. only contigs overlaps that are consistent with scaffold information are merged (using the megamerger tool from the emboss suite). in case neither a scaffold nor a reference genome have not been provided by the user, possible overlaps for each of the enly cycles are stored in a specific output files (see enly 's manual for details) that the user can manually inspect for eventual gap closures. 9) these contigs, together with those that have not been enlarged / merged are then used as input for the following cycle of the pipeline. the first cycle of the enly pipeline is completed when all the contigs have been processed, mapped and saved to a new multi - fasta file. the procedure is then repeated (re - starting from point 1) for a user - specified number of cycles or, alternatively, until no more bases have been added to the contigs during the last cycle. output files from the mapping procedure (contiguator) are saved in separate folders (one per cycle), ready for being loaded by the artemis comparison tool 11, in order to visually inspect contigs alignment against the reference genome. reads used for extending contigs may derive from any of the currently available sequencing technologies (illumina, 454, iontorrent, etc.), as long as they are provided in the form of fasta files. moreover, reads obtained by different sequencing technologies may be pooled in a single file to be used as input for enly pipeline. intuitively, since enly uses the sequence of the reads partially protruding from each contig, the probability of extending its length increases with the average length of the reads dataset. it should be noticed that, besides 454 pyrosequencing, other sequencing platforms are now starting to generate reads of length comparable to the ones of the datasets used in this work (e.g. illumina miseq, iontorrent), thus paving to the use of this alternative datasets for gap - filling through enly 's approach. to evaluate the reliability of the pipeline, we tested enly on three different 454 reads datasets retrieved from either the ncbi short read archive database (sra, http://www.ncbi.nlm.nih.gov/sra), namely escherichia coli ko11 (srs084754) and staphylococcus aureus 649 (srs114535), or from a previous sequencing run on streptococcus pneumoniae ap200 12. ap200 12, 13) or the genome of a phylogenetically close bacterium (s. aureus col 14) were available, allowing the validation of the results obtained with enly. each reads dataset was first assembled with newbler v. 2.6, using default parameters, resulting in 719, 254 and 124 contigs for e. coli ko11, s. aureus 649 and s. pneumoniae ap200, respectively. contigs obtained from de novo assembly were, then, used, together with the corresponding reads, as input for the enly pipeline. parameter values (and an evaluation of their effects on the genome assembly) used during these tests are reported in additional file 1 : supplementary figure 1, together with introduced mismatch rates for different reads alignment thresholds (-s option, additional file 1 : supplementary figure 2 and 3). in all cases, enly was able to improve the de novo assembly (table 1). in detail, the number of closed gaps ranged from 16% to 19.1% of all the gaps present in each input draft genome. most of the closed gaps resulted from merging two contigs although, in some cases (e.g. e. coli ko11 drafts assembly), up to 5 different contigs were merged in a single (sub) scaffold. importantly, after running enly on the de novo assemblies, an increase in the n50 value for each of the genome was observed, accounting for the overall improvement of the input draft assemblies. interestingly, enly showed to perform reasonably good also when non-454 reads were used as input for the pipeline. results obtained with reads obtained from iontorrent, miseq and pacbio sequencing runs are reported in additional file 1 : supplementary table 2 and 3. the computational time required by enly correlates with the amount of contigs / reads embedded in the input files and with the number of cycles required by the user. on a machine with eight 3.1 ghz processors, the computational time required for the tests performed in this work (and according to the parameters specified in additional file 1 : supplementary table 1) ranged from 2 up to 5 hours depending on the size of the reads datasets and parameters used (see additional file 1 : supplementary figure 4). recently, two scaffolding approaches apparently similar to the one presented here have been developed. both of them take advantage of the additional information that is present on a typical illumina paired - end sequencing run 15, 16. currently, enly does not use paired - end information, being able to process single end sequencing reads (as long as they are provided in fasta format) for contigs extension ; moreover, by implementing the possibility to guide contigs extension / merging through the use of scaffold information (independently generated by the user or obtained through the implemented contiguator tool), our pipeline reduces the probability of chimeric scaffolds. in conclusion, enly is a simple, cross - platform and parallelizable tool allowing the improvement of draft genomes resulting from de novo - assembled high - throughput sequencing reads. it is based on the iterative mapping of reads at contigs ends and it is also able to use (and generate) scaffold information to guide contigs merging, reducing the probability of chimeric scaffolding. testing it on a set of de novo draft genomes led to the closure of up to 20% of the gaps originally present, thus resulting particularly helpful during genome finishing procedures. | the reconstruction of the complete genome sequence of an organism is an important point for comparative, functional and evolutionary genomics. nevertheless, overcoming the problems encountered while completing the sequence of an entire genome can still be demanding in terms of time and resources. we have developed enly, a simple tool based on the iterative mapping of sequence reads at contig edges, capable to extend the genomic contigs deriving from high - throughput sequencing, especially those deriving by newbler - like assemblies. testing it on a set of de novo draft genomes led to the closure of up to 20% of the gaps originally present. enly is cross - platform and most of the steps of its pipeline are parallelizable, making easy and fast to improve a draft genome resulting from a de novo assembly. |
a genetic background to the diversity seen in the clinical progression of heart disease is well documented. genetic variants that lead to halted or delayed disease progression are particularly interesting as they may provide a basis for new therapies. genetic diversity in pathways involving nucleotide metabolism are particularly important due to the latter s direct links to myocardial function and metabolic regulation. the c34 t (glu12stop) mutation in exon 2 is by far the most common in the general population with an allele frequency of 1014 %. were the first to describe a benefit of the c34 t mutation in patients with heart disease. this study conducted in a group of 132 patients with dilated cardiomyopathy demonstrated that the probability of surviving without transplantation for more than 5 years is 8.6 times greater in patients carrying the c34 t allele. anderson. confirmed a protective effect in ischemic heart disease demonstrating prolonged survival associated with the c34 t mutation in a prospective study in 450 patients. conducted in a group of 90 patients with congestive heart failure demonstrated better prognosis in patients possessing the c34 t ampd1 mutation. analysis of a consecutive group of 390 patients with left ventricular dysfunction revealed better survival in c34 t allele carrier patients within a subgroup with ischemic cardiac dysfunction. other independent studies demonstrated a beneficial effect of the c34 t mutation on metabolic aspects related to the cardiovascular system such as a lower level of an inhibitor of plasminogen activator and soluble von willebrand factor in patients with coronary heart disease. in contrast, three studies have indicated a lack or even a deleterious effect of the c34 t ampd1 mutation in patients with heart disease. a large population study conducted in 935 post myocardial infarction and 433 heart failure patients with long term follow - up indicated increased mortality associated with the c34 t mutation within patients with a history of myocardial infarction. a prospective study in 686 patients with stable congestive heart failure did not demonstrate any impact of the c34 t polymorphism on tested clinical, biochemical, echocardiographic, radionuclide or exercise parameters. analysis of 161 patients undergoing coronary revascularisation for clinical parameters including heart failure and cardiac death revealed lack of any impact of the c34 t mutation. in case of c34 t polymorphism, assessment of impact on cardiovascular system could be complicated because this mutation was found to exert deleterious effects on muscle performance. frequency of diabetes and obesity was lower in subjects with c34 t mutation (table 1).table 1summary of clinical effects of c34 t mutation of amp deaminase in heart diseasenumber of patientsdiagnosiseffect of c34 t mutationreference132dilated cardiomyopathyimproved survival450ischemic heart diseaseimproved survival90congestive heart failurebetter prognosis390left ventricular dysfunctionbetter survival in ischemic cardiac dysfunction group109coronary artery diseaselower level of inflammation / thrombosis markers1368myocardial infarction or heart failureincreased mortality in subgroup with prior myocardial infarction686stable congestive heart failureno effect161coronary revascularisationno effect32heart transplantationhigh frequency in donors with good cardiac function[13, 14]262heart transplantationlower need for postoperative inotropic support, worse 1 year survival201coronary artery disease or heart failurelower prevalence of diabetes summary of clinical effects of c34 t mutation of amp deaminase in heart disease our own studies have focused on the effects of the c34 t mutation in patients undergoing cardiac surgery, including transplantation. we demonstrated a remarkably high frequency of c34 t mutation of ampd1 in 22 cardiac donors with good cardiac function as compared to 10 donors with echocardiographically confirmed acute cardiac failure [13, 14 ]. donors with healthy hearts had a significantly higher frequency of c34 t mutation also compared to control population (n = 207). our recent analysis of 262 cardiac donors and 190 heart transplant recipients highlighted a potential explanation for the discrepancy of published results by indicating that the c34 t mutation induces diverse effects. while a protective effect was demonstrated in donor hearts with the c34 t mutation in that they required less inotropic support, recipients of c34 t allele carrying organs had a poorer 1 year survival. it seems that c34 t mutation is protective for donor organ function in the short term but deleterious in the long term possibly due to the highly immunogenic post transplant environment. consistent with this report we found that among a group of 153 patients undergoing coronary bypass surgery with use of cardiopulmonary bypass c34 t carriers were better protected from functional deterioration. in a group of patients without heart failure and with advanced coronary artery disease postoperative ejection fraction was similar to preoperative in patients with the c34 t mutation while it was significantly decreased in patients without this mutation. long before its cardiovascular associations were observed, the c34 t mutation was identified as cause of skeletal myopathy [17, 18 ]. homozygotes for this mutation could have complete loss of amp deaminase activity in skeletal muscle. it has been described as one of the most common inherited metabolic defects, with an estimated allele frequency of 20 %. clinical symptoms associated with this deficiency are highly variable. while many subjects are asymptomatic others suffer from early fatigue, cramps and/or myalgia. inability to maintain energy equilibrium, depletion of the muscle nucleotide pool or insufficient supply of anaplerotic substrates for the krebs cycle in the exercising skeletal muscle were proposed as the underlying mechanisms of this syndrome. a varying effect of this mutation is known to be caused by alternative splicing of the ampd1 gene involving the elimination of the c34 t nonsense mutation in exon 2 and allowing production of functional enzyme [17, 19 ]. taken together these data suggest that the c34 t mutation of ampd1 has diverse effects on the cardiovascular system and on the function of the human organism as a whole. during acute cardiovascular incidents it is clearly beneficial, but in the long term and in highly immunogenic environments such as after transplantation, the c34 t mutation may have deleterious effect. discrepancies between different studies attempting to clarify the impact of this alteration on human longevity may be a consequence of a different interplay of beneficial and deleterious effects in specific clinical conditions and under specific treatment. besides basic information these studies have provided a clear indication when and how a potential therapy based on ampd inhibition could be applied clinically. amp - deaminase (ampd) exists in human tissues in several isoforms with different kinetic properties, molecular weights and structures. these isoforms are the products of three different genes : ampd1, ampd2 and ampd3. in humans ampd1 is predominantly expressed in skeletal muscle, ampd2 is predominantly expressed in the brain, liver and heart and ampd3 is expressed mainly in the erythrocytes. in rodents while ampd1 is still the dominant skeletal muscle isoform and ampd2 is present in the liver, ampd3 is almost exclusively expressed in the heart. this indicates that altered expression of ampd1 (as conferred by the c34 t mutation) would not have any effect on ampd expression in the mouse or rat heart. in humans while ampd2 is the main form expressed in human myocardium, transcripts for ampd3 and ampd1 are also present (our unpublished observations). therefore the ampd1 c34 t mutation has an impact not only on skeletal muscle ampd activity but also on its activity in myocardium where it causes a substantial reduction in enzyme activity even among heterozygotes [21, 22 ]. it has several unique cellular functions and its activity and expression pattern are highly tissue specific. amp deaminase forms part of the purine nucleotide cycle, which is designed to preserve adenylate s energy charge and phosphorylation potential under conditions of insufficient energy supply. this cycle plays a crucial role in regulating the adenine nucleotide pool, in the synthesis of guanine nucleotides and in the provision of anaplerotic substrates for the krebs cycle. these processes are important in skeletal muscle so the activity of amp deaminase is 30100 times higher than in the other organs. under conditions of heavy exercise, when amp accumulates, amp deaminase allows rapid breakdown of amp to imp allowing a higher value of phosphorylation potential and free energy from atp hydrolysis that translates directly into improved exercise capacity to be maintained. after exercise, when energy use is decreased, the imp (a polar molecule) that remained inside the cell is reincorporated back into the adenine nucleotide pool via the adenylosuccinate synthetase and adenylosuccinate lyase reactions. the latter reaction also releases fumarate that supports the operation of the krebs cycle. in the heart and non - muscle organs amp deaminase is not involved in the purine nucleotide cycle, but plays a role in regulation of the adenine nucleotide pool and in the synthesis of guanine nucleotides. the contribution of the amp deamination pathway to the overall catabolism of nucleotides seems to be lower in human cardiomyocytes than in rat cardiomyocytes [23, 24 ], but still accounts for 30 % of the total breakdown capacity. an important consequence of amp deaminase deficiency is an increased flux of substrates through the 5-nucleotidase pathway and increased adenosine production under conditions of heavy exercise. adenosine content was found to increase 14 times in skeletal muscle biopsies taken from patients with ampd deficiency during exercise compared with a 2 fold increase in normal subjects [25, 26 ]. however, previous studies have shown that increased production of adenosine may ameliorate a number of pathological processes including those involved in heart failure. adenosine has long been recognised to increase coronary flow and to be involved in the autoregulatory loop between contractile cells and blood supply and was classified as an autacoid, retaliating against external stimuli, which deplete intracellular atp in the heart. a number of other cardioprotective physiological effects of adenosine have been described, such as the antagonism of catecholamine mediated hypercontraction, an anti - aggregatory activity, the inhibition of adhesion and toxic free radical generation by polymorphonuclear leukocytes, the promotion of angiogenesis and the induction of preconditioning [3034 ]. adenosine inhibits t lymphocyte function both at the stage of blastic transformation and cytolysis [3540 ]. increased adenosine concentration is partially responsible for severe combined immunodeficiency syndrome observed in patients with inherited adenosine deaminase deficiency. adenosine also affects several processes involved in the pathogenic mechanisms of heart failure such as tnf and il-6 production [4144 ], apoptosis and proliferation of fibroblasts and smooth muscle cells [4650 ]. we have previously shown the significant capacity of human endothelial cells to degrade amp via the deamination pathway. an increased adenosine production in cardiac endothelial cells due to deficiency of ampd is one possible mechanism of the cardioprotective effects. preconditioning at a distance has been demonstrated, indicating that an increase in adenosine production outside the heart in skeletal muscle for example may exert beneficial cardiac effects. it has been shown also that a period of brief myocardial ischemia and increased cardiac adenosine production are capable of attenuating platelet aggregation in remote arteries. treatment with a2 adenosine receptor agonists was found to exert beneficial effects in animal models of both acute and chronic heart failure. despite numerous reports indicating benefits of elevated adenosine in cardiovascular disease the amistad trial reported reduced infarct size but increased number of adverse clinical events, including death, in patients infused with adenosine as an adjunct to thrombolysis. the administration of adenosine could be proarrhythmic or produce coronary artery steal phenomenon in patients with critical stenosis. besides cardiovascular effects adenosine can contribute to fluid - retaining disorders via its a1 receptor mediated effects in the kidney or induce bronchospasm in some patients. adenosine effects on immune cell function mediated by purinergic receptors may also promote cancer progression. while these deleterious effects are restricted to specific clinical scenarios, its careful monitoring is needed in any adenosine related therapy including potential treatment with ampd inhibitors. amp is not only a substrate for the ampd reaction but also an allosteric regulator that signals energy deficiency in the cell. amp directly activates glycolytic enzymes and indirectly controls a broad range of cellular functions via amp regulated protein kinase (ampk). ampk is a heterotrimeric protein that was initially described as a regulator of energy metabolism [61, 62 ] but later found to play a role in cytoprotection, cell growth and regeneration. accomplished by phosphorylation and inhibition of acetyl coa carboxylase and reduction of malonyl - coa concentration. ampk activates glucose transport into the cell by translocation of glut-4 into the membrane and controls the expression of enzymes of energy metabolism by phosphorylation of hif-1. besides its metabolic effects, ampk is linked with the akt kinase pathway and induction of proteins involved in cytoprotection and regeneration. activation of ampk in heart infarction or heart failure is currently considered as a therapeutic target. however, ampk s protective effects could be dependent on how and when it is activated. loss of regulatory feedback in ampk due to mutation in its 2 subunit (prkag2) resulting in constitutively increased activity is known to cause myocardial glycogen storage disease and cardiomyopathy [6769 ]. our current hypothesis is that inhibition of ampd will act to amplify the amp accumulation in cells with disrupted energy metabolism. this indirect ampk activation by its endogenous activator could be superior to direct activation of ampk (e.g. by aicar) since ampk activation would be restricted to cells and conditions where this activation is necessary. we have in vitro evidence showing that high ampd activity could suppress ampk activity, possibly by competition for amp. recent study on the mechanism of ampk activation by metformin has suggested involvement of inhibition of ampd. we have developed several possible therapeutic strategies based on the beneficial effects of adenosine that are applicable during cardiac surgery. we have established that adenosine administration both as a constituent of cardioplegic solution or as an infusion following cardioplegic arrest is beneficial [71, 72 ]. administration of adenosine at the time of cardioplegic arrest, after reperfusion or after myocardial infarction is undergoing clinical evaluation. we have also developed a procedure that allows endogenous adenosine production in normoxic cardiac cells to increase by combined application of adenosine metabolism inhibitors and substrates for nucleotide synthesis. we have shown that application of this procedure following experimental transplantation resulted in an improvement in all aspects of cardiac mechanical function, roughly a threefold decrease in postischemic cardiac neutrophil infiltration and an increase in myocardial atp concentration. the discovery that genetic alterations of nucleotide metabolism that potentially leads to enhanced adenosine production and result in improved clinical outcome in heart dysfunction indicates new areas where such treatment could be applied. the limited availability of specific inhibitors of ampd is a major drawback for testing the regulation of ampd in heart disease. such inhibitors are not commercially available, although a procedure for chemical synthesis has been described and preliminary evaluation of their effects has been performed as part of a phd thesis. we have followed this procedure and chemically synthesized a most effective compound : 3-[2-(3-carboxy-4-bromo-5,6,7,8-tetrahydronaphthyl)ethyl]-3,6,7,8-tetrahydroimidazo[4,5-d][1, 3]diazepin-8-ol (ampdi). we have performed several preliminary studies using ampdi with isolated ampd, with heart homogenates, in isolated rat cardiomyocytes, perfused hearts and in mice in vivo [7678 ]. in each case the efficiency of ampd inhibition was confirmed, although in cardiomyocytes, perfused hearts and in vivo the concentration of inhibitor had to be several orders of magnitude higher than for isolated enzyme or heart homogenate alone. we have established that even at these high concentrations ampdi remained specific for ampd inhibition. while further studies are necessary to clarify the difference in effective concentration we believe that we have optimized the conditions for in vivo use of ampdi. we have conducted a preliminary assessment of ampdi effects in a mouse model of cardiac hypoxia and have demonstrated a protective effect. we have established that the half life of ampdi in mouse blood is relatively short (about 30 min) and that ampd inhibition in vivo is transient, even with continuous infusion. ampdi could therefore be a good tool to study the acute effects of ampd inhibition, but the design of chemicals suitable for long term in vivo use and as drug candidates requires further work. | nucleotide metabolism and signalling is directly linked to myocardial function. therefore analysis how diversity of genes coding nucleotide metabolism related proteins affects clinical progress of heart disease could provide valuable information for development of new treatments. several studies identified that polymorphism of amp deaminase 1 gene (ampd1), in particular the common c34 t variant of this gene was found to benefit patients with heart failure and ischemic heart disease. however, these findings were inconsistent in subsequent studies. this prompted our detailed analysis of heart transplant recipients that revealed diverse effect : improved early postoperative cardiac function associated with c34 t mutation in donors, but worse 1-year survival. our other studies on the metabolic impact of ampd1 c34 t mutation revealed decrease in ampd activity, increased production of adenosine and de - inhibition of amp regulated protein kinase. thus, genetic, clinical and biochemical studies revealed that while long term attenuation of ampd activity could be deleterious, transient inhibition of ampd activity before acute cardiac injury is protective. we suggest therefore that pharmacological inhibition of amp deaminase before transient ischemic event such as during ischemic heart disease or cardiac surgery could provide therapeutic benefit. |
cases of more than 6,000 gas resected by endoscopy or surgery on file at the samsung medical center were examined between march 2008 and july 2010. among the files examined, we identified only three cases of ga - fg characterized by well differentiated columnar cells mimicking fundic gland cells, notably chief cells. immunohistochemical staining of mucin (muc) 2, muc5ac, muc6, and cd10 was performed in three ga - fg cases using the bond - max (leica microsystems, wetzlar, germany). paraffinized sections were incubated with the following primary monoclonal antibodies : anti - muc2 (1:200, novocastra, newcastle, uk), anti - muc5ac (1:200, novocastra), anti - muc6 (1:200, novocastra), and anti - cd10 (1:100, novocastra). pepsinogen - i and h / k - atpase were evaluated by immunohistochemistry performed at the department of human pathology, juntendo university school of medicine, tokyo, japan as described by ueyama.12 the expression of muc2, muc5ac, muc6, cd10, pepsinogen - i, and h / k - atpase was evaluated as either positive or negative. staining was defined as positive when the percentage of positive cells was greater than 20%. they underwent endoscopic submucosal dissection (esd), subtotal gastrectomy, and subtotal gastrectomy after esd. the lesions were located in the lower, upper, and middle third of the stomach. the tumors were small, with a diameter of 1.2, 3.1, and 3.6 cm. two cases had lesions that invaded the submucosal layer, and one case had lesions confined to the mucosa. lymph node metastasis was assessed in two of the three surgically resected cases and the result was negative ; it could not be assessed in one case due to esd. none of the patients died or showed signs of disease recurrence during the follow - up period. samples from all three cases were composed mainly of well differentiated adenocarcinoma with columnar cells mimicking fundic gland cells (fig. although cytologic atypia was minimal, the atypical glands were variable in size and shape with anastomosing and endless glands. the tumor cells had a monomorphous appearance with centrally placed round and mildly atypical small nuclei. the cytoplasm of the tumor cells was pale gray to blue and basophilic, and resembled that of chief cells. at higher magnification, the nuclei were monotonous and slightly larger than those of normal fundic gland cells, and frequently contained small but prominent nucleoli. in two cases, tumor cells with coarse granular eosinophilic and round all three cases revealed only slight desmoplastic reaction. in the background mucosa of the tumor, intestinal metaplasia was observed in two cases and chronic gastritis was observed in one case. all three cases were positive for muc5ac, muc6, pepsinogen - i and negative for muc2 and cd10 (fig. 2). unfortunately, all three cases showed non - specific staining for h / k atpase, which suggested that the staining results for this parietal cell differentiation marker were not reliable. the three cases in this study were of gastric mucin phenotype (muc5ac+/muc6+/muc2-/cd10-) with chief cell differentiation (pepsinogen - i+). cases of more than 6,000 gas resected by endoscopy or surgery on file at the samsung medical center were examined between march 2008 and july 2010. among the files examined, we identified only three cases of ga - fg characterized by well differentiated columnar cells mimicking fundic gland cells, notably chief cells. immunohistochemical staining of mucin (muc) 2, muc5ac, muc6, and cd10 was performed in three ga - fg cases using the bond - max (leica microsystems, wetzlar, germany). paraffinized sections were incubated with the following primary monoclonal antibodies : anti - muc2 (1:200, novocastra, newcastle, uk), anti - muc5ac (1:200, novocastra), anti - muc6 (1:200, novocastra), and anti - cd10 (1:100, novocastra). pepsinogen - i and h / k - atpase were evaluated by immunohistochemistry performed at the department of human pathology, juntendo university school of medicine, tokyo, japan as described by ueyama.12 the expression of muc2, muc5ac, muc6, cd10, pepsinogen - i, and h / k - atpase was evaluated as either positive or negative. staining was defined as positive when the percentage of positive cells was greater than 20%. they underwent endoscopic submucosal dissection (esd), subtotal gastrectomy, and subtotal gastrectomy after esd. the lesions were located in the lower, upper, and middle third of the stomach. the tumors were small, with a diameter of 1.2, 3.1, and 3.6 cm. two cases had lesions that invaded the submucosal layer, and one case had lesions confined to the mucosa. lymph node metastasis was assessed in two of the three surgically resected cases and the result was negative ; it could not be assessed in one case due to esd. none of the patients died or showed signs of disease recurrence during the follow - up period. samples from all three cases were composed mainly of well differentiated adenocarcinoma with columnar cells mimicking fundic gland cells (fig. although cytologic atypia was minimal, the atypical glands were variable in size and shape with anastomosing and endless glands. the tumor cells had a monomorphous appearance with centrally placed round and mildly atypical small nuclei. the cytoplasm of the tumor cells was pale gray to blue and basophilic, and resembled that of chief cells. at higher magnification, the nuclei were monotonous and slightly larger than those of normal fundic gland cells, and frequently contained small but prominent nucleoli. in two cases, tumor cells with coarse granular eosinophilic and round all three cases revealed only slight desmoplastic reaction. in the background mucosa of the tumor, intestinal metaplasia was observed in two cases and chronic gastritis was observed in one case. all three cases were positive for muc5ac, muc6, pepsinogen - i and negative for muc2 and cd10 (fig. 2). unfortunately, all three cases showed non - specific staining for h / k atpase, which suggested that the staining results for this parietal cell differentiation marker were not reliable. the three cases in this study were of gastric mucin phenotype (muc5ac+/muc6+/muc2-/cd10-) with chief cell differentiation (pepsinogen - i+). however, it has distinct clinicopathological characteristics, especially in terms of tumor location, histologic features, phenotypic expression, and low - grade malignancy.12 histologically, ga - fg is well - differentiated adenocarcinoma mainly composed of cells resembling chief cells and is classified into chief cell predominant type, parietal cell predominant type, and mixed type. ueyama.12 first reported 10 cases of ga - fg with chief cell differentiation, some of which revealed only focal positivity of h / k atpase. in the present study, we describe three cases of ga - fg among koreans for the first time, with clinicopathologic features, cell differentiation, and biologic behaviors. in the previous study, ga - fg typically showed expression of pepsinogen - i and h / k atpase.12 there are two immunologically distinct types of pepsinogen. pepsinogen - i is produced only by chief and mucus neck cells in the fundic glands, whereas pepsinogen - ii is produced by the aforementioned cells, the glands in the cardia, and the pyloric glands in the antrum.13,14 pepsinogen - i expression was observed in all three cases, supporting differentiation into chief cells, which are a component of the fundic gland. this enzyme is mainly located near cell surface membranes and in the membranes of intracytoplasmic canaliculi. therefore, h / k atpase is considered a marker for parietal cell differentiation.8 in the present study, tumor cells were negative for h / k atpase. however, since an antibody against h / k atpase has not yet been commercialized, the staining was performed manually with an antibody produced by the ueyama laboratory. because of non - specific staining with this antibody, results from the h / k atpase stain presented here are not reliable. in this study, as tumor cells resembled parietal cells upon hematoxylin and eosin staining, we concluded that parietal cell differentiation also occurred focally. however, as most tumors were composed mainly of chief cells, and there were only a few scattered parietal cells, our cases were classified as ga - fg with chief cell differentiation type, and these findings are consistent with the previously reported 10 cases by ueyama.12 for ga - fg, differential diagnoses include fundic gland polyp, dysplasia in fundic gland polyp, carcinoid tumor, and glandular cystic profunda. although they are composed of fundic gland cells, glandular structures and nuclear features can help to rule out other tumors.15,16 in our cases, additional immunohistochemical staining for chromogranin and synaptophysin was negative and could help confirm the diagnosis. in the present case series, all three tumors were small in size and were discovered in the early stages. neither lymphatic nor venous invasion was identified in any of the three cases. the previously reported 10 ga - fg cases have been said to have a favorable prognosis.12 similarly, all three of the cases in the present study were shown to have early gastric carcinoma and therefore the prognosis for these patients should also be good. however, further investigation on the prognosis of this group of tumors is needed. it is likely that the molecular pathway of ga - fg may be different from that of conventional ga. however, further research will be needed to better understand the molecular mechanisms underlying ga - fg. in conclusion, ga - fg is very rare and has distinct characteristics that separate it from usual ga by their unique histologic findings, mucin phenotypes, and early stage. to our knowledge | recently, fundic gland type gastric adenocarcinoma (ga - fg) has been reported as a new entity. this report describes ga - fg among koreans for the first time. from march 2008 to july 2010 we identified only three cases of ga - fg out of over 6,000 gas resected by endoscopy or surgery. cell differentiation by mucin proteins, pepsinogen - i, and h+/k+-atpase was evaluated. all three cases were male patients and diagnosed as early stage ga. histologically, ga - fgs were well - differentiated adenocarcinoma with pale gray - blue, basophilic columnar or cuboidal cells and mildly enlarged nuclei, resembling chief cells. all three cases were positive for pepsinogen - i and were classified as gastric mucin phenotype. among three histologic subtypes of ga - fg, since tumors were mainly composed of chief cells, our three cases were classified as chief cell predominant type. in conclusion, ga - fg is very rare among koreans and pepsinogen - i and muc6 expression are typical immunohistochemical findings in ga - fg suggesting differentiation toward fundic glands. |
sleep- wake circadian rhythms are regulated by a pacemaker in brain and controlled by some external factors including light, temperature, and social interaction. in addition, pattern of sleep and wakefulness have many variations in different subjects in terms of age, physiologic and psychological characteristics, somatic and psychiatric disorders, and demands of occupation. furthermore these patterns are affected by social requirements of modern life in recent decades. sleep specialists recommend that healthy people generally need about seven hours of sleep per day. but recent surveys in different countries have indicated that the average of sleep duration is very less than this amount. prior studies performed all over the world have showed that different sleep disorders are associated with psychiatric and/or somatic problems as well as social life disorders. sleep deprivation in leads to impaired mood, judgment, ability to learn and maintain information. moreover, it is related to different health problems including cardiovascular disease, obesity, diabetes, metabolic syndrome, and increased mortality. university students are one of the high risk groups for developing sleep disorders, with a high vulnerability especially in medical students. the prevalence of poor sleep quality has been estimated about 20 to 60 percent in medical students. in these studies, sleep quality was associated with sex, years of education, perceived adequate amount of sleep, stress and concern about university tasks, and irregular sleep - work hours. some of them include high daily and nightly workload, inadequate time for leisure activities, living conditions, and high level of stress due to intensive curriculum schedule. these students are more likely to have improper sleep - wake schedule that is harmful in many cases. poor academic performance has been reported in medical students who suffer from sleep disorders. moreover, studies have shown that sleep deprivation increases the risk of medical errors in health care workers. sleep hygiene practices is one of the important variables that affects sleep quality.inappropriate sleep behaviors are harmful for sleep. these behaviors, which were introduced firstly by peter hauri are based on physiology of sleep. some of them include the followings : 1) avoiding caffeine, nicotine, and alcohol near the bed time, 2) avoiding napping as an occasional pattern, 3) maintaining a regular sleep and wake time, 4) keeping bed room comfortable and quiet, and 5) avoiding highly demanding activities in bedroom. also, they are often unaware how poor quality of sleep deteriorates their academic performance and cognitive function. in a survey, knowledge and practice of more than 900 medical students on sleep hygiene practices were assessed. also, students ' knowledge on sleep hygiene was positively related to sleep hygiene practices. according to issues mentioned above, the objective of this study was to assess the association between sleep hygiene practices and sleep quality of medical students in qazvin university of medical sciences, qazvin, iran. this descriptive - correlational study was conducted in qazvin university of medical sciences from march to september, 2012. all medical students were included in the study. none of them had any history of sleep or medical problems. purpose and methods of the study was clearly explained to students and informed consent was obtained from them. the demographic characteristics of students including age, sex, body mass index (bmi), type of accommodation (living in dormitory, renting houses, and parent - owned houses) and marriage status were assessed by self - administered questionnaire. all students were also asked about their routine sleep patterns. information about sleep included total sleep duration, total time in bed, sleep latency, number of awakenings during the night, and naptime during the day. this information was collected on week days and weekends. to assess the prevalence of good sleep hygiene practices in students, we asked 10 questions. some questions were as follow : " during the past month, have you taken a nap during daytime occasionally ? ", " during the past month, have you smoked during two hours before bedtime ? ", and " within the past month, have you eaten heavy night meals near the bedtime ? all the questions about sleep hygiene practices of students are presented. sleep hygiene questionnaire was designed based on expert s opinion in the field of sleep medicine and using previously published articles about sleep hygiene. test - retest reliability was done by calculating intraclass coefficient (icc). for this, fifty questionnaires were completed again by students after 2 weeks. result from test - retest has shown that icc was 0.91 and chronbach 's alpha coefficient was 0.78. persian version of pittsburg sleep quality index (psqi) was used to evaluate subjective sleep quality of participants. psqi assesses participant 's view about her or his quality sleep during one month ago. it constitutes seven subscales including subjective sleep quality, sleep latency, sleep duration, sleep efficiency, sleep disturbances, use of sleep medications, and daytime dysfunction. each part have four score rating from 0 to 3 which indicates : never, once a week, twice a week, and more than three times a week, respectively. the range of total score is between 0 - 21 and scores more than 5 shows poor quality of sleep. reliability and validity of persian form of psqi has been assessed in previous published article and its chronbach 's alpha was 0.83. student t - test was used to determine differences in sleep pattern between weekday - weekend, and between male and female participants. chi - square test was used to assess differences between males and females in frequency of poor sleep hygiene practices. to determine predictive factors (demographic and lifestyle characteristics and sleep hygiene practices) for poor quality of sleep, we used linear regression model. total number of students was 325, in which 285 students (response rate : 87.7) have responded to the questionnaires. of 285 students who responded to questionnaire, 150 were female (52.6). mean age of students was 22.8 1.74 years (ranged from 20 to 27 years). fifty six (19.6%) of students were current smokers, and most of the smokers were male (47 students). more than half (53.7%) of the students were at basic science level, and the others were junior (22.8%) and senior (23.5%). only 32 (10.8%) medical students were married and others were single. a total of 135 (47.3%), 46 (16.1%), and 104 (36.5%) of students were lived in dorms, renting houses, and parent - owned houses, respectively. table 1 shows and compares average time of sleep parameters in weekdays and weekends in males and females. as the table shows sleep parameters were statistically different between the weekdays and weekend in term of sex. table 2 shows the responses of students to 10 questions about sleep hygiene practices. according to the table, male students had poorer sleep hygiene practices than female students in four items (2, 3, 4, and 7). while, sleep hygiene practices of females were worse than males in two items (5 and 6). mean global psqi score and average score of four subscales among males were significantly higher than females. overall, 164 (57.5%) of students (52% of female vs. 63.7% of male) had poor sleep quality (total score of them was more than 5). table 4 shows linear regression model for detecting predictive variables for poor sleep quality. according to the model, males (=-0.85, p<0.05), students at senior level (=-0.81, p<0.05), married students (=-0.45, p<0.05), and students who had six types of improper sleep hygiene practices reported worse sleep. minutes, p - value for differences between weekday and weekend variables in females. the findings of this study showed that the prevalence of poor sleep quality in medical students is generally, more than half of the students participating in the study suffered from poor quality of sleep. also, complaint from this problem was more prevalent in male students than females. these results are consistent with most of the studies have been performed in other countries such as ethiopia, saudi arabia, and america. however, some studies reported a lower prevalence of poor sleep quality in students such as brazil, and palestinian students. the variation between results from different studies may be related to differences in cultural habits, socioeconomic status and university characteristics of different countries. in the other words, in studies that have examined students ' sleep quality during exam periods, the situation was worse. in a study conducted on 162 students at zanjan university of medical sciences in iran during exam period, 86.4% of students had poor quality of sleep. this is also consistent with other studies which have been reported high prevalence of morning fatigue and daytime sleepiness in female than male students. this may be due to the fact that females physiologically need more time for sleep. it should be noted that this study assessed incoming students (newly signed in) and this leads to discrepancies between the results. in some other studies, based on present results, male students had worse sleep hygiene practices than females. it could be a reason for higher prevalence of poor sleep quality in this group. other finding of this study showed that the mean sleeping time of participants in the study was less than recommended sleep amounts. in previous studies, association between short sleep duration with various health problems has been reported. based on the other results, sleep hygiene practices for males was lower than females. smoking close to bedtime, eating heavy dinner, performing dynamic physical activity, and highly demanded activities before bedtime (like watching exciting movies) were higher among males. instead, females were more likely to go to bed thirstily and hungry. furthermore, thinking about daily events and worry thoughts were more prevalent in females. according to the results, improper sleep hygiene behaviors might be a reason for poor quality of sleep in medical students. improper behavior of sleep hygiene and poor sleep quality can ultimately lead to poor academic performance and increased medical errors in medical students. a study conducted in hong kong indicated that students ' awareness of sleep hygiene practices was low. in this study, good knowledge of students about sleep hygiene practices is not sufficient for improving sleep quality as reported by brown. in fact, implementing and practicing these principles would help to improve sleep quality. males, students at senior level, married students, and those with improper sleep hygiene practices had worse sleep. sleep hygiene practices is shown to be associated with a higher prevalence of insomnia in other studies. poor quality of sleep in senior students can be due to their shift work schedules. also, it is assumed that junior students may have developed better coping strategies for their university needs. first the study population were the medical students on qazvin university of medical sciences and do not cover the all of the iranian medical students. secondly, we used self - reported questionnaire for detecting variables, which could have been subject to bias. more subjective instrument like sleep diary, will give more accurate results. to avoid prolonging the questionnaire, authors did not assess some important variables influencing sleep such as stress, anxiety and depression. in conclusion, sleep hygiene is one of fundamental factors affecting sleep quality. current findings recommend conducting further interventional studies for measuring the effects of educational programs on sleep hygiene and academic performance. moreover, assessing changes of academic performance in students after interventional programs will be helpful. we would like to thank all medical students in qazvin university of medical sciences participated in this study. the authors wish to thank the staff of the center for clinical researches at qazvin children hospital, affiliated to qazvin university of medical sciences for their help in preparing this paper. | introduction : poor quality of sleep is a distressing and worrying condition that can disturb academic performance of medical students. sleep hygiene practices are one of the important variables that affect sleep quality. the objective of this study was to assess association between sleep hygiene practices and sleep quality of medical students in qazvin university of medical sciences. methods : in this descriptive - correlational study, a total of 285 medical students completed a self - administered questionnaire. demographic data, sleep - wake schedule in weekday and weekend, and sleep duration were collected. students ' sleep quality was assessed by pittsburg sleep quality index (psqi). data were analyzed by spss ver 13. results : overall, 164 (57.5) of students had poor sleep quality. mean global psqi score and average score of four subscales were significantly higher in male than female. regression analysis showed that male students (=-0.85, p<0.05), students at senior level (=-0.81, p<0.05), married students (=-0.45, p<0.05), and those with improper sleep hygiene practices slept worse. conclusion : the findings of this study showed that the prevalence of poor sleep quality in medical students is high. improper sleep hygiene behaviors might be a reason for poor quality of sleep in medical students. |
stabilization exercises are used to treat postural instability, as well as to consciously and unconsciously assist the maintenance of the spine in neutral position1. the purpose of stabilization exercises is to enhance stability and increase muscle strength, and therefore, recover the ability to adjust for balance and movement2. bridge exercises are one type of spinal stabilization exercise, which help to prevent damage to the local muscles of the spine, joint, and ligaments during activities of daily living, and they are widely used to enhance stabilization of movement3. bridge exercises are the most basic type of exercise performed on a mat, and they provide trunk stabilization, reduce pressure on the buttocks, promote ease of performance of bed mobility, toileting needs, and lower body dressing, improve sit - to - stand ability, and facilitate pelvic movement. they also facilitate proper pelvic movement during gait and during activities of daily living4. sling exercises uses a rope to elicit many effects, and they are considered an important stabilization exercise method for the trunk5. the therapeutic advantage of using a sling is that, when pain is present, it can be used as an early stage exercise and treatment due to its anti - gravity properties6. the use of sling exercises is based on the latest concepts and theories of trunk stabilization exercise, and has been suggested as a new therapeutic exercise6. although it has been reported by previous studies that slings are commonly used in clinical settings, studies that compare muscle activation with the use of slings are lacking3. it has been confirmed that many previous studies have focused on the trunk, and studies comparing the muscle activation of the gluteus maximus and hamstring are lacking. in addition, hip abductor strengthening exercises are commonly performed in the side - lying position in clinical settings7, 8, and recently the widespread use of slings for stabilization purposes has been reported9. therefore, the purpose of this study was to investigate the effects of performing one - legged bridge exercises with a sling and hip abduction on the trunk and lower extremity muscle activities of healthy adults, in order to suggest which positions most efficiently activate the lower extremity muscles. twenty - seven healthy subjects between the ages of 20 and 30 years agreed to participate in this study after being informed of the study purpose and methods. subjects who had experienced back pain, deformity of the limbs, severe surgical or neurological disease, trauma, or pain within the last 6 months were excluded from the study (table 1table 1.general characteristics of the subjectsexperimental groupgender (male / female)27 (14/13)age (years)27.8 5.8height (cm)166.4 10.1weight (kg)66.2 13.4values are expressed as mean sd.). values are expressed as mean sd. all subjects signed a consent form approved by the sahmyook university institutional review board. muscle activation was measured using electromyography while the subjects maintained a general bridge, one - legged bridge, a one - legged bridge with hip abduction, one - legged bridge with use of a sling, and one - legged bridge with hip abduction. after attachment of the electrodes over the erector spinae (es), external oblique (eo), gluteus maximus (gm), and biceps femoris (bf), the emg value of the maximal voluntary isometric contraction (mvic) of the each muscle measured. prior to the measurements, the subjects were fully informed on how to perform the bridge exercises and were allowed to practice the exercises at least 3 times to learn how to perform the bridge methods. each type of bridge exercise was performed three times, and the measurements were made repeatedly in a random order. 1) general bridge exercise the general bridge is performed by starting in a hook - lying position with both knees at 90 degrees of flexion, and the hip in 0 degrees of flexion. then the hip is lifted from the surface3, 8. beginning with the same starting position as the general bridge, the left knee (contralateral) is maintained at 90 degrees of flexion, while the right lower extremity (ipsilateral) is lifted, followed by raising of the hip while maintaining 0 degrees of hip flexion. 3) one - legged bridge with hip abduction beginning with the same starting position as the general bridge, the left knee (contralateral) is maintained at 90 degrees of flexion, while the right lower extremity (ipsilateral) is lifted and abducted to 30 degrees, followed by raising of the hip while maintaining 0 degrees of hip flexion. 4) one - legged bridge with sling beginning in the same starting position as the general bridge, the left knee (contralateral) is maintained at 90 degrees of flexion, and the heel of the right lower extremity is placed in a sling. then, the hip was raised while maintaining 0 degrees of hip flexion. 5) one - legged bridge with hip abduction and sling subjects lifted the hip while maintaining 0 degrees of hip flexion and stayed aligned with the trunk position for 5 seconds. the bridge conditions were randomly performed by the subjects, and a one - minute rest period was provided between each bridge condition. to investigate the muscle activation patterns during the bridge conditions, a telemyo 2400 g2 telemetry emg system (noraxon, usa, 2011) was used. a sampling rate of 100 hz and band - pass filter of 10450 hz were used. the electrode placement sites for the erector spinae was the iliac crest and 2 cm inside the triangle that connects the lower ribs, 15 cm above the umbilicus for the external oblique, between the sacrum and greater trochanter for the gluteus maximus, and on the thigh between the knee and buttocks for the biceps femoris9. myoresearch xp master edition software (noraxon inc., arizona, usa, 2011) was used to process emg measurements. after the emg measurements had undergone full - wave rectification, the rms (root mean square) values were divided by the mvic, to convert the values to percentages of mvic. although the bridge condition was measured for 5 seconds once the hip was fully lifted off the mat4, 8, only the middle three seconds of data were used in the analysis ; the measurements of the first and last second were excluded. the pasw version 18.0 (spss inc., the general characteristics of subjects were analyzed using descriptive statistics, and one - way repeated measures anova was used to investigate the effects of the different bridge conditions on the trunk and leg muscle activation. to investigate the differences in muscle activation between the trunk and lower extremity among the different bridge conditions, the least significant difference (lsd) test was used. there was a significant increase in bilateral eo and contralateral gm with the one - legged bridge compared with the one - legged bridge with sling exercise (p<0.05). the muscle activation of the ipsilateral es was significantly greater during the one - legged bridge with hip abduction and sling compared with the one - legged abduction bridge exercise (p<0.05). muscle activation of the ipsilateral gm and bf was significantly less during the one - legged bridge exercise compared to the one - legged bridge with sling exercise, and it was significantly greater during the one - legged bridge with hip abduction compared with the one - legged bridge exercise (p<0.05). the muscle activation of the contralateral gm and bf was significantly greater with the one - legged bridge with hip abduction compared with the general bridge exercise (p<0.05) (table 2table 2.comparison of the trunk and lower extremity activities during the bridge exercises (unit : % mvic)erector spinaeexternal obliquegluteus maximusbiceps femorisipsilateralcontralateralipsilateralcontralateralipsilateralcontralateralipsilateralcontralateralgbr41.5 16.439.8 18.66.7 5.96.7 4.413.7 7.915.4 9.514.1 9.614.3 9.1obr47.3 16.037.6 14.712.6 7.312.8 7.15.2 3.628.8 14.74.1 3.127.7 14.7oabr46.7 12.035.6 13.115.7 9.317.5 9.25.8 3.830.1 14.54.4 2.826.2 11.9sobr44.6 13.841.3 17.37.7 5.27.7 4.58.5 7.619.1 12.919.2 11.317.8 9.8soabr50.3 15.040.2 14.010.6 8.810.0 9.713.0 12.125.6 14.85.0 5.218.9 8.3gbr : general bridging exercise ; obr : one leg bridging exercise ; oabr : one leg bridging exercise with hip abduction ; sobr : one leg bridging with sling ; soabr : one leg bridging with sling and hip abduction. mean sd. statistically significant difference from gbr (p<0.05) statistically significant difference from obr (p<0.05) statistically significant difference from oabr (p<0.05) statistically significant difference from sobr (p<0.05)). gbr : general bridging exercise ; obr : one leg bridging exercise ; oabr : one leg bridging exercise with hip abduction ; sobr : one leg bridging with sling ; soabr : one leg bridging with sling and hip abduction. statistically significant difference from gbr (p<0.05) statistically significant difference from obr (p<0.05) statistically significant difference from oabr (p<0.05) statistically significant difference from sobr (p<0.05) in order to investigate the effects of performing the one - legged bridge with sling, and the one - legged bridge with hip abduction condition on the trunk and lower extremity, surface emg was used to compare the muscle activation of the es, eo, gm, and bf in healthy adults. with one lower extremity raised, a significant increase in muscle activation was observed in the es and eo, as well as the gm and bf. it has been reported that raising one lower extremity reduces the base of support, and therefore, there is an increase in trunk muscle activation to compensate for the instability10. when the ipsilateral lower extremity is raised from the ground, an equivalent amount of force used to maintain the lower extremity off the ground is applied to the contralateral side, which leads to an increase in muscle activation on the contralateral side11. due to the instability that occurs while performing a one - legged bridge exercise, this study confirmed that there was a significant increase in muscle activation during the one - legged bridge with sling and the one - legged bridge with hip abduction conditions compared with the general bridge condition. bogla12 compared three closed chain exercises with three open chain exercises, and reported there was a greater amount of muscle activation during closed chain exercises performed in a side - lying hip abduction position (p<0.05). thus, the length of the lever arm is important in optimizing the muscle activation. if the length of the lever arm increases, the mechanical and power demands on of the related muscles increase. in this study, it is considered that the increase in muscle activation that occurred during the bridge with hip abduction condition compared to the general bridge condition was due to an increase in the lever arm. in this study, an increase in es and eo muscle activation was observed during the one - legged bridge with sling and one - legged bridge with hip abduction condition compared to the general bridge condition, and an increase in the contralateral gm and bf muscle activation compared to the ipsilateral side. guthie.13 studied subjects in their twenties and with low back pain. they observed an increase in rectus abdominis muscle activation when the subjects performed a bridge with a sling compared to a conventional bridge (p<0.05). also, the intensity of the sling exercises can be varied by the location of the suspension points, length of the sling, use of additional weights, the intensity level chosen by the therapist, and the use of a theraband in open or closed - chain exercises14. a significant decrease in muscle activation was observed with the one - legged bridge with sling condition compared with the one - legged bridge condition, due to the emergence of the co - contraction of the gm and hamstrings, as well as hip extension13, 15. as a result, the use of a sling with bridge exercises may serve as a more efficient exercise for the activation of the trunk and lower limb muscles. this study, provided evidence that performing bridge exercises with a sling and hip abduction has an effect on the trunk and lower extremity muscle activation in healthy subjects. it is presumed that these exercises may be a clinically effective method for providing treatment for one side or for treating patients with hemiplegia. however, due to the use of healthy subjects and the small sample size, the results of this study can not be generalized. also, only four muscles were analyzed, and the possibility of a learning effect can not be excluded, since each subject had performed each of the five bridge conditions. therefore, further studies should consider these limitations and focus on patients who may need training on one side, or those with hemiplegia, and studies that assess the changes in muscle strength, cross - sectional area, and evaluate fatigue are also warranted. | [purpose ] this study investigated the changes in the muscle activities of the trunk and lower limbs of healthy adults during a one - legged bridge exercise using a sling, and with the addition of hip abduction. [subjects and methods ] twenty - seven healthy individuals participated in this study (14 males and 13 females). the participants were instructed to perform the bridge exercises under five different conditions. trunk and lower limb muscle activation of the erector spinae (es), external oblique (eo), gluteus maximus (gm), and biceps femoris (bf) was measured using surface electromyography. data analysis was performed using the mean scores of three trials performed under each condition. [results ] there was a significant increase in bilateral eo and contralateral gm with the one - legged bridge compared with the one - legged bridge with sling exercise. muscle activation of the ipsilateral gm and bf was significantly less during the one - legged bridge exercise compared to the one - legged bridge with sling exercise, and was significantly greater during the one - legged bridge with hip abduction compared to the one - legged bridge exercise. the muscle activation of the contralateral gm and bf was significantly greater with the one - legged bridge with hip abduction compared to the general bridge exercise. [conclusion ] with the one - legged bridge with hip abduction, the ipsilateral eo, gm and bf muscle activities were significantly greater than those of the one - legged bridge exercise. the muscle activation of all trunk and contralateral lower extremity muscles increased with the bridge with sling exercises compared with general bridge exercises. |
commensal microbiota functions not only to serve as targets of host immunity but also as active players in regulation of host physiology and immunity as a result of long - term coevolution of the host and microbes. t cells play central roles in the regulation of anti - microbial immunity and tissue inflammation. most major t cell types are made in the thymus, although extrathymic generation of some t cell subsets has been described (1,2). t cells are highly heterogeneous and grouped into cd4 conventional t cells, cd8 conventional t cells, nkt cells, and other innate tcr-expressing t cells such as mucosal - associated invariant t (mait) cells (3,4,5,6). cd4 conventional t cells are further divided into foxp3 regulatory and foxp3 t cells (7,8). foxp3cd4 t cells include various effector and regulatory t cells based on their cytokine phenotype (ifn, il-17, il-22, il-4, il-9, il-10, il-35, and/or lap - tgf1) (6,9). these t helper cells include ifn th1 cells, il-17/il-22 th17 cells, il-4 th2 cells, il-9 th9 cells, il-21 t - fh cells, and il-10/il-35/tgf1 tregs (9,10,11,12). all of these t helper cell subsets are generated mainly in the periphery from nave t cells made in the thymus. tcr repertoire and antigen specificity / affinity greatly influence t cell differentiation in the thymus and periphery (13,14). co - stimulation signals such as cd28, icos, ctla4, ox-40, and pd-1 signaling reciprocally regulate t cell differentiation and effector function (15,16,17). cytokine milieu during t cell activation is crucial to generate specialized effector versus regulatory t cell subsets (6,9). a mounting body of evidence indicates that nutrients and metabolites provide significant regulatory signals for t cell differentiation (18,19,20,21,22,23). potentially important roles of gut microbial products such as short - chain fatty acids (scfas) have been recently documented (24,25,26). in this review, we will review the recent progress in our understanding of the roles of scfas in regulating cd4 t helper cell differentiation and the impact of this process on tissue inflammation. scfas refer to free fatty acids containing fewer than 6 carbons and therefore they have short aliphatic carbon - chains. formic acid (c1), acetic acid (c2), propionic acid (c3), butyric acid (c4), and valeric acid (c5) belong to the scfa group. these metabolites are distinguished from longer fatty acids such as medium - chain (6 - 12 carbons) and long - chain free fatty acids. because they have relatively shorter hydrophobic chains as well as the hydrophilic carboxyl group, scfas are water soluble and readily absorbed or transported into cells. scfas are produced by gut microbiota as fermentation products, meaning that they are partially oxidized from sugar molecules under anaerobic conditions in the colon. carbohydrates are good sources of scfas but scfas can be made from other nutrients such as proteins and peptides albeit at low levels (27). these scfa precursors, however, are easily degraded by host digestive enzymes in the upper alimentary tract and do n't reach the microbiota in the colon in significant amounts for scfa production. in contrast, digestion - resistant oligosaccharides and fibers (e.g. oligofructose, inulin, pectin, and arabinoxylan) are good sources of scfas. insoluble fibers including cellulose and chitin, however, are not readily fermented by the microbiota and thus do not produce scfas at significant levels. while it is yet to be determined clearly through extensive bacterial isolation and metagenomics studies, available information indicates that bacteria species greatly differ in their genetic make - up of enzymes involved in scfa production (28,29). among scfas, c2 is relatively more readily produced than c3 and c4 by most enteric and acetogenic bacteria (30). propionate can be produced by three pathways (i.e. succinate, acrylate, and propanediol) from various sugar molecules such as pentoses, hexoses, and rhamnose (31). production of c4 requires additional enzymatic processes that extend acetyl - coa with butyryl - coa : acetate coa - transferase, which is active in some bacteria including roseburia, eubacterium and anaerostipes species and faecalibacterium prausnitzii (27,32). the combined concentrations of scfas produced in the colon reach ~150 mm, making scfas the most abundant anions in the colon. scfas are absorbed in the colon and either utilized in colonocytes or transported via the portal vein to reach the blood circulation and other organs. scfas enter cells through passive diffusion and carrier - mediated transportation through smct1/slc5a8 and mct1/slc16a1 (33,34,35). smct1 is a sodium - coupled monocarboxylate transporter 1 for cell intake of scfas and related organic acids such as lactate and pyruvate (34). mct1 is an h - coupled transporter for scfas and related organic acids and it transports these molecules depending on the net chemical gradients for h and monocarboxylates across the membrane (36). expression of these transporters in the apical membrane of colonocytes, dcs, kidney cells, and/or brain cells has been documented (table i). gpr41 and gpr43 are major receptors that can be activated by most scfas (37). gpr41 is also expressed in adipocytes, renal smooth muscle cells, enteric neuronal cells, and pancreatic cells (table i) (42,43). the expression of gpr41 is co - regulated with gpr40, a receptor for medium and long - chain fatty acids, because their gene transcription is regulated by the same promoter (44). gpr109a, a receptor for niacin (also called nicotinic acid and vitamin b3), is a receptor also for c4 (48). gpr109a is expressed by gut epithelial cells, adipocytes, macrophages and dendritic cells (table i). olfr78 is expressed in the kidney juxtaglomerular apparatus and is activated by c2 and c3 (49). however, t cells do not express these receptors at functionally significant levels (unpublished results) (24). scfas, also called volatile fatty acids because of their relatively more volatile nature compared to longer fatty acids, have been studied for more than a century (50,51). scfas are physiologically important in the intestine as they regulate ion absorption and gut motility. because scfas are absorbed first into colonic epithelial cells and can be metabolized in these cells, they profoundly affect the basic biology of intestinal epithelial cells. scfas, particularly c4, are used as the major energy source for colonic epithelial cells and regulate their gene expression, proliferation, differentiation, and apoptosis (52). for example, scfas promote the production of mucin and gastrointestinal peptide (e.g. ll-37) (53), molecules important for gut barrier function. scfas condition intestinal epithelial cells to make them more readily respond to bacterial products (40). this function is important to prepare epithelial cells for mounting optimal innate immune responses to invading pathogens and commensal bacteria, and therefore helps prevent chronic intestinal inflammatory responses to microbes and their products. in this regard, scfas have anti - inflammatory activity in regulating intestinal inflammation (54). intestinal epithelial cells express gpr41, gpr43, and gpr109a, which mediate a significant portion of the scfa function (48,55,56,57). these gpcrs activate signaling processes such as ras, protein kinase a, pi3k, and erk1/2 for activation of transcription factors such as atf2 (40,47,48,58,59). activation of this pathway is important for expression of key immune and inflammatory mediators such as il-1, il-6, tnf-, cxcl1, and cxcl2. another function of scfas is to activate gpr41 and gpr43 on secretory epithelial cells to produce glucagon - like peptide (glp)-1 (60). enteric neurons express gpr41 to sense scfas for regulation of gut motility (39). to support this, there is a high correlation in expression sites between scfa receptors and gut endocrine hormones such as glp-1, pyy, and neurotensin. another major mechanism for the scfa regulation of epithelial cells is mediated through inhibition of hdacs by scfas (61,62). scfas induce the chemotaxis of neutrophils via activation of gpr43 (58,59) and regulate neutrophil degranulation (63,64). scfas suppresses nf - kb and the production of inflammatory cytokines such as il-6 and tnf- but increases il-10 secretion from macrophages (67). in contrast, increased c2 levels in alcoholism can increase the expression of inflammatory cytokines in macrophages and even exacerbate the inflammatory response in the liver (68). thus, the scfa function in regulation of immune responses may be altered in pathological conditions. olfr78 activation promotes renin production from the kidney to regulate blood pressure (49). early work on c4 revealed its regulatory effect on cytokine production by lymphocytes (73,74). c4 had regulatory effects on production of cytokines such as il-2, il-4, il-5, il-6, and il-10 (75). others observed that c4 induced fas - upregulation and apoptosis in t cells (76). reported that mice fed with scfas had increased numbers of il-10-producing foxp3 t cells in the colon (25). the effect was specific for colonic foxp3 t cells, and foxp3 t cells in other organs were not expanded after scfa administration. a mechanism provided by this group for the expanded colonic foxp3 t cells scfas can enter cells through diffusion or carrier - mediated transport and thus do not necessarily go through cell surface receptors. moreover, t cells do not express gpr43 at significant levels and thus this mechanism remains to be verified. another group reported that c2 and c3 can directly suppress hdacs and increase histone acetylation at the foxp3 gene locus for increased transcription (20). similarly, it was reported that treg generation was increased by scfas as a result of hdac inhibition by scfas and histone h3 acetylation in key regulatory regions of the foxp3 locus (77). in relation to these reports, inoculation of germ - free mice with scfa - producing clostridia groups induced il-10 and icos - expressing foxp3 t cells (78). our group found that scfas can increase il-10, but not necessarily foxp3, expression in t cells (24). interestingly, scfa either positively or negatively regulate induced foxp3 cells depending on the strength of t cell activation in vitro. in high t cell activation conditions, scfas can even suppress foxp3 cell induction promoted by tgf1 and t cell activation. independent of foxp3 regulation, scfas increased il-10 production in all t cell activation conditions (24). we observed that the foxp3 t cells even in the colon were not reproducibly regulated by scfa administration in vivo (unpublished results). these results imply that foxp3 induction by scfas may be regulated by indirect mechanisms through non - t cells. a rather surprising finding was that scfas facilitated nave t cell differentiation into th1 and th17 cells in appropriate t cell polarization conditions. thus, scfas can enhance both effector and regulatory t cells depending on the immunological milieu. in support of this, c2 administration via drinking water increased th1 and th17 cells in the intestine and secondary lymphoid tissues during c. rodentium infection (40). in the absence of infection, scfas increased gut il-10 t cells in vivo, which would promote immune tolerance. it appears that scfas selectively promote only the right types of t cells required to handle specific immunological conditions (fig. 1). the first mechanism involves the activation of scfa - binding g - protein - coupled receptors (gpcrs) such as gpr41, gpr43, gpr109a, and olfr78. however, t cells do not express any of these receptors at significant levels, according to published information and unpublished microarray data. thus, scfa receptors are not likely to be important for direct regulation of t cells by scfas. another pathway is to regulate cell energy status and relevant signaling processes through integration of scfas into cellular metabolism. scfas can be converted to acetyl - coa and integrated into the citric acid cycle (krebs cycle). acetyl - coa is a central molecule that stores energy in the molecule, which is eventually oxidized to co2 for energy production. as the result, the cellular energy [atp / adp ] level increases, and this change boosts mtor activation (79). in t cells, activation of mtor skews t cell differentiation into effector t cells such as th1 and th17 cells at the expense of foxp3 t cells (80). thus, the scfa - regulation of cell metabolism and mtor accounts for the increased generation of th1, th17 cells, and il-10 cells. all major scfas such as c2, c3, c4 and c5 have hdac inhibitor activity (24,82,83). some regarded that c2 does not have the hdac inhibitor activity but it has clear hdac inhibitor activity at concentrations (~10 mm) higher than c3 and c4 (~1 mm) (24). moreover, c2 is maintained at relatively high concentrations in blood (~1 mm). this hdac inhibitor activity requires the transport of scfas into cells and enzymatic inhibition of hdacs. while scfas do not suppress class iii hdac such as sirt1, down - regulation of sirt1 expression by scfas was reported (84). thus, scfas may affect a broad range of hdacs for their regulatory effects. because hdac inhibition increases the acetylation of histone and other proteins, the impact of this activity is far reaching and affecting a number of genes and proteins. physical interaction between hdacs and s6k has been reported (85), and s6k is a downstream effector molecule of the mtor pathway. p70-s6 kinase 1 (s6k) is hyper - acetylated by scfas in t cells, leading to increased mtor activity in t cells (24). scfas can indirectly affect t cells through their effects on other cells that control t cell differentiation such as dcs (fig. scfas suppress the development of bone marrow progenitors into myeloid dcs in vitro (86). it has been observed that scfas also inhibit functional maturation of dcs in vitro (66,86,87,88,89,90). for example, c4 suppressed the maturation of bone marrow - derived dcs and production of il-12 but increased the expression of il-23p19 (89). valproic acid, a branched short - chain fatty acid and potent hdac inhibitor, suppressed the maturation of human dcs in vitro, inhibiting the up - regulation of t - cell activating molecules such as mhc ii, cd80, cd86 and il-12 (90). while the functional importance is yet to be determined, a report indicates that c4 increased cd1d at the expense of cd1a expression on developing human dcs (88). gpr109a activation affects colonic macrophages and dcs for generation of tregs and il-10-producing t cells (91). this effect, however, is not solely due to c4, because gpr109a is a receptor for niacin as well. in this regard, niacin treatment suppressed colitis and colon cancer in a gpr109a - dependent manner. moreover, gpr109a colonic epithelial cells were defective in producing il-18 in response to c4. more studies are required to separate the niacin from scfa effect in regulation of gpr109a. overall, the published results indicate that the regulatory effects of scfas have the potential to steer dc development into tolerogenic dcs for promotion of immune tolerance. a caveat is that it remains to be fully determined if scfas would exert the same inhibitory effect on dcs in vivo. therefore, scfas have been studied for decades for their effects on inflammatory bowel diseases (ibd). despite some conflicting reports, high scfa - producing conditions formed with high levels of dietary fibers are linked to decreased tissue inflammation in the intestine (92,93,94). oral administration of c4 ameliorated t cell - induced colitis in lymphopenic mice (26). c4 administration attenuated inflammation and mucosal lesions in dextran sodium sulfate (dss)-induced colitis, an experimental model frequently used for ulcerative colitis (95). however, there is a conflicting report that c4 administration via drinking water worsened the colitis induced by dss (89). scfas also failed to regulate the acute colitis induced with 2,4,6-trinitrobenzenesulfonic acid (tnbs) (96). these conflicting results may have been obtained due to differences in methods to induce inflammation and regimens to treat the heterogeneous inflammation. to make the function of scfas even more complicated, both increased and decreased dss - induced inflammation in gpr43-deficient mice gpr43-deficient mice had exacerbated inflammation in animal models of colitis, arthritis and asthma (97). gpr43 may modulate gut inflammation, in part, through cytokine production by mononuclear cells (98). gpr43 and gpr41, expressed by tissue cells such as epithelial cells, are also important to prevent chronic inflammation in the intestine following c. rodentium infection (40). thus, the available information suggests that scfa receptors play an overall beneficial role in prevention of inflammation (fig. 2). more work is required to identify the cell types and mechanisms that mediate the beneficial effect of scfas in a scfa receptor - dependent manner. in humans, c4 enemas had a small ameliorating effect on human colitis patients (99). treatment of patients with distal ulcerative colitis with c4 (100 mm) was effective in ameliorating disease activity (100). moreover, treatment of patients with mild to moderate distal ulcerative colitis with combined scfa enemas (100 ml, twice daily enemas of sodium acetate 80 mm, sodium propionate 30 mm, and sodium butyrate 40 mm) were effective in ameliorating colitis (101). a similar therapeutic effect was observed in ~50% of ulcerative colitis patients who were refractory to a rectal and oral therapy with 5-aminosalicylic acid and corticosteroid (101). scfas improved the efficacy of other treatments such as oral mesalazine therapy (102). there is a report that patients with mild to moderate ileocolonic crohn 's disease who were treated with 4 g / day c4 tablets for 8 weeks had decreased clinical activity (103). a caveat is that several large randomized studies found no significant effects of scfa therapies on ulcerative colitis patients (104,105). these mixed results indicate that scfas and their receptors may regulate inflammatory responses only in certain pathological conditions, ameliorating certain types of inflammatory responses while exacerbating other types of responses. beyond inflammatory bowel diseases, high fiber diets and scfas have suppressive effects on respiratory allergic diseases (106). overall, scfas have the potential to work through multiple cell types, including t cells, to exert their regulatory effects on tissue inflammation (fig. the gut microbial metabolites scfas profoundly regulate t cell differentiation in the body. because these metabolites are produced at high levels in the gut, the t cells in the intestine and gut - associated lymphoid tissues are an important cell target for regulation by scfas. scfas can be transported into the blood and have the potential to regulate t cell activity in systemic tissue sites as well. beyond t cells, scfas regulate the function and phenotype of a number of immunologically important cell types such as epithelial cells, neutrophils, and antigen presenting cells. while the anti - inflammatory activity of scfas has been emphasized, scfas can also promote the generation of effector t cells and enhance gut barrier function and innate immunity. all of these effects of scfas are important to maintain a healthy immune system and to prevent inflammatory diseases. more studies are required to sort out the detailed mechanism of scfa - mediated regulation of t cells and other immune cells. the current body of literature indicates that scfas are not a panacea for inflammatory diseases and may exacerbate certain types of tissue inflammation. therefore, it is important to identify the types of cells, immune responses, tissue inflammation, and diseases that are highly responsive to scfa - based therapies. | t cells are central players in the regulation of adaptive immunity and immune tolerance. in the periphery, t cell differentiation for maturation and effector function is regulated by a number of factors. various factors such as antigens, co - stimulation signals, and cytokines regulate t cell differentiation into functionally specialized effector and regulatory t cells. other factors such as nutrients, micronutrients, nuclear hormones and microbial products provide important environmental cues for t cell differentiation. a mounting body of evidence indicates that the microbial metabolites short - chain fatty acids (scfas) have profound effects on t cells and directly and indirectly regulate their differentiation. we review the current status of our understanding of scfa functions in regulation of peripheral t cell activity and discuss their impact on tissue inflammation. |
growths on the penis invariably cause alarm both on the part of the part of the patient as well as the treating physician and need to be biopsied and treated accordingly. certain rare tumors initially show benign histology or later show either a low - grade or delayed malignant growth potential. those are penile horn, giant condyloma (buschke - lowenstein tumor) and an extremely rare penile growth pseudoepitheliomatous, keratotic, and micaceous balanitis (pekmb). we report here a patient with pekmb who, having declined definitive surgery was managed with topical therapy and lifelong follow - up. a 35-year - old unmarried man presented with a thick scaly plaque on the glans penis present for the past one and half years [figure 1 ]. the lesion initially was small and progressed very slowly and to attain the current size. the thick scaly plaque on the glans penis examination revealed a thick scaly plaque on the glans penis measuring about 1.5 cm by 1.5 cm. examination of the rest of the body, mucous membranes, hair and nails revealed no abnormality. results of blood examination including blood sugar, hepatitis b surface antigen, venereal disease research laboratory (vdrl) test and human immunodeficiency virus were normal. incisional biopsy was done and sent for histopathological examination. the slide [figure 2 ] revealed pseudoepitheliomatous hyperplasia, acanthosis, and elongation of rete ridges. there was a nonspecific dermal inflammatory cell infiltrate consisting mainly of lymphocytes with few eosinophils. a non - specific dermal inflammatory cell infiltrate consisting mainly of lymphocytes with few eosinophils is seen. there is no cytological atypia or koilocytes based on the clinical features and histology, the diagnosis of pekmb of civatte was made. the patient declined definitive surgery and was started on topical 5-fluorouracil cream on a daily basis and advised life - long follow - up. ulcerations, cracking, and fissuring on the surface of the glans are frequently present. the keratotic scale is usually micaceous and resembles psoriasis or may be nail like which could be easily peeled off. most patients are over the age of 50 and frequently have been circumcised for phimosis in adult life. the differential diagnosis includes squamous cell carcinoma (scc), verrucous carcinoma, keratoacanthoma, giant condyloma, penile horn, and erythroplasia of queyrat. the pathogenesis of pekmb occurs in four stages : (a) initial plaque stage, (b) late tumor stage, (c) verrucous carcinoma, and (d) transformation to scc and invasion. topical 5-fu has been effective, but the hyperkeratotic scale may make penetration suboptimal. if topical chemotherapy is utilized, post - treatment biopsies are recommended. out of the 15 cases described in the english literature, 6 progressed to verrucous carcinoma, 4 cases developed scc, out of which 2 had progressed from verrucous carcinoma to invasive scc. our patient had presented at a relatively young age, and as in other reports, had a previously existing phimosis problem. he was asymptomatic but was anxious about the cosmetic disfigurement and potential for developing cancer., that chronic irritation and inflammation of long standing phimosis predisposes to the condition. however, larger studies are required to corroborate this observation. to the best of our knowledge, only 15 cases have been described in the literature until date throughout the world, with very few reports from the indian subcontinent. this case is being reported not only for its rarity, but also for emphasizing the need for early diagnosis and long - term follow - up. | pseudoepitheliomatous, keratotic, and micaceous balanitis is a rare condition characterized by verrucous excrescences with scaling. most patients are over the age of 50 and frequently have been circumcised for phimosis in adult life. we present here a case of 35-year - old male patient with long standing phimosis presenting with a firm whitish plaque on the glans penis. the crusts were micaceous in nature. histopathologically, there was pseudoepitheliomatous hyperplasia with acanthosis and no cellular atypia. the condition was explained to the patient and treatment options discussed. the patient was started on topical 5-fluorouracil cream on a daily basis as he did not express consent for operative intervention. |
enrollment of individuals in organizations such as health maintenance organizations (hmos) that supply medical care for a fixed periodic premium or a capitated rate continues to grow ; by 1991 enrollment in such organizations was about 13 percent of the population (national center for health statistics, 1992). moreover, the percentage of children enrolled is probably even higher because disproportionately few medicare enrollees are enrolled in hmos (2.8 percent), and because hmos have typically covered maternity and well - child care with less cost sharing than insurance plans in the fee - for - service (ffs) system (mcmillan, lubitz, and russell, 1987). with growing hmo enrollment, more attention is being paid to the method for setting the rate at which the government and the private sector pay hmos. in public - sector programs, most researchers have focused on medicare 's formula, the adjusted average per capita cost (aapcc), and have consequently analyzed the behavior of those 65 years of age or over, or at least the behavior of adults (anderson., 1986 ; anderson and knickman, 1984a, 1984b ; ash., 1989 ; beebe, lubitz, and eggers, 1985 ; gruenberg, wallack, and tompkins, 1986 ; howland., 1987 ; lubitz, beebe, and riley, 1985 ; mccall and wai, 1983 ; mcclure, 1984 ; newhouse, 1986 ; newhouse., 1989 ; thomas and lichtenstein, 1986a and 1986b ; thomas., 1983). however, 44 percent of the recipients in the other major public program, medicaid, were less than 18 years of age in 1989, a figure that is likely to grow in light of the planned eligibility expansion for poor children (reilly, clauser, and baugh, 1990). moreover, many states are attempting to expand their use of capitated systems for the medicaid population. if each capitated group enrolled a representative mix of health risks among the medicaid population, the rate could simply be a fraction, or perhaps as much as 100 percent, of per capita ffs costs. however, it is unreasonable to expect that each group will do so. on the one hand, chronically ill patients who are under the care of an ffs physician will have incentives to continue with their physicians rather than to join an hmo ; on the other hand, hmos have incentives to avoid costly patients if they only receive payment that is based on the cost of the average patients. even if health risks were distributed randomly, chance alone would cause some hmos to have a mix of enrollees whose health characteristics differed from the population average. if all hmos received the same payment per patient, there would be windfall profits and losses. such profits and losses would, however, be more important for small hmos because of the law of large numbers. the natural approach to the issue of heterogeneous enrollees is to vary the amount paid an hmo according to an enrollee 's expected use of medical services, i.e., to adjust the average rate. indeed, medicare makes such adjustments, thus the term adjusted average per capita cost (aapcc). specifically, it adjusts for age, gender, welfare status, institutional status, county of residence, and basis for medicare eligibility (old age, disability, or end stage renal disease). it is estimated that they may account for only 5 to 10 percent of the variation in expected cost and much less of actual cost across individuals (lubitz, beebe, and riley, 1985 ; newhouse, 1986 ; newhouse., 1989). in our 1989 article, we examined how much additional adjusters, specifically measures of health and of use in the prior year, would improve the performance of an aapcc - type formula for adults under 65 years of age. using similar methods, we present herein results for children, although our results are limited to outpatient expenditures for children 5 - 13 years of age because our data set has few children that were hospitalized. outpatient expenditures, however, account for 55 percent of total expenditures by children, compared with 38 percent for adults (manning., 1987), and we see little reason to believe that the relative performance of various adjusters would change much if we had sufficient inpatient data to analyze (though the absolute amounts of explained variance may decrease). we begin by estimating how much of the actual variation in expenditure one could potentially explain, and how much instead is because of random or unforeseeable events. because adjusters can not predict variation due to future random events, we wish to ignore the influence of such events as we assess the performance of adjusters, and want only to explain variation in expected, not actual, expenditure. put another way, we estimate what the r would be if we regressed actual expenditures on a set of almost ideal adjusters. as the explanatory power of a set of adjusters approaches the maximum explainable variance, the incentives for risk selection fall to negligible levels. we begin with the analog for children of the demographic types of variables currently used in the aapcc formula. we then estimate the gain from also using several measures of health status and prior use to adjust the capitation rate. we analyze outpatient expenditures per child ; that is, we analyze individual, not family, expenditure. one might argue that because families typically enroll as a group, we should have analyzed family behavior. the explanatory variables whose importance we assess, however, are at the individual level. their relative importance would not have changed had we chosen to analyze data at the family level, but we would have had to impose additional assumptions to aggregate individual - level explanatory variables to the family level. indeed, the appropriate assumptions are not at all obvious. however, because family - member expenditures are not independent, any incentive to skim or dump will be increased if families enroll as a unit. expenditure can not be fully or even largely predicted, so any set of risk adjusters will not explain all variance. fortunately this does not cause a problem, as long as the hmo (indeed, simply paying at the average for all is appropriate if all expenditures are unpredictable.) problems potentially arise, however, if the hmo can determine that one person 's expected expenditure (before the fact) exceeds another 's. there is a financial incentive to enroll the low - cost person (skimming) if there is no adjustment in payment. thus, one criterion for judging a set of adjusters is how well they explain expected expenditure or predictable variance. if all predictable variance is accounted for, there should be no skimming. to judge against this criterion, therefore, we need to know the variance in expected expenditure, which will be less than the actual or observed variance by the variance in unpredictable expenditure. if children 's medical expenditures correspond to the following simple model, it would be straightforward to determine the variance in expected expenditure, which is the amount of variance one could possibly explain in a regression of annual expenditure, using cross - sectional data : xit is a vector of risk adjusters, is a vector of weights, i indexes the child, t indexes year, i is an unobserved child - specific, time - invariant (stable) component of variance, and it is a child - specific, time varying component of variance. if the last term it is random and can not be predicted by the hmo or by the family, the maximum variance that could be explained is that accounted for by the first two terms, and we shall make this assumption. in fact, this is a lower boundary on the maximum explainable variance because some elements of it might also be predictable. that is, there may be some time - varying variables, omitted from the x vector, that explain a non - trivial amount of variance. an example of a variable usually contained in it rather than in xit is an illness that has a partially predictable time pattern, such as leukemia. nonetheless, it seems plausible to assume that most of the variation in it is random. to the extent this is true, to the degree that it is predictable, however, our estimates understate the amount of variation one can explain. we have thus estimated the maximum explainable variance by estimating the proportion of variance in the i term of the right - hand side of equation 1, assuming no adjusters (i.e., no x 's) ; this is analogous to the r from using a dummy variable for each person or to the proportion of variance that is between - person variance. to estimate the between - person variance, we subtracted an estimate of within - person variance from total variance, correcting for the bias from estimating within - person variance from a finite time series (searle, 1971). an alternative method for computing the maximum r is to specify an x vector and estimate the amount of stable variation in the residuals. in principle, this method should lead to a higher maximum r because the method described in the previous paragraph omits any variation for the x term from covariates that change over time. for adults, however, we found that the estimated maximum r by the alternative method was less than the estimate using the method described in the previous paragraph (newhouse. we have used r as a criterion variable, but some question the appropriateness of doing so. they argue that r shows the goodness of prediction at the individual level, but that the formula only needs to predict well for groups (lubitz, 1987). in other words, as long as the hmo receives adequate payment for its entire group of enrollees, the formula does not need to predict well at the individual level. this argument, however, ignores the behavioral incentives of the hmo, which can make more money by discouraging enrollment (or encouraging disenrollment) of any individual or family whose expected cost exceeds revenue. to blunt this incentive requires a premium that matches the expected cost of the hmo for each patient or family that it enrolls. a different criticism is that r may be on average high, but still perform badly for certain subgroups. that is, the payment formula may not fit well in some regions of the response surface, the functional form of the x vector may be specified incorrectly. this criticism has merit if one 's purpose is to develop a specific payment formula, but it is less relevant for our purposes. our aim is not to develop a specific formula, but only to compare in a gross way the performance of demographic, health status, and prior use variables. welch (1985) has proposed a model in which the errors follow a first order auto - regressive process : uit is an independently and identically distributed random term and 1 < < 1. in equation 2, the potential explainable variance is that explained by the adjusters plus that explained by the first term on the right - hand side of the equation (because when one is predicting year t 's expenditures, one has an estimate of it1). thus, in this model the maximum r is approximately the proportion of variance explained by the adjusters plus approximately [1/(1)]var (u). the consistency of equations 1 and 2 with the data can be tested straightforwardly by examining the pattern of correlation of the residuals over time. in the first model, the correlation between the residuals for time periods t and t + s for varying s should be constant (up to sampling error) and equal to variance []/ (variance [] + variance []). in the second model, the correlation should decline geometrically (specifically, it should equal). we later present results on the time pattern of the correlations in our data for children. for adults, the effect of regression to the mean, which equation 2 implies, appears modest (newhouse., 1989). because our principal interest was to ascertain how useful various adjusters would be in further developing capitation rates rather than a particular payment formula, we have not performed a variety of specification tests for the accuracy of the functional form for the x vector. thus, variables are simply entered in a linear form, and no tests for interactions have been performed. a more complex specification would probably improve performance, but it seems unlikely to change our qualitative conclusions. moreover, going beyond a simple linear form risks overfitting our sample data, thereby distorting our results. using our results on explainable variance we consider a child whom the hmo predicts to be one standard deviation below or above the mean for expenditure based on the information available to it. we show how the profit or loss to the hmo diminishes as the payment formula changes to incorporate information from additional risk adjusters. in the limit, the additional risk adjusters would encompass all the information available to the hmo, and the hmo would not gain from selection. the data we use come from the rand health insurance experiment, the design of which has been described in many places (brook., 1983 ; manning., 1987 ; newhouse., 1981 ; newhouse., 1993). seattle, washington ; dayton, ohio ; charleston, south carolina ; fitchburg - leominster, massachusetts ; and two rural areas, franklin county, massachusetts, and georgetown county, south carolina to insurance plans that varied the cost sharing they faced. we have removed the effect in the sample of cost sharing from all observations because some of the variation in spending due to cost sharing was induced by the experiment ; i.e., we have removed the between - plan variance. in effect, we ask how well various explanatory variables or adjusters account for within - plan variance. thus, our results apply to an insured group with no variation in cost sharing, which is a good approximation to groups covered by capitation arrangements. an aspect of the experiment that approximates capitation less well is that the experimental plans employed no utilization management techniques, such as pre - admission certification. this clearly raised the absolute level of spending relative to an hmo (manning., 1984), and the question therefore arises as to whether results from this sample apply to children in a capitated group. although we can not be sure they do, it is not clear whether utilization management would much affect the proportion of variance explained by various personal characteristics. unless utilization management techniques differentially increase the predictable portions of expenditure, the conclusions of this article, with respect to how well one can predict, are unaffected. even if they were to increase the proportion of predictable variation, they would have to increase it differentially by type of covariate for our conclusions with respect to specific covariates to be changed. (the number of children 5 - 13 years of age enrolled in the hmo portion of the experiment, a little more than 200, were too few to use in this analysis.) the families who participated in this experiment were randomly assigned to a 3-year or 5-year participation period, during which time the experiment acted as their insurance company. (they formally assigned to the experiment the benefits of any insurance for which they were eligible.) independent verification of physician office claims indicates that the families filed claims with the experiment for more than 90 percent of their utilization ; thus, we have a nearly complete record of utilization for the period of participation (rogers and newhouse, 1985). the families invited to participate in the experiment were randomly selected, subject to some qualifications that are not important for this article. specifically, the following groups were excluded : (1) those eligible for medicare ; (2) military personnel in active duty and retired ; (3) veterans with service - connected disabilities ; and (4) those institutionalized indefinitely (those in prison and in long - term psychiatric hospitals are the principal groups excluded by this criterion). additionally, in five of the six sites (all but seattle), low - income individuals were over - sampled to a limited extent. all those living at a given dwelling unit who met the eligibility requirements were offered enrollment. as a result, the utilization of the 1,844 observations are not all independent because the amount of utilization by children in the same family is positively correlated. our calculations of the explained proportion of variance do not account for intrafamily correlation, but that should have little effect on our estimates of the proportion of variance that various types of individual characteristics can explain. in addition, as we will show, there is dependence over time within child. indeed, the essence of the risk - adjustment problem is to account for the dependence in the residuals over time. the sample used for the regression equation included only those participants who completed the study and the physical examination at exit. although 93 percent of those children who began the study completed it, our analysis sample is considerably smaller. children who turned 14 years of age during the experiment were excluded from our analysis because they took an adult screening exam at exit, which differed from the children 's exam. moreover, children under 5 years of age at exit were not given physiologic tests and were also excluded. this excluded another 10 percent of the children who began the study. in the regression analysis, we did not use children in their first year of participation because we did not have comparable prior - use data for them. we did use first - year data in examining the stability of year - to - year correlations. we excluded those with any missing data for physiologic variables ; these were mainly children who moved out of area during the experiment, and so did not have a hearing test as part of their out - of - area screening examination. in all, our sample consisted of 2,185 person - years. only 84 of the person - years (3.8 percent) had inpatient use. because inpatient use was so rare, we chose not to include it. our major interest was to predict annual expenditures per child on medical care services in constant dollars. for purposes of calculating the maximum r, we examined expenditure in both raw and trimmed form. the trim point was at the 98th percentile of total medical expenditure. for trimmed data, if an observation was in the upper 2 percent of the relevant distribution, it was set equal to the mean of the upper 2 percent of the observations. this preserved the overall mean. because we wished to ignore within - plan variation, we began by regressing expenditures on plan. plan was defined as the log of the nominal coinsurance rate plus a dummy variable for one particular plan (a plan with outpatient - only cost sharing). by design, we then calculated : a indexes the specification with only the plan variables included, and b indexes any of the more complete specifications. in fact, the plan variables explained only 1 percent of the total variance, so this correction is in practice unimportant. first, we included the demographic kinds of variables used by medicare : age (entered linearly) ; gender ; aid to families with dependent children (afdc) status (supplemental security income recipients are not in the sample population) ; and site. then we added four different sets of variables to this basic set : dichotomous physiologic health. a set of dummy variables that indicate the presence or absence of the physiologic conditions shown in table 1. variables defined in table 1 as (0,1) were included in the regression unchanged. variables defined in table 1 as the maximum of zero and the test value minus some cutting point were dichotomized according to whether the test value was above or below the cutting point. for example, a dummy variable for anemia assumes the value one if a child 5 - 8 years of age has a hemoglobin below 11.0 g / ml. these physiological measures are derived from data collected at exit from the study rather than at entrance because only a random 60 percent of the children were given an exam at entrance. we felt we would obtain more accurate estimates by using data measured at exit for the entire sample than the data measured at enrollment for a partial sample despite the possibility that use would affect the observed value. the experimental results showed that plan did not affect these values (valdez, brook, and rogers, 1985), and of course pre - experiment use could have affected the enrolled values. a set of variables that indicate the presence or absence of the physiologic conditions shown in table 1, and for some conditions, a measure of the severity. variables, again measured at exit, were included in the regression as defined in table 1. for example, two variables related to anemia were included in the regression : (1) low hemoglobin, coded as the maximum of 0.0 or (for children 5 - 8 years of age) 11.0hemoglobin value ; and (2) the dummy variable for anemia described in the preceding paragraph. in principle, the coefficient of the dummy variable measures the fixed costs of treating the condition, and the coefficient of the continuous variable measures the variable cost of increased severity. the cutting points reflect a judgment about values above or below which most physicians would not treat. for example, most physicians would probably not prescribe treatment for anemia with hemoglobin values above 11.0. for values differing from the cutting point in an unhealthful direction it is quite possible, indeed probable, that the true functional form is non - linear, but theory does not specify a functional form, and we felt we would likely overfit the data if we experimented with non - linear functional forms. for example, we treated the effect of being anemic and having asthma as additive. any effort to create an actual payment formula using these variables would need to consider more complicated functional forms, though any such effort should employ a larger data set than the one used in this study. at this point the observed value of the physiologic health variables was used ; thus, an individual who had a hemoglobin value of 12.0 g/100 ml achieved through medications was not distinguished from one who had a natural hemoglobin value of 12.0 g/100 ml and who was not under treatment. in effect, our specification implies that the expected treatment cost of a child will increase with less healthy values, but that will not always be true. specifically, it will not be true if treatment alters the physiologic measure and less healthy patients use more resources (or if not all individuals are under treatment). consider the above example of two persons with a hemoglobin value of 12. although a physiologic condition that we measured was in fact responsible for treatment costs of one of the persons (i.e., the medication to raise the hemoglobin level), the physiologic variable we measured would not explain any variation in expenditure because it would be at 12.0 for both persons. ideally one would measure what the value of the physiologic health measure (e.g., hemoglobin) would be if each child were untreated, but this can not be observed. an extension that partially allows for this difficulty is to enter a dichotomous variable for being in treatment. incorporating such an adjuster has the additional advantage that the relevant information can be collected solely from claims forms. nonetheless, such an approach is only a partial solution because it does not allow for bias within the treated group. for example, one child may have a hemoglobin value of 10 g/100ml without treatment, whereas another may have a value of 10.5. if medication raises them both to 12.0 but the costs of treating the first person are greater, the cost difference would appear to the analyst as unexplained. this may be one reason that the measures of prior use described later achieve considerably more explanatory power than the measures of health status. a set of measures of functional status or physical health, general health perceptions, and mental health as rated by a parent, usually the mother. although the use of such variables as adjusters in a payment formula seems problematic because of the possibilities for fraud, we wished to ascertain the possible gains from using them in our data where there were no incentives for fraud. the same difficulty just described for the physiologic variables is present in these variables as well because medical care for a chronic problem can affect these measures, and medical care may be greater the more severe the problem. four variables measuring use of medical services in the previous year : whether there was any outpatient expenditure ; whether there was any inpatient expenditure ; and the logarithms of outpatients and inpatient expenditures. to determine the gain from using various adjusters, we use a variant of a two - equation model we have used in other work (manning., 1987 ; duan., 1983). this variant models the probability of outpatient expenditures and the logarithm of outpatient spending, but then retransforms the logarithm to raw dollars using a non - parametric method (the smearing estimate) described in the articles cited. armed with our estimated equations (and estimated retransformation factor), we then compute the amount of explained variation as follows : we first predict the total outpatient expenditure of each person using the two - equation model. we then calculate a measure of r due to efron (1978) who uses the following formula : y - hati is the predicted yi using the two - equation model with alternative sets of explanatory variables, and y - bar is the sample mean of y. thus, the numerator of the expression in parentheses is the unexplained sum of squares, and the denominator is the total sum of squares. note that this measure of r can be negative when predicting from a non - linear model such as ours, but in this application it never was. we have used the two - part model and efron 's r rather than the more ordinary analysis of covariance because the two - part model has less tendency to overt it, and yields estimates with significantly lower mean square forecast error (duan., 1983). thus, use of analysis of covariance, which is common in the literature, overstates how well one can do. our major interest was to predict annual expenditures per child on medical care services in constant dollars. for purposes of calculating the maximum r, we examined expenditure in both raw and trimmed form. the trim point was at the 98th percentile of total medical expenditure. for trimmed data, if an observation was in the upper 2 percent of the relevant distribution, it was set equal to the mean of the upper 2 percent of the observations. because we wished to ignore within - plan variation, we began by regressing expenditures on plan. plan was defined as the log of the nominal coinsurance rate plus a dummy variable for one particular plan (a plan with outpatient - only cost sharing). by design, we then calculated : a indexes the specification with only the plan variables included, and b indexes any of the more complete specifications. in fact, the plan variables explained only 1 percent of the total variance, so this correction is in practice unimportant. first, we included the demographic kinds of variables used by medicare : age (entered linearly) ; gender ; aid to families with dependent children (afdc) status (supplemental security income recipients are not in the sample population) ; and site. then we added four different sets of variables to this basic set : dichotomous physiologic health. a set of dummy variables that indicate the presence or absence of the physiologic conditions shown in table 1. variables defined in table 1 as (0,1) were included in the regression unchanged. variables defined in table 1 as the maximum of zero and the test value minus some cutting point were dichotomized according to whether the test value was above or below the cutting point. for example, a dummy variable for anemia assumes the value one if a child 5 - 8 years of age has a hemoglobin below 11.0 g / ml. these physiological measures are derived from data collected at exit from the study rather than at entrance because only a random 60 percent of the children were given an exam at entrance. we felt we would obtain more accurate estimates by using data measured at exit for the entire sample than the data measured at enrollment for a partial sample despite the possibility that use would affect the observed value. the experimental results showed that plan did not affect these values (valdez, brook, and rogers, 1985), and of course pre - experiment use could have affected the enrolled values. a set of variables that indicate the presence or absence of the physiologic conditions shown in table 1, and for some conditions, a measure of the severity. variables, again measured at exit, were included in the regression as defined in table 1. for example, two variables related to anemia were included in the regression : (1) low hemoglobin, coded as the maximum of 0.0 or (for children 5 - 8 years of age) 11.0hemoglobin value ; and (2) the dummy variable for anemia described in the preceding paragraph. in principle, the coefficient of the dummy variable measures the fixed costs of treating the condition, and the coefficient of the continuous variable measures the variable cost of increased severity. all variation on one side of a cutting point the cutting points reflect a judgment about values above or below which most physicians would not treat. for example, most physicians would probably not prescribe treatment for anemia with hemoglobin values above 11.0. for values differing from the cutting point in an unhealthful direction, we simply entered the physiologic measure linearly. it is quite possible, indeed probable, that the true functional form is non - linear, but theory does not specify a functional form, and we felt we would likely overfit the data if we experimented with non - linear functional forms. for example, we treated the effect of being anemic and having asthma as additive. any effort to create an actual payment formula using these variables would need to consider more complicated functional forms, though any such effort should employ a larger data set than the one used in this study. at this point the observed value of the physiologic health variables was used ; thus, an individual who had a hemoglobin value of 12.0 g/100 ml achieved through medications was not distinguished from one who had a natural hemoglobin value of 12.0 g/100 ml and who was not under treatment. in effect, our specification implies that the expected treatment cost of a child will increase with less healthy values, but that will not always be true. specifically, it will not be true if treatment alters the physiologic measure and less healthy patients use more resources (or if not all individuals are under treatment). consider the above example of two persons with a hemoglobin value of 12. although a physiologic condition that we measured was in fact responsible for treatment costs of one of the persons (i.e., the medication to raise the hemoglobin level), the physiologic variable we measured would not explain any variation in expenditure because it would be at 12.0 for both persons. ideally one would measure what the value of the physiologic health measure (e.g., hemoglobin) would be if each child were untreated, but this can not be observed. an extension that partially allows for this difficulty is to enter a dichotomous variable for being in treatment. incorporating such an adjuster has the additional advantage that the relevant information can be collected solely from claims forms. nonetheless, such an approach is only a partial solution because it does not allow for bias within the treated group. for example, one child may have a hemoglobin value of 10 g/100ml without treatment, whereas another may have a value of 10.5. if medication raises them both to 12.0 but the costs of treating the first person are greater, the cost difference would appear to the analyst as unexplained. this may be one reason that the measures of prior use described later achieve considerably more explanatory power than the measures of health status. a set of measures of functional status or physical health, general health perceptions, and mental health as rated by a parent, usually the mother. although the use of such variables as adjusters in a payment formula seems problematic because of the possibilities for fraud, we wished to ascertain the possible gains from using them in our data where there were no incentives for fraud. the same difficulty just described for the physiologic variables is present in these variables as well because medical care for a chronic problem can affect these measures, and medical care may be greater the more severe the problem. four variables measuring use of medical services in the previous year : whether there was any outpatient expenditure ; whether there was any inpatient expenditure ; and the logarithms of outpatients and inpatient expenditures. to determine the gain from using various adjusters, we use a variant of a two - equation model we have used in other work (manning., 1987 ; duan., 1983), with the variables in table 1 as explanatory variables. this variant models the probability of outpatient expenditures and the logarithm of outpatient spending, but then retransforms the logarithm to raw dollars using a non - parametric method (the smearing estimate) described in the articles cited. armed with our estimated equations (and estimated retransformation factor), we then compute the amount of explained variation as follows : we first predict the total outpatient expenditure of each person using the two - equation model. we then calculate a measure of r due to efron (1978) who uses the following formula : y - hati is the predicted yi using the two - equation model with alternative sets of explanatory variables, and y - bar is the sample mean of y. thus, the numerator of the expression in parentheses is the unexplained sum of squares, and the denominator is the total sum of squares. note that this measure of r can be negative when predicting from a non - linear model such as ours, but in this application it never was. we have used the two - part model and efron 's r rather than the more ordinary analysis of covariance because the two - part model has less tendency to overt it, and yields estimates with significantly lower mean square forecast error (duan., 1983). thus, use of analysis of covariance, which is common in the literature, overstates how well one can do. the maximum r for children is 37 percent for untrimmed data and 35 percent for trimmed data (table 2). because the results are not sensitive to use of trimmed or untrimmed data, we present only the untrimmed results. age, gender, site, and afdc status explain only about 6 percent of the explainable variance in expected outpatient costs, i.e., 6 percent of what one could hope to explain. measures of subjective health status do not much improve on the demographic variables of age, gender, site, and afdc status. only 14 percent of the explainable variance in expected costs is explained if those measures are also included. the variance in expected costs that is explained rises into the 25 to 30 percent range. results using the continuous specification of the health variable differ little from those using the dichotomous version. when paired with measures of health, this fraction rises into the two - thirds region. the year - to - year correlations decline as the time period extends (table 3), but the decline appears to bottom out rather than continue geometrically, especially for ambulatory expenses. if there were simple regression to the mean, the values of the average of diagonal column should fall geometrically when reading from bottom to top (one is averaging increasingly longer intervals), but they clearly do not. the expected gain from including measures of prior use is substantial in reducing incentives to select favorable risks. as table 4 shows, for a child one standard deviation from the mean, the gain or loss is $ 672 per child if hmos know only the variance from prior use and our health measures, and only demographic variables are used to adjust premiums. this is about one - half the comparable figure for adults, but is enhanced by the usual practice of enrolling all children in a family because of the positive correlation among children. for a three - child family with an inter - child correlation of 0.25the correlation between expenditures of children in the same family in the health insurance experiment data the profit or loss would be 22 percent again as large as for a 3-child family with no correlation, or $ 1,426 at one standard deviation from the mean of 3-child families (1,426=6724.5). simple demographic variables such as age, gender, site, and welfare status account for only about 6 percent of the explainable variance in the expected annual ambulatory care expenditure of children. indeed, they performed even less well than they did for adults, where they accounted for about 15 percent of the explainable variance of outpatient expenditure. it is perhaps not surprising that age would explain more variation in expenditure among those 14 - 65 years of age than among those 5 - 13 years of age, simply because of the greater variation in age among the adult group. despite their poor performance, this set of demographic variables is an administratively straightforward one to include in a payment formula. put another way, although there is little reason not to vary capitation rates based on these demographic characteristics, simply adjusting for them will not solve the problem of heterogeneity among enrollees. a frequently advocated step is to add measures of health status as adjusters (howland., 1987 ; mcclure, 1984 ; thomas and lichtenstein, 1986a, 1986b ; thomas, lichtenstein, and wyszewianski, 1983). those measures of health status that we included did not much help. in the case of physiologic measures, this could be because our list of variables was quite short, limited to six types of medical problems. nonetheless, most remaining chronic diseases affecting children are not very prevalent. because the percentage of variance explained is proportional to the percentage of children with the problem furthermore, a much longer list of physiologic variables used for adults did not perform markedly better. although few children in a general population are physically limited or have serious mental illness, the general health index has been shown to be a reliable and valid measure of child health, and its distribution is not as non - normal as the other measures (eisen., 1980). it is striking that even a quite limited set of six physiologic conditions measured at exit can explain notably more variance in outpatient expenditure than the three subjective measures taken at enrollment. this finding also held for adults ; subjective measures performed less well than physiologic measures. from a practical point of view, it may not be so serious that subjective measures of health status are of little help. implementing them as part of a payment formula would pose possibly insuperable problems because of the possibility of fraud. for that reason, and because we believe the scope for improving our physiologic measures is considerably greater than the scope for improving our subjective measures of health, we suggest that in the case of children the preponderance of any further effort spent to develop health - status adjusters be devoted to physiologic measures. although none of the measures of health status performed very well, measures of prior use did. more than one - half the variation in expected ambulatory care costs (i.e., the stable variance) could be explained by our four measures of prior use. indeed, prior use did even better for children than it did for adults, where the comparable figure was somewhat less than one - half. incorporating measures of prior use into the payment formula poses both a mundane and a philosophical issue. many capitated organizations do not have readily available data on outpatient use ; thus, there would be a serious implementation problem. the philosophical issue relates to the appropriateness of paying on the basis of prior use. one commonly heard argument for capitation is that the ffs fee structure is distorted (i.e., it is profitable for physicians to treat more intensively, and they can act on these incentives because of consumer ignorance) and that these distortions can be internalized to the organization by means of capitation. although the existing fee structure may well be distorted (i.e., many fees depart markedly from marginal cost), capitation means that the marginal revenue of an additional service is zero. necessary services that were contracted for, unless these services attract or retain healthy (low cost) patients who pay an average rate or unless they reduce future expenditure. (preventive care is an example of a service that may both attract healthy patients and reduce future expenditure.) against the point - in - time incentive to underserve are the possible consequences of current enrollees ' withdrawing and potential damage to the organization 's reputation, reducing the number of new enrollees. these threats, however, rely upon information, and information may not be very good. if the consumer is not knowledgeable enough to detect overservice from an ffs physician, will he or she be knowledgeable enough to detect underservice ? indeed, the potential of capitated organizations to underserve has been widely noted (pauly, 1980). the second problem with the philosophical argument is that it simply ignores the mismatch between an enrollee 's cost to the hmo and the revenue received for that enrollee, if the revenue is not tailored to the individual 's characteristics. thus, it does not address the incentive of the capitated organization to seek good risks and the resulting market failure for the poor risk (table 4). including prior use in the payment formula mitigates both problems the incentive to underserve an enrollee, and the incentive to select good risks. it mitigates the problem of incentives at the time of use by paying some positive amount, provided the child remains an enrollee in the next year. it also addresses the mismatch between marginal revenue and cost at the individual level, as the results in table 2 demonstrate ; i.e., prior use picks up unmeasured variation across individuals in the amount of current use. thus, its inclusion reduces the incentives to select patients whose expected costs are less than average. for the same reason, it does not equally pay hmos whose mixes of health risks differ, whether through deliberate action on the hmo 's part or simply through random events. including prior use and our measures of health status raises the proportion of explained variance to the 65 to 70 percent range, but, as table 4 shows, there are nonetheless substantial profits to be made from selective enrollment and disenrollment. if one wants to do better, one will have to include a measure of current use in the payment formula (newhouse, 1986). for example, payment could be a weighted average of an adjusted capitation rate and a current use payment. basing the formula on current use rather than prior use also means the hmo does not lose revenue if a high - spending child disenrolls. the objections many have to including any measure of use in the payment formula are twofold. this is true, but points up that we are dealing with a second - best solution. second, many feel ffs is inherently a flawed system that provides incentives for overservice. as pauly (1980) pointed out, the incentive is not inherent. ignoring the moral hazard on the patient 's side, a fee at the marginal cost of delivering the service would provide the physician (or capitated organization) no incentive for overservice. paying a partial capitation and a partial fee reduces the likelihood that the fee will induce overservice. the moral hazard can be addressed through the incentives of capitation to the provider. in short, systems that vary payment with the amount of use although one can conceptualize fees at marginal cost, in practice a regulator will not know the true marginal cost. thus, one can not claim a priori that a mixed payment system, part ffs and part capitation, will definitely improve on either pure system, but our results suggest it might. we conclude that some experimentation with a mixed payment system is indicated (selden, 1990 ; newhouse, 1991). | few capitation arrangements vary premiums by a child 's health characteristics, yielding an incentive to discriminate against children with predictably high expenditures from chronic diseases. in this article, we explore risk adjusters for the 35 percent of the variance in annual outpatient expenditure we find to be potentially predictable. demographic factors such as age and gender only explain 5 percent of such variance ; health status measures explain 25 percent, prior use and health status measures together explain 65 to 70 percent. the profit from risk selection falls less than proportionately with improved ability to adjust for risk. partial capitation rates may be necessary to mitigate skimming and dumping. |
lung cancer, also known as bronchogenic carcinoma, generally refers to malignant tumors from epidermal cells of the bronchus or bronchiole, which account for 9095% of total lung cancer cases [13 ]. currently, lung cancer is the leading cause of death among all cancers worldwide, and its mortality shows a rising tendency each year, especially in women [46 ]. the precise pathogenesis of lung cancer is not yet clearly understood, but numerous reports have confirmed some risk factors involved in lung cancer, including smoking, air pollution, occupational factors, chronic lung diseases, and human genetic factors [711 ]. an in vitro experiment suggested that cigarette smoke exposure could increase the death of lung cancer cells. the study of wang. found that tobacco smoke could promote the development of lung cancer via enhancing ccl20 level. in addition, elevated risk of lung cancer was identified in individuals exposed to silica dust, welding fumes, diesel exhaust, and man - made mineral fibers. further analysis by li. reported that occupational exposure to welding fumes brought about oxidative stress, telomere alterations, and dna methylation. in a clinic - based case - control study, family history of lung cancer or any other cancer a growing body of evidence shows the crucial roles of genetic factors, like genetic polymorphisms and abnormal expression, in the pathogenesis of lung cancer [1721 ]. all these findings suggest that the development of lung cancer results from the combined effects of genetic and environment factors, which is supported by many studies [2225 ]. cyclooxygenase (cox), also called prostaglandin endoperoxide synthases (ptgs), is a rate - limiting enzyme catalyzing the synthesis of prostaglandins (pgs) and thromboxanesa2 (txa2) through arachidonic acid (aa). so far, there are at least 2 types in the cox family cox-1 and cox-2. as an induced enzyme, cox-2 rarely expresses in normal tissues, but starts its expression after being stimulated by multiple factors, such as cytokines, growth factors (including pd - gf, tnf, egf, bfgf and il-1), oncogenes (like ras and v - rsc), tumor promoters, and endotoxins, thus participating in physiological and pathological processes in inflammation and tumors. many studies have explored the relationship between polymorphisms in cox-2 gene and lung cancer, but contradiction among study results still exists. moreover, cox-2 polymorphisms might be influenced by genetic and environmental factors, such as high - fat diets, lifestyle, folate intake, and smoking [3032 ]. as a consequence, results of studies on the correlation of cox-2 polymorphisms with lung cancer risk based on a single population can not be generalized. therefore, a meta - analysis was performed among studies on this relationship to extract a more reliable and comprehensive conclusion. a literature search was performed in the databases of pubmed, embase, cnki, and chinese wanfang data for potentially relevant studies published in english or chinese languages. the terms for search included lung cancer or pulmonary cancer or lung carcinoma, cox-2, and all studies included in this meta - analysis met the following criteria : (1) using case - control study method to assess the relationship of cox-2 polymorphisms with lung cancer risk ; (2) providing sufficient genotype distribution data in cases and controls for calculation of odds ratio (or) with corresponding 95% confidence interval (95%ci) ; and (3) with validated genotyping methods. when overlapping data appeared in more than 1 publication, we selected that containing the largest samples. the data for meta - analysis were extracted independently by 2 authors in accordance with the same standard. no disagreement occurred in this work. from each study included in this analysis, the following information was recorded : first author, year of publication, original country, ethnicity, source of control, genotyping methods, researched polymorphism, and genotype frequencies in cases and controls. the overall pooled ors and corresponding 95%cis were calculated to evaluate the relationship between cox-2 polymorphisms and lung cancer under homozygous, dominant, recessive, allele, and heterozygous models. the chi - square - based q statistic was used to assess the heterogeneity among included articles. the overall ors were obtained under the random - effects model when there was significant heterogeneity (p0.05 indicates that the control samples were in good equilibrium. publication bias was detected by begg s funnel plot and egger s linear regression test. sensitivity test was performed through deleting a single included study each time to observe the effect on the overall ors in this meta - analysis. all data were processed with stata 12.0 software (stata corporation, college station, tx, usa). a literature search was performed in the databases of pubmed, embase, cnki, and chinese wanfang data for potentially relevant studies published in english or chinese languages. the terms for search included lung cancer or pulmonary cancer or lung carcinoma, cox-2, and all studies included in this meta - analysis met the following criteria : (1) using case - control study method to assess the relationship of cox-2 polymorphisms with lung cancer risk ; (2) providing sufficient genotype distribution data in cases and controls for calculation of odds ratio (or) with corresponding 95% confidence interval (95%ci) ; and (3) with validated genotyping methods. when overlapping data appeared in more than 1 publication, we selected that containing the largest samples. the data for meta - analysis were extracted independently by 2 authors in accordance with the same standard. no disagreement occurred in this work. from each study included in this analysis, the following information was recorded : first author, year of publication, original country, ethnicity, source of control, genotyping methods, researched polymorphism, and genotype frequencies in cases and controls. the overall pooled ors and corresponding 95%cis were calculated to evaluate the relationship between cox-2 polymorphisms and lung cancer under homozygous, dominant, recessive, allele, and heterozygous models. the chi - square - based q statistic was used to assess the heterogeneity among included articles. the overall ors were obtained under the random - effects model when there was significant heterogeneity (p0.05 indicates that the control samples were in good equilibrium. publication bias was detected by begg s funnel plot and egger s linear regression test. sensitivity test was performed through deleting a single included study each time to observe the effect on the overall ors in this meta - analysis. all data were processed with stata 12.0 software (stata corporation, college station, tx, usa). we retrieved 81 relevant articles following the above search strategy, and 12 qualified ones were included ultimately [3546 ]. the association of each polymorphism in cox-2 gene with lung cancer is listed in table 2 under 5 contrasts with corresponding effect models. among 9 polymorphisms, 7 polymorphisms (rs5275, rs689466, rs2745557, rs3218625, rs20432, rs16825748, and rs5277) had no significant relationship with lung cancer risk, while the other 2 (rs20417 and rs2066826) expressed significant correlations with the cancer. cox-2 rs20417 polymorphism demonstrated a remarkable relevance to reduced lung cancer risk under aa versus gg (or=0.41, 95%ci=0.220.77) and aa versus gg+ga contrast (or=0.39, 95%ci=0.220.70), as well as in subgroup analysis of white and population - based groups (figure 2, figure 3). as for rs2066826, a positive relationship with lung cancer was found in all 5 models [aa versus gg (or=4.36, 95%=1.4812.87), aa+ga versus gg (or=1.65, 95%ci=1.202.26), aa versus gg+ga (or=4.00, 95%ci=1.3611.79), a versus g (or=1.76, 95%ci=1.312.35), and ga versus gg (or=1.56, 95%ci=1.122.16) ] (figure 4). the pooled ors showed no distinct discrepancy from those obtained after omitting a single study each time, indicating all these studies did not have substantial impact on the whole ors. begg s funnel plot seemed symmetrical for each polymorphism, which was further proven by egger s linear regression test (p=0.582), implying there was no significant publication bias among studies in our meta - analysis (figure 5). we retrieved 81 relevant articles following the above search strategy, and 12 qualified ones were included ultimately [3546 ]. the association of each polymorphism in cox-2 gene with lung cancer is listed in table 2 under 5 contrasts with corresponding effect models. among 9 polymorphisms, 7 polymorphisms (rs5275, rs689466, rs2745557, rs3218625, rs20432, rs16825748, and rs5277) had no significant relationship with lung cancer risk, while the other 2 (rs20417 and rs2066826) expressed significant correlations with the cancer. cox-2 rs20417 polymorphism demonstrated a remarkable relevance to reduced lung cancer risk under aa versus gg (or=0.41, 95%ci=0.220.77) and aa versus gg+ga contrast (or=0.39, 95%ci=0.220.70), as well as in subgroup analysis of white and population - based groups (figure 2, figure 3). as for rs2066826, a positive relationship with lung cancer was found in all 5 models [aa versus gg (or=4.36, 95%=1.4812.87), aa+ga versus gg (or=1.65, 95%ci=1.202.26), aa versus gg+ga (or=4.00, 95%ci=1.3611.79), a versus g (or=1.76, 95%ci=1.312.35), and ga versus gg (or=1.56, 95%ci=1.122.16) ] (figure 4). the pooled ors showed no distinct discrepancy from those obtained after omitting a single study each time, indicating all these studies did not have substantial impact on the whole ors. begg s funnel plot seemed symmetrical for each polymorphism, which was further proven by egger s linear regression test (p=0.582), implying there was no significant publication bias among studies in our meta - analysis (figure 5). begg s funnel plot seemed symmetrical for each polymorphism, which was further proven by egger s linear regression test (p=0.582), implying there was no significant publication bias among studies in our meta - analysis (figure 5). in spite of the advances in the diagnostic technology, the 5-year overall survival rate of lung cancer is still low, at about 1215%, because the patients were diagnosed at moderate and advanced stages when clinic symptoms are presented. statistically, the 5-year survival rate of patients at stage i reaches more than 70%, so early discovery, diagnosis, and treatment appear to be important to reduce the mortality rate of lung cancer. currently, only 10% of asymptomatic patients are identified and receive radical treatments. because of the limited sensitivity and specificity of existing screening methods, the mortality rate of lung cancer is still not reduced. it is urgently important to discover effective means for detection of individuals with high risk of lung cancer. human cox-2 gene is located on chromosome 1q25.2~25.3 with a length of about 8.8 kb, and consists of 10 exons and 9 introns. the over - expression of cox-2 is closely related to the metastasis of malignant tumors, and the cox-2 gene plays an important role in all stages of neoplasm metastasis, such as the decrease of cells adhesion caused by the changes in cell surface adhesion factors and in extracellular matrix, and the promotion of neovascularization in tumors. studies of the relationship of cox-2 polymorphisms with lung cancer are based on various populations in different countries ; therefore, varied results may exist even among those on the same polymorphism. we carried out this meta - analysis of the eligible studies in order to reach a more precise conclusion. as shown in the present analysis, 9 polymorphisms were examined to ascertain their potential relationships with lung cancer risk, of which 7 were not found to have relevance to the risk of lung cancer, including rs5275, rs689466, rs2745557, rs3218625, rs20432, rs16825748, and rs5277. rs2066826 had a significant association with the increased risk of lung cancer under all 5 contrasts, while a distinct correlation was observed between rs20417 polymorphism and the reduced risk of lung cancer under both homozygous and dominant models. furthermore, in subgroup analysis for rs20417 and lung cancer risk, the same relationship was revealed in the white group under homozygous and dominant contrasts, and in population - based group under homozygous, dominant, and allele models. the presence of this phenomenon might be attributed to the following aspects : the samples in previous studies and our meta - analysis were not balanced in terms of quantity, or based on different ethnicities in various genetic backgrounds ; and the possible interactions among genes and environmental factors were not taken into consideration in this meta - analysis. therefore, the exact correlations of cox-2 polymorphisms with lung cancer risk need to be re - examined in future explorations. multiple genetic variants in cox-2 are reportedly associated with lung cancer, so in the present analysis we selected as many polymorphisms as possible from eligible studies to explore the relationship between these polymorphisms and lung cancer risk. as in previous studies, the present analysis also had its own shortcomings affecting the exactitude of the ultimate results. in this study, we only discussed the association of cox-2 polymorphisms with lung cancer in asian and white populations, ignoring other populations. moreover, for some polymorphisms, the number of involved studies and samples was relatively small. although a meticulous literature search was performed and relevant reference lists were manually examined, the limitation in study language may lead to possible publication bias which can not be shown by begg s funnel plot and egger s test. in addition, the interactions between genetic and environmental factors were not taken into account in this analysis. therefore, the results in this meta - analysis should be interpreted with caution, and need to be verified by well - designed studies in future. cox-2 rs20417 polymorphism is associated with reduced risk of lung cancer, but rs2066826 polymorphism may increase the risk of lung cancer. these results will contribute to detecting individuals with high risk of lung cancer and providing timely treatments. | backgroundmultiple relevant risk factors for lung cancer have been reported in different populations, but results of previous studies were not consistent. therefore, a meta - analysis is necessary to summarize these outcomes and reach a relatively comprehensive conclusion.material/methodsstata 12.0 software was used for all statistical of the relationship between cox-2 polymorphisms and lung cancer risk. inter - study heterogeneity was examined with the q statistic (significance level at p<0.1). the publication bias among studies in the meta - analysis was analyzed with begg s funnel plot and egger s test. hardy - weinberg equilibrium was tested in all controls of the studies.resultscox-2 rs20417 polymorphism had a significant association with reduced risk of lung cancer under homozygous and recessive models, and similar results were observed in white and population - based subgroups under 2 and 3 contrasts, respectively. additionally, rs2066826 polymorphism manifested a strong correlation with increased risk of lung cancer under 5 genetic models.conclusionsin cox-2 gene, rs20417 may have a certain relationship with reduced risk of lung cancer, while rs2066826 may increase the risk of lung cancer. |
fermented sausages such as salami and pepperoni are commonly considered safe for consumption, and the acidification by lactic acid starter bacteria is one of the main preserving factors. nevertheless, outbreaks of serious sausage - borne gastrointestinal infections with pathogens such as verocytotoxic (shigatoxic) escherichia coli (vtec / stec), salmonella, and listeria monocytogenes do occur regularly (1). for example, in a 2006 outbreak in norway, 17 people with sausage - borne vtec infections (10 of them children < 9 years old) were treated for renal failure or hemolytic uremic syndrome, with one fatal outcome (2). although fermented beef products have been identified as potential health hazards (3), it is largely unclear when and why fermented sausages pose a risk to consumers. we tested the hypothesis that statutorily tolerable levels of veterinary antibiotics in meat pose a food safety threat associated with sausages by inhibiting microbial starter cultures and fermentation, thus allowing pathogens to multiply during processing (4). sausage processors typically initiate fermentation with lyophilized starter cultures that produce large amounts of lactic acid, and the rapidly decreasing ph levels prevent growth of pathogenic bacteria. such starter bacteria are primarily selected for production purposes. therefore, most strains of lactic acid bacteria are highly sensitive to antibiotics, and commercial suppliers even take care not to provide strains that carry antibiotic resistance genes (5). still, antibiotics are used extensively and widely in livestock farming for treatment, control, and prevention of animal diseases as well as for production purposes, e.g., to enhance growth or improve feed efficiency. as a consequence food safety regulation in many countries sets maximum tolerable levels of microbial residues. in the european union (eu), these are called maximum residue limits (mrl) (6), whereas in the united states, the food and drug administration (fda) has defined tolerance levels (tl), and violations, where the measured antibiotic concentrations in meat exceed the mrl / tl, are registered. national residual monitoring programs showed violations in 0.2 to 1.0% of sampled beef and pork meat in the eu and united states in 2009 (7, 8), with 0.4% of bovine animals and 0.05% of pigs being required to be controlled in the eu (8). meat samples violating the tolerance levels are withdrawn from the food chain, but not all violations are caught in the monitoring programs. furthermore, many countries lack monitoring or reporting of sales and data on use of antibiotics (9), and the frequency of inspection of imported meat is low ; e.g., in the united states in 2009, 3,872 imported meat samples were analyzed for chemical contamination (7). shortcomings in the current screening methods are likely to cause underestimation of noncomplying products, and there is a need for development and implementation of more adequate residual screening methods (10). here, we evaluated six commercially available starter cultures that are widely used for sausage production (bactoferm fsc-111, f1, and t - spx [c. hansen, hoersholm, denmark ] and bitec advance rd-1, ls-25, and ls-25 - 2 [gewrzmller, korntal - mnchingen, germany ]). the starter cultures are all a mixture of two or three species, including both lactic acid - producing bacteria, which are important for ph control, and coagulase - negative cocci, which are important for flavor formation. the starter cultures used in this study contain either (i) pediococcus pentosaceus in combination with staphylococcus xylosus ; (ii) lactobacillus sakei in combination with staphylococcus carnosus ; or (iii) lactobacillus curvatus, s. carnosus, and kocuria varians. in broth experiments, we found that under laboratory conditions (de man, rogosa, and sharpe broth [mrs ], ph 6.1), all six starter cultures were sensitive to three commonly used veterinary antibiotics (oxytetracycline, erythromycin, and penicillin) (fig. 1) at or near the levels designated as tolerable (tl or mrl). as expected, acidification correlated well with starter culture growth after 20 h incubation at 25c. importantly, in the presence of antibiotics at or close to the tolerable concentrations, only minor acidification occurred, with a final ph of 6, whereas in the absence of antimicrobials, the final ph was 4.3. six commercial starter cultures were inoculated in mrs broth (oxoid) at an absorbance at 600 nm of 0.05 in the presence or absence of oxytetracycline (a), erythromycin (b), or penicillin (c). after incubation at 25c for 20 h, absorbance (bars) and ph (dots) were measured. arrows mark the tolerance levels (tl, set by the fda) for residual tetracyclines (2 g ml) or the maximal residual limits (mrl, set by the eu) for penicillin (0.05 g ml) and erythromycin (0.2 g ml). to evaluate the impact of residual antibiotics on fermentation, we created standardized 50-g model sausages stuffed in 60-ml plastic syringes (11) using a recipe that resembles those of traditional european sausages (minced beef or pork meat, 3% nacl, 100 ppm sodium nitrite, 0.7% dextrose, and starter culture, according to the manufacturer s recommendations ; 25 g kg meat batter). fermentation was monitored in terms of ph decrease after 48 h of incubation at 25c. model sausages (controls) fermented by any of the starter cultures had an average end ph of 4.75 0.07 after fermentation, whereas spontaneous fermentation in meat without addition of starter cultures resulted in a final ph of 5.45 0.12 (n 12 for each condition). in contrast, we found that with the addition of erythromycin at the mrl concentration, fermentation was significantly reduced in five of the six starter cultures, resulting in an average end ph of 5.16 0.34. also, the presence of oxytetracycline at the tl concentration reduced fermentation in three of the six starter cultures, resulting in an average end ph of 4.84 0.14. it was reported in 1998 that commercial starter cultures are susceptible to low levels of antibiotics like erythromycin, penicillin, tylosin tartrate, and ceftiofur hydrochloride (excenel), leading to inhibited starter culture performance in meat (12), and this problem seems to be overlooked, as the continuous development of starter cultures has failed to addressed the issue. the influence of residual antibiotics on pathogen survival and viability was evaluated using reporter strains of escherichia coli o157:h7 and salmonella enterica serovar typhimurium uk1 that express high levels of bioluminescence (13). model sausages were inoculated with e. coli or s. typhimurium to a level of 2 10 to 4 10 cfu g, as determined by selective plating, by harvesting 10 ml of lb cultures at an absorbance at 600 nm of 1.0 by centrifugation (5,000 g for 5 min) and resuspending pellets in sterile, saline (0.9%) water before inoculation. bioluminescence signal intensities were used to measure pathogen viability in relative light units (rlu, in photons s cm) in a xenogen ivis100 imaging system (xenogen, alameda, ca) before and after fermentation. importantly, high - level pathogen bioluminescence was observed only in sausages with residual erythromycin present at twice the mrl (0.4 g g) and not in control sausages without antibiotics (fig. furthermore, in sausages without antibiotics, fermentation reduced the number of pathogens by 1 log unit (accompanied by a 3- to 4-log - unit decrease in bioluminescence), whereas in the presence of erythromycin at twice the mrl (0.4 g g), no reduction neither in pathogen counts nor bioluminescence levels was observed (fig. this suggests that, at a level close to the mrl, erythromycin can render the starter culture ineffective during sausage processing and enable pathogen survival. (a) bioluminescent imaging after 48 h of fermentation at 25c on triplicate 1-g sausage samples inoculated with the e. coli o157:h7 reporter strain without (lower row) and with (upper row) the addition of erythromycin (0.4 g g). (b) selective e. coli o157:h7 and (c) s. typhimurium counts (bars) and relative light units (rlu ; dots) in model sausages after fermentation (48 h, 25c). each bar or dot shows the value for one representative of three biological replicates, measured in three technical replications. erm, erythromycin (0.4 g g) ; otet, oxytetracycline (2.0 g g). starting counts before fermentation were 2.9 10 to 3.3 10 cfu g for e. coli and 1.7 10 to 2.5 10 cfu g for s. typhimurium. the resistance of starter cultures to veterinary drugs was investigated previously (12, 14), but in contrast to earlier studies, our study shows that starter cultures can be affected by antibiotics at levels that are probable and even tolerable in meat, which highlights the importance for food safety. we conclude that sausages prepared from meat with residual concentrations of antibiotics at or close to levels deemed tolerable by u.s. and eu regulators can lead to full or partial fermentation failures and thus to food products capable of causing serious food - borne infections. there is a general lack of knowledge about the decay of antibiotics in meat or the state of the residuals, and we can only mimic the state of the antibiotics in meat. one of the common methods for qualitative screening of antibiotic residuals in muscle tissue relies on microbiological activity against sensitive bacterial strains (15), but this and other applied detection methods are reported to be insensitive or inadequately accurate (10, 15). we suggest that fermentation disruption could occur in single batches in a production and that random sampling could leave some fermentation failures undetected. some smaller sausage producers, including local butcher shops, altogether lack adequate ph control (16, 17). our results indicate that fermentation during sausage production should be monitored closely to reduce food safety risks. at present, no data on the use of antibiotics in livestock farming worldwide are collected systematically (9). our work reveals an overlooked risk associated with the presence of veterinary drugs in meat. the results add to a large body of research pointing to adverse effects of antibiotics in food, and this may prompt legislators to reconsider the criteria behind the establishment of tolerance levels. | abstractfermented sausages, although presumed safe for consumption, sometimes cause serious bacterial infections in humans that may be deadly. not much is known about why and when this is the case. we tested the hypothesis that residual veterinary antibiotics in meat can disrupt the fermentation process, giving pathogenic bacteria a chance to survive and multiply. we found that six commercially available starter cultures were susceptible to commonly used antibiotics, namely, oxytetracycline, penicillin, and erythromycin. in meat, statutorily tolerable levels of oxytetracycline and erythromycin inhibited fermentation performance of three and five of the six starter cultures, respectively. in model sausages, the disruption of meat fermentation enhanced survival of the pathogens escherichia coli o157:h7 and salmonella enterica serovar typhimurium compared to successful fermentations. our work reveals an overlooked risk associated with the presence of veterinary drugs in meat. |
primary percutaneous coronary intervention (pci) is considered the preferred reperfusion modality for patients presenting with st - segment elevation myocardial infarction (stemi) regardless of the hour of presentation as long as reperfusion can occur in a timely manner. yet despite the prompt and successful restoration of ante grade epicardial blood flow by pci, a significant proportion of patients with ami remain at increased risk of death and adverse outcomes. also microvascular obstruction with diminished myocardial perfusion occurs in a large proportion of patients with a patent epicardial vessel after primary pci, and this event is associated with an increased infarct size, reduced recovery of ventricular function, and increased mortality. the high frequency of suboptimal myocardial reperfusion after primary pci has resulted in the development of different feasible and safe thrombectomy and distal protection devices. the efficiency and safety of adjunct thrombectomy using diver ce device (invatec, italy) have been established. a promising novel solution to ameliorate the outcome of angioplasty for acute coronary syndromes resides in the combined use of pharmacological and catheter - based therapies to increase local concentration of drugs such as glycoprotein iib / iiia inhibitors at the culprit site, prolonging their residency time. the therapeutic perfusion catheter is a microporous balloon catheter that acts as a low - pressure irrigating system for localized perfusion of therapeutic agents into the coronary vasculature providing up to 500 times the systemic concentration of a drug by gently occluding the blood flow and significantly increasing the residence time of the infused drug at the specific target site. we investigated the efficacy of local eptifibatide delivery to the site of thrombus through infusion catheter in comparison with thrombus aspiration in patients with acute stemi undergoing primary pci. the study population consisted of 75 patients who presented to ain shams university hospital with st - elevation myocardial infarction (stemi) and planned for primary pci ; they were randomized to management either by local intracoronary eptifibatide through infusion catheter (n = 25) or by aspiration thrombectomy device (n = 25) or managed by conventional pci (n = 25). the following was excluded from the study : use of a fibrinolytic agent within 14 days before pci, suspected active internal bleeding, history of cerebrovascular accident within the previous 2 years, known platelet count 0.068 inches internal diameter) or conventional pci with or without ptca. the three arms were treated finally by stenting of the culprit lesion. all patients received weight adjusted dose of heparin during the procedure, aspirin 300 mg orally as soon as possible and 150 mg daily thereafter, a clopidogrel 600 mg loading dose before pci, and 75 mg daily for at least 3 months after randomization (or up to 1 year in case of drug - eluting stent implantation), statins beta blockers, and ace inhibitors. laboratory investigations were done for all patients including serum creatinine level, cbc, and troponin on admission and 6 hours after and also ck - mb every 6 hours till normalization. echocardiography was done during hospital stay to all patients to measure ef using simpson 's method. the primary end points were postprocedural assessment of timi flow, corrected thrombolysis in myocardial infarction (timi) frame count, and myocardial blush grade ; these parameters were measured by the pci operator who was blinded. the secondary end point was procedure - related myocardial infarction (mi) and in - hospital stay rates of major adverse cardiac events (mace). mace was defined as the composite of death from any cause, reinfarction, or target vessel revascularization. procedure - related mi was diagnosed if the creatine kinase - myocardial band (ck - mb) level increased to be twice the last nonnormalized measurement. timi thrombus grading classification was used to evaluate thrombus burden ; patient was considered to have angiographically evident thrombus if timi thrombus grades 2 to 5 were present. the collected data were coded, tabulated, and statistically analyzed using the spss program (statistical package for social sciences) software version 17.0. descriptive statistics were done for numerical parametric data as mean sd (standard deviation) and minimum and maximum of the range, while they were done for categorical data as number and percentage. inferential analyses were done for quantitative variables using independent t - test in cases of two independent groups with parametric data and one way anova for two or more means. pearson correlation was used to measure the correlation (linear dependence) between two variables. the level of significance was taken as follows : p value < 0.05 is significant ; otherwise it is nonsignificant. the p value is a statistical measure for the probability that the results observed in a study could have occurred by chance. during the study period, 75 patients who presented to ain shams university hospital with st - elevation myocardial infarction (stemi) and planned for primary pci were randomized to management either by local intracoronary eptifibatide through perfusion catheter (n = 25) or by aspiration thrombectomy device (n = 25) or managed by conventional pci (n = 25). baseline demographic data, including age, gender, cardiovascular risk factors, and infarct related vessel, is presented in table 1. in all our study population the duration of chest pain (pain - to - door) had mean value of 5.18 hours (sd 3.96), while the door - to - balloon time had mean value of 43.85 minutes (sd 20.6) ranging from 15 to 100 minutes. in the infusion catheter group, the peak ck - mb reached had mean value of 216.88 75.46, versus 368.60 217.02 in the thrombus aspiration group and 351.72 217.02 in the control group. post hoc analysis showed that the control group and the thrombus aspiration group were both significantly higher in ck - mb level compared to perfusion catheter group (p value = 0.004, p value = 0.011, resp.). the mean time to reach peak of ck was 13.12 4.25 hours in the local intracoronary infusion group, 16.56 5.43 hours in the thrombus aspiration group, and 19.52 6.44 hours in the control group. which is significantly lesser in the perfusion catheter group compared to both aspiration group and control group (p value = 0.015, p value = 0.001, resp.) in the local eptifibatide group the magnitude of st resolution had mean value of 56.88% (sd 15.14), while in the aspiration group it was 59.6% (sd 21.5) and 51.52% (sd 26.28) in the control group (p value = 0.404). also in the infusion catheter group the mean ejection fraction measured after infarction was 46.64 6.66%, in the thrombus aspiration group was 41.76 8.38%, and in the control group was 41.88 9.85% (p value 0.071). in the infusion catheter group 68% of patients had mbg 3 compared to 36% of patients in thrombus aspiration group and 20% of patients in the control group, with proven significant increase in the number of patients with mbg 3 in infusion catheter group as compared to the other 2 groups (p value = 0.002). also the infusion had ctfc shorter than the aspiration and control group (20.76 4.44 versus 26.68 8.40 and 28.16 5.96), respectively (p value = 0.001) (figure 1). there was no significant increase in the number of patients with timi 3 flow in the infusion catheter group (84% versus 80% of patients in both thrombus aspiration and control groups) (p = 0.916). to the best of our knowledge, this is the first study comparing local delivery of intracoronary eptifibatide using infusion catheter to the use of thrombus aspiration in primary pci in patients with acute stemi. we started this work to evaluate the newly introduced device (perfusion catheter) regarding its efficacy in management of thrombus containing lesion. intracoronary eptifibatide is associated with improved microvascular perfusion demonstrated by an improved ctfc in the ice trial. the presence and lowering wmi of high localized concentration of drug may permit the dissociation of the bound fibrinogen with platelets to form the occlusive thrombus. hence microvascular perfusion may be improved by reducing both the number and size of microemboli. this mechanism was seen in in vitro studies modeling coronary flow [11, 12 ]. further more recent studies have demonstrated that higher concentrations of gp iib / iiia receptor antagonists are necessary to effectively disaggregate stable and aged aggregates compared with newly formed thrombi. also, intracoronary verapamil injection is beneficial in preventing no - reflow / slow - flow, reducing ctfc, and improving mpg. the current study showed that intracoronary eptifibatide was significantly superior to using thrombus aspiration catheter and to conventional pci ; as regards myocardial reperfusion expressed by mbg, 68% of patients in the local drug delivery arm had mbg 3 versus 36% and 20% of patients in the other groups, respectively. the crystal ami study (a pilot study before infuse ami) shows similar results, while coctail study found a nonsignificant increase in mbg with use of infusion catheter, and also the infuse ami trial did not find significant difference between its groups as regards mbg. crystal ami, which compared iv abciximab and intracoronary abciximab in 50 patients with stemi, showed that intracoronary abciximab catheter led to better myocardial perfusion as shown by higher number of patients with mbg 3 score compared to iv abciximab (75% versus 45%, resp.). the coctail study, which randomized 50 patients with non - st segment elevation myocardial infarction to administration of abciximab by local intracoronary infusion versus intracoronary infusion through guiding catheter, found a nonsignificant increase in mbg compared to ic abciximab infusion through guiding catheter. the infuse ami evaluated the use of intracoronary abciximab and aspiration thrombectomy (export catheter) in 452 patients undergoing primary pci for anterior stemi and did not find significant difference between ic abciximab and the other arm as regards mbg scores. this finding may be related to the structure of the infuse ami trial itself, where part of the group of patients who did not receive ic abciximab underwent thrombus aspiration by export, hence decreasing thrombus load and improving mbg scores. in addition one limitation concerning infuse ami trial was that all patients had only anterior stemi. in the present study postprocedural timi flow did not reach statistical significance ; this is similar to results of coctail and crystal ami studies. also, our study showed that the intracoronary eptifibatide group had better myocardial perfusion results assessed by significantly less ctfc rates than thrombus aspiration and control groups (20.76 4.44 versus 26.68 8.40 and 28.16 5.96, resp.). these results are concordant with the results of coctail study, while the infuse ami trial did not find significant effect for using perfusion catheter on ctfc rates after procedure. the coctail study illustrated significantly lower ctfc rates in group with intracoronary abciximab via infusion catheter compared to group with intracoronary abciximab delivered via guiding catheter (15.3 10.2 versus 21.1 9.9, p = 0.049). the results obtained by this study showed a good safety profile of the infusion catheters with promising results that may improve clinical outcome and decrease thrombus burden and complications related to microvascular occlusion. the small number of the patients is the main limitation of this study as is it was not large enough to increase the power of our results ; however this field is really interesting and further larger scaled studies are needed to prove or disprove the results in this study. | objectives. we compared local delivery of intracoronary eptifibatide via perfusion catheter to thrombus aspiration in primary pci. background. perfusion catheter increases local concentration of the drugs at the culprit site and prolongs their residency time. methods. 75 patients with acute stemi were randomized to three groups : 25 received local intracoronary eptifibatide and verapamil via perfusion catheter ; 25 patients were managed by diver ce thrombectomy device and 25 patients by primary pci without thrombus aspiration. primary end point was assessment of postprocedural timi flow, mpg, and corrected timi frame count (ctfc) in the culprit vessel. results. perfusion catheter was superior to thrombus aspiration and conventional pci as regards mbg (68% versus 36% in diver ce and 20% in the control arm ; p value = 0.002), with shorter ctfc rates than thrombectomy and control groups (20.76 4.44 versus 26.68 8.40 and 28.16 5.96, resp. ; p = 0.001). timi flow was not different between the 3 groups. eptifibatide led to less time to peak ck (13.12 hours versus 16.5 and 19.5 hours, respectively, p value = 0.001). conclusion. local intracoronary eptifibatide by perfusion catheter reduces thrombus burden with better results in microvascular perfusion assessed by ctfc and mbg compared to aspiration device or conventional pci. |
inflammatory arthritis (ia) is an umbrella term for several long - term, progressive musculoskeletal diseases, including rheumatoid arthritis (ra), ankylosing spondylitis (as), connective tissue disease (ctd), psoriatic arthritis (psa) and systemic lupus erythematosus (sle). ra is the most common of these diseases, affecting an estimated 580,000 people in england, with 26,000 new cases diagnosed each year (house of commons committee of public accounts, 2010). there is substantial evidence that ia can have an adverse psychological impact, including elevated levels of anxiety and depression (treharne., 2007). manifestations of anxiety include worrying, tension, rumination and avoidance behaviours for example, in relation to pain and fatigue. symptoms of depression include feelings of sadness, helplessness, and loss of feelings of pleasure and interest to the extent that they interfere with daily functioning (geenen., 2012). conservative figures suggest that the prevalence of depressive disorder in patients with ra ranges from 1320% (sheehy., 2006). in a systematic review and meta - analysis of 12 studies, depression was more common in patients with ra than in control respondents (dickens., 2002). although the majority of research to date has focused on serious psychological consequences such as clinical levels of anxiety and depression, it is recognized that most patients face a degree of psychological challenge. the occurrence of psychological distress that does not fulfil diagnostic criteria of anxiety and depression is estimated to be as high as 65% in patients with ra (vriezekolk., 2010). such psychological distress can be in relation to dealing with fluctuating physical symptoms (pain, fatigue, flares) ; restricted mobility and participation in valued activities ; emotional impact (changes to roles and relationships) ; and managing complex medication regimens (homer, 2005). a survey on the emotional impact of arthritis found that when arthritis pain was at its worst, 68% of respondents felt depressed and 50% felt helpless (arthritis care, 2011). research findings on the interaction of somatic and psychological factors in the development of depression and anxiety are mixed. there is growing evidence of pain and fatigue as predictors but controversy remains regarding the strength and causal direction of these associations (nagyova. one consistent finding is that disease status and disease activity alone are not good predictors of psychological distress (wolfe and hawley, 1993 ; curtis., 2005). influential psychological factors include illness beliefs, locus of control, social support, self - esteem, body image and coping strategies (groarke., 2004 ; homer, 2005 ; nagyova., 2005 ; zyrianova., 2011). the consequences of psychological difficulties include poorer quality of life, the loss of valued social roles, body image disturbance and a reduced capacity to work (jenkinson, 2009). in addition to the distress experienced by patients, there is evidence that depression can increase the burden on the healthcare system, through repeated consultations, reduced treatment adherence and poorer treatment outcomes (covic., 2006 ; hider., many of the psychological factors influencing adaptation to ia are amenable to intervention (astin., 2002). meeting psychological support needs can improve the quality of life of those affected and can result in economic benefits as fewer healthcare resources are used (sharpe. this evidence has led a coalition of charities working on behalf of people with long - term conditions, including arthritis research uk, to urge national policy - makers and clinical commissioning groups to provide access to services such as counselling and self - management programmes. they argue that prevention of psychological difficulties and support for self - management are key to reducing the impact of these diseases on individuals and society (arthritis research uk, 2012). the importance of addressing psychological needs is acknowledged in treatment guidelines from the national institute for health and care excellence (nice), which state that people with ra should be offered psychological interventions such as relaxation, stress management and cognitive coping skills, to help them adjust to living with their condition (national institute for health and care excellence, 2013). as the management of ia is still largely based in secondary care, the rheumatology team might be those best placed to provide such support (national audit office, 2009). in addition, the european league against rheumatism (eular) recommends that the role of the rheumatology nurse includes the provision of psychosocial and self - management support for patients with ia (van eijk - hustings., 2012). in practice, treatment of ia targets the underlying disease process and primary physical symptoms, while attention to psychological status and the psychosocial factors that might impact on the disease is inconsistent and fragmented (gettings, 2010 ; geenen., 2012). this was highlighted in a recent house of commons report, which identified significant gaps and variation in access to psychological services (house of commons committee of public accounts, 2010). the present study was a first step in matching recommendations to practice by scoping the psychological support currently available in rheumatology units across england and identifying the factors that help or hinder provision. scoping studies provide a broad overview of a topic, drawing on evidence from a range of sources, including key informants and stakeholders (abelson., 2008). the research team, comprising rheumatology and psychology clinicians, patient partners and researchers, undertook a brief descriptive survey using a questionnaire of closed and open - ended questions. the questionnaire was developed during research team discussions and shown to local rheumatology clinicians for feedback on its clarity and relevance. psychological support as covering any services that addressed social or emotional challenges in relation to rheumatic disease ; examples could include psycho - educational group programmes, clinics to support behaviour change and self - management, or the incorporation of psychosocial approaches into routine consultations by members of the rheumatology team. the aims were to identify the psychological support available in rheumatology units across england, and to identify key factors influencing service provision. the survey probed three areas in relation to psychological support in rheumatology units : current practice and provision, psychological skills within the team, and the resources required to deliver services. ethics approval to conduct the survey was obtained from the faculty research ethics committee at the university of the west of england, bristol (reference : hls/12/06/70). rheumatology units were identified via the nhs choices website, which lists the acute trusts in england. within each trust, contact details for their rheumatology unit were available under departments and services. a total of 143 questionnaires were sent, addressed to the nurse specialist or a named nurse, where known (19 hospitals). nurses from 73 units (51%) responded, including 15 using the email version. overall, 73% of respondents rated their unit 's psychological support provision as inadequate and 4% rated it as good (18% as adequate, 4% not sure and 1% did not answer) (figure 1). overall rating of psychological support provision while only 12% of respondents reported a team view that psychological support did not fall within the unit 's remit and only 19% expressed a preference to refer to psychological support elsewhere, very few rheumatology teams had a psychologist (8%). in relation to the detection of psychological difficulties, 27% units reported routinely screening patients, while 34% sometimes screened (33% did not, and 6% were not sure). among 42 (58%) respondents who answered an open - ended question about screening processes, 31 (42%) indicated that assessments were informal (for example, asking about mood and coping in clinic) and 11 (15%) reported that that they also used formal measures, such as the arthritis impact measurement scales 2 (aims2) (meenan., 1980), the hospital and anxiety depression scale (hads) (zigmond and snaith, 1983), the 36-item short form health survey (sf36) (ware and sherbourne, 1992) or a two - question depression screening tool. referrals to other service providers for psychological support, including clinical psychology services, gps, increasing access to psychological therapies (iapt) services, and liaison psychiatry, were reported in 42% of units, with 32% not referring, 22% sometimes referring and 4% not sure. where referrals were made, 3% were very satisfied with the provision (21% fairly ; 29% not very), while 14% were not sure and 33% did not answer. open - ended data about the reasons for dissatisfaction showed that they included long waiting lists, a limited service and local variations in availability. services that contained some elements of psychological support and were available within the responding rheumatology units included occupational therapy (81%), patient education programmes (58%), pain management clinics (30%), facilitated peer support groups for patients (30%), self - management clinics (27%) and psychology / counselling (14%) (figure 2). open - ended responses describing any other services available in the unit included nurse - led clinics following diagnosis, one - to - one counselling by a rheumatology clinical nurse specialist, psychological assessment for patients with ra as part of their annual review and support from the clinical nurse specialists via the telephone helpline. services available that contain elements of psychological support respondents reported that a range of psychological approaches were used by team members in their clinical role mainly shared decision - making and pain management skills (77% and 63%, respectively), followed by counselling (48%) and relaxation / mindfulness techniques (36%), while a quarter used cognitive behavioural (cb) approaches (26%) or motivational interviewing (mi ; 25%) (figure 3). responses to an open - ended question to describe any other skills showed that some team members were providing psychological support without formal training in specific approaches, and some clinicians expressed a need to receive additional support to utilize the training they had undertaken. psychological skills within the rheumatology team respondents identified the main current barriers to providing psychological support as a lack of clinical time, appropriately trained clinicians and available training (86%, 71% and 74%, respectively), and the costs of delivery (74%) (figure 4). open - ended data about any other barriers identified the following issues : difficulty getting commissioners to support and fund these servicesthe need for more nurses to support the number of patients requiring psychological supportthe pressure to reduce the number of follow - up appointmentsa concern that there was no one to refer the patient to if problems were identifiedan emphasis on addressing physical limitations of the conditionpatients reluctance to acknowledge and talk about psychological issues. difficulty getting commissioners to support and fund these services the need for more nurses to support the number of patients requiring psychological support the pressure to reduce the number of follow - up appointments a concern that there was no one to refer the patient to if problems were identified an emphasis on addressing physical limitations of the condition patients reluctance to acknowledge and talk about psychological issues. current barriers to psychological support provision in unit respondents identified that in the future, the main facilitators of support provision would be management and team support for psychological services (74% ; 68%), the availability of skills training for clinicians (74%), and integration of psychological support into the care pathway (73%) (figure 5). responses to an open - ended question about any other potential facilitators included the importance of recognition by the clinical commissioning groups that psychological support is an important part of patient care. future facilitators to psychological support provision in unit in relation to current resources, the responses of the three units which rated their provision as good showed that their available services included patient education, pain management, occupational therapy and a psychologist / counsellor / psychotherapist. one of these units had a dedicated health psychologist for the rheumatology team, another delivered facilitated peer support groups for patients and the third offered self - management / coping clinics for patients. in addition, one of these units made referrals to a psychologist for one - to - one or group sessions and was very satisfied with the service provision. there were numerous psychological skills in the teams at these three units ; in two of the units these included cb approaches, pain management and mindfulness / relaxation techniques, and in one unit it included mi and counselling techniques. while only 12% of respondents reported a team view that psychological support did not fall within the unit 's remit and only 19% expressed a preference to refer to psychological support elsewhere, very few rheumatology teams had a psychologist (8%). in relation to the detection of psychological difficulties, 27% units reported routinely screening patients, while 34% sometimes screened (33% did not, and 6% were not sure). among 42 (58%) respondents who answered an open - ended question about screening processes, 31 (42%) indicated that assessments were informal (for example, asking about mood and coping in clinic) and 11 (15%) reported that that they also used formal measures, such as the arthritis impact measurement scales 2 (aims2) (meenan., 1980), the hospital and anxiety depression scale (hads) (zigmond and snaith, 1983), the 36-item short form health survey (sf36) (ware and sherbourne, 1992) or a two - question depression screening tool. referrals to other service providers for psychological support, including clinical psychology services, gps, increasing access to psychological therapies (iapt) services, and liaison psychiatry, were reported in 42% of units, with 32% not referring, 22% sometimes referring and 4% not sure. where referrals were made, 3% were very satisfied with the provision (21% fairly ; 29% not very), while 14% were not sure and 33% did not answer. open - ended data about the reasons for dissatisfaction showed that they included long waiting lists, a limited service and local variations in availability. services that contained some elements of psychological support and were available within the responding rheumatology units included occupational therapy (81%), patient education programmes (58%), pain management clinics (30%), facilitated peer support groups for patients (30%), self - management clinics (27%) and psychology / counselling (14%) (figure 2). open - ended responses describing any other services available in the unit included nurse - led clinics following diagnosis, one - to - one counselling by a rheumatology clinical nurse specialist, psychological assessment for patients with ra as part of their annual review and support from the clinical nurse specialists via the telephone helpline. respondents reported that a range of psychological approaches were used by team members in their clinical role mainly shared decision - making and pain management skills (77% and 63%, respectively), followed by counselling (48%) and relaxation / mindfulness techniques (36%), while a quarter used cognitive behavioural (cb) approaches (26%) or motivational interviewing (mi ; 25%) (figure 3). responses to an open - ended question to describe any other skills showed that some team members were providing psychological support without formal training in specific approaches, and some clinicians expressed a need to receive additional support to utilize the training they had undertaken. respondents identified the main current barriers to providing psychological support as a lack of clinical time, appropriately trained clinicians and available training (86%, 71% and 74%, respectively), and the costs of delivery (74%) (figure 4). open - ended data about any other barriers identified the following issues : difficulty getting commissioners to support and fund these servicesthe need for more nurses to support the number of patients requiring psychological supportthe pressure to reduce the number of follow - up appointmentsa concern that there was no one to refer the patient to if problems were identifiedan emphasis on addressing physical limitations of the conditionpatients reluctance to acknowledge and talk about psychological issues. difficulty getting commissioners to support and fund these services the need for more nurses to support the number of patients requiring psychological support the pressure to reduce the number of follow - up appointments a concern that there was no one to refer the patient to if problems were identified an emphasis on addressing physical limitations of the condition patients reluctance to acknowledge and talk about psychological issues. current barriers to psychological support provision in unit respondents identified that in the future, the main facilitators of support provision would be management and team support for psychological services (74% ; 68%), the availability of skills training for clinicians (74%), and integration of psychological support into the care pathway (73%) (figure 5). responses to an open - ended question about any other potential facilitators included the importance of recognition by the clinical commissioning groups that psychological support is an important part of patient care. future facilitators to psychological support provision in unit in relation to current resources, the responses of the three units which rated their provision as good showed that their available services included patient education, pain management, occupational therapy and a psychologist / counsellor / psychotherapist. one of these units had a dedicated health psychologist for the rheumatology team, another delivered facilitated peer support groups for patients and the third offered self - management / coping clinics for patients. in addition, one of these units made referrals to a psychologist for one - to - one or group sessions and was very satisfied with the service provision. there were numerous psychological skills in the teams at these three units ; in two of the units these included cb approaches, pain management and mindfulness / relaxation techniques, and in one unit it included mi and counselling techniques. the aim of psychological care in ia is to prevent and reduce distress which might be causing a negative impact on patients wellbeing and ability to manage their illness and its impact effectively. the postal survey in the present study was designed to scope the psychological support provision available in rheumatology units across england. it was undertaken because treatment guidelines recommend that patients are offered psychological support, yet there are no data on current provision. the claim has been made that in long - term conditions generally, patients do not receive care that addresses both their physical and psychological needs for reasons, including : a lack of clinician training in psychological awareness, assessment and management, and patchy service design and provision (nhs confederation, 2012). the present survey found that the majority of respondents supported this view and rated their unit 's current psychological support provision as inadequate. historically, rheumatology services have been configured around a biomedical model of care that focused primarily on increasingly, the need to heighten rheumatology teams awareness of the psychological aspects of ia and to find ways of incorporating psychological approaches into routine clinical practice has been acknowledged (keefe and somers, 2010). this is based on the understanding that disease management is strengthened when psychological input is part of care (naylor., 2013). the present findings suggest that respondents were aware of the psychological challenges faced by patients with ia and viewed addressing them as part of their remit, but struggled to deliver adequate services. respondents reported that the main challenges included a lack of clinical time and available training, and the cost of delivering psychological support. in their view, service improvements could be facilitated by management support and increased skills training. a first step to meeting psychological needs is the detection of psychological distress (currid, 2012). although it has been proposed that screening should become part of routine clinical care in rheumatology (nichol and zhang, 2005), this was not common practice in the majority of units surveyed. once needs have been determined, the question arises of who addresses them and in which setting. this survey found that very few rheumatology teams had a psychologist, with almost half of respondents referring patients to other service providers. there were low levels of satisfaction with these referrals, often due to difficulty in accessing appropriate services in a timely manner. in addition, over one - third of respondents did not state whether or not they were satisfied. this might indicate that once the referral had been made, the rheumatology team was not informed of the subsequent outcome. in a stepped approach to care, patients are treated at the lowest appropriate intervention in the first instance, only stepping up to more intensive or specialist services as clinically required (bower and gilbody, 2005). this offers clinical and financial advantages that can benefit patients, local trusts and commissioners. a model of enhanced support provision in rheumatology could involve a two - pronged approach : developing the psychology - based skills and confidence of rheumatology clinicians to support the majority of patients who do not require intense input ; plus strengthening links with local specialist services (e.g. clinical psychology and liaison psychiatry) for the minority of patients experiencing high levels of psychological difficulty. this would fit well with recent research supporting the idea that the rheumatology team, with their understanding of ia and its treatment, can play a vital therapeutic role in helping patients to increase their sense of control and improve their quality of life (hill and ryan, 2000 ; dures and gilbody, 2012). it would also reflect eular recommendations that specialist and practice nurses and other allied health professionals should be trained to provide support to patients with ia on managing the emotional impact of their condition (van eijk - hustings., 2012). a focus on developing appropriate training would fit with respondents identification of a lack of available training as a current barrier to psychological support provision. just over a quarter of units reported delivering self - management clinics and only 14% offered counselling, suggesting that these approaches are still not common practice. although training clinicians to incorporate psychology skills into their role is a fairly new area within rheumatology, there is evidence emerging that training can impact positively on clinicians confidence to address psychosocial issues in the consultation (dures. the efficacy of non - psychologists using a range of less intensive skills and approaches to support patients is currently being evaluated in several clinical areas, such as palliative care and chronic obstructive pulmonary disorder (mannix., 2006 ; the survey found that even those units whose team members used some psychological approaches, typically rated their provision as inadequate. one possible explanation is that respondents felt that provision was inadequate in relation to supporting a particular group of patients for example, those with higher levels of distress. this would reinforce a stepped - care strategy of improving access to specialist psychology services. another possible explanation is the role and influence of the wider team on the implementation of psychologically informed practice. for example, research found that shared decision making was less effectively implemented when it was not a whole team activity and there were diverse and conflicting attitudes among team members (king., 2013). the perceived barrier of a lack of managerial support contributes to the evidence of the need to adopt a whole - systems model, based on the requirements of patients, clinicians and organizations, when introducing changes to clinical practice (eaton., 2012). research with gps concluded that to utilize fully their training in patient - centred approaches, they required the support of practice level systems and structures (robertson., 2013). several limitations to the present study have implications for the generalizability of the conclusions that can be drawn. in the majority of cases, the survey packs were addressed to the nurse specialist, who was not named. among the units that did not respond (49%), it is not known whether they chose not to participate or whether the pack did not reach the addressee. for those who took part, it is not known whether they consulted colleagues before responding on behalf of the team, or whether answers reflected their individual perceptions of service provision for example, the extent of routine screening or satisfaction with other service providers. a definition of psychological support was included in the survey, but the questions and the terminology used might have been interpreted differently between respondents. in the final question, respondents were asked to rate the adequacy of their unit 's psychological support provision ; this was a subjective evaluation as no set criteria were provided. in addition, the survey asked about the support available within rheumatology units but it is possible that, in some locations, team boundaries are not clear cut for example, occupational therapists who work in several hospital departments. strengths of the study included the high number of units in england that were approached, and the input from patient partners (jc and ap) in the design and interpretation of the survey. the present scoping study on psychological support in rheumatology reinforced the evidence from a range of long - term conditions that service provision is patchy, and suggests that nice treatment guidelines are not being met. most rheumatology units viewed psychological support provision as part of their remit but perceived a lack of resources in relation to time, training and cost. despite some team members using psychological skills in their role, units rated their overall provision as inadequate. to improve provision requires a whole - systems approach that addresses the training needs of clinicians and teams, understands patients views on services, and builds organizational support for implementation. the lack of psychologists in rheumatology units, the low levels of satisfaction with other service providers, and the eular recommendation that nurses provide psychosocial support all highlight the value of testing whether the usual team can be effective in this capacity. further research is needed to understand what constitutes adequate psychological support provision from clinical and patient perspectives, and whether patients perceive that they are being offered this. | objectivesthe consequences of inflammatory arthritis can include depression, anxiety and low mood, reducing patients quality of life and increasing pressure on the healthcare system. treatment guidelines recommend psychological support, but data are lacking on the provision available.methodsa postal survey concerning psychological support provision was sent to rheumatology units in 143 acute trusts across england. nurses from 73 rheumatology units (51%) responded.resultsoverall, 73% rated their unit 's psychological support provision as inadequate and only 4% rated it as good. few units believed that psychological support did not fall within their remit (12%), yet only 8% had a psychologist in the team. most units (68%) did not routinely screen patients to identify psychological difficulties. referral to other service providers was reported in 42% of units, with 3% very satisfied with this provision. within units, services containing elements of psychological support ranged from occupational therapy (81%) to psychology / counselling (14%). psychological approaches used by team members ranged from shared decision making (77%) to cognitive behavioural approaches (26%). the current barriers to providing psychological support were lack of clinical time and available training (86% and 74%, respectively), and delivery costs (74%). future facilitators included management support (74%) and availability of skills training (74%).conclusionsrheumatology units viewed psychological support provision as part of their remit but rated their overall provision as inadequate, despite some team members using psychological skills. to improve provision, clinicians training needs must be addressed and organizational support generated, and further research needs to define adequate psychological support provision from the patient perspective. 2014 the authors. musculoskeletal care published by john wiley & sons ltd. |
the rare side effects are aplastic anemia, peripheral neuropathy, liver toxicity, pulmonary toxicity, and stevens johnson syndrome (sjs). drug reaction with eosinophilia and systemic symptom (dress) due to nitrofurantoin may be life - threatening which is reported very rarely. a 34-year - old female patient was presented to our medicine emergency with acute skin rashes all over body for 4 days, fever for 3 days, and decreased urine output for 2 days, followed by dizziness. on detailed history, we found that she was on nitrofurantoin 100 mg thrice a day for uti for 6 days, prescribed by a general physician. she was a known case of type ii diabetes mellitus, and blood sugar was controlled with drugs. physical examination revealed bilateral cheilitis [figure 1 ] and pruriginous maculopapular eruptions with desquamation spread all over the body, predominantly over extremities [figure 2a and b ]. vital signs were as temperature 102f (febrile), pulse rate 102/min (tachycardia), respiratory rate 20/min (tachypnea), blood pressure 86/64 mmhg (hypotension), and spo2 87%. serology of hepatitis a virus, hepatitis b surface antigen, and hepatitis c antibody were negative. cheilitis over both angles of mouth (a and b) maculopapular eruptions with desquamation seen on bilateral hands and lower limbs laboratory parameters of patient the aforementioned case was in accordance with a clinical condition as dress syndrome associated with nitrofurantoin therapy involving the skin, kidneys, lungs, and hematological abnormalities. severe skin reaction with systemic symptoms may be challenging to diagnose by clinicians because of clinically close differential diagnosis of toxic epidermal necrolysis and sjs. dermatology opinion was taken, and the case was managed on the line of dress syndrome. once the diagnosis was established with the help of clinical features and investigations, nitrofurantoin was stopped immediately. urine production increased on the same day and was in adequate amount the next day. she made an uneventful recovery, and no sequelae were found during subsequent follow - up for 2 months. in 1950, chaiken described dress syndrome first, and he called it the drug - induced hypersensitivity syndrome. it has an incidence of 1 in 100010,000 exposures to drug and death rate of about 10%. in 1996 drug rash with eosinophilia and systemic symptoms to describe patients exhibiting a drug - induced condition characterized by an extensive rash, fever, lymphadenopathy, hematological abnormalities, hepatitis, and involvement of the kidneys, lungs, heart, or pancreas. it may appear in an acute fashion or with a delayed onset (26 weeks after drug administration. the cutaneous manifestations in dress are urticaria, maculopapular eruption ; however, in some instances, vesicles, bullae, pustules, purpura, target lesions, facial edema, cheilitis, and erythroderma may be there. desquamation / scaling may occur with healing. while, visceral involvement are as hepatitis, pneumonitis, myocarditis, pericarditis, nephritis, and colitis which remains the major cause of morbidity and mortality in this syndrome. hematological manifestations may be leukocytosis with eosinophilia (90%) and/or mononucleosis (40%). literature has showed has that the severity of organ dysfunction does not always correlate with the extent of skin involvement. this syndrome is most frequently seen in association with anticonvulsants and antibiotic agents. a number of drugs including anticonvulsants - carbamazepine (phenytoin, lamotrigine, zonisamide, and phenobarbital), antibiotic agents (sulfonamides, minocycline, and cefadroxil), anti - inflammatory agents (salazosulfapyridine and sulfasalazine), antiretroviral drugs (nevirapine and abacavir), and others fluoxetine, calcium channel blockers, imatinib, nonsteroidal anti - inflammatory drugs, allopurinol, mexiletine, hydroxychloroquine, esomeprazole, efalizumab, ranitidine, sorbinil, gold salt, zalcitabine, thalidomide, and dapsone. the diagnostic criteria are based on clinical and laboratory findings as mentioned [table 2 ]. dress syndrome can be diagnosed if all three of following criteria are present. these are (1) cutaneous eruption ; (2) absolute eosinophilia (1500/l) with or without atypical lymphocytes ; and (3) systemic involvement (lymphadenopathy 2 cm, aspartate aminotransferase 2 upper limit, interstitial nephritis, interstitial pneumonitis, or carditis). the skin biopsy findings may be lymphocytic infiltrate with or without eosinophils in the papillary layer of the dermis. diagnostic criteria of dress syndrome the pathogenesis of dress syndrome is not well clear and is hypothesized to consist of a complex interaction of the following which includes detoxification defects leading to reactive metabolite formation and subsequent immunological reactions slow acetylation, and reactivation of human herpes including epstein barr virus and human herpesvirus-6 and -7. other types of viral infection were also reported such as cytomegalovirus reactivation and paramyxovirus infection. it is hoped that further research may define pharmacogenetic disease susceptibility markers to identify people at high risk of developing hss / dress. it is thought that organ involvement is due to eosinophilic accumulation which acts probably by inhibition of interleukin 5. unfortunately, use of corticosteroids in the management of dress is not well - supported by strong evidence - based data. our case fulfilled the diagnostic criteria of dress syndrome with dermatology opinion. to our best knowledge, there are only few cases of nitrofurantoin - induced dress syndrome and no report from india. many drugs have been reported causing dress syndrome in india ; at present, nitrofurantoin has also included in this category. therefore, the patient must be counseled for an adverse reaction before starting any drug. | drug reaction with eosinophilia and systemic symptom (dress) is a severe adverse drug - induced reaction with a prolonged latency period which is characterized by a variety of clinical manifestations, usually fever, rash, lymphadenopathy, eosinophilia, and a wide range of mild - to - severe systemic presentations. drugs are an important cause of dress in most of the cases. it is challenging to diagnose dress because of the diversity of cutaneous eruption and visceral organs involvement. we hereby report a 34-year - old female who developed dress syndrome following ingestion of nitrofurantoin for the treatment of urinary tract infection. she was managed conservatively and recovered after few weeks. our aim of this study is to raise awareness to suspect dress syndrome in patients who present with unusual clinical features with skin involvement after initiating any drug. |
the burden from glaucoma disproportionately affects individuals of african ancestry who are at much greater risk of developing glaucoma (seddon 1991 ; tielsch 1991 ; sommer 1991 ; sommer 1996) and blindness from glaucoma (javitt and al 1991). glaucoma remains the leading cause of irreversible blindness among blacks, while it is the third leading cause among whites. the reason for this differential burden is multifactoral and incompletely understood. while, socioeconomic disparity, differences in healthcare access, and differences in both systemic comorbidities and ocular parameters such as corneal thickness all play some role, the hypothesis central to our investigations is that variation in the structure of the optic nerve remains an important and critical factor in the more aggressive disease seen in this at - risk underserved population. this paper will review the literature concerning racial variation in the structure of the optic nerve between blacks and whites and the impact these differences may have on diagnosis and follow - up of glaucoma and possible implications for pathogenesis in this at - risk population. medical researchers and clinicians often categorize patients and research subjects by race in order to recognize differences in susceptibility to disease, to determine differing medical needs, and to highlight health disparities (williams and rucker 2000). however, several authors have raised questions as to the validity of racial classification in the strict biologic sense (goodman 2000). additionally, the history of the use of the term race, especially with regards to attempts to define race on a genetic basis, is full of examples of misuse in both scientific and political circles (la veist 1996). in response to these concerns however, cultural distinctions as well as racial ones define ethnicity (hahn and stroup 1994). thus ethnicity may be even more ambiguous to define than race (williams 1996). clearly there are limitations with using this definition and self - described race is a term that represents an amalgam of cultural, geographic, socioeconomic, and biologic characteristics and is at best an incomplete summary of human biodiversity that can not be interpreted in the strict biologic sense (sommer 2003). however, self - described race has demonstrated dependent and independent associations to glaucoma along with several other ocular and systemic conditions, thus it remains an important and relatively accessible factor (tielsch 1991). several researchers have used more sophisticated genetic methods to describe racial variation using multiple assays of single nucleotide polymorphism haplotypes (snps) to develop a profile of genetic admixture (smith 2001 ; rosenberg 2002 ; gower 2003 ; shriver 2003). these admixture profiles correlate highly to the biogeographic structure of human populations and can be used to summarize the genetic ancestry of mixed populations. initial experience using these techniques with subjects participating in our studies has clearly demonstrated the imprecision of self - describe race to determine ancestral history (figure 1). fortunately, genetic admixture estimates of ancestral origin, generally correlate highly to self - described race, which is much easier to obtain, and thus self - described race is probably an adequate surrogate for molecular biologic testing in many situations (rosenberg 2002). while race is a tenuous biologic concept, many researchers consider that the influence of race on the delivery of medical care and clinical science is so strong that information regarding race should still be collected in clinical studies, with the acknowledgment that it is an imprecise and poorly understood measurement (sommer 2003 ; wilson 2003). we share this view and while the literature supports a significant relationship between self - described race and glaucoma, the causal factors for this association and how it is mediated remains poorly understood. however, we have continued to use self - described race in our research and are of the opinion that this can provide useful information as long as this information is obtained using standardized methodology. several clinical and histological studies have characterized racial differences in optic disc structure between blacks and whites. quantitative evaluation of conventional optic disc photography from the baltimore eye survey demonstrated that mean optic disc area was 12% larger in blacks compared to whites (varma 1994). cup area was larger as well. while global rim area was similar in both racial groups, due to the relatively larger optic disc in blacks, there was a decrease in rim / disc area, indicating that there may be a decrease in rim thickness and nerve fibers relative to disc size in this population. in a smaller study including 200 normal subjects, also using disc photography, beck and colleagues also demonstrated that there was an increase in cup - to - disc ratio in blacks relative to whites (beck 1985). finally, a post - mortem histological study of 30 white and 30 black eye donors demonstrated a larger vertical diameter of the optic disc, but not in horizontal diameter in the black group (quigley 1990). optic disc and nerve fiber layer imaging techniques have evolved out of an attempt to acquire quantitative objective topographic information regarding optic disc structure and in - vivo measurements of retinal nerve fiber layer thickness in order to improve the ability to detect glaucoma and progressive glaucomatous damage. current studies evaluating these instruments have previously been performed in predominantly white study populations and have not included adequate numbers of black subjects to evaluate the role of quantitative optic disc analysis, the parameters that are most predictive of glaucoma, and optimum analysis strategies for detection of glaucoma in this at risk population. differences in optic disc structure between blacks and whites may have an effect on the ability of optic disc and nerve fiber layer imaging techniques to detect glaucoma. broadway demonstrated that the discriminating ability of confocal scanning laser ophthalmoscopy (cslo) varied depending on the phenotype of optic disc damage present (broadway 1998). in addition, iester (1997) demonstrated that optic disc area has an effect on the diagnostic precision of the cslo. this is an important consideration in that one of the primary reported differences in optic disc structure between blacks and whites is disc area (varma 1994). we recently compared the cslo results between 146 eyes from black subjects and 97 eyes from white subjects, and found similarly that blacks had significantly greater optic disc area, cup area and volume, and similar rim area and volume (girkin 2005). additionally, black subjects had a deeper optic disc cup than whites. following adjustment for racial variation in disc area, there was no significant difference between racial groups other than cup depth, indicating that most of the normal variation in optic disc topography between blacks and whites seen with the cslo is due to differences in disc area except for differences in cup depth (table 1). we hypothesized that those methods that account for disc area should perform similarly across racial groups and the moorfields classification (wollstein 2000), which takes disc area into account, performed with similarly specificity in each racial group in this study. in an additional conducted study to determine the structural characteristics of the optic disc that are associated with early glaucoma in blacks and whites and whether these characteristics differ between these races (girkin 2003), parameters of optic disc topography from 260 eyes from black participants and 193 eyes from white participants were included in the analysis. a staged multivariable logistic regression model was used to calculate the association between glaucoma and cup, rim and disc margin parameters. to account for the effect of differences in optic disc area, this parameter was included in the multivariable model at each level of interaction in constructing the final model. to account for the intercorrelation of eyes within persons, this study found similar racial differences between normal control subjects with cslo than prior studies using photography. these differences included a larger disc area, cup - to - disc ratio, rim area and cup area in blacks. additionally we found several other cslo parameters that were significantly different in the black control group including greater cup depth, and a thicker nerve fiber layer measurement. this study demonstrated racial differences exist in the optic disc structural parameters that are independently predictive of early glaucoma between blacks and whites even when accounting for differences in optic disc area. while the most predictive parameter, rim area, was the same for each racial group, the magnitude of association was higher in whites. differences in disc area does account for some of these racial differences ; however, residual differences still persist. overall, the summary odds ratios based on the most predictive cslo parameters demonstrated a lower association with glaucoma in blacks, even when adjusted for the effect of disc area. these differences in the relationship between optic disc structural and visual functional measures between black and whites indicate that topographic features of the optic disc convey different information with regards to assessing the risk of early glaucoma in differing racial groups, which should be considered in the statistical judgment of disease status based on these parameters. racial variation on optic nerve structure may have a significant impact on the ability to detect glaucoma by subjective and objective techniques. larger optic nerves have a larger scleral canal and consequently larger optic cups for the same rim volume and number of retinal nerve fibers. thus, a larger nerve is more likely to be misconstrued as glaucomatous on casual observations, whereas a smaller nerve with a small degree of glaucomatous cupping may be overlooked as normal. differences in optic disc structure between blacks and whites may have an effect on the ability of optic disc and nerve fiber layer imaging techniques to detect glaucoma. broadway demonstrated that the discriminating ability of the cslo varied depending on the phenotype of optic disc damage present (broadway 1998). in addition, iester (1997) demonstrated that optic disc area has an effect on the diagnostic precision of the cslo. this is an important consideration in that one of the primary reported differences in optic disc structure between blacks and whites is disc area (varma 1994). our prior studies using the cslo have also demonstrated that racial variations in optic disc structure had little impact on the ability of structural parameters and discriminant functions to detect glaucomatous visual field defects. however, differences in normative values required race - specific cutoff values to optimize specific detection strategies (deleon - ortega 2006). the widely used moorfields regression analysis, which takes in to account disc area, performed similarly across racial groups, but optic disc area had a significant impact on the diagnostic efficacy of this technique with more patients incorrectly diagnosed as glaucomatous who had larger optic nerves, probably reflecting the normative database used to develop this technique (girkin 2006). since the biomechanical behavior of any object is determined by its morphology and its material properties, there are potentially important biomechanical implications with the variations in optic disc morphology our group and others have described. while little is currently known regarding the impact of variations in optic disc anatomy and the susceptibility of glaucoma, preliminary computational modeling of the biomechanical behavior of the lamina cribrosa and posterior scleral has suggested that the laminar connective tissue may experience greater intraocular pressure - related stress and strain in idealized eyes with larger optic disc area (bellezza 2000). thus the larger optic nerve found more commonly in patients of african ancestry may experience greater strain at similar levels of pressure. additionally, the findings of a deeper cup in patients of african ancestry may relate to either a thinner lamina cribrosa or a more posterior insertion of the lamina within the scleral wall (girkin 2005). the impact of these morphologic variations has yet to be explored. the field of biomechanical modeling of the optic nerve connective tissues is rapidly developing and will add to our understanding of the impact of variation in the microarchitecture of the optic nerve on the biomechanical behavior of the critically supportive connective tissue that are important to the development of glaucoma. while socioeconomic differences, disparities in health care access, and differences in disease awareness, along with several differences in potential systemic risk factors all play a role in the higher prevalence of glaucoma in african - americans, ocular characteristics (primarily in central corneal thickness and in optic disc structure) may explain the increased risk of glaucoma in this population. as our clinical ability to detect glaucomatous progression improves with the further evolution of ocular imaging and physiologic testing, these ocular differences between blacks and whites are important to recognize and evaluate in longitudinal trials, if this new information is to be applied for maximal benefit in this at - risk population. the exact role of these racial differences in nerve structure in the variation in susceptibility to glaucoma remains to be elucidated. | glaucoma disproportionately affects individual of african ancestry. additionally, racial differences in the optic nerve head have been well described that may alter the vulnerability to intraocular pressure related injury and, in addition, alter the clinical ability to detect the presence of early optic nerve injury. this paper will review the literature describing racial differences in the optic nerve head between individuals of african and european ancestry with regards to the potential effects of these differences on the ability to detect glaucoma in different racial groups and to potential differences in the pathogenesis of glaucomatous injury. |
inflammation plays a major role in rheumatoid arthritis and osteoarthritis. in clinics, the nonsteroidal anti - inflammatory drugs (nsaids) are commonly prescribed for pain relief in arthritic conditions. however, their continual use is associated with serious adverse effects like gastric mucosal damage, occult blood loss and elevation of serum hepatic transaminases, salt and water retention, and also exacerbation of asthma. in order to circumvent these adverse effects associated with conventional nsaids, novel selective cox-2 inhibitors are in progress. however, the development of serious adverse reactions, like cardiovascular events with rofecoxib and stevens - johnson syndrome with valdecoxib, has compelled their withdrawal from use. additionally, the clinical uses of the remaining drugs in this class have been prescribed with caution and have consequently decreased. in milieu of these observations patients as well as health care providers prefer to use alternative therapeutic agents as they are considered to be safe and effective in alleviating inflammation associated with arthritis. several indian medicinal plants were reported as an important source of new chemical moieties with potential therapeutic effects. the studies on plants with substantiated folkloric use as anti - inflammatory agents are viewed as a productive and logical research strategy in the search for new anti - inflammatory drugs emblica officinalis gaertn. (euphorbiaceae) commonly known as amla grow in the tropical areas of south - east asia. the fruit of the plant is one of the most important medicinal ingredients used in ayurveda, siddha, unani, arabic, tibetan, and various other folk systems for the management of myriad chronic ailments. experimental studies have shown potent antioxidant, analgesic, antipyretic, adaptogenic, immunomodulatory, and antiulcerogenic activities of the fruit of emblica officinalis [68 ]. the fruits are reported to contain thermostable vitamin c, minerals, amino acids, tannins, flavonoids, and other important phytochemicals which are believed to possess diverse pharmacological and biological effects. earlier studies have shown that the leaf extract possesses anti - inflammatory activities in the carrageenan and dextran - induced rat hind paw edema. however, studies on the fruit extract which is the most used part of amla have never been performed. therefore, the present study was carried out to evaluate the anti - inflammatory activity of the hydroalcoholic extract of the fruit of emblica officinalis (haeeo) in both acute and chronic models of inflammation in rats. further, in order to understand the possible underlying mechanism, the effect of extract on the oxidative stress produced by carrageenan was also studied in the rat paw. the standardized lyophilized hydroalcoholic extract of the fruit of emblica officinalis (haeeo) was procured from sanat products limited, india (a who - gmp and iso 9001 accredited herbal extract manufacturer company). the voucher specimen of lyophilized extract of the fruits of emblica officinalis (number eo 0114) was deposited at department of pharmacology, all india institute of medical sciences, new delhi, india. the phytochemical analysis was done by using hplc (waters, milford massachusetts, usa). the extract obtained was of the highest purity with 28.26% w / w of hydrolysable tannins emblicanin a and emblicanin b on dried weight basis. carrageenan, histamine, 5-hydroxytryptamine (serotonin), chlorpheniramine, cyproheptadine, prostaglandin e2 (pge2), and bovine serum albumin were purchased from sigma chemicals, st. all experimental procedures described were reviewed and approved by the institutional animal ethics committee and care of animals was taken as per guidelines of cpcsea, ministry of environment and forest, government of india. wistar albino rats of either sex weighing 180200 g were used for the study. the animals were procured from the central animal facility in all india institute of medical sciences, new delhi. the rats were group - housed in polypropylene cages with no more than four animals per cage. they were maintained under standard laboratory conditions with natural dark - light cycle and were allowed free access to standard pellet diet (golden feeds, india) and tap water ad libitum. all the experiments were carried out using five groups, each containing 6 animals (groups i v) except carrageenan - induced paw edema where groups i vi were used. acute inflammation was produced by injecting 0.1 ml of carrageenan (1% in saline) locally into the plantar aponeurosis of the right hind paw of the rats [11, 12 ]. groups ii and iii received vehicle (saline 1 ml / kg, i.p.) and standard drug indomethacin (10 mg / kg, p.o.), respectively, and served as vehicle and positive controls. haeeo (300, 500, and 700 mg / kg, i.p.) was administered to groups iv, v, and vi, respectively. the haeeo or vehicle was administered 30 min prior to injection of carrageenan and indomethacin was orally administered 1 h prior to the injection of carrageenan. the pedal volume up to the ankle joint was measured using a digital plethysmometer (ugo basile, 7140 comerio, varese, italy) at 0 h (just before carrageenan injection) and then at 3 h. the different timing was chosen because of the different route of drug administration. the % inhibition of edema volume between treated and control groups was calculated as follows : % inhibition = vc vt 100/vc, where vc and vt represent the mean increase in paw volume in control and treated groups, respectively. this experiment was conducted according to the method described by singh and pandey. the autacoids serotonin (1 mg / ml), histamine (1 mg / ml), and prostaglandin e2 (1 g / ml) were employed as phlogistic agents. the effect of haeeo (300, 500, and 700 mg / kg, i.p.) and vehicle was tested individually against each autacoid. the anti - inflammatory effect of haeeo was compared with that of standard drugs against each autacoid : phenylbutazone (pbz, 100 mg / kg, p.o.) against prostaglandin e2, chlorpheniramine (cpm, 3 mg / kg, p.o.) against histamine, and cyproheptadine (cph, 3 mg / kg, p.o.) against serotonin. right hind paw edema was induced by the subplantar injection of 0.1 ml of different phlogistic agents in the respective groups. the pedal volume was measured just before (0 h) and then at 3 h after the phlogistic challenge. the cotton pellet - induced granuloma in rats was studied according to the method of d'arcy.. the rats were anaesthetized and sterile cotton pellets weighing 10 1 mg were implanted subcutaneously into both sides of the groin region of each rat. haeeo in the doses of 300, 500, and 700 mg / kg, i.p. was administered to animals in groups ii, iii, and iv for seven consecutive days from the day of cotton pellet implantation. group v received indomethacin (10 mg / kg, p.o.) for the same period. on day 8, the animals were anaesthetized and the pellets together with the attached granuloma tissue were carefully removed and freed from extraneous tissues. the wet pellets were weighed and then dried in an oven at 60c for 24 h to a constant weight ; after that the dried pellets were weighed again. increment in the dry weight of the pellets was taken as a measure of granuloma formation. the biochemical markers of oxidative stress were determined in the carrageenan - induced rat paw edema model. animals were euthanized 3 h after measurement of paw volume and the inflamed paw tissue was removed and processed for the estimation of oxidative stress. paw tissue samples were thawed and homogenized with 10 times (w / v) ice - cold 0.1 m phosphate buffer (ph 7.4). aliquots of homogenates from paw tissue were used to determine the malondialdehyde (mda) and glutathione. the remaining homogenates were centrifuged at 7000 rpm for 30 min at 4c temperature and the supernatant was used for estimation of superoxide dismutase (sod), catalase, and protein. statistical differences between the treatment and the respective control groups were evaluated by one - way anova followed by tukey - kramer post hoc test. the mean increase in paw edema volume was 1.0 0.02 ml in the vehicle - treated control rats. all the three doses of haeeo (300, 500, and 700 mg / kg, i.p.) produced a dose - dependent significant (p < 0.001) reduction in the mean paw edema volume (figure 1). the percentage inhibition in paw edema volume as compared to the vehicle treated group was 48.9, 60.2, and 70.0% for haeeo, respectively. the standard drug, indomethacin (10 mg / kg, p.o.), exhibited maximum anti - inflammatory activity with 84.27% inhibition. carrageenan injection into the subplantar tissue of the rat paw decreased the tissue gsh, catalase, and sod levels (table 1). both haeeo and indomethacin produced a significant increase in the endogenous antioxidants in a dose dependent manner to maintain oxidative homeostasis. carrageenan injection produced significant lipid peroxidation, as evidenced by a marked increase in the levels of mda. haeeo at 700 mg / kg dose most effectively stabilized the oxidative stress parameters. a dose - dependent effect of haeeo on hind paw edema was observed. the 700 mg / kg dose of haeeo was the most effective (figure 1). it significantly (p < 0.001) inhibited hind paw edema induced by histamine (68.47%), serotonin (79.26%), and pge2 (64.00%). phenylbutazone (100 mg / kg, p.o.), chlorpheniramine (3 mg / kg, p.o.), and cyproheptadine (3 mg / kg, p.o.) also significantly (p < 0.001) inhibited hind paw edema induced by pge2 (92.00%), histamine (82.06%), and serotonin (89.56%), respectively (figure 1). the study of haeeo on proliferative phase of inflammation indicated that haeeo (300, 500, and 700 mg / kg, i.p.) significantly (p < 0.001) and dose - dependently reduced the granuloma formation (table 2). indomethacin (10 mg / kg, p.o.) exhibited significant (p < 0.001) and maximum inhibition on granuloma formation. in the present study, it was observed that emblica officinalis possessed potent anti - inflammatory activity both in acute and chronic rat models of inflammation. inflammation is part of the host defense system and is triggered by a variety of noxious stimuli. it involves a complex interplay between cell - cell, cell - mediator, and tissue interactions. carrageenan - induced rat paw edema model is a well - established model for evaluating anti - inflammatory drugs. the edema and inflammation induced by carrageenan are a biphasic event. in the initial 1 h after carrageenan administration, the edema and inflammation later, the increased vascular permeability is maintained by the release of kinins up to about 2.30 h. thereafter from 2.30 h to 6 h, inflammation is mediated by prostaglandins and is also associated with migration of leucocytes into the inflamed site. carrageenan - induced paw edema model in rats is known to be sensitive to cyclooxygenase (cox) inhibitors and has been used to investigate the effect of nonsteroidal anti - inflammatory agents. the result of the present study indicated that haeeo afforded protection against the carrageenan - induced acute inflammation in dose dependent manner. haeeo at a dose of 700 mg / kg exhibited significant anti - inflammatory activity with 70.0% inhibition of paw edema and was comparable to the indomethacin group. in autacoid - induced models of inflammations (against serotonin, histamine, and pge2), haeeo produced significant inhibitory activity. the present study exhibited haeeo 's anti - inflammatory action by means of inhibiting the synthesis, release, or action of inflammatory mediators like histamine, serotonin, and prostaglandins that are involved in inflammation. in earlier study on the anti - inflammatory activity of leaf extracts of emblica officinalis in carrageenan- and dextran - induced rat paw edema models, it was reported that the extracts did not inhibit the synthesis of the lipid mediators ltb4, txb2, or paf. therefore, it is quite possible that a composite effect may have been responsible for the observed protection against autacoids - induced inflammation. the role of excess generation of nitric oxide (no) in inflammatory response is well studied. inflammation or tissue damage leads to induction of inos (inducible nitric oxide synthase) ; consequently large amounts of no are generated at the site of inflammation. no reacts with superoxide anion to form peroxynitrite, an oxidizing molecule capable of eliciting lipid peroxidation. in lipid peroxidation there is oxidative deterioration of polyunsaturated lipids to form radical intermediates that causes cellular damage. mda is a major end product of this reaction and an index of lipid peroxidation that is measurable by estimating as thiobarbituric acid reactive substance (tbars). the present study showed that both haeeo (500 and 700 mg / kg) and indomethacin (10 mg / kg) decreased the levels of mda. the infiltrating inflammatory cells also generate reactive oxygen species (ros) and free radicals. the most common ros include the superoxide anion, hydroxyl radical, singlet oxygen, and hydrogen peroxide. the activity of sod reduces during severe inflammation as well as in the presence of oxidative stress. the large quantities of hydrogen peroxide generated are then taken care of by catalase and glutathione peroxidase (gpx) to water. excessive production of lipid hydroperoxide may also lead to reduced activity of gpx in inflammatory conditions. besides the enzymatic antioxidants, the level of glutathione, a nonenzymatic reducing agent that traps free radicals and prevents oxidative damage, is also diminished in inflammatory conditions. both haeeo (700 mg / kg) and indomethacin (10 mg / kg) maintained the oxidative homeostasis, and the levels of reduced glutathione and activities of catalase and sod were comparable to the control animals. various phytochemical constituents of the plant such as emblicanins a and b, gallic acid, and ellagic acids have been identified as powerful free radical scavengers. moreover, other phytochemicals with no scavenging properties like geraniin, corilagin, and furosin have been reported in the emblica officinalis fruit extract. recently, it has also been reported that the superoxide scavenging properties of emblica officinalis extract approximate those of l - ascorbic acid, a well - established antioxidant. in order to assess the efficacy of haeeo against chronic inflammation, the cotton pellet granuloma model in rats haeeo at all doses tested significantly (p < 0.001) reduced the granuloma formation. the maximum effect was observed at the dose of 700 mg / kg with 52.36% inhibition in granuloma formation as compared to the control group. although the exact mechanism of anti - inflammatory activity of haeeo on proliferative phase of inflammation in this model is not known, it may be hypothesized that both the antioxidant and the immunomodulatory properties of the plant may have been responsible for the protective action of the extract. emblica officinalis extract has been reported to inhibit nf-b activation, a key transcription factor involved in chronic inflammatory response and ageing. the main adverse effect of nonsteroidal anti - inflammatory drugs is their ability to produce gastric lesions. furthermore, sairam. demonstrated the ulcer protective potential of emblica officinalis in different acute gastric ulcer models in rats induced by aspirin, ethanol, cold restraint stress, and pyloric ligation and healing effect in chronic gastric ulcers induced by acetic acid in rats. the antiulcerogenic activity of emblica officinalis is definitely complementary to the good anti - inflammatory and antioxidant activity observed in the present study. further, it has been shown that emblica officinalis was well tolerated in mice even at the dose of 2.5 g / kg. in conclusion, the present study clearly demonstrated that haeeo possessed potent anti - inflammatory activity and also scientifically validated the traditional use of this plant for treating inflammatory disorders in the folk medicine. the advantages of haeeo, namely, better and safer anti - inflammatory profile with potent antiulcerogenic activity, deserve further studies to establish the therapeutic value and elucidate the mechanism of action in the treatment of different inflammatory diseases. | emblica officinalis, commonly known as amla in ayurveda, is unarguably the most important medicinal plant for prevention and treatment of various ailments. the present study investigated the anti - inflammatory activity of hydroalcoholic extract of emblica officinalis (haeeo). acute inflammation in rats was induced by the subplantar injection of carrageenan, histamine, serotonin, and prostaglandin e2 and chronic inflammation was induced by the cotton pellet granuloma. intraperitoneal (i.p.) administration of haeeo at all the tested doses (300, 500, and 700 mg / kg) significantly (p < 0.001) inhibited rat paw edema against all phlogistic agents and also reduced granuloma formation. however, at the dose of 700 mg / kg, haeeo exhibited maximum anti - inflammatory activity in all experimental models, and the effects were comparable to that of the standard anti - inflammatory drugs. additionally, in paw tissue the antioxidant activity of haeeo was also measured and it was found that haeeo significantly (p < 0.001) increased glutathione, superoxide dismutase, and catalase activity and subsequently reduced lipid peroxidation evidenced by reduced malondialdehyde. taken all together, the results indicated that haeeo possessed potent anti - inflammatory activity and it may hold therapeutic promise in the management of acute and chronic inflammatory conditions. |
all aspects of the study detailed herein were performed by the biological test center (irvine, ca) under sponsorship from bacterin international, inc (belgrade, mt). the animal research protocol was conducted in accordance with all biological test center animal welfare policies and was approved by the biological test center institutional animal care and use committee. twelve skeletally mature female new zealand white rabbits at least 12 weeks old and weighing 4.0 to 4.8 kg (western oregon rabbitry [philomath, or ]) were randomly divided into 2 groups (groups a and b). animals were anesthetized with an intravenous injection of ketamine (7.7 mg / kg) and xylazine (2.3 mg / kg). the cranium of each animal was shaved, disinfected with betadine and alcohol scrubs, and surgically draped using aseptic technique. a midline skin incision was made to expose the muscle fascia and periosteum of the sagittal crest. the temporalis muscle was retracted, and 2 bilateral, full - thickness craniotomies (approximately 10 mm in diameter) were created in the frontal bone using a hand trephine. each animal served as its own control with one of the defects being filled with novabone dental putty (novabone products, llc) and the contralateral defect being filled with osteoselect dbm putty (bacterin international, inc) (fig. caution was used to avoid excessive compression during insertion of the bone graft substitutes into the defects. the pericranium and skin were closed in layers using nonabsorbable sutures, and the rabbits were allowed to recover. following placement of elizabethan collars, the animals b, filled defects (left side = osteoselect, right side = novabone). novabone dental putty was used without modification according to the manufacturer s instructions for use. the osteoselect dbm putty was prepared from demineralized rabbit bone and mixed with a bioabsorbable carrier (carboxymethylcellulose) and phosphate - buffered saline to form a putty - like consistency. with the exception of the use of rabbit dbm, the formulation and process used to produce osteoselect dbm putty were the same as those used to produce commercially available osteoselect dbm putty. on day 43 (group a) or day 91 (group b), the animals were humanely killed by an intravenous bolus injection of commercially available euthanasia solution. three sections were made from each filled defect in a sagittal plane at the midpoint and approximately 2.5 mm lateral and medial to the midpoint of the defect. histology was performed on each section to evaluate inflammation, the amount of residual implant material, the amount of fibrous tissue in the defect, the extent of bridging of the defect by new bone formation, and the quality of the new bone. histology was graded on a semiquantitative scale of 0 to 3 as outlined in table 1. following histology, quantitative histomorphometry was performed under 20 magnification using a motic digital slide scanner and a motic automated tele - microscope model ba600 mot (motic corporation ltd, hong kong) for each section to quantitatively determine the amount of new bone formation and residual implant within each filled defect. all histology was performed by an independent laboratory (vet path services, inc [mason, oh ]). histopathology evaluation and histomorphometry measurements were conducted on blind sections by an independent board - certified veterinary pathologist. histology scoring matrix the ratio of new bone formation and residual implant for the novabone - filled defect and the osteoselect - filled defect was calculated for each animal using the histomorphometric measurements. z scores and p values were calculated from the mean ratio compared with the null hypothesis of equal bone formation and residual implant for the 2 different bone graft substitutes. for the histopathology results, semiquantitative histopathology revealed differences between cranial defects filled with novabone putty and those filled with osteoselect dbm putty in day 43 and day 91 rabbits. the results are shown in figure 2. at day 43, the amount of inflammation (p = 0.0001), residual implant material (p = 0.034), and fibrous tissue (p = 0.0041) were all significantly higher for novabone putty than for osteoselect dbm putty. the extent of bridging of the defect by new bone was higher for osteoselect (p = 0.0013). the quality of bone was the same for both groups (p = 1.00). at day 91, inflammation (p < 0.0001) and the amount of fibrous tissue in the defect (p = 0.0003) were all significantly higher for novabone putty than for osteoselect dbm putty. the extent of bridging of the defect by new bone was higher for osteoselect (p = 0.0038). the amount of residual implant material (p = 1.00) and the quality of bone (p = 1.00) were the same for each group. the graphs represent averages and ses for each metric examined. a, day 43 results. the defect sites were examined histomorphometrically for quantitative evaluation of residual implant and new bone formation. osteoselect dbm putty induced formation of considerably more new bone than did novabone putty (70.7% vs 40.7%, p = 0.043). the amount of residual implant was similar for both groups (17.7% vs 29.1%, p = 0.21). at day 91, osteoselect dbm putty induced considerably more new bone formation than did novabone putty (70.4% vs 39.9%, p = 0.0044). the amount of residual implant was similar for both groups (19.0% vs 19.5%, p = 0.30). the remainder of the defect was composed primarily of connective tissue with or without inflammatory cell components. representative histology slides are shown in figures 4 and 5. at 43 and 91 days, defects filled with osteoselect dbm putty were histologically characterized by small, isolated fragments of residual implant material surrounded by a combination of new cortical and trabecular bone growth that spanned the full width of the defect area. defects filled with novabone putty demonstrated incomplete bone ingrowth across the defect area, accompanied by large, solid regions of residual implant material. representative histology slides from the 2 bony defects in the same animal at day 43 for (a) osteoselect and (b) novabone showing the defect area (da), residual implant (ri), and area of new bone formation (nb). representative histology slides from the 2 bony defects in the same animal at day 91 for (a) osteoselect and (b) novabone showing the defect area (da), residual implant (ri), and area of new bone formation (nb). the objective of the study was to evaluate the osteogenic potential of a dbm putty in comparison to a synthetic putty when implanted in a critical - size bone defect in the crania of new zealand white rabbits. on days 43 and 91, osteoselect dbm putty was associated with less inflammation, less fibrous tissue, greater bone formation, greater defect bridging, similar levels of residual implant material, and similar new bone quality when compared with novabone putty, as determined by semiquantitative histopathologic and quantitative histomorphometric evaluation. to evaluate the clinical implications of these findings, it is instructive to compare the present results with those previously reported. in 2002, clokie and colleagues22 compared the regenerative effect of a dbm putty to calcium sulfate pellets and 2 different calcium phosphate cements in critical - size calvarial defects in new zealand white rabbits. the rabbits were examined histomorphometrically at 6 and 12 weeks postoperatively for new bone formation. the dbm putty showed 10.9 times more new bone formation than the best performing synthetic at 6 weeks and 3.0 times more at 12 weeks. these results show that not only did the dbm putty result in more new bone formation but also more rapid formation of new bone than any of the 3 synthetics. in addition, in 2011, khoshzaban and colleagues23 compared the regenerative effect of a dbm to a synthetic bone graft substitute, -tricalcium phosphate, in critical - size calvarial defects in wistar rats. in their study this result was confirmed at 10 weeks when the dbm graft showed 2.0 times more new bone formation compared with the synthetic bone graft substitute. furthermore, several additional studies have been reported in which dbm products outperform synthetic bone substitutes in terms of new bone growth.24,25 the enhanced bone formation of the dbm putties in these studies is likely a reflection of their osteoinductive potential.26 although the exact spatial and temporal sequences of bone remodeling and repair are still being uncovered, it is certain that the process is highly coordinated, involving numerous signaling events and multiple cell types.27 while both synthetic and dbm putties provide a scaffold for bone formation and blood vessel ingrowth, bmps and other growth factors within demineralized bone have been reported to induce the differentiation of osteoblast progenitor cells.28 this cell differentiation likely enhances bone remodeling and graft integration, thus providing a pronounced advantage when using dbm, which unlike synthetics maintains bone s natural regenerative capacity. the results generated in this study, coupled with previous animal models presented in the literature, suggest that dbm putties are superior to synthetic bone graft substitutes in terms of bone regeneration of cranial defects. the long - term clinical implications of this enhanced regenerative capacity are the subject of ongoing study, and additional studies, including studies in humans, are needed to determine the full clinical significance of these findings. | abstractthe purpose of this study was to compare the osteogenic potential of a synthetic and a demineralized bone matrix (dbm) putty using a cranial defect model in new zealand white rabbits. paired, bilateral critical - size defects (10 mm) were prepared in the frontal bones of 12 rabbits and filled with either osteoselect dbm putty or novabone calcium - phosphosilicate putty. at days 43 and 91, 6 rabbits were killed and examined via semiquantitative histology and quantitative histomorphometry. defects filled with the dbm putty were histologically associated with less inflammation and fibrous tissue in the defect and more new bone than the synthetic counterpart at both time points. histomorphometric analysis revealed that the defects filled with dbm putty were associated with significantly more bone formation at day 43 (70.7% vs 40.7%, p = 0.043) and at day 91 (70.4% vs 39.9%, p = 0.0044). the amount of residual implant was similar for both test groups at each time point. |
intussusception is a common cause of acute intestinal obstruction in young children, and it is rarely associated with pathological lesions. however, chronic intussusception is a rare childhood disease that is more commonly accompanied by leading points, such as polyps or neoplasms, and should be treated surgically (12). the clinical triad of colicky intermittent abdominal pain, vomiting, and bloody stool in acute intussusceptions is observed only in a few patients with chronic intussusceptions (1)., we report a case of chronic intussusception with intestinal lymphoma that presented as abdominal pain and constipation for 2 months. based on our experience, on may 23, 2014, a 6-year - old female visited our outpatient clinic complaining of recurrent abdominal pain and constipation for 2 months. several primary physicians had examined her, and the symptoms were relieved with the use of antispasmodic and probiotics. three days before visiting our clinic, she had been admitted to the emergency room for non - bilious vomiting and worsening abdominal pain. 1), an evacuation enema relieved her symptoms, with the expulsion of feces and gas. on physical examination, she looked fatigued, but showed no sign of significant weight loss. she was 116 cm tall (50th percentile) and weighed 20 kg (25th percentile). on palpation, her abdomen was distended mildly, with tenderness in the right upper quadrant. laboratory tests included the following : white blood cells 14,000/l (segmented neutrophils 94%, lymphocytes 4.0%, monocytes 2.0%, eosinophils 0%, basophils 0%), hemoglobin 12.2 g / dl, and platelets 423,000/l. the serum chemistry was within normal limits, except a c - reactive protein of 0.87 mg / ml (normal < 0.5 mg / ml). ultrasonography (fig. 2) revealed an ileocolic - type intussusception that contained crescent - shaped hypoechoic spots, suspected to be the leading cause, and enlarged mesenteric lymph nodes. abdominal computed tomography revealed an ileocolic - type intussusception with 3-cm, crescent - shaped, low - density lesions at the top of the intussusceptum and small lymph nodes along the intussusception (fig. 3). after the failure of air reduction, laparoscopic exploration of the abdomen and reduction of the intussuscepted bowel were attempted. at laparoscopic exploration of the abdomen, the intussuscepted bowel was seen in the right upper quadrant of the abdomen, immediately proximal to the hepatic flexure of the large bowel. grossly, no ischemic change of the intussuscepted bowel was observed and the appendix appeared normal (fig. laparoscopic instruments were used to drain the intussuscepted bowel several times, in an attempt to reduce it. however, laparoscopic reduction was unsuccessful because a tight, fibrous adhesion was present around the ileocecal valve and proximal cecum, where the main part of the bowel intussusception was located. the procedure was converted to open manual reduction. through a transverse incision of the right side of the abdomen, the inside of the normal large bowel should normally slide easily over the intussusceptum. in this case, however, the intussuscepted bowel had formed a hard mass, and the serosa was thickened at the severely folded ileocecal junction. manual reduction was impossible because a hard, fibrous adhesion had formed between the strongly impacted ileum and cecum. she was discharged on the seventh postoperative day, with good bowel movements and was referred to the cancer center for further management. in recent literature reviews, cases reported between 1972 and 2007 indicate that chronic intussusceptions more frequently involve leading points, especially in children older than 2 years, and the classical triad of colicky abdominal pain, vomiting, and passage of blood through the rectum was absent at the time of diagnosis. furthermore, 80% of the patients had abdominal pain or vomiting (1). our patient had only a 2-month history of abdominal pain and constipation with transient vomiting ; therefore, we could not determine when the intussusception occurred. the finding of a tight, fibrous adhesion around the intussusception, and microscopic submucosal and serosal fibrosis suggest that her condition was not the result of recent events. chronic intussusception is a rare disease that can follow repeated episodes of subacute intestinal obstruction without strangulation. a partially maintained blood supply through another mesenteric artery may allow the intussusception to remain viable in a chronic state in older children. we believe that our patient underwent repeated subacute intussusceptions with collateral circulation via other mesenteric arteries (2). lymphoma as a leading point is often reported in childhood, causing acute intussusception with abdominal pain and passage of blood through the rectum (567). few cases of chronic intussusception with lymphoma accompanied by a palpable mass and abnormal blood findings have been reported. diffuse large b - cell lymphoma is the most common non - hodgkin s lymphoma in adolescents, and manifests as either abdominal or primary mediastinal lymphoma (34). in children, recurrent abdominal pain is occasionally considered a functional disorder in the absence of alarming symptoms such as significant vomiting, fever, diarrhea, and weight loss or delayed growth, without an imaging or laboratory work - up. the intussusception in this patient progressed slowly, with no definite signs or symptoms of intestinal obstruction. therefore, a careful examination and a high index of suspicion when chronic abdominal pain is present could decrease the mortality due to this disease. | the classical triad of abdominal pain, vomiting, and bloody stool is absent in chronic intussusception for more than 2 weeks. here, we report a 6-year - old female with recurrent abdominal pain for 2 months. ultrasonography of the abdomen revealed an ileocolic - type intussusception. the lesion accompanying the tight fibrous adhesion was treated by resection and ileocolic anastomosis. it was diagnosed as intussusception with diffuse large b - cell lymphoma. a high index of suspicion for abdominal pain in children should result in the correct diagnosis and appropriate management. |
there is a recent report from uk that indian doctors are failing in the key licensing examination in general practice. approximately 60% of medical graduates from india, south asia, and africa have failed in the licensing examination conducted by royal college of general practitioners (rcgp). there is a lesson to be learnt by medical students and young indian doctors. in general, we are inclined to think that most meritorious persons should get license to deal with human lives. we also like to believe that the best indian doctors emigrate abroad. however, there are other larger invisible forces, other than merit and capabilities of individual doctors, which govern license to practice a trade such as medical profession. for decades, countries like usa and uk have exploited postgraduate training opportunities as a tool to attract young trained medical graduates, from developing countries like india, pakistan, bangladesh, philippines, china, and africa to strengthen their own healthcare workforce. in usa, the number of postgraduate (md / ms) seats is almost double the numbers of the undergraduate (mbbs) seats. for 16,527 us medical school students, 26772 positions of post of these postgraduate seats, approximately 50%are available in generalist disciplines such as family medicine. these excess of postgraduate training opportunities are the bait for img (international medical graduates). though the official ratio for mbbs and md / ms seats is said to be 2:1, there are various types of educational qualifications which define the practice privileges, restrictive barriers and independent trade license. there are degrees, diplomas, dnbs (diplomate of national board) in non clinical, pre and para clinical disciplines. at the end only one in ten doctor while the majority of medical colleges are operating in the private sector, the license to practice is available for a handsome capitation fee on demand. the cost of these seats is directly linked with scarcity of residency training opportunities / specialist trade licence in india. (there is a shortage of post - graduate opportunities because if you open it up, capitation fee will collapse and then the [medical education ] industry will collapse- dr devi shetty, former member, board of governors, medical council of india, in an interview, march 23 2013 forbes india). dnb qualification offered by national board of examination (nbe) is largely perceived by young doctors as a platform for exploitation. this system lures venerable medical graduates and makes them work for three years as trainees and a great majority among them end up without securing a specialist trade practice license. today there is a scarce chance for a fresh medical graduate to evolve into a competent medical doctor equipped with full trade licence. it is no wonder that a good number of indian medical graduates are aspiring to immigrate abroad not necessarily due to personal ambition but due to difficult professional conditions. back home, many of them have already started seeking opportunities in civil services, business management, clinical trial, call center jobs, pharmaceutical industry, real estate, travel business, cosmetic and beauty industry etc. irrespective of the talent pool of youth in india, only a very limited few will get license to practice as a clinical doctor which is a paradox itself ; given the billion plus population. our system is surviving because of abundance of merit (population supplies for it) as compared to the available opportunities. the hard work of medical students and young doctors compensates for the intrinsically weakened medical education system. in this flawed environment, medical students and doctors tend to judge themselves by the difficulty and toughness of the entrance tests they are subjected to at undergraduate / post graduate level.. therefore majority of our young doctors spend years of dysfunction, preparing for md / ms entrance without stopping to think by their own minds, in spite of the statistical odds. limited opportunities create a false hierarchy and hegemony among the most capable persons of our society. while a few enjoy the privileged and glamorous life, majority constitutes an unsatisfied workforce. in the absence of necessary processes, majority of mbbs doctors are ending up as cheap labor supply working at large hospitals in metropolitan cities as ward rmos (resident medical officers) ; stretching up to 100 hours per week (employed at two to three hospitals) struggling to meet their end needs. in public sector they have an option to work as contractual worker engaging in a bulk of nonmedical work, which could be very well taken care of by a non licensed person. contrary to the perception of the scarcity of medical doctors, there is no campus interview or fat pay packages even at premium institutions like aiims (all india institute of medical sciences). this is unlike the opportunities available for top management and engineering graduates, indicating towards some fundamental flaw in the intent and direction of medical education system. given the clinical morbidity and the burden of huge population, one of the major challenges lies ahead is expanding the opportunities, training, and complete license for the available workforce, specially the mbbs doctors. lack of recognition for primary care as a trade / vocation of medical practice and non availability of training posts in family medicine is the reason for scarcity of training residency positions in india. in country like australia, it is very tough for international medical graduates (img) to get a license to practice. however, if someone is willing to work in rural, remote location and area of need, work permit is available without having to clear the licensing examination. in canada, physician recruitment agency of saskatchewan (government agency) has recently conducted interviews in india for direct recruitment with license to practice for family physicians. in uk, we can not be sure about the racial bias, however message is loud and clear. you are welcome to work under supervision but not entitled for an independent trade license, that is, allowed to own your own business. the impression and perception that young doctors are not eager to work for community setting in india is an unfortunate and a wrongful misconstruction of the facts. in india, unfortunately due to healthcare workforce mismanagement, majority of the young doctors do not get a fruitful opportunity for engagement within the healthcare delivery system. there seems to be no initiative and eagerness to end this deadlock by the people who are in a position to influence. given the morbidity pattern and population, there is a genuine need for practicing and skilled doctors in the primary healthcare sector. however, the concept of gate - keeping by efficient and assertive workforce in the community intimidates many interest groups. there is a willingness to continue with the centralized administrative process of the public health fund distribution system. at the same time unrestricted migration of patients continues from under served and rural areas to feed the urban un regulated tertiary level heath care services. since the inception of medical profession, license to practice has remained a political issue and governed by political forces. limiting medical education to tertiary care institutions and allowing teaching exclusively by doctors with specialist qualification restricting entry of primary care doctors into mainstream medical education system as faculty and not legalizing community health services as accredited sites of medical education is not an inadvertent act of omission. rather it is a well thought out strategy towards supporting the existing monopolies. as an outcome, doctors engaging in primary health care also do not occupy leadership positions at academic institutions and therefore do not have any representation on the regulatory bodies such as medical council of india and national board of examination. recognition, development, and execution of primary care as a vocation for medical doctors are the way forward. universal health coverage (uhc) and national health mission (nhm) will open up new horizons and expand the career opportunities. author 's note : the findings and conclusions in this article are those of the author and do not necessarily represent the official position of ilbs, new delhi, india. | as a country india has to her credit the largest number of medical colleges in the world. more than 40,000 seats of mbbs (bachelor of medicine and bachelor of surgery) are available annually but only a fraction would enter into primary health care vocation. it is a matter of common perception and also of great concern that a large majority of young indian doctors are not willing to serve the rural, remote and underserved population. an observation on human resource policies of several developed countries reveals interesting patterns. beyond willingness and interest of the medical students and young doctors, there are real factors which prohibit their engagement with the health care delivery system in india, especially in the area of primary health care. |
ulcerative colitis (uc) is a chronic idiopathic inflammatory disorder involving the colonic mucosa. it is characterized by periods of active symptomatic disease interspersed with periods of clinical remission. a 2012 systematic review indicated worldwide uc prevalence rates of up to 249 per 100,000 persons in north america and 505 per 100,000 persons in europe ; the highest reported annual incidence rates of uc were 19.2 per 100,000 person - years in north america and 24.3 per 100,000 person - years in europe. the highest incidence appears to occur during the age range of 2030 years, although there is some evidence for a second peak in incidence later in life. endoscopic examination of the colon in patients with uc reveals a number of characteristic changes seen in the mucosa, including loss of vascular pattern, erythema, granularity, friability, erosions, and ulceration [1, 3 ]. mucosal healing, which has been defined as complete resolution of the visible alterations or lesions, regardless of their baseline nature or severity, is emerging as an important goal in the management of inflammatory bowel diseases such as uc ; increasing evidence indicates that mucosal healing is associated with reductions in the number of disease flares, hospitalizations, and the need for colectomy in patients with uc. classic symptoms of uc include rectal bleeding, diarrhea, urgency, tenesmus, and abdominal pain, and these can impose a substantial burden on patients. patients with uc report problems in a number of aspects of their daily lives, including withdrawal from social situations, employment disruption, increased anxiety, and decrease in health - related quality of life [57 ]. current us and european guidelines recommend treatment with 5-aminosalicylates (5-asas) as first - line therapy for the induction of remission in patients with mild to moderate uc ; such treatment is considered most effective when combinations of both topical and oral preparations are used [8, 9 ]. corticosteroids may be indicated in patients in whom 5-asa formulations are ineffective in inducing remission [8, 9 ]. however, first - generation corticosteroids, such as prednisone, are associated with a number of potential safety concerns, including increased risks of serious infections, bone disease, the development of cushingoid features, and increased risk of mortality [8, 1012 ]. budesonide is an orally active, second - generation corticosteroid that has affinity for the glucocorticoid receptor approximately 8.5-fold, 15-fold, and 195-fold greater than those of dexamethasone, prednisolone, and hydrocortisone, respectively. a number of oral formulations are available, including oral budesonide controlled ileocolonic release (cir) (entocort ec, astrazeneca lp, wilmington, de), budesonide capsules [budenofalk capsules, dr falk pharma, freiburg, germany (not available in the usa) ], and budesonide multi - matrix (mmx ; santarus, inc. ; budesonide cir and budesonide capsules are not indicated for uc, but are indicated only for induction of remission of mild to moderate crohn s disease (cd) involving the ileum and/or ascending colon ; budesonide cir is also indicated for maintenance of cd remission. however, budesonide mmx is indicated for induction of remission of mild to moderate uc. based on data from the colonic release budesonide (core) i and ii studies [15, 16 ], which are described later in this review, an updated uc treatment algorithm has recommended budesonide mmx before the introduction of conventional corticosteroids for the induction of remission in patients for whom 5-asa therapy has been unsuccessful, or for those who relapse during 5-asa therapy. several guidelines, developed before the availability of budesonide mmx, do not recommend oral conventional or second - generation corticosteroids for the maintenance of remission in uc [8, 9 ] ; however, data are accumulating to support an acceptable tolerability profile for second - generation corticosteroids. one study, which evaluated the long - term (1-year) safety of budesonide mmx in patients with uc, indicated that oral budesonide mmx 6 mg had a safety profile similar to that of placebo. in addition, the cd clinical trials of budesonide cir and budesonide capsules support the safety of oral budesonide during long - term (e.g., 1 year) exposure in patients with inflammatory bowel disease [1828 ]. this article reviews the efficacy and safety profile of budesonide mmx for the treatment of uc. budesonide is a second - generation corticosteroid with low systemic bioavailability after oral administration because of extensive (~90 %) first - pass hepatic metabolism. it is metabolized predominantly by hepatic cytochrome p450 3a (cyp3a) enzymes to form 2 principal metabolites : 16-hydroxyprednisolone and 6-hydroxybudesonide. these metabolites comprise only 110 % of the biologic activity of the parent compound. following oral administration, the mmx formulation has been designed to target orally administered drugs to sites in the distal colon. this delivery system utilizes an outer ph - dependent coating consisting of a hydrophilic and inert polymer matrix, which allows passage of active drug through the gastrointestinal tract to the ileum, where the outer layer of the capsule begins to dissolve at a ph > 7.0. the active drug is therefore delivered uniformly throughout the length of the colon, thus minimizing systemic absorption, in contrast to conventional corticosteroid absorption (fig. 1) [31, 32 ]. mmx technology has been used effectively for the delivery of 5-asa to the colon, whereby mesalamine mmx is being used for both induction [31, 3335 ] and maintenance [36, 37 ] of remission in patients with mild to moderate uc.fig. original art from asklepios medical atlas / science photo library targeted delivery of budesonide mmx throughout the colon. original art from asklepios medical atlas / science photo library in pharmacokinetic studies with budesonide mmx 9 mg, the mean relative absorption of budesonide in the region between the ascending colon and the descending / sigmoid colon was 95.9 % with drug detected between 4 and > 24 h postdose (fig. 2). this relative absorption profile contrasts with the absorption of other oral budesonide formulations : for example, following administration of budesonide cir, approximately 69 % of the dose is absorbed in the distal ileum and ascending colon, the sites typically affected by inflammation in patients with cd. release of the active drug from budesonide cir and budesonide capsules occurs in a more acidic environment than with budesonide mmx, with absorption beginning at ph values of 5.5 and 6.4, respectively [40, 41].fig. 2scintigraphic image in a healthy volunteer showing dispersion of [sm]-labeled budesonide mmx in the colon. scintigraphic image in a healthy volunteer showing dispersion of [sm]-labeled budesonide mmx in the colon. reprinted with permission from brunner. in a study of healthy volunteers, the mean lag time (tlag) between administration of budesonide mmx 9 mg and detection of budesonide in plasma was 6.8 h ; the mean peak plasma concentration (cmax) was 1768.7 pg / ml, and the time to cmax (tmax) was 14.0 h. administration of budesonide mmx with food resulted in significant decreases in both cmax (p = 0.03) and systemic exposure as measured by the area under the concentration time curve to 48 h (auc48h ; p = 0.008), but these changes are not considered to be clinically meaningful ; hence, budesonide mmx may be administered with or without food. after single dosing in healthy volunteers, cmax, auc036 h, auc0, and half - life (t1/2) of budesonide mmx 9 mg were comparable to those of budesonide cir 9 mg. median tlag was 6 h for both 9- and 6-mg doses of budesonide mmx, compared with 1 h for budesonide cir 9 mg. because budesonide is metabolized predominantly in the liver, bioavailability may be increased in patients with impaired liver function. in a study in patients with primary biliary cirrhosis who received a single dose of budesonide 3 mg (non - mmx formulation), patients with late - stage (stage iv) disease showed significantly greater systemic exposure to budesonide than those patients with early - stage (stage i ii) disease. mean cmax was 1.5 ng / ml in patients with early - stage disease, compared with 4.9 ng / ml in patients with late - stage disease (p 0.99 vs. pbo) pbo : 33.1 % histologic healing rates at week 8 : budesonide mmx 9 mg : 4.1 % (p = 0.38 vs. pbo) budesonide mmx 6 mg : 7.4 % (p = 0.80 vs. pbo) mesalamine 2.4 g : 11.3 % (p = 0.20 vs. pbo) pbo : 6.6 % complete symptom resolution rates at week 8 : budesonide mmx 9 mg : 28.5 % (p = 0.03 vs. pbo) budesonide mmx 6 mg : 28.9 % (p = 0.02 vs. pbo) mesalamine 2.4 g : 25.0 % (p = 0.10 vs. pbo) pbo : 16.5 % any aes : budesonide mmx 9 mg : 28.3 % budesonide mmx 6 mg : 27.8 % mesalamine 2.4 g : 24.4 % pbo : 26.4 % potential glucocorticoid - related aes : budesonide mmx 9 mg : 11.8 % budesonide mmx 6 mg : 5.6 % mesalamine 2.4 g : 7.9 % pbo : 10.1 % mean morning plasma cortisol concentrations decreased after 2 and 4 weeks of treatment with budesonide mmx 9 mg or budesonide mmx 6 mg, but remained within normal range for all groups during studycore iitravis. r, db, dd, pbo - cmild to moderate active uc (ucdai score 4 and 10)budesonide mmx 9 mg qd (n = 128) budesonide mmx 6 mg qd (n = 128) budesonide cir 9 mg qd (n = 126) pbo qd (n = 129) for 8 weeksno concomitant uc therapiesreported previous use of any 5-asas: budesonide mmx 9 mg : 51.6 % budesonide mmx 6 mg : 60.2 % budesonide cir 9 mg : 55.6 % pbo : 58.1 % reported previous use of sulfasalazine: budesonide mmx 9 mg : 25.8 % budesonide mmx 6 mg : 21.1 % budesonide cir 9 mg : 23.8 % pbo : 21.7 % clinical and endoscopic remission rates after 8 weeks : budesonide mmx 9 mg : 17.4 % (p = 0.005 vs. pbo) budesonide mmx 6 mg : 8.3 % budesonide cir 9 mg : 12.6 % (p = 0.048 vs. pbo) pbo : 4.5 % clinical improvement rates after 8 weeks : budesonide mmx 9 mg : 42.2 % budesonide mmx 6 mg : 25.7 % budesonide cir 9 mg : 33.0 % pbo : 33.7 % endoscopic improvement rates at week 8 : budesonide mmx 9 mg : 42.2 % budesonide mmx 6 mg : 25.7 % budesonide cir 9 mg : 36.9 % pbo : 31.5 % histologic healing rates at week 8 : budesonide mmx 9 mg : 16.5 % (p = 0.04 vs. pbo) budesonide mmx 6 mg : 9.2 % budesonide cir 9 mg : 13.6 % pbo : 6.7 % complete symptom resolution rates at week 8 : budesonide mmx 9 mg : 23.9 % (p = 0.02 vs. pbo) budesonide mmx 6 mg : 13.8 % budesonide cir 9 mg : 18.4 % pbo : 11.2 % most commonly reported aes : uc relapse: budesonide mmx 9 mg : 15.6 % budesonide mmx 6 mg : 21.1 % budesonide cir 9 mg : 12.7 % pbo : 11.6 % headache: budesonide mmx 9 mg : 16.4 % budesonide mmx 6 mg : 15.6 % budesonide cir 9 mg : 7.1 % pbo : 6.2 % potential glucocorticoid - related aes: budesonide mmx 9 mg : 6.3 % budesonide mmx 6 mg : 4.7 % budesonide cir 9 mg : 11.1 % pbo : 10.1 % mean morning plasma cortisol concentrations within normal range after 8 weeks: budesonide mmx 9 mg : 253 nmol / l budesonide mmx 6 mg : 315 nmol / l budesonide cir 9 mg : 323 nmol / l pbo : 337 nmol / lpooled data : core i and core iisandborn. r, db, dd, pbo - cmild to moderate active uc (ucdai score 4 and 10) budesonide mmx 9 mg qd (n = 232) budesonide mmx 6 mg qd (n = 230) pbo qd (n = 210) for 8 weeksno concomitant uc therapiesreported previous use of any 5-asas: budesonide mmx 9 mg : 63.4 % budesonide mmx 6 mg : 74.8 % pbo : 71.0 clinical and endoscopic remission rates after 8 weeks : budesonide mmx 9 mg : 17.7 % (p = 0.0002 vs. pbo) budesonide mmx 6 mg : 10.9 % (p = 0.069 vs. pbo) pbo : 6.2 % clinical improvement rates after 8 weeks : budesonide mmx 9 mg : 37.5 % (p = 0.06) budesonide mmx 6 mg : 28.3 % (p = 0.93) pbo : 28.6 % endoscopic improvement rates at week 8 : budesonide mmx 9 mg : 41.8 % (p = 0.04 vs. pbo) budesonide mmx 6 mg : 30.9 % (p = 0.78 vs. pbo) pbo : 32.4 % histologic healing rates at week 8 : budesonide mmx 9 mg : 9.9 % (p = 0.26) budesonide mmx 6 mg : 8.3 % (p = 0.54) pbo : 6.7 % complete symptom resolution rates at week 8 : budesonide mmx 9 mg : 26.3 % (p = 0.002 vs. pbo) budesonide mmx 6 mg : 21.7 % (p = 0.03 vs. pbo) pbo : 14.3 % most commonly reported aes : uc relapse: budesonide mmx 9 mg : 13.3 % budesonide mmx 6 mg : 16.5 % pbo : 14.0 % headache: budesonide mmx 9 mg : 11.4 % budesonide mmx 6 mg : 14.6 % pbo : 10.5 % potential glucocorticoid - related aes: budesonide mmx 9 mg : 9.0 % budesonide mmx 6 mg : 5.1 % pbo : 10.1 % maintenance of remission sandborn. r, pbo - cpatients with mild to moderate uc in clinical and endoscopic remission budesonide mmx 6 mg qd pbo qd for 12 monthsno concomitant uc therapies without investigator approvalmaintenance of clinical remission for up to 12 months was comparable for budesonide mmx 6 mg and pbo groups median time to clinical relapse : budesonide mmx 6 mg : > 1 year pbo : 181 days (p = 0.02) probability of clinical relapse after 12 months : budesonide mmx 6 mg : 40.9 % pbo : 59.7 % any aes : budesonide mmx 6 mg : 21.0 % pbo : 21.3 % 5-asa 5-aminosalicylic acid, aes adverse events, cir controlled ileocolonic release, core colonic release budesonide, db double blind, dd double dummy, mc multicenter, mmx multi - matrix, pbo placebo, pbo - c placebo - controlled, r randomized, uc ulcerative colitis, ucdai ulcerative colitis disease activity index asacol, proctor & gamble pharmaceuticals, cincinnati, oh clinical and endoscopic remission defined as total ucdai score 1, with rectal bleeding score = 0, stool frequency score = 0, no evidence of mucosal friability on colonoscopy, and decrease from baseline of 1 point in endoscopic index score clinical improvement defined as improvement (reduction) from baseline of 3 points in ucdai score endoscopic improvement defined as decrease from baseline of 1 point in ucdai endoscopy (mucosal appearance) subscore histologic healing defined as histologic score 1 symptom resolution defined as ucdai rectal bleeding and stool frequency subscores = 0 glucocorticoid - related aes : acne, fluid retention, flushing, hirsutism, insomnia, mood changes, moon face, sleep changes, and striae rubrae morning plasma cortisol normal range 138690 nmol / l maintenance of remission defined as ucdai subscores of 0 for both rectal bleeding and stool frequency time to clinical relapse defined as time to recurrence of rectal bleeding and/or stool frequency 12 stools / day more than normal for patient efficacy and safety of budesonide mmx for the treatment of ulcerative colitis remission 5-asa 5-aminosalicylic acid, aes adverse events, cir controlled ileocolonic release, core colonic release budesonide, db double blind, dd double dummy, mc multicenter, mmx multi - matrix, pbo placebo, pbo - c placebo - controlled, r randomized, uc ulcerative colitis, ucdai ulcerative colitis disease activity index asacol, proctor & gamble pharmaceuticals, cincinnati, oh clinical and endoscopic remission defined as total ucdai score 1, with rectal bleeding score = 0, stool frequency score = 0, no evidence of mucosal friability on colonoscopy, and decrease from baseline of 1 point in endoscopic index score clinical improvement defined as improvement (reduction) from baseline of 3 points in ucdai score endoscopic improvement defined as decrease from baseline of 1 point in ucdai endoscopy (mucosal appearance) subscore histologic healing defined as histologic score 1 symptom resolution defined as ucdai rectal bleeding and stool frequency subscores = 0 glucocorticoid - related aes : acne, fluid retention, flushing, hirsutism, insomnia, mood changes, moon face, sleep changes, and striae rubrae morning plasma cortisol normal range 138690 nmol / l maintenance of remission defined as ucdai subscores of 0 for both rectal bleeding and stool frequency time to clinical relapse defined as time to recurrence of rectal bleeding and/or stool frequency 12 stools / day more than normal for patient in both studies, clinical and endoscopic remission was achieved in a significantly greater percentage of patients receiving budesonide mmx 9 mg compared with placebo (table 1). in core i, remission at week 8 was achieved in 17.9 % of patients receiving budesonide mmx 9 mg, compared with 7.4 % (p = 0.01) in the placebo group and 12.1 % in the group receiving mesalamine (fig. 3a). in core ii, the 8-week remission rate was 17.4 % in patients receiving budesonide mmx 9 mg, compared with 4.5 (p = 0.005) and 12.6 % (p = 0.048) in the placebo and budesonide cir groups, respectively (fig. in addition, a subgroup analysis in the core ii study showed that a significantly greater percentage of patients with left - sided uc achieved clinical and endoscopic remission with budesonide mmx 9 mg than with placebo (17.7 vs. 5.8 %, respectively ; p = 0.03) ; the percentage of patients with extensive disease who reached clinical and endoscopic remission was also numerically higher with budesonide mmx 9 mg than with placebo (13.8 vs. 0 %, respectively), but this difference was not statistically significant (p = 0.10).fig. 3combined clinical and endoscopic remission rates at week 8 in the core i (a) and core ii (b) studies. clinical and endoscopic remission was defined as a ucdai score 1, with scores of 0 for rectal bleeding and stool frequency, no mucosal friability on colonoscopy, and a reduction from baseline of 1 point in endoscopic index score. ci confidence interval, cir controlled ileal release. reprinted with permission from sandborn travis. combined clinical and endoscopic remission rates at week 8 in the core i (a) and core ii (b) studies. clinical and endoscopic remission was defined as a ucdai score 1, with scores of 0 for rectal bleeding and stool frequency, no mucosal friability on colonoscopy, and a reduction from baseline of 1 point in endoscopic index score. reprinted with permission from sandborn. and travis. in core i, an analysis by disease severity subgroup indicated that in patients with mild uc (ucdai score 4 or 5) who received budesonide mmx 9 mg or placebo, clinical improvement (defined as a 3-point reduction in ucdai score) was achieved in 44.4 and 25.0 % of patients, respectively ; corresponding figures in patients with moderate disease (ucdai score 6 and 10) were 39.7 and 30.1 %, respectively. furthermore, the mucosal healing rate was greater with budesonide mmx 9 mg than with placebo in patients with proctosigmoiditis (32.4 vs. 19.5 %, respectively ; p = 0.20) and left - sided uc (40.6 vs. 26.5 %, respectively ; p = 0.22). a similar numeric difference favoring budesonide mmx 9 mg was also observed in patients with extensive uc (16.1 vs. 10.0 % with placebo), but this difference also was not statistically significant (p = 0.39). in a pooled analysis of the core i and core ii studies, patients treated with budesonide mmx 9 mg were at least 3 times more likely to achieve clinical and endoscopic remission versus placebo [or 3.3 (95 % ci 1.76.4) ]. budesonide mmx 9 mg was statistically significantly more efficacious versus placebo for several subgroups : males, females, patients 60 years, patients with prior mesalamine use, patients without prior mesalamine use, patients with mild uc at baseline, patients with moderate uc at baseline, patients with proctosigmoiditis, patients with left - sided uc, patients with uc duration > 1 to 5 years, and patients with uc duration > 5 years. the efficacy of budesonide mmx for the maintenance of uc remission was investigated in a study of patients who had achieved clinical and endoscopic remission in the core i and ii studies [15, 16 ] or patients in core i and ii who had received an additional 8 weeks of treatment (budesonide mmx 9 mg) in an open - label study (table 1) [17, 48 ]. in the maintenance study, patients were randomized to receive budesonide mmx 6 mg or placebo for up to 12 months ; the primary efficacy endpoint was clinical remission, assessed after 1, 3, 6, 9, and 12 months. the median time to clinical relapse (defined as rectal bleeding, stool frequency 12 stools per day, or both) was 181 days in the placebo group, but was not reached in the budesonide mmx group (p = 0.02 ; fig. 4) ; at 12 months, the probability of relapse was 59.7 and 40.9 %, respectively. however, the percentage of patients in whom remission was maintained for up to 12 months did not differ significantly between the groups, a finding that was potentially attributable to insufficient statistical power. therefore, the potential benefit of budesonide mmx in maintenance of remission is currently unclear and further studies are required.fig. 4kaplan meier plot showing the time to clinical relapse (defined as rectal bleeding, stool frequency 12 stools per day above normal, or both) in patients receiving maintenance therapy with budesonide mmx 6 mg or placebo for up to 1 year. reprinted with permission from sandborn. kaplan meier plot showing the time to clinical relapse (defined as rectal bleeding, stool frequency 12 stools per day above normal, or both) in patients receiving maintenance therapy with budesonide mmx 6 mg or placebo for up to 1 year. the efficacy and safety of budesonide mmx for the induction of remission in patients with mild to moderate uc [uc disease activity index (ucdai) score 410 ] have been investigated in 2 identically designed, randomized trials : core i and ii (table 1) [1517, 47 ]. core i compared budesonide mmx 9 mg and 6 mg with mesalamine 2.4 g and placebo, whereas core ii compared the same doses of budesonide mmx with budesonide cir 9 mg and placebo. in both studies, treatment was administered for 8 weeks, and the primary endpoint was clinical and endoscopic remission at week 8. remission was defined as a ucdai score 1, with scores of 0 for rectal bleeding and stool frequency, no mucosal friability on colonoscopy, and a reduction of 1 point in endoscopic index score from baseline [15, 16].table 1efficacy and safety of budesonide mmx for the treatment of ulcerative colitis remissionstudy designdisease statetreatment and durationconcomitant and previous therapiesprimary efficacy endpoint(s)secondary efficacy endpointssafety induction of remission core isandborn. r, db, dd, mc, pbo - cmild to moderate active uc (ucdai score 4 and 10) budesonide mmx 9 mg qd (n = 123) budesonide mmx 6 mg qd (n = 121) mesalamine 0.8 g tid (n = 124) pbo qd (n = 121) for 8 weeksno concomitant uc therapiesreported previous use of any 5-asas: budesonide mmx 9 mg : 56.1 % budesonide mmx 6 mg : 73.6 % mesalamine 2.4 g : 63.7 % pbo : 67.8 % clinical and endoscopic remission rates at week 8 : budesonide mmx 9 mg : 17.9 % (p = 0.014 vs. pbo) budesonide mmx 6 mg : 13.2 % (p = 0.14 vs. pbo) mesalamine 2.4 g : 12.1 % (p = 0.22 vs. pbo) pbo : 7.4 % clinical improvement rates at week 8 : budesonide mmx 9 mg : 33.3 % (p = 0.14 vs. pbo) budesonide mmx 6 mg : 30.6 % (p = 0.31 vs. pbo) mesalamine 2.4 g : 33.9 % (p = 0.12 vs. pbo) pbo : 24.8 % endoscopic improvement rates at week 8 : budesonide mmx 9 mg : 41.5 % (p = 0.17 vs. pbo) budesonide mmx 6 mg : 35.5 % (p = 0.68 vs. pbo) mesalamine 2.4 g : 33.1 % (p > 0.99 vs. pbo) pbo : 33.1 % histologic healing rates at week 8 : budesonide mmx 9 mg : 4.1 % (p = 0.38 vs. pbo) budesonide mmx 6 mg : 7.4 % (p = 0.80 vs. pbo) mesalamine 2.4 g : 11.3 % (p = 0.20 vs. pbo) pbo : 6.6 % complete symptom resolution rates at week 8 : budesonide mmx 9 mg : 28.5 % (p = 0.03 vs. pbo) budesonide mmx 6 mg : 28.9 % (p = 0.02 vs. pbo) mesalamine 2.4 g : 25.0 % (p = 0.10 vs. pbo) pbo : 16.5 % any aes : budesonide mmx 9 mg : 28.3 % budesonide mmx 6 mg : 27.8 % mesalamine 2.4 g : 24.4 % pbo : 26.4 % potential glucocorticoid - related aes : budesonide mmx 9 mg : 11.8 % budesonide mmx 6 mg : 5.6 % mesalamine 2.4 g : 7.9 % pbo : 10.1 % mean morning plasma cortisol concentrations decreased after 2 and 4 weeks of treatment with budesonide mmx 9 mg or budesonide mmx 6 mg, but remained within normal range for all groups during studycore iitravis. r, db, dd, pbo - cmild to moderate active uc (ucdai score 4 and 10)budesonide mmx 9 mg qd (n = 128) budesonide mmx 6 mg qd (n = 128) budesonide cir 9 mg qd (n = 126) pbo qd (n = 129) for 8 weeksno concomitant uc therapiesreported previous use of any 5-asas: budesonide mmx 9 mg : 51.6 % budesonide mmx 6 mg : 60.2 % budesonide cir 9 mg : 55.6 % pbo : 58.1 % reported previous use of sulfasalazine: budesonide mmx 9 mg : 25.8 % budesonide mmx 6 mg : 21.1 % budesonide cir 9 mg : 23.8 % pbo : 21.7 % clinical and endoscopic remission rates after 8 weeks : budesonide mmx 9 mg : 17.4 % (p = 0.005 vs. pbo) budesonide mmx 6 mg : 8.3 % budesonide cir 9 mg : 12.6 % (p = 0.048 vs. pbo) pbo : 4.5 % clinical improvement rates after 8 weeks : budesonide mmx 9 mg : 42.2 % budesonide mmx 6 mg : 25.7 % budesonide cir 9 mg : 33.0 % pbo : 33.7 % endoscopic improvement rates at week 8 : budesonide mmx 9 mg : 42.2 % budesonide mmx 6 mg : 25.7 % budesonide cir 9 mg : 36.9 % pbo : 31.5 % histologic healing rates at week 8 : budesonide mmx 9 mg : 16.5 % (p = 0.04 vs. pbo) budesonide mmx 6 mg : 9.2 % budesonide cir 9 mg : 13.6 % pbo : 6.7 % complete symptom resolution rates at week 8 : budesonide mmx 9 mg : 23.9 % (p = 0.02 vs. pbo) budesonide mmx 6 mg : 13.8 % budesonide cir 9 mg : 18.4 % pbo : 11.2 % most commonly reported aes : uc relapse: budesonide mmx 9 mg : 15.6 % budesonide mmx 6 mg : 21.1 % budesonide cir 9 mg : 12.7 % pbo : 11.6 % headache: budesonide mmx 9 mg : 16.4 % budesonide mmx 6 mg : 15.6 % budesonide cir 9 mg : 7.1 % pbo : 6.2 % potential glucocorticoid - related aes: budesonide mmx 9 mg : 6.3 % budesonide mmx 6 mg : 4.7 % budesonide cir 9 mg : 11.1 % pbo : 10.1 % mean morning plasma cortisol concentrations within normal range after 8 weeks: budesonide mmx 9 mg : 253 nmol / l budesonide mmx 6 mg : 315 nmol / l budesonide cir 9 mg : 323 nmol / l pbo : 337 nmol / lpooled data : core i and core iisandborn. r, db, dd, pbo - cmild to moderate active uc (ucdai score 4 and 10) budesonide mmx 9 mg qd (n = 232) budesonide mmx 6 mg qd (n = 230) pbo qd (n = 210) for 8 weeksno concomitant uc therapiesreported previous use of any 5-asas: budesonide mmx 9 mg : 63.4 % budesonide mmx 6 mg : 74.8 % pbo : 71.0 clinical and endoscopic remission rates after 8 weeks : budesonide mmx 9 mg : 17.7 % (p = 0.0002 vs. pbo) budesonide mmx 6 mg : 10.9 % (p = 0.069 vs. pbo) pbo : 6.2 % clinical improvement rates after 8 weeks : budesonide mmx 9 mg : 37.5 % (p = 0.06) budesonide mmx 6 mg : 28.3 % (p = 0.93) pbo : 28.6 % endoscopic improvement rates at week 8 : budesonide mmx 9 mg : 41.8 % (p = 0.04 vs. pbo) budesonide mmx 6 mg : 30.9 % (p = 0.78 vs. pbo) pbo : 32.4 % histologic healing rates at week 8 : budesonide mmx 9 mg : 9.9 % (p = 0.26) budesonide mmx 6 mg : 8.3 % (p = 0.54) pbo : 6.7 % complete symptom resolution rates at week 8 : budesonide mmx 9 mg : 26.3 % (p = 0.002 vs. pbo) budesonide mmx 6 mg : 21.7 % (p = 0.03 vs. pbo) pbo : 14.3 % most commonly reported aes : uc relapse: budesonide mmx 9 mg : 13.3 % budesonide mmx 6 mg : 16.5 % pbo : 14.0 % headache: budesonide mmx 9 mg : 11.4 % budesonide mmx 6 mg : 14.6 % pbo : 10.5 % potential glucocorticoid - related aes: budesonide mmx 9 mg : 9.0 % budesonide mmx 6 mg : 5.1 % pbo : 10.1 % maintenance of remission sandborn. r, pbo - cpatients with mild to moderate uc in clinical and endoscopic remission budesonide mmx 6 mg qd pbo qd for 12 monthsno concomitant uc therapies without investigator approvalmaintenance of clinical remission for up to 12 months was comparable for budesonide mmx 6 mg and pbo groups median time to clinical relapse : budesonide mmx 6 mg : > 1 year pbo : 181 days (p = 0.02) probability of clinical relapse after 12 months : budesonide mmx 6 mg : 40.9 % pbo : 59.7 % any aes : budesonide mmx 6 mg : 21.0 % pbo : 21.3 % 5-asa 5-aminosalicylic acid, aes adverse events, cir controlled ileocolonic release, core colonic release budesonide, db double blind, dd double dummy, mc multicenter, mmx multi - matrix, pbo placebo, pbo - c placebo - controlled, r randomized, uc ulcerative colitis, ucdai ulcerative colitis disease activity index asacol, proctor & gamble pharmaceuticals, cincinnati, oh clinical and endoscopic remission defined as total ucdai score 1, with rectal bleeding score = 0, stool frequency score = 0, no evidence of mucosal friability on colonoscopy, and decrease from baseline of 1 point in endoscopic index score clinical improvement defined as improvement (reduction) from baseline of 3 points in ucdai score endoscopic improvement defined as decrease from baseline of 1 point in ucdai endoscopy (mucosal appearance) subscore histologic healing defined as histologic score 1 symptom resolution defined as ucdai rectal bleeding and stool frequency subscores = 0 glucocorticoid - related aes : acne, fluid retention, flushing, hirsutism, insomnia, mood changes, moon face, sleep changes, and striae rubrae morning plasma cortisol normal range 138690 nmol / l maintenance of remission defined as ucdai subscores of 0 for both rectal bleeding and stool frequency time to clinical relapse defined as time to recurrence of rectal bleeding and/or stool frequency 12 stools / day more than normal for patient efficacy and safety of budesonide mmx for the treatment of ulcerative colitis remission 5-asa 5-aminosalicylic acid, aes adverse events, cir controlled ileocolonic release, core colonic release budesonide, db double blind, dd double dummy, mc multicenter, mmx multi - matrix, pbo placebo, pbo - c placebo - controlled, r randomized, uc ulcerative colitis, ucdai ulcerative colitis disease activity index asacol, proctor & gamble pharmaceuticals, cincinnati, oh clinical and endoscopic remission defined as total ucdai score 1, with rectal bleeding score = 0, stool frequency score = 0, no evidence of mucosal friability on colonoscopy, and decrease from baseline of 1 point in endoscopic index score clinical improvement defined as improvement (reduction) from baseline of 3 points in ucdai score endoscopic improvement defined as decrease from baseline of 1 point in ucdai endoscopy (mucosal appearance) subscore histologic healing defined as histologic score 1 symptom resolution defined as ucdai rectal bleeding and stool frequency subscores = 0 glucocorticoid - related aes : acne, fluid retention, flushing, hirsutism, insomnia, mood changes, moon face, sleep changes, and striae rubrae morning plasma cortisol normal range 138690 nmol / l maintenance of remission defined as ucdai subscores of 0 for both rectal bleeding and stool frequency time to clinical relapse defined as time to recurrence of rectal bleeding and/or stool frequency 12 stools / day more than normal for patient in both studies, clinical and endoscopic remission was achieved in a significantly greater percentage of patients receiving budesonide mmx 9 mg compared with placebo (table 1). in core i, remission at week 8 was achieved in 17.9 % of patients receiving budesonide mmx 9 mg, compared with 7.4 % (p = 0.01) in the placebo group and 12.1 % in the group receiving mesalamine (fig. 3a). in core ii, the 8-week remission rate was 17.4 % in patients receiving budesonide mmx 9 mg, compared with 4.5 (p = 0.005) and 12.6 % (p = 0.048) in the placebo and budesonide cir groups, respectively (fig. in addition, a subgroup analysis in the core ii study showed that a significantly greater percentage of patients with left - sided uc achieved clinical and endoscopic remission with budesonide mmx 9 mg than with placebo (17.7 vs. 5.8 %, respectively ; p = 0.03) ; the percentage of patients with extensive disease who reached clinical and endoscopic remission was also numerically higher with budesonide mmx 9 mg than with placebo (13.8 vs. 0 %, respectively), but this difference was not statistically significant (p = 0.10).fig. 3combined clinical and endoscopic remission rates at week 8 in the core i (a) and core ii (b) studies. clinical and endoscopic remission was defined as a ucdai score 1, with scores of 0 for rectal bleeding and stool frequency, no mucosal friability on colonoscopy, and a reduction from baseline of 1 point in endoscopic index score. ci confidence interval, cir controlled ileal release. reprinted with permission from sandborn travis. combined clinical and endoscopic remission rates at week 8 in the core i (a) and core ii (b) studies. clinical and endoscopic remission was defined as a ucdai score 1, with scores of 0 for rectal bleeding and stool frequency, no mucosal friability on colonoscopy, and a reduction from baseline of 1 point in endoscopic index score. reprinted with permission from sandborn. and travis. in core i, an analysis by disease severity subgroup indicated that in patients with mild uc (ucdai score 4 or 5) who received budesonide mmx 9 mg or placebo, clinical improvement (defined as a 3-point reduction in ucdai score) was achieved in 44.4 and 25.0 % of patients, respectively ; corresponding figures in patients with moderate disease (ucdai score 6 and 10) were 39.7 and 30.1 %, respectively. furthermore, the mucosal healing rate was greater with budesonide mmx 9 mg than with placebo in patients with proctosigmoiditis (32.4 vs. 19.5 %, respectively ; p = 0.20) and left - sided uc (40.6 vs. 26.5 %, respectively ; p = 0.22). a similar numeric difference favoring budesonide mmx 9 mg was also observed in patients with extensive uc (16.1 vs. 10.0 % with placebo), but this difference also was not statistically significant (p = 0.39). in a pooled analysis of the core i and core ii studies, patients treated with budesonide mmx 9 mg were at least 3 times more likely to achieve clinical and endoscopic remission versus placebo [or 3.3 (95 % ci 1.76.4) ]. budesonide mmx 9 mg was statistically significantly more efficacious versus placebo for several subgroups : males, females, patients 60 years, patients with prior mesalamine use, patients without prior mesalamine use, patients with mild uc at baseline, patients with moderate uc at baseline, patients with proctosigmoiditis, patients with left - sided uc, patients with uc duration > 1 to 5 years, and patients with uc duration > 5 years. the efficacy of budesonide mmx for the maintenance of uc remission was investigated in a study of patients who had achieved clinical and endoscopic remission in the core i and ii studies [15, 16 ] or patients in core i and ii who had received an additional 8 weeks of treatment (budesonide mmx 9 mg) in an open - label study (table 1) [17, 48 ]. in the maintenance study, patients were randomized to receive budesonide mmx 6 mg or placebo for up to 12 months ; the primary efficacy endpoint was clinical remission, assessed after 1, 3, 6, 9, and 12 months. the median time to clinical relapse (defined as rectal bleeding, stool frequency 12 stools per day, or both) was 181 days in the placebo group, but was not reached in the budesonide mmx group (p = 0.02 ; fig. 4) ; at 12 months, the probability of relapse was 59.7 and 40.9 %, respectively. however, the percentage of patients in whom remission was maintained for up to 12 months did not differ significantly between the groups, a finding that was potentially attributable to insufficient statistical power. therefore, the potential benefit of budesonide mmx in maintenance of remission is currently unclear and further studies are required.fig. 4kaplan meier plot showing the time to clinical relapse (defined as rectal bleeding, stool frequency 12 stools per day above normal, or both) in patients receiving maintenance therapy with budesonide mmx 6 mg or placebo for up to 1 year. reprinted with permission from sandborn. kaplan meier plot showing the time to clinical relapse (defined as rectal bleeding, stool frequency 12 stools per day above normal, or both) in patients receiving maintenance therapy with budesonide mmx 6 mg or placebo for up to 1 year. reprinted with permission from sandborn. in general, the budesonide molecule exhibits a more favorable safety profile than first - generation oral corticosteroids such as prednisone or prednisolone. for example, in a 10-week, double - blind, double - dummy study in 176 patients with cd who received tapering doses of prednisolone or budesonide cir for 10 weeks, the incidence of glucocorticoid - related adverse effects was significantly lower with budesonide than with prednisolone (33 vs. 55 %, respectively ; p = 0.003). in addition, suppression of the hypothalamic pituitary adrenal axis, assessed by measurement of the mean morning plasma cortisol concentration, was significantly greater with prednisolone than with budesonide cir after 4 weeks (p < 0.001) and 8 weeks (p = 0.02). the favorable adverse event (ae) profile of budesonide mmx in uc patients was demonstrated in the core i and ii studies [15, 16 ]. the incidence of aes in patients receiving budesonide mmx 9 mg or 6 mg was 57.5 and 58.7 %, respectively, in core i, and 55.5 and 62.5 %, respectively, in core ii. in both studies, the majority of aes were mild or moderate in intensity, and the incidence of serious aes was low and similar across all treatment groups. the most commonly reported aes in patients receiving budesonide mmx were uc, headache, and nausea (table 2) [15, 16 ]. in a pooled analysis of core i and ii, the incidence rates of predefined potential glucocorticoid - related adverse effects (acne, fluid retention, flushing, hirsutism, insomnia, mood changes, moon face, sleep changes, striae rubrae) were comparable for budesonide mmx 9 mg (10.2 %), 6 mg (7.5 %), and placebo (10.5 %). the most common predefined potential glucocorticoid - related adverse effects with budesonide mmx 9 mg versus placebo were mood changes (3.5 vs. 4.3 %, respectively) and sleep changes (2.7 vs. 4.7 %, respectively). in the 1-year budesonide mmx 6 mg maintenance study, 2most commonly reported adverse events (5 % of patients in any group) in core i and ii studies [15, 16]adverse eventstudypatients, n (%) budesonide mmx9 mgbudesonide mmx6 mgplacebomesalamine 2.4 gbudesonide cir9 mgany adverse eventcore i73 (57.5)74 (58.7)81 (62.8)80 (63.0)core ii71 (55.5)80 (62.5)57 (44.2)69 (54.8)uccore i14 (11.0)15 (11.9)21 (16.3)13 (10.2)core ii20 (15.6)27 (21.1)15 (11.6)16 (12.7)headachecore i8 (6.3)17 (13.5)19 (14.7)12 (9.4)core ii21 (16.4)20 (15.6)8 (6.2)9 (7.1)pyrexiacore i3 (2.4)5 (4.0)9 (7.0)3 (2.4)core iinrnrnr nrinsomniacore i5 (3.9)6 (4.8)9 (7.0)3 (2.4)core iinrnrnr nrback paincore i5 (3.9)4 (3.2)7 (5.4)2 (1.6)core iinrnrnr nrnauseacore i5 (3.9)5 (4.0)8 (6.2)10 (7.9)core ii8 (6.3)7 (5.5)3 (2.3)3 (2.4)abdominal paincore i6 (4.7)2 (1.6)8 (6.2)10 (7.9)core ii3 (2.3)5 (3.9)7 (5.4)7 (5.6)diarrheacore i2 (1.6)5 (4.0)7 (5.4)8 (6.3)core iinrnrnr nrflatulencecore i1 (0.8)1 (0.8)2 (1.6)7 (5.5)core ii5 (3.9)7 (5.5)3 (2.3)7 (5.6)nasopharyngitiscore inrnrnrnr core ii1 (0.8)8 (6.3)2 (1.6)6 (4.8)decreased blood cortisol levelcore inrnrnrnr core ii7 (5.5)3 (2.3)1 (0.8)4 (3.2) cir controlled ileocolonic release, core colonic release budesonide, mmx multi - matrix, nr not reported, uc ulcerative colitisadapted with permission from sandborn. and travis. most commonly reported adverse events (5 % of patients in any group) in core i and ii studies [15, 16 ] cir controlled ileocolonic release, core colonic release budesonide, mmx multi - matrix, nr not reported, uc ulcerative colitis adapted with permission from sandborn. and travis. the chronic and relapsing nature of uc means that the condition imposes a substantial burden on healthcare resources, and this burden extends to society as a whole when indirect costs resulting from lost productivity are taken into account. one us study estimated that the direct medical costs of uc were $ 2.7 billion, with health insurer and patient out - of - pocket expenditures between $ 390 million and $ 920 million. another study reported that mean estimated annual healthcare insurer expenditures were significantly greater for patients with uc than for patients without uc ($ 7424 vs. $ 4530, respectively, p < 0.001 ; expenditures adjusted to 2010 us dollars), and that mean annual out - of - pocket costs for uc patients were $ 1280. treatments that increase the likelihood of achieving and maintaining remission in uc may provide cost savings through decreased use of healthcare resources. however, the economic benefits of treatment with conventional corticosteroids in uc may be overestimated in economic models that failed to take into account the long - term adverse effects of these medications, such as the increased risk of osteoporosis and fractures. it remains to be determined whether the budesonide molecule, or a particular budesonide formulation, provides an economic benefit compared with conventional oral corticosteroids, although the decreased incidence of systemic adverse effects associated with budesonide may result in long - term economic benefits. patients with uc are often nonadherent to treatment [5355 ], and this has substantial clinical and economic consequences, including increased risk of uc relapse, decreased quality of life, and increased healthcare expenditures from hospitalizations and emergency room treatments [56, 57 ]. oral formulations of budesonide have several advantages compared with conventional oral corticosteroids, including once - daily dosing [15, 16, 42, 58 ], targeted absorption in the ileocolonic region or colon (depending on formulation), and favorable ae profiles [15, 16, 28 ]. as a result in a study of maintenance treatment, a greater percentage of uc patients receiving oral 5-asa once daily were adherent to treatment after 3 and 6 months compared with patients receiving conventional twice - daily or three - times - daily dosing [3 months : 100 vs. 70 %, respectively (p = 0.04) ; 6 months : 75 vs. 70 %, respectively (p = 0.8) ]. furthermore, more patients were very satisfied with dosing once daily (83 %) than with dosing twice daily or three times daily (60 %), although this difference was not statistically significant. the budesonide mmx formulation delivers the drug throughout the colon, in contrast to other controlled - release oral formulations of budesonide, which are targeted to the distal ileum and ascending colon the sites primarily affected by inflammation in cd. budesonide mmx has been shown to be efficacious and well tolerated for the induction of remission in patients with mild to moderate uc [15, 16 ], and the data currently available suggest that it may also be efficacious and well tolerated for maintaining long - term (up to 1 year) uc remission. the long - term safety of budesonide mmx in patients with uc was comparable to that of placebo, but these findings are limited to the single 12-month study. however, several studies have evaluated the use of oral formulations of budesonide as maintenance therapy in patients with cd [1828 ], and these have provided support for the long - term (1 year) safety of budesonide for maintenance of remission of inflammatory bowel disease. budesonide mmx may also offer pharmacoeconomic benefits by potentially increasing adherence to treatment via once - daily dosing and decreasing the risk of aes compared with conventional oral corticosteroids. | ulcerative colitis (uc) is a chronic idiopathic inflammatory disorder in which patients cycle between active disease and remission. budesonide multi - matrix (mmx) is an oral second - generation corticosteroid designed to deliver active drug throughout the colon. in pharmacokinetic studies, the mean relative absorption of budesonide in the region between the ascending colon and the descending / sigmoid colon was 95.9 %. in 2 identically designed, phase 3 studies (core i and ii), budesonide mmx 9 mg once daily was efficacious and well tolerated for induction of remission of mild to moderate uc. clinical and endoscopic remission rates were 17.9 % (core i) and 17.4 % (core ii) for budesonide mmx 9 mg compared with 7.4 and 4.5 %, respectively, with placebo (p 1 year with budesonide mmx 6 mg versus 181 days (p = 0.02) with placebo ; however, further studies are needed. in the core studies, budesonide mmx exhibited a favorable safety profile ; the majority of adverse events were mild or moderate in intensity, and serious adverse events were uncommon. furthermore, rates of potential glucocorticoid - related adverse events were comparable across treatment groups. the long - term (12-month) safety of budesonide mmx appears to be comparable with placebo. data support budesonide mmx in the management algorithm of uc. |
in general, many middle - aged women tend to have lifestyle - related diseases (e.g., hyperlipidemia, diabetes, and obesity) with contributing factors such as insufficient exercise, poor quality of food intake, psychogenic stress, and endocrine system dysfunction or imbalance. changes in the body shape and psychophysiological state that are accompanied by obesity lead to a loss of self - confidence and in decreased motivation to enjoy family life and social activities. such undesirable changes in lifestyle lead to aging - related changes and poor health. improving body weight, body - mass index (bmi), and body fat percentage (bfp) are important measures for promoting health care in middle - aged overweight women. however, an inappropriate health care program can lead to unfavorable changes in the physiological conditions of individuals or patients. it is important to develop an ideal health care program with less physiological stress and to verify its effectiveness in middle - aged women at the pre - obese or mild obese stage before they become severely obese. many reports have been published on the effects of various health care programs or lifestyle in middle - aged women, and include physical exercise and dietary or nutritional conditions. various methods for improving overweight - related health conditions have been proposed, although optimal health promotion should combine several types of treatments rather than focus only on one type of treatment. including stress - reducing body treatments is also important for holistic health. our ohcp is an integrated and complementary therapy for middle - aged women that has been performed every year for 10 years. the objective of an ohcp is weight control and promoting healthy condition inside the whole body. for this objective, the ohcp consisted of body treatments with cupping and massage, walking and stretching exercises, and diet treatments with special meals. to examine functional changes inside the body, we measured physiological parameters such as blood biochemical profiles and body composition in the study participants from 2011 to 2013. we performed the present study to clarify whether the proposed ohcp is a prompt and ideal method as a treatment in middle - aged japanese women at the pre - obese or mild obese stage. sixty - seven middle - aged women participated in the 3-year study (20112013). all participants arbitrarily applied to the overall health care program (ohcp), provided by slim beauty house company (shibuya ward, tokyo, japan). before the study, each participant provided informed, written consent. the ohcp included cupping treatments of the body surface, body massage, walking exercise, stretching, and dietary supplements that were based in chinese herbal medicine. of the 67 women, 17 women, 20 women, and 30 women participated in 2011, 2012, and 2013, respectively. seventeen participants through the 3-year study were categorized as obese with a bmi > 25 (range, 25.229.5). the bmi was calculated by the following equation : bmi = body weight (kg)/height (m). to avoid accidental health risks during ohcp, only participants who did not have underlying diseases such as allergies, serious inflammation or injury, scoliosis, low back pain, and hernia were allowed into the study. for this reason, all participants were required to provide a health certificate and receive interviews about their health conditions before undergoing the ohcp. the research period of the ohcp was conducted for 3 months (from late july to early november) in each year of 20112013. while the participant lay prone on a bed, 21 body surface regions were locally suctioned by a cupping cup and electrically powered suction equipment (minipon ; origin medical instruments co., ltd., cupping was performed with negative pressure of 66.5 kpa on 20 regions that were arranged symmetrically across the back midline from the upper scapular region to the lower limb and one region on the lumbar midline. each body portion from the shoulder to the foot of the participants was vibrated by a massage machine (hot - viter vr-303 ; meiko tsusho, tokyo, japan) with an oscillation frequency of 5060 hz. in 2011 and 2012, participants were allowed to rent a similar type of vibration apparatus and use it in their own home whenever they wanted to use it. in 2013, the participants were not allowed to use this apparatus in their home. the total number of walking days was 7891 days (mean, 87.0 days), 7893 days (mean, 90.0 days) and 8396 days (mean, 91.4 days) in 2011, 2012, and 2013, respectively. the daily average walking time was 34.4 minutes, 42.9 minutes, and 36.0 minutes in 2011, 2012, and 2013, respectively. there was no statistically significant difference (p > 0.05) between these walking times. in addition, there was no significant difference (p > 0.05) in total walking time between participants with a bmi 25 (mean, 3149 minutes ; n = 17). each subject was provided a special pack of alternative foods (i.e., enzyme foods) that contained more than 50 natural food components (table 1). in the first month, two of three daily meals (i.e., breakfast and dinner) were replaced with the enzyme foods. in the second and third months, only the dinner meal was replaced with the enzyme foods. participants were instructed to consume approximately 1500 kcal per day. body weight (kg) and bfp (%) were measured by a bioelectric impedance analysis scaleinner scan bc-621 ; tanita corporation, tokyo, japan. the circumference of the waist, lower limbs (i.e., thigh, calf, and ankle), arms, and lower thorax were also measured. the decrease rate (%) in body weight and bfp was determined as follows : (pre - ohcp post - ohcp)/pre - ohcp 100. venous blood was collected from all participants before and after ohcp for biochemical examination of the plasma. the following blood levels were examined by researchers at a blood examination company (lsi medience corporation, tokyo, japan) : creatine kinase (ck) and its isozymes (ck - mb and ck - mm), aspartate transaminase (ast), alanine aminotransferase (alt), lactate dehydrogenase (ldh), alkaline phosphatase (alp), -glutamyl transferase (-gt), aldolase (ald), choline esterase (che), leucine aminopeptidase (lap), triglyceride (tg), total cholesterol (t - cho), high - density lipoprotein (hdl) cholesterol, low - density lipoprotein (ldl) cholesterol, uric acid, creatinine, urea nitrogen, glucose, glycosylated hemoglobin a1c (hba1c), total protein (tp), albumin, and the albumin / globulin (a / g) ratio. the reference range of these blood markers in japanese women are as follows : ck, 40150 iu / l ; ck - mb, 25 or a bmi 25 (mean, 26.7) and 50 participants had a bmi 25 was somewhat less than in the participants with bmi 0.05). there were no noticeable correlations between the values of d - roms and ck pre - ohcp or post - ohcp (r = 0.02, 0.06, and 0.04 in 2011, 2012, and 2013, respectively). there were no significant correlations between the d - roms or bap post - ohcp values and total walking time during ohcp in any study year from 2011 to 2013. no positive correlation existed between d - roms and bmi in 67 participants (fig. however, there was a significant difference (p 25) and 363.4 units (n = 50) in the low bmi group (bmi 25 is considered obese in japanese people. before initiating ohcp, 17 of the 67 participants had a bmi > 25. in japan, 22.0% of women aged 4049 years are obese (japan ministry of health, labour and welfare, 2012). in the present study, the percent decrease in bfp after ohcp was unexpectedly larger in participants with a bmi 25. however, it is possible that participants with a larger bmi may be less susceptible to mechanical stimuli such as massage, cupping, and vibration. the dietary modification may have been less effective in participants with a high bmi because they received nutritional therapy through the meal replacement and the same volume of alternative enzyme foods as participants with the low bmi. therefore, it is unlikely that walking time factored into the bfp loss differential between the two groups. no significant changes occurred in the ast and alt throughout the 3-year study, which indicated that hepatic functions remained normal. furthermore, significant decreases in alp and -gt values within normal ranges suggest that hepatic functions actually improved from pre - ohcp to post - ohcp. significant increases in ck, ck - mb, and ck - mm were within their normal ranges in 2011 and 2012. the levels of ck and its isozymes are increased by exercise, which suggests that the increased muscle work from walking, massage, and stretching during the ohcp influenced the blood levels of ck. the increase in ck blood level is induced by regional muscle works and by local or whole body vibration, which suggests that passive - mechanical stimuli alone on the skeletal muscle can induce an elevation in blood ck. therefore, we have attributed the increase of ck and its isozymes in the present study to the walking exercise, body vibration and/or body massage that was performed 1 day or more before the blood sampling. in the present study, there was no evidence of a correlation between the total walking time and the ck values. because ck is an escape enzyme derived from skeletal muscle contraction, the blood ck level may be influenced by the intensity of the muscle activity rather than by the walking time. the consistent and significant decreases in alp and -gt indicated that the ohcp maintained the liver functions (including the biliary system) in good condition. the significant increase within normal ranges in ald and ldh in 2011 suggests facilitation of glycolysis metabolism during the ohcp. in addition, the significant decrease in che that occurred every year may be associated with lipid metabolism because che (e.g., butylcholinesterase) tends to increase in obese humans and dogs, and decreased che improves lipid profiles after physical exercise. in the present study, tg decreased considerably every year, as did t - cho in 2012 and 2013. these positive lipid changes, along with the post - ohcp changes in the body weight and bmi, clearly show the effectiveness of the ohcp among the study participants. the positive outcomes may be derived from the total integrated program, which includes walking exercise, body massage and cupping treatments, and basal calorie control through meal replacement for 3 months. the one participant who had high pre - ohcp and post - ohcp tg levels (369 mg / dl and 565 mg / dl, respectively) also had high pre - ohcp and post - ohcp t - cho levels (273 mg / dl and 249 mg / dl, respectively), and her bmi slightly decreased from 25.2 to 24.2. this low responder, although a rare case, may denote a lack of effectiveness of ohcp in participants with high levels of tg and t - cho. further research is warranted for this specific population. in our study, the mean d - roms value before ohcp was between 282.5 units and 426.9 units, and the mean bap value was between 2050.6 these values are nearly consistent with the values in middle - aged japanese healthy women (3049 years old) reported by komatsu. the d - roms and bap tests have been validated in japanese participants with metabolic syndromes and lifestyle - related diseases ; a significant correlation was observed between oxidative stress (i.e., the d - roms levels) and these abnormalities. the d - roms levels were higher in obese participants than in overweight and normal weight participants, and there is a positive correlation between d - roms levels and bmi. our study also showed a significant difference in the d - roms level between subject groups with a bmi higher than 25 or lower than 25. therefore, d - roms seem to reflect the overweight condition. however, the present study failed to show a clear positive correlation between the d - roms level and bmi because of the small number of obese participants and participants with less extensive obesity, compared to participants included in the study by vassalle. in 2011, significant increases in the post - ohcp d - roms and bap levels suggested that oxidative stress by ros and the elevation of antioxidant potential were concurrently induced. it is generally known that physical exercise provokes an increase in ros in the blood and skeletal muscle and that ros is associated with intracellular signaling. the walking time in the participants in 2011 was not different from the other 2 years ; however, it is possible that exercise and/or muscle activation by the other treatments that preceded the blood sampling after ohcp were somewhat intensive in 2011. in 2013, on the other hand, the d - roms level significantly decreased after ohcp, and was accompanied by a significant increase in the bap / d - roms ratio. therefore, the ohcp in 2013 resulted in less oxidative stress for participants, but more antioxidative stress potential. in 2013, 13 randomized participants were assigned to have their autonomic nervous function measured by power spectrum analysis of pulse intervals immediately before and after body cupping and massage treatments. a significant increase in hf power and a significant decrease in the lf / hf ratio, along with a significant decrease in the heart rate, suggested that the autonomic nervous function shifted to a predominantly parasympathetic nervous tone rather than a sympathetic tone. this shift provided evidence that body cupping and massage in this program produced the desired physical and mental relaxation. such a change in autonomic nervous tone in healthy participants may contribute to the recovery of the physiological condition from overall body fatigue. our study results indicated that ohcp effectively improved the physiological state and the body composition of middle - aged women without noticeable physiological stress. the ohcp may aid in the prevention of lifestyle - related diseases such as hyperlipidemia and obesity in middle - aged, japanese women. however, further studies are required because of the limitations in the present study resulting from a relatively small number of participants, lack of a control group that had not undergone ohcp, lack of measurements of blood hormonal activities, and the exclusion of participants with severe obesity. a part of this study was financially supported by slim beauty house company (tokyo, japan). | this study aimed to verify the effectiveness of an overall health care program (ohcp) for middle - aged japanese women through assessing physical and physiological changes. the ohcp consisted of diet modification with natural alternative foods, walking and stretching exercises, and body massage and cupping treatments. sixty - seven participants were assigned to one of three groups during a 3-year study period (20112013). the ohcp was performed for 3 months in each year. after the ohcp, most participants had significant decreases in the blood levels of triglycerides, low - density lipoprotein cholesterol, total cholesterol, alkaline phosphatase, -glutamyl transferase, and cholinesterase ; body weight ; body fat percentage ; and body - mass index. the oxidative stress markers varied among the study years ; however, a significant decrease in blood reactive oxygen - derived metabolites and a significant increase in the relative antioxidative potential were observed in 2013. in 2013, participants who were randomly selected for autonomic nervous activity measurements immediately before and after body massage and cupping treatments showed a significant predominance in parasympathetic nervous activity after the treatments. these results indicate that the ohcp in the present study is an effective and prompt method as a complementary treatment to improve the pre - obese or mild obese status without any noticeable physiological stress in most middle - aged women. however, because of the limitations of this study, the findings of this study need to be confirmed. |
chronic hepatitis is a common cause of liver related morbidity due to different hepatic viruses, where hepatitis b (hbv) and hepatitis c (hcv) have been identified as the main cause and lead to many complications. over a million persons die annually due to hbv related complications [2, 3 ]. infection with multiple viruses leads to management problems with higher incidence of morbidity and mortality. since hepatitis b, hepatitis c, and hepatitis d share almost the same modes of transmission, infection with more than one virus is possible. therefore, presence of dual and triple viral infections has been reported from various parts of the world. hcv is a positive stranded rna virus and has been classified into the genus hepacivirus of the family flaviviridae. lack of proper implementation of international standards in procedures like blood transfusion, reuse of injections, injecting drug users, tattooing, shaving from barbers, unsterilized dental reuse of needles for ear and nose piercing, and surgical instruments is the key factor of hcv transmission in pakistan. worldwide, there are about 170 million people infected with hcv, and three to four million individuals are diagnosed as new cases every year, while in pakistan 10 million people are presumed to be hcv patients with 5% prevalence in general population. hepatitis b virus belongs to hepadnaviridae family with a circular genome of 3.2 kb composed of partially double - stranded dna. an average prevalence of hepatitis b antigen in pakistan is 2.4% (range 1.411.0%) in healthy adults and 2.4% in pediatric population. the reuse of used syringes and unsafe blood transfusion are the major causes of spread of hepatitis b. hepatitis delta virus (hdv), first discovered by rizzetto. in a patient with chronic hepatitis b virus (hbv) infection, is a unique single - stranded negative circular rna virus with genome of 1.7 kb that requires the helper function of hbv for infection. it was originally thought to be a new nuclear antigen associated with hbv but later proved to be a new virus that requires the surface antigens of hbv (hbsags) to support its life cycle and infectivity [1517 ]. the prevalence of hdv accounts for 1520 million people who are already infected with hbv. very limited data is available about the prevalence and epidemiology of hdv infection in pakistan. hdv infection is present in 16.6% of hepatitis b infected patients in pakistan. in another study from karachi 35.2% of the coinfection it was further explained that hbv / hdv coinfection resulted in the suppression of hbv dna. a fair percentage of hbv / hdv coinfected patients with hbeag negative had active hepatitis b infection and cirrhosis as compared to those with monoinfection. diagnosing multiple hepatitis viral infections is limited by low level of awareness among physicians and availability of simple diagnostic tests. recently, good results were demonstrated by a single integrated protein microarray that could simultaneously determine in human sera two viral antigens (hbsag and hbeag) and seven antibodies (hbsab, hbcab, hbeab, hcvab, hdvab, hevab, and hgvab) of human hepatitis viruses within 20 minutes. treatment options are limited in triple infections as lamivudine alone or in combination with interferon has not shown much benefit in patients coinfected with hdv. since there is no report on triple infection caused by hepatitis viruses from pakistani population, the aim of this study is to find the rate of coinfection of hbv and hdv in hcv infected pakistani patients. present study was conducted at atta - ur - rahman school of applied biosciences (asab), national university of science and technology (nust), in collaboration with capital development authority (cda) hospital, islamabad, railways hospital (iimct), rawalpindi, and holy family hospital, rawalpindi, pakistan. the study was approved by the institutional review board (irb), asab, and nust. in the present study, a total of 730 patients, with liver disease, were included who were referred to asab diagnostics center during the period from july 2009 to march 2010. during the course of the study, 137 samples were collected from capital development authority (cda) hospital, islamabad, 257 samples from government holy family hospital, rawalpindi, 155 samples from railways hospital (iimct), rawalpindi, and 181 from atta - ur - rahman school of applied biosciences (asab) diagnostics. sera of the patients were subjected to viral rna extraction by using qiaamp viral rna extraction kit (qiagen), according to the manufacturer 's protocol. all elisa positive samples with chronic hepatitis c infection were further confirmed for hcv presence by pcr. indirect elisa method is used for the detection of antibodies to hcv in two - step incubation procedure (microlisa). viral rna was taken to reverse - transcribe the 5 ncr of hcv using moloney murine leukemia virus reverse transcriptase (m - mlv rtase, fermentas) in a total reaction volume of 20 l. the reaction mixture contained 4 l mmlv (5x) buffer, 1 l m - mlv reverse transcriptase (rt) enzyme, 1 l dntps (10 mm), 0.5 l rnase inhibiter (fermentas), 1.5 l rnase free water, 1 l specific antisense primer p2 5-actcgcaagcacctatcaggcagtac-3 (macrogen, korea), and 10 l template (viral rna). cycle conditions for cdna were as follows : 42c for 55 minutes followed by 70c for 10 minutes. the cdna produced was stored at 4c for short - term storage or 20c for prolonged storage. the first round pcr was performed using sense p1 5-ccctgtgaggaacactgtcttcacgc-3 and antisense p2 5-actcgcaagcacctatcaggcagtac-3 primers (macrogen, korea) followed by second round pcr (nested pcr), using the first round product with inner sense p3 5-gaaagcgtctagcatggcg-3 and antisense p4 5-cacaaggcctttccgacc-3 primers (macrogen, korea). the pcr product was visualized by 1.2% agarose gel and stored at 20c until further use. the sera of hcv samples were tested for infection of hbv. to analyze the hbv infection, strip device (acon, usa), the specific portion of surface gene was amplified through pcr from hbv genomic dna using specific forward and reverse primers. viral dna was isolated from the serum of hbv infected patient 's samples using qiagen kit (germany) according to the manufacturer 's protocol. 20 l pcr reaction mixture contain dna, pcr master mix (50 units / ml of taq dna polymerase supplied in a proprietary reaction buffer ph 8.5, 400 m datp, 400 m dgtp, 400 m dctp, 400 m dttp, and 3 mm mgcl2) (promega cat. # m7502), 10 mm of sense primer (macrogen, korea), 5-ccgaattcgccaccatgcatcctgctgctatgcctcatct-3 and 10 mm of antisense primer (macrogen, korea), and 5-cccgaattcgccaccatgcgaaccactgaacaaatggcact-3. thirty cycles of dna amplification were performed. the condition of each cycle was denaturation at 94c for 45 seconds, primer annealing at 64c for 45 seconds, and elongation at 72c for 45 seconds, followed by a final elongation at 72c for 7 minutes. pcr product was further amplified with the inner nested primer set, 10 mm sense primer (macrogen, korea), 5-cccgaattcgccaccatgggtatgttgcccgtttgtcctct-3, and 10 mm of antisense primer (macrogen, korea) 5-cccgaattcgccaccatgggcactagtaaactgagcca-3 for an additional 30 cycles under the same reaction conditions. the pcr product was visualized by 1.2% agarose gel and stored at 20c until further use. all the patient 's sera positive for hbv dna by pcr were checked for anti - hdv antibodies using 3rd generation elisa assay kit (globe diagnostics, italy) using the methodology described in the manufacturer 's protocol. in brief, incubator was set to 37 1c. all the reagents were brought to room temperature before use (approximately 1 hour), without removing the plate from the bag. a 1/20 dilution of serum samples in tubes apart was prepared by adding 5 l of sample to 95 l of sample dilution solution (1/20 dilution). 80 l of sample dilution solution was added into all wells except in those assigned to controls. 20 l of the 1/20 dilutions of serum samples, 100 l of positive control, 100 l of cutoff (cutoff in duplicate), and 100 l of negative control were added into the corresponding wells. plate was covered with a sealing sheet and incubated at 37 1c for 60 min. the seal was removed and aspirate liquid from all wells was washed five times with 0.3 ml of washing solution per well. then immediately 100 l of reconstituted antigen - conjugate complex was added into each well, covered with a sealing sheet, and incubated in incubator 37 1c for 60 min. the seal was removed and liquid from all wells was aspirated and washed five times with 0.3 ml of washing solution per well. immediately after that 100 l of substrate solution was added into each well, incubated at room temperature for 20 min, and protected from light and then immediately 50 l of stopping solution was added into all wells, and finally read with elisa plate reader at 450 nm within 1 hour of stopping. the level of fasting glucose, total cholesterol (tc), high - density lipoprotein (hdl), alanine amino transferase (alt), aspartate transaminase (ast), bilirubin, and fasting triglyceride (tg) was measured by microlab 300 apparatus (merck). sera of all 501 chronic hcv patients were analyzed for these parameters. in statistical analysis clinical variables presented as mean sd. mean, sd, p value, and ci (95%) and standard error were calculated and compared by using independent t - test. for p value for the evaluation of common risk factors associated with the hcv transmission, no provincial data collection system exists. a total of 730 samples, suspected for hepatitis c infection, were subjected to pcr - based detection for viral rna, out of which 501 (with mean age of patients 39.35 12.32) samples were proved as hcv positive, by giving a band size of approx. a total of 501 hcv positive samples were screened for hbsag through immunochromatographic technique (ict hbsag) ; out of 501 samples, 33 were (6.6%) found positive for hbsag. these 33 samples were screened for hbv dna through nested pcr technique and the results of nested pcr are shown in figure 2. a total of 31 (6.2%) samples were found positive for hbv dna and the data is given in table 1. after the confirmation of samples for hbv dna, 31 coinfected (hbv and hcv) samples were further screened for hepatitis delta (hdv) infection. anti - hdv elisa screening was performed in hbv and hcv coinfected samples and it was found that 5 (1% of the total hcv positive) samples were positive for anti - hdv antibodies showing that the 1% of the total 501 samples have triple infection of hcv, hbv, and hdv, with mean age of 30.20 8.258, shown in figures 3 and 4. the 501 samples were divided into 3 groups : (1) the patients with single infection (hcv), (2) patients with the double infection (hcv and hbv), and (3) patients with the triple infection (hcv, hbv, and hdv) were subjected to the analysis of liver function tests, that is, alt, ast, and bilirubin. in case of single infection, the mean levels of ast, alt, and bilirubin were found to be 76 iu / l, 91 iu / l, and 1.9 mg / dl, respectively. iu / l, 84 iu / l, and 1.6 mg / dl in case of double infection for ast, alt, and bilirubin, respectively. the mean values of lfts for triple infection were 174 iu / l, 348 iu / l, and 3.25 mg / dl, respectively (table 2). various possible risk factors, for example, blood transfusion, injectable drug users, dental operations, razor sharing, observed in the current study responsible for infection transmission with each single, double, and triple infection are given in figures 6, 7, and 8 and table 3. all the 501 patients were included in the study ; 229 (46%) were females with mean age of 39.58 11.07 and 229 (54%) were males with mean age of 39.15 13.29. a summary of gender and age association of hcv infected patients is given in table 4. it is evident from table 4 that there is no significant relation between gender / mean age of the patients and hcv infection. in the first group with hcv single infection alone, there was no significant difference between the number of males (53%) and number of females (47%) as well as the mean age of males (39.36 13.37) and the mean age of females (39.80 11.11) as shown in table 5. among the second group with dual hepatitis infection (hcv + hbv) the case was different from the first group. the numbers of males with dual infection were more than double (69%) as compared to females (31%). the mean age of females in this group was 33.5 8.19 and that of males was 40.11 13.02, as shown in table 6. in the third group with triple hepatitis infection (hcv, hbv, and hdv) the observations were different. all of the patients in this group were males with mean age of 30.2 8.25. lfts of coinfected patients (hcv and hbv) were compared with hcv infected patients through independent t - test. it was found that the lfts of dually infected patients were significantly lower (closer to the normal values) as compared to the single infected patients with p values 0.020, < 0.05, and 0.052 for alt, ast, and bilirubin, respectively, as shown in figure 5. then the lfts of patients with triple infection (hcv, hbv, and hdv) were compared with single infected patients (hcv) through independent t - test. it was found that the lfts of triple infected patients were significantly higher (away from the normal values) as compared to the single infected patients with all the three p values < 0.05 for alt, ast, and bilirubin, as shown in figure 5. patients having single infection with hcv were placed, and the second group comprised patients having double infection with hcv and hbv. the patients who were infected with all three viruses were placed in the third group. in order to establish an association of coinfection (either double or triple) with route of transmission, the whole data of routes of transmission were divided into 10 groups comparing routes between coinfected and single infected patients. after analyzing the data, it was found that the most important route of transmission associated with coinfection was intravenous drug users (idu) in which 50% (6/12) of the subjects were found coinfected with hbv and hdv. from this data, the other possibly associated route of transmission for the coinfection may be the multiple blood transfusions with 23% (3/13) of the coinfected cases. in the case of sexual transmission, use of contaminated tools for nose and ear piercing (11.1% of coinfected patients in each) and health care workers (10.3%) may also be considered as the associated routes of transmission for the coinfection as shown in figures 6, 7, and 8. the coinfection of hbv in hcv patients is frequent in pakistan and this study indicates that superinfection with hdv is also a serious problem. chronic hepatitis due to different hepatic viruses is a common cause of liver related morbidity. hepatitis b (hbv) and hepatitis c (hcv) are the main causes for chronic hepatitis [1, 24, 25 ]. it has been shown that superinfection of hepatitis a or e over hbv or hcv could lead to patient 's deterioration and increase or precipitate encephalopathy. infection with multiple viruses leads to management problems with higher incidence of morbidity and mortality. presence of dual and triple viral infections has been reported from various parts of the world. as hepatitis b, hepatitis c, and hepatitis d share same modes of transmission, infection with more than one virus the objectives of the current study were to determine the double and/or triple viral infections of hepatitis b and hepatitis d in chronic hcv patients, the effect(s) of triple infection (if present) of hepatitis on liver, and risk factors involved in its transmission. in the present study, 501 hcv positive samples, 54.3% males and 45.7% females, were screened for dual infection of hbv and 31 (6.2%) were found positive for dual infection. the dually infected patients were screened for the presence of hdv and 5 (1%) were found positive for triple infection. in present study, this effect could be due to the fact that the authors primarily inducted the patients for hepatitis b diagnosis and tested them for hdv and hcv while they primarily inducted the patients of chronic hepatitis and tested for all three viruses. infections were predominantly acquired through injection of drugs (i.e., hbv and hcv). in case of liver infection, the levels of alt, ast, and bilirubin usually rise up indicating liver injury. the mean value of ast, alt, and bilirubin levels in the patients with chronic hepatitis c alone was found to be 76 24.88 iu / l, 91 45.38 iu / l, and 1.9 0.69 mg / dl, respectively. in case of coinfection of hbv in hcv patients, the mean ast, alt, and bilirubin level were found to be 61 (15.39), 84 (16.26), and 1.6 (0.73), respectively. the level of ast and alt enzymes and bilirubin in triple hepatitis was comparatively higher as compared to single / dual infection. lfts (figure 5 and table 2) were 174 (77.00), 348 (117.05), and 3.25 (0.88). it was found that multiple use of syringes (110) (22%) and dental operation (94) (18.7%) are the major route of transmission in case of hcv alone or coinfection of hbv, while the use of contaminated needles is the standalone cause of triple hepatitis affecting 80% of patients in the study subjects. large proportion of patients enrolled in the study (96) (20.4%) even did not know how they acquire these viral infections. this might be due to lack of awareness of viral hepatitis, poor sanitary condition, and lack of proper disposal of waste material. nearly in all samples, hcv was acquired via idu ; hcv seroprevalence was 89.7% among injection drug users, compared with 10.5% among noninjection drug users, and idu was by far the strongest risk factor for hcv infection in multivariate analyses. | seroprevalence of hcv indicates that hcv is found in more than 10% of hbv- or hdv - infected patients worldwide leading to liver disease. here we show hbv and hdv coinfection association with hcv infected pakistani patients, study of disease severity, and possible interpretation of associated risk factors in coinfected patients. a total of 730 liver diseased patients were included, out of which 501 were found positive for hcv infection via pcr. 5.1% of patients were coinfected with hbv while 1% were coinfected with hbv and hdv both. lfts were significantly altered in dually and triply infected patients as compared to single hcv infection. mean bilirubin, ast, and alt levels were highest (3.25 mg / dl, 174 iu / l, and 348 iu / l) in patients with triple infection while dual infection lfts (1.6 mg / dl, 61 iu / l, and 74 iu / l) were not high as in single infection (1.9 mg / dl, 76 iu / l, and 91 iu / l). the most prominent risk factor in case of single (22%) and dual infection (27%) group was reuse of syringes while in triple infection it was intravenous drug users (60%). it is concluded that hbv and hdv coinfections are strongly associated with hcv infected pakistani patients and in case of severe liver disease the possibility of double and triple coinfection should be kept in consideration. |
a 29-year - old cambodian lady with a history of transfusion - dependent -thalassemia from six years of age was referred for ophthalmic evaluation. she presented with recent onset of impaired color vision, constriction of visual fields and night blindness. she had been on subcutaneous desferrioxamine (40 mg / kg) six times per week since her initial transfusion. ten weeks prior to her referral, she was started on intravenous desferrioxamine (50 mg / kg per day) for gross hepatic iron overload (serum ferritin level 5440 microgram / l, therapeutic index 0.009). on examination, visual acuity was 20/20 in the right eye (re) and 20/40 in the left eye (le). she had a left relative afferent pupillary defect and markedly diminished color vision in both eyes. fundus fluorescein angiography (ffa) showed speckled hyper - fluorescence with well - demarcated areas of blocked fluorescence [fig. further evaluation with full - field electro - retinogram (erg) showed marked bilateral reduction in amplitude for photopic, scotopic and 30-hz flicker erg. electro - oculogram (eog) revealed a diminished response (arden index of 1.36 in the re and 1.11 in the le). the p100 latency period was more delayed in the left compared to the right on pattern visual evoked potential (vep) testing. color fundus photos demonstrating diffuse mottling of the retinal pigment epithelium at the posterior pole and mid - periphery in the right eye (a) and left eye(b) fundus fluorescein angiogram (late venous phase) showing diffuse retinal hyper - fluorescence in both eyes along with blocked fluorescence in the peripapillary, macular and equatorial regions in the re (a) and blocked fluorescence in the peripapillary, inferior papillomacular bundle and equatorial regions in the le (b) desferrioxamine was stopped and replaced with deferipone (1 g three times per day). four months later, there was marked recovery in color vision in both eyes ; the visual acuities remained unchanged. desferrioxamine mesylate is a widely used chelating agent in managing patients with chronic iron overload, acute iron poisoning and aluminum toxicity. as illustrated by this report, patients on desferrioxamine can present with acute / sub - acute deterioration in visual acuity and color vision, night blindness, scotomas or constricted fields. the ocular toxicity is postulated to be due to the direct effect of desferrioxamine, chelation of ions (iron, copper, aluminum) on the retinal pigment epithelial with resultant dysfunction or due to defective vasoregulation. ocular side - effects include cataracts, retrobulbar optic neuritis, pigmentary retinopathy, bull 's eye maculopathy and vitelliform maculopathy.[46 ] the pigmentary retinopathy is classically macular or peripheral but can rarely present in the paramacular, papillomacular or peripapillary pattern. it is still unclear whether ocular toxicity is dose - dependent or not ; however, existing literature as well as our experience with this patient shows that those with lower iron loads and desferrioxamine dosage higher than 50 mg / kg / day are at increased risk for developing systemic toxicity. as ocular toxicity can be asymptomatic, all patients on desferrioxamine should have baseline visual acuities, color vision, visual fields, ffa, eog and erg. during the follow - up phase, diffuse outer retinal fluorescence on ffa is a useful marker for ongoing disease activity, whilst eog and erg are helpful in monitoring the retinal dysfunction. regular ophthalmic screening at three - monthly intervals along with monthly monitoring of serum ferritin levels and maintenance of the therapeutic index level of desferrioxamine (daily dose per body weight (mg / kg) divided by serum ferritin (microgram / l)) at levels < 0.025 can help in prevention and reversal of ocular toxicity. it is also interesting to observe that a presenting therapeutic index level of desferrioxamine below 0.04 can be indicative of better visual prognosis. in conclusion, heightened awareness amongst ophthalmologists and regular ophthalmic screening is required in patients receiving desferrioxamine to avoid delayed diagnosis and management of desferrioxamine - related optic neuropathy and retinal dysfunction. | a 29-year - old lady receiving repeated blood transfusions for thalassemia since childhood, presented with rapidly deteriorating symptoms of night blindness and peripheral visual field loss. she was recently commenced on high - dose intravenous desferrioxamine for reducing the systemic iron overload. clinical and investigative findings were consistent with desferrioxamine - related pigmentary retinopathy and optic neuropathy. recovery was partial following cessation of desferrioxamine. this report highlights the ocular side - effects of desferrioxamine mesylate and the need to be vigilant in patients on high doses of desferrioxamine. |
le forme invasive di listeriosi umana includono setticemia, meningiti e infezioni materno - fetali (lorber, 1997). molti paesi hanno organizzato un sistema di sorveglianza per l. monocytogenes a causa della sua importanza per la salute umana ma anche perch il suo controllo una grossa sfida per le aziende alimentari. la tipizzazione di l. monocytogenes a livello di ceppo viene utilizzata nelle attivit di sorveglianza, negli studi epidemiologici e durante gli episodi tossinfettivi (kathariou, 2002 ; swamina - than e gerner - smidt, 2007). studi filogenetici hanno identificato nella popolazione di l. monocytogenes 4 distinte linee filogenetiche delle quali le linee 1 e 2 contengono genotipi pi importanti per la loro patogenicit per luomo (kathariou, 2003 ; nightingale., 2005 ; orsi., 2011 ; piffaretti., 2008 ; ward., 2010). per identificare tali genotipi e le loro fonti di contaminazione sono necessarie metodiche di tipizzazione standardizzate ; tra tali metodiche, la sierotipizzazione (seeliger e hhne, 1979) e la polymerase chain reaction (pcr) sierotipizzazione (doumith., 2004), sebbene largamente utilizzate per la caratterizzazione di l. monocytogenes non sono abbastanza discriminanti da poter essere impiegate nel contesto di unanalisi epidemiologica durante un focolaio di tossinfezione alimentare. lelettroforesi in campo elettrico pulsato (pfge) ha rappresentato per anni la metodica di riferimento per la tipizzazione di l. monocytogenes ed ancora ampiamente utilizzata per le attivit di sorveglianza e le analisi epidemiologiche (graves e swaminathan, 2001). la multi - locus sequence typing (mlst) la tecnica attualmente pi utilizzata per le analisi epidemiologiche e lo studio delle popolazioni. infatti, il profilo mlst pu essere facilmente confrontato tra laboratori diversi e il dato fornito, basato sul sequenziamento, correlabile al livello di diversit genetica ed alla frequenza di ricombinazione tra ceppi (feil, 2004 ; maiden, 2006). tuttavia, la mlst una metodica lunga, costosa e per l. monocytogenes ha un potere discriminatorio limitato (ragon., 2008 ; den bakker., 2010). per superare le limitazioni associate alle tecniche descritte un approccio alternativo rappresentato dallanalisi multilocus del numero variabile di sequenze tandem (mlva) gi utilizzata per le analisi epidemiologiche di altri batteri patogeni (lindstedt, 2005) perch relativamente semplice, economica e dotata di un buon potere discriminatorio. la metodica mlva si basa sullo studio della variabilit del numero di sequenze tandem in specifici loci del genoma batterico. cinque schemi mlva sono stati simultaneamente sviluppati per la tipizzazione di l. monocytogenes ed il loro impiego gi stato dimostrato in vari studi epidemiologioci (balandyte., 2011 ; chen., 2011 ; houhoula., 2012 ; li., 2013 ; lunestad., 2012). i cinque schemi si differenziano per il numero di multiple locus variable number of tandem repeats (vntr) considerato, variabile da 3 a 10. la carne di maiale la tipologia di carne fresca pi consumata in europa (devine, 2003) ed il suo controllo in termini di contaminazione con microrganismi patogeni fondamentale sia per la salute pubblica sia per le aziende alimentari. in questo studio una metodica mlva basata sullanalisi di 6 loci vntr stata utilizzata per tipizzare un gruppo di 82 ceppi di l. monocytogenes, isolati da 8 lotti di carne di maiale testati dal momento del confezionamento al consumo, per valutarne la diversit e potenziale patogenicit per luomo in funzione della appartenenza alle linee filogenetiche note per l. monocytogenes. otto lotti di lonza di maiale sono stati campionati da dicembre 2010 a ottobre 2011 nello stesso laboratorio di sezionamento. in ogni lotto, la presenza / assenza di l. monocytogenes stata valutata in 20 unit campionarie utilizzando la metodica iso11290 - 1:1996/amd1 : 2004 (iso, 2004). le 20 unit campionarie sono state suddivise come segue : 5 sono state analizzate dopo il confezionamento sotto vuoto ; 5 dopo trasporto in automezzo refrigerato aziendale e stoccaggio nel banco frigo presente nel punto vendita fino al quarto giorno post confezionamento ; 5 dopo trasporto e stoccaggio al punto vendita, trasporto per 45 min in auto senza refrigerazione e stoccaggio a 6c fino al termine della shelf life del prodotto al giorno sette post - confezionamento ; 5 dopo trasporto e stoccaggio al punto vendita, trasporto per 45 min in auto senza refrigerazione e stoccaggio a 14c fino al giorno sette post - confezionamento. da 3 a 15 isolati sono stati selezionati a caso dai campioni positivi appartenenti ad uno stesso lotto, purificati mediante tre passaggi seriali in piastre di brain heart infusion agar (oxoid, milano, italy) incubate a 37c per 24 ore, identificati come l. monocytogenes o listeria spp. un totale di 6 vntr sono stati ottimizzati per lamplificazione in due distinte multiplex - pcr. i prodotti di reazione sono stati diluiti e miscelati in una mix contenente formammide e genescan 600 liz come marcatore di peso molecolare. le corse elettroforetiche sono state eseguite mediante 3130 genetic analyzer (applied biosystems, carlsbad, ca, usa). i dati sono stati analizzati mediante genemapper 4.0 (applied biosystems), i singoli alleli normalizzati, importati in bionumerics 6.5 (applied maths, sint - martens - latem, belgium) ed utilizzati per lanalisi filogenetica. tuttavia, i dati di prevalenza e concentrazione del patogeno nei campioni testati sono fuori dallo scopo di questo lavoro. complessivamente sono stati tipizzati mediante mlva 82 ceppi isolati da prodotti al momento del confezionamento (n=16), dopo trasporto e stoccaggio al punto vendita (n=21) e dopo stoccaggio fino al giorno sette post - confezionamento a 6 (n=22) o 14c (n=23) (tabella 1). nel lotto 1, gli isolati analizzati con mlva sono stati raccolti fino al giorno 4 post confezionamento mentre nei lotti 7 ed 8 da quel momento in poi. i ceppi analizzati erano classificati in 10 profili mlva siglati da i a x, contenenti ognuno un numero di isolati variabile da 1 a 20 (tabella 1). i lotti 1 e 3 sono stati caratterizzati da isolati con il medesimo profilo mlva, mentre i restanti 6 lotti hanno mostrato profili mlva diversi durante la shelf - life. in particolare, in tutti i lotti stato osservato un profilo mlva persistente (es. profilo iii nel lotto 2, vii nel lotto 4, viii nei lotti 5 e 6, vii nel lotto 7 e parzialmente ii nel lotto 8) e profili mlva associati a fasi specifiche. come osservato in studi precedenti, i profili mlva consentono, con una notevole affidabilit, di prevedere la linea filogenetica, il sierotipo ed il sequence type (st) degli isolati analizzati. in questo studio, i profili mlva dal vi al x identificati nel 75.6% degli isolati testati indicano lappartenenza di tali ceppi alla linea filogenetica 2 ed al sierotipo 1/2c, spesso associato a ceppi isolati da alimenti ma non dalluomo. al contrario, 3 isolati con profili mlva i e iv risultano appartenere alla linea filogenetica 1 e sierotipo 4b, spesso identificato in ceppi responsabili di episodi di infezione umana. infine, 17 isolati con profili mlva ii, iii e v risultano associabili linea filogenetica 2 ed al sierotipo 1/2a, anchesso tipico di ceppi responsabili di infezione umana. l. monocytogenes uno dei patogeni frequentemente associati al consumo di carne di maiale come dimostrato da fosse e collaboratori (2008) ; inoltre, matargas e collaboratori (2008) hanno confermato la relazione tra il rischio di contrarre listeriosi ed il consumo di carne di maiale poco cotta o processata e da riscaldare prima del consumo. sulla base di queste considerazioni la carne di maiale cruda, come quella analizzata in questo studio, pu essere fonte di contaminazioni crociate e pertanto il suo controllo diventa rilevante in termini epidemiologici. per capire il livello di rischio associato ad un prodotto alimentare contaminato con l. monocytogenes importante capire come cambia la popolazione del patogeno durante la vita commerciale del prodotto. alcune delle fasi che impattano non solo sulla sopravvivenza e moltiplicazione di l. monocytogenes nella carne fresca ma anche sulla composizione della popolazione contaminante sono la fase di manipolazione nel laboratorio di sezionamento ; il trasporto e lo stoccaggio del prodotto confezionato nel punto vendita ; il trasporto da parte del consumatore dal punto vendita a casa e lo stoccaggio in frigorifero prima del consumo. in questa ricerca limpatto della fase di stoccaggio in frigorifero da parte del consumatore stato valutato considerando come temperatura media dei frigoriferi di casa la tecnica mlva si distingue da altre metodiche di tipizzazione utilizzate per l. monocytogenes, come la sierotipizzazione, la pfge e la mlst, per la notevole processivit e per i costi contenuti di esecuzione. inoltre, facilmente standardizzabile e riproducibile tra laboratori, garantendo la possibilit di confrontare gli isolati con un sistema univoco di interpretazione. i risultati ottenuti in questo studio preliminare hanno dimostrato che in funzione del profilo mlva la maggior parte degli isolati testati ricadeva in un genotipo raramente coinvolto in episodi clinici. tuttavia, i tre ceppi classificati nei profili mlva i e iv potrebbero essere altamente patogeni perch associati alla linea filogenetica 1 e sierotipo 4b, ed anche i profili mlva ii, iii e v del sierotipo 1/2a andrebbero ulteriormente caratterizzati a causa dellincremento atteso delle segnalazioni relative al coinvolgimento di tali isolati in focolai di listeriosi anche nel nostro paese (mammina., 2013). anche se la loro presenza nel prodotto post confezionamento non pu essere esclusa per il basso numero di isolati tipizzati, interessante notare come queste tipologie di ceppi compaiano alla fine della shelf life del prodotto. la maggior parte dei profili mlva persistenti nei lotti analizzati non sembrano associabili a sierotipi altamente patogeni per luomo ma la loro coesistenza con ceppi potenzialmente patogeni stata osservata nei lotti 2, 6 e 8. questo risultato dimostra che la corretta valutazione del numero di ceppi da sottoporre a tipizzazione fondamentale per consentire una corretta mappatura della popolazione del patogeno. la tecnica di mlva applicata in questo studio riteniamo possa rappresentare un valido strumento diagnostico specialmente nello studio di situazioni epidemiologiche complesse, come possono essere gli stabilimenti di produzione, in cui spesso diverse popolazioni della stessa specie possono convivere e contaminare gli alimenti, ma soprattutto quando vi sia la necessit di collegare tra loro diversi episodi clinici o questi alle rispettive fonti di contaminazione. in questo studio lapplicazione dellmlva ha permesso di identificare nel prodotto al momento del consumo tre ceppi potenzialmente patogeni per luomo con sierotipo 4b in due dei lotti analizzati, confermando la necessit di caratterizzare geneticamente i ceppi di l. monocytogenes al fine di una efficace valutazione del rischio. | listeria monocytogenes is recognised as a public health issue and a serious challenge for the food industry. l. monocytogenes strain characterisation on the basis of serotyping and molecular typing methods is used for surveillance, epidemiological tracking and outbreak investigation purposes. genetic variants of l. monocytogenes have diversified into four major phylogenetic lineages, with lineages 1 and 2 each containing multiple clonal groups of public health importance. standardised tools for easy identification of clonal groups are needed to trace such groups and determine their presence in a large variety of sources. given the current limitations of available methods for l. monocytogenes strain typing, a potentially useful approach is multiple locus variable number of tandem repeats (vntr) analysis (mlva). in this study, mlva has been applied to a random group of 82 l. monocytogenes strains isolated from 8 different batches of loin chops obtained from the same facility and tested between packaging and consumption time. the strains typed were classified into 10 mlva profiles containing a number of isolates ranging between 1 to 20. according to the identified mlva profiles, 75.6% of the pork isolates belonged to the phylogenetic lineage 2 and serotype 1/2c, frequently associated to food isolates. however, 3 pork strains belonged to the phylogenetic lineage 1 and serotype 4b. moreover, 17 isolates were classified in the phylogenetic lineages 2 and serotype 1/2a. both serotypes 4b and 1/2a are frequently associated to human isolates of l. monocytogenes. these preliminary results show how the mlva profiles can support the assessment of the risk profile of food products based on the contaminating l. monocytogenes strain types. |
avascular necrosis of the femoral head (anfh) is considered to be part of a multifactorial, heterogeneous group of disorders that lead to the necrosis and collapse of the femoral head during later stages [13 ]. anfh may induce hip joint dysfunction and partial or complete loss of the ability to walk. anfh can be caused by various conditions such as trauma, glucocorticoid (gc) therapy, alcoholism, and storage diseases, of which gc - induced anfh (ganfh) ranks first. there are several alternative mechanisms such as fat embolization, intramedullary pressure changes, modified artery constriction, circulatory impairment, coagulation disorders, and cell dysfunction ; however, none alone can explain the underlying mechanism. moreover, it can not be ignored that while some people develop osteonecrosis others do not under the same conditions. it was recently suggested that genetic polymorphisms of the enzymes responsible for steroid metabolism, steroid receptors, and transport proteins may explain the individual differences. the transport protein, p - glycoprotein (p - gp), which acts as an energy - dependent membrane efflux pump for a wide spectrum of therapeutic agents, including steroids, plays an important role in absorption and distribution of drugs. p - gp is encoded by the multidrug resistance gene 1 (abcb1), also known as mdr1. more than 50 single - nucleotide polymorphisms (snps) of mdr1 have been identified, among which single - nucleotide polymorphisms in exon 21 (g2677t / a, rs2032582) and exon 26 (c3435 t, rs1045642) are the most studied. particularly, rs2032582 and rs1045642 snps have been found to be related with a decreased and an increased expression of p - gp, respectively. demonstrated the abcb1 rs1045642 and rs2032582 polymorphism decreased the risk for ganfh after kidney transplantation. however, others demonstrated patients carrying rs2032582rs2032582 polymorphism had a higher risk of developing ganfh than those with wild - type genotypes. recently, another study found rs1045642 polymorphism may decrease the risk of having ganfh, but there was no relationship between the rs2032582 polymorphism and ganfh. even more, another study showed that rs1045642 polymorphism may be a risk factor for susceptibility to ganfh. thus, the aim of this study was to assess the association of the abcb1 gene polymorphisms with the risk of ganfh by conducting a meta - analysis of eligible studies published to date. the pubmed, cochrane library, and embase databases were searched independently by 2 investigators to retrieve relevant studies published before may 30, 2014. the search criteria abcb1, atp binding cassette b1, multidrug resistance gene 1, the reference lists of the selected articles were also manually examined to find relevant studies not discovered during the database searches. we selected any studies that investigated the relationship between abcb1 polymorphism (rs1045642 and rs2032582) and ganfh susceptibility. all titles, abstracts, and full papers of potentially relevant studies were assessed for eligibility. when several reports from the same study were published, only the most recent or informative one was included in this meta - analysis. the data extraction of all variables and outcomes of interest were performed independently by 2 investigators. data on clinical design, country of study, number of participants, and genotyping information were extracted. the included studies were assessed independently by the 2 reviewers using the newcastle - ottawa scale (nos). the nos employs a star rating system to assess quality from 3 broad perspectives of the study : (1) selection of the study groups, (2) comparability of the groups, and (3) identification of the exposure (for case - control studies) or outcome of interest (for cohort studies). scores ranged from 0 to 9 stars, and studies with no less than 7 stars were considered to be of high quality. the statistical analysis was performed using meta - analysis software called comprehensive meta analysis. the strength of the association between gene polymorphisms and ganfh risk was calculated with the or and respective 95% cis. the significance of the pooled or was determined by the z test, and p - values of less than 0.05 were considered significant. chi - square test was used for the hardy - weinberg equilibrium (hwe) of genotypes in the control group of each study. statistical heterogeneity among studies was assessed with the i statistics, which ranges from 0% (complete consistency) to 100% (complete inconsistency). if the i -value was more than 50%, the random - effects model was chosen to calculate the pooled or ; otherwise the fixed - effects model was used., we removed each particular study and performed meta - analysis with the rest repeatedly to show how conclusions might be affected. the presence of publication bias was assessed by a visual inspection of a funnel plot and egger s linear regression test. the data extraction of all variables and outcomes of interest were performed independently by 2 investigators. data on clinical design, country of study, number of participants, and genotyping information were extracted. the included studies were assessed independently by the 2 reviewers using the newcastle - ottawa scale (nos). the nos employs a star rating system to assess quality from 3 broad perspectives of the study : (1) selection of the study groups, (2) comparability of the groups, and (3) identification of the exposure (for case - control studies) or outcome of interest (for cohort studies). scores ranged from 0 to 9 stars, and studies with no less than 7 stars were considered to be of high quality. the statistical analysis was performed using meta - analysis software called comprehensive meta analysis. the strength of the association between gene polymorphisms and ganfh risk was calculated with the or and respective 95% cis. the significance of the pooled or was determined by the z test, and p - values of less than 0.05 were considered significant. chi - square test was used for the hardy - weinberg equilibrium (hwe) of genotypes in the control group of each study. statistical heterogeneity among studies was assessed with the i statistics, which ranges from 0% (complete consistency) to 100% (complete inconsistency). if the i -value was more than 50%, the random - effects model was chosen to calculate the pooled or ; otherwise the fixed - effects model was used., we removed each particular study and performed meta - analysis with the rest repeatedly to show how conclusions might be affected. the presence of publication bias was assessed by a visual inspection of a funnel plot and egger s linear regression test. the initial literature search retrieved 22 relevant articles (duplicates were discarded) and 7 articles were excluded for not investigating the topic after carefully screening the titles and abstracts. then, full publication review was performed, and 2 articles were excluded (1 study of overlapping data, and 1 cell study), which left 5 studies (all case - control studies) for this meta - analysis [14,1720 ]. all included studies were in accordance with the nos scale and were therefore defined as high - quality studies. a total of 833 patients (281 with ganfh and 552 controls) were enrolled in the studies. table 2 lists the main results of the meta - analysis for the relationship between gene abcb1 polymorphism and ganfh. for rs1045642 polymorphism, quantitative synthesis from 5 studies showed significant differences in the comparisons of cc vs. ct+tt (case vs. control, or, 1.462 ; 95% ci, 1.0662.007 ; p=0.019). however, no significant differences were found when comparing cc vs. ct, cc vs. tt, or ct vs. tt (figure 2). for rs2032582 polymorphism, the frequencies of g(ta) and (ta)(ta) in the wei he. study control groups were zero ; hence, the study was excluded when we conducted meta - analysis for comparison of the g(ta) and (ta)(ta). quantitative synthesis showed significant differences in the comparisons of gg vs. g(ta)+(ta)(ta) (case vs. control, or, 1.548 ; 95% ci,1.0632.255 ; p=0.023). however, no significant difference was found when comparing gg vs. g(ta), gg vs. (ta)(ta), or g(ta) vs. (ta)(ta) (figure 3) in the sensitivity analysis, when each particular study was removed from analysis, no corresponding pooled ors were qualitatively altered. funnel plots and egger s test were performed to assess the publication bias of studies included in this meta - analysis. the funnel plots and egger s test demonstrated no evidence of publication bias for cc vs. ct+tt (p=0.40) or gg vs. g(ta)+(ta)(ta) (p=0.17) (figure 4). the initial literature search retrieved 22 relevant articles (duplicates were discarded) and 7 articles were excluded for not investigating the topic after carefully screening the titles and abstracts. then, full publication review was performed, and 2 articles were excluded (1 study of overlapping data, and 1 cell study), which left 5 studies (all case - control studies) for this meta - analysis [14,1720 ]. all included studies were in accordance with the nos scale and were therefore defined as high - quality studies. a total of 833 patients (281 with ganfh and 552 controls) were enrolled in the studies. table 2 lists the main results of the meta - analysis for the relationship between gene abcb1 polymorphism and ganfh. for rs1045642 polymorphism, quantitative synthesis from 5 studies showed significant differences in the comparisons of cc vs. ct+tt (case vs. control, or, 1.462 ; 95% ci, 1.0662.007 ; p=0.019). however, no significant differences were found when comparing cc vs. ct, cc vs. tt, or ct vs. tt (figure 2). for rs2032582 polymorphism, the frequencies of g(ta) and (ta)(ta) in the wei he. study control groups were zero ; hence, the study was excluded when we conducted meta - analysis for comparison of the g(ta) and (ta)(ta). quantitative synthesis showed significant differences in the comparisons of gg vs. g(ta)+(ta)(ta) (case vs. control, or, 1.548 ; 95% ci,1.0632.255 ; p=0.023). however, no significant difference was found when comparing gg vs. g(ta), gg vs. (ta)(ta), or g(ta) vs. (ta)(ta) (figure 3) in the sensitivity analysis, when each particular study was removed from analysis, no corresponding pooled ors were qualitatively altered. funnel plots and egger s test were performed to assess the publication bias of studies included in this meta - analysis. the funnel plots and egger s test demonstrated no evidence of publication bias for cc vs. ct+tt (p=0.40) or gg vs. g(ta)+(ta)(ta) (p=0.17) (figure 4). the most important finding of this study was that the abcb1 polymorphisms (rs1045642 and rs2032582) were found to significantly decrease ganfh susceptibility. it is well known that glucocorticoids may induce a hypercoagulable hypofibrinolysis state in blood, which may induce thrombosis of the vessels, resulting in bone ischemia, necrosis of bone tissue, and, finally, anfh occurs. however, the truth is that not all patients treated with virtually the same protocol for steroid administration develop anfh, which means the individual differences in the steroid sensitivity (ability to absorb and metabolize glucocorticoids) due to genetic factors play an important role in the development of ganfh. recently, studies found that polymorphisms of the molecules involved in steroid metabolism, steroid receptors, or drug transport may be involved in this individual difference. the membrane transporter protein p - gp, encoded by the human abcb1 gene, is an important determinant in drug absorption, distribution, and elimination. the abcb1 polymorphisms have been demonstrated to affect the expression and function of p - gp and therefore determine individual variability in drug resistance. several case - control studies have examined the association between the abcb1 polymorphisms and steroid - induced onfh. however, as discussed above, reports concerning the role of the polymorphisms in the pathogenesis of ganfh have been inconsistent. the lack of consistency across these studies may be caused by the geographic and ethnic variability of populations or the probability of a type ii error resulting from small sample sizes. thus, this meta - analysis was performed to overcome the weakness in sample size and population. the mechanism by which these 2 snps decrease the risk of ganfh is still unknown. rs2032582 of abcb1 was recently reported to be associated with an amino acid substitution (ala to ser and ala to thr), leading to an enhanced efflux transporting ability, and, finally, decreased risk of ganfh. rs1045642 snp present in exon 26 was considered as a functional snp, and its relationship with various diseases has been reported [2628 ]. rs1045642 snp is a synonymous polymorphism that does not change the protein sequence, but it affects rna stability and alters the interaction of p - gp with drugs by affecting the timing of co - translational folding ; thus, the rs1045642 snp may decrease the amount and activity of p - gp. it is interesting that the results showed a negative association between rs1045642 and ganfh susceptibility. an explanation may be the linkage disequilibrium between rs1045642 and rs2032582, as reported in various studies. the most important limitation of this meta - analysis is the inconsistency of the baseline characteristics (e.g., age, sex, and concomitant disease) between the case and control groups, which might increase the selection bias. the results of this meta - analysis suggest that the abcb1 polymorphisms (rs1045642 and rs2032582) significantly decrease ganfh susceptibility. | backgroundthe results of studies on association between abcb1 gene polymorphisms and glucocorticoid - induced avascular necrosis of the femoral head (ganfh) are controversial. this study aimed to assess the association of abcb1 gene polymorphisms with the risk of ganfh by conducting a meta-analysis.material/methodsthe pubmed, cochrane library, and embase databases were searched for papers that describe the association between abcb1 polymorphisms and ganfh risk. summary odds ratios and 95% confidence intervals (ci) were estimated based on a fixed - effects model or random - effects model, depending on the absence or presence of significant heterogeneity.resultsa total of 5 studies and 833 patients were included in the final analysis. significant differences were found for rs1045642 polymorphism in the comparisons of cc vs. ct+tt (or, 1.462 ; 95% ci, 1.0662.007 ; p=0.019), and rs2032582 polymorphism in the comparisons of gg vs. g(ta)+(ta)(ta) (or, 1.548 ; 95% ci,1.0632.255 ; p=0.023).conclusionsthe study demonstrated that the abcb1 polymorphisms (rs1045642 and rs2032582) significantly reduced the risk of ganfh. |
nanoparticles (nps) of colloidal magnetite (fe3o4) are a promising material for a wide range of biomedical applications, including magnetic resonance imaging, magnetic hyperthermia, magnetic separation / extraction, and drug delivery. for these practical applications, fe3o4 nps with excellent magnetic properties can be produced as colloidal dispersions by wet - chemistry methods. as - synthesized nps are typically functionalized with hydrophobic or hydrophilic capping ligands, thereby rendering them dispersible in organic or aqueous solvents, respectively. surfaces of nps strongly influence their magnetic properties (through surface / volume ratios). in particular, a reduced atomic moment at the surfaces of nps lowers their saturation magnetization (ms) relative to that of the corresponding bulk material. a reduction or even elimination of the surface disorder can be expected when capping ligands covalently bind to the np surface ; however, evidence for this putative surfactant effect is still a matter of debate. although the presence of surfactants has been shown to enhance ms, several studies have suggested that the presence of a surfactant does not cancel surface moment reduction but rather leads to glass - like behavior of surface spins. temperature - dependent measurements of nanoparticle magnetization [m(t) ] could provide insights complementary to those obtained from the more typical measurements at or below room temperature, for example, by probing nanoscale compositional and structural features such as magnetic phase transitions, inhomogeneity, structural / point defects, nonstoichiometry, and cation ordering. for example, thermal treatment of ligand - capped fe3o4 nps can lead to chemical disproportionation of the magnetic phase, reduction of the surface, spin disarrangement, and annihilation of structural and point defects and can be detrimental to the chemical order. these compositional and structural changes will affect the fe o fe superexchange interactions and thus be manifested in the modification of the magnetic properties at elevated temperatures. high - temperature magnetic measurements, therefore, can reveal useful information even for nps that are intended primarily for room - temperature applications. previously, we observed a net reduction in m after high - temperature treatment of oleate- (ol-) capped fe3o4 nps, which we attributed to spin disarrangement on the surface of the nps resulting from thermal decomposition of the organic shells. in this work, we found evidence of more complex mechanisms for temperature - dependent np magnetic properties. specifically, in heating cooling cycles, our magnetite nps exhibited irreversible m behavior with two peculiar effects, namely, dips and loops in their m(t) curves, whose origins we investigated using several complementary characterization techniques. colloidal magnetite nps were prepared in aqueous reaction medium using a previously reported hydrothermal method ; the detailed synthesis procedure is described in the supporting information (si). during synthesis, sodium oleate was used as a surfactant for the formation of ol - capped magnetite nps, which are colloidally stable in organic solvents for long periods of time. to investigate their structural evolution with thermal treatment, as - synthesized ol - capped nps (ol - ht) were annealed for 2 h at 650 and 900 k (ol - ht-650k and ol - ht-900k, respectively) under a static vacuum. the nps were characterized by magnetization measurements (squid - vsm magnetometer, quantum design), thermogravimetric analysis (tga)/ differential scanning calorimetry (dsc) (tga / dsc 1 star system, mettler - toledo), powder x - ray diffraction (xrd) (xpert pro diffractometer, panalytical), raman scattering (alpha300 r confocal microscope, witec), transmission electron microscopy (tem), high - resolution tem (hrtem), high - angle annular dark - field scanning tem (haadf - stem), and energy - dispersive x - ray spectroscopy in stem mode (stem - edx) [tecnai g 30 ut, titan chemistem (fei) and jem - arm200f (jeol) microscopes ], and fe mssbauer spectroscopy. we took advantage of a superconducting quantum interference device (squid) magnetometer to investigate m(t) over the range of 300900 k for the hydrothermally synthesized ol - capped ol - ht nps (figure 1). m is expressed in units of electromagnetic units per gram of iron oxide [emu/(g of iron oxide) ] ; that is, the mass was corrected for the ligand contribution determined by tga. the m(t) data were repeatedly recorded under an applied field of 10 koe. three consecutive heating cooling m(t) cycles measured in a 10 koe field for as - synthesized ol - ht magnetite nps. tc 840 k. the most distinctive phenomenon in figure 1 is the irreversible net loss of m, which is consistent with our previous observations. specifically, the ol - ht nps exhibited a decrease in m when temperature was increased to the curie temperature, tc (black line, from a to b in figure 1) ; m then continuously increased upon cooling from 900 to 300 k (black line, from b to c in figure 1), albeit with an irreversible net loss of m (ca. another interesting effect clearly observed for this sample is the dip in m(t) upon the first heating (black line, from a to b in figure 1) ; the temperature corresponding to the local minimum of the dip parameters, such as was found to be 602 k. no analogous dip features were found in the subsequent cooling or heating curves for this sample (figure 1), indicating that the dip was an irreversible event, unique to the initial heating. in addition to the dip in m(t), ol - ht exhibited an irreversibility of the subsequent cooling and heating m(t) curves, resulting in loop features. figure 1 displays loops in m(t) measured during three consecutive heating cooling cycles : the temperature at which the curves diverged, the area of the loop, and m values all underwent substantial changes during the measurements. the area of the loop appeared to decrease with the number of cycles with a concomitant increase in m (clearest at 300 k) toward the initial value as the number of cycles increased. we believe that the observed m(t) behavior can be attributed to nonequilibrium processes induced by heating. to elucidate these processes, ol - ht nps were annealed at 650 and 900 k to produce ol - ht-650k and ol - ht-900k, respectively. we note that the 2-h annealing time for these derivative samples was much longer than the duration of the heating cycles in figure 1, allowing us to observe changes in structure and composition more clearly. sample crystallinity was characterized by xrd (figure 2). as - synthesized ol - ht nps exhibited an xrd pattern with high background and broad peaks typical for nanopowders. in contrast, distinctly sharper diffraction peaks were observed for ol - ht-900k, indicating enhanced crystallinity and enlarged particle size produced by annealing at 900 k. according to the phase analysis, all three samples resembled single - phase magnetite with cubic inverse - spinel type structure (icdd no. a lattice shift was observed as the annealing temperature was increased to 900 k ; that is, the peaks shifted to a lower angle, reflecting a larger d spacing. the unit - cell parameter a was established to be 8.381(1), 8.378(1), and 8.4007(4) for ol - ht, ol - ht-650k, and ol - ht-900k, respectively, where the latter value is in good agreement with the unit - cell parameter of bulk fe3o4 (8.396). this trend among a values is unusual, as high - temperature annealing of oxide nps often results in solvent removal and annihilation of defects, thus leading to decreasing a values. in contrast, a substantial increase in the unit cell was observed for our magnetite nps. a possible reason for this increase is a partial reduction of fe into fe, which has a larger ionic radius (0.64 vs 0.78). xrd patterns collected from magnetite nps as - synthesized and after annealing at 650 or 900 k. tick marks below the patterns correspond to the positions of the bragg reflections expected for magnetite with a cubic inverse - spinel structure (icdd no. iron oxide phases before and after annealing were investigated by raman scattering (figure 3 ; table s1, si). the coexistence of magnetite with an admixture of maghemite (-fe2o3) is evidenced by lorentzian fitting of the raman data for ol - ht nps. specifically, the prominent bands centered at 680 and 703 cm in the raman spectrum of ol - ht are assigned to a1 g phonon modes of fe3o4 and -fe2o3, respectively. additional expected bands representing t2 g and eg phonon modes of -fe2o3 can also be observed in the low - wavenumber region (351 and 495 cm). the raman spectra of the two annealed samples are similar to each other, and the set of observed bands and spectrum features agrees with the raman data reported for phase - pure fe3o4. notably, lorentzian fitting of the raman data suggested that the annealed samples contained contributions from -fe2o3 ; however, the magnitudes of the contributions were very low, as one can see from the large values of the intensity and peak area ratios of the respective fe3o4 and -fe2o3 prominent a1 g bands (table s1, si). thus, raman scattering points to a minor admixture of -fe2o3 in both annealed products. notably, the a1 g mode of fe3o4, seen in the raman spectrum of as - synthesized ol - ht at 680 cm, shifted to lower wavenumbers (668 cm) upon annealing. additionally, the width of this band decreased from 90 cm for ol - ht to 38 cm for ol - ht-900k, indicating that the crystalline quality of magnetite increased with annealing, in good agreement with the xrd data. raman scattering data collected from magnetite nps as - synthesized and after annealing at 650 and 900 k. dotted lines mark the positions of resolved bands. tem analysis was applied to investigate the evolution of the structure, size, and morphology of the fe3o4 nps with annealing. figure 4a shows a typical low - magnification bright - field (bf) tem image of ol - ht. we note that all of the as - synthesized ol - ht nps were spatially well - separated by the ol capping shells (figure 4a). in contrast, objects of roughly the same size as ol - ht nps in figure 4a became aggregated in the annealed ol - ht-650k (figure 4b). presumably, after thermally induced removal of the ol capping at 650 k, the nps fused to reduce their surface and interfacial energies, forming aggregates. at the yet higher annealing temperature used for ol - ht-900k, np sintering occurred, resulting in the formation of bulky magnetite products with a typical size of crystallites from 50 to 100 nm (figures 4c and s1, si). electron diffraction (ed) revealed high crystallinity of all of the products, in agreement with the xrd results. the corresponding ed patterns (insets in figure 4) can be completely indexed based on the cubic fd3m magnetite structure, using the unit - cell parameters determined by xrd. np morphologies and (insets) corresponding ring ed patterns show microstructural changes from (a) as - synthesized nps to derived nps annealed at (b) 650 and (c) 900 k. figures 5a and s2 (si) show representative bf hrtem images of ol - ht, wherein the np surface is terminated with columns of iron atoms and some of the particles exhibit defects, in agreement with our previous report. annealing at 650 k removed these structural defects, as seen in high - resolution haadf - stem images viewed along and zone axes (figure 5b, c). in contrast to the highly crystalline surfaces of the ol - ht nps, however, a 0.71.1-nm - thick amorphous surface layer was clearly visible on the ol - ht-650k nps in figure 6 (top panel). stem - edx data (figure 6, bottom panel) suggest that this layer most likely consisted of carbonaceous residues that formed during thermal decomposition of the ol capping. (a) and bf hrtem images of the as - synthesized ol - ht magnetite nps and (b, c) haadf - stem images of the annealed ol - ht-650k sample with magnetite nps along the (b) and (c) zone axes. (bottom) haadf - stem image of ol - ht-650k nps, together with the corresponding stem - edx maps showing c, fe, and o distributions. figure 7 shows fe mssbauer spectra of the as - synthesized ol - ht nps and the annealed ol - ht-650k and ol - ht-900k derivatives ; all of the hyperfine parameters extracted from the measurements are summarized in table s2 (si). comparison of the mssbauer spectra of as - synthesized ol - ht and annealed ol - ht-650k and ol - ht-900k samples collected at room temperature (and at 80 k for ol - ht). experimental data, circles ; calculated spectrum, black line ; fe or fe component, red line ; fe components : blue, green, and orange lines. the room - temperature mssbauer spectrum of as - synthesized ol - ht nps exhibits four components, one of which is very broad, probably due to the superparamagnetic effect. these component widths make the fitting of the mssbauer spectrum ambiguous ; therefore, this sample was measured at 80 k to obtain sharper spectral lines. the 80 k spectrum also has four components, namely, q1, q2, q3, and q4. three components, q1, q3, and q4, have centroid shift () values ranging from 0.372 to 0.515 mm / s (table s2, si). these values are characteristic for fe, taking into account the second - order doppler shift. the forth component, q2, has a value of 0.856 mm / s (table s2, si) ; such a high value of the centroid shit can be assigned to fe. the measurements were performed below the charge - ordering verwey transition, which is 120 k for fe3o4 ; therefore, a separate signal coming from fe in the fe3o4 octahedral site is expected, in accordance with the results of evans and hafner. the observed fe component had an intensity of 12% instead of 33% expected for phase - pure bulk fe3o4, where the fe / fe ratio is 2:1. 36% magnetite and 64% of an fe phase, which was presumably maghemite -fe2o3, as indicated by raman scattering (figure 3). in contrast to ol - ht, derivative sample ol - ht-650k annealed at 650 k produced a room - temperature mssbauer spectrum without superparamagnetic broadening of its sharp lines, which was fitted by four components (table s2, si). the q2 component has a value of 0.635 mm / s, which is characteristic for fe, that is, the averaged fe / fe signal from iron atoms in the octahedral sites of magnetite. the measurement was performed above the verwey transition temperature ; therefore, no charge ordering or separation of fe and fe in the octahedral positions was expected. the intensity of this combined signal was 36%, indicating that half of it, 18%, was from fe. hence, the mssbauer data indicate that annealing at 650 k led to the reduction of part of the fe in the as - synthesized sample to fe, increasing the total fraction of fe3o4 to 54%. annealing of the as - synthesized nps at 900 k resulted in almost complete elimination of the putative -fe2o3 phase. the mssbauer spectrum of ol - ht-900k was fitted with only two components, q1 and q2 (table s2, si). component q2 has a value of 0.660 mm / s and is from fe in the octahedral site. the intensity of this component is 62%, which is close to the 67% value expected for pure fe3o4. the two striking phenomena we observed in the magnetic properties of our nps at high temperature a dip in m(t) at ca. heating m(t) curves in the 500800 k temperature range appear to be different in nature ; therefore, the first heating curve should be considered separately from the subsequent ones. the temperature at which the dip in m(t) was observed, 602 k, matches very well the decomposition temperature of the ol ligand shell, 605 k, as detected by a combination of tga / dsc and mass spectrometry. we hypothesize that the decomposition of the organic coating has a significant impact on the magnetic properties of nps. to verify this assumption, we used a hydrothermal method to synthesize a reference sample of ligand - free magnetite nps. this reference material did not feature a dip in m(t) upon heating (black curve, figure 8a), confirming that the dip observed for ol - functionalized nps is associated with the presence of the organic capping ligands and, more specifically, with their thermal decomposition, based on the temperature at which the dip occurred (figures 1 and 8b). therefore, we deduce that the dip in m(t) is most likely related to changes in the composition or oxidation state of the iron oxide on the surface of the nps, as a consequence of the decomposition of the organic shell. (a) one heating cooling m(t) cycle for a reference magnetite sample synthesized without organic coating (ligand - free magnetite) and for an annealed sample (ol - ht-900k). (b) m(t) data for model magnetite nps functionalized with different organic capping ligands : poly(vinylpyrrolidone) (pvp), tetramethylammonium hydroxide (tmaoh), citrate (ct), and poly(acrylic acid) (paa). looking for evidence of these changes in composition or oxidation state of the iron oxide, in fact, motivated our choice of the 650 k annealing temperature for the ol - ht-650k derivative sample. our raman analysis suggested the -fe2o3 phase in as - synthesized ol - ht to be the most likely candidate for undergoing the transformation upon heating. indeed, after the sample had been annealed at 650 k, the contribution of -fe2o3 became quite small (compare ol - ht and ol - ht-650k in figure 3 and table s1, si). mssbauer analysis confirmed that, after the sample had been annealed at 650 k, the content of fe increased at the expense of fe (figure 7 ; table s2, si). thus, both raman and mssbauer analyses point to the reduction of the fe - rich surface layer, which is characteristic of as - synthesized ol - ht nps, as the main change in iron oxide composition of ol - ht upon annealing at 650 k. the in situ reducing agent for this apparent fe reduction is suggested by its connection to the presence and thermal decomposition of the organic capping ligands, as deduced from the m(t) features (figure 8) and from carbonaceous residues observed by haadf - stem and stem - edx (figure 6). the reduction did not take place in the absence of the putative reducing agent in ligand - free nps, which did not exhibit the dip feature (black curve in figure 8a). the following model then emerges to explain the dip in m(t) during the first heating of as - synthesized ol - ht nps : as - synthesized nps contain a significant excess of fe both in the core and on the surface of the particles, forming fe3o4-fe2o3 solid solutions. upon the first heating above ca 600 k, the ol ligands decompose, and the carbonaceous product of that decomposition induces the in situ reduction of part of the excess fe on the np surfaces. although formation of secondary metallic iron, iron carbide, or oxo - carbide phases can be expected as a result of a carbon - induced reduction, our detailed characterization did not reveal any major phase other than magnetite. accordingly, the reduction and associated magnetite - phase stabilization must produce the dip in the magnetization. in particular, during the reduction, the nps likely exhibit chemical disorder associated with the migration and redistribution of o and fe ions. this disorder leads to the frustration of fe o fe superexchange interactions, generating a dip in m(t) until the reduction is complete. the remaining excess of fe detected by mssbauer spectroscopy in ol - ht-650k (figure 7 ; table s2, si) was likely situated in the core of the particles. indirect evidence of this fe localization is provided by minimal changes in the unit - cell parameters (and, therefore, in the structure of np cores) upon annealing at 650 k (figure 2). we note that, even in the annealed ol - ht-650k sample, the original nps were identifiable (figure 4b), so the in situ reduction was largely confined within individual nps. a temperature of 650 k was thus not sufficient to produce a uniform composition across an entire 20-nm np. temperature, rather than heating time, was implicated as the primary limiting factor based on the observation that, during magnetometry measurements, heating for just a few minutes around 600 k was sufficient to complete the putative reduction reaction on the np surfaces (completion is inferred from the dip being unique to the initial heating), whereas even the much longer (2-h) annealing of ol - ht-650k did not extend the reaction to np cores, as indicated above (figures 2 and 7 ; table s2, si). we observed a significant irreversibility in consecutive cooling and heating profiles of m(t) in ol - ht, whereby starting from the second heating cooling cycle, the m value at 300 k increased after every cycle (cycles 2 and 3 in figure 1). our analyses of annealed ol - ht-650k and ol - ht-900k samples by diffraction techniques (xrd in figure 2 and ed in figure 4) and raman scattering (figure 3) did not reveal any phase transition in the temperature range of the m(t) measurements, but pointed to two types of gradual changes, namely, sintering and equilibration of the fe3o4 composition, as likely explanations for the gradual recovery of m at 300 k. owing to their small size, the nps exhibit a high specific surface area. structurally, the surface of the nps is disordered, giving rise to a reasonable quantity of magnetically dead layer on the particle surface. the series of tem images in figure 4 clearly indicates that, in the temperature range of our m(t) measurements, np sintering occurred, promoted by both heating and reducing conditions (the latter are discussed in more detail in section 4.1). the gradual increase in the crystallite size of magnetite with sintering is not only evident in the tem images (figures 4c and s1, si) but is also supported by the sharpest peaks in the xrd (figure 2) and raman (figure 3) data for the ol - ht-900k sample annealed at 900 k, that is, at the high - temperature limit of our m(t) measurements. during the sintering, the particles grew, and accordingly, their specific surface area decreased. the overall effect of the magnetically dead layer then diminished, leading to the gradual increase in m. apart from the anticipated sintering - induced size effect, the gradual recovery of m was also tracked down to the uncommon significant change in fe / fe ratio with the heat treatment. as discussed above, annealing at 650 k was not sufficient to reach the theoretical fe3o4 stoichiometry of fe and fe across an entire 20-nm np. analysis of mssbauer spectra for ol - ht-900k (figure 7 ; table s2, si), however, clearly indicates that the larger (50100-nm) sintered particles produced by annealing at 900 k exhibited a nearly uniform fe3o4 composition. the uniformity of converting the initial excess fe to fe across the entire volume of these larger particles is further indicated by the increase of the unit - cell parameter to the bulk fe3o4 value (figure 2) after annealing at 900 k, in contrast to the commonly observed reduction in unit - cell parameters in annealed metal oxide nps. this seemingly simple change in fe / fe ratio is deceptive, as the compositional change from ca. 46% to 7% of fe2o3 significantly increased m, judging by the fact that the ms value of fe3o4 is higher than that of -fe2o3. thus, both sintering and uncommon equilibration of the fe3o4 composition would contribute to the gradual increase of m in heating cooling cycles, because m is expected to increase with both larger particle size and improved fe3o4 crystallinity and uniformity. neither process, however, reached an end point or equilibrium during the short high - temperature phase of each heating cooling cycle ; therefore, divergent m(t) curves depicting loops were produced as the sample gradually approached its end - point configuration. this interpretation is supported by the nearly reversible m(t) cycle for ol - ht-900k (red curve in figure 8a), which indicates that annealing for 2 h at 900 k was sufficient to complete the sintering of the original nps and equilibration of the fe3o4 composition throughout the resulting particles. as 900 k was the highest temperature reached in every heating cycle, the ol - ht-900k behavior confirms that, in this particular case, heating time rather than temperature was the parameter limiting the extent of np transformation in each cycle. our extensive analysis of the as - synthesized ol - ht nps combined with measurements of m(t) and of derivative samples annealed at elevated temperatures provide the basis for the following inferences about the structure and composition of ol - ht nps. iron oxide in as - synthesized ol - ht nps is best understood as an fe3o4-fe2o3 solid solution with excess (beyond fe3o4 stoichiometry) fe distributed throughout the nps, with indications of a possible enrichment at their surfaces. -fe2o3 and fe3o4 have very similar crystal structures. both powder xrd and (figure 2) and high - resolution tem (figure 5a) indicate that the as - synthesized sample had a cubic inverse - spinel structure, which is also the case for both pure fe3o4 and fe3o4-fe2o3 solid solution. local mssbauer spectroscopy revealed the elevated fe to fe ratio in ol - ht (figure 7 ; table s2, si) ; the associated -fe2o3 phase was detected by raman scattering (figure 3). indirect evidence of a possible enhancement of m by the capping ol ligands of ol - ht nps comes from a comparison of the initial m values for ol - ht (figure 1) and ol - ht-900k (red curve in figure 8a). as discussed above, both the increased size of the particles in ol - ht-900k and its predominantly magnetite composition should increase the m value for this material. however, the initial m value at room temperature for ol - ht nps before thermal treatment was actually slightly higher than the m value at room temperature for ol - ht-900k, despite the smaller np size and structural / compositional imperfection of magnetite in ol - ht. a higher amount of -fe2o3 in ol - ht does not justify this difference in m, as fe3o4 has an even higher magnetic moment than -fe2o3. ligand enhancement of m in ol - ht nps provides a possible interpretation of this apparent discrepancy. the above inferences provide illustrations of how investigating the properties of magnetic nps at elevated temperatures can provide insights into the structure and composition of as - synthesized nps. these illustrations reinforce our prospective that high - temperature measurements can be useful for nps that are intended for room - temperature applications. an example of extending this analytical concept to investigating nps capped with common organic ligands is shown in figure 8b. for each model colloidal magnetite np, the dip in m(t) is observed at a specific temperature that closely corresponds (within 3 k) to the sharp step in thermal decomposition of the capping ligands : poly(vinylpyrrolidone), tetramethylammonium hydroxide, citrate, and poly(acrylic acid). observation of a dip in m(t) at a characteristic temperature, therefore, can be used to confirm the identities of these common capping ligands. we have observed complex irreversible behavior of magnetization for ol - capped magnetite nanoparticles upon thermal cycling in the 300900 k temperature range. two prominent features of m(t) curves for these nps are (1) a dip in m(t) during the initial heating and (2) an irreversibility of heating cooling curves, producing loops in subsequent cycles. the dip in m(t) is due to the reduction of overoxidized np surfaces by carbonaceous decomposition products. the m(t) irreversibility results from gradual np sintering and uncommon compositional equilibration after reduction of overoxidized np cores, both of which are enabled after thermal decomposition of the capping ligands. our analysis of as - synthesized nps, combined with measurements of m(t) and of derivative samples annealed at elevated temperatures, indicates that iron oxide in as - synthesized colloids is best understood as an fe3o4-fe2o3 solid solution with excess fe present both in the np cores and on their overoxidized surfaces. we also found indirect evidence of the m enhancement by capping ligands in as - synthesized nps. the novel analytical methodology demonstrated in this work reversible m(t) curves indicate uniform structure and composition, as well as a lack of organic capping ligands. conversely, characteristic features in irreversible m(t) curves provide insights into the nature of structural or compositional uniformity, as well as the identity of the organic capping ligands. | to investigate magnetostructural relationships in colloidal magnetite (fe3o4) nanoparticles (nps) at high temperature (300900 k), we measured the temperature dependence of magnetization (m) of oleate - capped magnetite nps ca. 20 nm in size. magnetometry revealed an unusual irreversible high - temperature dependence of m for these nps, with dip and loop features observed during heating cooling cycles. detailed characterizations of as - synthesized and annealed fe3o4 nps as well as reference ligand - free fe3o4 nps indicate that both types of features in m(t) are related to thermal decomposition of the capping ligands. the ligand decomposition upon the initial heating induces a reduction of fe3 + to fe2 + and the associated dip in m, leading to more structurally and compositionally uniform magnetite nps. having lost the protective ligands, the nps continually sinter during subsequent heating cycles, resulting in divergent m curves featuring loops. the increase in m with sintering proceeds not only through elimination of a magnetically dead layer on the particle surface, as a result of a decrease in specific surface area with increasing size, but also through an uncommonly invoked effect resulting from a significant change in fe3+/fe2 + ratio with heat treatment. the interpretation of irreversible features in m(t) indicates that reversible m(t) behavior, conversely, can be expected only for ligand - free, structurally and compositionally uniform magnetite nps, suggesting a general applicability of high - temperature m(t) measurements as an analytical method for probing the structure and composition of magnetic nanomaterials. |
a constant flood of new genomic information has brought a new age of discovery to biology. unfortunately, this deluge of new data is rarely fully utilized, in part because bench scientists find it increasingly challenging to maintain a current, integrated picture of the latest data. this problem is particularly pronounced for scientists who study large numbers of potentially interesting molecules, a common result of microarray - based or proteome - based experiments. regularly updating such data by hand can be extremely burdensome and is rarely done. as a result, many scientists work unaware of newly discovered annotation, homologs, clones or protein domains that could further their research. current comparative table, or cct, is a web - based application designed to solve this problem by displaying the most up - to - date results of customized genomic searches in a convenient table. it can be easily configured to automatically download new versions of databases and to run any number of bioinformatics searches on the new data. cct then organizes the results in a table containing hyperlinks color - coded by result age, making it simple to pick out recently changed results. this allows scientists to continuously harvest potentially useful data about any set of sequences of importance to their research. cct joins a number of other excellent servers whose aim is to manage data overload (1,2), but cct has unique strengths. the most widely used of these other services, pubcrawler, searches for text and literature matches in pubmed, genbank or both but does not perform actual sequence searching (3). servers that do allow sequence searches (e.g. and) allow the searching of prescribed subsets of public databases and/or a single private database of each data type that is uploaded manually (2). like myhits and swiss - shop, cct performs sequence - based searches, but it uniquely offers a local installation, allowing independence from remote servers. other novel features of cct include automated highlighting of even small changes in data files, a simple interface for scientists interested in multiple sequences and the ability to monitor any number of databases to which the user has access. the computer has a 3 ghz processor, 200 gb of hard drive space and 2 gb of ram. mac os x compatibility was tested on a dual 2 ghz g5 tower with 1.5 gb of ram, a 160 gb hard drive and mac os x 10.3.4. cct is implemented in perl and makes heavy use of the bioperl toolkit (4). a demonstration of cct and an installation guide are available at, and the software is freely available from. a scientist typically begins using cct by adding three types of data through a web interface : (i) a file containing sequences of interest, (ii) database location(s) to monitor for updates and (iii) searches to perform. although cct can be run at will, it is typically run automatically. in this mode, cct periodically (e.g. once per day, such as at 1 a.m.) checks user - selected databases and downloads updated versions as they become available. cct then runs user - selected searches on these data and builds a table with one row for each sequence and one column for each database searched (figure 1). each cell contains links to the results of each search, color - coded by the length of time since a change in data has affected the search results. in addition, when a result is updated, the new result is compared with the previous one, and differences are highlighted in the new data file (figure 2). taken together, link coloring and difference highlighting allow numerous search results to be quickly scanned and evaluated for novelty (or for stability over time). this feature is valuable for scientists engaged in ongoing projects as well as those deciding when to commit limited laboratory resources to the characterization of a set of interesting but preliminary sequences. cct can be run locally or remotely via the internet and comes bundled with wrappers for six different bioinformatics search programs. hmmpfam is a wrapper for the hmmpfam tool and is useful for automating searches of sequences against ever changing protein domain databases such as pfam (5). tblastn and blastp are the software 's wrappers for ncbi 's blast searches (6). the seq program is specific to cct and is useful for isolating regions of the genome, e.g. for finding genes and open reading frames. seq takes tblastn or blastp output, captures the sequences for the target blast high - scoring pairs and extends them out to a user - specified delimiter. for example, if a stop codon were selected, seq would capture the sequence of the flanking open reading frame. revblast uses seq output as a query to blast search another database, permitting reciprocal blasting, a common method for finding ortholog pairs (7). finally, the homolog program takes revblast output and uses clustal - w (8) to generate a pairwise alignment if sequence pairs meet user - specified parameters. when used together, these programs are an effective tool for finding orthologs and can be customized in a way that sets cct apart from other comparative genomics tools (9). the mac os x version of cct can be installed in 60 s in a few simple steps from a double clickable install package. it is fully self - contained and includes code for bioperl, clustal - w, blastall and hmmpfam. the linux version does not include this code in the expectation that linux users may want to integrate cct into existing bioinformatics resources on their servers. cct 's user manual is part of every installation and can also be found at the software 's demo site. the user manual contains an installation guide, a beginner 's guide, the addresses of sample databases, screenshots and other useful information. in addition, cct is installed with a link to extensive code documentation to make its customization as easy as possible for users with any level of programming experience. programmers can construct new program modules to interact seamlessly with cct using an included template file. the design of cct falls into two main parts : the web interface and the script runcct.pl. users can add and delete tables, searches and databases, and can view their data by browsing a cct web page. runcct.pl controls most of cct 's daily work, such as downloading databases, running searches and updating tables. this script can also be called manually from the command line and can be manipulated to perform only certain steps of its process or run only specified searches. cct is freely available to all and it will continue to be developed (). cct can be a very useful tool for scientists who study large sets of genes in today 's evolving genomic landscape. by empowering non - bioinformaticians to automate custom searches and examine current results at a glance, cct allows a remote database submission in the evening to influence the next morning 's bench experiment. the molecule and description columns contain information supplied by the user ; the other columns contain data generated by automated searches against user - specified databases. in these database columns, links are color - coded to reflect the length of time since the search result last changed. to generate the table shown, cct was given a set of 48 genes in the mycobacterium tuberculosis (mtb) dormancy regulon (10) and directed to monitor four remote databases (pfam, the mtb proteome and two incomplete genomes, m.smegmatis and m.marinum). the pattern of red indicates that a new release of the m.marinum genome was downloaded in the past 24 h (generating many new red tblastn links), and that a new sequence (seq program) of an ortholog (homolog program) was found for the tb protein rv1812c. the predicted ortholog for rv0079, in contrast, did not change as a result of the update and the corresponding links remain blue. more detail concerning any result can be viewed by clicking on the corresponding link(s). example of a result file revised to reflect a new release of the pfam database. the regions above and below the horizontal line show different parts of the same result file. this hmmpfam search result shows that the conserved hypothetical protein rv2030c matches a new domain in pfam, specifically the phosphoribosyl domain has been changed subtly (note the changed amino acids in the subject line). taken together with the change in database size for the new release, the e - value for this search has changed somewhat. to view the newest results only (without highlighting to show changes) | the current comparative table (cct) software program enables working biologists to automate customized bioinformatics searches, typically of remote sequence or hmm (hidden markov model) databases. cct currently supports blast, hmmpfam and other programs useful for gene and ortholog identification. the software is web based, has a bioperl core and can be used remotely via a browser or locally on mac os x or linux machines. cct is particularly useful to scientists who study large sets of molecules in today 's evolving information landscape because it color - codes all result files by age and highlights even tiny changes in sequence or annotation. by empowering non - bioinformaticians to automate custom searches and examine current results in context at a glance, cct allows a remote database submission in the evening to influence the next morning 's bench experiment. a demonstration of cct is available at and the open source software is freely available from. |
the major benefits of laparoscopy for the patient are a reduced need for analgesics, reduced surgical trauma, improved cosmesis and faster recovery. this accounts for the worldwide acceptance of laparoscopy in the clinical setting, with its applications having expanded from simple ablative procedures to more complex operations, such as prostatectomy, gastric bypass and liver and rectal surgery [25 ]. under these circumstances, the shortcomings of conventional laparoscopy, especially the limited degrees of freedom, two - dimensional view, restricted ergonomics for the surgeon and the lack of the wrist gear, have become more evident [6, 7 ]. minimally invasive robotic systems, such as the da vinci surgical system (dv) (intuitive surgical, sunnyvale, ca), however, orientation in a narrow space, the identification and attribution of structures and the estimation of the instrument s position in relation to the position of risk and target structures remain difficult. a navigation system, similar to those used in neuro- and maxillofacial surgery, might be a possible solution to these problems [1113 ]. however, navigation in soft tissue surgery is relatively more complex due to organ deformation and changing organ positions caused by tissue elasticity as well as cardiac and respiratory movements. there is a need for updated information on the position of patient risk and target structures to build a navigation system that shows enough precision and accuracy for soft tissue surgery. while optic tracking systems provide high accuracy and precision, they require a direct line of sight from the sensor to the camera. their usability, high accuracy and precision in minimally invasive robotic surgery have already been proven. electromagnetic tracking systems are also highly accurate and precise, and they do not require a direct line of sight. however, they are susceptible to interference from ferromagnetic materials and electromagnetic fields. since dv effectors and instruments consist of metal, wire ropes and servo motors, its influence on magnetic tracking and its usability in the operating room are not known. the aim of the study reported here was to evaluate whether the dv can be used in combination with an electromagnetic navigation system to provide sufficient accuracy to visualize risk and target structures intraoperatively. to evaluate the effect of the dv and the operation table on the ndi aurora v1 (ndi inc, waterloo, ontario, canada) electromagnetic tracking system, here referred to as emt, a metal - free measuring facility had to be built to minimize other possible sources of interference. in addition, the data acquisition setup was chosen to be as close to the real operation setup as possible to evaluate the usability of the emt in a realistic environment. a completely metal - free measuring facility was built to minimize interference with the emt. this consisted of 12 polyvinyl chloride (pvc) rigid tubes that were arranged in such a way that the dv instruments and camera could be used in between them. the measuring facility walls were built out of medium - density fiberboard (diameter 22 mm). the pvc rigid tubes were 500 mm long and had a wall thickness and inner diameter of 3 and 5 mm, respectively. the pipes were arranged to cover the complete tracking volume of the emt. the cubic tracking volume featuring a volume of 500 500 500 mm, according to the manufacturer of the emt, was chosen due to known increased distortion in the periphery of the alternative dome volume. the pipes (500 mm) were arranged along the x - axis of the emt volume (fig. 1). a computed tomography (ct) (512 512 pixel, layer thickness 0.6 mm) was performed to generate a digital representation of the measuring facility.fig. 1wooden metal - free measuring facility with 12 polyvinyl chloride (pvc) tubes, thus enabling laparoscopic instruments to be used between the tubes wooden metal - free measuring facility with 12 polyvinyl chloride (pvc) tubes, thus enabling laparoscopic instruments to be used between the tubes the emt was used with one field generator and one sensor. the field generator was a rectangle box that created an electromagnetic field, with a cube size tracking volume of 500 500 500 mm, according to the manufacturer. the sender was arranged on the right side of the operating table (fig. 2). the emt was used in combination with a 5dof sensor (type mednetix-5dk) embedded in a flexible cord. the outer diameter of the cord was adjusted to fit the inner diameter of the pipes using leukosilk tape.fig. 2realistic setup in the operating room with anesthesia console, laparoscopic turret and the da vinci surgical system, as used in laparoscopic nissen fundoplication realistic setup in the operating room with anesthesia console, laparoscopic turret and the da vinci surgical system, as used in laparoscopic nissen fundoplication the dv was arranged in the operating room in the same way a typical operation setup is used for nissen fundoplication, with the dv over the head of the patient. all medical instruments and devices were positioned as if for a regular abdominal operation (fig. 2). the operating table used was an alphamaquet 1150 (maquet, rastatt, germany) system and consisted of several parts with ferromagnetic characteristics (fig. 3).fig. 3operating table alphamaquet 1150, with outlined ferromagnetic material (yellow). emt electromagnetic tracking system operating table alphamaquet 1150, with outlined ferromagnetic material (yellow). thus, the sensor was constantly pulled orthogonally to the field generator along the path forced by the pvc tube, simulating the instruments in use. the measurement of distorted positions was achieved by pulling the sensor from one end of the pipe to the other. in this way, the shift in the y- and z - axes of the tracking coordinate space was addressed. the shift in the x - axis a shift was detected if the tracked position left the centerline of the corresponding pipe. the distance between the centerline and the tracked coordinate was used to describe distortion at each point along the x - axis. two measurements for each tube and setup were acquired by slowly and continuously pulling the sensor through each pipe. we performed seven measurements : a reference measurement without the table, the dv and other metallic objects in close proximity (r), respectively, one with the measuring facility directly on the table (tl), one with the measuring facility lifted 50 mm (t), one with the dv in active mode but not in motion (d), and one with the dv in motion (dm) (fig. the dv measurements were only performed with a 50 mm - lifted measuring facility due to obvious high distortion when the measuring facility was not lifted.fig. 4 left static da vinci magnetic sensors were pulled through a pvc tube. right da vinci was constantly in motion using the da vinci console left static da vinci magnetic sensors were pulled through a pvc tube. right da vinci was constantly in motion using the da vinci console for data processing the centerline of each pipe was interactively defined. this was accomplished by processing the ct scan dicom file of the measuring facility and precisely defining sample points inside each pipe at five equivalent positions, using mitk (medical imaging interaction toolkit ; dkfz, german cancer research center, heidelberg, germany), thereby creating four line segments. registration between the ct coordinate and tracking coordinate space was done by rigid point - to - point registration. the attribution of each measured track sample to the corresponding line segment was first determined for each x coordinate, and then the offset vector between the matched track sample and the matched line segment in orthogonal direction was calculated. if two measurements were found for the same x coordinate, the larger offset vector was used. to ensure precision, each evaluation setup was also assessed by measuring three fixed positions of each track : head, middle and feet. a completely metal - free measuring facility was built to minimize interference with the emt. this consisted of 12 polyvinyl chloride (pvc) rigid tubes that were arranged in such a way that the dv instruments and camera could be used in between them. the measuring facility walls were built out of medium - density fiberboard (diameter 22 mm). the pvc rigid tubes were 500 mm long and had a wall thickness and inner diameter of 3 and 5 mm, respectively. the pipes were arranged to cover the complete tracking volume of the emt. the cubic tracking volume featuring a volume of 500 500 500 mm, according to the manufacturer of the emt, was chosen due to known increased distortion in the periphery of the alternative dome volume. the pipes (500 mm) were arranged along the x - axis of the emt volume (fig. 1). a computed tomography (ct) (512 512 pixel, layer thickness 0.6 mm) was performed to generate a digital representation of the measuring facility.fig. 1wooden metal - free measuring facility with 12 polyvinyl chloride (pvc) tubes, thus enabling laparoscopic instruments to be used between the tubes wooden metal - free measuring facility with 12 polyvinyl chloride (pvc) tubes, thus enabling laparoscopic instruments to be used between the tubes the field generator was a rectangle box that created an electromagnetic field, with a cube size tracking volume of 500 500 500 mm, according to the manufacturer. the sender was arranged on the right side of the operating table (fig. 2). the emt was used in combination with a 5dof sensor (type mednetix-5dk) embedded in a flexible cord. the outer diameter of the cord was adjusted to fit the inner diameter of the pipes using leukosilk tape.fig. 2realistic setup in the operating room with anesthesia console, laparoscopic turret and the da vinci surgical system, as used in laparoscopic nissen fundoplication realistic setup in the operating room with anesthesia console, laparoscopic turret and the da vinci surgical system, as used in laparoscopic nissen fundoplication the dv was arranged in the operating room in the same way a typical operation setup is used for nissen fundoplication, with the dv over the head of the patient. all medical instruments and devices were positioned as if for a regular abdominal operation (fig. 2). the operating table used was an alphamaquet 1150 (maquet, rastatt, germany) system and consisted of several parts with ferromagnetic characteristics (fig. emt electromagnetic tracking system operating table alphamaquet 1150, with outlined ferromagnetic material (yellow). thus, the sensor was constantly pulled orthogonally to the field generator along the path forced by the pvc tube, simulating the instruments in use. the measurement of distorted positions was achieved by pulling the sensor from one end of the pipe to the other. in this way, the shift in the y- and z - axes of the tracking coordinate space was addressed. a shift was detected if the tracked position left the centerline of the corresponding pipe. the distance between the centerline and the tracked coordinate was used to describe distortion at each point along the x - axis. two measurements for each tube and setup were acquired by slowly and continuously pulling the sensor through each pipe. we performed seven measurements : a reference measurement without the table, the dv and other metallic objects in close proximity (r), respectively, one with the measuring facility directly on the table (tl), one with the measuring facility lifted 50 mm (t), one with the dv in active mode but not in motion (d), and one with the dv in motion (dm) (fig. 4). the dv measurements were only performed with a 50 mm - lifted measuring facility due to obvious high distortion when the measuring facility was not lifted.fig. 4 left static da vinci magnetic sensors were pulled through a pvc tube. right da vinci was constantly in motion using the da vinci console left static da vinci magnetic sensors were pulled through a pvc tube. right da vinci was constantly in motion using the da vinci console for data processing the centerline of each pipe was interactively defined. this was accomplished by processing the ct scan dicom file of the measuring facility and precisely defining sample points inside each pipe at five equivalent positions, using mitk (medical imaging interaction toolkit ; dkfz, german cancer research center, heidelberg, germany), thereby creating four line segments. registration between the ct coordinate and tracking coordinate space was done by rigid point - to - point registration. the attribution of each measured track sample to the corresponding line segment was first determined for each x coordinate, and then the offset vector between the matched track sample and the matched line segment in orthogonal direction was calculated. if two measurements were found for the same x coordinate, the larger offset vector was used. to ensure precision, each evaluation setup was also assessed by measuring three fixed positions of each track : head, middle and feet. accuracy particularly decreased at the periphery of the tracking volume, far from the field generator. in contrast, the tracking system showed low distortion at the center of the tracking volume (fig. 5reference evaluation shows the virtual three - dimensional (3d) scene by mitk : interactively defined reference centerlines are red, and measured positions with the emt system at corresponding centerline positions are yellow. the yellow and green lines should always stay close to the red line for high accuracyfig. 6results of the exemplary reference measurements for each separate tube showing the respective maximum distance from the centerline. the y - axis represents the extent of shift (of the tracked position) ; the x - axis represents the x - coordinate of the tracking volume reference evaluation shows the virtual three - dimensional (3d) scene by mitk : interactively defined reference centerlines are red, and measured positions with the emt system at corresponding centerline positions are yellow. the yellow and green lines should always stay close to the red line for high accuracy results of the exemplary reference measurements for each separate tube showing the respective maximum distance from the centerline. the y - axis represents the extent of shift (of the tracked position) ; the x - axis represents the x - coordinate of the tracking volume the results of the two operation table assessments (tl, t) showed that the closer the field generator was to the table, the higher the amount of errors. these errors increased dramatically towards the periphery of the tracking volume (figs. 7, 8).fig. 7measurement without the da vinci system for all tubes, with the measuring facility lifted 50 mm on the operation tablefig. 8overview of the maximal error for all tubes (according to the setup in the x - axis), measured orthogonally to the reference lines measurement without the da vinci system for all tubes, with the measuring facility lifted 50 mm on the operation table overview of the maximal error for all tubes (according to the setup in the x - axis), measured orthogonally to the reference lines the use of the dv (d, dm) did not reveal any additional measurable errors, neither in static position nor during motion (fig. for all measurements, variance declined from the periphery to the middle of the tracking volume for both the y- and z - axes, although to a lesser extent along the z - axis. limiting the tracking volume to 190 mm in the craniocaudal direction led to a maximum error of 10 mm. the maximum errors of the entire tracking volume are shown in table 1.table 1maximum errors recorded in the measurementstracking volume measurement rtltddmfull tracking volume [mm]9.943.432.837.937.2limited tracking volume [mm]4.09.98.38.58.9 r, reference, no metal ; tl, operating table, low measuring facility ; t, operating table, high measuring facility (50 mm and upwards) ; d, da vinci in standby ; dm, da vinci in motion limitation of the tracking volume to 95 mm on each side of the field generator maximum error is given in millimeter maximum errors recorded in the measurements r, reference, no metal ; tl, operating table, low measuring facility ; t, operating table, high measuring facility (50 mm and upwards) ; d, da vinci in standby ; dm, da vinci in motion limitation of the tracking volume to 95 mm on each side of the field generator maximum error is given in millimeter in summary, this study has shown that an emt can be reliably used with the dv within a real medical environment if the tracking volume is limited. our results also demonstrate that the dv seems to have had hardly any effect on the accuracy of the magnetic tracking system. in contrast, metallic parts of the operating table distorted the positions delivered by the emt to a large extent. the result from lifting the measurement setup by 50 mm shows that the emt was more accurate in areas that were further away from ferromagnetic objects. the largest errors were seen towards the borders of the tracking volume, which can be explained by the decreasing strength of the electromagnetic field the further away it was from the electromagnetic field generator. in general, detected errors have to be either eliminated or accurately detected in order to ensure precise navigation throughout the tracking volume. since the amount of errors detected is still fairly high,. this can be done by using the wooden measuring facility presented here as a reference ; for example, by logging the coordinates over time and registering them with the virtual description of the wooden measuring facility (centerlines). by means of an iterative closest point algorithm, the best fit can be calculated in order to construct a lookup table for distorted positions and their corresponding correction. the distortion can also be decreased by repositioning the field generator (and the patient) to a position which is less affected by distortion due to ferromagnetic objects. the resulting amount of electromagnetic distortion caused by the operating table can also be decreased by choosing a table with a different material. an operation table constructed with carbon might have less effect on the electromagnetic field of the emt. furthermore, it should be noted that the results presented here can be only applied to the emt tested. we did not evaluate a different aurora tracking system or a different emt, but according to theory, similar types of results are expected. ndi inc. has developed a new type of electromagnetic field generator which resembles a board that can be installed right under the patient directly on top of the operation table. according to the manufacturer, this system shows less distortion due to ferromagnetic material of the operation table, but it has yet to be evaluated with the above - mentioned setup. previous work has already shown that navigation is feasible, such as for transhiatal minimally invasive esophagectomy. the biggest challenge of these systems is that they do not provide an intraoperative update of the target position and risk structures. particularly in esophagectomy, but also in rectal surgery, the iatrogenic manipulation causes a substantial shift of structures. determining the correct height for the anastomosis in transhiatal esophagectomy or rectal resection requires much surgical experience. to achieve this, emt sensors could be applied endoscopically in the esophagus and the rectum. thus, combining the developed system, which is based on optical tracking, with an emt will enable, for example, the intraoperative update of the position of a tumor in the esophagus or rectum, resulting in higher overall precision. this navigation system could help to find the correct position for anastomosis or affected lymph nodes in esophagectomy, or it could help to distinguish between scar and tumor for tumor recurrence of preoperated rectal cancer. there are also limitations to this study. to compute the overall volume, we deemed accuracy to be less useful for the emt because of the strong spatial dependence of its errors. therefore, we computed the maximum errors which we believe to be clinically more important. values such as the root mean square deviation have been calculated but are of less use since they involve the entire pipe, whereas here only the positional deviation at certain points of the x - axis was important. to summarize, a magnetic tracking system can be used reliably in combination with the dv in a limited tracking volume and shows sufficient accuracy for navigation purposes. | in recent years, robotic assistance for surgical procedures has grown on a worldwide scale, particularly for use in more complex operations. such operations usually require meticulous handling of tissue, involve a narrow working space and limit the surgeon s sense of orientation in the human body. improvement in both tissue handling and working within a narrow working space might be achieved through the use of robotic assistance. soft tissue navigation might improve orientation by visualizing important target and risk structures intraoperatively, thereby possibly improving patient outcome. prerequisites for navigation are its integration into the surgical workflow and accurate localization of both the instruments and patient. magnetic tracking allows for good integration but is susceptible to distortion through metal or electro - magnetic interference, which may be caused by the operation table or a robotic system. we have investigated whether magnetic tracking can be used in combination with the da vinci (dv) telemanipulator in terms of stability and precision. we used a common magnetic tracking system (aurora, ndi inc.) with the dv in a typical operation setup. magnetic field distortion was evaluated using a measuring facility, with the following reference system : without any metal (r), operation table alone (t), dv in standby (d) and dv in motion (dm). the maximum error of the entire tracking volume for r, t, d and dm was 9.9, 32.8, 37.9 and 37.2 mm, respectively. limiting the tracking volume to 190 mm (from cranial to caudal) resulted in a maximum error of 4.0, 8.3, 8.5 and 8.9 mm, respectively. when used in the operation room, magnetic tracking shows high errors, mainly due to the operation table. the target area should be limited to increase accuracy, which is possible for most surgical applications. the use of the da vinci telemanipulator only slightly aggravates the distortion and can thus be used in combination with magnetic tracking systems. |
several plants of the ericaceae (rhododendron) family produce grayanotoxins which can poison humans. grayanotoxins are known to occur in honey produced from the nectar of rhododendrons [1, 2 ]. grayanotoxins such as grayanotoxin i iv are a unique class of toxic diterpenoids which are polyhydroxylated cyclic hydrocarbons that do not contain nitrogen. the grayanotoxins are neurotoxins interfering with the transmission of the action potential by blocking sodium channels in cell membranes. the best - known of these intoxications involves the eating of mad honey contaminated by nectar with grayanotoxins. it is still one of the common food intoxications encountered for humans and livestock in turkey. it causes a sharp burning sensation in the throat and is thus also referred to as bitter honey. honey produced in springtime is more toxic and sometimes contains higher concentrations of grayanotoxin than that produced in other seasons. mad honey is used as an alternative medicine for the treatment of gastric pains, bowel disorders, and hypertension, and it is also believed to be a sexual stimulant. although the grayanotoxin (mad honey) poisoning is not known commonly, there are some case series and case reports in the medical literature about it, especially in turkey. the aim of this study was to describe the presentation of 21 natural honey intoxication cases and to review the literature. this study is retrospective analysis of twenty - one (21) patients who were admitted to the emergency department due to honey poisoning between april and june 2010. the demographic data, clinical symptoms, length of delay after consumption, length of stay in hospital, vital signs, ecg pathologies, and treatments administered to mad honey patients were noted. we enrolled the patients whose other causes (cardiac, neurologic, metabolic) were ruled out as alternative diagnoses of clinical presentation. also the diagnosis of mad honey poisoning was based on a history of ingestion of unprocessed locally obtained honey and typical signs of dizziness, ataxia, bradydysrhythmias, diaphoresis, and hypotension. the confirmation of mad honey intoxication was mainly based on the clinical symptoms and the patients confirmed to have used the mad honey. there were 21 patients (13 male and 8 female) admitted to the emergency service due to the honey poisoning. the mean length of delay after consumption is 3.4 hrs (95% ci ; 1.56.2 hrs). dizziness, weakness, excessive perspiration, nausea - vomiting, and low blood pressure were the most observed symptoms (table 1). mean systolic blood pressure was 102 mmhg (95% ci ; 78125 mmhg). the mean length of hospital stay is 14.7 hrs (95% ci ; 6.321.2 hrs). patient rhythms on arrival were as follows (figure 1) : 10 patients were in normal sinus rhytm, 7 sinus bradycardia, 3 nodal rhytm, and 1 atrial fibrillation. the grayanotoxins are neurotoxins interfering with the transmission of the action potential by blocking sodium channels in cell membranes. these compounds prevent inactivation ; thus, excitable cells (nerves and muscles) are maintained in a state of depolarization, during which entry of calcium into the cells may be facilitated. all of the observed responses of skeletal and heart muscles, nerves, and the central nervous system are related to the membrane effects. the toxic effects of honey poisoning are rarely fatal and generally last for no more than 24 hours. symptoms of poisoning occur after a dose - dependent latent period of a few minutes to 2 or more hours. in our case series, mad honey intoxication 's symptoms are dose - related. in mild forms, dizziness, weakness, excessive perspiration, hypersalivation, nausea, vomiting, and paresthesias however, severe intoxication may lead to life threatening cardiac complications such as complete atrioventricular block. in our case series, and in those of patients previously described, symptomatic sinus bradycardia with hypotension is the most frequently reported mad - honey - induced cardiac dysrhythmia. locally produced honey is widely consumed in the black sea region. in general, beekeepers sell their own unprocessed honey in local and regional markets. they reach the consumer directly, with no intermediate processing. in general, the severity of the honey poisoning depends on the amount ingested. but there is no standard amount of toxin in 1 g. the concentration of grayanotoxin ingested may differ greatly from case to case. reported that the amount of honey causing poisoning is between 5 and 30 g. as grayanotoxins are metabolized and excreted rapidly, patients generally regain consciousness and feel better within hours, and heart rate and blood pressure usually return to normal within 29 hours. symptoms of poisoning occur after a dose - dependent latent period of a few minutes to two or more hours. in untreated cases of severe intoxication, the worst signs and symptoms last about 24 hours. however, the therapy of the patient should be planned after taking a careful history. in the emergency setting, poisoning is a clinical state which is very hard to identify. we have to keep in mind that drugs and toxins may cause lethal dysrhythmias. | background. the grayanotoxin (mad honey) poisoning is not known commonly, there are some case series and case reports in the medical literature about it, especially in turkey. the aim of this study was to describe the presentation of 21 natural honey intoxication cases and to review the literature. material and method. this study is retrospective analysis of twenty one patients who were admitted to the emergency department due to honey poisoning. results. median age of 21 patients was 55. the mean length of delay after consumption is 3.4 hrs. dizziness, weakness, excessive perspiration, nausea - vomiting, and low blood pressure were the most observed symptoms. mean pulse rate was 56/min. mean systolic blood pressure was 102 mmhg. the mean length of hospital stay is 14.7 hrs. patient rhytms on arrival were as follows : 10 patients were in normal sinus rhytm, 7 sinus bradycardia, 3 nodal rhytm, 1 atrial fibrillation. atropine was given to 18 patients. none of our patients died and all were discharged home without any complication. discussion. in the emergency setting, poisoning is a clinical state which is very hard to identify. we have to keep in mind that drugs and toxins may cause lethal dysrhythmias. |
mesenteric cysts can occur anywhere in the mesentery of the gastrointestinal tract and also may extend from the base of the mesentery into the retroperitoneum : 60% of mesenteric cysts occur in the small - bowel mesentery, 24% in the large - bowel mesentery and 14.5% in the retroperitoneum [2, 3 ]. patients generally present with vague abdominal pain sometimes associated with a palpable mass. although often asymptomatic, 10% of patients with such cysts present as an acute abdomen [3, 4 ]. a 30 year - old man presented with diffuse abdominal pain in the last 6 months, without other abdominal or systemic symptoms. at the physical examination, a rounded swelling in the upper left quadrant was appreciated. the abdominal ultrasonography confirmed a rounded cystic formation, with regular walls, in the mesogastric region. a computed tomography scan showed a cystic mass measuring 95 60 mm, interjected between jejunal loops and located close to the inferior mesenteric artery and aorta (see fig. 1). computed tomography view of the mesenteric cyst. with the informed consent of the patient, we planned to remove the mass with laparoscopic technique. the omentum raised up and the small intestine disposed to the right, the cyst was seen and the third trocar was placed in the left lumbar region. the dissection started with an incision of the peritoneal covering of the mass that was then peeled away from the underlying fat tissue. during the dissection, the cyst was damaged and a dense white milk - like fluid spilled out. the laboratory tests on the cyst 's liquid confirmed chylous content (just chemical physical properties of the fluid content were analyzed, without the cyst 's histology). the postoperative course was regular and the patient left the department on the fifth postoperative day. a 61-year - old woman came to our department for regurgitation, dyspepsia and dry cough. the patient had the diagnosis of gerd associated with a hiatal hernia (to which are related the presenting symptoms). a routine abdominal ultrasonography, performed during hospitalization, surprisingly showed a mesogastric cystic formation between aorta and the caval vein. the abdominal computed tomography scan with contrast revealed a huge (10 cm of diameter) retroperitoneal cyst, oval shaped and containing dense fluid, located within the caval vein and the aorta, under the origin of the renal artery, partially dislocating the caval vein to the right (see fig. 2). figure 2:computed tomography view of the mesenteric cyst partially dislocating the caval vein. computed tomography view of the mesenteric cyst partially dislocating the caval vein. with the informed consent of the patient, a laparotomy was undertaken with removal of the cyst and a nissen fundoplication was carried out. the dissection started after the complete mobilization of ascending colon and the kocherization of the duodenum, with the complete detachment of the cyst from the major retroperitoneal blood vessels. the postoperative recovery was normal and the patient returned home on the ninth postoperative day. a 30 year - old man presented with diffuse abdominal pain in the last 6 months, without other abdominal or systemic symptoms. at the physical examination, a rounded swelling in the upper left quadrant was appreciated. the abdominal ultrasonography confirmed a rounded cystic formation, with regular walls, in the mesogastric region. a computed tomography scan showed a cystic mass measuring 95 60 mm, interjected between jejunal loops and located close to the inferior mesenteric artery and aorta (see fig. 1). computed tomography view of the mesenteric cyst. with the informed consent of the patient, we planned to remove the mass with laparoscopic technique. the omentum raised up and the small intestine disposed to the right, the cyst was seen and the third trocar was placed in the left lumbar region. the dissection started with an incision of the peritoneal covering of the mass that was then peeled away from the underlying fat tissue. during the dissection, the cyst was damaged and a dense white milk - like fluid spilled out. the laboratory tests on the cyst 's liquid confirmed chylous content (just chemical physical properties of the fluid content were analyzed, without the cyst 's histology). the postoperative course was regular and the patient left the department on the fifth postoperative day. a 61-year - old woman came to our department for regurgitation, dyspepsia and dry cough. the patient had the diagnosis of gerd associated with a hiatal hernia (to which are related the presenting symptoms). a routine abdominal ultrasonography, performed during hospitalization, surprisingly showed a mesogastric cystic formation between aorta and the caval vein. the abdominal computed tomography scan with contrast revealed a huge (10 cm of diameter) retroperitoneal cyst, oval shaped and containing dense fluid, located within the caval vein and the aorta, under the origin of the renal artery, partially dislocating the caval vein to the right (see fig. 2). computed tomography view of the mesenteric cyst partially dislocating the caval vein. with the informed consent of the patient, a laparotomy was undertaken with removal of the cyst and a nissen fundoplication was carried out. the dissection started after the complete mobilization of ascending colon and the kocherization of the duodenum, with the complete detachment of the cyst from the major retroperitoneal blood vessels. the postoperative recovery was normal and the patient returned home on the ninth postoperative day. the diagnosis can be challenging because chylous cysts mimic other pathologies, such as pancreatic pseudocysts or cystic tumors, pelvic diseases and aortic aneurysms. preoperative diagnosis may be achieved with the imaging investigations (ultrasonography, computed tomography, nuclear magnetic resonance) [46 ]. ultrasonography must be the first - line technique because it can localize the cystic mass and often the involvement of the near anatomical structures. computed tomography scan confirms the ultrasonography 's diagnosis and is really important in order to adequately plan the surgical approach [7, 8 ]. the treatment of choice is the complete surgical excision of the cyst [9, 10 ]. the first effective surgical treatment of a mesenteric cyst was performed in 1880s by tillaux. in 1897, o'conor described the marsupialization of a chylous mesenteric cyst by suturing its edges to the skin [4, 5 ]. reported the complete enteroscopic excision of a mesenteric chylous cyst developing into the lumen of the proximal jejunum. some authors performed laparotomic or laparoscopic fenestration of the cyst, if it is located near a major abdominal vessel, but such a surgical option should be avoided due to the risk of malignancy. in our first case, we performed the complete excision of the cyst by laparoscopy. the position of the trocars must be decided depending on the location of the tumor. a second concern of the technique is the relation between the cyst and the major abdominal vessels. our second case, with a huge retroperitoneal cyst highly interconnected with major abdominal blood vessels and a syncronous hiatal hernia, required a laparotomic approach. it is important in order to avoid any risk of chylous fistula to accurately seal and divide any vessel of the cyst. however, the chyle leakage from the cyst does not represent any particular concern, as long as the surgeon can accurately wash the surgical field and eventually insert a drain (see fig. it is a rare disease, but surgeons must consider the diagnosis in the presence of a cystic abdominal tumor. the first - choice therapy is the complete removal of the cyst, which must be accurately planned according to the anatomy of the lesion, its dimensions and its relationships with major abdominal structures. | a mesenteric cyst is defined as a cyst that is located in the mesentery of the gastrointestinal tract and may extend from the base of the mesentery into the retroperitoneum. it is often asymptomatic and therefore it is usually found as an incidental finding. preoperative diagnosis may be possible with computed tomography and magnetic resonance imaging. however, the correct diagnosis can only be made with histology. the first - choice therapy is the complete removal of the cyst, which must be accurately planned according to the anatomy of the lesion, its dimensions and its relationships with major abdominal structures. we present two clinical cases : the one of a 30-year - old man with a mesenteric cyst that was removed by laparoscopy and the other of a 61-year - old woman who underwent open excision of a huge retroperitoneal cyst. |
recently, a great advance was achieved in the understanding of pathogenesis of autoimmune diabetes, particularly regarding the molecular mechanism of pancreatic -cell apoptosis and immunological significance of -cell apoptosis. hence, it has been shown that pancreatic -cell death is important not only in the final effector phase of autoimmune type 1 diabetes (1,2) but also in the initiation of -cell autoimmunity (3,4). such progress was mostly achieved by employing murine models of autoimmune diabetes because application of most essential genetic manipulation or immunological intervention is possible only in animal models. murine autoimmune diabetes models and human type 1 diabetes have many common characteristics such as the presence of insulitis, requirement for specific mhc haplotypes and autoimmune responses to autoantigens including glutamic acid decarboxylase (gad). thus, many recent progress obtained employing murine autoimmune diabetes models would be applicable to human type 1 diabetes, implying important therapeutic potential. autoreactive t lymphocytes are the most important effector cells in murine autoimmune diabetes (5 - 7), and probably in human type 1 diabetes. they will ultimately induce apoptosis of -islet cells in murine autoimmune diabetes (8,9), while apoptosis of pancreatic -cells in human type 1 diabetes has not been demonstrated because of the difficulty in procuring human pancreatic tissue and inability to synchronize disease process in human type 1 diabetes. we have shown that ifn/tnf synergism is responsible for murine pancreatic -cell apoptosis both in vitro and in vivo (2), which was critically dependent on stat1 activation by ifn (1). in vivo role of stat1 activation by ifn other death effector molecules such as fas ligand (fasl) might be an effector molecule for a small number of autoreactive lymphocytes (10) but not for the majority of final death effector cells (9,11). ifn appears to sensitize otherwise resistant pancreatic islet cells or insulinoma cells to tnf -mediated apoptosis by activating stat1/irf-1 signal pathway (2). most such pancreatic -cell death and signal pathways were studied in murine autoimmune diabetes models. such findings might also be relevant in human type 1 diabetes also. in an effort to elucidate the possible mechanism of human pancreatic islet cell apoptosis leading to human type 1 diabetes, we investigated if similar cytokine synergism could induce apoptosis of human pancreatic islet cells and similar signal molecules are induced in them. human pancreatic islets were obtained from brain - dead patients between 1998 and 2002 at samsung medical center, using a modification of the automated method for human islet isolation (12). briefly, 350 ml of hank 's buffered salt solution (hbss) containing 9.1mol / l collagenase solution (liberase, boehringer - mannheim, mannheim, germany) was injected through the pancreatic duct after cannulation. the pancreas was loaded into a stainless steel digestion chamber, and islets were separated during a continuous digestion process for 30~45 min. during the recirculation phase (flow rate, 85 ml / min), intrachamber temperature was increased at a rate of 2/min by the passage of the solution through a stainless steel coil immersed in a water bath (50). the chamber containing the distended pancreas was gently agitated and samples were taken every 2 min to monitor digestion. after 20~30 min of recirculation, digestion was stopped by dilution in 400 ml / min ice - cold hbss. in this phase, the digested tissue was rapidly collected in sterile bottles containing 200 ml fcs. purification of the islets was carried out over discontinuous euro - ficoll gradients (1.108, 1.096, 1.037 and hbss). purified islets were then washed twice, evaluated for purity, and counted after dithizone (sigma, st. the pellet was resuspended in 3 ml warm 53.7mol / l trypsin-3 mmol / l edta. after incubation at 37 for 5 min and pipetting for 2~3 min, islets became invisible. then, cells were washed with warm rpmi-10% fcs at 1,500 rpm for 5 min. single islet cells were frozen in liquid nitrogen until use. at the time of assays, single islet cells were thawed and 1.410 cells were plated per single well of 96-well plates. viability of the islet cells after thawing was above 90%, as judged by trypan blue staining and acridine orange / propidium iodide staining. isolated human pancreatic islet cells were grown in dmem containing 15% fbs, 2 mm glutamine, and penicillin - streptomycin (gibco - brl, gaithersburg, md). recombinant human tnf and recombinant human il-1 were purchased from r&d systems (minneapolis, mn). louis, mo) unless stated otherwise. cells (210/well for human single islet cells) were seeded in 96-well microtiter plates and treated with various combinations of cytokines for the indicated time periods. the optimal concentrations of cytokines for the cytotoxic action were 1,000 u / ml for ifn, 10 ng / ml for tnf, and 17.5 ng / ml for il-1. after cytokine treatment, the medium was removed and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (mtt, 0.5 mg / ml) was added followed by incubation at 37 for 2 hr in co2 incubator. after a brief centrifugation, supernatant was carefully removed and dmso was added. after insoluble crystals were completely dissolved, absorbance at 540 nm was measured using thermomax microplate reader (molecular devices, sunny vale, ca). morphological changes in the nuclear chromatin of cells undergoing apoptosis were detected by staining with 2.5g / ml of dna - binding bisbenzimide hoe33342 fluorochrome (calbiochem, san diego, ca), followed by an examination on a fluorescence microscope. for transmission electron microscopy, cells were fixed in 4% glutaraldehyde/1% paraformaldehyde/0.2 m phosphate (ph 7.2) at 4 for 2 hr. after two washes in 0.2 m phosphate, the cell pellets were postfixed with 2% oso4 in the same buffer for 30 min. the pellets were dehydrated in ethanol and then in 100% propylene oxide, followed by embedding at 37 overnight and 60 for another 3 days. ultrafine sections were cut and examined on an electron microscope (hitachi h7100, 75 kv). cells were lysed in triple - detergent lysis buffer (50 mm tris - cl, ph 8.0, 150 mm nacl, 0.02% sodium azide, 0.1% sds, 1% np-40, 0.5% sodium deoxycholate, 1 mm pmsf). an equal amount of protein for each sample was separated by 10% or 12% sds - page and transferred to hybond ecl nitrocellulose membrane (ge healthcare life sciences, buckinghamshire, uk). after blocking with 5% skim milk, the membranes were sequentially incubated with one of the primary antibodies (rabbit anti - mouse irf-1, santa cruz ; rabbit anti - phospho - stat1, new england biolabs, ipswich, ma) and then hrp - conjugated secondary antibodies (anti - rabbit igg, ge healthcare life sciences, buckinghamshire, uk), followed by ecl detection (ge healthcare life sciences, buckinghamshire, uk). human pancreatic islets were obtained from brain - dead patients between 1998 and 2002 at samsung medical center, using a modification of the automated method for human islet isolation (12). briefly, 350 ml of hank 's buffered salt solution (hbss) containing 9.1mol / l collagenase solution (liberase, boehringer - mannheim, mannheim, germany) was injected through the pancreatic duct after cannulation. the pancreas was loaded into a stainless steel digestion chamber, and islets were separated during a continuous digestion process for 30~45 min. during the recirculation phase (flow rate, 85 ml / min), intrachamber temperature was increased at a rate of 2/min by the passage of the solution through a stainless steel coil immersed in a water bath (50). the chamber containing the distended pancreas was gently agitated and samples were taken every 2 min to monitor digestion. after 20~30 min of recirculation, digestion was stopped by dilution in 400 ml / min ice - cold hbss. in this phase, the digested tissue was rapidly collected in sterile bottles containing 200 ml fcs. purification of the islets was carried out over discontinuous euro - ficoll gradients (1.108, 1.096, 1.037 and hbss). purified islets were then washed twice, evaluated for purity, and counted after dithizone (sigma, st. the pellet was resuspended in 3 ml warm 53.7mol / l trypsin-3 mmol / l edta. after incubation at 37 for 5 min and pipetting for 2~3 min, islets became invisible. then, cells were washed with warm rpmi-10% fcs at 1,500 rpm for 5 min. single islet cells were frozen in liquid nitrogen until use. at the time of assays, single islet cells were thawed and 1.410 cells were plated per single well of 96-well plates. viability of the islet cells after thawing was above 90%, as judged by trypan blue staining and acridine orange / propidium iodide staining. isolated human pancreatic islet cells were grown in dmem containing 15% fbs, 2 mm glutamine, and penicillin - streptomycin (gibco - brl, gaithersburg, md). recombinant human tnf and recombinant human il-1 were purchased from r&d systems (minneapolis, mn). cells (210/well for human single islet cells) were seeded in 96-well microtiter plates and treated with various combinations of cytokines for the indicated time periods. the optimal concentrations of cytokines for the cytotoxic action were 1,000 u / ml for ifn, 10 ng / ml for tnf, and 17.5 ng / ml for il-1. after cytokine treatment, the medium was removed and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (mtt, 0.5 mg / ml) was added followed by incubation at 37 for 2 hr in co2 incubator. after a brief centrifugation, supernatant was carefully removed and dmso was added. after insoluble crystals were completely dissolved, absorbance at 540 nm was measured using thermomax microplate reader (molecular devices, sunny vale, ca). morphological changes in the nuclear chromatin of cells undergoing apoptosis were detected by staining with 2.5g / ml of dna - binding bisbenzimide hoe33342 fluorochrome (calbiochem, san diego, ca), followed by an examination on a fluorescence microscope. for transmission electron microscopy, cells were fixed in 4% glutaraldehyde/1% paraformaldehyde/0.2 m phosphate (ph 7.2) at 4 for 2 hr. after two washes in 0.2 m phosphate, the cell pellets were postfixed with 2% oso4 in the same buffer for 30 min. the pellets were dehydrated in ethanol and then in 100% propylene oxide, followed by embedding at 37 overnight and 60 for another 3 days. ultrafine sections were cut and examined on an electron microscope (hitachi h7100, 75 kv). cells were lysed in triple - detergent lysis buffer (50 mm tris - cl, ph 8.0, 150 mm nacl, 0.02% sodium azide, 0.1% sds, 1% np-40, 0.5% sodium deoxycholate, 1 mm pmsf). an equal amount of protein for each sample was separated by 10% or 12% sds - page and transferred to hybond ecl nitrocellulose membrane (ge healthcare life sciences, buckinghamshire, uk). after blocking with 5% skim milk, the membranes were sequentially incubated with one of the primary antibodies (rabbit anti - mouse irf-1, santa cruz ; rabbit anti - phospho - stat1, new england biolabs, ipswich, ma) and then hrp - conjugated secondary antibodies (anti - rabbit igg, ge healthcare life sciences, buckinghamshire, uk), followed by ecl detection (ge healthcare life sciences, buckinghamshire, uk). treatment of single human islet cells with cytokines disclosed that combination of ifn, tnf and il-1 induced significant death after 5 days of incubation. when the effect of individual cytokine was studied, a combination of ifn and tnf induced death of human islet cells while single cytokine did not exert significant cytotoxicity on human islet cells (fig. the addition of il-1 to the ifn/tnf combination had only a minor effect on islet cell viability. our results showing death of human islet cells by the triple combination of ifn, tnf and il-1 is similar to previous reports by others employing human islet cells (13 - 16). percent death of human islet cells by the cytokine combination in this investigation was similar to a previous report (13), and was smaller than that of murine islet cells by the similar cytokine combination even after prolonged incubation for 5 days (2). most of the death of human islet cells by the triple combination could be explained by ifn/tnf combination because the addition of il-1 to the ifn/tnf combination increased human islet cell death only to a small degree, consistent with a previous paper (13). hoechst 33342 staining and electron microscopic examination showed that the death of human islet cells by ifn/tnf combination was a typical apoptosis characterized by nuclear condensation and fragmentation with preserved plasma membrane integrity (fig. these results are similar to previous reports showing nuclear condensation or tunel nuclei after cytokine treatment of human islet cells (15,16). next we asked if ifn activates stat1 and induces irf-1 which has been reported to be important for induction of tnf susceptibility in otherwise resistant murine islet cells or cancer cells (2,17). immunoblot analysis using antibody to phosphorylated stat1 showed that stat1 became activated 30 min after ifn treatment, similar to murine insulinoma cells (2) (fig. irf-1 was also induced by ifn treatment of human islet cells for 48 hrs again similar to murine insulinoma cells suggesting that stat1 activation and irf-1 induction by ifn may sensitize human islet cells to tnf-induced apoptosis, similar to the case of murine islet cell death by ifn/tnf synergism (2) (fig. these results were similar to our previous study using murine islet / insulinoma cells and suggests the possibility that intracellular signal activated by ifn may sensitize otherwise resistant human pancreatic islet cells to tnf-induced apoptosis, which could not be proved because of shortage of human islet cells, the absence of immortalized human islet cells and unavailability of genetic manipulation system. a recent paper has shown that bim, a bh3-only proapoptotic bcl-2 family member, is induced in human islets or rat islet cells after treatment with ifn+tnf which plays an important role in -cell death by ifn+tnf synergism (18). in that model, bim induction was attributed to ifn-induced activation of stat1 which was bound to bim promoter (18). while detailed biochemical and cellular mechanism of human islet cell death by cytokines could not be investigated further because of limited availability of human islets for diabetes research, our results suggest that the death of human islet cells is basically similar to that of murine islet cells. | fasl, perforin, tnf, il-1 and no have been considered as effector molecule(s) leading to -cell death in autoimmune diabetes. however, the real culprit(s) of -cell destruction have long been elusive despite intense investigation. previously we have suggested ifn/tnf synergism as the final effector molecules in autoimmune diabetes of nod mice. a combination of ifn and tnf but neither cytokine alone, induced classical caspase - dependent apoptosis in murine insulinoma and pancreatic islet cells. ifn treatment conferred susceptibility to tnf-induced apoptosis on otherwise resistant murine insulinoma cells by stat1 activation followed by irf-1 induction. here we report that ifn/tnf synergism induces apoptosis of human pancreatic islet cells. we also observed stat1 activation followed by irf-1 induction by ifn treatment in human islet cells. taken together, we suggest that ifn/tnf synergism could be involved in human islet cell death in type 1 diabetes, similar to murine type 1 diabetes. |
chronic obstructive pulmonary disease (copd) is a leading cause of death worldwide.1 its high prevalence and associated medical expenses impose large socioeconomic burdens. this is especially true in asian cities, due to high rates of smoking, outdoor or indoor air pollution including biomass fuel combustion, and exposure to occupational dusts and noxious gases.2,3 copd shows heterogeneous features that are demonstrated with the variability in symptoms, comorbidities, and exacerbations.4,5 the heterogeneity of copd may be due to the variations in genetic influences and environmental exposures among which exposures to biomass fuels and dusty jobs were reported to be related with the development of copd in asia.6,7 therefore, to assess the heterogeneity of copd, it would be reasonable to compare the exposure history of biomass fuels and dusty jobs, demographic characteristics, and clinical characteristics of copd patients from different cities or regions. the asian network for obstructive lung disease (anold)8 is a group of collaborative researchers studying the heterogeneous characteristics of asian copd patients. we have evaluated the history of exposure to biomass fuels and dusty jobs, respiratory symptoms, health - related quality of life, comorbidities, and respiratory medications in copd patients from seven cities in asia. we also examined the relations of respiratory symptoms, severe airflow limitation, and poor quality of life to the exposure to biomass fuels and dusty jobs. we hypothesized that biomass fuel exposure or dusty job exposure would be related to increased risks of respiratory symptoms, severe airflow limitation, and poor quality of life in copd patients. this was a cross - sectional observational study involving copd patients from seven asian cities. patients underwent simple chest radiography and pre- and post - bronchodilator spirometry and were administered questionnaires about respiratory symptoms ; exposure to tobacco smoking, biomass fuels, and dusty jobs ; health - related quality of life ; comorbidities ; and respiratory medication during a single visit. this study was approved by the institutional review board at every participating center, and all study participants provided written informed consent. copd patients were recruited between september 2009 and september 2010 at the pulmonary clinics in seven asian cities : beijing, china ; colombo, sri lanka ; penang, malaysia ; quezon city, philippines ; sapporo, japan ; seoul, korea ; and taipei, taiwan. the japanese data were obtained from the hokkaido copd study;9 the korean data were obtained from a korean cohort of obstructive lung disease named the kold cohort.10 ten clinics or hospitals in or near sapporo, eleven in or near seoul, and only one in other asian cities participated in the recruitment of patients. the above seven cities were chosen as they were the location of the authors study group, the asian network for obstructive lung disease. all copd patients were of asian ethnicity, aged 40 years and had post - salbutamol forced expiratory volume in 1 second / forced vital capacity (fev1/fvc) ratio < 0.7. smokers were defined as individuals with a history of cigarette smoking for at least 10 pack - years, whereas nonsmokers were defined as individuals with a lifetime history of < 100 cigarettes. patients were excluded if they had a history of asthma, bronchiectasis, tuberculosis, or other concomitant respiratory diseases. patients with old healed tuberculosis with sequelae not associated with cavities or destroyed lung, but associated both with the extent of radiological lesion not extending beyond one lobe territory and with the above defining criteria of copd were included. patients were also excluded if they were in an exacerbated state but they were allowed to participate one month after an exacerbation. patients were also excluded if they had a history of prior lung surgery including lung volume reduction, uncontrolled cancer, or radiation therapy to the chest, mediastinum, or breast. the standardized questionnaires assessed respiratory history and symptoms, smoking history, family history, health - related quality of life, comorbidities, and current respiratory medications. these questionnaires included a modified version of the american thoracic society division of lung diseases respiratory epidemiology questionnaire, charlson comorbidity conditions and the st george s respiratory questionnaire (sgrq). questionnaires were administered by interviewers.1113 cigarette smoking was evaluated using the question, have you ever smoked cigarettes ? (no means less than 100 cigarettes in your life). biomass fuel exposure was evaluated using the question, for cooking and/or heating, have you ever been exposed to biomass fuels such as wood, agricultural crop residues, animal dung, charcoal, and others ? exposure to a dusty job was evaluated using the question, have you ever worked for 1 year or more at any dusty job ? paternal (or maternal) smoking was evaluated with the question, was your father (or mother) ever a cigarette smoker ? cough was evaluated using the question, do you usually have a cough ? (excluding clearing of the throat), and phlegm was evaluated with the question, do you usually bring up phlegm from your chest ? chronic bronchitis was defined as both cough and phlegm for over 3 consecutive months for a period of more than 2 years.14 wheeze was evaluated with the question, have you ever had wheezing or whistling in your chest ? dyspnea was evaluated using the modified medical research council dyspnea grade.15 current medications were evaluated using the question, at present, do you use medications to treat your breathing problems ? if the subject answered yes, he or she was asked to choose specific medication(s). spirometry was performed as proposed by the american thoracic society / european respiratory society (ats / ers) task force.16 for post - bronchodilator spirometry we used 200 g of salbutamol with a spacer. we used various spirometric machines (chestac ; chest mi inc, tokyo, japan ; masterscreen pulmonary function test [pft ] ; carefusion corporation, san diego, ca ; vmax encore 22 ; carefusion corporation ; koko spirometry ; pulmonary data services inc, louisville, co ; quark pft 4 ; cosmed, rome, italy), each of which was calibrated daily. quality control of spirometry was performed at the center of each city and also monitored at the coordination center at asan medical center, seoul, korea. at each center the same personnel performed spirometry using the same spirometry machine which was calibrated daily with syringe. the reference equations for spirometry were developed from corresponding local populations for japan and korea, or adopted from european populations for the other countries.1720 body mass index (bmi) was calculated as the patient s weight in kilograms divided by the square of the height in meters. underweight was defined as bmi < 18.5 kg / m2 and overweight as bmi 25 kg / m.21 the chi - square or kruskal wallis test was performed for the evaluation of variation in patients characteristics among the seven asian cities. multiple logistic regression analysis was performed to evaluate whether the risk factor of biomass fuel (or dusty job) exposure was associated with respiratory symptoms after the adjustment for age, sex, global initiative for chronic obstructive lung disease (gold) stage, cigarette smoking, exposure to dusty jobs (or biomass fuels), and city. all statistical analyses were performed with spss version 18.0 software (ibm corporation, armonk, ny). this was a cross - sectional observational study involving copd patients from seven asian cities. patients underwent simple chest radiography and pre- and post - bronchodilator spirometry and were administered questionnaires about respiratory symptoms ; exposure to tobacco smoking, biomass fuels, and dusty jobs ; health - related quality of life ; comorbidities ; and respiratory medication during a single visit. this study was approved by the institutional review board at every participating center, and all study participants provided written informed consent. copd patients were recruited between september 2009 and september 2010 at the pulmonary clinics in seven asian cities : beijing, china ; colombo, sri lanka ; penang, malaysia ; quezon city, philippines ; sapporo, japan ; seoul, korea ; and taipei, taiwan. the japanese data were obtained from the hokkaido copd study;9 the korean data were obtained from a korean cohort of obstructive lung disease named the kold cohort.10 ten clinics or hospitals in or near sapporo, eleven in or near seoul, and only one in other asian cities participated in the recruitment of patients. the above seven cities were chosen as they were the location of the authors study group, the asian network for obstructive lung disease. all copd patients were of asian ethnicity, aged 40 years and had post - salbutamol forced expiratory volume in 1 second / forced vital capacity (fev1/fvc) ratio < 0.7. smokers were defined as individuals with a history of cigarette smoking for at least 10 pack - years, whereas nonsmokers were defined as individuals with a lifetime history of < 100 cigarettes. patients were excluded if they had a history of asthma, bronchiectasis, tuberculosis, or other concomitant respiratory diseases. patients with old healed tuberculosis with sequelae not associated with cavities or destroyed lung, but associated both with the extent of radiological lesion not extending beyond one lobe territory and with the above defining criteria of copd were included. patients were also excluded if they were in an exacerbated state but they were allowed to participate one month after an exacerbation. patients were also excluded if they had a history of prior lung surgery including lung volume reduction, uncontrolled cancer, or radiation therapy to the chest, mediastinum, or breast. the standardized questionnaires assessed respiratory history and symptoms, smoking history, family history, health - related quality of life, comorbidities, and current respiratory medications. these questionnaires included a modified version of the american thoracic society division of lung diseases respiratory epidemiology questionnaire, charlson comorbidity conditions and the st george s respiratory questionnaire (sgrq). questionnaires were administered by interviewers.1113 cigarette smoking was evaluated using the question, have you ever smoked cigarettes ? (no means less than 100 cigarettes in your life). biomass fuel exposure was evaluated using the question, for cooking and/or heating, have you ever been exposed to biomass fuels such as wood, agricultural crop residues, animal dung, charcoal, and others ? exposure to a dusty job was evaluated using the question, have you ever worked for 1 year or more at any dusty job ? paternal (or maternal) smoking was evaluated with the question, was your father (or mother) ever a cigarette smoker ? cough was evaluated using the question, do you usually have a cough ? (excluding clearing of the throat), and phlegm was evaluated with the question, chronic bronchitis was defined as both cough and phlegm for over 3 consecutive months for a period of more than 2 years.14 wheeze was evaluated with the question, have you ever had wheezing or whistling in your chest ? dyspnea was evaluated using the modified medical research council dyspnea grade.15 current medications were evaluated using the question, at present, do you use medications to treat your breathing problems ? if the subject answered yes, he or she was asked to choose specific medication(s). spirometry was performed as proposed by the american thoracic society / european respiratory society (ats / ers) task force.16 for post - bronchodilator spirometry we used 200 g of salbutamol with a spacer. we used various spirometric machines (chestac ; chest mi inc, tokyo, japan ; masterscreen pulmonary function test [pft ] ; carefusion corporation, san diego, ca ; vmax encore 22 ; carefusion corporation ; koko spirometry ; pulmonary data services inc, louisville, co ; quark pft 4 ; cosmed, rome, italy), each of which was calibrated daily. quality control of spirometry was performed at the center of each city and also monitored at the coordination center at asan medical center, seoul, korea. at each center the same personnel performed spirometry using the same spirometry machine which was calibrated daily with syringe. the reference equations for spirometry were developed from corresponding local populations for japan and korea, or adopted from european populations for the other countries.1720 body mass index (bmi) was calculated as the patient s weight in kilograms divided by the square of the height in meters. underweight was defined as bmi < 18.5 kg / m2 and overweight as bmi 25 kg / m.21 the chi - square or kruskal wallis test was performed for the evaluation of variation in patients characteristics among the seven asian cities. multiple logistic regression analysis was performed to evaluate whether the risk factor of biomass fuel (or dusty job) exposure was associated with respiratory symptoms after the adjustment for age, sex, global initiative for chronic obstructive lung disease (gold) stage, cigarette smoking, exposure to dusty jobs (or biomass fuels), and city. all statistical analyses were performed with spss version 18.0 software (ibm corporation, armonk, ny). between september 2009 and september 2010, we recruited 922 copd patients from pulmonology clinics of seven cities in asia : 70 in beijing, china ; 268 in sapporo, japan ; 173 in seoul, korea ; 92 in penang, malaysia ; 109 in quezon city, philippines ; 110 in colombo, sri lanka ; and 100 in taipei, taiwan. we observed a variation of characteristics of the patients with copd collected from the seven asian cities in terms of possible exogenous causes, lung function, clinical symptoms (dyspnea score, presence of chronic bronchitis), health - related quality of life, comorbidities, and history of lung problems including exacerbations (figure 1 and table 1 ; p value < 0.001 for all analyses). overall mean age was 68.2 years (standard deviation 8.5 years) and 864 of the subjects (93.7%) were male. we found that 296 patients (32.1%) had a history of exposure to biomass fuels and 412 (44.7%) had an occupational history of dusty jobs. the prevalence of biomass exposure differed from city to city throughout asia, ranging from 0% in sapporo, japan, to 97.2% in quezon city, philippines. biomasses included wood (85.0%), charcoal (8.7%), and agricultural crop residues (4.2%). of the 922 copd patients, 201 (21.8%) had symptoms of chronic bronchitis and 693 (75.2%) had wheeze. mean bmi was 22.1 kg / m2, mean predicted post - bronchodilator fev1 was 54.7% and mean total sgrq score was 37.5. the proportion of copd patients with underweight and overweight were 19.4% and 20.5%, respectively. of the copd patients, 43 (4.7%) had no history of cigarette smoking and 879 (95.3%) were cigarette smokers. among them 222 (24.1%) were current cigarette smokers and 657 (71.3%) were past smokers (table 2). we found that 63.9% of these patients had fathers who smoked and that 16.7% had mothers who smoked. we found that 8.8% and 8.5% of the copd patients had a history of diabetes mellitus and ulcer disease, respectively, and that 3.6% and 3.5% had a history of myocardial infarction and cerebrovascular disease, respectively. of the copd patients, 81.8% reported that they were currently using medications to treat breathing problems. of these patients, 38.7% were using theophylline, 37.6% an inhaled long - acting muscarinic antagonist, 35.1% an inhaler containing a combination of a corticosteroid and a long - acting beta - agonist, and 32.0% an inhaled short - acting beta - agonist. respiratory symptoms, including cough, phlegm, wheeze, and dyspnea, were more frequent in those copd patients with a history of exposure to biomass fuels than without and in those with a history of exposure to dusty jobs than without (table 3). for some of the symptoms, these relationships remained even after the adjustment for age, sex, gold stage, cigarette smoking, biomass fuel exposure, dusty job exposure, and city (table 4). multivariable analysis showed that, for biomass fuel exposure, the odds ratios (ors) of cough, phlegm, wheeze, and dyspnea were 1.11 (95% confidence interval [ci ] : 0.721.72), 1.39 (95% ci : 0.852.26), 1.37 (95% ci : 0.822.27), and 1.08 (95% ci : 0.701.66), respectively, and, for dusty job exposure, the ors of these symptoms were 1.47 (95% ci : 1.012.14), 1.77 (95% ci : 1.162.69), 1.51 (95% ci : 0.982.35), and 1.19 (95% ci : 0.811.77), respectively. airflow limitation appeared to be more severe in the copd subjects with a history of exposure to biomass fuels or dusty jobs than without (table 3). the mean of post - bronchodilator fev1 was 52.2% of predicted value versus 55.9% for the copd subjects with versus without biomass exposure ; 51.2% of predicted value versus 57.3% for the subjects with versus without dusty job exposure (both comparisons, p < 0.01). quality of life appeared to be poorer in the copd subjects with a history of exposure to biomass fuels or dusty jobs than without (table 3). the mean of the total sgrq score was 40.4 versus 36.2 for the copd subjects with versus without biomass exposure (p = 0.001) ; 41.0 versus 34.6 for the subjects with versus without dusty job exposure (p = 0.006). multivariable analysis showed that being female or in a higher gold stage was related to poor quality of life. the or of male to female was 0.48 (95% ci : 0.250.91) for poor quality of life. the ors of gold stage ii, iii, and iv to gold i were 1.8 (95% ci : 1.12.8), 4.4 (95% ci : 2.87.0), and 12.0 (95% ci : 6.024.0), respectively. between september 2009 and september 2010, we recruited 922 copd patients from pulmonology clinics of seven cities in asia : 70 in beijing, china ; 268 in sapporo, japan ; 173 in seoul, korea ; 92 in penang, malaysia ; 109 in quezon city, philippines ; 110 in colombo, sri lanka ; and 100 in taipei, taiwan. we observed a variation of characteristics of the patients with copd collected from the seven asian cities in terms of possible exogenous causes, lung function, clinical symptoms (dyspnea score, presence of chronic bronchitis), health - related quality of life, comorbidities, and history of lung problems including exacerbations (figure 1 and table 1 ; p value < 0.001 for all analyses). overall mean age was 68.2 years (standard deviation 8.5 years) and 864 of the subjects (93.7%) were male. we found that 296 patients (32.1%) had a history of exposure to biomass fuels and 412 (44.7%) had an occupational history of dusty jobs. the prevalence of biomass exposure differed from city to city throughout asia, ranging from 0% in sapporo, japan, to 97.2% in quezon city, philippines. biomasses included wood (85.0%), charcoal (8.7%), and agricultural crop residues (4.2%). of the 922 copd patients, 201 (21.8%) had symptoms of chronic bronchitis and 693 (75.2%) had wheeze. mean bmi was 22.1 kg / m2, mean predicted post - bronchodilator fev1 was 54.7% and mean total sgrq score was 37.5. the proportion of copd patients with underweight and overweight were 19.4% and 20.5%, respectively. of the copd patients, 43 (4.7%) had no history of cigarette smoking and 879 (95.3%) were cigarette smokers. among them 222 (24.1%) were current cigarette smokers and 657 (71.3%) were past smokers (table 2). we found that 63.9% of these patients had fathers who smoked and that 16.7% had mothers who smoked. we found that 8.8% and 8.5% of the copd patients had a history of diabetes mellitus and ulcer disease, respectively, and that 3.6% and 3.5% had a history of myocardial infarction and cerebrovascular disease, respectively. of the copd patients, 81.8% reported that they were currently using medications to treat breathing problems. of these patients, 38.7% were using theophylline, 37.6% an inhaled long - acting muscarinic antagonist, 35.1% an inhaler containing a combination of a corticosteroid and a long - acting beta - agonist, and 32.0% an inhaled short - acting beta - agonist. we found that 8.8% and 8.5% of the copd patients had a history of diabetes mellitus and ulcer disease, respectively, and that 3.6% and 3.5% had a history of myocardial infarction and cerebrovascular disease, respectively. of the copd patients, 81.8% reported that they were currently using medications to treat breathing problems. of these patients, 38.7% were using theophylline, 37.6% an inhaled long - acting muscarinic antagonist, 35.1% an inhaler containing a combination of a corticosteroid and a long - acting beta - agonist, and 32.0% an inhaled short - acting beta - agonist. respiratory symptoms, including cough, phlegm, wheeze, and dyspnea, were more frequent in those copd patients with a history of exposure to biomass fuels than without and in those with a history of exposure to dusty jobs than without (table 3). for some of the symptoms, these relationships remained even after the adjustment for age, sex, gold stage, cigarette smoking, biomass fuel exposure, dusty job exposure, and city (table 4). multivariable analysis showed that, for biomass fuel exposure, the odds ratios (ors) of cough, phlegm, wheeze, and dyspnea were 1.11 (95% confidence interval [ci ] : 0.721.72), 1.39 (95% ci : 0.852.26), 1.37 (95% ci : 0.822.27), and 1.08 (95% ci : 0.701.66), respectively, and, for dusty job exposure, the ors of these symptoms were 1.47 (95% ci : 1.012.14), 1.77 (95% ci : 1.162.69), 1.51 (95% ci : 0.982.35), and 1.19 (95% ci : 0.811.77), respectively. airflow limitation appeared to be more severe in the copd subjects with a history of exposure to biomass fuels or dusty jobs than without (table 3). the mean of post - bronchodilator fev1 was 52.2% of predicted value versus 55.9% for the copd subjects with versus without biomass exposure ; 51.2% of predicted value versus 57.3% for the subjects with versus without dusty job exposure (both comparisons, p < 0.01). quality of life appeared to be poorer in the copd subjects with a history of exposure to biomass fuels or dusty jobs than without (table 3). the mean of the total sgrq score was 40.4 versus 36.2 for the copd subjects with versus without biomass exposure (p = 0.001) ; 41.0 versus 34.6 for the subjects with versus without dusty job exposure (p = 0.006). multivariable analysis showed that being female or in a higher gold stage was related to poor quality of life. the or of male to female was 0.48 (95% ci : 0.250.91) for poor quality of life. the ors of gold stage ii, iii, and iv to gold i were 1.8 (95% ci : 1.12.8), 4.4 (95% ci : 2.87.0), and 12.0 (95% ci : 6.024.0), respectively. we have shown here that there were variations of copd patients from seven asian cities in the exposure history to biomass fuels and dusty jobs and also in respiratory symptoms. the symptoms were more frequent, airflow limitation was more severe, and quality of life was poorer in those copd patients with a history of exposure to biomass fuels than without and those with a history of exposure to dusty jobs than without. our findings suggest that both biomass fuel exposure and dusty job exposure might contribute to copd morbidity in asian cities. in this study symptoms of copd, cough, phlegm, wheeze, and dyspnea were more frequent in the copd patients with a history of exposure to biomass fuels or dusty jobs than without. among the symptoms, cough and phlegm were more frequent in copd patients with exposure to dusty jobs even after the adjustment for age, sex, gold stage, cigarette smoking, exposure to biomass fuels, and city. these findings suggest that exposure to dusty jobs might impose bronchitis symptoms in the copd patients, most of whom were past or current cigarette smokers in this study. we found that the proportion of copd subjects exposed to biomass fuels differed from city to city in asia, with a range from 0% to 97.2%. biomass exposure in women (44.8% = 100 26/58) was higher than that in men (31.3% = 100 270/864) (table 3). although men s exposure to biomass fuels appeared to be less than women s, men s exposure percentage of 31% was also considerable, which suggests that biomass fuel exposure may be important for men as well as for women. exposure to biomass fuels has been reported to be an important risk factor for the development of copd in both asian and non - asian cities.22,23 similar to previous findings, we found that 32.1% of our copd subjects had been exposed to biomass combustion,24 and that this exposure may be related to respiratory symptoms. this finding is in agreement with a report showing the development of respiratory symptoms in indians using domestic cooking fuels.23 in sapporo, no patient had an exposure history of biomass fuels. they did not use biomass fuels at all as energy resources because oil and/or gas supply by the local government or by private companies were almost perfect in all areas throughout japan including sapporo. exposure to dusty jobs has been reported to be a risk factor for the development of copd.24 in addition to having a role in the development of copd, these jobs were associated with an increase in respiratory symptoms in patients with copd in our study. our findings therefore emphasize the importance of asking for history about exposure to dusty jobs, as well as cigarette smoking and biomass fuels, when examining copd patients in asia. of our copd subjects, 8.8%, 8.5%, 3.6%, 4.3%, and 3.5% had histories of diabetes mellitus, ulcer disease, myocardial infarction, peripheral vascular disease, and cerebrovascular disease, respectively. the prevalence of diabetes mellitus in the general populations of asia - pacific regions has been reported to range from 3.7% to 13.3%.25 in addition, the prevalence of diabetes mellitus may not differ between individuals with and without copd. for example, the prevalence of diabetes mellitus in individuals in saskatchewan, canada, with and without copd has been reported to be 14.5% and 12.4%, respectively.26 the prevalence of ulcer disease in our study was comparable to the 8.5% previously reported,27 and the prevalence of myocardial infarction and cerebrovascular disease in our study was comparable to previous findings.26,28 we found that 38.7%, 35.1%, 32.0%, and 37.6% of our copd patients were taking theophylline, an inhaler containing a combination of a corticosteroid and a long - acting beta - agonist, an inhaled short - acting beta - agonist, or an inhaled long - acting muscar - inic antagonist, respectively. the various combinations of these treatments may differ within asian countries and also differ to those used in western countries. theophyl - line was the most prevalent and appears to be higher than in western countries,29 perhaps due to its relatively low cost. the copd patients were recruited not with random or systematic sampling but with convenient sampling, which inherently has a potential limitation of selection bias. thus, the data in this manuscript may not accurately represent the cities of asian countries. despite the potential limitation of selection bias, this study provides a meaningful profle of copd patients characteristics in seven asian cities. secondly, the percentage of females was low in our study, perhaps due to the relatively low percentage of asian females who smoke cigarettes.2 besides the low percentage of cigarette smokers in females of these countries, there might be other possibilities why the female copd subjects were very low in percentage. it would be less likely that asian women may be referred to subspecialty clinics for copd because biomass exposure is relatively unknown as a risk factor and also less likely that asian women will consent to participate in clinical studies. another possibility would be that health care might be less accessible for asian women. because this study is a clinic - based cross - sectional study, there seem to be several sorts of selection biases that might influence the characteristics of copd patients. future population - based studies could reveal the reasons why the percentage of women copd patients was so low in asian referral clinics. thirdly, the questions for biomass fuel exposure and dusty job exposure have not been validated yet. further study with a validated questionnaire is needed to confirm our findings. on the contrary, the questions of cough, phlegm, and wheeze were adopted from the american thoracic society division of lung diseases respiratory epidemiology questionnaire that was validated as were the charlson comorbidity conditions and the sgrq.1113 finally, it is difficult to draw a definite conclusion with this study of a cross - sectional design. a follow - up study is needed to draw a confirmative conclusion from our findings. despite these possible limitations, our study showed that the characteristics of asian copd patients might differ from city to city in asia, and might also differ from those of western copd patients. the copd patients were recruited not with random or systematic sampling but with convenient sampling, which inherently has a potential limitation of selection bias. thus, the data in this manuscript may not accurately represent the cities of asian countries. despite the potential limitation of selection bias, this study provides a meaningful profle of copd patients characteristics in seven asian cities. secondly, the percentage of females was low in our study, perhaps due to the relatively low percentage of asian females who smoke cigarettes.2 besides the low percentage of cigarette smokers in females of these countries, there might be other possibilities why the female copd subjects were very low in percentage. it would be less likely that asian women may be referred to subspecialty clinics for copd because biomass exposure is relatively unknown as a risk factor and also less likely that asian women will consent to participate in clinical studies. another possibility would be that health care might be less accessible for asian women. because this study is a clinic - based cross - sectional study, there seem to be several sorts of selection biases that might influence the characteristics of copd patients. future population - based studies could reveal the reasons why the percentage of women copd patients was so low in asian referral clinics. thirdly, the questions for biomass fuel exposure and dusty job exposure have not been validated yet. further study with a validated questionnaire is needed to confirm our findings. on the contrary, the questions of cough, phlegm, and wheeze were adopted from the american thoracic society division of lung diseases respiratory epidemiology questionnaire that was validated as were the charlson comorbidity conditions and the sgrq.1113 finally, it is difficult to draw a definite conclusion with this study of a cross - sectional design. a follow - up study is needed to draw a confirmative conclusion from our findings. despite these possible limitations, our study showed that the characteristics of asian copd patients might differ from city to city in asia, and might also differ from those of western copd patients. the characteristics of copd patients in asian cities are various and a history of exposure to biomass fuels or dusty jobs was related to more frequent symptoms, severe airflow limitation, and poor quality of life. | background and objectiveschronic obstructive pulmonary disease (copd) is responsible for significant morbidity and mortality worldwide. we evaluated the characteristics of stable copd patients in the pulmonology clinics of seven asian cities and also evaluated whether the exposure to biomass fuels and dusty jobs were related to respiratory symptoms, airflow limitation, and quality of life in the copd patients.methodsthis cross - sectional observational study recruited 922 copd patients from seven cities of asia. the patients underwent spirometry and were administered questionnaires about their exposure to cigarette smoking, biomass fuels, and dusty jobs in addition to respiratory symptoms and health related quality of life.resultsof the patients, there appeared to be variations from city to city in the history of exposure to biomass fuels and dusty jobs and also in respiratory symptoms of cough, phlegm, wheeze, and dyspnea. these symptoms were more frequent in those copd patients with a history of exposure to biomass fuels than without and those with a history of exposure to dusty jobs than without (p < 0.01 for all comparisons). airflow limitation was more severe in those copd patients with a history of exposure to biomass fuels than without (52.2% predicted versus 55.9% of post - bronchodilator forced expiratory volume in 1 second [fev1 ], p = 0.009) ; quality of life was poorer in those with exposure to biomass fuels than without (40.4 versus 36.2 of the st george s respiratory questionnaire [sgrq ] total score, p = 0.001). airflow limitation was more severe in those copd patients with a history of exposure to dusty jobs than without (51.2% predicted versus 57.3% of post - bronchodilator fev1, p < 0.001) ; quality of life was poorer in those with dusty jobs than without (41.0 versus 34.6 of sgrq score, p = 0.006).conclusionin asian cities, the characteristics of copd patients vary and the history of exposure to biomass fuels or dusty jobs was related to frequency of symptoms, severe airflow limitation, and poor quality of life. |
conventional binocular rivalry occurs when different stimuli filling corresponding retinal regions in each eye promote perceptual alternations of images, in which dominance durations typically follow a gamma density function. several lines of evidence point toward multiple competition stages through the visual pathway involving eye - dependent and eye - independent mechanisms (blake & logothetis, 2002 ; tong, meng, & blake, 2006 ; wilson, 2003), although the relative contribution of both mechanisms is still debated. attention modulates rivalry dynamics (e.g., dieter & tadin, 2011 ; paffen & alais, 2011), and recent evidence suggests that it might play an important role in allowing competition to take place (brascamp & blake, 2012). the effect of selective attention on binocular rivalry is commonly evidenced by enhancing the relative predominance of the attended stimulus (chong, tadin, & blake, 2005 ; meng & tong, 2004), although some studies have also reported a decrease in predominance of the unattended stimulus (e.g., hancock & andrews, 2007). attention modulation is likely to depend on stimulus complexity (alais, van boxtel, parker, & van ee, 2010) and to increase with ascending visual hierarchy (lee, blake, & heeger, 2007). in 1996, logothetis and coworkers reported an influential study in which observers were presented rival visual stimuli that switched between eyes at a regular and fast rate of 3 hz (i.e., every 333 ms). under this swapping paradigm, the observers experienced either perceptual periods of swapping, aligned with the effective stimulation of each eye, or, more surprisingly, perceptual stability or dominance with durations extending beyond 333 ms (logothetis, leopold, & sheinberg, 1996). the remarkably slow changes in image dominance, occurring when rival flickering stimuli are swapped between each eye, refer to the so - called stimulus rivalry. although restricted to some spatial and temporal frequencies (lee & blake, 1999), these slow changes show similar characteristics with exclusive image alternations, as found in conventional binocular rivalry (logothetis., 1996). more specifically, they exhibit similar unimodal, asymmetric distribution of relative phase durations with a fast growth and long tail gamma distribution fitting. furthermore, similar changes in mean duration dominance are observed when the strength of one of the rival stimuli is manipulated. stimulus rivalry is thought to be solved at eye - independent levels (freeman, 2005 ; leopold, & logothetis, 1999 ; logothetis., 1996 ; wilson, 2003). in the current study, we tested the hypothesis that attention increases image predominance during stimulus rivalry under a swapping paradigm, and that attention modulation varies as a function of the spatial characteristics of the stimuli. to this end, we used, similarly to bonneh, sagi, and karni (2001), two different sizes of stimuli that may determine the level of processing at which rivalry occurs : large orthogonal gratings designed to elicit the receptive fields of extrastriate areas, and small orthogonal gratings to preferentially involve early visual processing (see methods for details). catch trials in attention conditions were first analyzed to detect subjects with potential response bias. significant differences (p <.05) between leftward and rightward ratios (perceived - time divided by displayed - time, see methods for details) were found for three participants, which were therefore excluded from the analysis. in accordance with bonneh. (2001), stimulus size resulted in distinct patterns of perception : large stimuli generated significantly longer periods of stability (leftward and rightward dominances together) than swapping, whereas the opposite pattern was found for small stimuli (figure 1). cumulative duration of stability (leftward / rightward orientation) and swapping in both passive (a) and attention (b) conditions. the following repeated - measure anova was conducted : session (passive or attention) size (1.4 or 10) percept (stability or swapping). results revealed a significant size percept interaction, f(1,8) = 37.71, p <.001, but no other interaction (session size percept : f(1,8) =.023, p =.88 ; session size : f(1,8) =.29, p =.60 ; session percept : f(1,8) =.159, p =.70) or main effect (session : f(1,8) =.01, p =.91 ; size : f(1,8) = 3.87, p =.09 ; percept : f(1,8) =.02, p =.89). of note, ambiguity periods, which corresponded to about half of the total cumulative time, did not differ between the passive and attention conditions. although no significant interaction between attention and stimulus size was not found, it is noteworthy that the attention effect tended to be higher for large stimuli (figure 2b). indeed, the cumulative time between leftward and rightward percepts was larger for large (m = 8.9, sd = 4.6) than small stimuli (m = 3.3, sd = 6.7). the lack of significant difference (t(8) = 1.98, p =.08) was likely due to the more unstable and variable percepts evoked by the small stimuli. cumulative time (s) of rightward (attended) and leftward stimuli in the passive and attention conditions per stimulus size (a b). mean normalized duration of rightward (attended) and leftward stimuli in the passive and attention conditions per stimulus size (c d). error bars represent 1 sem. to assess the effect of attention on the stimulus - cumulated dominance time, the following repeated - measure anova was conducted : session (passive or attention) size (1.4 or 10) percept (leftward or rightward) (figure 2). a significant session percept interaction was found (f(1,8) = 20.02, p <.01), as well as a significant main effect of size (f(1,8) = 42.39, p <.001) and a significant main effect of percept (f(1,8) = 8.51, p <.05). no other significant interaction (session size : f(1,8) =.69, p =.43 ; size percept : f(1,8) = 3.29, p =.11 ; session size percept : f(1,8) = 1.25 p =.30) or main effect (session : f(1,8) = 1.48, p =.26) was found (figure 2). post hoc analysis indicated higher rightward percept compared to leftward in the attention (t(8) = 4.7, p <.01), but not in the passive condition (t(8) =.19, p =.86). a further repeated - measure anova was conducted on the mean normalized duration, which allowed us to better determine whether attention also influences the unattended stimulus (figure 2). as observed for the cumulated dominance time, a significant session percept interaction (f(1,8) = 15.37, p <.01), as well as a significant main effect of percept (f(1,8) = 9.51, p <.05), was found. when both passive and attention sessions were compared, attention significantly increased the mean duration of the attended stimulus (t(8) = 2.51, p <.05), but did not change the unattended one (t(8) =.81, p =.44). figure 3 illustrates the distribution of the mean normalized duration in the passive and attention conditions. the gamma function fittings in the attention conditions have a lower peak and broader upper tail than those in the passive condition. the kolmogorov smirnov test revealed that the distributions of the attended stimulus differed significantly between the passive and the attention conditions, for both the large (d =.40, p <.001) and the small (d =.37, p <.01) stimuli. no significant difference was found for the unattended stimulus between the passive and the attention conditions, either for the large (d =.18, p =.30) or the small (d =.20, p =.46) stimuli. gamma distributions (f(x) = 1/((k))x- e-/) of normalized duration in the passive vs. attention conditions for large (a b) and small (c d) stimuli. data on the left and right sides refer to the leftward and rightward orientation stimuli, respectively. parameters of gamma distribution for large stimuli (a b) : k = 5.39, = 0.18 for leftward and k = 5.73, = 0.18 for rightward in the passive condition ; k = 5.51, = 0.21 for leftward and k = 6.97, = 0.22 for rightward in the attention condition. parameters of gamma distribution for small stimuli (c d) : k = 3.30, = 0.35 for leftward and k = 3.02, = 0.36 for rightward in the passive condition ; k = 3.73, = 0.32 for leftward and k = 6.09, = 0.25 for rightward in the attention condition. in agreement with the results of bonneh. (2001), we found different patterns of percept as a function of the stimulus size in the passive viewing condition. the same pattern was present under the endogenous attention condition, so that attending to one stimulus did not change the swapping duration or the stability as a whole. however, attention modulated the slow changes (stability periods) during stimulus rivalry by increasing the cumulated perceived time and mean dominance duration of the attended stimulus compared to the unattended one. changes in effective stimulus contrast have been suggested to account for attention control of rivalry (see paffen & alais, 2011 for review). in accordance with levelt 's (1968) second law, increasing the contrast of one rival stimulus decreases dominance durations of the other stimulus. while hancock and andrews (2007) reported a decrease in the dominance duration of the unattended stimulus, other reports (e.g., chong, tadin, & blake, 2005) found the opposite effect, i.e., an increase in the predominance of the attended stimulus with no significant change to the unattended stimulus. wilson (2003) proposed that eye - independent competitive mechanisms are recruited during stimulus rivalry because the stimulus flickering used in the swapping paradigm defeats the eye - dependent competitive stage. such an eye - independent feature of stimulus rivalry is thought to rely on high - level processing involving extrastriate areas (e.g., bonneh., 2001 ; freeman, 2005), in which the strength of the visual competition processing is likely to be higher (desimone & ducan, 1995 ; dieter & tadin, 2011). interestingly, previous reports have shown an increase of attention modulation in disentangling and prioritizing alternative percepts while ascending the hierarchy of visual processing (alais., 2010 ; lee., 2007). although no significant interaction between attention and stimulus size was found in the current study, it is noteworthy that the attention effect tended to be higher for large stimuli (figure 2b), which preferentially solicit extrastriate processing. recently, brascamp, sohn, lee, and blake (2013) challenged the notion that stimulus rivalry resides at an eye - independent level. without totally precluding binocular contribution, they proposed a model in which the slow changes in image dominance during stimulus rivalry could be explained by competition at eye - dependent (monocular) level. the model proposes two main types of orientation - tuned inhibition : inhibition between pools of neurons coding for different eyes but the same orientation, and inhibition between pools of neurons coding for the same eyes but the opposite orientation. both are characterized by different strengths and scale decays that can be unbalanced by stimuli flickering. such a stimulus - flickering imbalance tends to favor changes in ocular dominance, resulting in perception of stability periods. in this framework, stimulus rivalry and swapping rely on the same underlying mechanisms in early visual cortex, but with varying strength. if attention can affect stimulus rivalry, one could predict, according to brascamp. model (2013), an attention modulation on the swapping percept as well, either directly or indirectly through changes of ambiguity ; this was not observed here. one may argue, however, that swapping periods can not be influenced by attention since there is no stable stimulus to attend to when the images alternate at 3 hz. although this is indeed a major challenge for attention modulation, it has been reported that even an unaware stimulus can be influenced by attention (e.g., hancock and andrews, 2007 ; kaunitz, fracasso, & melcher, 2011). therefore, our findings invite future research with other designs to better assess attention modulation in stimulus rivalry as a function of eye - independent and eye - dependent processing. twelve adults were presented with different images to corresponding regions of the two eyes and were asked to indicate their perception by pressing the corresponding keys on a computer keyboard (leftward dominance, rightward dominance, or swapping), or by not pressing any key during ambiguity. similarly to logothetis. (1996), circular orthogonal gratings (45), flickering at 15 hz, were swapped between eyes at 3 hz. to favor the occurrence of exclusive stimulus rivalry, stimuli, displayed on a grey background (60 cd / m), were colored in red in one eye and in green in the other. stimulus size was either 1.4 or 10 in diameter with spatial frequencies of 5.7 or 0.8 cycles / degree, respectively, to keep the duty cycle constant. stimuli were created with psykinematix and presented through oled stereoscopic goggles (emagin z800, bellevue, wa). dioptic catch trials mimicking the time course of binocular rivalry were used in order to control / correct understanding of the task and potential response bias induced by attention instructions. perceptual - dominance durations varied according to the stimulus size from 1.6 to 3 s, whereas swapping periods ranged from 10 to 35 s for large and small stimuli, respectively. there were two catch trials in the passive viewing condition (one per type of stimulus) and four catch trials in the attention condition (two per type of stimulus). to assess the performance for each participant in the catch trials, we calculated the ratios between the perceived time and the physically displayed time for both leftward and rightward stability periods. a paired t - test between leftward and rightward duration in the attention condition was conducted for each participant. after 3 min of training, participants started the experiment, consisting of 30 trials of 60 s each split in two sessions. the first session was a passive viewing condition followed by a pause of 10 min. in the second session, observers were instructed to pay attention to the rightward stimulus (+ 45) and, once perceived, to try to maintain the percept as long as possible. the cumulative time and the mean normalized duration (in s) were used as dependent variables in the anova analyses. for each observer, normalized dominance durations were calculated by dividing the duration of each reported percept (leftward or rightward) by the mean dominance duration (all stability percepts in all viewing conditions) for that observer. gamma distribution fitting was applied to the data using mean - normalized dominance durations in accordance with the literature. all the statistical analyses were performed using spss 20 (spss inc., chicago, illinois). | stimulus rivalry refers to the sustained periods of perceptual dominance that occur when different visual stimuli are swapped at a regular rate between eyes. this phenomenon is thought to involve mainly eye - independent mechanisms. although several studies have reported that attention can increase image predominance in conventional binocular rivalry, it is unknown whether attention can specifically modulate stimulus rivalry. we addressed this question and manipulated the spatial characteristic of the stimuli to assess whether such an attention modulation could depend on visual processing hierarchy. the results showed that selective attention of stimulus rivalry significantly increased the predominance of the attended stimulus, regardless of the stimulus ' spatial characteristics. no effect was observed on the swapping percept. the findings are discussed in the context of recent models attempting to characterize stimulus rivalry between eye - dependent and eye - independent levels. |
suicide is the second leading cause of death in the 1024-year age group throughout the world.1 self - harm encompasses a wide range of behaviors and intentions on the part of individuals to harm themselves, with or without suicidal intent,2 and it has been reported that there may be up to 50100 suicide attempts or self - harm behaviors for every completed adolescent suicide.3,4 approximately 5%10% of adolescents participating in self - report surveys in schools have reported an episode of self - harm in the previous 12 months in western countries.58 adolescents who self - harm often deny or hide their suicidal ideation,9 but the existence of a plan for suicide is a poor predictor of self - harm, because many who self - harm report only fleeting ideation and no premeditated plan.10 a recent study has reported an average interval of only 10 minutes between onset of ideation and the act of self - harm.11 therefore, for the purpose of prevention of self - harm, it might not be feasible to intervene in adolescents with acute suicidal ideation, but an ongoing prevention program focusing on adolescents at potential risks of self - harm needs to be implemented. in terms of prevention, because the majority of episodes of self - harm do not lead to hospital - based care,12,13 the focus should be on a school - based evaluation and prevention program for self - harm behavior in adolescents.7 the focus should be on views not only from adolescents presenting to hospital to seek help, but also from those in the community. however, to date, research on help - seeking among adolescents who self - harm in the community has been scarce. friends and family members have been reported to be the main sources of support for adolescents who self - harm in previous studies.14,15 with regard to factors affecting help - seeking, older age,16 being in an ethnic majority,17 and a family history of self - harm were associated with an increase in help - seeking behaviors. however, to our knowledge, there have been no reports concerning help - seeking patterns among adolescents in non - western communities. the present study aims to elucidate the prevalence of poor help - seeking behavior and its associated factors in students aged 1218 years who self - harm in japan, and what resources for helping these students are available. public junior high schools with students aged 1215 years (grades 79) and public senior high schools with students aged 1618 years (grades 1012) in tsu city, mie prefecture, and kochi prefecture participated in this cross - sectional survey of psychopathology among young adolescents. both of these prefectures are located in the central region of japan, and tsu - city are the prefectural capitals. the populations of tsu city and kochi prefecture are approximately 287,000 and 796,000, respectively. parents were informed of the project by letter and asked to notify the school if they did not want their child to participate. on the day of participation, students were given the choice of opting out and not participating. each teacher reported the total number of students present and absent on the day of the survey. to highlight that the survey was anonymous, all students were provided with an envelope into which to insert and seal their completed questionnaires. ethical approval was obtained from the ethics committees at kochi medical university, mie university school of medicine, and the tokyo institute of psychiatry, japan. the questionnaire included items regarding self - harm in the previous 12 months, current help - seeking behavior, and resources used for help. the questionnaires also included items intended to address potential factors associated with self - harm and help - seeking behavior, as demonstrated in previous literature, including current suicidal thoughts, physical health, gender,7,8 living situations,15 psychotic - like experiences,18 mental health status, such as depression and anxiety,7,8 substance use,7,8,19 alcohol use,20,21 bullying,8,22 victimization,21 and interpersonal attitudes.23 in the questionnaire, self - harm behaviors in the previous 12 months were assessed using two questions. the first was have you intentionally hurt yourself within the past year ? response options were yes and no. respondents who answered yes were then asked to provide a brief written description of the actual act. based on the definition used in a previous study7 and in a comparative study of seven countries,24 self - harm was defined as an act with a nonfatal outcome in which an individual deliberately did one or more of the following : initiated behavior (eg, self - cutting, jumping from a height), which was intended to cause self - harm ; ingested a substance in excess of the prescribed or generally recognized therapeutic dose ; or ingested a noningestible substance or object. classification of the episodes as self - harm or otherwise was based on independent ratings by two researchers using these criteria. the kappa value for agreement between the two raters was 0.83 (95% confidence interval [ci ] 0.790.86). help - seeking behaviors relating to the psychological stress of problems were assessed by asking are you currently consulting anyone to discuss your psychological stress or problems ? possible responses included : no, i do not need to consult because i have no psychological stress or problems, no, i am not currently consulting anyone despite having some stress or psychological problems, and, in that students felt a need for help but did not engage in actual help - seeking behavior. when the third response was obtained, all resources for consultation were identified from a list of six potential resources for help, including friends, family members, home room teachers, school nurses, and medical or mental health professionals, such as physicians, psychiatrists or counselors. information about the presence or absence of current suicidal thoughts was collected by asking the following question : do you currently have thoughts that your life is no longer worth living ? one of four possible responses was allowed to these questions, including no, probably no, possibly yes, and yes. a response of yes was regarded as the presence of suicidal thoughts. a response of possibly yes was not classified as the presence of suicidal thoughts, because the question asked in the present study did not ask about suicidal thoughts directly (eg, the education boards of the participating schools did not permit us to ask this question. therefore, we thought that we should not regard broader range of adolescents as having suicidal thoughts in consideration of the comparability with the definition employed in western countries. psychotic - like experiences were assessed using four items adopted from the schizophrenia section of the diagnostic interview schedule for children,25 which has been used previously in a birth cohort study, and shown to contain items that are good predictors of psychotic disorders in adulthood.26 a japanese version was developed using a translation and back translation method,27 and has been used in several previous studies conducted in japan.28,29 the items were as follows : have other people ever read your thoughts ? (thoughts read) ; have you ever had messages sent especially to you through the television or radio ? (special messages) ; have you ever thought that people are following you or spying on you ? (spied upon) ; and have you ever heard voices that other people can not hear ? (heard voices)., yes, only once, and yes, more than twice. we defined yes, more than twice on at least one item as the presence of a psychotic - like experience and the others as no such experience. symptoms of depression and anxiety were assessed using the 12-item general health questionnaire (ghq-12). the ghq-12 is one of the most widely used self - report screening tools for nonpsychotic mental illnesses. the japanese version of the ghq-12 has been validated, with a cronbach s alpha coefficient of 0.83 for males and 0.85 for females, and has a corrected item - total correlation coefficient of at least 0.20 for both genders.30 a four - point scale with binary scoring (0, 0, 1, 1), known as the ghq method, was used to answer each question. answers rated as 1 were then added together to form the total score, with a range of 0 (best possible) to 12 (worst possible). subjects with a total ghq-12 score 4 were considered to have poor mental health relating to depression and anxiety, according to previous studies.31 in our questionnaire, items relating to other factors covered gender, age, living situation, and the experience of being bullied (within the previous year), bullying student peers (within the past year), violence from adults in the home (within the previous month), currently having someone to discuss psychological distress, feeling physically ill (within the previous month), feeling dissatisfied with current body weight, drinking alcohol (within the previous month), and use of recreational drugs (lifetime). items concerning victimization (being bullied and violence from adults in the home) were answered as yes or no. the items on alcohol use and use of recreational drugs were answered as not at all or once or more than once. data from all participants who provided responses to the question about self - harming behavior in the previous year were included in the analysis. prevalence of self - harm in the previous 12 months and prevalence of current help - seeking behavior were determined separately for junior and senior high school students. univariate logistic regression analyses were performed to detect associations between students with psychological problems but not seeking help and possible associated variables. crude odds ratios (ors) and 95% cis were calculated. adjusted ors and their 95% cis first, factors with p < 0.2 were entered, as in a previous study, to avoid false negatives.32 in the multivariate analyses, backward selection using the wald method was used to identify factors that were most important statistically in distinguishing the presence or absence of help - seeking behavior. prevalence of using resources for help - seeking behavior was calculated, separating students who self - harmed from those who did not. chi - square tests were used to investigate whether there was any statistically significant difference in resources used between these two groups. all statistical tests were conducted using spss version 18.0 for windows (spss inc, chicago, il). public junior high schools with students aged 1215 years (grades 79) and public senior high schools with students aged 1618 years (grades 1012) in tsu city, mie prefecture, and kochi prefecture participated in this cross - sectional survey of psychopathology among young adolescents. both of these prefectures are located in the central region of japan, and tsu - city are the prefectural capitals. the populations of tsu city and kochi prefecture are approximately 287,000 and 796,000, respectively. parents were informed of the project by letter and asked to notify the school if they did not want their child to participate. on the day of participation, students were given the choice of opting out and not participating. each teacher reported the total number of students present and absent on the day of the survey. to highlight that the survey was anonymous, all students were provided with an envelope into which to insert and seal their completed questionnaires. ethical approval was obtained from the ethics committees at kochi medical university, mie university school of medicine, and the tokyo institute of psychiatry, japan. the questionnaire included items regarding self - harm in the previous 12 months, current help - seeking behavior, and resources used for help. the questionnaires also included items intended to address potential factors associated with self - harm and help - seeking behavior, as demonstrated in previous literature, including current suicidal thoughts, physical health, gender,7,8 living situations,15 psychotic - like experiences,18 mental health status, such as depression and anxiety,7,8 substance use,7,8,19 alcohol use,20,21 bullying,8,22 victimization,21 and interpersonal attitudes.23 in the questionnaire, self - harm behaviors in the previous 12 months were assessed using two questions. the first was have you intentionally hurt yourself within the past year ? response options were yes and no. respondents who answered yes were then asked to provide a brief written description of the actual act. based on the definition used in a previous study7 and in a comparative study of seven countries,24 self - harm was defined as an act with a nonfatal outcome in which an individual deliberately did one or more of the following : initiated behavior (eg, self - cutting, jumping from a height), which was intended to cause self - harm ; ingested a substance in excess of the prescribed or generally recognized therapeutic dose ; or ingested a noningestible substance or object. classification of the episodes as self - harm or otherwise was based on independent ratings by two researchers using these criteria. the kappa value for agreement between the two raters was 0.83 (95% confidence interval [ci ] 0.790.86). help - seeking behaviors relating to the psychological stress of problems were assessed by asking are you currently consulting anyone to discuss your psychological stress or problems ? possible responses included : no, i do not need to consult because i have no psychological stress or problems, no, i am not currently consulting anyone despite having some stress or psychological problems, and, in that students felt a need for help but did not engage in actual help - seeking behavior. when the third response was obtained, all resources for consultation were identified from a list of six potential resources for help, including friends, family members, home room teachers, school nurses, and medical or mental health professionals, such as physicians, psychiatrists or counselors. information about the presence or absence of current suicidal thoughts was collected by asking the following question : do you currently have thoughts that your life is no longer worth living ? a response of possibly yes was not classified as the presence of suicidal thoughts, because the question asked in the present study did not ask about suicidal thoughts directly (eg, the education boards of the participating schools did not permit us to ask this question. therefore, we thought that we should not regard broader range of adolescents as having suicidal thoughts in consideration of the comparability with the definition employed in western countries. psychotic - like experiences were assessed using four items adopted from the schizophrenia section of the diagnostic interview schedule for children,25 which has been used previously in a birth cohort study, and shown to contain items that are good predictors of psychotic disorders in adulthood.26 a japanese version was developed using a translation and back translation method,27 and has been used in several previous studies conducted in japan.28,29 the items were as follows : have other people ever read your thoughts ? (thoughts read) ; have you ever had messages sent especially to you through the television or radio ? (special messages) ; have you ever thought that people are following you or spying on you ? (spied upon) ; and have you ever heard voices that other people can not hear ?, yes, only once, and yes, more than twice. we defined yes, more than twice on at least one item as the presence of a psychotic - like experience and the others as no such experience. symptoms of depression and anxiety were assessed using the 12-item general health questionnaire (ghq-12). the ghq-12 is one of the most widely used self - report screening tools for nonpsychotic mental illnesses. the japanese version of the ghq-12 has been validated, with a cronbach s alpha coefficient of 0.83 for males and 0.85 for females, and has a corrected item - total correlation coefficient of at least 0.20 for both genders.30 a four - point scale with binary scoring (0, 0, 1, 1), known as the ghq method, was used to answer each question. answers rated as 1 were then added together to form the total score, with a range of 0 (best possible) to 12 (worst possible). subjects with a total ghq-12 score 4 were considered to have poor mental health relating to depression and anxiety, according to previous studies.31 in our questionnaire, items relating to other factors covered gender, age, living situation, and the experience of being bullied (within the previous year), bullying student peers (within the past year), violence from adults in the home (within the previous month), currently having someone to discuss psychological distress, feeling physically ill (within the previous month), feeling dissatisfied with current body weight, drinking alcohol (within the previous month), and use of recreational drugs (lifetime). items concerning victimization (being bullied and violence from adults in the home) were answered as yes or no. the items on alcohol use and use of recreational drugs were answered as not at all or once or more than once. in the questionnaire, self - harm behaviors in the previous 12 months were assessed using two questions. the first was have you intentionally hurt yourself within the past year ? response options were yes and no. respondents who answered yes were then asked to provide a brief written description of the actual act. based on the definition used in a previous study7 and in a comparative study of seven countries,24 self - harm was defined as an act with a nonfatal outcome in which an individual deliberately did one or more of the following : initiated behavior (eg, self - cutting, jumping from a height), which was intended to cause self - harm ; ingested a substance in excess of the prescribed or generally recognized therapeutic dose ; or ingested a noningestible substance or object. classification of the episodes as self - harm or otherwise was based on independent ratings by two researchers using these criteria. the kappa value for agreement between the two raters was 0.83 (95% confidence interval [ci ] 0.790.86). help - seeking behaviors relating to the psychological stress of problems were assessed by asking are you currently consulting anyone to discuss your psychological stress or problems ? possible responses included : no, i do not need to consult because i have no psychological stress or problems, no, i am not currently consulting anyone despite having some stress or psychological problems, and, in that students felt a need for help but did not engage in actual help - seeking behavior. when the third response was obtained, all resources for consultation were identified from a list of six potential resources for help, including friends, family members, home room teachers, school nurses, and medical or mental health professionals, such as physicians, psychiatrists or counselors. information about the presence or absence of current suicidal thoughts was collected by asking the following question : do you currently have thoughts that your life is no longer worth living ? one of four possible responses was allowed to these questions, including no, probably no, possibly yes, and yes. a response of yes was regarded as the presence of suicidal thoughts. a response of possibly yes was not classified as the presence of suicidal thoughts, because the question asked in the present study did not ask about suicidal thoughts directly (eg, the education boards of the participating schools did not permit us to ask this question. therefore, we thought that we should not regard broader range of adolescents as having suicidal thoughts in consideration of the comparability with the definition employed in western countries. psychotic - like experiences were assessed using four items adopted from the schizophrenia section of the diagnostic interview schedule for children,25 which has been used previously in a birth cohort study, and shown to contain items that are good predictors of psychotic disorders in adulthood.26 a japanese version was developed using a translation and back translation method,27 and has been used in several previous studies conducted in japan.28,29 the items were as follows : have other people ever read your thoughts ? (thoughts read) ; have you ever had messages sent especially to you through the television or radio ? (special messages) ; have you ever thought that people are following you or spying on you ? (spied upon) ; and have you ever heard voices that other people can not hear ?, yes, only once, and yes, more than twice. we defined yes, more than twice on at least one item as the presence of a psychotic - like experience and the others as no such experience. symptoms of depression and anxiety were assessed using the 12-item general health questionnaire (ghq-12). the ghq-12 is one of the most widely used self - report screening tools for nonpsychotic mental illnesses. the japanese version of the ghq-12 has been validated, with a cronbach s alpha coefficient of 0.83 for males and 0.85 for females, and has a corrected item - total correlation coefficient of at least 0.20 for both genders.30 a four - point scale with binary scoring (0, 0, 1, 1), known as the ghq method, was used to answer each question. answers rated as 1 were then added together to form the total score, with a range of 0 (best possible) to 12 (worst possible). subjects with a total ghq-12 score 4 were considered to have poor mental health relating to depression and anxiety, according to previous studies.31 in our questionnaire, items relating to other factors covered gender, age, living situation, and the experience of being bullied (within the previous year), bullying student peers (within the past year), violence from adults in the home (within the previous month), currently having someone to discuss psychological distress, feeling physically ill (within the previous month), feeling dissatisfied with current body weight, drinking alcohol (within the previous month), and use of recreational drugs (lifetime). items concerning victimization (being bullied and violence from adults in the home) were answered as yes or no. the items on alcohol use and use of recreational drugs were answered as not at all or once or more than once. data from all participants who provided responses to the question about self - harming behavior in the previous year were included in the analysis. prevalence of self - harm in the previous 12 months and prevalence of current help - seeking behavior were determined separately for junior and senior high school students. univariate logistic regression analyses were performed to detect associations between students with psychological problems but not seeking help and possible associated variables. crude odds ratios (ors) and 95% cis were calculated. adjusted ors and their 95% cis first, factors with p < 0.2 were entered, as in a previous study, to avoid false negatives.32 in the multivariate analyses, backward selection using the wald method was used to identify factors that were most important statistically in distinguishing the presence or absence of help - seeking behavior. prevalence of using resources for help - seeking behavior was calculated, separating students who self - harmed from those who did not. chi - square tests were used to investigate whether there was any statistically significant difference in resources used between these two groups. all statistical tests were conducted using spss version 18.0 for windows (spss inc, chicago, il). of the 138 junior and 36 senior high schools invited, 47 (34%) junior and 30 (83%) senior high schools participated in the study. of 19,436 students in the relevant classes invited to participate, 18,638 were approached at school (798 were absent), of whom 18,250 agreed to contribute to the survey. of these, 18,104 students (93.1% of all students in the relevant classes), 8620 junior and 9484 high school students returned the questionnaire. of the junior high school students, 190 (100 boys and 90 girls, 2.2% of total) did not provide data on self - harm and 243 senior high school students (91 boys and 152 girls, 2.6% of total) also did not provide self - harm data. details of the characteristics of those who self - harmed have been published elsewhere.33 data from 8430 junior and 9241 senior high school students who responded to the question about presence or absence of self - harm were included in the analysis. a history of self - harm in the previous 12 months was reported by 276 of 8430 (3.3%, 46 boys and 230 girls) junior high school students and by 396 of 9241 (4.2%, 65 boys and 331 girls) senior high school students. of these, 271 of 276 junior (98.2%) and 383 of 396 senior (96.7%) high school students provided data on the presence or absence of help - seeking behavior. the number of adolescents who had psychological stress or problems but were not currently consulting anyone (poor help - seeking) was 110 of 271 (40.6%) in junior and 144 of 383 (37.6%) in senior high school students (table 1). in univariate analysis, having no one to discuss psychological distress with was the strongest risk factor associated with poor help - seeking, with ors of 9.51 in junior and 9.57 in senior high school students. other variables having a statistically significant association with poor help - seeking behavior in both groups included current suicidal ideation (or 3.05 for junior ; 3.31 for senior), poor mental health (2.68 and 4.93, respectively) and feeling ill within the previous month (1.76 and 1.58). risk factors strongly associated with self - harm, such as female gender, psychotic - like experiences, and being bullied, were not associated with poor help - seeking behavior. multivariate logistic regression showed that having no one to discuss psychological distress with was most strongly associated with poor help - seeking behavior, both in junior (or 9.16, ci 4.5518.43, p < 0.0005) and in senior (or 9.94, ci 5.5217.92, p < 0.0005) high school students, after adjusting for possible confounders (table 2). other variables having a statistically significant association with poor help - seeking included poor mental health related to depression and anxiety (or 2.30 for juniors and 6.65 for seniors) and current suicidal ideation (1.97 and 1.90, respectively). for adolescents who reported having psychological stress or problems and consulting others for help currently (2364 juniors and 3107 seniors), resources for help are presented separately for students who self - harmed and those who did not (figure 1). the most common source of help sought by adolescents for psychological distress was friends (approximately 75% of juniors and 80% of seniors contacted friends), with no differences between adolescents who self - harmed and those who did not. the second most common source was family members in all groups, but adolescents who self - harmed were significantly less likely to approach family members than those who did not self - harm (29% versus 46% for juniors, p < 0.0005 ; 23% versus 36% for seniors, p < 0.0005). in both school groups, adolescents who self - harmed were significantly more likely to contact school nurses (10% versus 5% in juniors, p = 0.017 ; 7% versus 3% in seniors, p = 0.005), physical or mental health professionals, such as physicians, psychiatrists, or counselors (14% versus 3% for juniors, p < 0.0005 ; 10% versus 3% for seniors, p < 0.0005), and other sources. a history of self - harm in the previous 12 months was reported by 276 of 8430 (3.3%, 46 boys and 230 girls) junior high school students and by 396 of 9241 (4.2%, 65 boys and 331 girls) senior high school students. of these, 271 of 276 junior (98.2%) and 383 of 396 senior (96.7%) high school students provided data on the presence or absence of help - seeking behavior. the number of adolescents who had psychological stress or problems but were not currently consulting anyone (poor help - seeking) was 110 of 271 (40.6%) in junior and 144 of 383 (37.6%) in senior high school students (table 1). in univariate analysis, having no one to discuss psychological distress with was the strongest risk factor associated with poor help - seeking, with ors of 9.51 in junior and 9.57 in senior high school students. other variables having a statistically significant association with poor help - seeking behavior in both groups included current suicidal ideation (or 3.05 for junior ; 3.31 for senior), poor mental health (2.68 and 4.93, respectively) and feeling ill within the previous month (1.76 and 1.58). risk factors strongly associated with self - harm, such as female gender, psychotic - like experiences, and being bullied, were not associated with poor help - seeking behavior. multivariate logistic regression showed that having no one to discuss psychological distress with was most strongly associated with poor help - seeking behavior, both in junior (or 9.16, ci 4.5518.43, p < 0.0005) and in senior (or 9.94, ci 5.5217.92, p < 0.0005) high school students, after adjusting for possible confounders (table 2). other variables having a statistically significant association with poor help - seeking included poor mental health related to depression and anxiety (or 2.30 for juniors and 6.65 for seniors) and current suicidal ideation (1.97 and 1.90, respectively). for adolescents who reported having psychological stress or problems and consulting others for help currently (2364 juniors and 3107 seniors), resources for help are presented separately for students who self - harmed and those who did not (figure 1). the most common source of help sought by adolescents for psychological distress was friends (approximately 75% of juniors and 80% of seniors contacted friends), with no differences between adolescents who self - harmed and those who did not. the second most common source was family members in all groups, but adolescents who self - harmed were significantly less likely to approach family members than those who did not self - harm (29% versus 46% for juniors, p < 0.0005 ; 23% versus 36% for seniors, p < 0.0005). in both school groups, adolescents who self - harmed were significantly more likely to contact school nurses (10% versus 5% in juniors, p = 0.017 ; 7% versus 3% in seniors, p = 0.005), physical or mental health professionals, such as physicians, psychiatrists, or counselors (14% versus 3% for juniors, p < 0.0005 ; 10% versus 3% for seniors, p < 0.0005), and other sources. based on data from 17,671 adolescents, approximately 40% of those who had self - harmed in the previous year were aware of their psychological stress or problems but did not seek help. after adjusting for possible confounding variables, thoughts of having no one to discuss their problems with other associated factors included poor mental health related to depression and anxiety as well as current suicidal ideation. overall, no notable differences were identified with regard to factors associated with poor help - seeking between adolescents in junior high schools and those in senior high schools. friends were first and family members were second among the most common resources sought for help in the present study. we note that the prevalence of poor help - seeking in our study is lower than the 48% found in a previous study conducted in seven western countries,34 which is within range among the countries. in terms of resources used for help, our results are similar to data reported previously.14,35,36 however, in the present study, adolescents who self - harmed were not more likely to consult family members for psychological distress than those who did not self - harm. we can not account adequately for this, but one can assume that this is probably because many adolescents fear that seeking help would create more problems for them and hurt people they cared about.14 those who self - harmed were more likely to consult school nurses, which are present in all junior and senior high schools in the japanese school system. far fewer adolescents sought help from formal services or health professionals, as reported in a previous study.36 considering accessibility and possibilities for students, we performed additional post hoc analyses focusing on school nurses. in brief, self - harm was significantly associated with a visit to the nurse s office at least twice a month in junior high school students (or 2.89, 95% ci 2.253.72, p < 0.0005), which was similar to that in senior high school students (or 3.15, 2.533.94, p < 0.0005). however, only 10.8% of junior high school students who self - harmed and made frequent visits to the nurse s office discussed their psychological distress there. similarly, only 10.6% of senior high school students discussed their psychological distress in the nurse s office. considering these findings, school - based programs including screening and education for adolescents at risk of self - harm should be developed, with information provided about resources for help. school nurses could potentially be the best resource in this regard for the following reasons. adolescents who self - harm perceive barriers to seeking help not only from outside professionals but also from family members, and use of friends as the main source of support may seem to be developmentally appropriate but this creates a paradox among young people who self - harm because of the strong direct association existing between individual and peer self - harm.37 further, self - harming behavior represents a transient period of distress,38 and the school nurse s office is generally an easy resource for students to approach for help, and where school nurses could identify students at risk of self - harm by careful observation and intervene appropriately. in terms of psychosocial interventions for adolescents who self - harm, there is a very limited evidence base in the literature.39 several effective psychosocial interventions for self - harm by experienced therapists have been reported,4042 but these resources are scarce in practice and the effectiveness of these interventions has not been reproduced in subsequent research.39 several studies have reported that school interventions provided by specialists without professional training in mental health are effective in terms of reducing the severity of depression43 and the risk of self - harm.44 the intervention was primarily delivered by school pupils in the latter study,44 so students as well as school nurses can be a useful resource for help and worthy of intervention. therapeutic assessment based on cognitive analytic therapy may also be helpful for adolescents who self - harm as part of helping them to engage in follow - up sessions45 and for global improvement among those who self - harm without nonsuicidal intent.46 the appropriateness and effectiveness of these interventions should be confirmed by replicate studies, and if evidence for these interventions is built in a rigorous manner, education of school nurses to be able to administer effective intervention should be promoted. to our knowledge, this is the largest study on help - seeking behavior among school - aged adolescents who self - harm. however, our study is not without methodological limitations. first, despite endeavoring to include as many adolescents as possible from the target population in the survey, we can not rule out the impact of absenteeism and nonresponders to the question about self - harm. it is known that self - harm is more common in those with truant behavior.47 although the response rate in our study was much higher than that in a previous one,14 it is probable that we did not include adolescents who had self - harmed in a severe way. second, help - seeking behavior was defined as consulting anyone about psychological stress or problems in the present study, whereas several previous studies have used different definitions, eg, consultation after self - harm.48 we defined help - seeking behavior as consulting anyone about psychological stress or problems because we intended to compare the frequency and source of help - seeking behavior between students who self - harmed and those who did not ; however, interpretation of help - seeking behavior among those who self - harmed may not be straightforward. third, although previous studies have reported several risk factors associated with self - harm, such as self - harm by family members and friends,5,7,8 we were not able to include these factors in our questionnaire. regrettably, we had to exclude these because the boards of the participating schools did not permit us to include such questions, on the grounds that they were intrusive in light of japanese culture, in which the preferred method of getting a message across is by artful indirect speaking and hinting at the issue. for the same reason, the question about suicidal ideation in our questionnaire (do you currently have thoughts that your life is no longer worth living ? approximately 40% of adolescents who self - harmed were aware of their psychological distress or problems, but did not seek help. adolescents who self - harmed were not more likely to consult family members than those who did not self - harm, but were more likely to consult school nurses. considering the barriers to help - seeking by adolescents who self - harm, school - based mental health intervention may be needed, including screening for school students at risk, and education of school nurses in the prevention of self - harm. | background : the aim of this study was to determine the prevalence of and factors associated with poor help - seeking among adolescents who self - harm and to explore the resources used for help.methods:a cross - sectional survey using an anonymous questionnaire was conducted in 47 junior and 30 senior high schools in japan. adolescent self - harm was defined as an adolescent who had harmed himself or herself in the previous year, as in previous studies reported in western countries. poor help - seeking was defined as not consulting anyone despite reporting current psychological or somatic complaints. information about sociodemographic and psychological factors possibly associated with help - seeking, such as suicidal thoughts, depression, anxiety, and psychotic - like experiences, was also collected. regression analyses were performed to examine associated factors.results:a total of 18,104 students (8620 aged 1215 years, 9484 aged 1518 years), accounting for 93% of all students in the relevant student classes, participated in the study. two hundred and seventy - six (3.3%) junior and 396 (4.3%) senior high school students reported having self - harmed. of these, 40.6% of adolescents in junior and 37.6% in senior high schools were classified as poor help - seeking. poor help - seeking with regard to self - harm was significantly more common in those who reported not having consulted anyone about psychological problems (odds ratio 9.2, 95% confidence interval 4.618.4 in juniors ; odds ratio 9.9, confidence interval 5.517.9 in seniors) and in those with current suicidal ideation (odds ratio 2.0, confidence interval 1.03.7 in juniors ; odds ratio 1.9, confidence interval 1.13.4 in seniors). family members were approached significantly less often as a resource for help by students who self - harmed than by those who did not, and school nurses were more often consulted by those who did self-harm.conclusion:around 40% of adolescents who self - harmed in the previous year did not seek help. school - based mental health should screen students at risk of self - harm, and educate school nurses about preventative care. |
in all living organisms, the non - protein - coding regions of genomes are host to a high density of functional elements, including regulatory dna sequences, transcription terminators and attenuators, riboswitches and wide variety of non - coding rna genes such as srp rna, rnase p rna or regulatory rnas. most bacterial genomes are thought to harbor in the order of a hundred small regulatory rnas (srnas) and a larger number of riboswitches, t - boxes and regulatory leader elements located in the 5 regions of mrna genes (cis - encoded rnas). traditionally, genome annotation processes have focused mostly on protein - coding genes and ignored these elements, to the point that the notion of white spaces between coding sequences are now being intensely scrutinized for regulatory elements and non - coding rna (ncrna) genes. early ncrna gene finders used the higher gc contents and supposed propensity for secondary structure formation of rnas to identify potential ncrna genes (1). however, as soon as complete genomes were available in sufficient numbers, these approaches were superseded by comparative genomics, which proved much more powerful in discriminating functional elements from comparative genomics reveals thousands of conserved elements in the intergenic regions of even small bacterial genomes. however, these elements are not always ncrnas and biologists need specific computational tools to discriminate ncrnas from other classes of functional elements or noise. the first of these tools was qrna (2) that uses pairwise sequence alignments to distinguish structural rnas from protein - coding segments by seeking mutational patterns consistent with a base - paired secondary structure or with a coding sequence. another program, rnaz (3), uses a multiple sequence alignment to classify conserved segments into ncrna / non - ncrna, based on the detection of significant conserved secondary structure and base - pair covariation. a more recent ncrna detection procedure, srnapredict / sipht (4), was developed specifically for bacteria and combines intergenic sequence conservation to the detection of rho - independent transcription terminators (rit). there is no gold standard for declaring a conserved non - coding sequence an rna gene, a cis - encoded rna, a dna - level element or a mere sequence comparison artifact. both qrna and rnaz assume that functional ncrnas adopt conserved secondary structures. however, some bacterial srnas may act independently of a specific secondary structure (5). however, a significant fraction of bacteria prefer other termination mechanisms and, even in those that favor rits, many genes use rho - dependent termination or are part of operons and therefore are not followed directly by a terminator. there is thus a strong need for methods that can analyze all non - coding genome elements independently of associated secondary structures. we have introduced nucleic acid phylogenetic profiling (napp) as a method for the classification of intergenic conserved non - coding elements (cnes) in bacterial genomes (6). napp involves collecting all cnes and cdss in a reference species and seeking homologous sequences in all other available species. cnes and cdss are then clustered based on the similarity of their occurrence profiles. applying this procedure to several bacterial genomes, we observed that actual ncrna genes and cis - acting rnas tend to strongly cluster together. we inferred that unidentified cnes in these clusters were good candidates for rna genes or elements, and experimentally confirmed this for a set of staphylococcus aureus candidates. we since applied napp to the identification of rna genes in bacillus subtilis (7) and improved the pipeline in several respects (see below). to this date, however, distributing napp results to a wider community has proven difficult due to the relative complexity of napp outputs and the quickly expanding bacterial genome set. the current version of the database covers 1017 species including 949 bacteria and 68 archaea. a significant change to the napp pipeline since its first publication relates to the definition of cnes. in the original napp procedure, we identified cnes as segments of variable length with a minimal conservation ratio, computed from local blast (8) alignments against other genomes. this presented two drawbacks : first, it discarded any region with conservation lower than a defined cutoff, which was problematic as we know many rnas are poorly conserved. we were interested in a more precise definition of cnes that would handle domains with different evolutionary histories as independent entities. to address this, we developed a tiling procedure where each intergenic region of the reference genome is divided into 50 nt, non - oriented tiles overlapping by 25 nt. all genes and intergenic tiles are submitted to the same clustering procedure. here, we define as gene any protein- or rna - coding element provided in genbank annotation files, i.e. protein - coding genes we align each tile / gene from the reference organism against a set of 1069 bacterial / archaeal genomes (obtained from the ncbi server in mid-2010) using ncbi blastn 2.2.15 (parameters : w 7 e 0.01). the highest bit score obtained against each genome is normalized by the blastn score of the sequence against itself. the phylogenetic profile of each tile / gene is thus a vector of 1069 normalized scores. profiles are clustered using the k - means method (r package) with parameters : pearson distance and k = 50. to identify ncrna - rich clusters, we blast all tiles in a cluster (parameters : w 5 e 0.001) against the rfam - full 10.0 database (9). each cluster is assigned an rna enrichment p - value using fisher 's exact test (r package) based on counts of rna and clusters with a fisher 's p < 0.05 are considered as rna - rich. we measure gene ontology (go) term enrichments of rna - rich clusters based on their protein - coding gene contents. we convert the gi numbers of protein - coding genes into uniprot ids and then into go terms using the appropriate ebi conversion tables. we measure terms enrichment in rna - rich clusters using a fisher 's exact test. species that fail to produce rna - rich clusters are mostly archaea, endosymbionts (buchnera, carsonella and mycoplasma) and other bacteria with unusually compact genomes (supplementary table s1), suggesting that these species contain fewer rna genes and elements than average. there are in average 4.3 rna - rich clusters per species containing altogether 1330 tiles. for ncrna prediction purposes, we combine all tiles separated by < 100 nt into contigs, independent of their cluster of origin (contigs are not oriented). this procedure produces an average of 643 contigs per genome, or 179 contigs / mbase of genomic sequence (supplementary table s2). a large fraction of contigs (49.5%) are composed of a single tile (supplementary table s3). as could be intuitively expected, large contigs are more likely to represent actual rnas than short ones. contigs made of four tiles or more are four times as likely to match rfam rnas than single - tile contigs (corrected for size, supplementary table s3, last column). the ncrna prediction accuracy of napp was recently benchmarked (10) along with the three other comparative genomics methods : srnapredict / sipht, rnaz and eqrna. the benchmark used a test set of 776 srnas from 10 bacterial species, including 132 rnas from rfam and the others from rna - seq and tiling array experiments. napp was generally more sensitive (higher recall rate) but less specific (more false positive predictions) than other methods. as srnapredict had the best overall accuracy (weighting both sensitivity and specificity), we further compare napp with this method below. averaged over all genomes, srnapredict finds 25 rna loci / mb (4) while napp finds 179 rna loci / mb (supplementary table s1). while this explains in part the higher reported specificity of srnapredict [12% versus 4% for napp (10) ], it should be noted that specificity is notoriously difficult to evaluate in this case (10) as many false positives may turn out to be expressed in rare conditions. furthermore, napp predictions include a significant number of ncrnas lacking a rit that are thus excluded by srnapredict. this comprises a large fraction of riboswitches and other mrna leaders that use translational attenuation instead of premature termination, and most of the srna predictions in genomes with low rit usage. rit usage is low overall in actinobacteria as well as in a number of isolated spirochaetes, cyanobacteria, alphaproteobacteria or firmicutes. these genomes were not sampled in the benchmark (10), with the exception of caulobacter crescentus. we tested 21 genomes with a reportedly low rit usage (11) and observed a dramatic decrease in the number of srnapredict loci for these genomes, from 25/mb in average to 2/mb in the low rit set, while the number of napp predictions remains stable at 159/mb versus 179/mb in average (supplementary tables s4 and s5). interestingly, these rit - poor genomes have nearly no rna annotated and few rfam hits besides housekeeping rnas and crispr loci, which suggests napp predictions may be a rich source of rna discovery in these species. it should be noted that napp also predicts rnas in archaea (which do not contain rit), at an average density of 142/mb (supplementary table s2). an underlying hypothesis in phylogenetic profiling is that genes or elements co - occur because they contribute to the same cellular function (12). we noted in our initial study that many ncrnas tend to cluster with housekeeping genes. we later identified a cluster of b. subtilis elements enriched in sporulation genes and containing a novel srna gene expressed during sporulation (7). to enable this kind of analysis, we built go term bias analysis into the napp server. the most frequent go terms biases in rna clusters (supplementary table s6) are related to housekeeping functions, such as translation (ribosome, translation, translational elongation, etc.) and energy metabolism (proton transport, nadh dehydrogenase, atp hydrolysis, atp synthesis, etc.). this enrichment is intriguing as it suggests a co - evolution of certain rnas and rna - binding proteins ; however, it is more likely a consequence of an over - representation of rna - binding activities among housekeeping functions. patchy phylogenetic profiles, such as the one shown in figure 1b (first column) for escherichia coli strain o127 h6. these profiles are often associated to plasmid or transposon - borne elements that are horizontally transmitted across distant bacteria. (a) rna - rich clusters table : for each cluster, the table provides cluster number, total number of elements, number of annotated genes, number of tiles, number of known ncrnas (rfam) and p - value of ncrna enrichment. (b) profile page : each column represents the average phylogenetic profile of all members of an rna - rich cluster. there are as many lines as species in the database (at present 1017). shaded / white squares indicate that members of this cluster have / do not have homologs in this species. contigs are produced by aggregating all overlapping or adjacent tiles from rna - rich clusters. columns indicate contig number, genbank i d. of chromosome, tiles forming contig (the cluster number of each tile is indicated in parentheses as c.1, c.2, etc.) and rfam annotation. (d) context view : from the contig or cluster views, users can visualize tiles or contigs in their genomic context through links to the ncbi genome server. rna - rich clusters table : for each cluster, the table provides cluster number, total number of elements, number of annotated genes, number of tiles, number of known ncrnas (rfam) and p - value of ncrna enrichment. (b) profile page : each column represents the average phylogenetic profile of all members of an rna - rich cluster. there are as many lines as species in the database (at present 1017). shaded / white squares indicate that members of this cluster have / do not have homologs in this species. contigs are produced by aggregating all overlapping or adjacent tiles from rna - rich clusters. columns indicate contig number, genbank i d. of chromosome, tiles forming contig (the cluster number of each tile is indicated in parentheses as c.1, c.2, etc.) and rfam annotation. (d) context view : from the contig or cluster views, users can visualize tiles or contigs in their genomic context through links to the ncbi genome server. the napp database is freely available online at http://napp.u - psud.fr/. the interface is composed of the following display elements (further detail is provided in the figure 1 legend and in the online documentation). species are selected either by typing keywords or through a drop - down menu.rna-rich clusters table (figure 1a) : this is the central page for a selected species., users can enter a position range to list the elements of interest (tiles and genes) at this location, or they can access the following pages.cluster view page : this page displays the contents of an rna - rich cluster (element name, position, i d and description).profile page (figure 1b) : this page presents a graphical view of the phylogenetic profiles of rna - rich clusters, together with associated go - term biases.contig page (figure 1c) : this page displays contigs produced from adjacent tiles in all rna - rich clusters.genome context view (figure 1d) : from the cluster and contig pages, users can visualize any element (tile, gene or contig) in its genomic context using the ncbi bacterial genome browser. rna - rich clusters table (figure 1a) : this is the central page for a selected species., users can enter a position range to list the elements of interest (tiles and genes) at this location, or they can access the following pages. cluster view page : this page displays the contents of an rna - rich cluster (element name, position, i d and description). profile page (figure 1b) : this page presents a graphical view of the phylogenetic profiles of rna - rich clusters, together with associated go - term biases. contig page (figure 1c) : this page displays contigs produced from adjacent tiles in all rna - rich clusters. genome context view (figure 1d) : from the cluster and contig pages, users can visualize any element (tile, gene or contig) in its genomic context using the ncbi bacterial genome browser. for each genome, users can export tiles or contigs as csv or gff files for further analysis or visualization in a genome browser. the long - term objective of the napp project is to provide biologists with comprehensive information on cnes in bacterial and archaeal genomes. while the current implementation focuses on the subset of elements that co - evolve with known non - coding rnas, many non - coding elements harbor distinct phylogenetic profiles that are not captured by this procedure. furthermore, current napp clusters can be very large (up to several thousand tiles and genes) and may combine tiles and genes with slightly, albeit significantly, different profiles that would benefit from a more detailed examination. for instance, the sporulation cluster, we identified in b. subtilis (7) is actually part of cluster # 2 for this species that is enriched in housekeeping terms (ribosome, the sporulation subcluster is visible only through visual inspection of a hierarchical clustering tree, which is not permitted with the current interface. a more comprehensive and interactive analysis of complete clustering trees should lead both to improved functional classification and to the recovery of additional non - coding elements that are currently discarded from napp clusters. agence nationale pour la recherche (grant anr-2010-blan-1602 - 01) duplex - omics. funding for open access charge : agence nationale pour la recherche, france. | nucleic acid phylogenetic profiling (napp) classifies coding and non - coding sequences in a genome according to their pattern of conservation across other genomes. this procedure efficiently distinguishes clusters of functional non - coding elements in bacteria, particularly small rnas and cis - regulatory rnas, from other conserved sequences. in contrast to other non - coding rna detection pipelines, napp does not require the presence of conserved rna secondary structure and therefore is likely to identify previously undetected rna genes or elements. furthermore, as napp clusters contain both coding and non - coding sequences with similar occurrence profiles, they can be analyzed under a functional perspective. we recently improved the napp pipeline and applied it to a collection of 949 bacterial and 68 archaeal species. the database and web interface available at http://napp.u-psud.fr/ enable detailed analysis of napp clusters enriched in non - coding rnas, graphical display of phylogenetic profiles, visualization of predicted rnas in their genome context and extraction of predicted rnas for use with genome browsers or other software. |
public health consequences of neurological and mental disorders, such as alzheimer 's disease (ad), bipolar disorder, or schizophrenia (sz) are enormous. yet, critical needs for reliable biomarkers for early detection and prognostic prediction of such disorders are still unmet (kubicki., 2007 ; macdonald and schulz, 2009 ; pettersson - yeo., 2011). the purpose of this article is to review different data mining, machine learning, and statistical techniques that can help unearth neurological - disease relevant biomarkers using data from imaging studies. since, the neuroimaging community has also been contributing to the development of informatics tools for biomarker discovery, the techniques reviewed include those that the neuroimaging community already uses as well. all these techniques could further improve the complex biomarker discovery process with eventual use in clinical setting. neuroimaging technologies such as volumetric mri, functional mri (fmri) and diffusion tensor imaging (dti) are in wide use to indirectly estimate altered cortical tissue, functional and physical connections in neuropsychiatric disease states (honey., 2009 ; park., 2008). volumetric mri measures the cortical thickness of a region, whereas fmri and dti allow one to construct a brain network for a subject where each defined region (e.g. dorsolateral prefrontal cortex, ca1 region in hippocampal) in the brain is termed as a node and a functional / physical connection (e.g. frontal - hippocampal connectivity) is termed as an edge (bullmore and bassett, 2011 ; sporns, 2011). the volumetric features or the edges measured from fmri or dti, referred to as these features can be binary (representing a healthy volume of a region, or the presence or absence of a connection) or weighted (indicating volume or strength of a connection). features of the brain measured from multiple subjects are then used to predict a phenotype of interest (ragland., 2007). phenotypes can be symptoms such as cognition, depression or mania, or a disease diagnosis such as sz (drevets and todd, 2005). a set of features that show different properties in different subgroups of the phenotype is referred to as a biomarker in the rest of this paper. in the case of a binary biomarker, the set of features could be (mostly) present in subjects of one group and not present in the subjects of the other group, and in the case of a continuous biomarker they could have high values in one group and low values in the other group. research in neuroimaging data has focused on exploring the hypothesis that mental disorders manifest due to the loss of cortical tissue or altered connectivity in the brain, i.e., reduction in the temporal lobe volume, aberrant connectivity within the default network or attention network that in turn disrupts cognitive functions (fornito and harrison, 2012 ; stephan., 2009). a vast majority of these studies (jafri., 2008 ; focus on discovering the features that individually show a different degree of volume or neural connectivity in disease subjects when compared with healthy subjects. while insightful, this direction of research has not yet yielded any conclusive causal factors for major mental disorders. first, the large number of individual factors, such as thousands of edges, makes it difficult to find statistically significant single markers without sufficiently large study samples. in particular, multiple hypothesis testing resulting from the enormous number of potential hypotheses increases the chances of statistical errors, i.e., mistaking spurious patterns for real ones. second, the complexity of the diseases being considered makes it unlikely that meaningful predictive patterns can be found by only looking at individual factors and largely ignoring their interrelations. third, many diseases are heterogeneous by nature, i.e., patients with a particular disease may form different subgroups, and biomarkers appropriate for one subgroup may not apply to another. given the inability of many commonly used analytic techniques to handle these challenges (statistical significance, disease complexity, and disease heterogeneity), it is no surprise that even when statistically significant biomarkers are found by one group in one study, they are rarely reproduced in follow - up studies by other groups or sometimes by even the same group (kubicki. research in biomarker discovery from neuroimaging data is at a crucial juncture where the field is beginning to acknowledge the need for complex multivariate analysis based techniques instead of currently used univariate analysis to capture the complex mechanisms underlying disease. existing clinical studies demonstrate that there is an increase in predictive power for models built using a combination of imaging features when compared to that of single (bressler and menon, 2010 ; westman., 2013 ; wolz., existing studies also show that although sz is widely treated as a single phenotype, there exist two different subgroups of subjects (those with good outcome and those with poor outcome) that exhibit different structural properties in the brain (mitelman., 2003 ; nenadic., 2012) for example, subjects with poor outcome had significantly smaller temporal and occipital lobe gray matter volumes (mitelman., 2003). these observations in early clinical studies (bressler and menon, 2010 ; westman., 2013 ; wolz., 2011) show the need to design computational methods that can be used to mine complex biomarkers. there are several ways of defining complex biomarkers that are relevant to a neuropsychiatric disease. for example, a simultaneous reduction in volumes of multiple regions, or loss of a set of edges (e.g., left frontal hippocampal connectivity) could result in a disease, even though a reduction in volume of one region or a loss of one edge (e.g., left frontal hippocampal connectivity alone) does not result in a disease. (2011)) have shown that models built using a combination of features result in more predictive power than univariate approaches. in contrast, it is possible that an fmri study of a disease might find hundreds of edges altered when compared to controls, of which only the loss of a specific subset of edges might cause changes to the functional network structure that result in disease. likewise, it is also possible that only the loss of a set of edges that belong to a specific functional group (e.g., executive network) may result in loss of executive functioning in a disease such as sz or geriatric depression. we refer to the edge sets belonging to a functional group as brain pathways. exploring such complex types of alterations in biomarker data could potentially improve the reproducibility and statistical power of imaging studies. this paper presents a set of techniques that attempt to identify complex biomarkers that may manifest in any of the above scenarios. we define four types of complex biomarkers (and analytic techniques) based on different interesting combinations discussed above : (i) linear biomarkers, (ii) combinatorial biomarkers, (iii) pathway biomarkers, and (iv) network biomarkers. several techniques developed in data mining, machine learning, and genomic data analysis communities can be helpful in discovering these four different types of biomarkers by overcoming some of the known challenges. a similar classification scheme for biomarkers has been used in genomic studies (ayers and cordell, 2010 ; chuang., 2007 ; fang., 2012a ; holden., 2008). a number of existing studies have analyzed neuroimaging data sets obtained from multiple technologies such as fmri, dti, and pet data collected on the same set of subjects to study group differences. however, in this manuscript we focus on only those studies that analyze one type of neuroimaging data set. given a dataset of features (structural information, edges in anatomic or functional networks) obtained from the brain of several subjects and a continuous valued phenotype of interest for these subjects (e.g., cognition, psychosis ratings), a linear biomarker is a weighted sum of the features that is predictive of the phenotype. the computational problem here is the estimation of the weights such that the weighted sum is most predictive of the phenotype. a traditional approach to estimate these weights is to use a linear regression model (friedman., 2001), where the features for a set of subjects are represented as matrix x, whose rows are subjects and columns are features obtained from neuroimaging techniques, as shown in fig. the linear regression model then estimates a vector, such that y = x +, where accounts for the error. the heart of the model y = x is depicted in fig. this model is solved such that the sum of the squared error is minimized, i.e., assigns a weight to each feature in the dataset in such a way that the weighted sum of all features (x) could approximate the phenotype (y), with a minimal error (). the advantage of using linear regression based models lies in the availability of well - documented standard software. using linear regression, kubicki. (2011) showed that the gray matter volumes of superior temporal gyrus and inferior frontal gyrus, and the functional and anatomical connections between them were predictive of hallucinations in sz. note that individual correlations between each features and the phenotype did not yield any significant associations. however there are several challenges that arise when linear regression is applied to neuroimaging datasets. one challenge is high dimensionality, i.e., the large number of features in the brain, e.g., a large number of edges as a result of the large number of nodes (voxels) in the brain that are of the order of 100,000. another challenge is that only a few features (e.g., a few functional edges in the brain out of the billions of edges) are expected to be associated with a given phenotype. a traditional linear regression model generally assigns weights over all the features in an effort to find the best association plausible. although one could potentially select the features that are weighted highly by the model as relevant features for a given phenotype, it is often unclear what the right number of features is, and therefore such an approach could result in an erroneous discovery of associated features. a variant of linear regression called lasso (least absolute shrinkage and selection operator) developed in the machine learning and statistics domains can address the two key challenges that arise for linear biomarker discovery (friedman. lasso introduces a penalty on (in addition to the sum of squares of the elements) such that the absolute sum of all elements of is small. when this model is used to estimate using matrix x and the vector y, it results in a vector where most components are 0 's and any non - zero element could be indicative of an edge relevant to the phenotype. 1(c) shows a typical vector that results from a lasso type model, where only a few values in 0/1 are nonzero. this model allows for automatic selection of relevant edges without having to choose a parameter for the number of features as in the case of a general linear regression model. control data analysis, where there are tens to hundreds of samples and up to hundreds of thousands of genomic features like snps and gene expression (ayers and cordell, 2010 ; beck. linear biomarkers approaches have shown promise in discovering imaging features that could explain group differences in adhd (bohland., 2012), ad (liu., 2012) and neuro - cognitive deficits (bunea., 2011). (2012)used a lasso type approach to select relevant features from anatomical and functional network measures in combination with non - neuroimaging features to predict attention deficit hyperactivity disorder (adhd) in individual subjects among a group of mixed disease and controls. they noticed that the features selected from all three modalities resulted in the best performance on a test set. liu. (2012) used a lasso model with spatial constraints to find the set of imaging features (t1-weighted baseline mr brain images) that show increased prediction accuracy between ad and mild cognitive impairment. (2011) demonstrated the use of penalized least squares regression approaches to predict neuro - cognitive deficits using a dataset that comprises of dti and brain volumetric measures from hiv infected subjects. logistic and linear regression models have been previously implemented in many statistical packages such as r, sas, and matlab and are easily available for use by the scientific community for analysis. a key assumption underlying linear regression based techniques presented in the previous section is that the discovered biomarkers are valid across all the subjects in the study (i.e., disease is homogenous). however, this assumption does not always hold true, due to disease and population heterogeneity. different subsets of patients tend to have different factors that drive the phenotype of interest. for example, about 50% of patients with mild cognitive impairment (mci) are amyloid scan positive but the other 50% are not, thus suggesting that mci is a greatly heterogeneous condition. in this section, in particular, we focus on techniques from the data mining area of association analysis (agrawal and srikant, 1994 ; han., 2007 ; pang - ning., 2006), which has well developed approaches for finding patterns (biomarkers) in data sets with binary features and binary outcomes (e.g., phenotype or disease label) given a dataset of neuroimaging features such as volumetric information or functional connections (edges), this information can be translated into a set of binary features, where each feature records the presence of a characteristic of interest with a 1, e.g., a volume being high or low, or an area being active or inactive. a phenotype of interest (sz and healthy) is also represented as a binary variable, typically with a 1 indicating presence of a disease and a 0 indicating absence (a control). a combinatorial biomarker is a subset of features that are present mostly in one group of subjects. note that the combinatorial biomarker is only relevant for those subjects in which the subset of features are all present. 2(a), where a dataset x whose rows are subjects, columns are features, with values 1 (shown in black) are indicative of the presence of the features, while values 0 (shown in white) are indicative of a features absence. the grouping of subjects is represented by a column vector y, where black color indicates sz and white color indicates healthy. the submatrix a in x represents two features that are all present in a subset of four subjects and they belong to the sz group. note that there can be many combinatorial biomarkers in a given dataset. in this example, submatrix b is associated with sz and submatrices c and d are associated with healthy subjects. one could argue that the features could be discovered by individual testing and then grouped together to recover the submatrices a, b, c, and d. however, there could be scenarios where the individual features themselves are not informative about the phenotype but together they have more information about the phenotype. 2(b) are equally frequent in healthy and sz groups, however the columns in a together are present only in the sz group. therefore, such biomarkers can not be discovered using traditional linear regression type techniques or by univariate testing. combinatorial biomarkers are substantially different from linear biomarkers in that each combinatorial biomarker potentially explains a subset of subjects, whereas a linear biomarker is expected to cover all the subjects in the study. this gives combinatorial biomarkers more flexibility to capture the heterogeneous nature of the subjects and their associated signals in the data. for example, submatrices a and b cover different subsets of subjects that have the phenotype in fig. approaches for discovering combinatorial biomarkers have to explore the space of all possible combinations of edges in the brain to discover these biomarkers exhaustively (fang., 2012b). for a set of n edges the number of all possible combinations is of the order 2 1. this further leads to an additional challenge of statistical significance due to multiple hypothesis testing. when 2 1 hypotheses are tested, there is a much bigger chance for some of them to turn out to be true just by chance. therefore, the statistical significance values have to be adjusted to account for this occurrence. efficient approaches to discover combinatorial biomarkers, referred to as pattern mining techniques, have been developed in the field of data mining in the last decade (agrawal and srikant, 1994 ; han. these approaches were first designed to discover the combinations of items that are purchased together in large market basket datasets where each record (transaction) has a list of items that are purchased by one customer (agrawal and srikant, 1994 ; agrawal., 1993). the pattern mining techniques draw their efficiency from the anti - monotonicity property which guarantees that if a combination of items is not frequently purchased together then a combination that includes these items is not frequently purchased too (agrawal and srikant, 1994). this property is also referred to as the apriori principle. fig. 2(c) shows the set of all possible combinations of items (a, b, c, d) (xiong., 2006) in the form of a lattice, where each node represents one combination of items. frequent pattern mining techniques typically search this lattice depicting all possible combinations. once a combination is found to be infrequent then all combinations that are extensions of the infrequent combinations are not enumerated. in fig. 2(c), when the combination ab is found to be infrequent all its supersets are excluded from being enumerated and tested. since the early 1990 's, several efficient algorithms to explore the search space have been developed (coatney and parthasarathy, 2005 ; han. some of these algorithms have also been found to be promising in bioinformatics problems involving gene expression and protein interaction network datasets (atluri., 2000 ; pattern mining techniques for discovering combinatorial biomarkers have been proposed for gene expression datasets (fang., 2012a, 2012b), where the goal is to find combinations of genes that are all highly expressed in subjects with cancer and not expressed together in healthy subjects. these techniques have also been extended to work with continuous valued gene expression datasets (fang., 2010). the challenge of statistical power posed by the large search space of combinatorial biomarkers can be overcome by providing a false discovery rate (fdr) and retaining only those biomarkers that are robust to multiple hypothesis testing. an approach to compute fdr for biomarkers is to first use randomized datasets to discover combinatorial biomarkers and then to compare the association strength of real biomarkers with those discovered from a randomized dataset. note that this approach takes into account the multiple hypothesis testing as the combinatorial biomarkers are discovered from real and randomized datasets by exploring an exponentially large search space. bench (biclustering - driven ensemble of classifiers), developed by padmanabhan. (2012), is another combinatorial biomarker discovery approach specifically designed for highly underdetermined problems (i.e., the number of features is much higher than the number of subjects / patients). the method is specifically tailored for the cases that exhibit different discriminatory signatures between subgroups of samples without any prior knowledge about subgroupings. these combinatorial techniques would represent a novel approach to discovery of large - scale connectivity biomarkers in neuroimaging data. because these approaches were primarily designed for binarized data, potential loss of information has dissuaded its use in clinical studies. to the best of our knowledge, one reason for this is the lack of strategies to transform continuous features obtained from neuroimaging technologies to binary features that most combinatorial techniques work with. this gap needs to be addressed before new studies could reap the benefits of these approaches to explore combinations of features effectively as well as their ability to discover subgroups in disease subjects. the functionality of the brain is known to be a coordinated effort of multiple regions. for example, the brain processes sensory information with the help of a salience network that encompasses functional connections between bilateral insula and anterior cingulate cortex. some known brain subnetworks are : (i) default mode network (dmn), (ii) salience network (sn), and (iii) central executive network (cen) (lee., 2012). exploring the association of these brain subnetworks with disease will enable researchers to study the relationship between these subnetworks and their role in mental disorders. motivated by the progress of finding associations between known biological pathways and common complex diseases in genomic data analysis, we refer to these type of biomarkers as pathway biomarkers (holden., 2008 ; medina., 2009 ; subramanian., 2005 ; the fact that such biomarkers conform to existing knowledge allows investigators to interpret their role in disease. in fact, a few neuroimaging studies (calhoun., 2008 ; kim., 2010 ; ngr., 2010 ; palaniyappan., 2010 ; sun., 2009 ; white., 2010 ; woodward., 2011) have investigated the association of known subsystems with a disease and found promising results. (2011) found association of functional connections within the dmn and cen network with sz. the most common connectivity biomarker tested in ad is the dmn, which has shown direct correlations with edges of the network and cognition (hedden., 2009). there have been multiple attempts to use measures of dmn function as a biomarker for early diagnosis (e.g., greicius. (greicius, 2008)) ; however, intersubject variability is currently too high for use in individual subjects. most studies in this category typically choose a subnetwork of interest and investigate its association with the disease ; this may result in spurious findings, as the subnetworks not considered in the study could be more relevant to ad. therefore, these subnetworks should be studied in comparison with each other and not in isolation. as such, data - driven approaches to exploring multiple functional networks, such as the twelve resting state networks identified by greicius (2008), have the potential for enhanced accuracy. one simplistic approach to discover associations of brain pathways with a phenotype is to compute the significance score of association for every edge in a brain network and then test the statistical significance of association of a brain pathway based on the scores of its constituent edges. this framework is shown in fig. 3, where each edge in the brain network is referred to as a feature, and groups of features that are in known brain pathways the significance of association for a brain pathway, generally referred to as enrichment score, is obtained by comparing the distribution of association scores of its constituent edges with that of association scores from random selection of edges. a related approach to discover brain pathway associations is to first rank all edges based on their association with the phenotype and test each brain pathway if their constituent edges are all at the highly associated end of the ranking. permutation based testing can also be used to quantify the significance of the brain pathway associations. a similar approach has been pursued in genetic association studies, referred to as gene set enrichment analysis (gsea) (subramanian., 2005). several extensions of gsea and other related approaches have been proposed in the literature (holden., 2008 ; medina., 2009 ; these variations include the choice of scoring a genomic feature for association (e.g., p - values from t - test or chi - squared test), determining the enrichment score for a pathway as the minimum of p - values of the features contained in the pathway (medina., 2009) and choice in the approach for estimating the statistical significance for pathway enrichment (e.g., phenotype based permutation of feature set permutation). note that the success of this class of approaches is limited by the strength of association of individual features. a variant of lasso, group - lasso, can select a set of the edges in the dataset that are known to be part of brain subnetwork and are associated with the phenotype. group - lasso techniques select all or none of the edges from a given group when they estimate. this approach generally discovers the best brain subnetwork that is associated with the phenotype in question. moreover, it has the potential to discover combinations that can be formed by features that may not be individually associated with the phenotype in question. discriminative pattern mining techniques can also be used to discover pathway biomarkers by constraining the search space of the patterns to only those that fall under known brain pathways. this reduces the computational complexity of the pattern mining technique and can also improve the statistical significance as the number of hypotheses generated is restricted to those groups of edges that fall within known pathways. the dense (dense and enriched subgraph enumeration) (2011) is a fast and theoretically guaranteed method that could take in as input a prior knowledge defined as a set of query nodes from a brain network and enumerate all the dense subnetworks in the brain network that contain user - defined percentage of the query nodes. while this method may not be directly applicable to identifying biomarkers common to a group of subjects as it works on one network at a time, it is, however, very useful to refine biomarkers identified. if the nodes of a brain pathway can be provided as input, then a particular subject 's network could be analyzed to identify some of the peripheral nodes and edges that are associated with the biomarker that can offer more information about the subject under analysis. there are several clinical applications of pathway biomarker type approaches in the context of investigating markers for sz (mamah., 2013 ; orliac., 2013 ; tu., 2013) and bipolar disorder (mamah., 2013). (2013), studied evaluated the role of mean connectivity (obtained from resting state fmri data) of within five known neural subnetworks (default mode, fronto - parietal, cingulo - opercular, cerebellar, and salience networks) in sz and bipolar disorder. they found that the decrease in within - connectivity in cingulo - opercular subnetwork is large in degree in sz than in bipolar disorder. (2013) studied the functional connectivity within dmn and sn in sz, while tu. while these studies show the usefulness of discovering pathway biomarkers, the methodologies discussed above will provide a systematic way to discover them. neuroimaging data obtained using fmri or dti is naturally represented in the form of a network, where nodes are brain regions and edges represent connections (physical or functional) (bullmore and sporns, 2009). in this context, we define network biomarkers as features of the network that could explain group differences between healthy and disease subjects. these features could be topological characteristics of nodes, or subnetworks that have significantly different topological properties in the two groups. topological properties of brain networks have the potential to offer insights into the functionality of the brain (rubinov and sporns, 2010). an extensive number of studies have pursued the goal of studying how topological properties differentiate in healthy and subjects from those with a brain disorder (camchong., 2011 ; liu., 2008 ; lynall., 2010 ; rotarska - jagiela., 2010 table 1 presents a representative sample of these studies listing different topological properties, including degree of a node, clustering coefficient, robustness and efficiency, considered in each of these studies. (2008), demonstrating a loss of small - world properties of whole - brain networks, and modest correlation with cognitive status. in addition, this approach has been used to look at the impact of different lesion patterns (e.g., diffuse vs. hub - targeted attacks) on global metrics. given the complex nature of mental disorders such as ad and sz, subgraph approaches that focus only on portions of the network may yield more accurate correlations with the disease in question. for example, a subnetwork in the brain can show different topological properties in healthy and disease groups that can not be reflected in the individual properties of a node or an edge. for this reason, a set of nodes in a network that exhibits different topological properties in disease and healthy groups of subjects can also be treated as a network biomarker. one example is a group of nodes that are densely connected in one group of subjects compared to the other group (as shown in fig. 4). another example is a subset of nodes whose diameter in the induced subgraph is different between the two groups. yet another example is a subset of nodes that play a critical role in the connectivity (in effect functionality) of the entire system (network), i.e., removing those set of edges could affect the connectivity in one group of subjects more than the other group. these examples illustrate how network structure allows one to measure the impact of a selected set of nodes on the system (brain) as a whole and to understand the nature of connectivity within the subset of nodes to study the relationship between subgraph connectivity and the disease in question. the key difference between the above examples of network biomarkers and the pathway biomarkers is that pathway biomarkers work with known subnetworks and test for their hypothesis - driven association with disease, whereas network biomarkers find subnetworks that are associated with the disease in an unbiased manner. thus, conceptually all pathway biomarkers can be considered to be a subtype of network biomarkers. the advantage of hypothesis - driven focused pathway biomarker analyses is that the findings are bound to comply with well - studied subnetworks in the brain, are easy to interpret, and less subject to spurious findings. the disadvantage of using pathway biomarkers is that with this approach it may be impossible to find novel subnetworks that are hidden in the data but truly associated with a disease. further, many of our a priori assumptions may be wrong and in that case, searching only for known pathways may result in a confirmation bias and limit our ability to find true causes of disease. network biomarkers are appropriate in these scenarios, where a global unbiased search of the data is required. however, they are computationally more intensive given the size of the search space of all possible subnetworks. one approach to derive subgraphs in the brain network whose dysfunction resulted in the manifestation of a phenotype is to first find the edges that are associated with the phenotype individually ; construct a network of these associated edges, and discover significantly densely connected regions in this network. zalesky 's network based statistic (nbs) approach (zalesky., 2010) works in a similar fashion and it discovers the largest connected component in the network of significantly associated edges. control data analysis to identify protein networks that are associated in cancer (chuang., 2007 ; ideker and sharan, 2008 ; karni., 2009 ; the advantage of these approaches is that even when the strength of the strongly associated edges is not statistically significant, the subnetworks discovered can be statistically significant if they form a connected structure. a drawback of nbs approaches is that they can not discover subnetworks when the individual edges are not associated with the phenotype, but when they are collectively associated. for example, consider a scenario where two edges (frontal caudate and frontal amygdala) connect three brain regions (e.g., caudate, amygdala, frontal lobe) that interactively accomplish a task (mood) ; each edge by itself can not capture this synergy of all the three relevant regions and so the above mentioned approach will not find the individual edges to be associated with the task and hence the synergistic system will be missed. a suite of network biomarker discovery techniques (chen., 2012 ; padmanabhan., 2012 ; schmidt and samatova, 2009 ; schmidt., 2012) proposed in genomic data analysis can be potentially used in the context of neuroimaging datasets. schmidt and samatova (2009),-motif finder algorithm is designed to discover cliques (a subgraph where every node is connected to every other node) in an underlying network that is significantly associated with a phenotype. in order to discover general network biomarkers, beyond cliques, padmanabhan. spice (system phenotype - related interplaying components enumerator) (chen., 2012) was proposed to discover subgraphs that explain only subsets of subjects. these techniques can significantly improve the state - of - the - art in network biomarker discovery from brain networks. simpler versions of network biomarkers have been used in analyzing neuroimaging data in the past, as shown in table 1. however, the above discussed network biomarker approaches are yet to be applied to this data to discover complex variants of network biomarkers. in this manuscript we considered the nature of complex biomarkers being investigated in the recent literature and presented techniques that are designed in related areas of data mining, statistics, machine learning and bioinformatics. most of the techniques presented here have been refined for over a decade since their inception and so they can be directly applied to study the hypotheses being considered in neuroimaging studies. thus there is significant potential for advancing the state of the art in complex biomarker discovery for neuroimaging data. specifically, the current state of the art provides neuroimaging based biomarkers that are typically based on single features and are good indicators of the mental disorder after the disorder has begun for some disorders, e.g., ad (linden, 2012). however, complex neuroimaging biomarkers hold out the promise helping predict high risk subjects before a disease, can also better help understand the differences between various mental disorders, e.g., schizophrenia and bipolar, and can provide insights where several subgroups exists, e.g., schizophrenia. the techniques covered in this manuscript have demonstrated their ability to find complex biomarkers in other domains and offer a new and promising set of new tools for neuroimaging investigators. indeed, since many of these techniques have already been applied to genetic and clinical data, there is a real possibility of finding complex biomarkers spanning multimodal data, thus further enhancing the breadth and depth of our understanding of neurological disorders. | neuropsychiatric disorders such as schizophrenia, bipolar disorder and alzheimer 's disease are major public health problems. however, despite decades of research, we currently have no validated prognostic or diagnostic tests that can be applied at an individual patient level. many neuropsychiatric diseases are due to a combination of alterations that occur in a human brain rather than the result of localized lesions. while there is hope that newer imaging technologies such as functional and anatomic connectivity mri or molecular imaging may offer breakthroughs, the single biomarkers that are discovered using these datasets are limited by their inability to capture the heterogeneity and complexity of most multifactorial brain disorders. recently, complex biomarkers have been explored to address this limitation using neuroimaging data. in this manuscript we consider the nature of complex biomarkers being investigated in the recent literature and present techniques to find such biomarkers that have been developed in related areas of data mining, statistics, machine learning and bioinformatics. |
calorie restriction (cr) extends lifespan in a variety of organisms and has also been shown to ameliorate many age - associated diseases such as diabetes and cancers [13 ]. however, the molecular mechanisms underlying cr - induced beneficial effects are still not fully understood. owing to a short lifespan and well - established molecular genetic techniques, the budding yeast saccharomyces cerevisiae represents a powerful system to identify new components in cr signaling pathways and to study these factors at the molecular / genetic level. yeast lifespan can be studied in two distinct ways : replicative lifespan (rls) and chronological lifespan (cls). rls measures the number of cell divisions an individual yeast cell undergoes before senescence (division potential), whereas cls measures the length of time cells remain viable at a nondividing state (postmitotic survival). rls may serve as a model to understand the mechanisms of replicative senescence such as in stem cells, while cls may be more relevant to postmitotic cell senescence in adult animals [4, 5 ]. moderate cr can be imposed in yeast by reducing the glucose concentration from 2% to 0.5% in rich media [69 ], which extends both rls and cls. in yeast, cr is suggested to function through reducing the activities of conserved nutrient - sensing pathways. decreasing the activities of the ras - camp / pka (cyclic amp - activated protein kinase a) pathway, sch9 (homolog of mammalian s6k kinases) and tor1 kinases have been shown to mimic cr and extend lifespan [6, 10, 11 ]. the recent identification of additional cr - specific longevity genes provides further insight into the molecular mechanisms underlying cr and the resulting metabolic alterations [7, 1217 ]. the sir2 family proteins (sirtuins) are among identified cr downstream targets ; they are conserved longevity factors that were originally discovered and studied in yeast. sirtuins are nad - dependent protein deacetylases that are responsive to metabolic changes and stress and have been shown to play important roles in several cr models [3, 18, 19 ]. mitochondria have also been shown to play important roles in cr. in yeast, cr induces a shunting of carbon metabolism from fermentation to the mitochondrial tca cycle. this metabolic shift to respiration is necessary and sufficient for the activation of sir2-mediated lifespan extension in certain yeast strains. a link between cr and increased mitochondrial metabolism has also been reported in higher eukaryotes including mammals [13, 14, 2022 ]. notably, the age - dependent decline in expression of genes encoding components of the mitochondrial respiratory chain has been reported in several species [2224 ]. since mitochondria are the major sites of energy production in eukaryotic cells, these findings highlight the crucial role of energy metabolism in cr. since cr regimens involve the reduction of nutrient input, it is believed that a global change in nutrient sensing and regulatory pathways as well as changes in the mitochondrial respiratory chain are translated to physiological responses to counteract age - induced effects [2527 ]., it has been suggested that cr activates mitochondrial respiration to prevent the accumulation of toxic metabolites [2830 ]. although the mitochondrial electron transport chain is also the primary site for reactive oxygen species (ros) generation in the eukaryotic cell, increased mitochondrial electron flow during cr would be expected to reduce ros levels [3, 3133 ]. recently, cytochrome c oxidase (cox) of the mitochondrial respiratory chain has been shown to catalyze the reduction of nitrite to nitric oxide (no). when considered with the findings that the respiratory chain is involved in cr and that no has been implicated in cr, it is of interest to ask if the no involved is produced by mitochondrial cox. in order to begin to elucidate how cr modulates complex genetic and metabolic networks to alter stress resistance, genomic stability, and lifespan, it is essential to uncover additional factors in the cr pathway. towards this end, we have explored the relationship between no and cr and have identified new genes in cr. yeast strains by4742 mat his31 leu20 lys20 ura30 and the genome - wide gene deletion collections (nonessential genes) were acquired from open biosystems. medium used for replicative lifespan (rls) analysis was yep (2% bacto peptone, 1% yeast extract, 1.5% agar) supplemented with filter - sterilized glucose at a final concentration of 2% or 0.5%. medium used for chronological lifespan (cls) analysis was minimal synthetic sd (6.7 g / l yeast nitrogen base) supplemented with 4x auxotrophic amino acids (leucine, histine, uracil, and lysine) and glucose to a final concentration of 2% or 0.5%. gene deletions were made by replacing the wild - type genes with the reusable kan marker as described in and verified by polymerase chain reaction (pcr) using oligonucleotides flanking the genes of interest. different concentrations of gsno were added to yeast cells during chronological lifespan assays at different time points. gsno was made as follow : 200 l of 0.5 m gsh in 0.5 m hcl was added to 200 l of 0.5 m nano2 and then incubated at 4c in the dark. after 30 minutes, 400 l of 0.25 m naoh was added to neutralize the solution. inactivated gsno was generated by exposing gsno to uv illumination for 30 min (photolysis). diaminofluorescein - fm diacetate (kamiya biomedical) was diluted to 1 m in reaction buffer (0.2 m phosphate buffer, ph 7, 1 mm edta, 0.1% glucose) immediately prior to the assay. cells at different growth stages were harvested, washed twice, and then resuspended into 120 l of reaction buffer (0.2 m potassium phosphate buffer, ph 7, 1 mm edta, 0.1% glucose). 100 l of cell suspension was added to 100 l reaction buffer with 1 m of daf - fm da in 96-well fluorescence assay plates (~5 10 cells were analyzed in each well). after 2 hours of incubation (30c), fluorescence signals were detected using a plate reader with excitation at 485 nm and emission monitored at emission at 535 nm [36, 37 ]. cells were grown in ypd media containing either 0.5% or 2% glucose on a shaker (200 rpm) at 28c and harvested in mid - exponential phase. cells were washed twice with cold distilled water, pelleted, and kept on ice until use. nitrite - dependent no synthesis was measured essentially as described in [34, 38 ]. briefly, cells were resuspended in 2 ml pbs (ph 6.5) in an no chamber and bubbled 5 min with nitrogen. then the chamber was closed, and no production was measured at 28c after the addition of 1 mm sodium nitrite using an no electrode (amino-700, innovative instrument) as described in [34, 38 ]. no production was measured with an amino-700 nitric oxide sensor connected to an innoii nitric oxide measuring system (innovative instruments, inc). simultaneous measurement of o2 concentration in the chamber was performed by a 2 mm clark - type electrode oxy-2 (innovative instruments, inc) connected to the innoii. except where noted, all solutions were nitrite - free. measurements were performed at 28c in a final reaction volume of 2 ml, in a thermostated chamber with a close - fitting lid containing ports for the electrodes and a hamilton syringe. assays for no production by the mitochondrial respiratory chain were performed in no assay medium (6 mm succinate, 650 mm mannitol, 10 mm k2hpo4 [ph 6.5 ], 0.1 mm edta, and 10 mm kcl). except where noted, the no assay medium was prebubbled with air in order to be saturated with oxygen (200 m) prior to addition of nano2, which was added to a final concentration of 1 mm, and the measurement of no production. each mutant strain from the deletion collection (open biosystems) was inoculated into sd in 96-well plates and allowed to grow for 2 days. 4 l saturated culture was then added into 400 l fresh sd and allowed to grow for 12 hr. to prepare for no measurement, cells were spun down in 96-well plates at 3000 rcf, washed, and then resuspended into 120 l reaction buffer (0.2 m phosphate buffer, ph 7, 1 mm edta, 0.1% glucose). 100 l cell suspension was added to 100 l reaction buffer with 1 m of daf - fm da (kamiya biomedical) prealiquated in 96-well fluorescence assay plates. multiple wild - type (wt) controls grown under both normal (2% glucose) and cr (0.5% glucose) conditions were included on each 96-well plate as internal controls. average no levels of wt controls grown under normal condition (after normalized to cell number) were set to 1. no levels of the mutants were normalized to the wt controls on the same plate. we have determined the variations among different plates and different experiments to be ~20% (data not shown), which was used as the standard deviation for the initial screen. three to four single colonies derived from each strain were analyzed in each experiment as described in with a few modifications. cells were grown in 10 ml sd (at a starting od600 of 0.1) in 50 ml tubes on a roller drum set at 250 rpm to ensure proper aerations. cell viability (~2 10 cells were analyzed in each sample) was monitored every 2 - 3 days by plating a fraction of the culture onto fresh media to determine the colony - forming units (cfu). cell survival rates were calculated by normalizing the cfu of each time point to the cfu of day 0 (48 hr after starting cls, when cells just entered stationary phase). numbers on the x - axes of cls graphs denote the number of days after entering stationary phase (nonmitotic state). gsno - treated cells were grown in the dark for the first 24 hr. all rls analyses were carried out on yep agar plates supplemented with glucose at a final concentration of 2% or 0.5% with 50 cells per strain per experiment using a micromanipulator under a microscope. about 300 od600 units of yeast cells grown to different stages were harvested and homogenized in 1.5 ml lysis buffer containing 20 mm tris - hcl, ph 8, 0.5 mm edta, 0.1% np-40, 1 mm phenylmethylsulphonyl fluoride (pmsf) (sigma), and protease inhibitor tablet (roche) using a beads beater. the gsno reductase (gsnor) activity of sfa1 was determined by measuring gsno - dependent nadh consumption using fluorescence (340/460 nm) as described in in 200 l reaction buffer (200 m nadh, 20 mm tris - hcl, ph 8, 0.5 mm edta) with 15 g (total proteins) cell lysate and 0 or 200 m gsno at room temperature. the no metabolizing activity of yhb1 was determined by measuring no - dependent nadh consumption using fluorescence (340/460 nm) as described in in a 200 l reaction mix containing 200 m nadh, 20 mm tris - hcl, ph 8, 0.5 mm edta, 15 g lysate, and 0 or 300 m mahma nonoate (cayman chemical) at room temperature. the nadph - dependent no - metabolizing activity was measured by mahma nonoate - dependent consumption of nadph using fluorescence (340/460 nm) as described in in a 200 l reaction mix containing 250 m nadph, 20 mm tris - hcl, ph 8, 0.5 mm edta, 15 g lysate, and 0 or 300 m mahma nonoate at room temperature. approximately 1 kb of the cyc7 promoter was cloned into the ura3 +, pyes2.1 vector (invitrogen) using the bamhi site immediately upstream of the -galactosidase gene. for the liquid -galactosidase assay, 5 od600 units of yeast cells grown in sd w / o uracil for 18 hrs (starting od600 = 0.1) under normoxic condition were washed, lysed by bead beating in breaking buffer (100 mm tris - hcl ph 8, 20% glycerol, 1 mm dtt, 0.02% sds, 8 mm pmsf), and separated from debris by centrifugation. 50 l of lysate was then added to 450 l of z buffer (0.1 m sodium phosphate buffer ph 7, 10 mm kcl, 1 mm mgso4, 50 mm -mercaptoethanol), preincubated at 30c for 5 min, and then 100 l 4 mg / ml onpg in z buffer was added. after 1 hr incubation at 30c, the reaction was stopped with 250 l of 1 m naco3 and read at 420 nm. this reading was then normalized to protein concentration of the lysate and finally normalized to the wt 2% glucose sample. cells were first inoculated in sd (staring od600 = 0.1) and allowed to grow for 12 hrs. the arginine analogue and nos inhibitor l - name (sigma) was then added to these cells at 200 mm final concentration as previously described in. after 2 hr incubation at 30c, cells were washed and then incubated with the daf - fm da fluorescence dye to determine relative no levels as described previously. for hydrogen peroxide treatments, cells were pregrown in sd with 2% or 0.5% glucose (cr) for 20 hrs (staring od600 = 0.1) then were treated with 0.5% h2o2 for 1 hr. following this treatment, cells were plated on ypd in 5-fold serial dilutions. for gsno toxicity test, cells were pregrown in sd with 2% or 0.5% glucose (cr) or pretreated with 25 m gsno for 18 hr. after 24 hr treatment, cells were removed from the gsno - containing sd, plated on ypd in 5-fold serial dilutions, and then allowed to grow for 2 days at 30c. statistical analysis of cls was carried out using the auc method (area under the curve) [44, 45 ]. p values were calculated for each pair of lifespans as shown in supplemental table 2 (see supplementary material available online at doi : 10.4061/2011/673185). statistical analysis of rls was carried out using the jmp statistics software (sas), and the wilcoxon rank sums tests p values were calculated for each pair of lifespans as shown in supplemental table 3. all other p values were calculated using student 's t - test (two - tailed). moderate cr in yeast results in a metabolic shift from fermentation to mitochondrial respiration. in mice, cr - induced mitochondrial biogenesis was attributed to increased expression of endothelial nitric oxide synthase (enos). to further understand the role of no in cr, we determined whether cr increased no levels in yeast using an no - sensitive dye, diaminofluorescein - fm diacetate (daf - fm da). although daf - fm da is fairly specific to no and no oxidation products [36, 37 ], we further confirmed that it did not cross - react with other reactive oxygen species (such as superoxide and hydrogen peroxide) in vivo under our assay conditions (supplemental figure 1). as shown in figure 1(a), cr significantly increased no - related signals during early growth stages, while cells were actively dividing. the long - lived tor1 and hxk2 mutants [6, 11 ] also showed increased no signals (figure 1(b)). in addition, cr, tor1, and hxk2 also conferred resistance towards nitrosative stress (treatments of a physiological no donor s - nitrosoglutathione, gsno) (figure 1(c)). we next determined whether the activities of major no detoxification enzymes were increased by cr. yeast flavohemoglobin (yhb1), which catalyzes the conversion of no to nitrite or nitrous oxide, and gsno reductase (gsnor, sfa1) are the two major enzymes that protect yeast cells from nitrosative stress [40, 41, 46 ]. interestingly, yhb1 activity determined in the crude cell lysate was increased by cr (figure 1(d)), whereas sfa1 activity was not increased by cr, suggesting that yhb1 may play an important role in cr. in addition, cr also slightly induced nadph - dependent no - metabolizing activity (figure 1(d)), which has been reported in mammalian cells. together, these results demonstrate that cr - induced increases in no are not due to decreased no degradation. to identify additional components in the cr pathway, we screened the yeast deletion collection (~4500 strains) for mutants with elevated no levels similar to cr. about 157 high - no mutants were identified and ranked by no levels, growth rate, and resistance to gsno (supplemental table 1). therefore, we used these criteria to classify potential cr genetic mimics. among the top 15 hits, 5 mutants (hxt17, pkh2, gup1, hhf1, and soy1) showed extended cls and rls (table 1). hxt17 is a high - affinity hexose transporter, which may mimic cr by decreasing the activity of the glucose sensing pathways. pkh2 is a ser / thr protein kinase that activates sch9, and pkh2 is likely to behave similar to sch9, which has been shown to mimic cr. recently, pkh2 was identified as an rls - extending mutant, providing further validation for our screen. gup1 is an er membrane - localized o - acyltransferase involved in remodeling the fatty acid moiety of the gpi anchor. encodes one of two identical histone h4 proteins. depleting histone h4 has been shown to alter the expression levels of specific yeast genes including many genes that regulate energy homeostasis [50, 51 ]. soy1/aim4 is suggested to participate in mitochondrial genome maintenance ; however, its molecular function remains unclear. we next determined whether these long - lived mutants function in the same pathway as cr to extend lifespan. as expected, cr did not significantly alter cls (figures 2(a)2(d)) or rls (figures 3(a)3(d)) of most of these long - lived mutants, suggesting that these mutations might be in genes that function in the same (or overlapping) pathway to extend cls and/or rls (detailed statistical analysis of cls and rls is shown in supplemental tables 2 and 3, resp.). two notable exceptions were observed in our studies : the gup1 (figures 2(c) and 3(c)) and the soy1 (figure 3(b)) mutants. cr further increased gup1 rls (gup1 versus gup1, cr ; p =.038) and vice versa (cr versus gup1, cr ; p =.004) (figure 3(c)), suggesting a positive interaction between gup1 and cr in rls extension. in addition, although cr - induced cls was not further increased by gup1 (cr versus gup1, cr ; p =.073), the gup1 mutant exhibited longer cls under cr (gup1 versus gup1, cr ; p =.035). interestingly, cr appeared to decrease soy1-induced rls (soy1 versus soy1, cr ; p =.008) (figure 3(b)), suggesting a negative interaction between soy1 and cr. however, soy1 did not significantly change cr - induced rls (cr versus soy1, cr ; p =.49). cr appeared to extend rls more significantly when combined with hhf1 (cr versus hhf1, cr ; p =.001). however, cr did not significantly change hhf1-induced rls (figure 3(d)) (hhf1 versus hhf1, cr ; p =.19). we next determined whether these long - lived, high - no mutants displayed an increase in mitochondrial respiration similar to cr cells. as shown in figure 4(a), all of these mutants showed increased oxygen consumption, demonstrating a correlation between increased mitochondrial respiration and no production. in addition, a functional electron transport chain was required for cr - induced lifespan. cr failed to extend rls [7, 12 ] and cls (figure 4(b)) in the respiratory - deficient cyt1 mutant lacking cytochrome c1. deletion of cyt1 also eliminated the long rls (figure 4(c)) and cls (b. li and s.- j. although there is biochemical evidence that nos homologs are present in yeast, the existence of nitric oxide synthases in yeast remains controversial since no nos sequence homolog has been identified. in contrast, cytochrome c oxidase (cox) has been shown to produce no in a nitrite- (no2-) dependent manner under hypoxic conditions. therefore, the mitochondrial electron transport chain is a potential source of no production in cr cells. our results (figure 4(d)) showed that cr- and cr mimics - induced no increases were largely abolished in cells lacking cyt1. in addition, cr - induced no production was not inhibited by the nos inhibitor (arginine analog) l - name (figure 4(e)). since the cox complex was reported to produce no under hypoxic conditions, we examined whether calorie - restricted yeast cells could synthesize no under normal (normoxic) conditions. using an no - specific electrode, we verified that calorie - restricted by4742 wt () cells could produce no when grown under normoxic conditions (figure 4(f)). in contrast, calorie restriction failed to induce no production either in the by4742 (), a rho strain lacking mitochondrial dna, or in the respiratory - deficient cyt1 mutant under normoxic conditions. these findings further support the conclusion that the no synthesis in calorie - restricted yeast cells requires a functional mitochondrial respiratory chain. to explore this further, we examined the oxygen sensitivity of nitrite - dependent no synthesis by mitochondria isolated from wt cells. as shown in figure 4(g), oxygen sensitivity reported previously for nitrite - dependent mitochondrial no synthesis was reduced in mitochondria isolated from wt cells grown under cr. these results demonstrated that yeast mitochondria are capable of no synthesis at oxygen concentrations that are in the normoxic range experienced by yeast cells grown in colonies or in liquid culture. eukaryotic cells harbor both aerobic and hypoxic isoforms for several components of the electron transport chain to ensure proper electron transfer in response to different oxygen concentrations [32, 5557 ]. it has been reported that, although cox - specific no synthesis is strongly inhibited by oxygen when cox contains the aerobic isoform of subunit v (va), the oxygen inhibition is relieved when cox contains subunit vb, the hypoxic subunit v isoform. interestingly, cr increased the expression of the hypoxia inducible cytochrome c cyc7 (figure 4(h)) as well as cox5b, which encodes cox hypoxic subunit vb (p. castello and r. poyton, unpublished). therefore, cr might induce no production in part by derepressing expression of the hypoxic isoforms of mitochondrial electron transport complexes and perhaps additional hypoxia responsive genes. next, we examined the roles of no detoxification enzymes yhb1 and sfa1 in cr. cr failed to extend rls in the sfa1yhb1 mutant (figure 5(a)), indicating that yhb1 and sfa1 are required for optimal no homeostasis during cr - induced rls. deleting yhb1 partially abolished cr - induced rls (p =.03, cr versus cr, yhb1), whereas deleting sfa1 alone had no significant effect. therefore, it appeared that yhb1 and sfa1 play redundant roles under our cr / rls assay condition. the lifespan of potential cr mimics hxt17, pkh2, and hhf1 was also reduced to wt levels in the yhb1sfa1 mutant (figure 5(b)). deleting yhb1/sfa1 was not likely to prevent cr - induced rls solely by reducing mitochondrial activity. as shown in figure 5(c), cr - induced increases in oxygen consumption and no production were only partially reduced in the yhb1sfa1 mutant. interestingly, yhb1sfa1 did not abolish cr - induced cls (figure 5(d)), suggesting that additional no - detoxification enzymes and stress response factors might compensate for the loss of yhb1/sfa1 for cr - induced cls. in line with our results, it has been reported that the stress response factors such as rim15 and superoxide dismutases play important roles in cr - induced cls [9, 58 ]. we then examined whether treating cells with no donors was sufficient to mimic cr to extend lifespan. interestingly, gsno appeared to be the most effective no donor for lifespan extension among the different no donors tested (b. li and s.- j. lin, unpublished). as shown in figures 6(a) and 6(b), both a single treatment of 25 m s - nitrosoglutathione (gsno) (which caused mild growth inhibition, figure 1(c)) and multiple treatments of 5 m gsno (no growth inhibition observed) extended cls to a level similar to cr. gsno did not further increase cr - induced (figures 6(a) and 6(b)) or cr mimics - induced (figure 6(c)) cls suggesting that gsno and cr may function in the same pathway to extend cls. interestingly, gsno treatments partially rescued the short cls of the respiratory - deficient cyt1 mutant (figure 6(d)), suggesting that it may partially compensate for the loss of respiration or may also confer some respiration - independent beneficial effects. however, gsno treatment (25 m) did not appear to have an impact upon rls (b. li and s.- j. lin, unpublished) ; this could be an effect of gsno instability in the plate - based rls assay. since cr confers resistance to various stresses, we examined whether gsno might mimic cr by increasing stress resistance. as shown in figure 6(e), cells pretreated with a low dose of gsno were more resistant to gsno - induced toxicity. pretreatment of gsno also slightly increased the resistance to hydrogen peroxide compared to calorie - restricted cells (figure 6(f)). therefore, gsno may extend cls in part by increasing stress responses, possibly via inducing hormesis effect. interestingly, not all of the high - respiration activity cr genetic mimics examined showed increased resistance towards hydrogen peroxide (figure 6(f)), although these mutants all showed increased resistance towards gsno (supplemental table 1). it is possible that different mutants only partially mimic cr by activating a different subset of stress response pathway. calorie restriction (cr) extends longevity and ameliorates age - related diseases in many organisms. understanding how cr induces these beneficial effects may therefore provide insights into the molecular mechanisms underlying age - associated diseases. considerable progress has been made in the discovery of genes / proteins and metabolites that affect longevity. uncovering additional long - lived cr - mimicking mutants will likely contribute to the understanding of the molecular mechanisms of cr. to identify new components in the cr pathway, we developed a nitric oxide- (no-) based screen for mutants that showed higher intracellular levels of no as potential cr mimics. nine of the top 17 high - no mutants summarized in table 1 show a positive correlation between increased mitochondrial respiration and no production. these nine mutants showed increased oxygen consumption (9 out of 17) and increased cls and/or rls. in addition, mutants that showed both extended rls and cls (5 out of 17) all showed increased oxygen consumption as well as no levels (table 1). two mutants (avl9 and tps1) that did not show either extended cls or rls also did not show increased oxygen consumption. however, it is noteworthy that 5 long - lived mutants (with extended rls or cls) did not possess increased oxygen consumption. although cr cells have increased no levels, a higher intracellular no concentration is not sufficient to extend lifespan under all growth conditions and/or genetic backgrounds. for example, the avl9 and tps1 mutants have higher no levels but do not show increased lifespan (table 1). it is possible that increases in the stress response as well as functional mitochondria are also required for no - induced lifespan extension. supporting this model, our results showed that treating the respiratory deficient cyt1 mutant with gsno only partially restored its cls (figure 6(d)). in addition, it has been shown that several stress response factors play important roles in cls and cr - induced cls in s. cerevisiae [9, 33 ]. in schizosaccharomyces pombe, the stress - responsive map kinase sty1 was demonstrated to be essential for cr - mediated cls extension. no detoxification enzymes yhb1 and sfa1 appear to play an important role in cr - induced rls (figure 5(a)) but not cls (figure 5(d)). one possible explanation is that perhaps actively dividing cells are more susceptible to cr - induced no stress. in line with this model, cr increases no more significantly in early growth stages during which most cells were still actively dividing (figure 1(a)). yhb1 and sfa1 are dispensable for cr - induced cls, which may be due to the fact that other no metabolizing factors and/or stress response factors play more important roles in cr - induced cls. interestingly, the sfa1yhb1 double mutant (under non - cr conditions) showed decreased no levels (figure 5(c)) suggesting that functional no detoxification is required to support no production in yeast cells. these results highlight the differences in sensitivity towards no production and detoxification activities for cr - induced rls and cls. it is possible that yeast rls and cls have different sensitivities towards certain no metabolites such as peroxynitrite. peroxynitrite is formed by the reaction of no with superoxide, both of which can be produced by the electron transport chain. it is possible that during replicative aging, superoxide detoxification is not as efficient, making no scavenging more important. during chronological aging, the high activity of superoxide dismutases can maintain consistently low levels of superoxide, compensating for the lack of no scavenging. supporting this possibility, several stress response factors including superoxide dismutase activities have been reported to be upregulated during cls [9, 33, 58 ]. in addition, lower levels of superoxide have also been observed in calorie - restricted yeast cells during cls. transcription factors associated with respiration (hap4), stress response (msn2), and a map kinase important in osmoregulation (hog1) can drive the expression of yhb1 [61, 62 ], sfa1 [63, 64 ], or both and may regulate increased rls and resistance to nitrosative stress during cr. our results indicate that cox is a major source of no production under cr (figure 7) because deleting components of the electron transport chain in the rho (figure 4(f)), cyt1 (figures 4(d) and 4(f)), and cox (b. li and s.- j. lin, unpublished) mutants largely abolishes cr - induced no production and increased longevity (figures 4(b) and 4(c)). moreover, gsno treatments could only partially compensate the loss of respiratory capacity (figure 6(d)), indicating that both mitochondrial respiration and mitochondrial no synthesis are required for optimal no - induced longevity. interestingly, the hypoxic isoforms of cytochrome c and cox subunit v, which are normally repressed by oxygen, are activated by cr (figure 4(h)) (p. castello and r. poyton, unpublished). it is therefore possible that cr activates / de - represses factors that are normally induced by hypoxia to further augment no production and respiration capacity. the upregulation of cox5b in cr cells could explain both the increased rate of no synthesis and the relaxation of oxygen sensitivity because a cox isozyme containing subunit vb has been shown to support a higher rate of no synthesis at high oxygen concentrations. in addition, increased no has also been suggested to function in the induction of hypoxic genes (hypoxic signaling) [32, 34, 65 ]. it would be interesting to determine the roles of cr - induced no production and hypoxic signaling in mitochondrial hormesis (mitohormesis), which also plays an important role increasing stress responses and lifespan. it remains unknown whether cox also plays important roles in cr - induced no production in mammals, although rat liver mitochondrial cox and human endothelial cell cox also exhibit no producing activity [34, 65 ]. in mammals, mitochondrial no could also come from enos, which has been reported to physically interact with the outer mitochondrial membrane. enos has been suggested as a mediator of cr in mice, and induction of enos caused both mitochondrial biogenesis and enhanced expression of the nad - dependent protein deacetylase sirt1. together, these studies suggest that no - mediated signaling and mitochondrial respiration work in concert to adapt cells to metabolic changes induced by cr leading to enhanced stress response and lifespan extension (figure 7). in summary, we have demonstrated that calorie - restricted yeast cells produce no under normoxic conditions perhaps by derepressing the hypoxic subunit isoforms of cox and cytochrome c. cr - induced no production may extend lifespan by increasing the stress response (mitohormesis). our study may have uncovered potential novel components in the cr pathway and provided tools to analyze the interconnections between no, mitochondrial respiration, cr, and longevity. although the cr mimics identified in this study share similar no levels, lifespan, and oxygen consumption phenotypes with cr, they may activate no production and regulate mitochondrial respiration and lifespan via different mechanisms. finally, we propose that cr likely confers its beneficial effects via a mitochondria - no - mediated adaptive metabolic shift, which optimizes metabolism and at the same time improves cellular defense system against the oxidative stress that accumulates with age. | calorie restriction (cr) induces a metabolic shift towards mitochondrial respiration ; however, molecular mechanisms underlying cr remain unclear. recent studies suggest that cr - induced mitochondrial activity is associated with nitric oxide (no) production. to understand the role of mitochondria in cr, we identify and study saccharomyces cerevisiae mutants with increased no levels as potential cr mimics. analysis of the top 17 mutants demonstrates a correlation between increased no, mitochondrial respiration, and longevity. interestingly, treating yeast with no donors such as gsno (s - nitrosoglutathione) is sufficient to partially mimic cr to extend lifespan. cr - increased no is largely dependent on mitochondrial electron transport and cytochrome c oxidase (cox). although cox normally produces no under hypoxic conditions, cr - treated yeast cells are able to produce no under normoxic conditions. our results suggest that cr may derepress some hypoxic genes for mitochondrial proteins that function to promote the production of no and the extension of lifespan. |
although metastatic neoplasms of the spine are common, pure intramedullary spinal cord metastasis (iscm) is a rare manifestation of systemic cancer, which indicates the occurrence of remote dissemination, and thus, the terminal phase of cancer (1 - 3). the most common primary tumors of iscm are from the lung, breast and melanoma, which account for about three - fourth, but lymphoma, kidney, colon and thyroid are uncommon (4 - 6). there are only a few reports presenting iscm originated from renal cell carcinoma which was histologically confirmed, and there is no report in korea (7 - 9). we report a unique case of a patient with an iscm originated from rcc who underwent surgery due to a rapid progression of paraparesis during focal radiotherapy. a 44-yr - old male was diagnosed with renal cell carcinoma on the left kidney with lung metastasis and was treated by molecular target agent therapy (sunitinib, 37.5 mg / day, per oral, 4/2 week scheduled) without surgery (fig. 1). after 6 months later from a diagnosis of rcc, he presented rapid progressive paraparesis and both leg numbness. his motor power of both hip flexion was 3/5 (0 ; none, 5 ; normal) and other distal lower extremity was 4/5. magnetic resonance image (mri) of the spine revealed intramedullary mass lesion on t12 level (fig. this lesion showed iso - signal intensity (si) on t1 weighted images (t1wi) and high - si on t2 weighted images (t2wi) with significant rim enhancement after gadolinium based contrast agent injection. extensive edematous infiltration on intramedullary space which shows high si on t2wi was checked up to the upper thoracic level. focal radiotherapy on the spine was initiated due to his refusal for surgery. over the following 10 days during radiotherapy, his neurological deficit rapidly progressed to 2 - 3/5 on the right lower extremity and 0 - 1/5 on the left lower extremity. under the umbilicus level (sensory dermatome level t10), all components of sensory, including pain, touch, vibration and temperature, were decreased and painful paresthesia on both lower extremities was checked. he also complained of urinary incontinence and decreased anal sphincter tone was checked on the neurological examination. for the rapid progression of neurological deficit, emergency surgery was performed. under the neural integrity monitoring (nim - spine, medtronic sofamor danek, usa), laminectomy of t10, t11, and t12 was performed. under the intra - operative ultrasonographic view, mass lesion was not checked on the surface of the spinal cord, posterior myelotomy through midline posterior sulcus was performed. after gentle dissection, soft and grayish colored tumor lesion distinguishable on microscopic view was checked. microsurgical removal of the tumor with the use of cavitron ultrasonic aspirator (cusa, valleylab, usa) was performed. on the neural integrity monitoring, after surgery, painful paresthesia of both lower extremities was immediately improved on the visual analogue scale (vas) from 7 to 2. significant improvement of motor power to self - ambulation with walking stick was checked on an outpatient follow - up after 2 months later from surgery. follow up mri imaging after 2 months later from surgery, enhancing mass lesion was nearly total removed and edematous infiltration on t2wi was significantly reduced (fig. it was composed of nests of clear tumor cells with intermediate nuclear grade vascular meshwork and showed a strong cytoplasmic reaction within tumor cells in immunohistochemical staining for both cytokeratin and vimentin (fig. 4). on the neurological examination of 6 months from surgery, the motor power of both lower limbs was improved to 3 - 4/5, and he could walk by himself with the assistant of a walking stick. iscm is rare and clinically affects only 0.1%-0.4% of all cancer patients (1, 2, 10). the most commonly described tumors in association with iscm include lung cancer and breast cancer ; on the other hand, rcc has been described to constitute about 4%-9% of the total number of iscm (4 - 7). for the rarity of metastasis intramedullary, as well as the low incidence of itself, only a few cases of iscm originated from rcc have been reported with histological confirmation in the literature (7 - 9, table 1). to our best knowledge, this is the first published case report with histological confirmation in korea. first, haematogeneous spread via the artery or vertebral venous plexus (batson 's venous plexus) is believed to account for most cases. second, tumor cells originated from carcinomatous meningitis infiltrate into the virchow - robin spaces of the vessels, penetrate the pial membrane and invade the spinal cord parenchyma. considering the high incidence of anastomosis between the left renal vein and the vertebral venous plexus, hematogenous spread can be a reasonable mechanism (10). focal radiotherapy has been accepted for an effective treatment modality for iscm with arresting tumor growth and preventing further neurological deficit (11). however, the efficacy of radiotherapy may be limited to radio - sensitive tumors, such as small cell lung cancer, breast cancer, and lymphoma. these radio - sensitive tumors are most frequently found as the origin of iscm (4 - 6). previous reports favoring radiation therapy are somewhat biased as their clinical elements mainly consist of these radio - sensitive tumors. despite the radio - resistance of rcc itself, focal radiotherapy has been preferred for the first - line treatment modality of iscm from rcc due to the absence of effective systemic therapy for metastatic rcc and short life expectancy which estimated at 3 to 9 months (3, 12). however, in selected cases with solitary lesion and rapidly progressing neurological deficits but incomplete, surgical management can be an effective salvage procedure. in our case, despite the focal radiotherapy, his neurological symptom was rapidly deteriorated, but improved after surgery. our case indicates that the iscm, despite the extremely rare incidence, is a considerable pathology in patients with rcc. additionally, our case emphasizes the importance of surgical management as a salvage option in cases with progressive neurological deficit, especially for the patients with radio - resistant primary tumor, such as rcc. in conclusion, we report a case of iscm originated from rcc that was removed successfully by a surgical procedure. this is the first published korean case, to our best knowledge, which shows an iscm from rcc with histological report via surgery. | intramedullary spinal cord metastasis (iscm) from renal cell carcinoma (rcc) is rare manifestation and most of them are treated by adjuvant treatment modalities like radiotherapy. despite the radio - resistance of rcc itself, focal radiotherapy has been preferred as the first - line treatment modality of iscm from rcc and only a few cases underwent surgical treatment. we describe a case of iscm from rcc, which underwent surgical excision and pathologically confirmed. a 44-yr - old man was presented with rapid deterioration of motor weakness during focal radiotherapy for iscm from rcc. after the surgery for removal of the tumor mass and spinal cord decompression, his motor power was dramatically improved to ambulate by himself. we report the first published korean case of iscm from rcc confirmed pathologically and describe our surgical experience and his clinical characteristics. |
. they can be achieved by accurate training, specialization, volume levels and a multidisciplinary approach, involving many different subspecialists, nursing staff and supporting staff members (perry., 2008). due to the increasing complexity of the breast teams it is of paramount importance to develop structured care in order to avoid a chaotic and non - consistent management of patients and ameliorate adherence to guidelines. it has been reported that in europe there are wide differences in treatment offered to patients with breast cancer in terms of mastectomy and radiotherapy rates and the use of adjuvant chemotherapy and hormone therapy, which result in considerable survival differences (del turco., 2010). a recent italian survey showed adherence to the breast cancer guidelines of the italian association for medical oncology was only seen in 71% of 355 cases examined in 35 representative italian oncological units (barni., 2011). the florida initiative for quality cancer care (a consortium of three academic and eight community hospitals in florida) is a physician and practice - based quality improvement project that was conceived to study the barriers of delivering high quality cancer care in florida (gray., 2011). of the 34 quality indicators (qis) for breast cancer care they evaluated, seven for medical oncology and four for surgical oncology fell below the 85% level of adherence. a national process survey in the usa providing benchmark data showed that a crucial element in the treatment of women with breast cancer, namely determination of the estrogen- and progesterone receptor status was performed in only 83% and 81% of the patients (owen., 2009). adherence to quality measures was less than 85% for 18 of the 36 defined breast cancer quality measures (malin 2006). these observations highlight a gap between optimal and actual care, that is, between what evidence has identified as recommended care and what patients actually receive (asch., 2006). there is a world - wide need for tools to improve quality of care in the daily clinical practice. qis are measures of health care quality that make use of readily available hospital inpatient administrative data. they can be used to highlight potential quality concerns, identify areas that need further study and investigation, and track changes over time. we have recently shown that the use of qis for breast cancer care, combined with regular internal and external audits of performance, are effective to improve adherence to guidelines in a breast cancer unit (van dam., 2013). assessing quality of care can be performed on different levels : national, regional, on a hospital basis or on an individual basis. in all cases development of an adequate database for data extraction is of major importance. in the present paper we performed a medline search on qis and breast cancer and benchmarking and breast cancer care, and various groups have called for a national system to monitor the quality of breast cancer care extracting data from existing cancer registries for the entire population. this allows scrutinizing breast cancer care in an entire region or country without exception of certain breast clinics. by analyzing performance on a national basis, one can identify more global and system - level elements that can be addressed to achieve more widespread quality improvement efforts (chen., it is mandatory that the registries contain a minimum number of parameters which can be used as qis, the data should be reliable and the data sets complete for the vast majority of patients. malin. (2002) studied the validity of such information in the california cancer registry by comparing the individual records of 304 women with a new diagnosis of breast cancer with the registry data. the accuracy of registry data was higher for hospital based services (eg. sensitivity = 95% for mastectomy, 95% for lumpectomy, 96% for lymph node dissection) than for ambulatory services. they concluded that registries could provide the infrastructure for collecting data on the quality of cancer care, although the cancer registry data may not be valid for all care settings. (2012) confirmed that it is feasible to evaluate quality of cancer care using cancer registry population based data and major computerized information systems. they tested a set of breast cancer care qis on the tuscan cancer registry which collects tumor cases diagnosed in all residents in tuscany. the estimation of the selected indicators confirmed a good homogeneity among areas, and globally a good intraregional performance. in a similar survey mccarthy. (2008) collected data sets relating to treatment of four common cancers (breast, colorectal, lung and prostate) from the data bases of 188 national health service hospital trusts in the uk. process indicators were evaluated and patient outcome measures included the national survey of patients satisfaction for cancer, and cancer survival drown from cancer registration. they showed that while this datamining system of evaluation of quality of care was not yet used in practice, it is possible to implement this in performance assessment of cancer networks. recently a french group (ferrua., 2012) they feel that 3 of them are ready for nationwide implementation in france (time to surgery, time to postoperative multidisciplinary team meeting, conformity to decision of multidisciplinary team meeting). the team of the belgian health care knowledge centre developed a set of indicators to monitor the quality of breast cancer care in belgium (stordeur. qis were identified from a systematic literature search and the 2010 belgian evidence based clinical practice guideline. the selection process involved an expert panel evaluating reliability, relevance, interpretability and actionability of each indicator. the qis were tested using the belgian cancer registry data linked with claims data for all women registered with breast cancer in belgium between 2001 and 2006 (n = 50.039). of these, 12 were measurable using the available data, while one indicator was measurable using proxy information. the authors showed that by data mining, linking the national cancer registry to claim data, these 13 indicators could be used as a multidisciplinary set of qis for breast cancer. in a second study on the same data set they selected the women treated with invasive breast cancer between 2004 and 2006 (vrijens., 2012). these were classified according to their annual volume of treated patients : 150 (high). six of the eleven process indicators showed higher rates in high - volume hospitals : discussion of the case in a multidisciplinary team meeting, cytological and/or histological assessment before surgery, use of neo - adjuvant chemotherapy, breast conserving surgery rate, adjuvant radiotherapy after breast conserving surgery, and follow - up mammography. the 5-year observed survival rates respectively were 74.9%, 78.8%, 79.8% and 83.9% for patients treated in very - low, low-, medium- and high - volume hospitals. after case - mix adjustment, patients treated in very - low or low - volume hospitals had a hazard ratio for death of 1.26 (95% ci : 1.12 - 1.42) and 1.15 (95% ci 1.01 - 1.30) respectively compared to high volume hospitals. the authors concluded that the survival benefits reported in high volume hospitals suggest a better application of recommended processes of care, justifying the centralization of breast cancer care in such hospitals. it is clear that this type of national audits may lead to adaptation of policies. a result of the above report was the political decision to implement the prospective evaluation of 17 qis in the recognized breast clinics in belgium, which up to now should treat at least 100 new patients a year. these qis will be centrally evaluated on a continuous basis by the government and breast clinics should perform according to a minimum standard (based on these 17 qis) in order to keep their certification. breast clinics have to keep a prospective database of all breast cancer patients they treat and this is at least annually audited by an independent external organization. this can be done electronically on the data in the database or by a regular in vivo site visit of the unit. breast clinics meeting a minimum standard of quality of breast cancer care get a certification for a certain amount of years. a major advantage of this system is that the quality of the data entered in the database is superior to data which are retrieved by dataprocessing of national registries. the down side is that only units who are willing to comply to the certification process are looked at. in collaboration with the deutsches onkologie centrum a prospective interventional multicentre study was started in 2003 in germany in order to establish a supraregional collaborative network of breast centers to provide proof of concept for centralized collection and independent analysis of relevant quality assurance data, and to define suitable qis for benchmarking the quality of breast cancer care (brucker., 2008). data collection depended on voluntary participation of breast centers in a commercial benchmarking procedure conducted by an independent external institute. nine guideline - based clinical parameters designed to attainment of predefined quality targets were defined as rate - based qis. the dkg / dgs dual certification process in its present form was established in july 2003. essentially it combines compliance with the requirements of breast centres (fachliche anforderungen fur brustzentren developed by dgs, dkg) and implementation and maintenance of a certified quality maintenance system. during the period 2003 to 2010 the number of certified breast centers increased form 59 to 210. in 2010 about 90% of the new breast cancer cases in germany, currently estimated at about 57970 per year, were diagnosed and treated in a certified breast centre (wallwiener., 2012). the initial set of nine qis had increased to 18 qis as surrogate indicators of long - term outcome quality. the 2003 - 2010 period saw marked increases for the following qis : preoperative histological diagnosis from 58 to 96%, guideline - concordant endocrine therapy in hormone receptor - positive patients from 27 to 97% ; guideline accordant adjuvant and neoadjuvant chemotherapy (no age limit) from 32 to 78% ; radiotherapy after breast conserving surgery from 20 to 87% ; and radiotherapy after mastectomy from 8 to 74%. there is no doubt that the german voluntary program for external benchmarking has produced remarkable results. it is highly likely that the improved quality of breast cancer care will result in better outcomes. the collection of longitudinal follow - up data on the entire population of patients treated in certified breast centers is ongoing to look at the effects of the treatment related interventions on survival of patients. (2011) looked at a sample of 3940 of these patients treated for invasive breast cancer in middle franconia (germany). patients undergoing treatment in certified breast centers were younger, had lower disease stages and lower grading. independent of the effects of these variables, patients treated in a certified breast centers had a better overall survival in the adjusted cox model (hazard ratio 0.70 ; 95% ci : 0.52 - 0.93. the european society of breast cancer specialists eusoma has started a voluntary certification process to assess the clinical performance in dedicated european units (perry., 2008 ; greco., 2006 ; del turco., 2010). so far, 32 breast units in europe have been recognized to comply with the requirements requested by eusoma and other european union guidelines on the basis of information collected by a questionnaire and by a site visit carried out by an independent team of breast cancer experts. a set of qis was defined by experts from different disciplines based on a literature review. for each of them they reported the definition, minimum and target standard, motivation for selection and level of evidence. overall 17 main qis have been identified, respectively 7 on diagnosis, 4 on surgery and loco - regional treatment, 2 on systemic treatment and 4 on staging, counseling, follow - up and rehabilitation (del turco., 2010). eusoma has selected 10 basic indicators (table 2) to be used for certification purposes. these clearly defined quality parameters, continuous internal audit and external social control by means of a site visit are of paramount importance to optimize adherence to evidence based guidelines and treatment results. specialized breast units should further comply to the following requirements : breast surgery should be performed by a specialist in breast surgery. there should be specialized radiotherapists, medical oncologists, pathologists, radiologists and breast nurses to take care of breast cancer patients. the unit should treat at least 150 new cases with breast cancer a year should have specialized clinics, genetics, psychological and social support available (perry., 2008). looking at the performance of individual units (see below), there is no doubt that this system improves the quality of breast cancer care. currently an analysis is ongoing on the data of the entire population of women treated in eusoma certified centers, consisting of more then 64000 patients, to assess the impact of this system of audit and certification on the performance of treatment of women with breast cancer. in the united states the national accreditation program for breast centers (napbc) is in the process of being developed. accreditation is granted only to those centers that voluntarily committed to provide the best care in the diagnosis and treatment of breast cancer and are able to comply with napbc standards. each center must undergo a rigorous evaluation and review of its performance and compliance with napbc standards. the most efficient methods of data collection are currently being defined (winchester, 2011) from an institutional standpoint analysis of qis identifies areas of good and lower quality in the continuum of breast cancer care. indicators with < 85% performance indentify specific clinical processes in most need for quality improvement. hospitals in the midwestern part of the netherlands carried out a clinical audit to monitor the quality of breast cancer care during the years 2002 - 2008 (verbeek., 2011). the hospitals also carried out an intervention project aimed at amelioration in quality over time. at the end of the project all nine indicators showed significant improvement compared to the start of the project. discussion of treatment before and after surgery took place more often (respectively 83 % versus 53% and 96 versus 70%.the national guideline for maximum waiting times was met more often for the outpatient clinic (74% versus 61%), time to diagnosis (92% versus 82%), and surgical treatment (52% versus 34%). more sentinel lymph node procedures were performed successfully (92% versus 69%), and for more patients more than 10 lymph nodes were evaluated in case of axillary lymph node dissection (85% versus 58%). more patients had definitive surgical treatment consisting of one surgical intervention (87% versus 75%). rizzo. (2011) reported the compliance with the three national quality forum guidelines before (2005 - 2006) and after (2008) implementations in 2007 in a metropolitan public hospital in atlanta. patients receiving or considered for adjuvant chemotherapy or hormonal therapy increased from 74% to 94% and from 84% to 90% respectively (iyengar., 2010). weber. (2012) assessed the adherence to breast cancer care quality indicators (bccqi) before and after the introduction of a patient navigation program helping to guide patients through the complex multidisciplinary cancer system, in a retrospective cohort of 134 consecutive patients treated between 1st january 2006 and 31th december 2006 and 234 consecutive patients between 1st january 2008 and 31th december 2009. (2011) assessing qis in a cohort of 105 patients with newly diagnosed stage i - iii breast cancer patients in a los angeles public hospital. (2008) showed that surveillance of the quality of surgical pathology reports of patients undergoing segmental resections of breast cancer was associated with significant improvement in the quality of the reports. fifty one quebec hospitals participated in a voluntary project in 1999 and 50 in 2003. overall, conformity improved from 85% in 1999 for the first evaluation, to 92.5% in 2003 for the second evaluation (p < 0.001). conformity was weakest for recording the distance of the resection margins (68%) and presence of lymphovascular invasion (61%) in 1999. we recently performed an analysis of evolution of the eusoma quality indicators in the breast unit of sint augustinus hospital for the period 2002 - 2010 (van dam., 2013). multiple qis were collected prospectively, and feed back and discussion of data with the breast team was organized at least annually. if necessary corrections in policy were made based on the internal audit data. evolution of the major mandatory quality indicators defined by eusoma (www.eusomadb.org/indicators.htm) is shown in table 2. it can be seen that most of these indicators are significantly better in 2011 compared to 2003. four years progression free survival was significantly (p < 0.05) better in the cohort of patients treated in 2006 - 2008 compared to 2004 - 2005 and 2002 - 2003. similar results were obtained if our data were stratified for t1 tumors only and t2-t4 tumors (van dam., 2013). although our survival results can partly be explained by an evolution in the case mix, with considerably more patients with small tumors and negative lymph nodes in more recent years, better adherence to guidelines is likely to be beneficial for the outcome of the patients. in 2011 had state of the art adjuvant radiotherapeutic, antihormonal or cytostatic treatment when indicated according to sankt gallen guidelines compared to 98%, 85% and 72% respectively in 2003. process indicators in the period 2002 - 2011 in the clinical pathway operable breast cancer of the sint augustinus hospital. evolution of quality indicators as formulated by eusoma prospectively evaluated between 2003 and 2011 (data for first semester breast clinic sint augustinus hospital, antwerp). a recent taiwanese study shows that when breast cancer patients are diagnosed and treated in complete accordance with widely accepted standards of care, they survive longer and have better outcomes (cheng., 2009). this prospective study followed 1378 newly diagnosed breast cancer patients from 1995 - 2001 in a single cancer hospital, tracking 10 indicators of care quality and a assessing the progression of disease up to june 2007. adherence to all 10 qis by 100% of patients was associated with better overall (hr 0.46, 95% confidence interval 0.33 - 0.63) and progression - free survival (hr 0.51 ; 95% confidence interval : 0.39 - 0.67). adherence to either the four treatment indicators, or the six diagnostic indicators by 100% of patients was also associated with a significant improvement of survival. most national and hospital databases collect data on the specialists who have participated in the treatment of breast cancer patients. although one has to be very careful to audit individual performance of hospital physicians, as differences in case mix may bias the conclusions, it may be useful to do this type of analysis to identify possible points of amelioration in breast care. if feedback can be given on these findings in discrete and a non - hostile way it can help doctors to adapt certain habits and to reflect more on their clinical activities. an internal audit in the sint augustinus hospital in 2007 showed for example that patients treated by the core breast team compared to patients treated by other collaborating physicians had a preoperative core biopsy rate of 70% versus 62%, a mastectomy rate of 25% vs 42%, free margins of 100% versus 97%, use of sentinel node biopsy in t1-t2 of 82% versus 35%. feedback of these findings and discussion of individual cases in the multidisciplinary meetings improved performance of both groups. for example, preoperative histological diagnosis was nearly 90% for all patients treated in sint augustinus in 2011. individual discussion of cases with surgeons having positive margins with invasive carcinoma at definitive surgery has nearly eradicated this problem in our hospital. the above review shows that quality control by means of internal and external audit and benchmarking leads to better breast cancer care. adherence to guidelines improves markedly and there are data emerging which show that this results in a better outcome. as this field of quality control is relatively new there is certainly room for more research on the development of more sophisticated tools to measure quality of care. current qis are sometimes unbalanced, as many indicators are encouraging more appropriate care but few indicators discourage inappropriate care. particularly in older patients life - expectancy calculations may be useful to limit unintended harm. if the estimated life expectancy and the lag - time - benefit are similar, then the net benefits are small or uncertain (lee., 2011). a crucial element in quality control is the establishment and maintenance of an accurate database. resources will have to be found to pay for man (woman) power and computer systems to perform quality management. it will be a challenge for the medical and hospital community to develop quality control systems which are not leading to an excessive (data input) workflow for clinicians and which will not be perceived as an unpleasant big brother is watching you. however, as the speedometer in a car is crucial to drive safely, quality measurement is of paramount importance to care safely. | quality indicators (qis) are measures of health care quality that make use of readily available hospital inpatient administrative data. assessment quality of care can be performed on different levels : national, regional, on a hospital basis or on an individual basis. it can be a mandatory or voluntary system. in all cases development of an adequate database for data extraction, and feedback of the findings is of paramount importance. in the present paper we performed a medline search on qis and breast cancer and benchmarking and breast cancer care, and we have added some data from personal experience. the current data clearly show that the use of qis for breast cancer care, regular internal and external audit of performance of breast units, and benchmarking are effective to improve quality of care. adherence to guidelines improves markedly (particularly regarding adjuvant treatment) and there are data emerging showing that this results in a better outcome. as quality assurance benefits patients, it will be a challenge for the medical and hospital community to develop affordable quality control systems, which are not leading to excessive workload. |
overwhelming evidence reveals close links between maternal obesity, excess gestational weight gain, unhealthy maternal lifestyles, and childhood adiposity. high maternal bmi and excess weight gain are independently predictive of high birth weight and increased child and adolescent overweight and adiposity. dual mechanisms both of metabolic imprinting by maternal diet and obesity during pregnancy and family lifestyle influences in early childhood have been proposed. educating and supporting mothers to achieve healthy lifestyles and weight in the perinatal period is therefore critical to preventing child obesity. in australia, over 46% of women are either overweight or obese at the start of pregnancy, and one - third gain excessive weight during pregnancy [4, 5 ]. retention of extra weight postpartum is also common. by the age of three years, 20% of australian children are overweight or obese, with their weight closely linked to that of their mothers. not only has the prevalence of overweight and obesity increased in australia, but the distribution of bmi has also shifted towards the upper end for parents and their children. recent meta - analytical studies indicate the positive outcomes of interventions to prevent overweight and obesity during pregnancy [10, 11 ]. perinatal health care providers (phcps) increasingly acknowledge the importance of promoting healthy weight during childbearing years, yet, in practice, time, remuneration, knowledge, skills, and capacity hamper their ability to provide mothers with counselling and advice [12, 13 ]. furthermore, maintaining healthy lifestyle behaviours is challenging for pregnant women and new mothers today as they confront competing family and work demands, fatigue, time pressure, lack of motivation, and reduced support from family and others due to dispersed living arrangements. in response, mothers increasingly rely on online resources to access health related information 24 hours a day, with instant answers to their questions and concerns, and diverse advice from which mothers can choose what suits them [1422 ]. in the past, phcps were a primary source of health information for new mothers, providing consultation, educational pamphlets, and parent classes. today phcps need to be ready to support pregnant women with interpretation and application of information retrieved online [10, 17, 24 ]. australia has the fifth highest internet use per person in the world, with over 92% of australians having home internet connection and women of childbearing age amongst the group with highest access to household broadband. mobile wireless internet connection is the fastest growing online resource, particularly among this younger generation, with a 32% increase in the volume of data downloaded via mobile handsets in the past year. key benefits to phcps of online health information for new mothers include the ability to reach a wider audience without increase in service costs [2729 ], as well as the opportunity for health promotion initiatives to engage with individuals wherever and whenever needed. in addition to static website information, mothers are using interactive online environments such as facebook, blogs, and smartphone applications (apps), which provide important social support especially when women are isolated, time poor, or needing reassurance. to this end, young women seek participation in electronic support groups for information and advice to navigate and deal with challenges during and after pregnancy [20, 21, 30 ]. research indicates that approaches using personalised online information with tailored messages [29, 31 ] are more effective in achieving longer - lasting health behaviour change than static information [3234 ], yet little research has been conducted to better understand what online information mothers need during the perinatal period and how to make it useful and appealing. if phcps are to benefit from the opportunities provided by the virtual environment as positive means of addressing the obesity epidemic among perinatal mothers and their offspring, then research is required to identify what online information young women feel is most needed, in what format, and how best it should be presented. although numerous websites and apps are emerging to reach perinatal women [21, 36 ] rarely has research to inform the design and planning of these online resources been reported. this paper summarises the findings of a study to determine online information needs of perinatal women regarding healthy eating, physical activity, and healthy weight during pregnancy and the first eighteen months postpartum. the views of both women and phcps are reported along with implications for content and format of the subsequent clinically endorsed ngala healthy you, healthy baby (hyhb) website and smartphone app. the paper also reports implementation of the resource and mothers ' usage in the first year since its inauguration. a logic model for this study was developed following an extensive literature review of models and instruments used to explore online health information retrieval and use among parents and health providers [1518, 3741 ] (see figure 1). the logic model was used to guide development of research instruments and interpretation of results. data collection to address the aims of the study included the following : intercept interviews with 53 pregnant women attending hospital antenatal clinics in western australia (wa) ; 12 focus groups with a total of 67 postnatal mothers attending wa urban and rural playgroups ; and intercept interviews with 76 phcps to determine what information they felt mothers should receive. reflecting the logic model, the interviews / focus groups sought information on maternal use of online devices and resources for lifestyle information during pregnancy and early postnatal months, identification of main online resources used to seek information, usefulness of online information, amount / format of information required, source of online information sought, trustworthiness of online information, gaps in useful forms of online information (e.g., tailored, self - assessments), and preferred formats for presentation. the interviews and focus groups were audio - taped, subsequently transcribed verbatim, and then analysed using logico - inductive analysis. based on the parents ' preferences for the content and format of online resources that emerged from the interviews and focus groups, a this was used assess the strengths and weaknesses of existing online resources used by the antenatal and postnatal mothers. content criteria specified inclusion of online information related to healthy maternal lifestyle (nutrition, activity, and weight), healthy parental lifestyle and modelling to children, emotional wellbeing, and parenting advice, as well as quantity and quality of information. format criteria included potential to impact on family behaviour to prevent obesity, user - engagement, personalised and tailored information, and local connectedness. australian websites were located using general search terms (e.g., overweight, obesity, pregnant women, newborn, parents, online programs, healthy lifestyles, nutrition, physical activity, and weight). to apply the gap analysis scale two researchers independently assessed and scored government, nongovernment, and private enterprise websites aimed at pregnant women and new mothers. the findings of the interviews / focus groups with parents and phcps, together with the results of the gap analysis, were presented to key wa government and nongovernment stakeholders and health practitioners to determine how best to overcome existing gaps to reach parents through online resources. their decision was guided by findings of the interviews / focus groups and gap analysis, together with their need to address staff shortages and capitalise on high online information seeking behaviour of expectant and new parents [16, 17, 27 ]. the outcome was development of a clinically endorsed ngala healthy you, healthy baby (hyhb) website and app (http://www.ngala.com.au/hyhb). the resources were launched with media coverage and mail - out of information, clinic posters, and patient leaflets to antenatal and child health service providers. support from the wa department of health allowed gps, obstetricians, midwives, and child health nurses to refer mothers to use the website and app. the web address and app were promoted through maternal and child health networks and newsletters. one year after the launch of the hyhb website and app in june 2012, resource usage data obtained from google analytics were analysed and demographic information of users compared with wa birth statistics. postcode information accessed from the app was used to determine user demographics in terms of geographic distribution across australian bureau of statistics statistical divisions and quintiles of social disadvantage expressed as socioeconomic index for areas (seifa) compared to annual births in wa. in line with recent data, the majority of perinatal women interviewed considered online resources their primary source of lifestyle information. women frequently searched online for information about pregnancy and early childhood, especially those mothers with their first child. the key reason for using the internet was to find short, quick factual answers to immediate concerns, both to confirm their current knowledge and/or to provide reassurance that their issues were normal, without having to visit the doctor for nonmedical reasons. in particular, women wanted information on issues like nutrition and diet, exercise, managing weight gain, sleeping problems, emotional fluctuations, allergies, breastfeeding, and gestational diabetes. they emphasised their need for realistic exercise they could do given their new situation and quick, cheap, safe recipes they could easily prepare. they also wanted information for their partners, as well as information on events and resources in their local area. mothers highlighted that, contrary to much of current information provided, they wanted hands - on parent - focused rather than child - focused interactive materials including personalised learning activities that would assist them to become role - models for healthier family lifestyles. women wanted credible, evidence - based information, yet few of the women interviewed were satisfied with online information currently available, with many being extremely dissatisfied. while online resources saved time, few users found them trustworthy ; many found information contradictory, and google search terms repeatedly directed them to international websites with no local information. while they trusted government or university websites highly and questioned the trustworthiness of commercial websites, they admitted commercial sites and forums were more accessible and user - friendly with attractive promotions and prizes. women were not particularly loyal to any healthy lifestyle online resource but instead checked and compared information from numerous sites. when messages conflicted, women usually sought clarification from experienced friends or family members rather than seeking advice from health professionals. cost and inconvenience were barriers to women visiting a doctor or health professional about daily concerns for which they just wanted quick easy answers, but nearly all those interviewed said they would greatly appreciate their phcp recommending an online resource with all information in one place and which they could trust. in terms of the format of online data, perinatal mothers indicated they wanted information relevant to their individual issues, through user self - assessment tools, ongoing tracking of their progress, smartphone apps they could use anywhere any time, instructional video clips, monthly updates on local events and activities in their area, e - newsletters, and information tailored to the developmental stage of their child. in addition to perinatal mothers ' views, phcps emphasised the need for positive messages to women about adopting healthy lifestyle changes at this crucial time in life to reduce potential complications and risks for themselves and their child. phcps also focused on the need to recommend simple, inexpensive foods and activities both mothers and their children could have at different stages across the perinatal and postnatal periods (table 1). gap analysis of websites most frequently used by parents showed government websites scored highly for quality and quantity of information, yet scored low on parent focused, user - friendly advice ; recommendations on how to achieve healthy gestational weight gain ; and links to services available in their local communities (table 2). in contrast, private enterprise websites had a lower level of trustworthy / quality information but high levels of user engagement and detailed information on perinatal health needs of mothers. results for nongovernment organisation websites varied but generally provided medium to relatively high quantity and quality of relevant online information and higher levels of user engagement than government websites but not as high as those of private enterprises. some of the not - for - profit organisation websites provided information on local activities and ways parents can connect, although with limited reach across regions in wa. whilst some websites reviewed provided information relevant to stage of pregnancy moreover, with the exception of one private website that was not clinically endorsed, none provided interactive information that enabled self - assessment, personalised advice, and tracking of progress, nor did any websites have links to apps which mothers indicated they found convenient and liked using on their mobile phones. the gap analysis also found variable content topics, with limited or no information on paternal lifestyle behaviour, recommended weight gain / loss, or physical activity type and intensity at different stages of pregnancy and postpartum. based on recommendations of key stakeholders, the healthy you, healthy baby (hyhb) web information and app were integrated into the website of a leading wa early childhood parent support organisation ngala (http://www.ngala.com.au). this website was well used and already confidently advocated to parents by gps, obstetricians, midwives, child health nurses, and child care providers. the hyhb web information was designed to address current gaps and provide perinatal women with convenient access to brief factual information on nutrition, physical activity, weight, emotions, social life, and sleeping patterns, all identified by mothers as key areas of interest. the accompanying app was developed with a self - assessment tool to track maternal lifestyle behaviours and weight during pregnancy and the first 18 months of motherhood. this self - assessment tool was designed to generate supportive tailored feedback and tips on how to make improvements. to sign in, users entered their postcode, thus providing information on their geographic location. information on their height, initial weight, and stage of pregnancy or postpartum was also collected to allow appropriate feedback and tailored information to be provided. resource usage data obtained from google analytics (http://www.google.com.au/, verified 16 july 2013) showed 14,023 views of hyhb antenatal website pages and 7,596 of postnatal pages over the first year. a total of 2,378 users signed up to the hyhb app over the same time period. with an estimated 33,000 wa births in 2012 - 13 and 40% of these being first time mothers, this extrapolates to 7% of pregnant wa women and 18% of first time mothers using the app. website views and app new user sign up rates increased from the first six - month period to the second six - month period, with website views increasing to 72% and 14% in the antenatal and postnatal periods, respectively, and app user growth of 47% (62 new users per week increasing to 91 new users per week). traffic to the ngala website increased significantly after the launch of the hyhb web pages and app (figure 2). peaks in website traffic occurred directly after the launch and newspaper media coverage in july 2012, while a large increase in new app users was seen after newspaper publicity in may 2013. hyhb app self - assessments were completed at a rate of 167 per week, with the average person completing 3.6 questionnaires. the highest hyhb app self - assessment usage was in the first two trimesters of pregnancy and in the first 3 months after birth (figure 3). the most popular hyhb app self - assessments completed over the year were weight (25%) and sleep (18%), followed by nutrition (15%), physical activity (15%), emotions (13%), and social life (13%) (figure 4). aside from weight assessment, assessment topics were in similar proportions across the pregnancy but with increasing emphasis on sleep until 9 months postpartum. the highest website page views related to the antenatal period featured nutrition content (40% of views) followed by weight (33%), physical activity (14%), sleep (6%), emotions (5%), and social life (2%) (figure 4). for page views related to the postnatal period and compared to antenatal, nutrition was again the highest focus (49% of views), with less views for weight (9%) and similar views for physical activity (16%), sleep (11%), emotions (11%), and social life (5%) (figure 4). when compared to the geographic distribution of mothers ' residence for annual births, wa regional use of the hyhb app was about 10% lower than in perth but otherwise showed a similar distribution across regions (table 3). app users were resident in areas across all quintiles of social disadvantage but were over represented in areas of lower disadvantage compared to distribution of wa births (table 4). mothers are identified as crucial agents of change for prevention of obesity in their offspring. pregnancy is a critical metabolic period and a time when mothers are most likely to be receptive to changing their lifestyles for the sake of their child. young women are primary users of internet technology and this research confirmed pregnant women and new mothers are seeking lifestyle advice online during their childbearing years. women in our research wanted short, quick answers to their pregnancy and child rearing concerns, self - assessment tools, and practical suggestions to achieve change at the family level. use of online resources and particularly mobile devices shows significant promise for supporting health behaviour change [29, 32, 33, 45 ]. not only do online resources provide users with access to health information, but they also enable interactive use, with ongoing collection of personalised data and cueing of the user 's behavioural information according to their goals and stages of behaviour change. in this way, individual messages can be tailored to the user 's needs while directing them to suitable support [31, 34 ]. research shows that such personalised online information with tailored messages is more effective in bringing about behaviour change than static information [3234 ]. likewise, evidence suggests longer - lasting behaviour change since interactive components enhance the user 's experience and support their achievement of behavioural goals. the hyhb resources were designed to address the findings of our research that highlighted both young women 's needs and the existing gaps in available online resources. specifically it sought to provide perinatal mothers with a personalised, interactive tailored resource with parent focused, brief advice relevant to their stage of pregnancy and lifestyle assessment, goal setting, and monitoring. the content was clinically endorsed and available via a mobile phone app with similar as well as more detailed factual, practical, and localised information on the website. monitoring hyhb resource usage in the first year of implementation showed online resource use varied with content, format, and delivery mode. whilst website hits were higher than new app signups, however a significant proportion (25%) of website traffic came directly from the app and the rate was increasing, indicating mobile devices are an important tool to engage women. also, the content accessed varied between app and website information. weight assessment was most common on the app (25% of assessments) with fairly stable assessment of other lifestyle categories (1318%). weight was also an important focus of antenatal website views (34%) but nutrition was the primary topic of webpage views related both to antenatal (40%) and postnatal periods (49%). these results suggest that the simple format of the app leads many users to complete all self - assessments at the same time, but with more frequent focus or return to the weight assessment. in contrast website users may be accessing the website to gain particular information (e.g., nutrition) and may not be exposed to the other categories. overall the results highlight the value of providing both a website and an app to engage women and to provide supportive information. given the magnitude of information in the online environment, promotion of the hyhb resources is a critical aspect of their successful adoption by women. women in our research and other studies [16, 17 ] expressed a clear preference for quality assured resources recommended by a trusted health professional. policy makers and phcps guiding development of the online resources also emphasised the need for clinically endorsed information that gps, obstetricians, midwives, child health nurses, and child care providers could confidently refer to women. the credibility of the hyhb resources, web address, and app was promoted through maternal and child health networks and newsletters. usage data showing steady increase in direct entry to the website url indicated promotion of this address via health professionals enhanced mothers ' use of it. whilst significant peaks in direct entry to the website and use of the app also coincided with modest short term newspaper promotion, this form of promotion was not sustainable and provided little advantage over promotion through phcps. these results highlight the value of engaging health professionals in targeted promotion of healthy lifestyle resources to pregnant women. for health care services, provision of online health information is identified as a cost - effective approach to reaching broad audiences in many locations [29, 31 ]. yet whilst demographic data for hyhb webpage views is not available, registrations for the app showed slightly higher use in urban than rural areas. this is not unexpected since some wa rural areas have poor internet access or limited phcps to refer the app. of greater significance is lower sign up to the app in areas of higher social disadvantage (table 4). this may be due to a range of factors including lower access to internet and smartphones, cultural and language barriers to app referral and content, and lack of motivation to achieve healthier lifestyles [22, 24 ]. whilst these factors need to be explored, the finding should not distract from significant and increasing uptake of the resource within the first year and the low cost of ongoing implementation through referral by phcps. whilst many pregnancy - focused websites and apps are available, the strengths of the hyhb resource include attention to women 's expressed needs as well as effective behaviour change strategies including self - assessment, goal setting, tailored advice, and feedback. in addition, our formative research identified gaps in useful online lifestyle information including appropriate weight gain during pregnancy and the types and amounts of physical activity considered safe during pregnancy. when addressed by the hyhb resources this information about weight particularly was amongst the highest accessed. online communication is an effective approach to reach pregnant women and new mothers seeking advice about healthy lifestyle and weight management. mobile phone apps can help to engage women, whereas websites are an accepted source of detailed information. together they are complementary and if recommended by trusted phcps can enhance information retrieval intended to promote maternal healthy lifestyle behaviour change in the perinatal period. referral of evidence - based online resources by phcps provides a low - cost intervention across most geographic and socioeconomic strata without additional demands on health service staff. | overwhelming evidence reveals the close link between unwarranted weight gain among childbearing women and childhood adiposity. yet current barriers limit the capacity of perinatal health care providers (phcps) to offer healthy lifestyle counselling. in response, today 's internet savvy women are turning to online resources to access health information, with the potential of revolutionising health services by enabling phcps to guide women to appropriate online resources. this paper presents the findings of a project designed to develop an online resource to promote healthy lifestyles during the perinatal period. the methodology involved focus groups and interviews with perinatal women and phcps to determine what online information was needed, in what form, and how best it should be presented. the outcome was the development of the healthy you, healthy baby website and smartphone app. this clinically - endorsed, interactive online resource provides perinatal women with a personalised tool to track their weight, diet, physical activity, emotional wellbeing, and sleep patterns based on the developmental stage of their child with links to quality - assured information. one year since the launch of the online resource, data indicates it provides a low - cost intervention delivered across most geographic and socioeconomic strata without additional demands on health service staff. |
pectinases are enzyme group that degrade pectic substances and are classified according to their mechanism of action in methylesterases (ec.3.1.11.1) that remove methoxyl groups from highly or partially esterified galacturonan ; polygalacturonases catalyse the hydrolysis of the glycosidic bonds in a random fashion (endopolygalacturonase - ec.3.2.1.15) or from nonreducing end of homogalacturonan releasing galacturonic or digalacturunic acid residues (exopolyglacturonases ec.3.2.1.67 and ec 3.2.1.82) and lyases (pl) which cleave the glycosidic bonds by trans - elimination (pectato lyase - ec.4.2.2.2 and exopectato lyase - ec. production of pectinase by fungi generally is influenced by the composition of the medium, in particular the carbon and nitrogen sources and physicochemical conditions such as ph, temperature, and aeration, besides the fermentative system employed. solid state (ssf) or submerged fermentations (smf) have been proposed for enzyme production under laboratory conditions using agricultural and agroindustrial wastes, and several forms of pg have been purified from both fermentative processes [2, 3 ]. the purification of pg is an important tool for comprehension of its properties and reveals its structure and functional mechanism which are important to knowledge of the action of these enzymes in the plant infections process, in industrial application, and the importance of them in the biomass degradation. fungal pgs generally are monomeric proteins with a carbohydrate content of 581% and molecular masses in a range from 13 to 82 kda [48 ]. in a previous paper, we described the purification of an exo - pg produced by penicillium viridicatum rfc3 in ssf, that enzyme exhibited a molecular weight of 24 kda and was strongly stimulated by ba. in this paper we report the production of polygalacturonase by the same fungus in smf, with orange bagasse and wheat bran as carbon sources, and the purification of another exo - pg with different physicochemical properties from the earlier enzyme. the microorganism used was penicillium viridicatum rfc3, isolated from decaying vegetables in so jos do rio preto, sp, brazil and maintained as stock culture on sabouraud dextrose agar (oxoid) containing 0.3% citrus pectin at 7c. polygalacturonase was produced by submerged fermentation (smf) in a 500 ml erlenmeyer flask containing 100 ml of sterilized (120c/30 minutes) liquid medium containing 3% carbon source (1.5% ground orange bagasse, provided by bascitrus (mirassol, sp) and 1.5% wheat bran) and 1 g l of (nh4)2so4 and mgso4.7h2o. the medium was sterilized at 120c for 30 minutes, inoculated with a volume of conidial suspension in 0.1% tween 80 equivalent to 10 spores per ml in the final medium and cultured at 28c for 4 days. every day, one flask was removed and the fermented material was filtered and centrifuged at 10,000 g for 15 minutes at 4c. exopolygalacturonase (exo - pg) activity was assayed in a reaction mixture containing 1% citrus pectin solution with a degree of esterification (d.e.) of 92% (sigma) in 0.2 m sodium acetate buffer (ph 4.5) at 45c for 10 minutes. the number of reducing groups, released by enzymatic action, was measured by the dns method and expressed as galacturonic acid. one unit of enzyme activity (u) was defined as the amount of enzyme releasing one mol of galacturonic acid per minute under the assay conditions. endo - polygalacturonase (endo - pg) was measured viscosimetrically by adding 2.0 ml of crude enzyme to 6.0 ml of 0.2 m citrate - naoh buffer (ph 5.5) containing 3% citrus pectin with 92% d.e. the reaction mixture was incubated at 45c for 10 minutes, after which its viscosity was determined with a basic viscosimeter (fungilab). one unit of enzyme activity (u) was defined as the amount of enzyme that reduced the initial viscosity by 50% per minute under assay conditions. a 1300 ml volume of crude enzyme solution obtained after 96 hours of fermentation was dialyzed overnight against 20 mm acetate buffer ph 4.5 in acetate cellulose membrane (pharmacia) and concentrated by ultrafiltration with quixstand benchtop of ge healthcare with a 10 kda cut - off. the retentate was directly loaded on a sephadex g-75 (pharmacia) column (2.6 90 cm) equilibrated with 40 mm acetate buffer (ph 5.0) and eluted with the same buffer at a flow rate of 0.3 ml min. the objective of this procedure was to estimate the number of isoforms of pg present in the crude enzyme solution. in another assay, the same volume of crude enzyme was concentrated by ultrafiltration with quixstand benchtop of ge healthcare with a 10 kda cut - off and then filtered with a 50 kda cut - off membrane and loaded directly on a sephadex g-75 column following the procedure described above. protein fractions collected from the sephadex column, corresponding to the pg activity peak, were pooled and loaded on a q sepharose column (aldrich 30 1 cm) equilibrated with 40 mm acetate buffer, ph 4.5. the adsorbed material was eluted with a linear gradient (0.0 to 1.0 m) of nacl, in the same buffer, at a flow rate of 0.6 ml min. the protein fraction with pg activity was desalted overnight by dialysis against 20 mm acetate buffer, ph 4.5, at 4c. the molecular weight of the purified enzyme was determined by sds - page in a mini protean ii apparatus (10 8 cm) (biorad). electrophoresis was carried out on a 4% (w / v) polyacrylamide stacking gel and 10% (w / v) resolving gel in tris / glycine buffer (ph 8.3) with the sigma molecular weight marker m6539 (6.5180 kda) in a parallel lane. analytical isoelectric focusing page was performed in ettan ipgphor ii isoelectric focusing system (amersham) by electrophoresis in a 12.5% polyacrylamide gel (14 15 cm) containing 5% pharmalyte (ge healthcare), which established a ph gradient from ph 3.010.0, in accordance with the instructions of the supplier. protein concentration was determined in the concentration ranges of 110 and 10100 g ml by the bradford microassay, with bovine serum albumin (bsa) as the standard. all enzyme catalytic properties were assayed with 1% citrus pectin (d.e 92%, sigma) as substrate using the procedure for enzyme activity determination described above and carried out with three replicates. pg activity was assayed as a function of ph, in mcilvaine buffer (ph 4.08.0), at 55c, and temperature, in mcilvaine at the ph optimum, incubated at temperatures between 35c and 70c. the thermal stability was investigated by remeasuring the activity of the purified enzyme solution after it had been kept for 1 hour, in the absence of substrate, at temperatures between 5 and 80c. the half - life was determined by incubating the enzyme solution at 60c for 1 hour. in these tests, ph stability of the purified enzyme was evaluated by dispersing (1 : 1, v / v) enzyme solution in 0.1 m mcilvaine buffer (ph 3.08.0) and 0.1 m glycine - naoh buffer (ph 8.010.5) and maintaining these solutions at 25c for 24 hours. an aliquot was taken to determine the remaining activity at the optimum ph and temperature. the michaelis constant (km) and vmax values were determined from lineweaver - burk plots of enzyme activity measured with 92% d.e. citrus pectin (sigma) as substrate, at concentrations between 1.0 and 10.0 mg ml at optimum ph and temperature. the effects of metal ions (ag, k, na, cu, ca, ba, co, hg, ni, mg, mn, zn, cr, al, fe) and edta on enzyme activities were assayed at concentrations of 2.0, 5.0, and 10.0 mm in the reaction mixture. the substrate specificity was assessed by testing polygalacturonic acid, citrus pectin (sigma) of 26% and 92% d.e., and apple pectin (87% d.e.- sigma) as substrates under optimum conditions for enzyme activity. the products of the hydrolysis of citrus pectin (92% d.e.) by pg were analyzed by paper chromatography on whatman no. 1 paper, with ethyl acetate / isopropanol / water (6 : 3 : 1, by volume) as the mobile phase. during thesubmerged fermentation in medium containing orange bagasse and wheat bran as carbon sources (figure 1), the pg activityincreased continuously between 24 and 96 hours of batch culture varying from 3.0 to 4.1 u ml by three repetitions. the enzyme activity was lower than that obtained in ssf with the same fungus (18 u ml). orange bagasse (pressed peel, pulp, rag, and seeds) has an average pectin content of 223 g kg (dry weight) [13, 14 ] and is a good inducer of pectinases [15, 16 ] while wheat bran is a good nutrient source. in spite of this, the pg activity obtained was lower than that reported for enzyme production in smf on other carbon sources. patil and dayanand obtained 30.3 u ml of exo - pg from the aspergillus niger dmf 27 when they used deseeded sunflower and glucose as carbon sources. the same fungi produced 14.5 u ml of pectinase in medium containing citrus pectin. the related a. sojae produced 15.5 u ml of pectinases in medium supplemented with maltrin. pg production increased substantially when the reducing sugar content dropped and after the log phase of fungal growth. the consumption of reducing sugars promotes fungal growth and ensures success in colonization of medium. on the other hand, a high level of reducing sugars in the medium is an important factor limiting of enzyme production, owing to catabolic repression. the crude enzyme solution obtained after 96 hours of fermentation, concentrated by ultrafiltration with a 10 kda cut - off and separated on a sephadex g-75 column, afforded 5 peaks of pg activity suggesting a number of isoforms (figure 2(a)). in work published previously, we obtained 5 pg fractions by solid - state fermentation of p. viridicatum rfc3 on a 1 : 1 mixture (w / w) of wheat bran and orange bagasse at 67% moisture, while and recently in another experiment, 6 pg fractions were obtained in the same medium, but at 80% of moisture. we supposed that the moisture difference between the two media could have influenced the expression of pg isoforms, but now, in liquid medium, we found the same number of isoforms as in the medium with lower moisture content. the influence of water potential (aw) variation on the isoform expression of extracellular enzymes has been attributed to changes in the permeability of fungal membrane, limitation of sugar transport, and presence or absence of inducer. we have also reported changes in the expression of extracellular enzymes with variation of culture conditions and fermentative techniques. pectinases produced by the same microorganism exhibit differing molecular weights, degrees of glycosylation and specificities, due either to posttranslational modification of a protein from a single gene or to the expression of different genes, and such variants are important in balancing specific modes of action (endo or exo) and substrate affinity [5, 23 ]. when the crude enzyme solution was concentrated by ultrafiltration at 10 kda and shortly after filtered through a 50 kda cut - off membrane, and the concentrated material loaded on a sephadex g-75 column, only one polygalacturonase peak (pg iii) was eluted, indicating that the majority of the pg fractions from crude enzyme were of low molecular weight and only one (pg iii) was retained by the 50 kda membrane (figure 2(b)). the pg peak, corresponding to elution volume 215 to 315 ml, was applied to a q sepharose column at ph 4 and, after elution with nacl solution (around 0.5 m), only one peak of pg was detected (figure 3). three stages were necessary to reach a 37.7-fold pg iii purification, with a final yield of 3.4% (table 1). molar mass of pgiii was estimated to be 92.2 kda (figure 4). homogeneity was confirmed by isoelectric focusing, where a single band with isoelectric point (pi) of 5.4 was observed (figure not shown). purified pg iii exhibited higher activity on highly esterified pectin (figure 5(a)) suggesting that pg is a polymethylgalacturonase. however, the activity on citrus pectin (5.1 u ml) was appreciably higher than that on apple pectin, although both have high d.e. the mode of action of the polygalacturonase on citrus pectin (92% d.e.) was also assessed by measuring viscosity in the reaction mixture, to estimate endo activity. figure 5(b) shows that the enzyme had a poor capacity to decrease the viscosity of the pectin solution, indicating mainly exo - activity. analysis by paper chromatography revealed that galacturonic acid was the sole product of enzyme hydrolysis after 5 minutes of incubation (figure 6), reinforcing the evidence for an exopolygalacturonase (exo - pg). the effect of ions on exo - pg iii activity was tested at concentrations of 2.0, 5.0, and 10.0 mm. the ions hg, zn, mg, fe and cu strongly inhibited the exo - pg activity while, cr, and k only partially inhibited it. on the other hand, ions such as na, mn, and ca, at 5 and 2 mm, enhanced the enzymatic activity by 10% (and ca by 30% at 5 mm). edta inhibited the enzyme activity by 717%, depending on the concentration (table 2). divalent ions such as ca act directly on the pectin molecule, stabilizing the negatively charged carboxyl groups and indirectly stimulating the polygacturonase activity [25, 26 ]. the concentration of the ions cr, al, ag, k, and ni in the reaction mixture was related anomalously to their inhibitory effects, which were highest at the lowest concentration. exo - pg iii showed maximum activity at ph 5.0 and 50% of its maximum activity at ph 8.0 (figure 7(a)). it was stable in the ph range 45, but the presence of ca ions in the reaction mixture resulted in an increase in the enzyme stability, with 90100% of the full activity in a broader ph range of 4.09.0 (figure 7(b)). with respect to temperature, optimal pg activity was observed at 5055c (figure 8(a)). in the absence of substrate for 1 hour, exo - pg iii showed 85100% of the original activity at 535c, while at 70c, the enzyme lost 55% of its initial activity. however, in the presence of ca (10 mm), the pg maintained 80100% of the initial activity at 555c and around 70% when maintained at 70c (figure 8(b)). in another experiment, exo - pg iii was maintained at 60c for 1 hour (samples taken every 5 minutes) in the presence and absence of ca. without this ion, the enzyme preserved 50% of its initial activity for 25 minutes, while in its presence, the enzyme half - life increased to 37 minutes (figure 8(c)). according to hernndez., ca protects enzymes against thermal denaturation and plays a vital part in maintaining their active configuration at high temperatures. the half - life time at 60c of exo - pg iii from p. viridicatum was higher than that described by shanley. those half - lifes were 10.6 minutes for pgi, 16.5 minutes for pgii, and 9.5 minutes for pgiii. the pg from acrophialophora nainiana purified by celestino. had a half - life of 20 minutes at 60c and 3 minutes at 70c. the exo - pg iii affinity for citrus pectin (92% d.e.) the substrate affinity increased, with km falling from 1.30 (0.04) to 1.16 (0.05) mg ml. similarly, an improvement was observed in vmax in the in presence of this ion, with values rising from 1.76 (0.06) to 2.07 (0.03) mol min mg. other purified exo - pgs have shown widely differing values in their kinetic parameters, which range from 0.11 mg ml to 4.47 mg ml for km and 1.68 mol min mg to 1100 mol min mg for vmax [3033 ]. the properties of exo - pg iii from p. viridicatum described in this work revealed quite different properties from those of another pg (exo - pg ii) from the same fungus such as molecular weight (92 and 24 kda, resp.) and optimum ph of activity (5.0 and 6.0, resp.). besides, the pg iii, purified in this work, proved to be an exo - pg inhibited by to ba at 10 mm which enhanced the stability of exo - pg ii, on the other hand, its stability against ph variation, thermostability, and substrate affinity were improved in presence of ca. the effect of ca and ba on stability and activity of exo - pgs brings out one step closer for improvement of pectinase efficiency when used in bioprocess application as juice extraction. | an exo - pg obtained from penicillium viridicatum in submerged fermentation was purified to homogeneity. the apparent molecular weight of the enzyme was 92 kda, optimum ph and temperature for activity were ph 5 and 5055c. the exo - pg showed a profile of an exo - polygalacturonase, releasing galacturonic acid by hydrolysis of pectin with a high degree of esterification (d.e.). ions ca2 + enhanced the stability of enzyme and its activity by 30%. the km was 1.30 in absence of ca2 + and 1.16 mg ml1 in presence of this ion. in relation to the vmax the presence of this ion increased from 1.76 to 2.07 mol min1mg1. |
all study participants were recruited through voluntary counseling and testing centers in nairobi, kenya, from september 2007 to december 2009, and represent a subset of a larger cohort study presented elsewhere. all study participants were hiv - exposed, seronegative women in heterosexual relationships with hiv - positive partners. eligible participants were aged > 18 years, reported sexual intercourse with their partner 3 times in the 3 months before screening, and planned to remain together for the duration of the study (up to 24 months). samples analyzed in this study included those that were collected 1 year after study enrollment. the women included in the subset for this study were grouped based on birth - control method used during this time dmpa users (n = 23) or controls not using hormonal contraceptives (total : n = 63 ; condom only : n = 31 ; tubal ligation : n = 3 ; copper intrauterine device : n = 1 ; none : n = 27 ; natural / rhythm : n = 1)and based on their self - reported vaginal drying practices : women who vaginal dry (n = 46) and those who do not (n = 40). depot medroxyprogesterone acetate users self - reported using dmpa as their current birth control method and also reported lifetime use of the method (median = 12 months ; interquartile range [iqr ] = 1.522). all participants were tested for hiv-1, bacterial vaginosis, trichomonas vaginalis, treponema pallidum, and herpes simplex virus type 2 and reported any symptoms of vaginitis or cervicitis at the time of enrollment. sociodemographic variables collected from these individuals also included age, sexual frequency in the previous month, vaginal cleansing practices, vaginal drying practices, partner viral load, and relationship length. participants with incident pregnancies during the year of study follow - up were excluded from our analysis. written informed consent was obtained from all study participants, and ethical approval was granted by institutional review boards at university of washington (30243), karolinska institutet (2009/264 - 31/3), university of manitoba (hs16416, h2013:200), and kenyatta national hospital (p151/07/2006). samples were collected by 2 cotton - tipped swabs from the cervical os and posterior vaginal fornix. both swabs were transferred into a vial containing 5 ml of phosphate - buffered saline, transferred on ice to the laboratory within 2 hours of collection, spun down to remove cellular debris, and cryopreserved at 80c. fifty micrograms of protein from each sample were digested with trypsin and analyzed by tandem mass spectrometry using an orbitrap velos mass spectrometer as described previously. human peptide identity searching was performed using mascot v2.4.0 against the swissprot database restricting taxonomy to human. bacterial peptide identity searches were performed using a manually curated trembl database containing the major identified genera identified from an initial search and taxa described previously by 16s rrna studies (21 genera total). search results were imported into scaffold to validate the protein identifications, using the following criteria : 0.1% false discovery rate (fdr) for peptide identification, 1% fdr for protein identification, and at least 2 unique peptides identified per protein. host proteome results were imported into progenesis lc - mass spectrometry (ms) software to perform label - free differential protein expression analysis based on ms peak intensities. feature detection, normalization, and quantification were all performed using default settings from the software. microbial abundance was calculated by summing normalized total spectral counts from scaffold for all proteins associated with each genus. database construction and analysis details are described in the supplementary methods. to adjust for underlying sources of variation within the data set, sociodemographic, clinical, and behavioral variables that were significantly different (p 18 years, reported sexual intercourse with their partner 3 times in the 3 months before screening, and planned to remain together for the duration of the study (up to 24 months). samples analyzed in this study included those that were collected 1 year after study enrollment. the women included in the subset for this study were grouped based on birth - control method used during this time dmpa users (n = 23) or controls not using hormonal contraceptives (total : n = 63 ; condom only : n = 31 ; tubal ligation : n = 3 ; copper intrauterine device : n = 1 ; none : n = 27 ; natural / rhythm : n = 1)and based on their self - reported vaginal drying practices : women who vaginal dry (n = 46) and those who do not (n = 40). depot medroxyprogesterone acetate users self - reported using dmpa as their current birth control method and also reported lifetime use of the method (median = 12 months ; interquartile range [iqr ] = 1.522). all participants were tested for hiv-1, bacterial vaginosis, trichomonas vaginalis, treponema pallidum, and herpes simplex virus type 2 and reported any symptoms of vaginitis or cervicitis at the time of enrollment. sociodemographic variables collected from these individuals also included age, sexual frequency in the previous month, vaginal cleansing practices, vaginal drying practices, partner viral load, and relationship length. participants with incident pregnancies during the year of study follow - up were excluded from our analysis. written informed consent was obtained from all study participants, and ethical approval was granted by institutional review boards at university of washington (30243), karolinska institutet (2009/264 - 31/3), university of manitoba (hs16416, h2013:200), and kenyatta national hospital (p151/07/2006). samples were collected by 2 cotton - tipped swabs from the cervical os and posterior vaginal fornix. both swabs were transferred into a vial containing 5 ml of phosphate - buffered saline, transferred on ice to the laboratory within 2 hours of collection, spun down to remove cellular debris, and cryopreserved at 80c. fifty micrograms of protein from each sample were digested with trypsin and analyzed by tandem mass spectrometry using an orbitrap velos mass spectrometer as described previously. human peptide identity searching was performed using mascot v2.4.0 against the swissprot database restricting taxonomy to human. bacterial peptide identity searches were performed using a manually curated trembl database containing the major identified genera identified from an initial search and taxa described previously by 16s rrna studies (21 genera total). search results were imported into scaffold to validate the protein identifications, using the following criteria : 0.1% false discovery rate (fdr) for peptide identification, 1% fdr for protein identification, and at least 2 unique peptides identified per protein. host proteome results were imported into progenesis lc - mass spectrometry (ms) software to perform label - free differential protein expression analysis based on ms peak intensities. feature detection, normalization, and quantification were all performed using default settings from the software. microbial abundance was calculated by summing normalized total spectral counts from scaffold for all proteins associated with each genus. to adjust for underlying sources of variation within the data set, surrogate variable analysis was performed using the software r (version 3.2.2). sociodemographic, clinical, and behavioral variables that were significantly different (p 1.3 ; p 1.3 ; p <.003), whereas underrepresented pathways included fibroblast proliferation and connective tissue adhesion (z score < 1.8 ; p <.002). increased injury signals in the female genital tract mucosa are associated with the use of depot medroxyprogesterone acetate (dmpa) and vaginal drying. a, hierarchical clustering of differentially abundant proteins among dmpa users and nonhormonal contraceptive user controls (kendall s tau distance metric, complete linkage) individuals with levels 1.5 fold higher than the mean were considered to have an injury signature. vaginal drying independently was significantly associated with an increased risk of injury (p =.01), as was dmpa (p =.004), and the combination of dmpa use and vaginal drying together was associated with an even greater injury signal (p =.0001). the comparisons shown are between each separate variable (vaginal wash, vaginal dry, dmpa, and dmpa with vaginal drying) and controls (women who do not vaginal wash or dry or use dmpa) where each variable was adjusted for in its own model. vaginal drying was associated with 30 differentially abundant proteins (student s t test ; p <.05), as seen in comparison with women who did not practice vaginal drying (supplementary table 2). these included increased levels of blood proteins involved in oxygen transport (hbb, hbd) and cadherin binding (plec, sfn trim29). proteins with known roles in focal adhesion and actin cytoskeleton organization (actr3, cfl1, ezr, myh9, plaur, zyx) were significantly lower. pathway analysis identified phagocytosis as a major inhibited biological function (azu1, ezr, myh9, padi4, plaur) (z score < 1.95 ; p <.002). a comparative analysis showed that 5 factors were commonly affected by both dmpa and vaginal drying, including lower levels of antimicrobial defense proteins (azu1, myh9, tmprss11e) and higher levels of hemoglobin proteins (hbd, hbb). independent adjusted models showed that hemoglobin protein levels were higher in women who practiced vaginal drying (fold change = 1.85 ; p =.01, student s t test) and those who used dmpa (fold change = 2.1 ; p =.004, student s t test) and that levels were greater still among dmpa users who also practiced vaginal drying (fold change = 3.8 ; p =.0001, student`s t test figure 1b) compared with controls who did not practice vaginal washing or vaginal drying and did not use dmpa. a multivariate model (supplementary figure 2) confirmed this barrier injury signature such that alad (delta - aminolevulinic acid dehydratase), a protein involved in porphyrin synthesis and a precursor for hemoglobin production, and barrier inflammation proteins (il36 g, hmgb1, hp) were positively associated with dmpa use. meanwhile, proteins important for maintaining and repairing the mucosal barrier were concurrently decreased (tff3, f11r) (supplementary table 3). we identified 486 unique microbial proteins from 18 different genera. clustering placed the major microbial communities into 2 groups : one dominated by predominantly lactobacillus species (group i, n = 56, 65.1%) and the other dominated by non - lactobacillus, including bacteria from the phyla actinobacteria, proteobacteria, and bacteroidetes (group ii, n = 30, 34.9%) (figure 2a and supplementary figure 3). group i included 2 subgroups, one mainly dominated by lactobacillus (subgroup a, n = 45, 52.3%), and the other heterogeneous, containing lactobacillus and clostridium species (subgroup b, n = 11, 12.8%). subgroup a species composition was 75% lactobacillus iners, 14% lactobacillus crispatus, and 11% other lactobacillus species. group ii contained two subgroups, one predominantly made up of gardnerella vaginalis with lower amounts of other anaerobes (subgroup c, n = 27, 31.4%), and a minor subgroup dominated by pseudomonas and streptomyces (subgroup d, n = 3, 3.5%). a, bacterial abundances were calculated by summing normalized total spectral counts for all proteins associated with each genus. hierarchical clustering of the samples was performed using unsupervised, average euclidean linkage of the proportional bacterial abundance of each sample, resulting in 2 major clusters : one dominated by lactobacillus (group i), and the other dominated by non - lactobacillus bacteria (group ii). subgroups are as follows : a = lactobacillus predominance ; b = lactobacillus / clostridium heterogeneous ; c = gardnerella vaginalis predominance, d = pseudomonas and streptomyces predominance. b, shannon s diversity indices were compared between women who vaginally washed, vaginally dried, or used depot medroxyprogesterone acetate (dmpa) and their respective controls, showing increased ecological diversity associated with vaginal drying practices (mann - whitney u test, = p <.01). there was no discernable relationship between dmpa use and vaginal washing with vaginal community structure based on bacterial community profiles or microbial diversity measurements. however, women who practiced vaginal drying had increased bacterial diversity (mean h index standard deviation : 0.71 0.46) and lower lactobacillus abundance compared with those who did not (h index : 0.45 0.36 ; mann - whitney u test, p =.009) (figure 2b). it has been proposed that dmpa and intravaginal practices are associated with an increased risk of hiv acquisition [4, 5, 20, 26, 27 ], and the mechanisms behind this enhanced vulnerability have been partly explored but have not been fully elucidated [16, 18, 20 ]. first, dmpa use was associated with increased levels of skin inflammatory and hemoglobin proteins with concurrent decreased levels of factors responsible for maintaining the epithelial barrier [2830 ], repairing damaged mucosal tissues [31, 32 ], and mediating inflammation [3335 ]. second, both dmpa use and vaginal drying independently associated with an increase in blood / injury biomarkers ; however, both variables in combination (dmpa + vaginal drying) had the most severe injury signature, suggesting that these factors together may have compounding effects that lead to epithelial barrier weakness. finally, vaginal microbiome alterations are evident in women who practice vaginal drying, leading to increased bacterial diversity and higher levels of anaerobic bacteria known to be associated with increased risk of hiv. depot medroxyprogesterone acetate has been previously associated with vaginal barrier thinning and weakness [37, 38 ], although this has not been the case in all studies [39, 40 ]. maintaining our findings suggest that these functions are impaired in women using dmpa, exemplified by signatures of activated bleeding and inflammation pathways, which could increase vulnerability to cervicovaginal barrier damage, particularly when faced with mechanical stress experienced during coitus. indeed, our multivariate model showed an inverse relationship between increasing skin inflammatory proteins, including zonulin, with decreasing wound repair factors, such as trefoil factor 3, among dmpa users, which collectively could contribute to increased tissue permeability due to their known functions in tight junction disassembly and tissue repair. this agrees with observations of ectocervical thinning, decreased epithelial junction proteins, and an increase in barrier permeability with dmpa use by in vivo evaluation and from animal models [43, 44 ]. although this study was not designed for the purpose of enumerating cervicovaginal immune cells, this agrees with previous observations of increased cervicovaginal hiv target cell numbers with dmpa use and may represent pathways that are affected by dmpa underlying or driving their recruitment. collectively, this suggests a model where epithelial damage at the molecular level of the genital mucosa affects barrier function, allowing hiv greater access to susceptible target cells, which are likely higher in frequency (figure 3). model of molecular effects of depot medroxyprogesterone acetate (dmpa) use on the vagina mucosa. the use of dmpa is associated with a molecular signature, which suggests that the genital epithelium is weak and likely more prone to injury when faced with any kind of mechanical stress. breach signals are evident, leading to an increase in the release of inflammatory molecules, which serve to attract immune cells to the breach site. proteins involved in this inflammatory signalling cascade are increased in women using dmpa, whereas mucosal protection and repair proteins are reduced. this lack of mucosal protection and reparation may further exacerbate risk of human immunodeficiency virus (hiv) infection in dmpa users as the portal of entry that is generated is likely slow to heal. further to this, dmpa users who practice vaginal drying appear to exacerbate this phenomenon, which likely contributes to an even great risk of hiv infection due to this compounding effect. another critical component of vaginal health is the composition and function of the microbial community found within this compartment. indeed, lactobacillus - dominant communities are known to be important for vaginal health, as the secretion of lactic acid and antimicrobial peptides helps to maintain a low vaginal ph and deter opportunistic pathogens. a shift to other community types that contain facultative anaerobes or anaerobic bacteria such as gardnerella vaginalis, prevotella, mobiluncus, atopobium, as well as others, are associated with adverse reproductive health outcomes [15, 47, 48 ]. here, we report that vaginal drying practices are associated with increased bacterial diversity and higher levels of heterogeneous communities containing g. vaginalis, with increased inflammatory signatures. this has particular relevance to hiv risk, given that women with higher microbial diversity and non - lactobacillus communities have higher mucosal inflammation, increased target cells, and an impaired ability to repair wounds. therefore, vaginal drying practices may exacerbate hiv risk in women through modulation of vaginal microbiota, which could have consequences on mucosal barrier function and stimulation of cellular inflammatory processes. menstrual cycle information was not available, and it is possible that inflammation signatures may have been affected by changes between menstrual cycle phases. however, a comparison of our dmpa data set with these menstrual cycle data sets showed these signatures had little overlap (5%, 3 proteins), thus supporting the idea that the molecular signatures observed were likely restricted to dmpa use. furthermore, samples were not collected from women who self - reported being on their period or were visibly menstruating. in summary, dmpa use was significantly associated with signatures of epithelial wounding and reduced levels of proteins important for tissue repair. intravaginal drying was associated with injury biomarkers and increased bacterial diversity that are related to increased mucosal inflammation, impaired wound healing, and increased hiv infection risk. this study provides new insight into the impact of dmpa use and vaginal drying on mucosal barriers, and future investigations are needed to confirm their relationship to hiv susceptibility risk in women. consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author. | abstractbackground.increasing evidence suggests depot medroxyprogesterone acetate (dmpa) and intravaginal practices may be associated with human immunodeficiency virus (hiv-1) infection risk ; however, the mechanisms are not fully understood. this study evaluated the effect of dmpa and intravaginal practices on the genital proteome and microbiome to gain mechanistic insights.methods.cervicovaginal secretions from 86 kenyan women, including self - reported dmpa users (n = 23), nonhormonal contraceptive users (n = 63), and women who practice vaginal drying (n = 46), were analyzed using tandem - mass spectrometry.results.we identified 473 human and 486 bacterial proteins from 18 different genera. depot medroxyprogesterone acetate use associated with increased hemoglobin and immune activation (hbd, hbb, il36 g), and decreased epithelial repair proteins (tff3, f11r). vaginal drying associated with increased hemoglobin and decreased phagocytosis factors (azu1, myh9, plaur). injury signatures were exacerbated in dmpa users who also practiced vaginal drying. more diverse (h index : 0.71 vs 0.45 ; p =.009) bacterial communities containing gardnerella vaginalis associated with vaginal drying, whereas dmpa showed no significant association with community composition or diversity.conclusions.these findings provide new insights into the impact of dmpa and vaginal drying on mucosal barriers. future investigations are needed to confirm their relationship with hiv risk in women. |
turner syndrome (ts) is one of the most common chromosomal abnormalities, its incidence being between 1/2500 and 1/5000 live births among girls. in approximately 50% of the cases, the karyotype anomaly is 45 monosomy ; however, a variety of other anomalies, including mosaicism, xp or xq deletion, and isochromy of the x long arm are known. the short stature in ts is attributed in a large part to haploinsufficiency for the pseudoautosomal gene short stature homeobox protein shox. although girls with ts are not usually growth hormone (gh) deficient, treatment with exogenous recombinant human gh is widely used to augment adult height. numerous factors seem to influence the decreased lean body mass (lbm) and the increased fat mass (fm), such as sex hormones, the growth hormone (gh)/insulin - like growth factor 1 (igf-1) (gh / igf) system, maximal oxygen uptake (or physical fitness), insulin sensitivity, ghrelin and leptin, and possibly other factors. distinct differences in the regional body composition were present in young ts girls (9 - 15 years) in comparison with age- and body mass index (bmi)-matched controls. the aim of this study was to construct the new body fat centiles for egyptian untreated ts and to present the body fat references. the study included 70 females with ts recruited from the out - patient clinic of clinical genetics department, national research centre (nrc). upon entry in the study, all subjects received oral and written information concerning the study, before giving written informed consent. each patient was subjected to history taking, pedigree construction and analysis, meticulous clinical examination of all body systems and essential body anthropometric measurements. standard cytogenetic analysis following giemsatequnique banding gtg banding technique was carried out for all patients on metaphases derived from the phytohemagglutinin stimulated peripheral blood lymphocytes by standard methods. a total of 50 metaphases were karyotyped and analyzed according to international system of human cytogenetic nomenclature (iscn)(2005). classic ts 45, x karyotype was found in 78.6% of cases (n = 55), 45, x/46, xx in 14.3% (n = 10), 45, x/46, x, i (xq) in 4.3% (n0 = 3) and 45, x/46, x, r (x) in 2.8% (n = 2). body composition analyzer (tanita corporation, tokyo, japan) with correction for light indoor clothing was used to measure the body composition parameters. the measurement procedure required the subject to stand in bare feet on the analyzer and to hold a pair of handgrips, one in each hand. the prediction equations used in this model are based on bio - impedance, weight, height, and age and were derived from the calibration studies against whole - body dual x - ray absorptiometry. the method is based on the fact that the lean tissue of the body is much more conductive due to its higher water content than fat tissue. the bia can measure and track changes in the amounts of body fluids, fat, and lbm, which includes muscles and organs. the bia distinguishes where the water is located in body - either intracellular or extracellular. functionally, the bia assesses how much of the body is acting as functioning cells, transport tissue or storage cells (fat). data is presented as means with the standard deviation (sd) or as proportions. statistical analysis and centile curves for body fat percentage were constructed for ts girls using the least mean square lms method, which summarizes the data in terms of three smooth age - specific curves, namely l (lambda), m (mu), and s (sigma). the m and s curves correspond to the median and co - efficient of variation of body fat percentage at each age whereas, the l curve allows for the age - dependent skewness in the distribution of body fat percentage. for the construction of the percentile curves, data were imported into the lms software (version 1.25) and data is presented as means with the standard deviation (sd) or as proportions. statistical analysis and centile curves for body fat percentage were constructed for ts girls using the least mean square lms method, which summarizes the data in terms of three smooth age - specific curves, namely l (lambda), m (mu), and s (sigma). the m and s curves correspond to the median and co - efficient of variation of body fat percentage at each age whereas, the l curve allows for the age - dependent skewness in the distribution of body fat percentage. for the construction of the percentile curves, data were imported into the lms software (version 1.25) and table 1 shows the means and sd reference values of body composition of ts girls aged from 13 years to 17 years. body fm % increased up to age 14 year with a marked increase after age 15 year. fat free mass (ffm) % increases slightly by age, while lean / fat ratio and total body water percentage (tbw %) decrease up to age 17 years. body compositional reference values of egyptian ts girls by age groups figure 1 illustrates curves of body fat % at 2, 75, 50, 25, and 98 centiles for egyptian untreated ts girls aged 13 - 17 years. the 50 centile continues to rise, and the other centiles diverge from the 50 centile. ts girls show a relatively flat 50 centile ranged between 24% and 28% body fat over the entire age range. bmi was ranged between 20 kg / m and 27 kg / m over the entire age range. in this study, we found no relation between karyotype and any of the measured variables. the present data showed that body composition in the untreated ts girls is profoundly changed, with increased amounts of body fat when compared with normal standard egyptian controls. on the other hand, the present study showed that body fm % was lower in our cases compared with age - matched american untreated ts girls. it has shown that gh - treated individuals had on average 15% less adipose tissue and approximately 8% more lean mass compared with untreated girls. gh treatment is well - known to promote anabolism of lean tissue and reduce adiposity in adults, with or without gh deficiency. two small longitudinal studies showing that gh treatment increased lean mass and decreased adiposity in girls with ts. leger. found increased thigh muscle volume in eight girls with ts over 12 months of gh treatment, and gravholt. observed increased muscle and decreased fat after 2 months of gh treatment. body composition, gender, age, and spontaneous gh secretion have been shown to be interrelated. obesity is associated with low circulating levels of gh, a situation that can be reversed by weight loss. bmi in turner s syndrome was unchanged by treatment with sex hormone, whereas significant increases in ffm and the tbw / ffm ratio were seen with sex hormone treatment. the average bmi in this study was between 20 kg / m and 27 kg / m over the entire age range. the present data showed that ts girls were overweight when compared with age matched egyptian controls, with a higher fm. fm and bmi have been found to be higher in adult turner patients compared with age matched controls, and lbm is inappropriately low, which is similar to the present findings. previous studies reported marked differences in regional body composition in young ts girls (9 - 15 years), in comparison with age - and bmi - matched controls in two different study groups. the authors reported that overweight ts girls have smaller skinfold thickness compared to equally overweight girls and suggested that this difference may be due to either to hidden fat on the trunk, or to increased lbm. reported that females with uts are overweight as a group when compared with a group of normal women, with a higher fm, a lower lbm, however, with a comparable amount of total body water (in %). however, the present study found decreased total body water %, in ts girls. this study provides body fat references, which can be used to base a clinical judgment for obesity in egyptian ts children and provides data to compare with other countries. the present study presents a new centile curve for body fat body for untreated ts girls from 13 years to 17 years. this curve might use for clinical monitoring of body fat for ts girls, whereas the 2 centile and the 98 centile as cut - off points for under - fat and over - fat girls, respectively. | objective : this cross - sectional study was undertaken to construct the new body fat % curve and provide body composition reference data for adolescent girls with turner syndrome (ts). they diagnosed cytogenetically by blood karyotyping and not treated with growth hormone (gh).materials and methods : the study included 70 ts girls from age 13 years to age 17 years. body composition was measured by bioelectrical impedance. smoothed centile charts were derived by using the least mean square (lms) method.results:the new body fat curves reflect the increase of body fat mass (fm) from age 13 years to age 17 years. body fm % of egyptian ts girls was lower when compared with age - matched american untreated ts girls.conclusion:this study presents the new body fat curves and reference values of body composition for untreated egyptian ts adolescent girls. the present charts can be used for direct assessment of body fm % for egyptian ts girls and evaluation for cases on gh treatment or other growth promoting therapy. |
the peak incidence of kd is from 6 months to 2 years of age, which includes approximately 50% of all kd patients1,2). the proportion of kd patients younger than 6 months of age in relation to all kd patients is approximately 10%3,4), which is similar to the 11.2% in japan5) and 7.7% in korea6). in addition, the incidence of kd patients younger than 3 months of age was 1.7% in japan5) and 2.2% in korea6). the incidence of kd is very low in patients younger than 3 months of age3,4) or older than 8 years of age7), and few cases of kd in the neonatal period have been reported8). additionally, because of their higher risk for developing coronary artery abnormalities, precise diagnosis is important4). cardiac lesions, such as coronary artery aneurysms, are a hallmark of kd10 - 12). coronary artery complications develop in up to 25% of affected children if the disease is left untreated13,14), and these lead to mortality in approximately 2% of cases15,16). prompt diagnosis and the administration of intravenous immunoglobulin (ivig) can reduce the incidence of coronary artery abnormalities from 25% to 5%17). to establish a diagnosis, physicians depend on the diagnostic criteria, based on the typical combination of clinical presentations, formulated by the american heart association (aha) (table 1)18) or the japanese kawasaki disease research committee (table 2)19). however, it is becoming evident that all criteria for kd need not be present at the same time and can appear in sequence. for this reason, the diagnosis of kd is based on a high index of clinical suspicion in cases that lack the typical criteria (incomplete kd). because the diagnosis of kd is based upon nonspecific clinical signs and because definitive diagnostic test exists kd should therefore be considered in the differential diagnosis of every child with fever of at least several days ' duration, rash, and nonpurulent conjunctivitis, especially in children younger than 1 year old and in adolescents, in whom the diagnosis is frequently missed. experienced clinicians who have treated numerous kd cases can establish the diagnosis before day 4. fever duration of less than 5 days, which can be achieved by early ivig treatment, can be considered a principal symptom according to the japanese criteria20). several studies have attempted to define risk factors for the development of coronary artery abnormalities in children with kd. identified risk factors include incomplete presentation, delay in diagnosis, duration of fever before treatment, male sex, young and older age, and ivig resistance21,22). incomplete clinical manifestations in infants and ivig nonresponsiveness in the older children are particularly associated with the development of kd - associated coronary artery abnormalities23). most studies also point to the timing of therapy as a critical factor in the development of coronary artery abnormalities. infants younger than 1 year tend to show fewer clinical manifestations of the disease, and various features are common by age group. some studies found that typical mucosal and lymph node changes were absent in infants younger than 6 months. patients younger than 6 months also had a lower incidence of strawberry tongue and indurative edema of the palms and soles compared with older patients24,25). the diagnosis of kd is difficult in infants because its presentation is usually atypical and similar to that of other diseases. in our experience, distinguishing between kd and enteroviral meningitis in febrile infants with cerebrospinal fluid pleocytosis poses a diagnostic challenge26). we identified longer duration of fever before admission, higher absolute neutrophil count, increased c - reactive protein (crp) level, pyuria, and less prominent cerebrospinal fluid pleocytosis as initial features of infants finally diagnosed with kd26). we also encountered the unusual case of infantile parotitis unresponsive to antibiotics and accompanied by prolonged fever that was diagnosed as incomplete kd with coronary complications27). the current guidelines recommend that infants aged 6 months or younger with fever for 7 days or longer without other explanation should undergo laboratory investigation for indicators of a systemic vascular response (i.e., erythrocyte sedimentation rate [esr ], crp level)28). kd is frequently associated with elevation of inflammatory markers including esr, crp, and platelet count. other laboratory findings such as high white blood cell (wbc) count (neutrophilic type), nonseptic pyuria, low sodium levels, hypoalbuminemia, or elevated liver enzymes may supplement the diagnosis29). the presumptive explanations for this phenomenon include the protective effect of passive immunity transmitted from the mother and the lower possibility of exposure to unknown airborne pathogens because the infants live indoors. some studies have reported that infants younger than 6 months old take the longest time to diagnose, are the least likely to fulfill the major clinical criteria, and have the least favorable laboratory results, all of which are risk factors for developing coronary artery abnormalities3,4,30). coronary artery aneurysm is more frequently observed in infants younger than 6 months, although not statistically significant. patients younger than 1 year old have more frequent high wbc count and sterile pyuria, but less neck lympadenopathy30). because many infants present atypically, kd should be considered in all children of 1 year or less with prolonged fever, extreme platelet count elevation, and no compelling alternative diagnosis30,31). witt.32) concluded that coronary artery abnormalities were more common in cases who did not meet the criteria (20%) compared with those who had the complete clinical presentation (7%). despite the potential risks of overdiagnosis and overtreatment, this practice seems justified because the complete criteria are an insensitive indicator of having or developing coronary artery abnormalities. in a retrospective study of 562 patients diagnosed with kd at 8 north american centers, 16 percent were diagnosed after the first 10 days of the illness (i.e., late diagnosis)33). predictors of delayed diagnosis of kd included age below 6 months, clinical presentation of incomplete kd, greater distance from a tertiary center, and variability between clinical centers. the results of this study underscore the need for a high index of suspicion of kd, especially in infants and patients who present with incomplete kd, in order to identify and treat patients in a timely manner. these age - specific characteristics could aid customization of the diagnostic and therapeutic strategies in kd, thereby helping to improve the outcome of the disease. the term " atypical kd " has recently been used to describe patients with an incomplete presentation of the disease, regardless of the presence of coronary complications34,35), and is interchangeable with " incomplete kd. " in the absence of a specific test, the diagnosis of clinically incomplete kd based on the history, physical examination, and clinical laboratory results can be challenging. using the algorithm of the aha for the diagnosis of incomplete kd (fig. 1)14), echocardiography should be performed in presentations with evidence of systemic inflammation, even if there are no clinical criteria of kd. this algorithm is offered as guidance to clinicians until an evidence - based algorithm or a specific diagnostic test for kd becomes available. echocardiography and ivig administration should be considered if the crp level is 3 mg / dl or higher or if the esr is 40 mm / hr or greater14). the aha recommended a diagnostic algorithm of incomplete kd, which consists of 6 supplemental laboratory and echocardiographic criteria (table 3)14,36). the presence of more than 3 laboratory criteria supports the diagnosis of incomplete kd (table 3a). an echocardiogram is considered diagnostically positive if any of the 3 conditions mentioned in table 3b are met. a recent report describes some problems with an excessively restrictive definition of incomplete presentation36). patients who had fever with less than 4 characteristic manifestations were diagnosed with incomplete kd when 2-dimensional echocardiography detected coronary artery involvement. a delay of management may be induced by postponing diagnosis of incomplete presentations until coronary artery abnormality is confirmed. it is now recognized that a large number of patients with kd do not fulfill full clinical kd criteria (i.e., incomplete kd) and that up to 20% of patients who are treated for kd are incomplete cases5,14,37,38). chang.4) showed higher coronary complications in infants less than 6 months old diagnosed as incomplete kd. park.6) also reported differences between patients with kd younger and older than 6 months in the incidence of coronary artery abnormalities (21.0% vs. 18.7%) and coronary artery aneurysms (4.7% vs. 3.1%), respectively. however, lee.39) studied the incidence of coronary artery lesions in kd patients younger than 3 months of age and older than 3 months of age and found no significant difference in the prevalence of coronary artery dilatation (19.9% vs. 18.7%) or coronary artery aneurysms (3.4% vs. 2.6%), respectively. they speculated that this unexpected result was because of the very small number of patients younger than 3 months of age among all kd patients, because the majority of pediatricians have a high index of suspicion for incomplete kd, and because early diagnosis can reduce the incidence of incomplete kd in korea. currently, the diagnosis of incomplete kd can be made in cases with fewer classical diagnostic criteria and with several compatible clinical, laboratory, or echocardiographic findings after the exclusion of other febrile illnesses. some studies state that almost half of the patients with coronary artery abnormalities were incomplete cases14,40). the high incidence of incomplete kd raises the concern that many cases of kd may be undiagnosed and untreated. the risk of delayed diagnosis and management in young infants with an incomplete presentation has been indicated previously41 - 44). however, males and children of asian ancestry appear to have the highest risk, which is consistent with the risk factors for complete presentation. sudo.28) compared clinical risk factors for coronary artery lesions in patients with both incomplete and complete presentations of kd and showed that late ivig administration (7 days of illness) was a significant risk factor for the development of coronary artery lesions in both groups. infantile kd patients also may have more severe coronary abnormalities and a slower resolution than older children. in addition, diastolic function might be vulnerable to impairment in the infant group based on mitral inflow and tissue doppler echocardiographic studies45). the higher rate of incomplete kd in infants may originate from their weakened responses to vasculitis due to an immature immune response, neutralization of superantigen by maternal antibody transferred through the placenta, and cross - reaction to antibody produced by frequent active immunity4). kd should therefore be considered in any infant or child, primarily if younger than 6 months old, with persistent and unexplained fever and laboratory evidence of systemic inflammation, even without more clinical criteria suggestive of the disease, because early recognition and treatment may prevent development of coronary artery dilatation and aneurysm formation. the clinical challenge lies in distinguishing cases of kd that do not fully meet the diagnostic criteria from those that strongly resemble a variety of common childhood disorders. the majority of coronary artery abnormalities in children with kd have been identified at initial echocardiography during the first week of illness. kd must be considered when prolonged fever is present, mainly in young infants in whom the incomplete forms of the disease are more frequent. a diagnostic approach that includes a high index of suspicion for very young infants who have a high fever with no definite clinical presentations of kd is therefore crucial to prevent coronary artery abnormalities. the majority of the " high - risk " patients (i.e., those who develop coronary artery abnormalities) might be identifiable by echocardiography at the time of initiation of therapy. | kawasaki disease (kd) is an acute febrile illness that is the predominant cause of pediatric acquired heart disease in infants and young children. because the diagnosis of kd depends on clinical manifestations, incomplete cases are difficult to diagnose, especially in infants younger than 1 year. incomplete clinical manifestations in infants are related with the development of kd - associated coronary artery abnormalities. because the diagnosis of infantile kd is difficult and complications are numerous, early suspicion and evaluation are necessary. |
breast cancer is the most common invasive cancer in women, with upwards of 1 in 8 women being affected during their lifetime. in 2013 while the incidence rate for invasive breast cancer has increased slightly from 2005 to 2009, the death rate continues to steadily decline. the consistent reduction in breast cancer mortality began in the 1990s, around the time medicare approved coverage for screening mammography, and is largely a reflection of improvements in early detection and/or treatment. despite years of clinical research that demonstrate a reduction in breast cancer mortality attributable to screening mammography [36 ], in november 2009, the united states preventative services task force (uspstf) published updated guidelines for breast cancer screening that markedly differed from their last update in 2002 and significantly decreased recommended screening. these updates recommended against routine mammographic screening for women aged 4049 suggested biennial rather than annual screening for women aged 50 to 74 and opposed screening for women aged 75 and older. these revised guidelines led to a great deal of controversy as they are divergent from those of the american cancer society (acs) and the national comprehensive cancer network (nccn) that call for annual screening mammography starting at age 40 for asymptomatic women and continuing for as long as a woman is in good health. disparate recommendations from professional associations can be the source of confusion among the public and may affect screening behaviors. the purpose of this study was to evaluate the pattern of screening subsequent to the revised uspstf guidelines in a population of women who were newly diagnosed with breast cancer at our institution. the breast cancer database (bcd) at new york university langone medical center (nyulmc) is a prospective database established in january 2010 and intended to include all individuals undergoing definitive breast cancer surgery at our institution. the database includes elements of prediagnosis personal and family history, screening history, method of diagnosis, stage at diagnosis, histopathological characteristics of the tumor, details of treatment, and outcomes. the bcd was queried to identify all women 40 years of age presenting for definitive surgical management of intraductal carcinoma and early or locally advanced breast cancer. we queried the database for the following clinical and pathological variables : age, race, how the cancer was first detected, mass palpability, screening frequency, stage, histology, and er / pr / her2-neu status. patients were divided into 3 age groups based on uspstf guidelines : (1) women aged 4049, who would be excluded from recommendations for screening, (2) women aged 5074, who would be recommended for biennial screening, and (3) women aged 75 years and older, who would be excluded from screening. screening frequency was defined as annual (regular), biennial, or nonregular and was assessed by questionnaire data and confirmed by medical chart review when available. statistical analyses were performed using sas version 9.3 (sas institute, cary, nc). variables of interest, including clinical and histopathological characteristics, were compared across the screening years (january 2010 through december 2012) using pearson 's chi - square and fisher 's exact tests. there were a total of 1112 women with a new diagnosis of ductal carcinoma in situ or invasive breast cancer presented to nyu for definitive surgical management. the median age at diagnosis was 60 years and ranged from 40 to 95 years. in this cohort, 270 (24%) patients were between the ages of 40 to 49 years at the time of their breast cancer diagnosis, 696 (63%) patients were between the ages of 50 to 74 years, and the remaining 146 (13%) patients were 75 years of age and older. the majority of patients were caucasian (76%) and had no family history of breast cancer in a first degree relative (74%) and no personal history of prior breast cancer (89%). overall, mammography was the modality of cancer detection in 684 (61%) women and remained the first method of detection in the majority of women over the study time period without significant change (p = 0.40). less than a third of patients presented with a palpable mass (29%), while the remaining 787 (71%) women presented with clinically occult tumors. there was no statistically significant difference in tumor palpability in our patient population over time (p = 0.31). the majority of women (69%) were annual (regular) screeners, and the frequency of screening (annual versus biennial versus not regular) did not change significantly over time (p = 0.30) (table 1). the majority of our patients presented with stage 0 (23%) and stage 1 (50%) breast cancers that were er positive (82%), pr positive (69%), and her2-neu negative (66%). these tumor characteristics did not change significantly over time : stage (p = 0.66), er (p = 0.12), pr (p = 0.29), and histology (p = 0.79) (table 1). while the majority of women in each age group were annual screeners, the proportion of annual, biennial, and nonregular screeners did vary significantly between age groups (p < 0.0001). specifically, there were significantly more nonregular screeners among women aged 4049 years (28%) compared to women aged 5074 years (15%) and women aged 75 years and older (18%) (table 2). the screening behaviors of women between the ages of 40 to 49 years and women aged 75 years and older did not change significantly from 2010 to 2012. however, there was a significant change in the screening behavior of women aged 5074 (p = 0.02), with a slight decline in the proportion of annual screeners and a small increase in the proportion on nonregular screeners. when we looked at screening frequency, breast cancer stage, and tumor palpability, we found that women who were regular (annual) screeners were most likely to present with early breast cancer, including carcinoma in situ (27%) or stage i (53%) (table 3). these women were also most likely to present with nonpalpable cancers (79%) (table 4). conversely, women who were not regular screeners had an increased risk of being diagnosed with later stage breast cancer (p < 0.0001) and were more likely to present with a palpable mass when compared to women who were regular screeners (56% versus 21% ; p < 0.0001). over the last 25 years, screening mammography, along with improvements in therapy, is responsible for a substantial decrease in breast cancer mortality. multiple reports from randomized controlled trials show improved survival in women who undergo screening mammography compared to those who do not as well as an independent association between screening detection and improved disease - specific and overall survival. specifically, a 2009 meta - analysis of these trials found a statistically significant reduction in breast cancer mortality for women in 2 age groups, aged 3949 (15%) and aged 5059 (14%), randomly assigned to screening mammography versus those who were not assigned to screening (controls). despite the similar mortality reductions between the two age groups, the 2009 uspstf updated guidelines largely deviated from prior guidelines that recommended annual mammographic screening beginning at age 40. the rationale for this change was that, given the lower incidence of breast cancer in this age group, the harms of screening, including high rates of false positives and need for additional imaging, outweighed the potential benefits of early detection. additionally, the 2009 guidelines advocate for biennial rather than annual screening for women aged 50 to 74 a recommendation based on statistical modeling that suggested the longer interval between screening would decrease false positives while maintaining the mortality benefit of annual screening. lastly, the uspstf felt that current evidence was insufficient to support screening mammography in women aged 75 and older. the goal of this study was to evaluate the screening behaviors of women newly diagnosed with breast cancer at our institution in the time period following the updated guidelines. in the three years since the publication of the updated uspstf guidelines, we found that the frequency of screening in our population did not significantly change. during this period, perhaps not surprisingly, the greatest proportion of nonscreeners was found in women aged 4049, where the current uspstf guidelines are in the starkest contrast to guidelines from other agencies. the breakdown of screening behavior in this age group did not change significantly over the study time period. interestingly, we did find a significant change in the screening behavior of women aged 5074. while there was a decline in the proportion of annual screeners, this was not matched by an increase in biennial screening, as one might expect based on the updated guidelines. though it is impossible to prove the impetus behind the change in screening behavior in this age group, we can speculate that an underlying cause may be confusion stemming from disparate screening recommendations. screening frequency among women aged 75 years and older did not change significantly during our observation period. as with the other two age groups, the majority of women aged 75 years and older were annual screeners, with the proportion of nonregular screeners falling between those of women aged 4049 and women aged 5074. regardless of age, our data support the benefits of annual screening mammography for early detection of breast cancer. with routine screening mammography, prior studies have shown that the three major prognostic features of breast cancer (tumor size, grade, and lymph node status) are significantly improved. additionally, stage at diagnosis is a well - known predictor of survival, with 99% survival for localized breast cancer compared to 84% in patients with regional disease and 23% for patients with distant disease. we show that, when compared to biennial and nonregular screeners, regular screeners were more likely to present with early breast cancer, including carcinoma in situ (27%) and stage i (53%) invasive breast cancer. additionally, over two - thirds of regular screeners presented with nonpalpable or clinically occult cancers, while about half of both biennial and nonregular screeners presented with palpable, later stage, and breast cancer. a retrospective analysis of the major screening trials found a strong association between risk of breast cancer mortality and diagnosis of advanced breast cancer. the approximately proportional decreased risk of advanced breast cancer and decrease in breast cancer mortality helped to show that screening leads to a decrease in the relative risk of advanced disease and subsequent mortality. in a similar vein, cady. noted that a reduced rate of advanced breast cancer can be used as a surrogate for success of screening, since screening mammography reduces mortality by earlier detection of biologically progressive cancers. moreover, a recent longitudinal prospective control cohort study found that woman aged 4049 with mammographically detected cancers were not only more likely to have lower stage disease detection than those with patient or physician detected cancers but were also less likely to die of disease and less likely to have recurrences. therefore, though we are unable to assess the mortality benefit of screening in our population due to short - term followup, we are able to show success of screening by demonstrating earlier detection of clinically occult tumors in regular screeners as compared to more advanced, palpable tumors in less frequent and nonregular screeners. the benefit of early detection of breast cancer afforded to annual screeners enables for a more conservative approach to treatment and allows surgical, medical, and radiation treatment to be more effective. breast conserving therapy (bct), consisting of lumpectomy, possible node dissection, and adjuvant radiation, is a less morbid, more conservative treatment that is more likely to be an available option to regular screeners with early stage cancers as compared to more extensive treatments often required by the advanced cancers of nonregular screeners. findings from a recent population - based prospective registry study support that bct confers at least equivalent, if not superior, survival to mastectomy. additionally, detection of early stage breast cancer potentially spares the patient exposure to cytotoxic systemic chemotherapy, whose side effects are not just limited to the short term. in our population, in a speculative analysis, up to 48% of non - regular screeners could have potentially been spared chemotherapy had they undergone annual screening mammography. notably, the harms of treating more advanced disease and increased recurrence risk in nonscreeners were not considered by the uspstf when the guidelines were updated. this study utilized a breast cancer database that prospectively enrolls all patients presenting to our institution, a high volume cancer center, for definitive surgical management of the breast cancer. though the generalizability of data from a single, large urban academic institution can be questioned, our population of women represent a highly educated (65% with college degree or higher), insured population. as such, screening behavior in our population is unlikely to be confounded by access to mammography and instead more likely to be impacted by changes in guidelines and resulting recommendations of primary physicians. another potential limitation of this study is that screening behavior was assessed by self - report via a questionnaire administered to patients on enrollment and is subject to recall bias. however, we were able to confirm the self - reported frequency with dates of mammograms prior to diagnosis and found 100% concordance. lastly, since we started enrolling patients in january 2010, we can not comment on screening behavior in our patient population prior to the updated uspstf guidelines. therefore, we are only able to evaluate the trend in screening in the years since the update and are unable to comment on how mammogram frequency changed as a result of these updates. while we can only speculate as to whether the impetus for this change is based on the patients ' own decision making or due to changes in recommendations by primary physicians, it will be interesting to see if this trend continues as we continue to enroll more patients. despite these limitations, our data are in line with prior studies that support the benefit of regular mammographic screening in detecting early breast cancer [5, 6 ]. we found that, in the years subsequent to the guideline updates, the overall screening frequency in our population did not change significantly. our results suggest that women who are not screened annually are at increased risk of a delay in breast cancer diagnosis, which may impact treatment options and outcomes. | purpose. in november 2009, the u.s. preventative service task force (uspstf) revised their breast cancer screening guidelines. we evaluated the pattern of screening subsequent to the altered guidelines in a cohort of women. methods. our database was queried for the following variables : age, race, method of diagnosis, mass palpability, screening frequency, histology, and stage. statistical analyses were performed using pearson 's chi - square and fisher 's exact tests. results. 1112 women were diagnosed with breast cancer from january 2010 to 2012. the median age at diagnosis was 60 years. most cancers were detected on mammography (61%). the majority of patients had invasive ductal carcinoma (59%), stage 0 (23%), and stage 1 (50%) cancers. the frequency of screening did not change significantly over time (p = 0.30). however, nonregular screeners had an increased risk of being diagnosed with later stage breast cancer (p < 0.001) and were more likely to present with a palpable mass compared to regular screeners (56% versus 21% ; p < 0.001). conclusions. in our study, screening behavior did not significantly change in the years following the uspstf guidelines. these results suggest that women who are not screened annually are at increased risk of a delay in breast cancer diagnosis, which may impact treatment options and outcomes. |
the number of diagnosed new cases of prostate cancer is increasing in the united states as well in the european union [13 ]. additionally, for the last decades significant migration of clinical stages has been observed which resulted in rise in the number of patients in low or intermediate risk of relapse. on the other hand, the number of patients representing an advanced stage of disease, which is related to the high - risk of relapse, is decreasing. despite these facts, a significant number of patients constitute the high - risk group with high probability of micrometastases in the regional lymph nodes. for this group optimal management the role of radiotherapy (rt) in treatment of high - risk prostate cancer is generally established, although there are still many controversies concerning the optimal total dose, definition of irradiated volume (whole pelvis versus prostate only), and ways of the most efficient combination with androgen deprivation therapy (neoadjuvant versus adjuvant and the timing of androgen deprivation). several clinical studies have demonstrated that rt combined with adjuvant long - term androgen deprivation therapy (l - adt) for high - risk patients is associated with improved biochemical progression - free survival (bpfs), cause - specific survival (css), and overall survival (os) [69 ]. however, these studies did not compare the whole pelvic radiotherapy (wprt) combined with neoadjuvant androgen deprivation therapy (n - adt) and l - adt with prostate radiotherapy only (port) combined with l - adt [10, 11 ]. in consequence, the effectiveness of the regional lymphatic network irradiation combined with n - adt has not been established. it is extremely important to evaluate the role of wprt because pelvic irradiation could raise the intensity of side effects [12, 13 ]. thus, the question arises about the therapeutic gain related to wprt combined with n - adt over the prostate only irradiation [1417 ]. the aim of this study was to evaluate whether n - adt combined with wprt and l - adt is associated with survival benefit over port and l - adt for the cohort of patients defined as the high - risk group of prostate cancer. from may 1999 to december 2004, 162 patients were entered into prospective comparison study. all patients defined as the high risk were treated with three - dimensional conformal radiotherapy (3d crt) and l - adt at the greater poland cancer center in poznan, poland. all patients represented good general performance status defined as 0 or 1 according to the eastern cooperative oncology group (ecog) classification. patients were classified as the high - risk patients when at least one of the following conditions was present : gleason score > 7 or initial prostate - specific antigen (psa) level > 20 ng / ml or t3. statistic analysis was conducted to explore the balance of known prognostic factors in the two groups. the distribution of age, gleason score, psa, and risk of lymph nodes metastases was similar between the two groups (table 1). the average level of psa before the beginning of treatment was for the group a 37.3 ng / ml (range : 1970 ng / ml) and for the group b 38.1 ng / ml (range : 670 ng / ml). pelvic lymph nodes were evaluated by computer tomography. only patients with no signs of metastases in these examinations the median level of risk metastases to lymph nodes based on the formula proposed by roach iii. for all patients was 32% (range : 23%67%). treatment strategy (n - adt + wprt versus port) for individual patient was chosen after discussing all cons and pros of two methods with treating physicians (urologist and radiation oncologist). as many as 70 out of 162 (43%) patients chose wprt with n - adt (group a). the second option of treatment (port + l - adt) was chosen by 92 (57%) of 162 patients (group b). all patients included into group a have started n - adt immediately after confirmation of histological diagnosis. all patients were treated with lhrh analogs started on a 1 monthly preparation of gosereline acetate and then moved to 3-monthly 10.8 mg depot preparation. additionally, patients received two weeks before lhrh analog treatment a short - time antiandrogen therapy to prevent the flare syndrome (flutamide 250 mg p.o. n - adt duration ranged from 2 to 10 months (median 4.4 months). all patients (group a and group b) were treated with l - adt (lhrh analog) from the last day of irradiation. the median duration of l - adt was 28.4 months (range : 337) and 29.1 months (range : 939) for the group a and group b, respectively. in case of biochemical failure (the psa recurrence defined according to the phoenix definition) an antiandrogen was added to lhrh analog as a second line hormonal therapy or the lhrh analog was introduced again. simulation and treatment were performed in a supine position (using knee support and laser beams) with comfortable full bladder filling. for radiotherapy planning all patients underwent pelvic ct scan in the treatment position ; 5-mm slice thickness is used from the top of iliac bone to at least 5 cm below the base of the penis. for all patients the following organs at risk (oar) were outlined : bladder, rectum, intestine, and femoral heads. planning target volume 2 (ptv 2) was the pelvic lymph nodes (the obturator, hypogastric, presacral, internal, and external iliac nodes) and prostate with seminal vesicles with a 1 cm margin and was treated with total dose of 46 gy. therefore, the superior border of the field was placed at the level of division of common iliac vessels. ptv 1 encompassed the prostate and seminal vesicles with 1 cm margin, except posterior part of ptv 1 where 0.5 cm margin was added. the reproducibility of the irradiated fields was checked by electronic portal imaging device (epid) performed at the start of the treatment (the first day of irradiation) and weakly thereafter or when the treatment phase was changed. in vivo dosimetry based on termoluminescence dosimetry (tld) was performed for each patient at the beginning (usually at the first day of irradiation) and in the middle of the treatment. radiotherapy was administered using 20 mv photon beam (clinac 2300 cd, varian) in a daily fraction of 1.8 gy or 2.0 gy for the total median dose of 70.2 gy (range : 66 gy74 gy). in each case 3d crt was based on 3-field or 4-field techniques with the application of the multileaf collimators. for the subgroup of patients irradiated to pelvic the total median dose was 46.4 gy (range : 44 gy50 gy) which was applied with box technique (4-field technique). acute side effects were evaluated during the irradiation course and than 1 month after the completion of treatment using the radiation therapy oncology group (rtog)/the european organization on radiation therapy criteria (eortc) morbidity scoring scale. late side effects were evaluated according to the rtog / eortc scale during each visit. patients were seen one month after the completion of radiotherapy and every 3 months thereafter. patients alternated their appointments between their urologists and radiation oncologists. during each visit serum psa level was determined and additionally digital rectal examination (dre) and clinical evaluation were performed. the tandem - r monoclonal method with detection sensitivity of 0.02 ng / ml was used for psa measurement. the median followup duration was 54 months (range : 6101 months) and 55 months (range : 799 months) for groups a and b, respectively. primary endpoints for analysis were overall survival (os), cause specific survival (css), distant metastases - free survival (dmfs), and biochemical progression - free survival (bpfs). os reflected all deaths, css reported deaths that could be attributed to prostate cancer. in those cases for which the cause of death was unclear, death was considered as a result of prostate cancer in case when clinically evident prostate cancer was present at the time of death. the biochemical progression endpoint (psa) for which outcome was compared this definition was selected because it is more accurate than widely used astro definition, especially for patients treated with rt and adt. actuarial results for os, css, dmfs, bpfs, and for late morbidities rates were calculated using the kaplan - meier method. the log rank test was performed to find the correlations between the actuarial results of treatment for the following clinical parameters : age, t stage, gleason score, psa, wprt + n - adt, port. for these calculations p - value of.05 the 5-year actuarial os rates were 89% and 78% for group a (n - adt + wprt) and group b (port), respectively (log rank test, p =.13) (figure 1). a and b, respectively (long rank test, p =.01) (figure 2). the 5-year bpfs rates were 52% versus 40% (p =.07), for groups a and b, respectively (figure 3). distant metastases - free survival (dmfs) for patients at high - risk of nodal involvement, as defined in text, was statistically significantly better for patients treated in combined arm (p =.04) (figure 4). on multivariate analysis combined treatment (wprt + n - adt) (p =.01), lower psa level (p =.01) and lower risk of lymph nodes involvement (p =.01) were statistically significantly associated with longer css (table 3). generally, rt in both groups was well tolerated (table 2). these symptoms typically appeared during the third week of treatment and resolved within a few weeks later. our study showed that short n - adt combined with wprt and l - adt provides significant advantage to port combined with l - adt in terms of css, dmfs, and bpfs. there was no os benefit for the wprt combined with n - adt in comparison to port. obviously, longer followup is needed to translate the benefit from the css and bpfs to os.. indicated similar conclusions from other studies. at present, conformal radiotherapy is one of the most popular modality of treatment for patients with intermediate and high - risk groups of prostate cancer. according to the american urology association (aua), national cancer comprehensive network (nccn), national cancer institute (nci), and the european urology association (eua) guidelines the 3d crt combined with adt is the most advocated standard of care for patients with high - risk of relapse [2426 ]. these guidelines are based on several randomized clinical trials which have demonstrated the benefit of combined therapy (radiotherapy plus adt) [27, 28 ]. however, the optimal timing and duration of hormonal treatment which is combined with radiotherapy remains unresolved. the main limitation of our study is that its nonrandomized trial and thus, it can introduce selection bias. moreover, while the comparison of study groups (table 1) showed that they were similar, group a (n - adt plus wprt) had marginally more aggressive tumors (more patients with gs 810 or t3 tumors, higher psa, and higher risk of lymph node metastases). thus, one might generate the hypothesis that the small benefit of wprt combined with n - adt would be grater (and difference in os could be significant) if the study groups were better balanced. for example, wang and lawton stated that further studies of above mentioned issues are necessary to define the best treatment for patients with high risk of pelvic lymph node involvement. in our study, heterogeneity of therapy modalities used in group a (n - adt plus wprt) can blur the final findings of our analysis. thus, it is impossible to indicate exactly the factor or factors (wprt only or n - adt only or wprt + n - adt) which were responsible for the achieving better results than those in group b. on the other hand, clinical trial rtog 94 - 13 suggested that benefit of wprt could be achieved if large volume was connected with n - adt. androgen deprivation therapy could be combined with rt in many ways, for example, as only n - adt, or on the other hand, as only l - adt, or combination of both. in addition, apart from different possibilities of adding adt and duration of therapy, the differences in irradiated clinical target volume (port only or wprt) may influence the results of therapy. one of the studies which indicated a survival benefit of n - adt combined with wprt was rtog 86 - 10 trial. in this study, the benefits were limited to a group of patients with bulky disease and gleason scores of 2 to 6. reanalysis of conducted rtog trials indicated that n - adt could be beneficial only in a group of patients extended to t1, t2, and gleason score of 7. however, there is no clear statement concerning the implementation of n - adt when radiotherapy is fundamental method of treatment for patients with high risk of relapse. wprt alone (without adt) has a weak influence on the results of treatment [12, 14 ]. probably dose in range from 44 gy to 50 gy is too low to efficiently sterilize lymph nodes from cancer cells. in addition, another factor which is responsible for disappointing results of wprt without n - adt is high risk of distant metastases when high risk involvement of lymph nodes is noted. it is obvious that for these patients even efficient loco - regional therapy has small impact on distant metastases and in consequence on overall survival. thus, many investigators in clinical trials are looking for efficient systemic therapy for this group of patients. the simplest and most convenient way of realizing such scenario in clinical practice would be implementation of adt. for example, the importance of n - adt combined with rt was investigated by damico. what is worth adding, no pelvic irradiation (wprt) had been performed. in conclusion, after the median 45-months followup, authors stated that significant os benefit was noted when 6 months of n - adt were implemented. another important issue is the duration of n - adt when it is combined with radiotherapy. trial performed by damico. indicated that 6 month n - adt is beneficial. is there any difference in effectiveness when short n - adt (3 months) is combined with radiotherapy ? the canadian trial which compares short - term n - adt (3 months) with long - term n - adt (8 months) showed that longer adt has no advantage over short therapy in the high - risk patients. in our study the median time of n - adt was 4.4 months and was similar to proposed in majority of clinical trials. similarly, benefit of short - term adt, in particular in high - risk patients, was demonstrated in the eortc study conducted by bolla., denham., and in the australian study [35, 36 ]. another very important issue is evaluation of the role of l - adt when n - adt is combined with radiotherapy. in literature there are many well prepared clinical studies which proved that long - term adjuvant adt is more efficient than port alone. one of the examples is study conducted by rtog (rtog 9202) where n - adt was introduced 2 months prior to irradiation (short term of n - adt) and then was continued during radiotherapy. in the investigational arm the patients were treated with adt for 2 years after the end of radiotherapy. in a group of patients treated with l - adt and radiotherapy the 5-year os rate was 80%, while in the group of patients treated without additional hormonal therapy was 69%, respectively. another well documented study, which showed a therapeutic benefit, had been carried out by bolla. who confirmed that l - adt conducted for 3 years resulted in an increase of 5 years os from 62% to 79% (p =.001). however, adt combined with radiotherapy in high - risk group of patients gives poor results. in our study interestingly, all patients included into these trials were treated with the wprt. in trial 9202 rtog the short n - adt and wprt were implemented. on the other hand, none of the mentioned trials included the arm with port combined with the l - adt. as a result, these trials could not test the role of wprt combined with n - adt and l - adt when in comparison arm was not included port with l - adt. rtog 9202 study indicated that l - adt is better strategy of treatment for high - risk patients than short - term n - adt. however, this study did not evaluate the role of wprt on the results of treatment. one of the crucial clinical trials which aim is to answer the question concerning the role of wprt combined with n - adt is rtog 9413 [10, 11, 15 ]. this is a four - arm trial which is trying to evaluate the role of wprt combined with short n - adt or short adjuvant adt (4 months). the early results indicated that implementation of wprt and short n - adt had no advantage over port plus n - adt and short - adjuvant adt or port plus short - adjuvant adt. after followup of 44 months there was no benefit in os, but the results defined as css, dmfs, bpfs were significantly better for wprt combined with n - adt. comparison of all four arms indicated that a clear benefit for patients treated with wprt and n - adt (4-year disease - free survival of 60%) was over all three other arms (44% versus 49% versus 50%, resp. ; rtog 9413 study specifically addressed the issue of treatment volume and demonstrated a sequence dependent benefit associated with wprt and n - adt. this trial demonstrated that when n - adt is applied in conjunction with irradiation (wprt) it yields a better progression disease - free survival than port even for low dose of irradiation (46 gy) to the pelvis. comparison of this trial with our study indicated the differences in the applied l - adt. in our study, the l - adt (28 months) had been implemented for both arms (port and wprt). this is clear and very important statement, because in the trial rtog 9413 only short (4 months) adjuvant adt was implemented. results of rtog 9413 and our study suggested that the addition of adt before starting of irradiation could be regarded as the additional biological dose, which kills some number of clonogenic cancer cells and creates better treatment conditions for further radiotherapy. of course, the decreasing level of psa after n - adt can not be interpreted as proportional diminishing of the number of cancer cells. it should be underlined that the latest update of trial 8610 stated in conclusion that the addition of 4 months of n - adt to radiotherapy has a dramatic impact on clinically meaningful end points in men with locally advanced disease. the most important clinical trials in which hormonal therapy has been combined with radiotherapy were implementing wprt. one of the most important issues of our study is the early and late toxicities. although, according to our observations in the group treated with the n - adt and wprt the intensity of early and late toxicities was more pronounced. however, n - adt caused the significant reduction in the volume of irradiated organs at risk because of reduced volume either of prostate cancer or volume of the enlarged prostate gland. on the other hand, in the first phase of irradiation (wprt) more healthy tissue was irradiated. when aiming to minimize the side effects it is important to introduce the n - adt 23 months before starting of irradiation. this policy was mandatory because a decrease in the volume of the prostate gland during the course of irradiation may result in position changes of the organs at risk and could shift them into volume of higher irradiation dose. our results showed that wprt combined with n - adt and l - adt compared to port combined with n - adt and l - adt had an advantage for css and bpfs. it is obvious that n - adt plus wprt could be standard of care for high - risk patients, but question concerned the gain in os is still open. | aim. to study whether use of neoadjuvant androgen deprivation therapy (n - adt) combined with whole pelvic radiotherapy (wprt) for high - risk prostate cancer patients was associated with survival benefit over prostate radiotherapy (port) only. material and methods. between 1999 and 2004, 162 high - risk prostate cancer patients were treated with radiotherapy combined with long - term androgen deprivation therapy (l - adt). patients were prospectively assigned into two groups : a (n - adt + wprt + l - adt) n = 70 pts, b (port + l - adt) n = 92 pts. results. the 5-year actuarial overall survival (os) rates were 89% for a and 78% for b (p =.13). the 5-year actuarial cause specific survival (css) rates were a = 90% and b = 79% (p =.01). biochemical progression - free survival (bpfs) rates were 52% versus 40% (p =.07), for groups a and b, respectively. conclusions. the wprt combined with n - adt compared to port for high - risk patients resulted in improvement in css and bpfs ; however no os benefit was observed. |
zeolites represent a very important class of solid acid catalysts utilized in a number of large - scale industrial applications. the unique combination of acidic and shape - selective properties has made zeolites the workhorse in oil refining and petrochemical applications, including fluid catalytic cracking (fcc), methanol - to - olefins, isomerization, and alkylation processes. a challenge for the rational design of better - performing zeolites is to tune the number, distribution, and nature of acid sites as well as to facilitate the molecular diffusion of reactants and products via the formation of mesopores. therefore, improving the catalytic performance of zeolites calls for a deeper understanding of single zeolite particle reactivity. the brnsted acidic nature of zeolites is generally associated with bridging hydroxyl protons resulting from isomorphous substitution of si (iv) by al (iii). the ability to synthesize well - defined zeolite crystals and to tune their si - to - al ratio as well as the architecture of microporous voids according to the application is certainly without parallel in heterogeneous catalysis. however, molecular transport, and therefore the reactivity, in purely microporous zeolite crystals is tremendously hindered by slow diffusion. steaming of zeolites is the most preferred, simple, and cost - efficient industrial post - treatment method to shorten the effective diffusion pathways and enhance the accessibility of acid sites via the creation of mesopores. during this process, dealumination of the zeolite takes place, which inevitably leads to a partial or a complete loss of brnsted acidity. while structural properties and the interconnection of micro- and mesopores can be studied with high - resolution scanning electron microscopy (hr - sem) and transmission electron microscopy (tem), the acidic properties of zeolites are mainly assessed via bulk measurements, such as solid - state nmr, x - ray absorption spectroscopy, temperature - programmed desorption (tpd), and infra - red (ir) spectroscopy, of numerous probe molecules. very recent advances in scanning transmission x - ray microscopy (stxm) enabled mapping of al coordination in 3d with 30 nm resolution. microspectroscopic methods that utilize probe molecules such as uv vis microscopy, confocal fluorescence microscopy, ir microscopy, and coherent raman spectroscopy, provide essential chemical information about reactive acid sites ; however, they do so with the limited, micrometer, resolution. as a consequence, inherent intra- and interparticle heterogeneities may pass unnoticed despite significantly altering the catalytic activity in space and time. therefore, in order to understand how the synthesis of zeolite material influences its catalytic performance, it is of fundamental importance to further comprehend the nanoscopic differences in the acidity and reactivity of single zeolite particles. single molecule fluorescence microscopy has revolutionized life sciences and the chemical understanding of numerous biological processes. besides offering the ultimate sensitivity limit of an analytic method, it opens possibilities to overcome the diffraction limited resolution of optical microscopy by localizing single fluorescent molecules with nanometer precision. in the fields of heterogeneous catalysis and material science, several examples have demonstrated the remarkable potential of this technique for visualizing the diffusion of fluorescent molecules in mesoporous materials and the reactivity of catalyst particles. however, despite the fact that there are no obstacles in instrumentation, the application of this method in the field of catalysis is seriously lagging behind its biological applications. in this work, we study the acid - catalyzed oligomerization of furfuryl alcohol (fa) taking place at brnsted acid sites of individual zeolite h - zsm-5 crystals. to study the brnsted acidity of zeolite h - zsm-5, we used large zeolite crystals as well - defined model systems. these consist of six individual subunits with the orientation of sinusoidal and straight pores differing between the crystal body and edges, often referred to as 90 intergrowths (figure 1a). as a consequence, molecular transport, diffusion, and reactivity change anisotropically throughout the crystal, influencing the overall catalytic performance of an individual catalyst particle. the concept of nanometer accuracy by stochastic chemical reactions (nasca) microscopy was previously used to resolve the individual catalytic conversions of fa on individual h - zsm-5 and h - mor crystals. using the 3d nasca approach, we now follow real - time changes in the stochastic dynamics of catalytic turnovers in parent and steamed zeolite h - zsm-5 crystals. to quantify the effects of steaming post - treatments on the rate of formation of fluorescent products, we monitored the dynamics of catalytic turnovers at three different types of single zeolite crystals that are intentionally chosen to mimic mild and severe steaming processes (typically used to improve molecular diffusion and alter the strength and accessibility of acid sites)., crystals with different degrees of brnsted acidity and mesoporosity have been prepared, namely, parent crystals (h - zsm-5-p), with preserved brnsted acidity and intact microporosity ; mildly treated crystals (h - zsm-5-mt ; steamed for 5 h at 500 c), with induced surface mesoporosity and preserved brnsted acidity ; and severely treated crystals (h - zsm-5-st ; steamed for 5 h at 700 c), with a high degree of mesoporosity (surface and bulk) and low brnsted acidity. recently, multilaser confocal fluorescence microscopy was used to resolve the location of different fluorescent styrene oligomers in the very same types of model h - zsm-5 crystals. it will be now shown that the unique sensitivity and spatial resolution of nasca microscopy enables accurate quantification of the local turnover frequencies in 3d for nanoscopic zeolite domains within individual, parent and steamed, zeolite h - zsm-5 crystals. this approach can be used to visualize enhanced catalytic activity and large micron - scale heterogeneities in local turnover frequencies of mildly steamed zeolite crystals as well as to measure a significant loss of turnover activity of severely steamed zeolite crystals. furthermore, the approach allows the stochastic behavior of single catalytic turnovers and their temporal correlations within nanoscopic zeolite domains to be studied. on the basis of this method, it was found that the single turnover kinetics of the seemingly homogeneous parent material proceeds with significant spatial, nanoscale, differences and noncorrelated temporal fluctuations. large coffin - shaped zeolite h - zsm-5 crystals (figure 1a) with an average size of 20 20 100 m and a bulk si / al ratio of 17 were used as provided by exxonmobil (machelen, belgium). organic template molecules (tetrapropylammonium, tpa) were removed by careful calcination (1 c / min) at 550 c for 8 h. after template removal, the zeolite crystals were converted into their acidic form by a triple ion - exchange with 10 wt % ammonium nitrate (99+%, acros organics) at 80 c, followed by 6 h calcination at 500 c. to avoid residual fluorescence, prior to use, the crystals were activated at 500 c (1 c / min) for 24 h in static air. zeolite h - zsm-5-p crystals in acidic form have been used for further preparation of steamed samples. steaming was performed under two sets of conditions, with the intention to simulate mild steaming (h - zsm-5-mt) and severe steaming (h - zsm-5-st) of parent h - zsm-5-p crystals. zeolites were heated in a tubular oven to 500 c (h - zsm-5-mt) and 700 c (h - zsm-5-st) at a heating rate of 5 c / min. further steaming treatment was performed using water - saturated (373 c) n2 flow (150 ml / min) for 5 h. details on the preparation and characterization of the crystals with uv vis microscopy, confocal fluorescence microscopy, synchrotron - based ir microspectroscopy, atomic force microscopy, hr - sem, and x - ray photoelectron spectroscopy (xps) have been reported before. single molecule fluorescence experiments were performed using an inverted epifluorescence wide - field microscope (olympus ix-71), equipped with a 100 oil immersion objective lens (1.4 na) and a highly sensitive electron multiplying ccd (emccd) camera (imagem enhanced c9100 - 23b, hamamatsu). wide - field illumination was achieved by circularly polarized 532 nm light from a diode laser (excelsior 532, spectra - physics). fluorescent emission was imaged by the emccd after passing through a dichroic mirror and a 545 nm long - pass filter to remove the excitation light. the image was expanded by a 3.3 camera lens, resulting in a field of view of 24.6 24.6 m and 48 48 nm per pixel. wide - field images of catalytic turnovers were recorded approximately at the middle of the zeolite crystal (figure 1b) with a frame rate of 10 images per second. schematic of the single molecule fluorescence approach used to map in 3d the reactivity of a single h - zsm-5 crystal. (a) intergrowth structure of a zeolite h - zsm-5 crystal indicating the direction of straight and sinusoidal pores in different subunits (color coded). (b) accumulated image of individual fluorescent products depicted with respect to the size of the zeolite crystal. (c) formation of fluorescent products (red) upon protonation of fa (black) on a brnsted acid site. (d) estimate of the analyzed crystalline volume depicting the 3d distribution of fluorescent molecules (red). note that the localization precision in the z - direction is estimated to be 500 nm. the oligomerization of fa (figure 1c) was performed on activated zeolite h - zsm-5 crystals loaded on the top of a cover glass in a reactor designed for liquid - phase experiments. the crystals were exposed to furfuryl alcohol (99%, sigma - aldrich), previously diluted in milli - q water, to achieve desirable catalytic activity. the optimal concentration of fa for high - resolution imaging was determined in a series of concentration - dependent measurements. the reaction was then monitored by focusing at the surface of the bottom subunit (denoted here as z = 0) or by moving the focus to any provisional focal depth in axial z - direction up to z = 20 m (figure 1a), with the estimated precision of 0.2 m. prior to the experiments, the absence of residual fluorescence was verified on individual crystals. recorded movies were analyzed with localizer software developed for igor pro (wavemetrics) and matlab (mathworks). subdiffraction localization of fluorescent events was done by independent segmentation of each frame into emissive spots and background using the approach of serg. the pixels identified by this segmentation were reduced to a list of initial emitter positions by considering adjacent active pixels as belonging to a single emitter. the locations of these emitters can be determined with subdiffraction limited resolution by fitting a 2d gaussian using the levenberg the correct functioning and absence of systematic errors in the algorithm were verified by visual inspection of the processed results. the emitter tracking algorithm, as implemented in localizer software, has been used to correct for the reappearance of fluorescent events in repetitive frames, a necessary step in order to quantify individual turnovers. an iterative procedure was further used to optimize the parameters of the algorithm that take into account the experimental results of single molecule reappearance in subsequent localizations (pixel jump) and blinking of the fluorescent molecule (blinking time). optimal values of 55 nm pixel jump and 0.5 s blinking time were found to be a good experimental correction for the summed effects of photobleaching, blinking, localization precision, and molecular diffusion (supporting information s1). the large majority of fluorescent events can be localized with an estimated lateral precision of 17 9 nm (supporting information s2). however, the optimized algorithm accounts also for the extremes in the localization efficiency (e.g., when one molecule appears in many consecutive frames) in order to eliminate artificially generated hotspots of reactivity. this approach is sensible considering that the probability of consecutively finding two fluorescent molecules within the diameter of 55 nm is very low. the time - of - flight secondary ion mass spectrometry (tof - sims) experiments were carried out on a tof - sims 5.100 machine (ion - tof gmbh, mnster, germany). for data evaluation, the uhv chamber had a base pressure h - zsm-5-p h - zsm-5-st. first, mild steaming increases the single turnover activity in the near - surface regions of a single zeolite crystal and induces clearly visible spatial inhomogeneities in reactivity. finally, reactivity maps at z = 2 and 4 m reveal regions of lower fluorescence activity that are a consequence of a different pore orientation in the crystal subunits, as indicated by yellow arrows in figure 4. from this point on, we will further elaborate on these observations in a quantitative manner by measuring spatiotemporal changes in the turnover frequencies of zeolite domains. single molecule reactivity maps for h - zsm-5-p, h - zsm-5-mt, and h - zsm-5-st crystals recorded at three different focal depths (z = 0 (surface), 2, and 4 m). reactivity is accumulated for 1000 frames after 3 h of reaction in a 5.75 mm solution of fa. yellow arrows indicate the regions with lower reactivity due to a different crystallographic orientation of the subunits. the impact of the intergrowth structure on reactivity can be clearly visualized when a sufficient quantity of single molecule products is accumulated in inner regions of the h - zsm-5 crystal, as illustrated for z = 2 and 4 m (figure 5). models of the h - zsm-5 intergrowth structure : red (top / bottom subunits), straight pores run parallel to the image plain ; blue (side subunits), straight pores run perpendicular to the image plain. the overlaid single molecule maps indicate differences in reactivity for planes that are 2 and 4 m below the surface, after 2.5 h in a 5.75 mm solution of fa. it is striking that the formation of linear fluorescent oligomers proceeds mainly along the straight pores of the zeolite h - zsm-5-p crystal even though the access to the crystalline bulk of the top / bottom subunits is mainly provided via sinusoidal pores (figure 1a). this implies that the circularly polarized laser light interacts predominantly with the transition dipole moments of fluorescent products oriented along the straight pores of zeolite h - zsm-5. likewise, the molecules that are aligned within the straight pores of the side subunits (figure 5) are not efficiently excited with the perpendicular vector component of the laser light and hence these subunits are not taken into account in our quantitative analysis. a strong dependence of the recorded signal from the crystalline anisotropy and the preferential orientation of the guest molecules has been observed on several occasions for h - zsm-5 and h - mor crystals using different microscopic techniques. we have further examined the 3d reactivity profiles of fa in order to provide a complete quantitative picture of the effect of steaming on brnsted reactivity. figure 6 illustrates the temporal evolution of the normalized turnover activities, recorded for the parent (h - zsm-5-p), mildly steamed (h - zsm-5-mt), and severely steamed (h - zsm-5-st) zeolite crystals at four different focal depths. the most notable difference in reactivity of the parent h - zsm-5-p and mildly steamed h - zsm-5-mt zeolite crystals is in the surface regions (depth z = 0). the reactivity profiles evidence slow intracrystalline diffusion of fa, with most of the fluorescent events detected within the 500 nm near - surface layers of the single crystals. the initial uptake of fa molecules and the subsequent oligomerization in h - zsm-5-mt proceeds faster and reaches a 4 times higher reaction rate after 1 h of reaction than that for h - zsm-5-p. the reactivity profile of h - zsm-5-p shows a longer induction period and reaches a maximal turnover activity of 0.63 turnovers per m per second. this value is about 1.8 times lower than that for h - zsm-5-mt after 4 h (figure 6). the surface turnover rates of the measured regions indicate an improved accessibility of the h - zsm-5-mt crystals achieved by mild steaming. it is worth noting that the h - zsm-5-mt crystals show consistently higher near - surface turnover rates than those of h - zsm-5-p crystals. however, the reaction rates recorded at z = 2 m do not differ significantly, indicating that mild steaming does not substantially affect the inner crystalline regions of the zeolite material. in contrast to surface turnover rates for both parent and mildly steamed zeolite crystals, severely steamed h - zsm-5-st crystals showed 460 times lower surface turnover rate than that of h - zsm-5-mt, without notable time - dependent changes. furthermore, the turnover rates at z = 4 m are 3 times higher than those at z = 0 (turnover rate of 2 10 turnover per m per second), suggesting a drastic change in the amount and distribution of active brnsted acid sites upon severe steaming. normalized turnover activities of zeolites h - zsm-5-p, h - zsm-5-mt, and h - zsm-5-st in a 5.75 mm solution of fa plotted as a function of time and focal depth z. the turnover rates are calculated and normalized for the top subunit (see figure 5) in order to eliminate the polarization effect and higher background scattering from the side subunits. the first two experimental points for the h - zsm-5-mt crystal (after 5 and 42 min) were recorded from two different crystals. measured turnover rates are the summed result of mass transfer limitations and the concentration of accessible acid sites. however, the acid sites of h - zsm-5-p are not homogeneously distributed throughout the crystal and change further upon steaming post - treatments. a recent micro - x - ray diffraction (-xrd) and time - of - flight secondary ion mass spectrometry (tof - sims) study of large zeolite h - zsm-5 crystals indicated that there is a strong gradient in aluminum concentration (often referred to as al zoning) present in parent h - zsm-5-p crystals. to corroborate the catalytic activity of the studied zeolite crystals with the changes in al concentration, all three samples were subjected to tof - sims sputter depth profiling measurements (figure 7). as expected from the surface turnover activity profiles and previous hr - sem and xps sputter depth profiling measurements, the most remarkable difference in aluminum distribution can be noticed in the near - surface regions of the crystals. parent h - zsm-5-p crystals typically show a depletion of aluminum in a surface layer of approximately 50 nm (first sputter depth profiling point), whereas mildly and severely treated h - zsm-5-mt and h - zsm-5-st crystals exhibit significant al enrichment in this region (figure 7). these differences in the surface distribution of aluminum help to understand the observed trends in the reactivity measured by the single molecule fluorescence method. the lower reaction rates in the surface region of the parent crystals are related not only to slow molecular diffusion in h - zsm-5-p but also to the presence of a silicalite layer at the surface (a si / al ratio of 160 has been measured by xps) that may significantly hinder reactivity. this explains the initially low turnover rates recorded at the surface of h - zsm-5-p crystals. in contrast, a mild steaming treatment creates extraframework aluminum species in the surface region but does not affect inner regions of the zeolite material, as observed by hr - sem. this is also an indirect indication of the formation of mesoporous defects in the surface layers of h - zsm-5-mt crystals that are responsible for enhanced diffusion and higher single turnover rates, despite a loss in the number of brnsted acid sites due to dealumination. it should be noted here that, apart from the differences in the near - surface layers, we observe very similar trends in the tof - sims depth profiles of both h - zsm-5-p and h - zsm-5-mt. however, the absolute values for measured si / al ratio vary from crystal to crystal, as visible in figure 7, where the concentration of al atoms seems to be lower for h - zsm-5-mt. aluminum tof - sims sputter depth profiles for single zeolite crystals : h - zsm-5-p (blue), h - zsm-5-mt (green), and h - zsm-5-st (red). the approximate number of al atoms is calculated on the basis of the tof - sims response of the si / al signal with respect to 96 t atoms per unit cell of zeolite h - zsm-5. measured tof - sims profiles indicate only the total concentration of al atoms, and not all of them are necessarily tetrahedrally coordinated and incorporated in the framework of zeolite ; hence, not all of them are necessarily catalytically active. recorded turnover frequencies of h - zsm-5-st are significantly lower than those for h - zsm-5-p and h - zsm-5-mt. this can be rationalized by an abundance of extraframework al species formed upon severe steaming. the tof - sims al depth profile indicates that aluminum is still present within the crystal but does not provide brnsted acidity necessary for the oligomerization reaction. the first experimental point in the tof - sims profile of h - zsm-5-st indicates the deposition of aluminum in the surface layer of the zeolite crystal, most probably due to the high degree of dealumination that is visible up to 1 m of the depth profile. in marked contrast, the reactivity observed in the surface layer of h - zsm-5-st is very low and can not be correlated with the concentration of aluminum determined by tof - sims. remarkably, the observed al zoning of the h - zsm-5-p single crystals has a profound effect on the degree of dealumination upon mild and severe steaming, as h - zsm-5 zeolite with lower al content is more resistant to dealumination. therefore, mild steaming will lead to selective dealumination mostly in the surface regions of the h - zsm-5-mt crystals, where al has the highest initial concentration. similarly, severe steaming affects more surface regions of h - zsm-5-st crystals than it does deeper parts, where we consistently observe several times higher turnover rates. the nasca method can further provide in - depth insights into the spatiotemporal changes taking place in nanoscopic domains of h - zsm-5-p and h - zsm-5-mt. the question arises as to whether the surface of a zeolite crystal is homogeneously affected by the mild steaming method. a closer look into the surface high - resolution reactivity maps of the h - zsm-5-p and h - zsm-5-mt zeolite crystals, presented in figure 4, indicates substantial differences in the spatial distribution of catalytic turnovers. these differences become highly visible when the crystals are exposed to a higher concentration of fa (1030 mm), enabling fast accumulation of catalytic turnovers. qualitatively, the reactivity of h - zsm-5-p was macroscopically homogeneous on a micrometer length scale (figure 8a), whereas the surface of h - zsm-5-mt shows significant heterogeneities in reactivity (figure 8b). to quantify the extent of those differences, the high - resolution maps from figure 8a, b were divided into 384 384 nm (8 8 binned pixels) regions, as illustrated in figure 8. such regions are used to construct the histograms of the turnover activity, as presented for h - zsm-5 p (figure 8c) and h - zsm-5-mt (figure 8d). while h - zsm-5-p has a fairly narrow distribution of turnover rates determined for 384 384 nm regions of interest, h - zsm-5-mt shows a broad reactivity histogram with regions of high and low reactivity spanning nearly 1 order of magnitude. a tof - sims sputter depth profile of the mildly steamed crystal (figure 7) indicates the deposition of extraframework al species in the near - surface regions of h - zsm-5-mt crystals. therefore, a nonuniform turnover activity of the nanoscopic domains of h - zsm-5-mt could be related to large differences in the accessibility of brnsted acid sites caused by the migration of al and blockage of micropores. such near - surface layers of extreme heterogeneity seem to be responsible for the large transport barriers that may significantly affect the uptake of molecules and unevenly reduce the local permeabilities. (a, b) high - resolution images of surface reactivity based on movies (2000 frames) for (a) a h - zsm-5-p crystal in a 23 mm solution of fa and (b) a h - zsm-5 mt crystal in a 11.5 mm solution of fa. the color bar denotes the number of detected turnovers per 48 48 nm. insets marked with arrows indicate high - resolution images of 384 384 nm domains, used for calculating the histograms displayed in (c) and (d). the yellow square in (a) indicates a region of interest used to construct the scatter plot in figure 9a. (c, d) corresponding histograms of turnover activity, calculated from 384 384 nm binned regions in (a) and (b) and normalized to the molar concentration of fa, for (c) h - zsm-5-p and (d) h - zsm-5-mt. the high - resolution map of turnover activity of h - zsm-5-p (figure 8a) indicates observable nanoscopic differences in reactivity even for the parent zeolite crystal. the scatter plot in figure 9a shows the locations of individual catalytic turnovers for a 2.4 2.4 m region of interest indicated in figure 8a. the inhomogeneous distribution of catalytic turnovers in figure 9a could be a consequence of the stochastic nature of the process, which is described by poisson statistics in figure 3. to verify this hypothesis, we have simulated a scatter plot that describes a completely random, stochastic process (figure 9b). because the scatter plots are constructed based on the identical number of catalytic turnovers (3709), we would expect a similar distribution of nearest - neighbors (nn) for both h - zsm-5-p and the simulated pattern. (a, b) scatter plots of reactivity reconstructed for (a) the h - zsm-5-p crystal and the region of interest indicated in figure 8a (yellow square) and (b) a simulated, random scatter plot. (c, d) histograms of the number of nearest - neighbors (nn) detected within a radius of 100 nm. (c) comparison of h - zsm-5-p and the simulated pattern, calculated from (a) and (b). (d) comparison of h - zsm-5-mt and the corresponding simulated pattern (see supporting information s5 for the corresponding scatter plots). the number of nns in a radius of 100 nm calculated for h - zsm-5-p suggests a substantial deviation from the simulated random distribution of catalytic turnovers. the histograms for a smaller nn radius (2050 nm) did not indicate a clear difference in the number of nn catalytic turnovers. furthermore, increasing the radius of nn analysis to 500700 nm leads to very similar nn histograms (supporting information s4). the observed heterogeneities in reactivity could be a direct consequence of intrinsic differences in the surface accessibility and acidity introduced to the zeolite framework during the synthesis, ion exchange, or activation. in comparison to the nn distrubution for h - zsm-5-p, a histogram of nn distribution for h - zsm-5-mt shows significant deviation from the simulated pattern (figure 9d and supporting information s5). the observed changes in reactivity for the h - zsm-5-p crystals can be resolved with a temporal resolution of 100 ms per frame. we studied the reactivity of the zeolite domain presented in figure 8a and divided it into 784 smaller domains with a lateral size of 384 384 nm (figure 8a). this size was chosen on the basis of the observed density of catalytic events. smaller domains can be analyzed in a similar manner, but they yield low numbers of detected events per domain. by applying the described quantification procedure, we reconstructed turnover trajectories of all analyzed domains. a digital single turnover trajectory of an exemplified region of interest is shown in figure 10a. (a) single turnover trajectory recorded for a 384 384 nm zeolite domain. inset : definition of the waiting time as the time between two subsequent catalytic turnovers. (c) evolution of turnover numbers for five exemplified zeolite domains : the black line is derived from (b), and the red lines in the background represent all 784 trajectories. (d) mean distribution of waiting times calculated for all 784 surface domains (dark blue). the blue and red lines denote the fitted exponential decays of the waiting time histograms for the blue and red trajectories in (c), respectively. (e) 2d conditional histogram of consecutive waiting times recorded at tn and tn+1. each turnover trajectory can be described by the time between subsequent catalytic events, denoted here as waiting time. this parameter was used in single enzyme kinetics to derive memory effects in enzyme conformation dynamics. a typical turnover trajectory of a zeolite domain illustrates the stochastic appearance of waiting times (figure 10b). we compared the turnover trajectories and the resulting cumulative sums of turnovers of all 784 analyzed domains. a selection of five trajectories that differ significantly in their reactivity is shown in figure 10c. it is evident that individual zeolite domains within a single zeolite particle may differ significantly in their average turnover frequencies. the distribution of individual waiting times follows the exponential decay function for all analyzed turnover trajectories (figure 10d), whereas the parameters of the distribution change with turnover frequencies recorded at individual zeolite domains. the question arises as to whether these fluctuations in waiting times have a temporal correlation component, i.e., whether the appearance of two consecutive waiting times can be statistically correlated to temporal changes in the oligomerization reaction mechanism. a summed 2d histogram of adjacent waiting times (tn and tn+1) calculated for all analyzed trajectories shows a symmetrical distribution of pairs of waiting times (figure 10e). this distribution describes stochastic behavior of the single turnover trajectories, where higher turnover rates may be followed with the longer time intervals of low activity. as a test of time - correlated features, we have examined the 2d difference histograms (supporting information figure s6) and the autocorrelation functions of recorded waiting time trajectories (supporting information figure s7). similar kinetic studies performed earlier for enzymes and nanoparticles found a correlation of catalytic turnover frequencies in time due to conformational and surface reconstruction changes. our analysis did not show the presence of similar correlation effects in h - zsm-5, most probably due to the significantly different nature of the catalytic processes taking place at enzymes and nanoparticles. very low turnover rates over large zeolite domains, as compared to the size of enzymes and nanoparticles, may not be sufficient to study dynamic disorder at the present time / space scales. however, the reasons for the observed behavior could be well - explained by the interplay of diffusion and the langmuir hinshelwood adsorption reaction mechanism, taking into account the complexity of the overall process that may lead to the nonperiodic, chaotic oscillations in reactivity. we note here a remarkable observation related to measuring the turnover frequency of a single catalyst particle. by definition, the turnover frequency is calculated with respect to the total number of catalytically active sites. while the rate of formation of product molecules can be precisely calculated with the nasca method, the local number of catalytically active sites (and not the local al concentration) can not be directly measured in 3d on the same length scales. however, stimulated raman microscopy with probe molecules recently demonstrated this information at diffraction limited resolutions. the reactivity of zeolite h - zsm-5 is measured under conditions of extremely low turnover frequencies. taking into account the maximum in recorded reactivity of 10 events per m per second (which corresponds to a reaction rate of 1.7 10 mol dm s for detected fluorescent products) and a bulk si / al ratio of 17, the average recorded turnover frequency of the reaction is in the order of 10 s. in comparison, typical turnover frequencies recorded at a bulk level in zeolites are on the order of 10 s, marking a difference of at least 5 orders of magnitude. the practical upper limit of the nasca technique applied to studied zeolite crystals is close to measured values, since a higher reactivity of the probe molecules would lead to the fast accumulation of bursts that could not be optically resolved anymore. in practice, the window of turnover values that can be recorded for the studied zeolite h - zsm-5 crystals ranges from 10 to 10 s, representing more than 4 orders of magnitude difference in reactivity. in principle, even lower turnover numbers can be determined at the expense of longer acquisition times. we have quantified in 3d the effect of steaming post - treatments on the catalytic performance of individual h - zsm-5 crystals using the high sensitivity and spatiotemporal resolution of single molecule super - resolution fluorescence microscopy. mild steaming of h - zsm-5 crystals at 500 c altered surface porosity via dealumination and notably enhanced accessibility and reactivity ; however, this also causes a highly heterogeneous distribution of accessible acid sites at the macroscopic level. further steaming at 700 c led to a significant loss of brnsted acidity and a 2 orders of magnitude lower average turnover frequency. the results were further explained by measuring tof - sims sputter depth profiles of al distribution. surface diffusion barriers of the parent zeolite crystals were attributed to the depletion of al in the surface region of the material, whereas changes in the 3d distribution of al upon steaming significantly affected the surface accessibility and reactivity of mildly steamed crystals. finally, the correlation analysis of waiting times between subsequent turnovers pointed toward significant temporal fluctuations and differences in the turnover frequencies of nanoscopic zeolite domains of the parent material. the obtained results demonstrate the importance of single turnover, single catalyst particle studies in unraveling the complex diffusion reactivity interplay taking place in hierarchical zeolite - based catalyst materials. | optimizing the number, distribution, and accessibility of brnsted acid sites in zeolite - based catalysts is of a paramount importance to further improve their catalytic performance. however, it remains challenging to measure real - time changes in reactivity of single zeolite catalyst particles by ensemble - averaging characterization methods. in this work, a detailed 3d single molecule, single turnover sensitive fluorescence microscopy study is presented to quantify the reactivity of brnsted acid sites in zeolite h - zsm-5 crystals upon steaming. this approach, in combination with the oligomerization of furfuryl alcohol as a probe reaction, allowed the stochastic behavior of single catalytic turnovers and temporally resolved turnover frequencies of zeolite domains smaller than the diffraction limited resolution to be investigated with great precision. it was found that the single turnover kinetics of the parent zeolite crystal proceeds with significant spatial differences in turnover frequencies on the nanoscale and noncorrelated temporal fluctuations. mild steaming of zeolite h - zsm-5 crystals at 500 c led to an enhanced surface reactivity, with up to 4 times higher local turnover rates than those of the parent h - zsm-5 crystals, and revealed remarkable heterogeneities in surface reactivity. in strong contrast, severe steaming at 700 c significantly dealuminated the zeolite h - zsm-5 material, leading to a 460 times lower turnover rate. the differences in measured turnover activities are explained by changes in the 3d aluminum distribution due to migration of extraframework al - species and their subsequent effect on pore accessibility, as corroborated by time - of - flight secondary ion mass spectrometry (tof - sims) sputter depth profiling data. |
in 2000, the total resident population of kosovo was estimated to be 2 million inhabitants,1 with 32.8% of the population aged 14 years or less.2 after the war in kosovo in 1999, returning refugees first priorities were housing and economic issues. the initial phase of reorganization in healthcare and educational institutions did not emphasize oral health promotion. the health system generally focuses on intervention and neglects issues such as preventive dentistry. despite difficulties associated with implementing measures in preventive dentistry, the department of preventive dentistry at the dental clinic of the university of prishtina founded a study group emphasizing oral health promotion. the group was supported by the non - governmental organizations, including medair, the finnish red cross, the danish red cross, and dental health international netherlands (dhin). the aim of the group is to promote oral health by re - establishing oral health education for school and preschool children in kosovo. pediatric dentists have advocated early oral examinations, appropriate interventions and parental counseling,3 but these have not been carried out systematically in kosovo. similarly, the majority of preschool - age children have never been to a dentist.4 the majority of children visit dentists only in the case of acute pain and never on the basis of preventive measures. one of the most aggressive types of caries in preschool children is early childhood caries (ecc). it is an acute dental disease that commonly occurs initially in the upper maxillary incisors, with localization in the neck of the tooth and with rapid development that leads to complete destruction of the crown. due to its characteristic features and etiological factors, ecc is known by a variety of names : caries of incisors, nursing caries, nursing bottle syndrome, baby bottle tooth decay (bbtd), early childhood caries (ecc), severe early childhood caries, and rampant caries (rc).511 due to the lack of epidemiological data concerning the oral health status of children in kosovo, the aims of this study were ; to assess the prevalence of caries in preschool and school children, to assess the prevalence of ecc in preschool children, to evaluate the decay status of the children s first permanent molars, to evaluate the children s and teacher s levels of knowledge about oral health issues, andto make proposals for preventive measures. to assess the prevalence of caries in preschool and school children, to assess the prevalence of ecc in preschool children, to evaluate the decay status of the children s first permanent molars, to evaluate the children s and teacher s levels of knowledge about oral health issues, and to make proposals for preventive measures. the sample in the present study consisted of two groups derived from a multi - site examination : preschool and school children. from a total of 3,793 examined children, there were 1,237 preschool children (aged 2 to 6 years old) and 2,556 school children (aged 7 to 14 years old). the sample size was calculated with a confidence level of 95% and a confidence interval of 2. the study was specifically based on the deft / dmft index, following the recommendations of the world health organization.12 preschool children were examined at various kindergartens in prishtina and prizren, while school children were examined at various primary schools in prishtina, peja, fush kosova, kastriot and dean. the examinations were done under natural light, using a dental mirror and a probe. it was performed by five dentists from the prishtina university dental clinics, mainly from the preventive dentistry department. the study group for oral health promotion conducted the study, and the examiners received relevant training in advance. diagnostic criteria were calibrated,13 with an inter - examiner reliability of kappa = 0.92 based on the examination of 30 children of different ages. for the caries assessments, all tooth surfaces were examined. every defect in the tooth was tested with a probe, and every visual change in the enamel transparency in the early phases of demineralization was defined as a carious lesion. decayed, filled and extracted / missing (due to caries) teeth were recorded in a modified who oral health assessment form.12 dmft (for permanent dentition) and deft (for primary dentition) describes the number, or the prevalence, of caries in an individual.14 dmft and deft are methods to numerically express the caries experience and are obtained by calculating the number of decayed (d), missing (m) / extracted (e), and filled (f) teeth (t). ismail and sohn15 describe the many different clinical diagnostic criteria of ecc. based on these studies, we have used the criterion that describes ecc as at least two affected primary maxillary incisors with caries. the interviews were mostly carried out in primary schools and kindergartens in prishtina, and they incorporated questions concerning children s experiences with oral health and teachers ' basic knowledge of oral health. approximately six months prior to the interviews, lectures were held to provide teachers with some information on oral health in the same institutions used in this study. moreover, there were practical demonstrations of tooth brushing techniques for children, and various printed materials published by the group (e.g. flyers, handouts and manuals) were distributed to the children and the teachers. the questionnaire for the children was given to 14 primary schools and 7 kindergartens in prishtina, and it included the following questions : have you ever been to a dentist (before)?if yes, give the reason for the visit.what is your experience with the dentist?do you have a dentist at your school?are there lessons about oral health at your school?how often are sweet foods served in kindergarten?how often do you eat sweet food(s) during the day ? do you have a dentist at your school ? are there lessons about oral health at your school ? the interviews for the preschool children were done with the help of their mothers or teachers. to obtain data on the teachers levels of basic knowledge about oral health issues these questions were as follows : when does the eruption of the primary and permanent teeth start?the first permanent molar erupts only once in life (true - false).describe the tooth structures.describe the factors of tooth decay.can sweets be taken between or with meals?how often and how long should teeth be brushed?what is the element that is in toothpaste that protects teeth?when should the dentist be visited ? what is the element that is in toothpaste that protects teeth ? when should the dentist be visited ? the levels of knowledge were assessed as poor (025% or 12 correct answers), satisfactory (25%50% or 34 correct answers), good (50%75% or 56 correct answers) and very good (75%100% or 78 correct answers). this study was carried out in kosovo, where the significant post - war internal migration from villages to cities is a significant factor. as a result, we were unable to categorize the children by locality (e.g. urban, suburban, or rural). in addition, most of the examined children were from prishtina, where internal migration has caused a sharp rise in the overall population. the collected data were entered in statistical package for social sciences (spss 12). the interviews were mostly carried out in primary schools and kindergartens in prishtina, and they incorporated questions concerning children s experiences with oral health and teachers ' basic knowledge of oral health. approximately six months prior to the interviews, lectures were held to provide teachers with some information on oral health in the same institutions used in this study. moreover, there were practical demonstrations of tooth brushing techniques for children, and various printed materials published by the group (e.g. flyers, handouts and manuals) were distributed to the children and the teachers. the questionnaire for the children was given to 14 primary schools and 7 kindergartens in prishtina, and it included the following questions : have you ever been to a dentist (before)?if yes, give the reason for the visit.what is your experience with the dentist?do you have a dentist at your school?are there lessons about oral health at your school?how often are sweet foods served in kindergarten?how often do you eat sweet food(s) during the day ? have you ever been to a dentist (before) ? do you have a dentist at your school ? are there lessons about oral health at your school the interviews for the preschool children were done with the help of their mothers or teachers. to obtain data on the teachers levels of basic knowledge about oral health issues these questions were as follows : when does the eruption of the primary and permanent teeth start?the first permanent molar erupts only once in life (true - false).describe the tooth structures.describe the factors of tooth decay.can sweets be taken between or with meals?how often and how long should teeth be brushed?what is the element that is in toothpaste that protects teeth?when should the dentist be visited ? can sweets be taken between or with meals ? how often and how long should teeth be brushed ? what is the element that is in toothpaste that protects teeth ? when should the dentist be visited ? the levels of knowledge were assessed as poor (025% or 12 correct answers), satisfactory (25%50% or 34 correct answers), good (50%75% or 56 correct answers) and very good (75%100% or 78 correct answers). this study was carried out in kosovo, where the significant post - war internal migration from villages to cities is a significant factor. as a result, we were unable to categorize the children by locality (e.g. urban, suburban, or rural). in addition, most of the examined children were from prishtina, where internal migration has caused a sharp rise in the overall population. the collected data were entered in statistical package for social sciences (spss 12). in the sample, 28.6% of the children were caries - free (deft = 0) at the age of two. as expected, this percentage decreased with increasing age. the lowest mean deft was seen in two - year - old children (2.1), while the highest were in five- and six - year - olds (8.1 and 7.9, respectively). less than one - tenth (9.8%) of the examined preschool children had a deft of 0. in children two years or older, the testing of the differences for gender for the mean deft values showed statistically significant differences for five- and six - year - olds (p=0.004 and p=0.009, respectively). there was no significant difference between gender for two-, three-, or four - year - olds (p=0.816, p=0.302 and p=0.814, respectively) (table 1). as expected, the mean deft in preschool children increased with age, with significant statistical differences between adjacent age groups (two - year - olds vs. three - year - olds, three - year - olds vs. four - year - olds, and four - year - olds vs. p.05). an anova test showed statistical differences between all of the age groups (f=204.59, p.05) or 13-year - olds vs. 14-year - olds (p>.05) (table 6). the greatest contribution to the dmft index was untreated caries, which varied from 2.10 for 7-year - olds to 5.00 for 14-year - olds (table 7). first permanent molars were the most decayed teeth with a high prevalence (97%). the dmft index related to the first permanent molar was 3, where 82.4% were decayed, 8.3% lost due to decay, and only 9.3% were treated (table 8). the interview involved 446 school children and 418 preschool children (with the help of the parents or teachers). the results from the questionnaire showed that 73% of the children have had a dental visit at least once in their lifetime. the most common reason for that visit was a toothache (69%), and 66% of the children had a bad experience while visiting the dentist. oral health classes were not organized at any of the schools, even in those with existing dental offices. concerning the consumption of sweets, 58% of the children responded that they consumed sweet snacks at least twice a day. the results from the questionnaire for the teachers showed that 54% of them had poor, 39% had satisfying and 7% had good knowledge on basic oral health issues. nearly 75% thought that children should visit the dentist only when they have a complaint. the data from this oral health assessment of children of kosovo showed a very low level of dental health in both the primary and permanent dentitions. caries prevalence expressed via the dmft index was very high. the results from the present study show that dental health of these children in kosovo is worse than that of children in other european countries. specifically, the mean deft for five - year - olds at preschools in kosovo (8.1) was found to be higher than the same value for preschool children in usa (1.7) and in many other european countries (19911995), including ireland (0.9), spain (1.0), denmark (1.3), norway (1.4), finland (1.4), netherlands (1.7), united kingdom (2.0), france (2.5), and germany (2.5). our results are only comparable to the rates in belarus (7.4), sarajevo, bosnia (7.53) (ages 57) and albania (8.5).16,17 the low treatment rate for children in kosovo (< 2%) indicates a high treatment need. also, the mean dmft (5.8) of school children in kosovo (age 12) was higher in comparison with school children (age 12) of the following developed countries : netherlands (1.1), finland (1.2), denmark (1.3), usa (1.4), united kingdom (1.4), sweden (1.5), norway (2.1), ireland (2.1), germany (2.6) and croatia (2.6) (16). the mean dmft of kosovo s children (age 12) was similar to the mean values in latvia (7.7), poland (5.1) and a group of 12- to 14-year - olds in sarajevo, bosnia (7.18).16,17 as previously mentioned, the low treatment rate of the children in kosovo is unfavorable and indicates a high treatment need. the pathology with the most severe consequences for children s dental health was found to be ecc, with a high prevalence (17.6% of children). the ecc prevalence of children in kosovo is higher than the prevalence in children in developed western countries, which is less than 5%.18,19 the mean deft of kosovo s children with ecc was 10.6. the clinical course of ecc is manifested initially with white spot lesions, with a rapid development until complete destruction of the crown. de grauwe described the development of ecc and found that the progression of the lesion from the enamel to the dentin occurs within six months.20 it is now well understood that ecc is a multifactorial disease, with numerous biological, psychosocial and behavioral risk factors.21,22 one of the important risk factors in the etiology of ecc is bottle feeding, especially during the night. kaste found that 95% of children worldwide aged 6 months to 5 years had used a bottle.23 bacteria play an important role in the contagious nature of ecc (s. mutans) and is naturally a subject of many studies in the field of dentistry.24 as a measure of ecc prevention, the education of parents regarding the dangers of inappropriate feeding practices on the oral health of their children is considered to be an important issue.25 considering the complexity of factors associated with ecc, it is unfortunate that most of the interest in this problem is limited to dental organizations. the critical change needed to accomplish the necessary research on the prevention of ecc may be to expand the network by including other health professionals, community leaders, national organizations serving children and political leaders.26 another interesting finding is the lack of awareness of the first permanent molar. in our daily activities in the pediatric dentistry department, more than one - third of all dental treatment rendered often, parents believe that the first permanent molar belongs to the primary dentition and will subsequently be replaced. there were only a small number of children who visited to a dentist prior to pain. their first comments regarding their dental visit were my child a terrible toothache all night and we could nt sleep at all. the children with toothaches had bad experiences at the dentist and thus refused future visits. even though there were dental offices in some of the schools in this study, they were often dysfunctional and poorly equipped. often, there were no dentists specializing in the fields of pedodontics or preventive dentistry. many of the dentists employed were trained in other fields (e.g., prosthetics or oral surgery) or simply inexperienced. in the school dental offices, pain relief measures were often provided, but no preventive program or educative measures were undertaken. there were no subjects in the primary school curricula dealing with issues in oral health. a greater awareness by the teaching staff was only with regard to tooth brushing instructions. in none of the schools did we find any intention to reduce sweet meals during the day or to cease bottle - feeding. there was a shortage in the teachers knowledge of basic oral and dental health issues. they were unaware of the chronology of tooth eruption, often providing answers that the first molar will be replaced. unfortunately, most of them thought that children should visit the dentist only when experiencing a complaint. more than half did not know anything about the benefits of fluoride in dental health. about two - thirds of the teachers were unaware of dangers that sweets can pose when they are used in between meals. but there was a general agreement that school curricula should include topics concerning general and oral health. basic interest in this subject did exist, but oral health promotion was largely negligible due to the high priority of other issues, including mine awareness, coping with war trauma and very low income levels. because of the lack of active preventive measures in kosovo the following health educational measures can serve as an effective foundation for raising awareness of oral health : the training of dentists and other dental healthcare personnel to manage preventive programs for early childhood patients.oral health promotion training for kindergarten and school teachers.cooperation with the ministry of health and the ministry of education regarding the development of teaching curricula that includes oral health topics.the introduction of regular tooth brushing practices in kindergartens and schools.planned active preventive programs in schools with existing dental clinics, such as - practical demonstrations of oral health maintenance,- dental plaque detection and its removal,- topical fluoride application,- fissure sealing procedures,- treatment of early stages caries. the training of dentists and other dental healthcare personnel to manage preventive programs for early childhood patients. oral health promotion training for kindergarten and school teachers. cooperation with the ministry of health and the ministry of education regarding the development of teaching curricula that includes oral health topics. the introduction of regular tooth brushing practices in kindergartens and schools. planned active preventive programs in schools with existing dental clinics, such as - practical demonstrations of oral health maintenance,- dental plaque detection and its removal,- topical fluoride application,- fissure sealing procedures,- treatment of early stages caries. - practical demonstrations of oral health maintenance, - dental plaque detection and its removal, - topical fluoride application, - fissure sealing procedures, - treatment of early stages caries. the dental health of preschool and school children in kosovo, as measured by deft and dmft indices, was severely lacking. the index values in preschool children were very high with maximum values seen in five - year - olds (mean deft of 8.1). on average, these children had almost five teeth with untreated caries. the index values in school children were also very high, with maximum values in the fourteen - year - olds (mean dmft of 6.91). on average, these children had almost five teeth with untreated caries. kosovo s children exhibited high ecc values (17.6% of all examined children), with a mean deft of 10.6. the first permanent molar was the most affected tooth in the permanent dentition ; the mean dmft for this tooth was 3.00. the testing of teachers showed that most had limited knowledge regarding oral health, and they failed to serve as useful resources for education on this issue. | objectives : the aim of this study was to assess caries prevalence of preschool and school children in kosovo.methods:the assessment, which was carried out between 2002 and 2005, included measurements of early childhood caries, deft and dmft.results:in total, 1,237 preschool and 2,556 school children were examined. the mean deft of preschool children was 5.9, and the mean dmft of school children aged 12 was 5.8. the caries prevalence for 2- to 6-year - old preschool children was 91.2%, and the prevalence for 7- to 14-year - old school children was 94.4%. the prevalence of early childhood caries was 17.6%, with a mean deft of 10.6.conclusions:all data assessed showed the very poor oral health status of children in kosovo. interviews with children and teachers indicated poor knowledge regarding oral health. significant measures must be taken to improve this situation. |
the first orthotopic liver transplants (olts) with the classic technique in humans were attempted by starzl (1, 2). thereafter, some extensive experimental studies were conducted by other investigators, and alternative techniques for liver transplants were devised. calne developed the piggyback technique, which is now the most popular technique for orthotopic liver transplantation (3). the classic technique consists of clamping the inferior vena cava above the renal veins and excision of the retrohepatic vena cava. many patients can tolerate this procedure, but some require a venovenous bypass (vvb) to maintain a blood pressure level that perfuses essential organs, especially the kidneys, during clamping. this classic procedure is associated with unique complications that can be avoided by using the technique of liver resection without caval excision (the piggyback technique) (4). according to some authors, the classic technique may increase the rate of post - operative renal failure, hemodynamic instability, bleeding, and blood product consumption. also, it can lead to a longer anhepatic phase, more time in the hospital, and, because of vvb, more thromboembolic complications, air emboli, wound seromas, infections, and additional costs (49). however, in some cases, the surgeon has an obligation to use the classic technique due to presence of tumors or anatomic difficulties (6, 8), but there is some controversy concerning the safety of this technique without vvb in liver transplantation. more than 1700 olts, including 200 classic hepatectomies without vvb, have been performed at the shiraz transplant center, and no significant changes have been observed in vital perioperative factors, such as renal function. this study was designed to compare the complications and outcomes of liver transplantations using two different techniques of hepatectomy (classic without vvb and the piggyback techniques) to ascertain whether the classic technique without vvb is a safe method to use in certain situations. from march 2010 through june 2011, all 283 patients in the visceral transplantation ward at namazi hospital in shiraz, iran, for orthotopic liver transplantation entered this retrospective case series study. however, 56 patients were excluded because they had partial liver transplants, i.e., from a living donor or a split liver from a deceased donor, which required the use of the piggyback technique. eventually thus, 227 patients were included, of which 172 had the piggyback technique (group 1) and 55 had the classic technique (group 2). the main method of hepatectomy was piggyback without vvb (no need to use it), but the classic technique without vvb (no need to use it) was used in cirrhotic cases with anatomic difficulties, including circulated liver parenchyma around the retrohepatic inferior vena cava (ivc) and the presence of tumors close to the retrohepatic ivc. the surgeon s preference was also a reason for using the classic technique, with one of five of the main surgeons exhibiting this preference, especially in cases of budd - chiari syndrome. the patients demographics and other factors were compared between the two groups, including model of end stage liver disease (meld) score, donor s age, cold ischemic time (cit : duration between the aort clamp in the donor and the liver exit from ice for implantation in the recipient), warm ischemic time (wit), operative time, transfusions, pre - operative creatinine, early post - operative one - week renal function, pre - operative bilirubin, the lowest mean blood pressure in the pre - anhepatic, anhepatic, and post - anhepatic phases, bleeding (before and after hepatectomy), urine output, continuous renal replacement therapy (crrt) usage, in - hospital mortality, mean alanine aminotransferase (alt) in the first post - transplant week, and survival. the immunosuppressive therapy was the same in groups (triple therapy with corticosteroid, tacrolimus or cyclosporine, and mycophenolate mofetil). we used three factors to compare the post - operative renal function of the two groups, i.e., serum creatinine > 1.5 mg / dl, pre - operative creatinine vs. post - operative mean creatinine of days 17, and oliguria requiring crrt during the first post - operative week. data were analyzed using chi - squared, the fisher exact test, the t - test, repeated measurements, and kaplan - meier (log rank for survival), where appropriate. all statistical analyses were performed using spss version 15 (ssps inc., chicago, il, u.s.). the causes of liver transplantations and their frequencies in both groups are presented in table 1. also, there were no significant differences between the two groups with respect to meld scores, donor s age, cit, operation time, transfused packed rbc volume, intra - operative urine output, pre - operative creatinine, pre - operative bilirubin, crrt usage, in - hospital mortality, or the mean alt in the first post - operative week (table 2). serial creatinine measurements in the first post - operative week indicated that there was at least one episode of a level greater than 1.5 mg / dl in 49 of the 172 patients in group 1 and in 18 of the 55 patients in group 2 ; however, this difference was not statistically significant (p = 0.611). furthermore, no remarkable increase was observed when the mean measured creatinine level in the first post - operative week was compared to the mean level in the pre - operative week (p = 0.391). there was no significant difference between the lowest mean arterial blood pressure of group 1 (62 mmhg) and group 2 (64.5 mmhg) in the anhepatic phase (p = 0.13). although there was a significant decrease in blood pressure from before clamping (pre - anhepatic phase) to the unclamping phase in all patients, there was no significant difference between the two groups (p = 0.1) (table 2 and figure 1). the mortality rates were 7.6% (13 cases) in group 1 and 5.5% (3 cases) in group 2 (p = 0.766). the one - year survival when the classic technique was used (94.4%) was insignificantly better than that when the piggyback technique was used (92%) (p = 0.580) (figure 2). comparing wit (45.07 9.54 min vs. 51.76 8.28 min), infused crystalloid and albumin volumes were significantly different between the two groups. total bleeding and the bleeding volume of group 1 before hepatectomy were significantly lower than those of group 2 (p = 0.01 and 0.001, respectively), but comparing bleeding volume after hepatectomy showed no considerable difference between the two groups (p = 0.164). interestingly, time spent in the hospital was shorter in group 2 than in group 1 (12.42 4.5 days vs. 14.6 9.76 days, p = 0.024,) and urine output was significantly greater in group 2 (p = 0.035). according to some authors, one of the major shortcomings of the classic technique is that it has a higher incidence of post - operative acute renal failure (arf) than the piggyback technique (10). reported that the classic technique represented an independent risk factor for post - operative arf (11), while some studies did not report any differences between the two techniques (1216). the present study showed no significant difference between the techniques with respect to post - operative renal function. the exact reason for the reported difference is not clear, but accurate intra - operative, hemodynamic monitoring and probable interventions to keep appropriate renal perfusion may prevent post - operative arf in the classic technique. furthermore, with such a comparable low rate of post - operative arf in the classic technique without vvb and the high rate of complications associated with vvb, it seems unnecessary to use vvb as an essential part of classic hepatectomy just to decrease the rate of post - transplantation renal failure. our study showed that, although the infused solutions and bleeding were more in the classic technique than in the piggyback technique, the intra - operative decrease in bp was not significantly different for the two groups, and the intra - operative urine output was even greater in the classic group. this shows that prompt replacement of blood loss using crystalloid and colloid solutions to avoid decreased bp is critical, especially in the anhepatic phase, for the prevention of intra - operative and post - operative renal damage. in the present study, there was no significant difference between the two groups regarding the duration of the operation or cit, but, in agreement with some other studies (14, 15, 17, and 18), wit was longer in the classic group, which was probably the result of one more anastomosis in the infrahepatic vena cava. however, the difference was only about seven minutes, and the mean duration of wit for patients in the classic group was less than 52 minutes, which is an acceptable duration for this phase. the results of this study showed that, in contrast with some studies (8, 12), the time spent in the hospital was shorter in the classic group than in the piggyback group. this might be due to the surgeon s extensive experience with the classic technique without vvb, resulting in patients experiences being similar to those of the patients who had the piggyback procedure. the limitation of this study was our center policy (try to do piggyback technique until obligation to use classic technique because of excessive bleeding), which had an insistent preference for the piggyback technique, even with its anatomical difficulties, in the most primary cases of classic technique. such a preference may cause a methodological bias, imposing on the patients more intra - operative bleeding (before the hepatectomy and in total) and a longer time to complete the hepatectomy. our findings showed that, although the piggyback technique was probably the technique of choice for hepatectomy in liver transplantation, the classic technique even without vvb can be used safely in necessary situations and in accordance with the surgeon s preference. we also found that the choice of surgical technique had no significant effect on the primary and final outcome in non - acute (cirrhotic) causes of liver transplantation. therefore, we recommend the classic technique even without vvb in the above situations because it can be performed without any significant problems or complications. | background : the classic technique of hepatectomy with venovenous bypass may cause a longer anhepatic phase and increase the rate of some complications, such as post - operative renal failure and thromboembolic events. but, in some cases, such as tumors and anatomic difficulties, the surgeon is obligated to use the classic technique even though there is some controversy about the safety of this technique without venovenous bypass in liver transplantation. the aim of this study was to compare the results of using the classic technique without venovenous bypass and the piggyback technique for liver transplantation.methods:a retrospective case - series study was conducted on 227 consecutive successful liver transplants, including 55 cases in which the classic technique was used and 172 cases in which the piggyback technique was used. the transplants were performed from march 2010 through june 2011 in the visceral transplantation ward at namazi hospital in shiraz, iran. the piggyback method was the preferred approach for hepatectomy, but the classic technique without venovenous bypass was performed in cirrhotic cases with anatomic difficulties, when there was a tumor, or when the surgeon preferred it.results:there were no significant differences in post - operative rise in creatinine, decreases in intraoperative blood pressure, transfused packed red blood cells (rbc), or survival rates between the groups. warm ischemic time (duration that donor liver is out of ice until it s blood reperfusion in the recipient) was approximately seven minutes longer in the classic group (p = 0), but it was less than 52 minutes, which is an acceptable time for this phase. hospital stays were shorter in the classic group than in the piggyback group (p = 0.024).conclusion : although the piggyback technique is the preferred technique for hepatectomy in liver transplantation, the classic technique without venovenous bypass can be used safely in cirrhotic livers when necessary or if the physician prefers it. |
the sample consisted of individuals recruited via mail from the danish society for polio, traffic and accident victims. the society works for the interests of its group members by liaising with the government and by providing services such as counseling and self - help groups. membership to the society is strictly by referral from the danish national health service and similar organizations. all respondents were entered into a prize draw where they could win a travel voucher worth 2,000 usd. the current study was part of a larger study (n=2,320) concerned with chronic whiplash associated disorders and its physical and psychological correlates. respondents had been exposed to a traumatic event resulting in whiplash, the majority of which had resulted from motor vehicle accidents (94%). the whiplash resulted in hospitalization for a proportion of the sample (25%) with the average stay in hospital equating to 6.9 days. a large majority of the sample (94%) sought medical assistance within four weeks from the occurrence of the accident. age ranged from 16 to 76 years, the mean age of the sample was 42.70 years (standard deviation [sd]=10.10). the raas (collins, 1996). the raas is a measure of adult attachment based on the aas (collins & read, 1990) which assesses interpersonal relationships. the raas consists of 18 items which measure three subscales ; closeness, dependency, and anxiety. the three subscales were composed by a factor analysis of the scale on a sample of undergraduate students. high scores on the anxiety dimension is characterized by individuals who worry about being unloved or abandoned by romantic partners, high scores on the closeness dimension is characterized by individuals who find closeness with others easy and high scores on the depend dimension is characterized by individuals who feel that others are trustworthy and dependable (collins, 1996). questions are answered on a five - point likert scale (not at all characteristic, to very characteristic of me). two of the three subscales are combined resulting in two subscales ; closeness / dependency and anxiety. the reliability of the scores, based on cronbach 's alpha, have been reported as 0.77 (closeness), 0.78 (dependency), and 0.85 (anxiety) based on undergraduate students (collins, 1996) and as 0.84 (closeness), 0.76 (dependency), and 0.90 (anxiety) based on anxiety disorder patients (eng., 2001). the reliability of the scores, based on cronbach 's alpha, in the current study were 0.67 (closeness), 0.69 (dependency), 0.83 (anxiety), and 0.76 (closeness / dependency). the harvard trauma questionnaire part iv (htq : mollica., 1992). the htq consists of 30 items which measure the presence and severity of post - traumatic stress. questions are answered on a four - point likert scale (not at all, to all the time). sixteen items correspond to the 17 items as specified by the diagnostic statistical manual - iv (dsm - iv : american psychiatric association, 1994). items pertaining to psychological distress and physiological reactivity within the dsm - iv specification are combined into one item which assesses both psychological and physiological reactions to reminders of the traumatic event (the combined item is placed in re - experiencing cluster in accordance with the dsm - iv specification). possible scores range from 16 to 64. in the current study scores ranged from 16 to 63 (m=37.46, sd=9.39). the difference in total scores for males (m=36.95, sd=9.96) and females (m=37.59, sd=9.23), t (1,400)= 1.05, p=0.005 (two - tailed) approached statistical significance. the items are divided into three subscales that correspond to the three main symptom groups of ptsd : re - experiencing, avoidance, and hyperarousal. in - line with dsm - iv guidelines, individuals met the ptsd diagnostic criteria if they scored three (quite a bit) or above on at least one re - experiencing symptom, three avoidance symptoms, and two hyperarousal symptoms. a proportion of the sample met the diagnostic criteria for ptsd (38.3%, m=80.84, sd=13.04). a further proportion of the sample met the criteria for sub - clinical ptsd, defined by individuals who missed meeting the dsm - iv diagnostic criteria by one symptom (28.5%, m=65.02, sd=9.51). the trauma symptom checklist (tsc-33 : briere & runtz, 1989). the tsc-33 was originally developed to assess the long - term impact of rape and child sexual abuse. it has been suggested that as the tsc-33 is responsive to physical abuse as well as rape and sexual abuse it may in fact be responsive to a wide array of traumatic experiences (briere & runtz, 1989). in addition, the items in this scale are highly overlapping with items in the symptom checklist (scl-90) (derogatis & coons, 1993), and the hopkins symptom checklist (hscl ; derogatis, lipman, rickels, uhlenhuth, & covi, 1974). in this the depression subscale consists of 10 items, and the anxiety subscale consists of eight items. respondents answer items for both subscales on a four - point likert scale (never to very often). possible scores for the depression subscale ranged from 10 to 40 and for the anxiety subscale from 8 to 32. in the current study scores ranged from 10 to 38 (m=20.92, sd=5.06) and from 8 to 30 (m=16.29, sd=3.74). there was a significant difference in total scores for males (m=20.18, sd=5.10) and females (m=21.13, sd=5.02) on the depression subscale, t (1,481)=3.01, p=0.003 (two - tailed), however, the magnitude of the difference was very small (eta squared=0.006). there was also a statistically significant difference between males (m=15.76, sd=3.82) and females (m=15.43, sd=3.71) on the anxiety subscale (t (1517)=2.85, p=0.004 (two - tailed), however, the magnitude of the difference was very small (eta squared=0.005).the subscales and total scores gained from the tsc-33 have been previously reported as being internally consistent, with good discriminant validity (briere & runtz, 1989). the lpa is a statistical technique employed to determine the number of homogeneous groups based on data from continuous latent variables. these groups are referred to as classes, in the attachment literature the classes represent attachment styles. distefano and kamphaus (2006) reported that lpa is a superior statistical technique to the more traditional methods of cluster analysis. lpa is thought to be advantageous as it provides a more flexible framework which allows for the incorporation of multiple variables which aid the researcher in understanding the differences between classes. model fit is determined by a variety of fit indices ; the akaike information criterion (aic ; akaike, 1987), the bayesian information criterion (bic ; schwartz, 1978), and the sample size adjusted bic (ssabic ; sclove, 1987), the lo - mendell - rubins adjusted likelihood ratio test (lrt ; lo, mendell, & rubin, 2001), entropy values (ramaswamy, desarbo, reibstein, & robinson, 1993) and the likelihood ratio chi - square (lr). guidelines state that with reference to the aic, bic, and ssabic the lower the values the superior the fit (hu & bentler, 1999). however, as more classes are added to the model, fit tends to improve with the aic, bic, and ssabic continually lowering. to determine what improvement is made to the model by adding an additional class, the difference between the values for the aic, bic, and ssabic can be calculated. if the difference between the values of one additional class is small, an additional class is said to add little to the model (distefano & kamphaus, 2006). if the lrt for a particular class solution is deemed significant (0.05) this indicates that a solution with one less class should be used. 1993) reported that high entropy values indicate good classification, with one indicating perfect classification. in the current study, a number of lpa models (two classes to six classes) were estimated using mplus 5.2 (muthn & muthn, 19982007). the analysis was conducted on the standardized scores on the two raas scales of closeness / dependency and anxiety. subsequently, class membership was used as an independent variable in a series of one - way analysis of variance (anova) tests to determine if they were significantly different in terms of scores on the measures of ptsd, depression, and anxiety. the sample consisted of individuals recruited via mail from the danish society for polio, traffic and accident victims. the society works for the interests of its group members by liaising with the government and by providing services such as counseling and self - help groups. membership to the society is strictly by referral from the danish national health service and similar organizations. all respondents were entered into a prize draw where they could win a travel voucher worth 2,000 usd. the current study was part of a larger study (n=2,320) concerned with chronic whiplash associated disorders and its physical and psychological correlates. respondents had been exposed to a traumatic event resulting in whiplash, the majority of which had resulted from motor vehicle accidents (94%). the whiplash resulted in hospitalization for a proportion of the sample (25%) with the average stay in hospital equating to 6.9 days. a large majority of the sample (94%) sought medical assistance within four weeks from the occurrence of the accident. age ranged from 16 to 76 years, the mean age of the sample was 42.70 years (standard deviation [sd]=10.10). the raas (collins, 1996). the raas is a measure of adult attachment based on the aas (collins & read, 1990) which assesses interpersonal relationships. the raas consists of 18 items which measure three subscales ; closeness, dependency, and anxiety. the three subscales were composed by a factor analysis of the scale on a sample of undergraduate students. high scores on the anxiety dimension is characterized by individuals who worry about being unloved or abandoned by romantic partners, high scores on the closeness dimension is characterized by individuals who find closeness with others easy and high scores on the depend dimension is characterized by individuals who feel that others are trustworthy and dependable (collins, 1996). questions are answered on a five - point likert scale (not at all characteristic, to very characteristic of me). two of the three subscales are combined resulting in two subscales ; closeness / dependency and anxiety. the reliability of the scores, based on cronbach 's alpha, have been reported as 0.77 (closeness), 0.78 (dependency), and 0.85 (anxiety) based on undergraduate students (collins, 1996) and as 0.84 (closeness), 0.76 (dependency), and 0.90 (anxiety) based on anxiety disorder patients (eng., 2001). the reliability of the scores, based on cronbach 's alpha, in the current study were 0.67 (closeness), 0.69 (dependency), 0.83 (anxiety), and 0.76 (closeness / dependency). the htq consists of 30 items which measure the presence and severity of post - traumatic stress. questions are answered on a four - point likert scale (not at all, to all the time). sixteen items correspond to the 17 items as specified by the diagnostic statistical manual - iv (dsm - iv : american psychiatric association, 1994). items pertaining to psychological distress and physiological reactivity within the dsm - iv specification are combined into one item which assesses both psychological and physiological reactions to reminders of the traumatic event (the combined item is placed in re - experiencing cluster in accordance with the dsm - iv specification). possible scores range from 16 to 64. in the current study scores ranged from 16 to 63 (m=37.46, sd=9.39). the difference in total scores for males (m=36.95, sd=9.96) and females (m=37.59, sd=9.23), t (1,400)= 1.05, p=0.005 (two - tailed) approached statistical significance. the items are divided into three subscales that correspond to the three main symptom groups of ptsd : re - experiencing, avoidance, and hyperarousal. in - line with dsm - iv guidelines, individuals met the ptsd diagnostic criteria if they scored three (quite a bit) or above on at least one re - experiencing symptom, three avoidance symptoms, and two hyperarousal symptoms. a proportion of the sample met the diagnostic criteria for ptsd (38.3%, m=80.84, sd=13.04). a further proportion of the sample met the criteria for sub - clinical ptsd, defined by individuals who missed meeting the dsm - iv diagnostic criteria by one symptom (28.5%, m=65.02, sd=9.51). the trauma symptom checklist (tsc-33 : briere & runtz, 1989). the tsc-33 was originally developed to assess the long - term impact of rape and child sexual abuse. it has been suggested that as the tsc-33 is responsive to physical abuse as well as rape and sexual abuse it may in fact be responsive to a wide array of traumatic experiences (briere & runtz, 1989). in addition, the items in this scale are highly overlapping with items in the symptom checklist (scl-90) (derogatis & coons, 1993), and the hopkins symptom checklist (hscl ; derogatis, lipman, rickels, uhlenhuth, & covi, 1974). the depression subscale consists of 10 items, and the anxiety subscale consists of eight items. respondents answer items for both subscales on a four - point likert scale (never to very often). possible scores for the depression subscale ranged from 10 to 40 and for the anxiety subscale from 8 to 32. in the current study scores ranged from 10 to 38 (m=20.92, sd=5.06) and from 8 to 30 (m=16.29, sd=3.74). there was a significant difference in total scores for males (m=20.18, sd=5.10) and females (m=21.13, sd=5.02) on the depression subscale, t (1,481)=3.01, p=0.003 (two - tailed), however, the magnitude of the difference was very small (eta squared=0.006). there was also a statistically significant difference between males (m=15.76, sd=3.82) and females (m=15.43, sd=3.71) on the anxiety subscale (t (1517)=2.85, p=0.004 (two - tailed), however, the magnitude of the difference was very small (eta squared=0.005).the subscales and total scores gained from the tsc-33 have been previously reported as being internally consistent, with good discriminant validity (briere & runtz, 1989). the lpa is a statistical technique employed to determine the number of homogeneous groups based on data from continuous latent variables. these groups are referred to as classes, in the attachment literature the classes represent attachment styles. distefano and kamphaus (2006) reported that lpa is a superior statistical technique to the more traditional methods of cluster analysis. lpa is thought to be advantageous as it provides a more flexible framework which allows for the incorporation of multiple variables which aid the researcher in understanding the differences between classes. model fit is determined by a variety of fit indices ; the akaike information criterion (aic ; akaike, 1987), the bayesian information criterion (bic ; schwartz, 1978), and the sample size adjusted bic (ssabic ; sclove, 1987), the lo - mendell - rubins adjusted likelihood ratio test (lrt ; lo, mendell, & rubin, 2001), entropy values (ramaswamy, desarbo, reibstein, & robinson, 1993) and the likelihood ratio chi - square (lr). guidelines state that with reference to the aic, bic, and ssabic the lower the values the superior the fit (hu & bentler, 1999). however, as more classes are added to the model, fit tends to improve with the aic, bic, and ssabic continually lowering. to determine what improvement is made to the model by adding an additional class, the difference between the values for the aic, bic, and ssabic can be calculated. if the difference between the values of one additional class is small, an additional class is said to add little to the model (distefano & kamphaus, 2006). on the basis of parsimony the solution with fewer classes should be accepted. if the lrt for a particular class solution is deemed significant (0.05) this indicates that a solution with one less class should be used. 1993) reported that high entropy values indicate good classification, with one indicating perfect classification. in the current study, a number of lpa models (two classes to six classes) were estimated using mplus 5.2 (muthn & muthn, 19982007). the analysis was conducted on the standardized scores on the two raas scales of closeness / dependency and anxiety. subsequently, class membership was used as an independent variable in a series of one - way analysis of variance (anova) tests to determine if they were significantly different in terms of scores on the measures of ptsd, depression, and anxiety. akaike information criterion (akaike, 1987) ; bic, bayesian information criterion (schwartz, 1978) ; ssabic, sample size adjusted bic (sclove, 1987) ; entropy (ramaswamy., 1993) and the lrt, lo - mendell - rubins adjusted likelihood ratio test (lo., 2001). the lo - mendell - rubin 's is non - significant for the four class solution, whereas the three class solution is significant. the aic, bic, and ssabic all show a large drop from the two to three class solutions, subsequent decreases through to the six class solution are much smaller suggesting that additional classes do not add to the model (distefano & kamphaus, 2006). class one (fearful, 18.6%) was characterized by respondents who scored high on the anxiety dimension and low on the closeness / dependency dimension. class two (preoccupied, 34.5%) was characterized by respondents who scored lower than class one (fearful) but higher than class three (secure) on the anxiety dimension and higher than class one (fearful) but lower than class three (secure) on the closeness / dependency dimension. class three (secure, 46.9%) was characterized by respondents who scored low on the anxiety dimension and high on the closeness / dependency dimension. it is noteworthy to mention that reference to low and high should be regarded as relative rather than absolute. 1. the class probabilities from the lpa can be viewed in table 2. the anova tests were employed to determine if the classes were significantly different in terms of their mean scores on ptsd, ptsd subscales (re - experiencing, avoidance, hyperarousal) depression and anxiety. post - hoc bonferroni corrections were used and all pairwise comparisons were significant (p=0.000). comparing the classes across all measures and subscales, the fearful class displayed the highest levels of symptomatology, the secure class displayed the lowest levels of symptomatology, and the preoccupied class displayed mid - levels of symptomatology (see table 3). anova for attachment styles, posttraumatic stress, depression, and anxiety scores abbreviations : htq, harvard trauma questionnaire (mollica., 1992) ; tsc, trauma symptom checklist (briere & runtz, 1989). akaike information criterion (akaike, 1987) ; bic, bayesian information criterion (schwartz, 1978) ; ssabic, sample size adjusted bic (sclove, 1987) ; entropy (ramaswamy., 1993) and the lrt, lo - mendell - rubins adjusted likelihood ratio test (lo., 2001). the lo - mendell - rubin 's is non - significant for the four class solution, whereas the three class solution is significant. the aic, bic, and ssabic all show a large drop from the two to three class solutions, subsequent decreases through to the six class solution are much smaller suggesting that additional classes do not add to the model (distefano & kamphaus, 2006). class one (fearful, 18.6%) was characterized by respondents who scored high on the anxiety dimension and low on the closeness / dependency dimension. class two (preoccupied, 34.5%) was characterized by respondents who scored lower than class one (fearful) but higher than class three (secure) on the anxiety dimension and higher than class one (fearful) but lower than class three (secure) on the closeness / dependency dimension. class three (secure, 46.9%) was characterized by respondents who scored low on the anxiety dimension and high on the closeness / dependency dimension. it is noteworthy to mention that reference to low and high should be regarded as relative rather than absolute. 1. the class probabilities from the lpa can be viewed in table 2. the anova tests were employed to determine if the classes were significantly different in terms of their mean scores on ptsd, ptsd subscales (re - experiencing, avoidance, hyperarousal) depression and anxiety. post - hoc bonferroni corrections were used and all pairwise comparisons were significant (p=0.000). comparing the classes across all measures and subscales, the fearful class displayed the highest levels of symptomatology, the secure class displayed the lowest levels of symptomatology, and the preoccupied class displayed mid - levels of symptomatology (see table 3). anova for attachment styles, posttraumatic stress, depression, and anxiety scores abbreviations : htq, harvard trauma questionnaire (mollica., 1992) ; tsc, trauma symptom checklist (briere & runtz, 1989). this study has two aims, first, to assess the validity of a four category attachment typology. the current study employed a rigorous quantitative approach to identify different attachment styles based on the dimensions of closeness / dependency and anxiety. the results demonstrated evidence of three discrete classes of attachment styles, which were labeled secure, preoccupied, and fearful. the results are in contrast to previous cluster analytic techniques which have identified four (collins & read, 1990) and two (eng., 2001) attachment styles based on the raas. however, given that the methods of estimation and statistical assessment of model fit are superior to older clustering techniques (distefano & kamphaus, 2006), the current three styles could be argued to be more robust. when compared with bowlby 's original four style typology of attachment, individuals in the secure style, identified in the current study, can be regarded as displaying a positive view of the self (high closeness / dependency) and a positive view of others (low anxiety), whereas, individuals in the fearful style can be regarded as displaying a negative view of the self (low closeness / dependency) and a negative view of others (high anxiety). interestingly, and despite the differences in sample characteristics, the secure style was represented by the style composed of the largest proportion of the sample (46.9%), which is in line with early reports based on ainsworth, blehar, waters, and wall (1978) three category attachment framework, which also reported that securely attached individuals were represented by the largest proportion of individuals (approx. 62%) (campos, barrett, lamb, goldsmith, & steinberg, 1983). individuals in the preoccupied style were characterized as such because relative to the other two styles they lay close to the midpoint in terms of the anxiety dimension and at the lower end of closeness / dependency dimension and so are characterized as having an ambiguous view of others and a negative view of the self. surprisingly, individuals typically classified as dismissing who are characterized as having a positive view of the self (low closeness / dependency) and a negative view of others (low anxiety) failed to be identified within this latent profile approach. such may be attributable to the notion of attachment existing along a continuum, as proposed by olsen. proposed that secure and fearful attachment styles should lie at the polar opposites with the remaining dismissing and pre - occupied styles being placed centrally. their proposal was based on the fact that secure attachment appeared to provide a protective factor across a number of variables, whereas, fearful attachment appeared to pose as a potential risk factor. the dismissing and preoccupied styles failed to display multiple significant results and thus appeared ambiguous with reference to their predictive ability. it is a possibility that the preoccupied class in the current study is an amalgamation of both dismissing and preoccupied individuals as the class is not as clear cut as would have been expected in terms of scores on the anxiety dimension. however, as dismissing attachment has been reported as being more prevalent in males than females with regards to adult romantic attachment (brennan, clark, & shaver, 1998 ; scharfe & bartholomew, 1994) another possibility may be that dismissing attachment is simply under represented in the current sample as there is a preponderance of females (79%). interestingly, although the majority of studies do indeed uncover a dismissing attachment style, its role is more ambiguous than that of alternative attachment styles. for example, declercq and palmans (2006) using dimensional scaling reported that the distance between dismissing attachment and ptsd was large suggesting that dismissing attachment styles are less related to ptsd. they speculated that perhaps individuals who had a dismissing attachment style simply responded to a critical incident with other dysfunctions (p. 331) given that their study only assessed attachment styles related to ptsd alone. this study also showed that the three attachment styles predicted differences in mean scores for ptsd, depression, and anxiety. for all variables the scores increased from secure, preoccupied, to fearful attachment styles. the secure class evidenced the lowest mean scores in terms of ptsd, in line with previous research, which has concluded negative associations between secure attachment and ptsd symptoms (declercq & willemsen, 2006 ; dekel., 2004 ; fraley., 2006 ; o'connor & elklit, 2008 ; olsen., 2010, submitted), in light of a traumatic experience. in the current study the preoccupied and fearful styles provided higher mean ptsd scores, respectively. interestingly, o'connor and elklit (2008) reported a positive association with fearful attachment and ptsd symptoms. these findings are comparable to those of the current study as secure attachment evidenced the lowest means scores and fearful attachment evidenced the highest means scores, in terms of ptsd symptoms as reported by participants. 2010), submitted) reported positive associations between both preoccupied and fearful attachment styles and ptsd. again, comparable with the results of the current study they reported that fearful attachment evidenced the strongest association. with reference to the ptsd symptom clusters of re - experiencing, avoidance, and hyperarousal the secure style evidenced the lowest mean scores. the lower mean scores for secure individuals across all ptsd variables may in part be attributable to securely attached individuals seeking and receiving greater beneficial social support than that of their insecurely attached counterparts (collins & feeney, 2000 ; riggs, jacobvitz, & hazen, 2002). (2006) suggested that securely attached individuals deal with adversity more effectively than their insecurely attached counterparts as their internal working models, which stem from early attachment relationships, offer comfort and security by reassuring that people are on hand when really needed. likewise, the higher mean scores for both the preoccupied and fearful styles, with reference to all ptsd variables, may be attributable to an individual 's level of perceived social support and their mental representations of the responsiveness and availability of others in times of need (fraley., 2006). further support for the roles of social support or the lack thereof was provided by o'connor and elklit (2008) who reported that individuals classified with a fearful attachment style where also individuals who reported the lowest levels of perceived social support. these results support the one - dimensional approach proposed by fraley and brumbaugh (2004), o'connor and elklit (2008), and olsen. (2010), submitted) which places secure and fearful attachment at polar opposites, with preoccupied and dismissing attachment placed centrally. interestingly, o'connor and elklit (2008) concluded that preoccupied attachment would be placed closer to secure attachment, whereas, dismissing attachment would be placed closer to fearful attachment. interestingly, however, it is in contrast to other studies which have concluded that dismissing attachment is also negatively associated with the subsequent development of ptsd (muller., 2001 ; olsen., 2010, in addition, collins (1996) reported that when compared to preoccupied individuals, dismissive people reported lower levels of negative emotion, suggesting that dismissive individuals would be placed closer to secure rather than fearful individuals. with reference to depression and anxiety, results again showed that the secure attachment style had the lowest mean scores. the more insecure styles of preoccupied and fearful attachment had higher mean scores, respectively. in line with previous research, the current results suggest that secure attachment may be negatively associated with depression and anxiety, whereas, the insecure styles may be positively associated (eng., 2001 ; williams & riskind, 2004). contrary to previous research which has proposed a link between preoccupied attachment and depression and anxiety (eng., 2001 ; williams & riskind, 2004) the highest mean scores evidenced in the current study were for fearful attachment. the propensity of insecure attachment styles to be associated with depression and anxiety has been suggested to be attributable to the tendency of such individuals to ruminate over negative experiences. in addition, insecurely attached individuals create a mental representation of the self as helpless and hopeless with no means of escape or support in light of aversive experiences (bemporad & romano, 1992 ; rholes & simpson, 2004). the current results therefore suggest that secure attachment may act as a protective factor for depression and anxiety, whereas fearful attachment may pose as a risk factor for the development of depression and anxiety. the results pertaining to both depression and anxiety further support the proposal of a one - dimensional attachment model (olsen., 2010, submitted). (2010), submitted) reported that the most salient finding in their study was not that secure attachment may operate as a protective factor but that fearful attachment may operate as a risk factor. the absence of a dismissing attachment class within this current study unfortunately prevents the testing of the hypothesis that dismissing individuals would also be placed centrally alongside preoccupied individuals. as previously mentioned it is important to note that the style referred to as preoccupied is not as clear cut as would be desired, with individuals approximating midpoint levels of anxiety rather than clear cut high or low levels. it may be the case that the preoccupied class is a culmination of both traditionally classified preoccupied and dismissing individuals. however, despite this, the fact that the mean scores for depression and anxiety are greater for fearful attachment and lower for secure attachment, lends further support to the notion of a one - dimensional attachment model (fraley & brumbaugh, 2004 ; o'connor & elklit, 2008 ; olsen. (2010), submitted), that attachment may be better conceptualized as a one - dimensional construct with secure and fearful attachment classifications being placed at polar opposites of the dimension. individual 's not classified as either securely or fearfully attached may indeed lie centrally along a continuum. with regards to the predictive utility of attachment styles, secure attachment may pose as a protective factor, whereas fearful attachment may pose as a risk factor with reference to the development of psychiatric symptoms. first, the study is retrospective and cross - sectional so no causal inferences regarding the influence of attachment styles and psychiatric disorders are possible. furthermore, as the study is retrospective some may question whether the findings are partly attributable to concerns over discriminant validity. in addition, some may question whether results may be attributable to a degree of conceptual overlap, i.e., those who are fearfully attached may also be those who are anxious and fearful in general. second, self - report measures of attachment have been criticized as they are open to faking good or faking bad, and thereby have the ability to confound the analysis. furthermore, it has been suggested that conclusions from self - report measures may simply reflect the respondents current mood. likewise, there has been ample debate regarding whether attachment researchers should employ self - report measures or attachment interviews (cf. however, as both have been shown to have merit and both have been able to provide answers to research questions in line with the core concepts of attachment theory (daniel, 2006) this may not be a major concern. fourth, it is also important to note that the characteristics of dismissing attachment styles may have resulted in a reporting bias whereby dismissing individuals are subsumed within either the secure or preoccupied attachment class. dismissing individuals often deliver positive reports of their childhood (and so positive reports of the self and others), however, when questioned further they find it difficult to support such memories (zimmerman, 2004) : self - report measures do not allow for further questioning. thus, if a lpa was conducted on data gleaned from an attachment interview perhaps a dismissing style would emerge. fifth, as participants in the sample are danish the generalization of results to other cultures must be conducted cautiously. sixth, early childhood trauma exposure may influence the development of later adult attachment styles ; unfortunately we did not enquire about participants early childhood experiences. these findings are notable given they suggest that secure and fearful attachment exist at polar opposites of what may be considered a risk continuum. future research may consider replicating the current lpa and extending the number of clinical variables under investigation to clarify and solidify conclusions. there is no conflict of interest in the present study for any of the authors. | background bartholomew (1990) proposed a four category adult attachment model based on bowlby 's (1973) proposal that attachment is underpinned by an individual 's view of the self and others. previous cluster analytic techniques have identified four and two attachment styles based on the revised adult attachment scale (raas). in addition, attachment styles have been proposed to meditate the association between stressful life events and subsequent psychiatric status.objective the current study aimed to empirically test the attachment typology proposed by collins and read (1990). specifically, lpa was used to determine if the proposed four styles can be derived from scores on the dimensions of closeness / dependency and anxiety. in addition, we aimed to test if the resultant attachment styles predicted the severity of psychopathology in response to a whiplash trauma.method a large sample of danish trauma victims (n=1577) participated. a latent profile analysis was conducted, using mplus 5.1, on scores from the raas scale to ascertain if there were underlying homogeneous attachment classes / subgroups. class membership was used in a series of one - way anova tests to determine if classes were significantly different in terms of mean scores on measures of psychopathology.results the three class solution was considered optimal. class one was termed fearful (18.6%), class two preoccupied (34.5%), and class three secure (46.9%). the secure class evidenced significantly lower mean scores on ptsd, depression, and anxiety measures compared to other classes, whereas the fearful class evidenced significantly higher mean scores compared to other classes.conclusions the results demonstrated evidence of three discrete classes of attachment styles, which were labelled secure, preoccupied, and fearful. this is in contrast to previous cluster analytic techniques which have identified four and two attachment styles based on the raas.in addition, securely attached individuals display lower levels of psychopathology post whiplash trauma. |
orofacial clefts are the most common major birth defect in america, affecting over 6,800 births annually (canfield. these oral clefts are developmental craniofacial abnormalities that result, at least in part, from a failure of neural crest cells to migrate properly. as a group, 70% of clefting disorders are comprised of those that are isolated to facial clefts only (non - syndromic), and 30% are those in which the facial cleft is part of a well - defined syndrome of additional anomalies (jones 1988). isolated oral clefts are further divided anatomically into clefts of the lip and/or palate (clp) and clefts of the palate only (cpo). in addition to the facial cleft, persons affected with isolated clefts of the lip and/or palate (iclp) suffer from a constellation of other problems including persistent problems with speech (even after cleft repair), as well as cognitive and behavioral abnormalities. the cognitive deficits associated with iclp are well documented and characterized with a lowering of overall intelligence quotient (iq) (though not to mental retardation level) and specific deficits in language function (richman and eliason 2009 ; richman and eliason 2001). these deficits are severe enough that reading disabilities have been reported to be as common as 35% of children with iclp (richman. an estimated 30% to 50% of children with iclp experience at least some periods of behavioral abnormality (richman and millard 1997). subjects with iclp have been consistently shown to have increased internalizing behavior problems (social inhibition or shyness, depressed mood) (endriga. 2003) ; however, very few studies have evaluated externalizing behaviors such as aggression, opposition, hyperactivity, impulsivity or inattention. a recent large study by hunt. found that parent ratings of children with iclp showed a significant increase in both internalizing and externalizing behaviors compared to children without iclp (hunt. 2007) ; however, the externalizing behaviors were not subdivided to isolate or characterize specific types. the behavioral traits of hyperactivity / motor impulsivity, impulsivity / non - planning, and inattentiveness form a core dimension of personality that is heritable, emerges early in the course of development, and persists across developmental stages (mckay and halperin 2001 ; kochanska and knaack 2003). moreover, these behaviors can be elevated to pathological levels and are the hallmarks of the neuropsychiatric diagnosis of attention - deficit hyperactivity disorder (adhd) ; however, they also occur at elevated levels (though often below diagnostic criteria for adhd) in a multitude of developmental disorders. in a previous study from our lab, we investigated the neural underpinnings of externalizing behaviors and found that in a sample of healthy normal boys (no psychiatric diagnosis including adhd), the region of the brain that was directly related to behaviors of impulse control was the right ventromedial prefrontal cortex (vmpfc). those boys with the highest ratings of hyperactivity and impulsivity had the lowest volumes of the right vmpfc (boes. these findings are conceptualized as supporting the notion that the right vmpfc acts as a neuroanatomical correlate of impulse control in normal healthy boys, extending upon structure - function studies of pathologic samples with adhd that have also highlighted the right vmpfc (shaw. in an additional study from our lab, we have found that the structure of the brain in children with iclp is substantially abnormal (nopoulos. there are overall decrements in the size of the intracranial volume (icv), and a proportional decrement in the frontal lobe, basal ganglia, and cerebellum after controlling for overall icv. moreover, there was a sex - specific finding in that for boys with iclp, the cerebral cortex was proportionately enlarged compared to healthy boys a tissue distribution abnormality. given the previous literature on elevated externalizing behavior in iclp, our study of hyperactivity and impulsivity and its neuroanatomical correlate in healthy boys, and finally our study of brain structure in children with iclp, the current study was designed to address the following questions : (1) do boys with iclp have elevations in hyperactivity / impulsivity / inattention (hii) ? (2) do boys with iclp have structural abnormalities in the right vmpfc compared to healthy control boys ? finally, (3) what is the relationship between right vmpfc and hii in both healthy and iclp boys ? participants the current study uses samples from three previous studies from our lab. the iclp boys (n = 50, age range 7.317.8 years) were previously analyzed for general brain morphology (nopoulos. 2007) and the normal healthy boys (n = 60, age range 7.817.9 years) were previously assessed for impulse control and regional brain morphology associated with those behaviors (boes. both samples were sub - samples of a study on neuropsychological functioning in children with clefts (conrad. 2009).all children with iclp were recruited from our university of iowa cleft clinic. any child with iclp in which there was a suspicion of genetic syndrome was evaluated by a clinical geneticist and included in the study only if the child was deemed non - syndromic based on that evaluation. exclusion criteria for the iclp subjects included presence of braces (creates artifact in magnetic resonance imaging (mri) scan) and known iq less than 70 (mental retardation). cleft type was broken down into clefts of the lip only (clo, n = 11), clefts of the lip and palate (clp, n = 26) and cleft palate only (cpo, n = 13).the comparison group consisted of healthy boys recruited from the community via local newspaper advertisements. exclusion criteria for this group included presence of braces, major medical, neurologic, or psychiatric illness or history of learning disability (information obtained from parents during screening process).the general measure of height was obtained by a trained research nurse and recorded in centimeters. parental socioeconomic status (ses) of all participants was obtained using a modified hollingshead scale of 1 to 5, with the lower number corresponding to higher socioeconomic status (hollingshead and redlich 1958). since ses is a factor that can significantly impact brain structure and function, it is accounted for in the statistical analyses (see statistical analysis the race of both groups was mostly caucasian (> 95%), consistent with the geographic demographics. all participants (subjects and their parents) signed an informed consent prior to enrolling in the protocol which was approved by the local investigational review board. iq testing wechsler intelligence scale for children, 3rd edition (wisc - iii) (wechsler 1991) the wisc - iii is designed to assess the intellectual abilities of children ages 6 to 16 years. the children were administered the vocabulary, similarities, block design, and picture completion subtests, and the full scale iq was prorated. the wechsler adult intelligence scale, 3rd edition (wechsler 1997) is a well - known test of adult intelligence. the subtests and scales are parallel to those in the children form. adolescents who were 17 years old were administered this subtest because norms on the wisc - iii only go up to 16 years. behavioral measure the pediatric behavior scale, short version (pbs) is a tool for assessing emotional and behavioral problems and is derived from the pbs (lindgren and koeppl 1987), a measure with similar items as the child behavior checklist (achenbach 1991). for each participant, a parent and a teacher were asked to rate problems on a four - point likert scale (03), with a lower score indicating fewer problems. for the current analysis all questions related to non - planning, motor impulsivity, and inattention were included. it is important to note that for our previous analysis of the healthy control boys, we limited the assessment to impulse control items, excluding the inattention items, thus a more restricted analysis. individual questions for the current analysis included : (1) can not concentrate, (2) easily distracted, (3) fails to finish things, (4) impulsive ; acts without stopping to think, (5) can not stand waiting ; wants things right away, (6) interrupts, talks out of turn, or blurts things out, (7) hyperactive ; always on the go, (8) squirms or fidgets, and (9) restless, can not sit still. the parent and teacher response rate for the pbs was 100% and 97%, respectively for the iclp boys and 86% and 88% for the healthy boys. as a means of data reduction, the pbs ratings were summed across these nine questions to get one sub - score each for parents and teachers, and then these two sub - scores were added together for one overall hii score (theoretical range of 054).the pbs scales were derived from factor analysis with varimax rotation from a sample of 600 children ages 612. the scales were obtained from a four - factor solution with all eigenvalues greater than one. all of the items on this scale do not cross load to any significant degree (less than 0.30) with other pbs scales. the reliability of the pbs impulse control scale was established using a longer version of the pbs, which estimated the internal consistency coefficient at 0.95 for the category including the hii questions (lindgren and koeppl 1987). the criterion for inclusion of items in the short pbs version is that items load on highly similar factors in the normal structure of the cbcl in both sexes across multiple age categories. the scale used in this study has a raw mean score of 3.82 from the normative sample (parent rating only). the pbs has been shown to be valuable in identifying symptoms of adhd in a sample of children with cleft (richman. 2004) as well as identifying attention deficits in a normal sample (boes. 2009)the pbs was also used as a proxy to a formal evaluation for adhd to identify participants that were likely to meet dsm - iv adhd criteria. the criteria were met if the combined parent and teacher ratings exceeded the 90th percentile in two of the three adhd - like scales (hyperactive\motor impulsivity, impulsiveness / non - planning, and inattentiveness), as described as a method of adhd diagnosis (richman. the 90th percentile was determined using normative data from 6 to 12-year - old boys, n = 300. of the iclp sample, nine of the 50 boys in addition, parents filled out a medical history form which documents all medical and psychiatric diagnoses for each iclp child. from that assessment, five boys with iclp were identified as having been diagnosed with adhd by a physician. none of the boys from the control fulfilled the criteria for adhd by the pbs ratings and none had been diagnosed as adhd by a clinician (which is one of our exclusionary criterion). mri acquisition magnetic resonance imaging scans were obtained using a 1.5 tesla general electric signa system (ge medical systems, milwaukee, wi). three - dimensional (3-d) t1-weighted images were acquired in the coronal plane using a spoiled grass sequence with the following parameters, 1.5-mm coronal slices, 40 flip angle, 24 ms repetition time (tr), 5 ms echo time (te), two numbers of extinctions (nex), a 26-cm field of view (fov), and a 256 192 matrix. the proton density (pd) and t2-weighted images were acquired with the following parameters, 3.0-mm coronal slices, 36 ms te (for pd) or 96 ms te (for t2), 3,000 ms tr, one nex, a 26-cm fov, 256 192 matrix, and an echo train length = 1. image processing mri data were processed using brain research : analysis of images, networks, and systems (brains2), our locally developed software, described elsewhere (magnotta. 2002) t1-weighted images were spatially normalized and re - sampled to 1.015625 mm voxels and the anterior posterior axis of the brain was re - aligned parallel to the anterior commissure posterior commissure line. the interhemispheric fissure was aligned by selecting points along the fissure in the coronal and axial views. t2 and pd images were co - registered to the final t1 image, and all images were intensity normalized and inhomogeneity corrected. a discriminant tissue classification was then performed, and a brain mask was created using an artificial neural network. measures obtained include intracranial volume (all tissues from the dura mater on down), then separated into cerebrum and cerebellum. the cerebrum is then segmented into gray matter (cerebral cortex and sub - cortical), and white matter.the t1 acquisition was processed using freesurfer (http://www.martinos.org/freesurfer), an automated parcellation software program (desikan. the output of interest was the predefined region of interest (roi), the right vmpfc. the anatomical accuracy of each freesurfer roi was visually inspected and those with unacceptable parcellation were excluded from all analyses (no scans were excluded). figure 1 displays the anatomical roi for the current study, derived from the standard freesurfer atlas. the vmpfc is composed of two regions defined by freesurfer, the medial orbitofrontal cortex (mofc) and lateral orbitofrontal cortex (lofc). the mofc is composed of the ventral sector of the medial prefrontal cortex and the orbitofrontal cortex medial to the olfactory sulcus (i.e., straight gyrus). the lofc is flanked by the olfactory sulcus medially and the lateral orbital sulcus laterally. details of freesurfer parcellation, including reliability, validity, and anatomical boundaries, are described in detail elsewhere (desikan. the left is a medial view of the right hemisphere with the fuchsia color representing the medial orbitofrontal cortex. the image on the right is a ventral view of both hemispheres with the fuchsia color representing the medial orbitofrontal cortex and the blue color representing the lateral orbitofrontal cortex. these regions combine to form the vmpfc and are not visible from a lateral view ventromedial prefrontal cortex (vmpfc). on the left is a medial view of the right hemisphere with the fuchsia color representing the medial orbitofrontal cortex. the image on the right is a ventral view of both hemispheres with the fuchsia color representing the medial orbitofrontal cortex and the blue color representing the lateral orbitofrontal cortex. iq and behavior scores the full scale iq (fsiq) and average pbs score for the hii section was compared between groups using a two - sample t test. regarding the hii, there were 14 subjects who were missing the teacher component of the score and two subjects who were missing the parent component. because the teacher component tended to be lower than the parent component (mean of 4.9 vs. 5.7), we used an imputation approach based on linear regression models fit on the complete data (n = 94) to estimate the missing components (n = 16). this approach resulted in mean hii scores that were similar in the complete cases and in the imputed cases (p = 0.782). to examine the potential confounding effects of ses, we included ses as a covariate in multiple linear regression models, and we also created and tested interaction terms involving ses in our models. brain morphology when evaluating regional measures of brain tissue (either total cortex or vmpfc), volumes were expressed as a percent of icv. to measure laterality, an asymmetry coefficient (ac) for the vmpfc gray matter volume was calculated using the following formula : (right left)/(right + left), with a negative value indicates a larger left - sided structure. brain volumes, percents, and laterality were compared between groups using two - sample t tests. since icv is known to increase substantially with age, we used multiple linear regression to adjust between - group comparisons for age, as well as parental ses. relationship between brain morphology and behavior scores the vmpfc is a specific region of the cortex. in this analysis, to control for overall cortical volume, the vmpfc was expressed as a percent of total cortex volume. this also attempts to highlight specificity, by controlling for any potential relationship that the total cortex itself could have with the behavior scores. in addition, we focused this aim on the side (left or right) of the vmpfc with the most significant between - group differences. multiple linear regression and scatter plots were used to examine the relationship between brain morphology and behavior in the two groups. demographic measures of age and parental ses are shown in table 1. the mean age for = 3.3) and for the healthy control boys was 12.1 years (s.d. = 2.7). parental social class was significantly lower in the iclp group (mean = 2.67, s.d. = 0.51) compared to the healthy control group (mean = 2.33, s.d. table 1 also displays the data for the iq and behavioral scores compared between the two groups. the mean iq scores for the iclp group was in the average range (mean 105.3, s.d. 13.3), but significantly lower than the mean for the control group (mean 113.0, s.d. 16.6), p = 0.01 ; a finding previously reported (richman and eliason 2009). the average pbs score for the hii section was significantly elevated in the iclp boys (mean 12.7, s.d. table 1demographics, behavior scores, general, and regional morphometrydemographicsiclp (n = 50)controls (n = 60)p value for differencemean (sd), medianmean (sd), medianage (years)11.9 (3.3), 11.012.1 (2.7), 11.70.640parental ses score2.67 (0.51), 3.02.33 (0.56), 2.00.001iq and behavior scoresfull scale iq (fsiq)105.3 (13.3), 104113 (16.6),1100.010hyperactivity / impulsivity / inattention (hii)12.7 (10.2), 9.38.9 (6.7), 7.00.021brain measuresintracranial volume (icv) (cc)1,403 (148) ; 1,3871,444 (111) ; 1,4330.097cortex volume (cc)746 (76), 740758 (57), 7580.368cortex volume / icv (%) 53.3 (2.0), 53.152.5 (2.3), 52.40.083vmpfc / icv (%) 2.17 (0.18), 2.172.09 (0.13), 2.100.010right vmpfc / icv (%) 1.08 (0.09), 1.081.03 (0.07), 1.040.008left vmpfc / icv (%) 1.09 (0.10), 1.081.06 (0.07), 1.060.059asymmetry coefficient (%) 0.83 (3.4), 1.11.36 (4.1), 1.660.469 demographics, behavior scores, general, and regional morphometry general measures table 1 also displays the results of the comparison across groups of both general and regional brain measures. after controlling for the smaller icv, boys with iclp had proportionately enlarged cortex volumes compared to healthy controls, though this did not reach statistical significance. 2007), this was significant ; however, the current analysis uses a larger control sample (n = 60) than in the previous publication (n = 50). region of interest expressed as a ratio of icv, the volume of the right vmpfc was significantly elevated in the iclp boys (2.02, s.d. this difference persisted after adjustment for age and parental ses (p = 0.007). the left vmpfc, however, was not quite significantly elevated (2.06, s.d. = 0.17 in the healthy control boys ; p = 0.059). laterality the ac was negative for both groups, indicating a slightly larger left vmpfc than the right. subjects with unilateral cleft were identified and compared to each other to assess if unilateral clefting affected the ac. unlilateral clefts are possible in clo and clp (cpo are not lateralized) giving a total of 37 subjects ; however, five of these were bilateral, leaving 32 unilateral subjects, 13 with clefts on the right and 19 with clefts on the left. the ac was not significantly different between the right and left group (right cleft mean, 1.07 ; s.d., the right cleft group did not differ from the left cleft group in hi scores (right cleft mean, 13.5 ; s.d. 9.1 ; p = 0.984) or right vmpfc to icv ratios (right cleft mean, 1.05% ; s.d., 0.07% ; left cleft mean, 1.08% ; s.d., 0.11% ; p = 0.511). effects of iq since iq can potentially impact both behavior and/or brain function, we tested the relationship between fsiq and brain morphology (the right vmpfc), and fsiq and hii scores. pearson correlation showed no relationship between fsiq and the ratio of right vmpfc to icv (r = 0.03, p =.798) and no significant relationship between fsiq and hii score (r = 0.14, p = 0.155). thus, the findings of increased hii and right vmpfc volume in the iclp males are not confounded by the difference in fsiq scores between the two groups. there was a robust interaction between group status and the right vmpfc when predicting hii scores (p 0.30 in each group). 2relationship between behavior scores and right vmpfc structure relationship between behavior scores and right vmpfc structure finally, to evaluate further regional specificity, the rmvpfc to cortex ratio was broken down into its two components of medial orbitofrontal (mof) and lateral orbitofrontal (lof). although both regions were enlarged in the iclp group compared to the controls, this is only significant for the mof (iclp mof mean = 0.79% ; s.d., 0.09% ; control mean = 0.75% ; s.d., 0.08% ; p = 0.048 ; iclp lof mean = 1.23% ; s.d., 0.12 ; control mean = 1.21% ; s.d., conversely, though both regions were positively correlated with hii in the iclp group, this was only significant in the lof (lof r = 0.45, p =.001 ; mof r = 0.16, p = 0.274). demographic measures of age and parental ses are shown in table 1. the mean age for = 3.3) and for the healthy control boys was 12.1 years (s.d. = 2.7). parental social class was significantly lower in the iclp group (mean = 2.67, s.d. = 0.51) compared to the healthy control group (mean = 2.33, s.d. table 1 also displays the data for the iq and behavioral scores compared between the two groups. the mean iq scores for the iclp group was in the average range (mean 105.3, s.d. 13.3), but significantly lower than the mean for the control group (mean 113.0, s.d. 16.6), p = 0.01 ; a finding previously reported (richman and eliason 2009). the average pbs score for the hii section was significantly elevated in the iclp boys (mean 12.7, s.d. table 1demographics, behavior scores, general, and regional morphometrydemographicsiclp (n = 50)controls (n = 60)p value for differencemean (sd), medianmean (sd), medianage (years)11.9 (3.3), 11.012.1 (2.7), 11.70.640parental ses score2.67 (0.51), 3.02.33 (0.56), 2.00.001iq and behavior scoresfull scale iq (fsiq)105.3 (13.3), 104113 (16.6),1100.010hyperactivity / impulsivity / inattention (hii)12.7 (10.2), 9.38.9 (6.7), 7.00.021brain measuresintracranial volume (icv) (cc)1,403 (148) ; 1,3871,444 (111) ; 1,4330.097cortex volume (cc)746 (76), 740758 (57), 7580.368cortex volume / icv (%) 53.3 (2.0), 53.152.5 (2.3), 52.40.083vmpfc / icv (%) 2.17 (0.18), 2.172.09 (0.13), 2.100.010right vmpfc / icv (%) 1.08 (0.09), 1.081.03 (0.07), 1.040.008left vmpfc / icv (%) 1.09 (0.10), 1.081.06 (0.07), 1.060.059asymmetry coefficient (%) 0.83 (3.4), 1.11.36 (4.1), 1.660.469 demographics, behavior scores, general, and regional morphometry general measures table 1 also displays the results of the comparison across groups of both general and regional brain measures. after controlling for the smaller icv, boys with iclp had proportionately enlarged cortex volumes compared to healthy controls, though this did not reach statistical significance. in our previous publication (nopoulos. 2007), this was significant ; however, the current analysis uses a larger control sample (n = 60) than in the previous publication (n = 50). region of interest expressed as a ratio of icv, the volume of the right vmpfc was significantly elevated in the iclp boys (2.02, s.d. this difference persisted after adjustment for age and parental ses (p = 0.007). the left vmpfc, however, was not quite significantly elevated (2.06, s.d. = 0.17 in the healthy control boys ; p = 0.059). laterality the ac was negative for both groups, indicating a slightly larger left vmpfc than the right. subjects with unilateral cleft were identified and compared to each other to assess if unilateral clefting affected the ac. unlilateral clefts are possible in clo and clp (cpo are not lateralized) giving a total of 37 subjects ; however, five of these were bilateral, leaving 32 unilateral subjects, 13 with clefts on the right and 19 with clefts on the left. the ac was not significantly different between the right and left group (right cleft mean, 1.07 ; s.d., 2.64 ; left cleft mean, 1.48, s.d., 3.7 ; p = 0.730). in addition, the right cleft group did not differ from the left cleft group in hi scores (right cleft mean, 13.5 ; s.d. 9.1 ; p = 0.984) or right vmpfc to icv ratios (right cleft mean, 1.05% ; s.d., 0.07% ; left cleft mean, 1.08% ; s.d., 0.11% effects of iq since iq can potentially impact both behavior and/or brain function, we tested the relationship between fsiq and brain morphology (the right vmpfc), and fsiq and hii scores. pearson correlation showed no relationship between fsiq and the ratio of right vmpfc to icv (r = 0.03, p =.798) and no significant relationship between fsiq and hii score (r = 0.14, p = 0.155). thus, the findings of increased hii and right vmpfc volume in the iclp males are not confounded by the difference in fsiq scores between the two groups. there was a robust interaction between group status and the right vmpfc when predicting hii scores (p 0.30 in each group). 2relationship between behavior scores and right vmpfc structure relationship between behavior scores and right vmpfc structure finally, to evaluate further regional specificity, the rmvpfc to cortex ratio was broken down into its two components of medial orbitofrontal (mof) and lateral orbitofrontal (lof). although both regions were enlarged in the iclp group compared to the controls, this is only significant for the mof (iclp mof mean = 0.79% ; s.d. 0.08% ; p = 0.048 ; iclp lof mean = 1.23% ; s.d., 0.12 ; control mean = 1.21% ; s.d., 0.11%, p = 0.351). conversely, though both regions were positively correlated with hii in the iclp group, this was only significant in the lof (lof r = 0.45, p =.001 ; mof r = 0.16, p = 0.274). although externalizing behaviors have been documented as being elevated in iclp children, no study to date has systematically evaluated hii behaviors in this population. one important exception is the study by richman. that examined a sample of children with iclp and diagnosed adhd by an outside clinician (richman. 2004). after careful examination to determine the accuracy of the adhd diagnosis, they reported that many iclp children that were diagnosed adhd were actually misclassified and were manifesting learning disabilities instead. the proportion of boys in our iclp sample that carried a clinical diagnosis of adhd (based on separate a assessment of local clinician) was five of 50 or 10%, somewhat higher than the 37% of all children in the general population (richman. 2004) ; however, by ratings of parent and teacher s assessment of hii behaviors, nine of 50 or 18% of the iclp boys had clinically significant elevations of these behaviors. even without consideration of what is deemed clinically significant or pathologically elevated, as a whole, boys with iclp exhibit these behaviors more frequently or to a greater degree than their peer counterparts. the region of the brain thought to be a neuroanatomic correlate of these behaviors, the ventromedial prefrontal cortex (vmpfc) was structurally abnormal in the boys with iclp. this is despite the finding in our previous work that the frontal lobe of children with iclp is proportionately smaller. therefore, it is important to emphasize that despite the overall smaller volume of the frontal lobe in iclp (both white and gray matter), the right vmpfc, a subregion within the frontal cortex, is enlarged. it is thought that an important function of this cortical region is to identify the emotional salience of stimuli and use that information to assign values to possible behavioral outcomes (bechara 2005 ; bechara and van der linden 2005). in the context of a neurocognitive theory of impulse control, the amygdala (the impulsive system) tags stimuli as having immediate pain or pleasure. this is then countered by the reflective system (the vmpfc) which weighs the long - term consequences of any given action. thus, impulsive behavior may be due to imbalance of the system with the amygdala having overactive or stronger than normal input compared to the vmpfc. although the left vmpfc was slightly enlarged as well, this did not reach statistical significance. this is consistent with some functional lesion studies that show in males where right unilateral damage to the vmpfc results in substantially more severe behavioral impairment in males compared to damage in the left vmpfc (tranel. this suggests that for males, it is the right hemisphere that is more important in relationship to behaviors and behavioral impairments. the fact that the iclp boys show excess hii and structural abnormalities in the right vmpfc seems in line with what is seen in the healthy controls. while the fact that the cortex is enlarged rather than smaller than normal may at first seem counterintuitive, the phenomenon of excess cortical tissue in males with iclp has been previously well documented in our previous work. this phenomenon is also seen in other neurodevelopmental disorders, including autism (piven. 1996). moreover, the positive correlation between hii scores and vmpfc morphology in iclp boys (the greater the volume, the more abnormal the behavior) support the notion that this is indeed pathological enlargement and not conceptualized as a compensatory mechanism of some type. the spectrum of morphology of the vmpfc from abnormally small / thin to abnormally thick / large can be correlated with the same spectrum of severity of behavior. in adhd 2007b) ; however on the opposite side of the morphology spectrum, where the vmpfc is abnormally large (as in the current study), there are again higher levels of impulsivity. this relationship can be conceptualized as a u - shaped curve in which abnormally small or abnormally large volumes of vmpfc are correlated to pathologic elevations of hii, whereas intermediate volumes are associated with low levels of these types of behaviors. iclp boys would thus be considered to not have the same pathoetiology of the typical adhd, but instead a phenocopy in which the behaviors are descriptively the same as that of adhd, and the region of the brain sub - serving impulse control is affected, but clearly by an altogether different pathologic process. this same phenomenon is seen in the context of total brain volume in which both microcephaly and macrocephaly are associated with mental retardation again, a u - shaped curve in the relationship between iq and total brain size. the current finding of pathological enlargement of cortex in iclp boys is similar in some ways to a recent study of children with idiopathic epilepsy who, like the iclp kids, also showed elevated rates of hyperactivity and inattention. similar to the current study, they also found cortical thickening in association with these behaviors (hermann. 2007) ; however the location was different the dorsolateral prefrontal cortex (rather than the ventral prefrontal cortex) although iclp and epilepsy both have elevated rates of hyperactivity and inattention, there is little else that is clinically similar between the two ; however, they are both neurodevelopmental disorders. the children with idiopathic epilepsy example highlights the notion that developmental aberration in general can lead to structural abnormalities in the brain (for example, cortical thickening) and can be manifested in symptoms of hyperactivity and inattention, presenting as a phenocopy of adhd. the microstructure of the iclp cortex is unknown, therefore the exact nature of the cortical enlargement is also unknown. whether it be enlarged neurons, excess glia or neuropil, or excess dendrites, the end result suggests that whatever the mechanism, the functionality of this region is clearly compromised. moreover, the connectivity of an abnormally structured region could also be impaired, a finding that future studies evaluating white matter integrity should focus on. in sum, the current study identifies iclp boys to have substantially elevated hii scores compared to a healthy comparison group. moreoever, the quantitative measures of hii were directly related to the volume of the vmpfc, an area of the brain with an important role in these behaviors. further studies will be needed to replicate and extend the findings in order to assess factors such as effects of clefting phenotype and whether these findings would also extend to females with iclp. | the purpose of this study is to evaluate quantitative structural measures of the ventromedial prefrontal cortex (vmpfc) in boys with isolated clefts of the lip and/or palate (iclp) relative to a comparison group and to associate measures of brain structure with quantitative measures of hyperactivity, impulsivity, and inattentiveness. a total of 50 boys with iclp were compared to 60 healthy boys without clefts. magnetic resonance imaging brain scans were used to evaluate vmpfc structure. parents and teachers provided quantitative measures of hyperactivity, impulsivity, and inattentiveness using the pediatric behavior scale. boys with iclp had significantly higher ratings of hyperactivity / impulsivity / inattention (hii) and significantly increased volume of the right vmpfc relative to the comparison group. there was a direct relationship between hii score and vmpfc volume in both the iclp group and control group, but the relationship was in the opposite direction : in iclp, the higher the vmpfc volume, the higher the hii score ; for the comparison group, the lower the vmpfc volume, the greater the hii score. the vmpfc is a region of the brain that governs behaviors of hyperactivity, impulsivity and inattention (hii). in boys with iclp, there are higher levels of hii compared to the controls and this is directly related to a significantly enlarged volume of the right vmpfc. enlargement of this region of the brain is therefore considered to be pathological in the iclp group and supports the notion that abnormal brain structure (from abnormal brain development) is the underlying etiology for the abnormal behaviors seen in this population. |
the ability of music to cause emotional reactions and enjoyment in listeners is undoubtedly crucial to its existence. previous neuroimaging studies [14 ] focused on how the brain reacts to pleasant music, leaving open why people like the music they do. these differences can not be due solely to qualities inherent in the music itself, since the same piece may be a psychomusicological studies, for example, [5, 6 ] have pointed to the mere exposure effect (mee) as an important part of the explanation. the mee means that simple exposure to a novel, neutral stimulus by itself increases liking for it [7, 8 ]. accordingly, studies of music preference generally find that liking increases with exposure [5, 6 ], a phenomenon which is utilised in practice by the music and advertising industries. while the mee is a well - established behavioural phenomenon, we know little about its biological basis. only a single neuroimaging study, by elliott and dolan, has so far focused specifically on it. that study used subliminal visual stimuli, and it showed particular involvement of the right lateral prefrontal cortex in implicit memory expressed in preference judgements, indicating this as a key brain area related to the mee. as for the mee of music, our study is the first to examine its neural basis. we examined supraliminal (rather than subliminal) stimuli, which are probably most relevant to everyday music listening. a learning phase familiarised participants with a number of melodies, where the amount of exposure to subsets of the melodies was varied systematically in order to induce different levels of implicit learning. subsequently, they were scanned using functional magnetic resonance imaging (fmri), while performing a liking judgement of the melodies, succeeded by a recognition test. we hypothesized that the right lateral prefrontal cortex would play a role in the mee for music, as it did for visual stimuli, that is, show differential activation as a function of prior exposure. however, given the absence of prior studies on the subject, additional brain areas could be involved. regarding perception of stimulus novelty, on the other hand, we expected involvement of the medial temporal (including hippocampal) region based on evidence from the study by elliott and dolan, as well as others, for example [2, 1012 ]. concerning activations related to subjective liking, we hypothesized the participation of limbic and paralimbic areas previously linked to positive judgements of music, such as insula, striatum, anterior cingulate, and orbitofrontal cortex [14 ]. additionally, it was of interest to us if the results would support the valence lateralization model [2, 13, 14 ], that is, that neural responses to positively judged melodies would be left - lateralized. 30 single - voice melodies of 13 s duration each were composed for the study, see figure 1 for two examples. melodies were digital sequences in both piano and guitar versions, quantised and generated in cubase sx, postprocessed in adobe audition. 10 melodies were in the key of a flat, 10 in e, and 10 in c. the 10 melodies in each key were further balanced between major and minor mode, resulting in a total of six different melody types (see for the report on neural correlates of musical mode). other parameters of the melodies were kept identical, including ambitus (a 10th), tempo (80 beats per minute), and amplitude. as we wished to study exposure effects, we used unknown melodies to eliminate the possibility of preexperimental knowledge of the stimuli. in composing these melodies melodies were composed adhering to the guidelines mentioned above, in order to render them comparable, thus avoiding differences in neural activation solely on the basis of variation of superficial features, such as timbre or tempo. on the other hand, it was also necessary to induce a certain level of variety and song - like qualities in the melodies, in order to make them stand out from each other, and be appreciated as individual pieces of music. we used supraliminal stimuli (as opposed to for example elliott and dolan), since music naturally unfolds over seconds and minutes, rather than milliseconds, and since listeners in real life are in fact most often aware (at least potentially) of the music they are listening to. additionally, six melodies for the learning phase were made along identical guidelines as above, but incorporating a single note detuned by 50 cents (half a semitone). the melodies containing a detuned note were not used in the scanning part of the experiment. an ascending chromatic scale of uniformly distributed intervals (minor seconds), but otherwise with similar characteristics as the melodies, was also employed in the fmri part of the experiment. a preexperimental liking rating of the melodies was done by 49 volunteers, who did not participate in the fmri experiment itself. this rating was carried out in order to divide the melodies into five groups containing six melodies each, so that the mean liking for each melody group would be as equal as possible. the mean liking ratings for the five groups were 2.95, 2.97, 2.97, 2.94, and 2.98, respectively, on a scale from 1 to 5 (overall mean 2.96, sd = 0.51). 21 healthy right - handed (by self - report) volunteers, 12 female, mean age 27.3 (range 2033) participated in the scanning experiment. participants were nonmusicians, but musically adept, as indicated by pitch and rhythm tests, as used at the royal academy of music, aarhus, denmark. in these tests, participants were asked to reproduce progressively more complex melodies and rhythms, by singing (pitch) or clapping (rhythm). the ethical committee of aarhus county approved the study, and participants gave their informed consent prior to their inclusion in the study. for each participant, the experiment incorporated five phases (a e) ; two outside the scanner, followed by two in the scanner, and lastly a debriefing and musical ability test outside the scanner. phases a and b utilised five different pseudorandomised scenarios of stimulus sequences, four of these were used four times each, and the last one five times (for a total of 21, corresponding to the number of participants). total randomisation was avoided to ensure that melodies of the same key and mode would not succeed each other, and that the occurrence of different stimulus types were uniformly separated (by employing a split - halves method). in the scanning phases c and d, stimulus sequences were pseudorandomised for each participant individually in order to avoid the amplification of possible sequence effects. (a) baseline rating and training phaseparticipants listened to 18 melodies over headphones, that they would hear again in phase b. they rated each melody immediately after listening to it, in a two - second gap of silence between melodies, on a 15 scale (1 : least liked, 5 : most liked). participants listened to 18 melodies over headphones, that they would hear again in phase b. they rated each melody immediately after listening to it, in a two - second gap of silence between melodies, on a 15 scale (1 : least liked, 5 : most liked). (b) learning phaseparticipants listened again to the 18 melodies, which were divided into three different groups of six. the melodies were played in pseudorandomised order, either once, seven or 31 times each, depending on which group they belonged to. this meant that participants would have heard a given melody either two, eight, or 32 times, at the conclusion of phase b, depending on scenario (see above). due to the large number of stimulus presentations in this phase, resulting in a total duration of about an hour, three measures were taken to aid the concentration of participants. first, participants were asked to press a button as quickly as possible to the occurrence of detuned notes in the six special melodies that would appear five times each throughout phase b. second, instrument sound in this phase alternated between piano and guitar, in order to help differentiate one melody from the next (the guitar versions of the melodies were not used for the scanning sessions). lastly, participants were allowed a five minute break halfway through the learning phase. participants listened again to the 18 melodies, which were divided into three different groups of six. the melodies were played in pseudorandomised order, either once, seven or 31 times each, depending on which group they belonged to. this meant that participants would have heard a given melody either two, eight, or 32 times, at the conclusion of phase b, depending on scenario (see above). due to the large number of stimulus presentations in this phase, resulting in a total duration of about an hour, three measures were taken to aid the concentration of participants. first, participants were asked to press a button as quickly as possible to the occurrence of detuned notes in the six special melodies that would appear five times each throughout phase b. second, instrument sound in this phase alternated between piano and guitar, in order to help differentiate one melody from the next (the guitar versions of the melodies were not used for the scanning sessions). lastly, participants were allowed a five minute break halfway through the learning phase. (c) liking scanning phasein the scanner, participants listened to these 18 melodies again once each, along with six further melodies that had not been heard previously (for a total of 24). the 24 melodies thus belonged to one of four categories designated f0, f2, f8, and f32, based on the number of previous repetitions in the given scenario. this resulted in a total of 126 trials (melody presentations) for each exposure category (six melodies in each group, times 21 subjects). participants were instructed to visually fixate on a crosshair on a screen, listen carefully to the stimuli over the headphones, and immediately after each melody to rate how well they liked it on a scale from 1 (least liked) to 5 (most liked), using a response box with one button for each finger. the scale and rating procedure was identical to the one in phase a, and thus well known to participants. stimulus sequences further included six repetitions of the chromatic scale, and a number of 28 s silences in between, yielding jittered interstimulus intervals to allow more exhaustive sampling of the fmri signal. in the scanner, participants listened to these 18 melodies again once each, along with six further melodies that had not been heard previously (for a total of 24). the 24 melodies thus belonged to one of four categories designated f0, f2, f8, and f32, based on the number of previous repetitions in the given scenario. this resulted in a total of 126 trials (melody presentations) for each exposure category (six melodies in each group, times 21 subjects). participants were instructed to visually fixate on a crosshair on a screen, listen carefully to the stimuli over the headphones, and immediately after each melody to rate how well they liked it on a scale from 1 (least liked) to 5 (most liked), using a response box with one button for each finger. the scale and rating procedure was identical to the one in phase a, and thus well known to participants. stimulus sequences further included six repetitions of the chromatic scale, and a number of 28 s silences in between, yielding jittered interstimulus intervals to allow more exhaustive sampling of the fmri signal. (d) memory phaseidentical to the preceding phase, except for two important differences. first, a further six new melodies were introduced (bringing the total to 30 in five categories, designated f0, f1, f2, f8, f32). second, the task for the participants was to judge their certainty of having heard the melody before (1 : certain that melody has not been played, 5 : certain that melody has been played). the rating was done with participants in the scanner, as for phase c, in order to ensure that the recognition rating was done in exactly the same physical context as the previous liking rating, and to have the two ratings as close to one another as possible in time. first, a further six new melodies were introduced (bringing the total to 30 in five categories, designated f0, f1, f2, f8, f32). second, the task for the participants was to judge their certainty of having heard the melody before (1 : certain that melody has not been played, 5 : certain that melody has been played). the rating was done with participants in the scanner, as for phase c, in order to ensure that the recognition rating was done in exactly the same physical context as the previous liking rating, and to have the two ratings as close to one another as possible in time. (e) debriefing interview and musical tests phasefollowing the fmri scan, participants were debriefed, interviewed about their experiences during the experiment, and pitch and rhythm tests were performed to confirm a basic level of musical ability (a 22nd subject was excluded from the data analysis on these grounds). following the fmri scan, participants were debriefed, interviewed about their experiences during the experiment, and pitch and rhythm tests were performed to confirm a basic level of musical ability (a 22nd subject was excluded from the data analysis on these grounds). scanning was performed on a signa excite 1.5 tesla mr scanner (general electric medical systems, milwaukee, wi, usa). t1-weighted anatomical images were acquired, and functional images were obtained using a gradient - echo echoplanar imaging sequence ; tr = 2700 ms, te = 40 ms. 34 axial slices covering the whole brain were acquired ; 5 mm thickness (no gap) with an in - plane resolution of 3.44 3.44 mm (64 64 matrix). fmri data analysis of the data from the scanning phase c was done with spm5 (institute of neurology, london, uk). data preprocessing consisted in realignment to the first image and unwarping, coregistration with the t1-weighted images, and slice timing. subsequently, segmentation of gray and white matter, together with spatial normalisation, was performed with the unified segmentation approach. during the spatial normalisation process images images were spatially smoothed using a 10 mm full width at half maximum gaussian kernel. periods with acoustic stimuli were modelled with a hemodynamic response function, whereas periods of subjective ratings after each stimulus were not modelled. the subjective liking rating, and the objective exposure frequency category (f0, f2, f8, or f32), pertaining to each melody, were entered into the model as parametric modulations. contrasts were set up to test effects of subjective liking, based on individual subject ratings, and for effects of stimulus exposure frequency. only clusters of more than 10 voxels were reported in order to minimise the risk of including spurious activations. anatomical locations were established using mainly talairach and tournoux and the talairach client software. to analyse the effects of exposure on liking and recognition, respectively, one - factor repeated measures analyses of variance (anova) were carried out on the data from phase c and d (see table 1 and section 2.2.1). f32, as described in subsection 2.2.1. to ascertain which conditions prompted any significant effect observed, the mean liking ratings for melodies heard 0, 2, 8, and 32 times by the end of the learning phase, are shown in figure 2 (the groups are termed f0 (frequency 0), f2, etc.). the ratings were obtained during the fmri scan (i.e., phase c ; refer to section 4 for experimental procedure). repeated measures anova showed a statistically significant effect of exposure on liking rating, f (3,60) = 2.784, p = 0.048. pairwise comparisons of means showed that liking for the f32 group was significantly higher than for the f0 group, t (20) = 2.312, p = 0.032. none of the other pairwise comparisons was statistically significant (although the f8 to f32 difference was borderline significant, p = 0.051). adjusting for the baseline (phase a) rating of each melody did not change this pattern of findings. reaction times (rts) for the liking ratings differed as a function of presentation frequency, as shown by a repeated measures anova, f (3,60) = 3.842, p = 0.014. pairwise comparisons of means revealed that subjects responded faster to the f32 group than to the other groups, f0 versus f32 : t (20) = 3.08, p = 0.006 ; f2 versus f32 : t (20) = 2.103, p = 0.048 ; f8 versus f32 : t (20) = 2.541, p = 0.019. the actual temporal difference was small ; 1.65 secs. for the f32 group versus 1.80 secs on average for the three other groups, yielding a 0.15 secs. rt also differed slightly as a function of subjective liking rating, f (4,44) = 3.278, p = 0.019. rt for 1 and 5 ratings were on average respectively 0.09 secs and 0.13 secs faster than the overall mean for liking ratings. mean recognition ratings for melodies heard 0, 1, 2, 8, and 32 times before are shown in figure 3. repeated measures anova showed a statistically highly significant effect of exposure on recognition rating, f (3.42,68.42) = 71.734, p < 0.001 (the sphericity assumption was not met, so huynh - feldt correction was applied). pairwise comparisons of means revealed that every pair of means differed significantly ; paired samples t - test, p < 0.05. rt for memory ratings did not differ significantly as a function of exposure, f (3.06,61.20) = 1.098, p = 0.358 (the sphericity assumption was not met, so huynh - feldt correction was applied). brain regions showing increased activity as a function of subjective liking rating (irrespective of presentation frequency) were all located in the left hemisphere and included a cluster in the anterior part of the insula (ba 13), extending into the rolandic operculum (table 2 and figure 4). further activations were found in the dorsal striatum, namely, in the putamen, and in the body of the caudate nucleus. the opposite contrast, of areas showing decreased activity as a function of liking rating, did not result in any significant activation. the contrast based on the amount of previous exposure to the melodies showed activity increases in dorsolateral prefrontal cortex (dlpfc), namely, in bilateral middle frontal gyri (ba 9), and neighbouring inferior middle / frontal gyri (ba 46). differential activations of the left hemisphere further incorporated activations of the postcentral gyrus (ba 2), and the supramarginal gyrus (smg) (ba 40). ba 40 of the right inferior parietal lobe was also implicated, as was ba 6 of the left middle frontal gyrus. the opposite contrast, corresponding to an increase in the fmri signal as a function of stimulus novelty, did not result in any significant activation. we have shown that listening to melodies rated as likeable differentially activates deeper brain structures related to emotion processing, all in the left hemisphere, including the anterior insula and the dorsal striatum. a supraliminal mere exposure effect was a contributing factor to how positively melodies were judged, and brain regions subserving this effect, that is, exhibiting increased activation as a function of prior exposure, included the dorsolateral prefrontal cortex (bilateral ba 9 and ba 46). we would like to caution that the results discussed here are based on an analysis uncorrected for multiple comparisons, (see section 2.2.2) and would therefore benefit from further empirical substantiation. preceding neuroimaging studies of liking effects in music listening have highlighted the contribution of limbic structures, consistent with the knowledge of their involvement in processing of emotions in general (e.g.,). a pet study found several limbic and paralimbic structures to be involved when listeners experienced so - called chills from the music. of these areas, some in particular have been confirmed by one or more of the subsequent studies on responses to pleasant music with pet and fmri, including the ventral striatum (nucleus accumbens), anterior cingulate, orbitofrontal cortex, and insula [24 ]. there is also evidence suggesting that neural responses to pleasant music in general tend to be more lateralized to the left hemisphere, an effect often termed the valence lateralization model [2, 13, 14 ]. of the brain regions that have been previously implicated in the liking - related network, we also found differential activation of the striatum, more precisely its dorsal part, rather than the ventral part often found in previous studies (see below). this only partial replication of the previously observed liking - related network may relate to the fact, that the melodies composed for our study were relatively short, unknown, computer - recorded single - voice melodies, in order to maximize experimental control. previous studies [14 ] were based on recorded music excerpts, mostly from the classical repertoire. activation of the entire liking - related network may be contingent upon using music excerpts varying on a wider range of parameters, such as instrumentation and dynamics, although this could potentially jeopardise stimulus comparability. the involvement of the insula, and more specifically its anterior part, was expected based on prior findings, although in our study it was left - lateralized, compared to mostly bilateral in previous studies on pleasant music (ibid.). menon and levitin used effective connectivity analysis in their fmri study to show a strong ventral tegmental area - mediated interaction of nucleus accumbens and the left anterior insula, forming a mesolimbic dopaminergic system that is central to reward processing. the insula is furthermore known to be one of the most important nodal points (together with the hypothalamus) in neural pathways concerned with autonomic, somatic, and emotional functions [21, 22 ]. on these grounds, menon and levitin attributed insula activation during music listening to its role in regulating autonomic and physiological responses to a rewarding and emotionally salient stimulus. while this explanation remains plausible in our study as well, we can not completely discount a motor response influence, given the slightly faster rt for both the highest and lowest rated melodies (0.09 secs and 0.13 secs faster than the mean, resp.). although it is not ideal that rt differs across stimulus categories, at least four points indicate that the problem was not of an alarming magnitude in the context of our study. second, the motor response (button press), occuring after the melody itself, was not included in the data design model. third, the faster reaction times concerned both extremes of the rating scale, therefore not affecting the subjective liking contrast in a unidirectional way. fourth, and perhaps most importantly, the fmri activation map did not appear to be heavily influenced by finger movements, since neither the primary motor nor somatosensory cortices were found to be differentially involved. moreover, the anterior insula, especially of the left hemisphere has also been implicated in preference judgements of nonauditory stimuli, such as visual (e.g., [23, 24 ]), and food stimuli. consequently, with a cautionary note on possible motor - related contamination, the most likely explanation for the anterior insula activity as a function of liking remains its role as a paralimbic emotion- and reward - related region. the rolandic operculum also showed liking - related activation, although the exact location of the activation peak proved difficult, given the relative proximity of functional areas in this region, in conjunction with the spatial resolution limitations of the fmri method. it is noteworthy that a previous study also indicated rolandic operculum involvement in the perception of pleasant music. in that study, as well as our own, it is possible that the activity of this region was related to sound production planning (wanting to hum along), since rolandic opercular areas have been found to be implicated in both overt and covert singing and speaking in previous neuroimaging studies [2629 ]. the subjects in our study were instructed to lie still, and consequently the rolandic opercular activity would more likely be related to covert than overt vocalisation. we found activation of the dorsal part of the striatum, namely, the putamen and caudate nucleus. the dorsal striatum has been associated with music before in fmri studies ; the caudate nucleus in a contrast of happy versus neutral music, and the putamen in connection with melodic processing. the dorsal striatum has also been implicated in reward processing of various types of stimuli, especially food and drink, for example [25, 32, 33 ]. small. demonstrated with pet a feeding - induced increase in dopamine release in the dorsal striatum, which at the same time correlated with pleasantness ratings of the food. as for the insula activation, a cautionary note on a possible motor response contamination applies here as well, because the basal ganglia, of which the putamen and caudate nucleus are constituents, are known to play a key role in the planning and modulation of movement. we did not find any differential activation in the opposite contrast, that is, related to disliking. other studies have shown possible neural correlates of unpleasant, dissonant music (e.g., [3, 34, 35 ]). a plausible reason for our negative finding is that our stimuli were not sufficiently unpleasant to cause significant differential activation based on low subjective liking, as opposed to the dissonant stimuli used in the studies mentioned, which is a musical property known to cause a high degree of unpleasantness. apart from the particular brain structures involved, we also wished to examine whether our results would support the finding of some researchers (e.g., [2, 13, 14 ]), that neural responses to positively judged melodies are more left - lateralized. the distribution of voxels in our subjective liking contrast was indeed exclusively left - lateralized. this lends some support to a valence lateralization model, but it should be noted that at least some versions of the lateralization model focus on cortical, and more specifically frontal and anterior temporal areas, for example, with empirical support concerning music perception by for example an eeg study by altenmller.. however, later developments of this type of model have included subcortical (limbic and paralimbic) areas as well, for example. evidence from our own as well as previous studies notwithstanding, there does seem to be a need for further empirical work concerning the lateralization effects of positive judgement of music, as not all studies seem to corroborate such findings, for example [3, 38 ]. moreover, it is conceivable that there is a connection between the left lateralization associated with pleasurable melodies, and vocalisation, which in itself could be an explanatory factor behind the observed lateralization effect in this and previous studies (see also the discussion above regarding vocalisation). the prefrontal cortex, in particular ba 9 of the middle frontal gyrus, which was also a central finding in the sole prior neuroimaging study of the mee, was one of the two most prominent activation sites in our study. the other was ba 46, which together with ba 9 forms the dlpfc [39, 40 ]. we also found additional areas of activation (bilateral ba 40, and left ba 2 and 6), which will be discussed afterwards. the dlpfc is central to higher - level cognitive operations, such as executive function and memory functions, including retrieval and working memory (e.g.,). working memory plays a crucial role in tasks related to the perception of music, which unfolds over time, since listeners need to maintain the auditory stimuli in short - term memory and relate them to subsequent input, see also. accordingly, studies on working memory in music perception have shown its relation to dorsolateral and inferior frontal regions, see for example [41, 42 ] for a review. when listening to a familiar melody, it is conceivable that stored information about it will continuously be compared with the current auditory input, in the working memory system. platel. thus found bilateral activation of mainly ba 9 and 10 of the middle frontal gyri in an episodic music memory task, using pet, and they ascribed this frontal activity to perceptual analysis of the melodies in working memory. parallel to its role in working memory, the dlpfc has also been widely implicated in memory retrieval, especially when some kind of evaluation of the retrieved information is needed ; see for a review. this function of the dlpfc could well have played a role in the observed activity pattern in our study (discussed below in the section on the mee). it should be noted that dlpfc activation as a function of familiarity is not exclusive to music perception. for example, a pet study by fletcher and dolan found that ba 9 of the middle frontal gyrus, extending inferiorly into ba 46, responded to familiar versus novel visually presented words (see also for a review). in sum, the observed dlpfc activation as a function of exposure was expected, based on prior research, and it can best be explained by an increase in automatic retrieval and working memory processes when listening to familiar melodies. the parietal activations as a function of exposure can also be tied to memory - related processes, given the evidence on parietal involvement (including ba 40) in memory functions [4549 ]. moreover, the inferior part of ba 40, that is, in particular the smg, has been described as especially implicated in successful memory retrieval [47, 50 ]. subjects in our study certainly exhibited stronger memory traces for melodies heard more often, as shown by the recognition ratings, and this fact may have contributed to the observed inferior parietal activations. (note, however, that subjects were not asked to explicitly recall melodies for the scanning session reported here, a topic which is discussed below.) similarly, in the study of the mee by elliott and dolan, the left inferior parietal cortex (ba 7 and 40) was associated with retrieval attempt. furthermore, other neuroimaging evidence has related activation of especially the smg part of the inferior parietal cortex to music perception [5154 ]. memory functions could very well have played a role in the smg activity found in those studies. from a connectivity perspective, it is interesting to note that the inferior parietal activations could be connected to the dlpfc activity discussed above, since these two groups of cortical areas form a frontoparietal functional network, which numerous studies have found to be involved in memory and working memory processes in a wide range of cognitive tasks ; see for example [46, 5557 ]. the involvement of the left postcentral gyrus (ba 2), a primary somatosensory area, in conjunction with the premotor cortex (ba 6) activation of the left middle frontal gyrus, could possibly have been related to the button press response itself (which was done using the right hand). rts differed marginally between melodies heard most often and the rest, and it can not be completely discounted that this difference had an observable impact on the fmri signal in this exposure - related contrast. we had expected to find participation of medial temporal lobe regions (particularly the hippocampus) in the contrast pertaining to the neural basis of the effect of stimulus novelty based on findings from studies on both music as well as other stimulus types [2, 912 ]. however, no significant differential activation was observed. a possible reason for this negative finding hinges on the prolonged learning phase, which thoroughly familiarised participants with the general style of the melodic material. participants may consequently not have perceived previously unheard melodies as sufficiently novel for the medial temporal lobe system to become differentially activated. previous exposure to melodies did produce an mee, meaning that participants preferred melodies heard the most often during the learning phase b (figure 2). since memory ratings confirmed that previous exposure had a substantial positive impact on the recognition of the melodies as well (figure 2), it seems highly probable that memory effects leading to this recognition facilitation also played a leading role in the observed liking increase. this interpretation of the behavioural results was supported by the fmri data, which showed a differential activation increase in memory - related dlpfc and parietal regions, as a function of exposure. importantly, participants were not actually queried about recognition, or other memory - related tasks, until after the learning phase and scanning (i.e., not until phase d, see section 2). participants were thus not aware until this late stage of the experiment that their memory of the melodies would be tested. during the scan (phase c), the reported dlpfc and inferior parietal activity therefore most likely reflect unintentional retrieval processes, drawing upon the exposure to the melodies during phase b. hearing more familiar melodies seems to have automatically engaged the memory system, even though participants did not actively try to remember them. previous behavioural research and theoretical work have often described the mee as essentially an implicit memory phenomenon, for example [5, 58 ]. the sole previous neuroimaging study of the mee similarly related the effect to implicit retrieval. elliott and dolan (ibid.) incidentally showed a similar neural activation pattern to the one we find, including ba 9. however, while the memory processes of the participants in our study may well have been initiated unintentionally, as well as learned incidentally, these processes can not be termed implicit, given that the explicit recognition test showed a clear learning effect. this result relates to the fact that we used supraliminal, and not the subliminal stimuli often employed in mee studies. it is therefore a significant result of the present study that some of the findings from based on subliminal visual stimuli, have now been replicated and expanded upon with relation to supraliminal auditory stimuli. however, the supraliminal nature of our stimuli, resulting in participants being able to consciously recognise melodies when asked to do so (phase d), may in fact have diminished the mee, since evidence have supported that it is usually stronger for subliminal stimuli [59, 60 ]. nonetheless, our stimuli had the benefit of being more relevant to how music is enjoyed in everyday listening. moreover, some researchers have suggested that explanations of the mee should not rely crucially on the distinction between explicit and implicit memory. a remaining question concerns the underlying reasons for the mee in music. the perceptual fluency / attributional model [62, 63 ] argues that the easy, fluent processing associated with familiar stimuli is misattributed to a positive disposition toward the stimulus itself. zajonc supports instead the notion that an absence of adverse effects when a stimulus is presented will generate a positive inclination towards it, through the basic mechanism of conditioning. the merits of these theories notwithstanding, we would like to suggest that, especially in the case of music, which is a temporally extended stimulus, exposure effects on liking are highly dependent on expectancy (sometimes termed anticipation or prediction). it has been observed in psychomusicological research [6567 ] by meyer and others that the degree of fulfillment of listeners ' expectations towards the music greatly influences how it is perceived and appraised. huron argues that the mere exposure effect should more aptly be considered a prediction effect. behavioural data have supported the notion that implicit learning of melodies does generate expectancy effects in listeners [68, 69 ]. apart from these theoretical and behavioural empirical insights about expectancy in music, a magnetoencephalography study, see also, showed brain networks engaged in so - called predictive coding, see [72, 73 ], when perceiving music. future studies will hopefully elucidate the relation between exposure, liking, and expectancy, as well as its neural basis. this study investigated the neural correlates of liking and exposure in music perception, as well as their interrelation. listening to subjectively likeable melodies recruited part of the limbic / paralimbic system also shown by earlier studies. brain areas showing liking - related activation included the anterior insula, and the dorsal striatum (putamen and caudate nucleus), all left - lateralized, thus providing some support of a valence lateralization model. the mere exposure effect was a contributing factor to how positively melodies were judged, since melodies heard most often during a prescan learning phase were rated as most liked, as well as most recognisable. the brain region subserving this exposure effect was mainly the dorsolateral prefrontal cortex, consistent with the main finding of the only prior neuroimaging study of the mere exposure effect. our study expanded on the previous by showing the effect for supraliminal auditory stimuli, as opposed to subliminal visual stimuli. furthermore, our study for the first time provided functional neuroimaging evidence of the mere exposure effect in music, pointing to underlying automatic memory processes being involved. we suggested expectancy as a potentially important factor in these phenomena, requiring further investigation by future studies. | we used functional magnetic resonance imaging to investigate the neural basis of the mere exposure effect in music listening, which links previous exposure to liking. prior to scanning, participants underwent a learning phase, where exposure to melodies was systematically varied. during scanning, participants rated liking for each melody and, later, their recognition of them. participants showed learning effects, better recognising melodies heard more often. melodies heard most often were most liked, consistent with the mere exposure effect. we found neural activations as a function of previous exposure in bilateral dorsolateral prefrontal and inferior parietal cortex, probably reflecting retrieval and working memory - related processes. this was despite the fact that the task during scanning was to judge liking, not recognition, thus suggesting that appreciation of music relies strongly on memory processes. subjective liking per se caused differential activation in the left hemisphere, of the anterior insula, the caudate nucleus, and the putamen. |
the [2,3]- and [1,2]-sigmatropic rearrangements of ammonium ylides are studied by a combination of experimental, standard computational, and dynamic trajectory methods. the mixture of concerted [2,3 ] rearrangement and bond cleavage observed experimentally is accounted for by the outcome of trajectories passing through the formal [2,3 ] rearrangement transition state. in this way the bond cleavage is promoted by the pericyclic stabilization of the [2,3 ] transition state. it is proposed that this dynamic effect is responsible for the pervasive co - occurrence of the two rearrangements. |
|
the importance of an aesthetic appearance has shown to be an important element in society 's acceptance of an individual.1 malocclusion often causes psychosocial problems as it affects the aesthetics of the person, disturbances of oral function, such as speech, mastication and swallowing, increased susceptibility to trauma, gingival and periodontal diseases and finally the general health of the individual. with a greater attention to aesthetics, in recent years, there is a notable increase in orthodontic treatment demand as a consequence of the higher perception rate of malocclusions.2 with the growing demand for orthodontic treatment a variety of clinician - based indices have been developed out of which the most commonly employed malocclusion indices are the dental aesthetic index, index of orthodontic treatment need (iotn), peer assessment rating and index of complexity, outcome and need.3 iotn was introduced by brook and shaw in 19894 and was found to be valid, reproducible and easy to perform since only identification of the most severe trait and assessment of the aesthetic component is required. information on the prevalence and distribution of malocclusions and its severity in a specific ethnic group is very much essential for planning an orthodontic treatment,5 as it helps in early orthodontic intervention. since there is only little available epidemiological data on the prevalence of malocclusion in south travancore population, this study is aimed to assess the prevalence and severity of malocclusion in 12 - 16 years old children of south travancore using iotn index. this descriptive study was done for a time period of 1-year with the samples being collected from the records data base of four dental centers. it was found that child population of age 12 - 16 years of south travancore comes to approximately 900,000 and is fairly high sample size. hence, in order to have a representation, the researcher decided to select a sample based on convenient sampling method by fixing the sample as 120 (n = 120). it is assumed that a fairly larger sample will automatically reflect the peculiar feature of the population. patients within the age group of 12 - 16 years who were in their growth period were included in the study and patients below the age 12 years and above 16 years in whom growth had almost completed and patients with history of previous orthodontic, prosthodontic, and facial surgery treatment were excluded from this study. study models where made anonymous and numbered equally, each of the four centers consisting of 30 subjects. the order of presentation of study models were randomized using random number tables, before they were seen by the examiner. four heads of the department of orthodontics with more than 15 years experience scored the 120 pre - treatment study models to establish a cut - off point to indicate whether treatment was needed or not. this was taken as the gold standard (gs) to which the rest of the eight orthodontist 's ratings were compared. eight orthodontists then screened the 120 pre - treatment study models using the iotn. at a second session, approximately 30 days after the first session, each rater again assigned a score to a random subset of 60 study models, stratified by occlusal severity, to test intra rater reliability. for both sessions, the study models were displayed in numerical order on tables in a large room. the raters were asked to start at staggered points throughout the sample and were instructed to work at their own pace with no time limit. at the beginning of both rater sessions, the following verbal and written instructions were given to the raters : you are the orthodontic consultant for a private corporation for which a fund has been established to provide orthodontic treatment for personnel. you are to evaluate these study models of personnel and answer the following question : in your opinion, to what extent does this occlusion needs orthodontic treatment ? please circle the corresponding number : at the end of the second session, each rater was asked to answer the following question : on the seven - point scale that you have used throughout this rating session, indicate the score at or above which you feel orthodontic treatment is indicated. this score was termed the indicated treatment point (itp) and was recorded for each of the 8 raters. the mean itp of the gs was compared with the mean score of each dental cast. the dental cast is assigned to no treatment category, if the mean itp of the gs was less than mean itp of each cast. tertiary care setting, with the study being conducted in the department of orthodontics at pms dental college and the samples being collected from four different dental health care centers, spread over the targeted area. no external funding was utilized for this study and cost entirely borne by the investigators. data were analyzed using computer software, statistical package for social sciences version 16 and were expressed in its frequency and percentage. the simple kappa statistic was used to assess agreement of the index with the expert panel. weighted (fleiss cohen) kappa statistics were used to assess both intra- and inter rater reliability.6 the kappa statistic is a measure of agreement that has been corrected for chance agreement.7 a kappa value of 0 indicates no agreement beyond chance, whereas a kappa value of 1 indicates perfect agreement. a score of 3 was selected as cut off values to grade low (1 - 3) and high (4 - 7) for all scores (table 1 and graph 1). association of gs with four tertiary dental health care centers. inter rater reliability was calculated by comparing all raters on the entire sample of 120 sets of casts during the first session8. intra rater reliability was calculated using kappa, which was the index of agreement after avoiding a chance agreement. intra rater reliability was based on a comparison of the scores assigned by the raters to the subset of 60 casts at the second session to the scores assigned by the raters to those same casts at the first session. gs was determined by calculating the mean score of 4 raters. if the mean score for each cast was compared to the mean score of 4 raters, and if the cast score was below the mean score, the case was assigned to the no treatment category. if the mean rater score for a cast was equal to or greater than the mean score of the raters, the case the following values were calculated for the index9 : sensitivity, specificity, positive and negative predictive values, accuracy (percentage agreement), and kappa statistic. sensitivity is the percentage of all cases needing treatment that the index identified as needing treatment. specificity is the percentage of all cases not needing treatment that the index identified as not needing treatment. positive and negative predictive values were the percentage of cases that the index identified as needing (positive) or not needing (negative) treatment that in fact need or do not need treatment. accuracy in this study was defined as the percentage agreement with the decisions of the expert panel (table 3). tertiary care setting, with the study being conducted in the department of orthodontics at pms dental college and the samples being collected from four different dental health care centers, spread over the targeted area. no external funding was utilized for this study and cost entirely borne by the investigators. data were analyzed using computer software, statistical package for social sciences version 16 and were expressed in its frequency and percentage. the simple kappa statistic was used to assess agreement of the index with the expert panel. weighted (fleiss cohen) kappa statistics were used to assess both intra- and inter rater reliability.6 the kappa statistic is a measure of agreement that has been corrected for chance agreement.7 a kappa value of 0 indicates no agreement beyond chance, whereas a kappa value of 1 indicates perfect agreement. a score of 3 was selected as cut off values to grade low (1 - 3) and high (4 - 7) for all scores (table 1 and graph 1). inter rater reliability was calculated by comparing all raters on the entire sample of 120 sets of casts during the first session8. intra rater reliability was calculated using kappa, which was the index of agreement after avoiding a chance agreement. intra rater reliability was based on a comparison of the scores assigned by the raters to the subset of 60 casts at the second session to the scores assigned by the raters to those same casts at the first session. gs was determined by calculating the mean score of 4 raters. if the mean score for each cast was compared to the mean score of 4 raters, and if the cast score was below the mean score, the case was assigned to the no treatment category. if the mean rater score for a cast was equal to or greater than the mean score of the raters, the case the following values were calculated for the index9 : sensitivity, specificity, positive and negative predictive values, accuracy (percentage agreement), and kappa statistic. sensitivity is the percentage of all cases needing treatment that the index identified as needing treatment. specificity is the percentage of all cases not needing treatment that the index identified as not needing treatment. positive and negative predictive values were the percentage of cases that the index identified as needing (positive) or not needing (negative) treatment that in fact need or do not need treatment. accuracy in this study was defined as the percentage agreement with the decisions of the expert panel (table 3). the kappa coefficients for the four experts were 0.65, 0.47, 0.41, and 0.6, respectively. the casts with mean scores equal to or > 3.91 were classified to the treatment category. the remaining casts, with scores < 3.91 were assigned to the no treatment category. 64 (53.3%) casts belonged to the treatment category, while 56 (48.7%) were categorized as no treatment category. the 8 raters exhibited a very good agreement for inter rater reliability of the 60 casts that were evaluated twice by each rater. the overall agreement between the iotn gs and 8 orthodontists for assessing orthodontic treatment need (the kappa coefficient) was 0.44. this agreement was moderate according to the altman classification.10 the prevalence of orthodontic treatment need in south travancore was found to be 53.3%. this was more in line with prevalence of orthodontic treatment need of 49.2% in south travancore population among 12 - 15 age groups in 1969.11 the kappa coefficient value of 0.44 suggests that there was moderate agreement between the iotn gs and 8 orthodontists for assessing orthodontic treatment need in trivandrum population (p < 0.001). however, there was good agreement among the iotn raters for inter rater and intra rater reliability. malocclusion features have been found to vary with a different population, age, gender, and ethnicity. assessment of the prevalence of malocclusion gives a scientific insight which helps in disbursing health to the needy. specific criteria of random sampling selection were used in this study and the racial composition was a representative of south travancore. the sample consisted of children of different ages,, the sample should be from a well - defined population, which is large enough, and include children of different ages who are not orthodontically treated. this was more in line with prevalence of orthodontic treatment need of 49.2% in south kerala population among 12 - 15 age groups in 1969. though malocclusion is not considered life threatening, it has various psychosocial implications since good dental appearance is often associated with success in many pursuits and social acceptance. children having malocclusion can be identified and corrective measures commenced at the earliest to prevent a wider impact on their psychological development. the epidemiological data on the prevalence of malocclusion is essential in assessing the resources for orthodontic services and can provide valuable information regarding the etiology of malocclusion and other complex traits. the information from this present study can be appropriately utilized for the future planning applicable to orthodontic treatment requirement among this population. as for the need of treatment in different populations and cultures, there are by and large multiple levels of treatment needs based on socio - economic and or ethnic variables. thus, orthodontic treatment need should be understood as a relative concept and, when expressed as a single figure, is not comparable between different cultures. a potential future investigation would be to repeat this study with a few changes in the methodology. instead of having the raters assign a number that represents the level of treatment for each cast in the sample, the raters could place the casts into one of four possible categories of treatment need. the raters would not have to choose the itp because the categories define the itp. a potential future investigation would be to repeat this study with a few changes in the methodology. instead of having the raters assign a number that represents the level of treatment for each cast in the sample, the raters could place the casts into one of four possible categories of treatment need. the raters would not have to choose the itp because the categories define the itp. the prevalence of orthodontic treatment need in south travancore population was found to be 53.3%. this denotes that there is not much of difference in the incidence of malocclusion in this population after a period of forty five years since the last published data. | background : assess prevalence and severity of malocclus ion in 12 16 year old population of travancore using iotn index. tertiary care setting, with the study being conducted in the dept of orthodontics at pms dental college & the samples being collected from four different dental health care centres. study design is descriptive study.materials and methods:120 pre- treatment study models of patients aged 12 - 16 yrs were collected, 30 each from four dental health centres spread across the state. these casts were subjected to three stages of screening based on iotn index to arrive at the prevalence and severity of malocclusion in the targeted group. kappa statistics and stratified kappa statistics.results:results of the study showed that the prevalence of malocclusion and treatment need was 53.3%.conclusions : the prevalence of orthodontic treatment need in south kerala was found to be 53.3%. |
heart murmur is a common phenomenon in as high as 50% of children, and it is one of the most common reasons for referral. the role of the primary care provider is to differentiate the common innocent murmur from pathological murmur resulting from structural heart disease. referral to the pediatric cardiologist is the next step if the nature of the murmur is unclear to the primary care physician. the most helpful parameter for distinguishing innocent from pathologic murmurs is the quality of the sound. still 's murmur is the most common innocent murmur and has a typical vibratory and musical quality, whereas most pathological murmurs have much harsher grafting sound. confidence of the examining doctor, clinical impression, anxiety level of parents and child 's availability for followup are the influencing factors in decision process of referral to pediatric cardiologist. academic general pediatricians were found to be able to correctly diagnose pathological murmurs with a similar sensitivity as compared to pediatric cardiologists. however, overall accuracy of diagnosing innocent murmurs among pediatricians was reported to be lower than pediatric cardiologists. differentiation of normal, innocent, and pathological murmurs by primary care physicians might ameliorate many parents and children anxiety and medical expenses. there are few literatures evaluating interdisciplinary consistency for cardiac auscultatory skills are some of them ; conducted on trainees [57 ]. academic family physicians participate in the training programs of the family physicians, and they play an important role in the training process. within this respect, the aim of this study is to evaluate degree of agreement, and concordance of normal, innocent, and pathologic murmur decision between academic family physicians and pediatric cardiologist. the study was approved by local ethical committee, and written informed consent was obtained from children 's parents. one in six students in each classroom was randomly chosen to participate in the study. informed parental consent approval was obtained from 715 of them. in the final step, 715 students were evaluated first by one of the family physicians and then by the pediatric cardiologist. demographic information of children such as age, grade, and residence was obtained from school records and from children themselves. three of the four academic family physicians and the pediatric cardiologist agreed to participate in the study. all three academic family physicians and the pediatric cardiologist were actively participating in the training program of family practice and pediatrics. each child was examined by one of the three family physicians and the pediatric cardiologist. family physicians and pediatric cardiologist were scheduled for physical examination on different time periods. first, family physicians examined children. family physicians filled out a report form including vital signs and characteristics of heart sounds. on the scheduled time, pediatric cardiologist blind to family physicians ' reports examined the same children and filled out a separate sheet of the same report form and scheduled children with pathologic murmur for echocardiographic examination. vital signs including height, weight, heart rate, and blood pressure were obtained. then auscultatory examination was performed. first and second heart sounds were evaluated for intensity and appropriate splitting. periods of systole and diastole were assessed. if present, intensity, frequency, duration, quality, location, and radiation of the murmur were described. innocent murmurs were classified as still 's, venous hum, supraclavicular systemic bruit, or unclassified, and pathologic murmurs were defined. report form sheets of the family physicians and pediatric cardiologist for each child were compared. bmi (body mass index) was calculated by using weight (kg)/height (m) formula. after 10 minutes of rest in a quiet room, 3 seated blood pressure and heart rate measurements were taken at 15-minute intervals, and an average of three measurements was used in subsequent analysis. agreement of normal, innocent, and pathologic murmur classification decision between family physicians and pediatric cardiologist were analyzed by using kappa statistic. there were 355 (49.7%) girls and 360 (50.3%) boys in the study group. normal, innocent, and pathologic murmurs were reported for 419, 228, and 54 children in family physicians ' reports, respectively. pediatric cardiologist agreed on 383 (91.4%) children as normal, 191 (83.7%) children having innocent murmur, and 19 (35.2%) children having pathologic murmur among family physician 's reports. family physicians could not decide on 14 auscultatory findings where pediatric cardiologist reported 11 of them as innocent murmur, 1 pathologic murmur, and 2 of them as normal. pediatric cardiologist could not decide on one of the cases which a family physician was reported as pathologic murmur. table 2 shows details about decisions of family physicians and pediatric cardiologists. when concordance of decisions between family physician and pediatric cardiologist was analyzed by kappa analysis, strength of association between them was statistically significant (value = 0.679, 95% ci 0.6300.727, p <.001). the results show that they agreed on the majority of normal and innocent murmur decisions. when echocardiography was performed to these children, there was no pathological finding in any of them. twenty - six children (25 with pathologic murmur decision and 1 with no decision) were scheduled for echocardiography. five children with pathologic murmur were lost at followup. finally echocardiography was done to 21 children with pathologic murmur decision and 1 child with no decision. fourteen (67%) of 21 children with pathological murmur decision were diagnosed as structural heart disease, and there was no pathological finding in 7 of them. we have evaluated strength of association of normal, innocent, and pathologic murmur decision between family physicians and pediatric cardiologist. our results show that family physicians and pediatric cardiologist agreed on the majority of normal heart sounds and innocent murmurs. however, family physicians reported more pathologic murmurs which can be explained as an overcautious approach toward potential serious outcomes in the presence of cardiac pathology. clinical skills of primary care physicians in the evaluation of cardiac murmurs may have vital importance and recognition of congenital heart disease in children is a diagnostic challenge. training programs in pediatrics and family medicine should emphasize on discriminating the pathologic from the innocent heart murmur based on the history and physical examination. even with good training and long experience, it is recognized that there will be situations in which the primary care physician will be uncertain about the presence or absence of heart disease. there is no published study comparing auscultatory skills of primary care physicians and pediatric cardiologists to our knowledge. clinical examination by a pediatric cardiologist is a sensitive and specific way to discriminate innocent murmur from congenital heart disease. further investigations have focused on the question of whether generalist can do as well [1214 ]. diagnosis before referral to pediatric cardiologist has been reported to reach only near to 20% among general practitioners. in two studies reported by rajakumar. and haney., general pediatricians were about as sensitive to the heart disease as the pediatric cardiologists, but the specificity of the generalists was poorer [12, 13 ]. furthermore the diagnostic accuracy of heart murmurs by pediatricians especially their specificity for the diagnosis of heart disease is suboptimal. on the other hand primary care physician serves a gatekeeper role in the evaluation and referral of children with heart murmur. many parents may not be aware of that and the majority of childhood heart murmurs can be innocent and transient. parental anxiety is common among parents of children with heart murmur. distinguishing innocent murmur from pathological murmur in primary care would help to improve parental anxiety in general. furthermore, better training of family physicians in cardiac auscultation may help in reducing medical expenses. skills in clinical assessment of heart murmurs in children can be improved among general practitioners in training. the result of our study shows that there may be good concordance between academic family physicians and pediatric cardiologist auscultatory findings. even though there is no published literature proving the effect of diagnostic accuracy for cardiac problems in children among family physicians, we believe that identifying the majority of heart murmurs by family physicians would help to improve health outcomes in general especially in areas with high children population and in rural areas where it may not be easy to reach pediatric cardiologist. results of our study show that family physicians may identify majority of normal children and children with an innocent murmur, and more cautious decision is an expected approach in the presence of pathologic murmur. the conclusion drawn from the data collected by a single group of family physicians and pediatric cardiologist can be safely generalized to others with similar training and auscultatory skills. however, the data of this study might not reflect the diagnostic accuracy of family physicians and pediatric cardiologists in general. further research is needed on diagnostic accuracy, sensitivity, and specificity of cardiac auscultatory skills of family physicians practicing in the field and pediatric cardiologists or general pediatricians. despite its limitation in this scope, this study has important implications for child health in primary care. conclusions of this study reflect the situation in which family physicians and pediatric cardiologist have done a preliminary evaluation and concluded that the murmur warrants echocardiography. it is a common approach that echocardiography can be done only to a minority of children since prevalence of heart murmur is very high and the majority of them are innocent murmurs. therefore better training of primary care physicians in cardiac auscultation may be of great benefit for primary health care. our results reveal that cardiac auscultatory skills of family physicians may be strongly associated with pediatric cardiologists. however higher percentage of undecided and pathologic murmur reports among family physicians shows us that there is still need for improvement of the family physicians auscultatory skills. | aim. heart murmur is common in children, and it is one of the main reasons for referral among children in primary care. the aim of this study is to evaluate agreement and consistency of normal, innocent, and pathologic murmur decision between academic family physicians and academic pediatric cardiologist. methods. seven hundred fifteen primary school children were examined by family physicians and paediatric cardiologist. auscultatory examination was performed. intensity, frequency, duration, quality, location, and radiation of the murmur were described if present. agreement of normal, innocent, and pathologic murmur classification decision between family physician and paediatric cardiologist was analyzed by using kappa statistic. results. normal, innocent and pathologic murmurs were reported for 419, 228, and 54 children in family physicians ' reports, respectively. paediatric cardiologist agreed on 383 (91.4%) children as normal, 191 (83.7%) children having innocent murmur, and 19 (35.2%) children having pathologic murmur among family physician 's reports. there was good consistency between family physicians and paediatric cardiologist (value = 0.679, 95% ci 0.6300.727, p <.001). they agreed on the majority of normal and innocent murmur decisions. however family physicians reported pathologic murmur more frequently. conclusion. cardiac auscultatory skills of academic family physicians may be concordant with paediatric cardiologist. |
mesenteric ischemia without thromboembolic occlusions of the mesenteric arteries is known as nonocclusive mesenteric ischemia (nomi). current knowledge of the epidemiology of nomi is limited and mainly derived from published cases [1, 2, 3, 4 ]. the dialysis population, and in particular hemodialysis (hd) patients, are especially prone to develop nomi. the estimated incidence of mesenteric ischemia in this group is in the range of 0.31.9% per patient / year, in contrast to an up to 0.2% value for the general population. this could be due in part to the increasing number of published cases as well as the increasing survival of end - stage renal disease (esrd) patients, predisposing them to nomi. in the absence of noninvasive tools with sufficient sensitivity and specificity, increased awareness and early diagnosis might improve the general understanding of the nomi incidence and of the characteristics of patients with nomi. her past medical history included primary hypertension, paroxysmal atrial fibrillation, atherosclerosis of the carotids and the abdominal aorta, and chronic congestive heart failure. her body weight was 46 kg and the ultrafiltration volume was around 2.52.7 kg each time. during hd, the blood pressure was 120/70 mm hg before hd and dropped to 80/60 mm hg after hd. in august of 2008, she was admitted to our department because she developed mild, diffuse abdominal pain in combination with nausea and vomiting. three months prior to admission, she had several episodes of abdominal pain, each time occurring after hd. her abdominal pain began and became more severe after hd (usually in the situation of hypotension). however, repeated blood tests did not show any abnormal results and an abdominal x - ray ultrasound was also normal. on admission, her physical examination showed that her blood pressure was 120/70 mm hg, a heart rate of 76 beats / min and a body weight of 43 kg ; she had dry skin and complained of thirst. an abdominal examination revealed that she had decreased bowel sounds with a mild tenderness to deep palpation, especially in the lower right quadrants. a stool examination for occult blood was negative. laboratory findings included blood urea 30.9 mmol / l, serum creatinine 749 umol / l, serum amylase 34 iu / l, calcium 2.2 mmol / l, phosphate 2.3 mmol / l, albumin 30 g / l, ipth 130 pg / ml, hemoglobin 114 g / l, and a white blood cell count of 11.1 10/l. the rest of her laboratory examination (including disseminated intravascular coagulation, c - reactive protein, erythrocyte sedimentation rate, and tumor biomarkers) was within normal limits. a plain abdominal film in the erect position disclosed abdominal distention with small fluid levels of the small intestine. an enhancement ct showed intestinal dilatation indicating a mesenteric ischemia ; there was no evidence of a tumor, severe intestinal infection or obstruction. the patient was initially treated with intravenous antibiotics (rocephin 2.0 g once daily). her medical condition did not improve in the following days. a ct angiography (cta) was then performed, and the result showed that she had a portal vein thrombus with a normal superior mesenteric vein and a mesenteric artery stenosis suspecting nomi (fig. 1, fig. 2, fig. 3, fig., she was treated with subcutaneous low - molecular - weight heparin (fraxiparine 5000 anti - xa iu / ml, subcutaneously once and twice every other day). thereafter, we recommended decreasing her ultrafiltration volume to less than 2 kg each time in order to avoid episodes of hypotension during or after hd ; she was treated with intravenous prostaglandin e1 10 g / day, and the abdominal pain gradually declined after 2 weeks. nomi, first described by ende in 1958, is one of the diseases that affect the vasculature of the intestine. the causes of mesenteric ischemia have been traditionally classified as either occlusive or nonocclusive, based on the underlying pathology. occlusive causes of mesenteric ischemia comprise about 80% of all cases and include acute mesenteric arterial thrombosis or embolism, chronic mesenteric ischemia, mesenteric venous thrombosis, and strangulated bowel obstruction. most studies have shown that 20% of all cases of mesenteric ischemia are nonocclusive in origin [8, 9 ]. the overall incidence rate of nomi is estimated to be approximately 1/5,000 in hospitalized patients. the mortality rate, despite a decrease from a shocking 80% 20 years ago, is still high, at approximately 50%. a major reason for this high mortality rate is delayed diagnosis and treatment initiation, which may range from 12 h to 11 days [10, 11, 12 ]. in clinical practice, the majority of patients die from nomi without any suspicion of intestinal infarction, even at the time of the patient 's death. high - risk factors include atherosclerosis, low cardiac output states (recent myocardial infarction, congestive heart failure, and arrhythmias), esrd and medications that are known to reduce mesenteric blood flow ; for example, cyclosporine, propranolol and phenobarbital overdose, ergot derivatives. other causes of mesenteric vasospasms are various forms of shock, septicemia, dehydration, and hypotension following heart surgery (cardiopulmonary bypass) or major abdominal surgery. the dialysis population, and in particular hemodialysis patients, are especially prone to the development of nomi. the estimated incidence of mesenteric ischemia in this group is in the range of 0.31.9% per patient / year, in contrast to an up to 0.2% value for the general population. this could be because of an increased number of published cases as well as the increased survival of esrd patients, predisposing them to nomi. the susceptibility of dialysis patients to nomi is explained by the common known risk factors in this patient group : widespread atherosclerosis, advanced age, long - standing hypertension, diabetes mellitus, congestive heart failure, arrhythmias, and the use of mesenteric vasoconstrictor drugs are common [13, 14 ]. in addition, esrd patients suffer from so - called calciphylaxis by the presence of inappropriately high calcium - phosphorus product because of the routine use of calcium - based phosphate binders and high - dose vitamin d analogues, resulting in the calcification of the intima and media layers of their arteries. moreover, the use of recombinant human erythropoietin in hd patients also plays a key role in the occurrence of nomi. recent studies in an in vitro and ex vivo model demonstrated that erythropoietin also has a direct vasopressor effect on small mesenteric resistance vessels. hypotension, especially when there are repeated episodes, is the most important and immediate precipitating factor for nomi in dialysis patients. in our case, the patient has accelerated atherosclerosis, arrhythmias, hypoalbuminemia and hyperphosphatemia, frequent hypotension during the hd, her body weight on admission was 43 kg (which means ca. 23.5 l of body water) and her ultrafiltration was 2.52.7 kg (which meant the removal of more than 10% of total body water) ; thus, it can definitely provoke ischemia. the condition improved after rehydration by decreasing ultrafiltration. it seems that the combination of nondistensible, calcified mesenteric blood vessels and a dialysis - induced hypotension is the background upon which splanchnic hypoperfusion is liable to occur. the clinical manifestation of nomi is variable, depending on the length of the involved bowel, the rapidity of hypoxia onset, and the intrinsic resistance of the bowel wall to ischemia and bacterial penetration. when present, pain is usually severe, but it may vary in intensity, character, and location. usually it appears 812 h after hd, but it may also appear during the course of it. the most common symptom is the initiation of the right lower quadrant pain that progresses to peritoneal signs and guarding. just like in our case, the pain was localized in the right abdomen. since the pattern of intestinal involvement in nomi is predominantly right, the cecum and the right colon are most commonly affected. in the absence of pain, unexplained abdominal distention and gastrointestinal bleeding may be the earliest signs of ischemia and impending intestinal infarction. fever, ileus, and diarrhea are common, but nonspecific manifestations ; however, this triple association along with leukocytosis strongly suggests intestinal ischemia. diffuse or localized abdominal tenderness, rebound and rigidity are ominous signs and usually herald transmural bowel infarction and peritonitis. although studies have described a high incidence of abdominal guarding upon presentation, mild abdominal signs do not rule out this diagnosis. nonsurgical abdomen when faced with a hypotensive hd patient with severe abdominal pain, especially in the right iliac fossa, should alert the nephrologist to the very real possibility of nomi. the nephrologist should keep in mind not to dialyze their patients too much ; they could induce dehydration and accurately estimating their lean body weight. in our case, we estimated the lean body weight only by the clinical observation of the blood pressure and cerebrovascular disease symptoms ; the finding of v. portae thrombosis [which might be of the same ethiology (dehydration) ]. therefore, it is very important to assess the proper lean body weight in hd patients with several high risk factors of dehydration such as low heart output and malnutrition. with some help of available techniques like vena cava inferior diameter or bioimpedance analysis, which of course are not 100% reliable, the more accurate assessment of the lean body weight should be performed in predisposed patients. plain abdominal x - rays are useful in excluding other causes of abdominal pain, such as perforated viscus or bowel obstruction. a normal plain film in a patient with pain out of proportion to physical findings is suggestive of early acute mesenteric ischemia and should prompt the consideration of diagnostic cta and doppler echography. in conclusion, despite its rarity, nomi should always be suspected in the differential diagnosis of abdominal pain in hd patients. the diagnosis of nomi should be strongly considered in every patient who has abdominal pain and risk factors associated with the development of dehydration, proper dry weight assessment and ultrafiltration prescription in vulnerable populations are 2 keys to avoid and relive the occurrence of nomi. chen nan and the other authors, we declare that no financial or other conflict of interest exists in relation to the content of the article. | nonocclusive mesenteric ischemia (nomi) is a rare disorder. failure of an early diagnosis may cause progressive intestinal ischemia, leading to abdominal pain, sepsis, and death. patients with end - stage renal disease are among the highest risk populations for developing this lethal complication. the key to a correct diagnosis at an early stage is a high index of suspicion in predisposed patients. in our case, we present a 62-year - old female undergoing maintenance hemodialysis for 8 years ; she complained of abdominal pain after hemodialysis in the last 3 months ; nomi was suspected after a ct angiography. she partially recovered after multiple clinical interventions such as decreased ultrafiltration, an increased dose of low molecular - weight heparin and the use of vasoactive drugs. in conclusion, nomi can be reversible if it is diagnosed as early as possible and after the necessary diagnostic measurements are initiated. |
the dnd39 cell line, a human, ebv burkitt lymphoma cell line (10) was cultured in rpmi 1640 medium (gibco brl, gaithersburg, md) supplemented with 2 mm glutamine and 10% fbs (hyclone, logan, utah). the dnd39 cells (2 10 cells/ ml) were cultured for 15 min with and without 4 nm scd154 (cd8cd154 ; reference 11). il-4treated cells received 2 ng / ml huil-4 (peprotech, rocky hill, nj) 10 min before addition of scd154. for treatment with anti - human igm (sigma chemical co., st. louis, mo), 1 10 cells were incubated with 10 g/ ml anti - igm for 24 h, followed by scd154 for 15 min. after stimulation, the cells were lysed in 1% digitonin, 50 mm hepes, 150 mm nacl, ph 7.4, with protease inhibitors at 2 10 cells/ ml. cleared lysate was immunoprecipitated for 2 h at 4c with 10 g / ml anti - hcd40 monoclonal antibody, either be-1 (ancell, minneapolis, mn) or s2c6 (gift of s. paulie, stockholm university, sweden) and protein g sepharose (sigma). precipitated proteins were separated by sds - page, transferred to nitrocellulose, and coprecipitated traf molecules detected with polyclonal rabbit anti human traf2 (c20) (santa cruz biotechnologies, santa cruz, ca) or anti human traf3 (n) produced against a peptide corresponding to residues 932 of the human traf3 sequence. rabbit ig horseradish peroxidase (bio - rad, hercules, ca) and detected with supersignal substrate (pierce corp., cd40-cleared lysates were treated with 20 g / ml glutathione - s - transferase (gst)cd40cyt and glutathione agarose for 2 h at 4c and traf2 and three were detected as described above. total traf2 and traf3 immunoprecipitations were performed on lysates from untreated and scd154-treated dnd39 cells using anti - human traf2 antibodies produced against a peptide corresponding to residues 249266 of the human traf2 sequence or the anti - traf3 antibodies described above. following 24-h stimulation, dnd39 cells were incubated for 20 min at 4c with either a control mouse igg1biotin or mouse anti human cd95biotin (10 g / ml ; pharmingen, san diego, ca). after washes in pbs with fcs, antibody binding was detected with streptavidin pe (2 g / ml ; southern biotechnology associates, birmingham, al). residual dead cells and cell aggregates were excluded from analysis by low angle and orthogonal light scatter. autoradiographs of the western blots from the anti - igm experiments were scanned using ofoto 2.0. the dnd39 cell line, a human, ebv burkitt lymphoma cell line (10) was cultured in rpmi 1640 medium (gibco brl, gaithersburg, md) supplemented with 2 mm glutamine and 10% fbs (hyclone, logan, utah). the dnd39 cells (2 10 cells/ ml) were cultured for 15 min with and without 4 nm scd154 (cd8cd154 ; reference 11). il-4treated cells received 2 ng / ml huil-4 (peprotech, rocky hill, nj) 10 min before addition of scd154. for treatment with anti - human igm (sigma chemical co., st. louis, mo), 1 10 cells were incubated with 10 g/ ml anti - igm for 24 h, followed by scd154 for 15 min. after stimulation, the cells were lysed in 1% digitonin, 50 mm hepes, 150 mm nacl, ph 7.4, with protease inhibitors at 2 10 cells/ ml. cleared lysate was immunoprecipitated for 2 h at 4c with 10 g / ml anti - hcd40 monoclonal antibody, either be-1 (ancell, minneapolis, mn) or s2c6 (gift of s. paulie, stockholm university, sweden) and protein g sepharose (sigma). precipitated proteins were separated by sds - page, transferred to nitrocellulose, and coprecipitated traf molecules detected with polyclonal rabbit anti human traf2 (c20) (santa cruz biotechnologies, santa cruz, ca) or anti human traf3 (n) produced against a peptide corresponding to residues 932 of the human traf3 sequence. rabbit ig horseradish peroxidase (bio - rad, hercules, ca) and detected with supersignal substrate (pierce corp. cd40-cleared lysates were treated with 20 g / ml glutathione - s - transferase (gst)cd40cyt and glutathione agarose for 2 h at 4c and traf2 and three were detected as described above. total traf2 and traf3 immunoprecipitations were performed on lysates from untreated and scd154-treated dnd39 cells using anti - human traf2 antibodies produced against a peptide corresponding to residues 249266 of the human traf2 sequence or the anti - traf3 antibodies described above. following 24-h stimulation, dnd39 cells were incubated for 20 min at 4c with either a control mouse igg1biotin or mouse anti human cd95biotin (10 g / ml ; pharmingen, san diego, ca). after washes in pbs with fcs, antibody binding was detected with streptavidin pe (2 g / ml ; southern biotechnology associates, birmingham, al). residual dead cells and cell aggregates were excluded from analysis by low angle and orthogonal light scatter. autoradiographs of the western blots from the anti - igm experiments were scanned using ofoto 2.0. dnd39 is a cd40-responsive, human burkitt b cell lymphoma that has been shown to increase sterile transcripts from the ige promoter (10) and be rescued from growth inhibition by cross - linking of cd40 (12). within 15 min of addition of a soluble, multimeric form of cd154 (scd154) both traf2 and traf3 could be coimmunoprecipitated with cd40. immunoprecipitation of cd40 from nonactivated dnd39s did not reveal constitutively associated traf2 or traf3 (fig. 1). association of trafs was maximal at a 4 nm concentration of ligand and found to peak after 15 min of ligand addition (data not shown). the association of the traf molecules with cd40 was mirrored by a decrease in the cytosolic pool of traf2 and traf3, which could be precipitated with a fusion protein consisting of gst and the cd40 cytoplasmic domain (gst cd40cyt ; reference 6) (see fig. however, the reduction in the cytosolic traf2 and traf3 could only be partially accounted for by recruitment of these molecules to the receptor complex. when total cellular traf2 or traf3 was immunoprecipitated with anti - traf2 or traf3 antibodies, a reduction in traf content was observed following engagement of cd40 (see fig. in addition to the recruitment of traf2 and traf3 to cd40, a significant amount of the cellular traf2 and traf3 is lost from the detergent - soluble fraction. whether this loss is due to movement of the traf molecules to another subcellular location or to degradation of the trafs is currently being studied. the biological response of b cells to cd40 signaling can be enhanced or inhibited by the engagement of other receptors on b cells. for example, il-4 and cd40 engagement synergize to induce b cell growth and immunoglobulin isotype switching (1315). in dnd39 cells, cross - linking of cd40 along with il-4 can synergistically upregulate the synthesis of the germline epsilon transcripts (10) and the expression of fas (see fig. studies were performed to determine whether at least some of the agonistic effects of il-4 on cd40 signaling could be due to changes in the protein components of the cd40 receptor complex. as shown in fig. 2 a, a 10-min pretreatment of dnd39 cells with il-4 increased the amount of traf2 recruited to the cd40 complex in response to scd154. the amount of traf3 recruited to cd40 in response to scd154 was unchanged by the inclusion of il-4 (fig. 2 c, engagement of cd40 induced upregulation of fas, which was enhanced by the coadministration of il-4. cells cultured in il-4 alone expressed low levels of fas. thus, short - term pretreatment of the cells with il-4 selectively increased the association of traf2 with the cd40 receptor complex and increased fas expression. cross - linking of the b cell receptor ig complex in b cells has been shown to exert both agonistic (16, 17) and antagonistic (18) effects on cd40 signals. the latter study showed that the cross - linking of membrane immunoglobulin (mig) on human germinal center (gc) b cells prevented the cd40-induced upregulation of fas. similarly, culture of dnd39 with anti- inhibited the upregulation of fas induced by scd154 (fig. 3 e). to evaluate whether cross - linking of migm altered the assembly of the cd40 receptor complex, scd154-induced traf association was investigated. as shown in fig. 3, the association of traf2 with cd40 was strongly downregulated in cells that were precultured with anti-. in contrast, there was much less effect on the levels of scd154-induced traf3 recruited to the cd40 complex in anti-treated b cells. the mean of three experiments found that the level of traf2 recruited to the receptor was reduced by 52%, whereas the level of traf3 recruitment was only reduced by 19%. anti- treatment also significantly reduced the amount of traf2 that could bind to the gst the most likely explanation is that the total traf2 protein expression was downregulated in response to anti- treatment (data not shown). measurement of the total traf2 and traf3 levels in the cells found that anti- treatment reduced traf2 levels by 58%, whereas traf3 levels were reduced by 26% (fig. 3 d). as was observed with il-4, anti- altered the assembled receptor complex and also altered the biological response to cd40 signaling. 3 e) found that anti- treatment reduced fas upregulation by approximately three- to four - fold. facs analysis of the level of cell surface cd40 revealed no difference between untreated and anti-treated cells (data not shown). the data presented in this study suggest that (a) the binding of cd154 is necessary and sufficient for the recruitment of both traf2 and traf3 to the cd40 receptor complex in human b cells ; (b) a majority of the traf2 and traf3 molecules are depleted from the cytoplasmic pool upon ligand binding, some of which is recruited to the receptor with the remainder lost to either the detergent insoluble fraction or degraded ; (c) il-4, a cytokine that can enhance biological signals by cd40, selectively increased the amount of traf2 recruited to the ligand - induced complex ; and (d) signals from the mig complex exerted a selective effect on reducing the amount of traf2 versus traf3 that can be recruited to the cd40 complex upon ligand binding. the molecular basis for why traf2 and traf3 are recruited to the receptor complex after cd154 binding is unknown. goeddel and coworkers have recently shown that the binding of tnf- to tnf - r1 induced the recruitment of traf2 to the receptor complex (19). molecular modeling studies based on similarities to tnf- and tnf-, have suggested that cd154 forms trimers and these trimers bind to three cd40 molecules (20, 21). it is also evident from functional studies with recombinant cd154 that membrane bound or multimerized cd154 possesses much better biological activity than monomeric cd154 (22). finally, the fact that the gst cd40cyt protein binds traf molecules also suggests that a high density matrix of the cd40 cytoplasmic domain may mimic an aggregated receptor and create sites for high affinity traf binding. thus, taken together, it may be proposed that aggregation of tnf - r family members is a critical event in traf recruitment. at the present time, the mechanisms responsible for the the rapid and extensive reduction of traf2 and traf3 after cd40 engagement are unknown. it is possible that upon receptor engagement the traf molecules are rapidly ubiquitinated and degraded, in a fashion similar to i-b (23). alternatively, the cd40 signal may result in movement of the trafs to a subcellular location that is not captured after detergent solubilization. the fact that the majority of the traf2 and traf3 was lost from the cell after addition of ligand has implications for signaling via the other members of the tnf - r family, which also bind traf2 (i.e., tnf - r2, lt-r, and cd30) or traf3 (cd30 and lt-r). one might anticipate that within an individual cell, the engagement of one tnf - r family member might cause elimination of the majority of the available traf molecules, leading to the desensitization of signalling through other receptor family members. the ligand - induced assembly of the cd40traf2 traf3 receptor complex in resting b cells may be triggered by the release of traf2 and traf3 complexes that are retained in the cytosol through interactions with the recently identified tank / i - traf (9, 24). by analogy to studies with tnf - r2 (24), it may be that upon stimulation with cd154, cd40 oligomerizes and creates a higher affinity binding site for the traf molecules than found on tank / i - traf. accumulating evidence suggests traf2, perhaps through nf-b activation, plays a dominant role in the early responses of resting b cells to cd40 signaling. early events in murine b cells are likely to be mediated by traf2, because b cells from traf3 knockout mice responded as wild - type b cells for the upregulation of such activation antigens as cd23 and b7 - 1 as well as proliferation, yet were deficient in ig isotype switching (25). correspondingly, the dnd39 cells lost their capacity to upregulate fas when the cytosolic pool of traf2 was diminished. this loss in the ability to upregulate fas may be due to the decreased amount of available traf2, but more importantly, the altered ratio of traf2/traf3. similar imbalances in traf2/traf3 were observed in hek 293 cells, where overexpression of traf3, relative to traf2, blocked the nf-b activation via cd40 (7). therefore, signals that alter the abundance of traf molecules or the ratio of traf molecules may qualitatively change the biological signals through cd40. as stimulated b cells differentiate to gc b cells, memory b cells, and plasma cells, the function of cd40 changes. in immature b cells, cd40 engagement rescues from apoptosis (26, 27), in mature b cells it induces proliferation and differentiation (2), in gc b cells it induces fas expression (18, 28, 29), and in some lymphomas it induces apoptosis (30, 31). the fact that biological mediators such as il-4 and anti- treatment can both modify the recruitment of traf2 to the receptor complex and alter the biological readout suggests that the traf composition of the cd40 receptor may contribute to the molecular basis for the rewiring. currently, we are attempting to establish a causal relationship between the traf composition of the cd40 receptor complex and the functional signals delivered by cd40 engagement. (a) dnd39 cells (2 10 cells / lane) were either left unstimulated (lanes 1, 2, 5, and 7), or stimulated with scd154 (4 nm) (lanes 3, 4, 6, and 8) for 15 min before lysis and immunoprecipitation with either irrelevant mouse igg1 (lanes 1, 3) and or with anti - human cd40 mouse igg1 monoclonal be-1 (2, 4) or s2c6 (lanes 5, 6, and 7, 8), respectively. the immunoprecipitated samples were immunoblotted for traf2 (arrowhead) (lanes 16) or for traf3 (indicated by asterisk) (lanes 7, 8). dnd39 cells (2 10 cells / lane) were incubated in media or with 10 g / ml goat anti human igm for 24 h and both groups were either left unstimulated (minus) or stimulated with scd154 (4 nm) (plus) for 15 min. lysates were immunoprecipitated for cd40 and immunoblotted for traf2 (a) or traf3 (b). the lysates used for the anti - cd40 precipitations described in a and b were further precipitated with gst 5 10 cells / lane were loaded for the traf2 blot, while the traf3 blot received 2 10 cell equivalents per lane. (e) fluorescence - activated cell sorting analysis of dnd39 cells after treatment with anti - igm and scd154. dnd39 cells were incubated for 24 h with media (minus), 10 g / ml anti - igm, scd154, or both (as indicated). fas expression was detected with anti - cd95 monoclonal antibody (open profile) or a control mouse igg1 monoclonal (closed profile). the mean fluorescent intensity of the cells is indicated in the upper righthand corner. engagement of cd40 results in the loss of immunoprecipitable traf2 and traf3 from dnd39 cells. dnd39 cells (2 10 cells / ml) were left untreated (minus) or treated with 4 nm scd154 (plus) for 15 min. after treatment, lysates were immunoprecipitated with either anti - traf2 or anti - traf3 antibodies. pretreatment with il-4 increases traf2, but not traf3, recruited to cd40 and increases cell surface fas expression. dnd39 cells (2 10 cells / lane) were either left untreated or pretreated for 10 min with human (h)il-4 (2 ng / ml) (genzyme, cambridge, ma) ; and both groups were either left unstimulated (minus) or stimulated with scd154 (4 nm) (plus) for 15 min. lysates were immunoprecipitated for cd40 and immunoblotted for traf2 (a) or traf3 (b). (c) fluorescence - activated cell sorting analysis of dnd39 cells after treatment with hil-4 and scd154. dnd39 cells were incubated for 24 h with media (minus), 2 ng / ml hil-4, scd154, or both (as indicated). fas expression was detected with anti - cd95 monoclonal antibody (open profile) or a control mouse igg1 monoclonal (closed profile). the mean fluorescent intensity of the cells is indicated in the upper righthand corner. | cd40 is a member of the tumor necrosis factor (tnf) receptor superfamily. studies with human b cells show that the binding of cd154 (gp39, cd40l) to cd40 recruits tnf receptor associated factor 2 (traf2) and traf3 to the receptor complex, induces the downregulation of the nonreceptor - associated trafs in the cell and induces an increased expression of fas on the cell surface. combined signaling through the interluekin 4 receptor and cd40 induces an increased expression of fas with a commensurate increase in the level of traf2, but not traf3, that is recruited to the receptor complex. in contrast, engagement of the membrane immunoglobulin and cd40 limits fas upregulation and reduces the recruitment of traf2, relative to traf3, to the cd40 receptor complex. these studies show that the traf composition of the cd40 receptor complex can be altered by signals that influence b cell differentiation. |
the organization for economic co - operation and development reported that countries spend on average 2 % of their gross domestic product (gdp) and 10 % of their social expenditures on sa and disability benefits (oecd 2011). when off work due to sickness, the probability of resuming work decreases with increasing sa duration (labriola 2008 ; lund. eventually, long - term sa leads to disability pension which excludes workers from the workplace and marginalizes them from the labor market. therefore, it is important to identify high - risk workers before they report sick, so that they can be invited for interventions aimed at preventing sa (taimela. 2008a ; kant. 2008). recently, two prognostic models for identifying workers at risk of high sa were developed in a sample of dutch hospital workers (roelen. the prognostic model predicting high sa days (i.e., 30 cumulated days during 1-year follow - up) showed fair performance in hospital workers, but poor performance at external validation. the prognostic model predicting high sa episodes (i.e., 3 episodes during 1-year follow - up) showed good performance in the development setting and maintained fair performance at external validation. it was concluded that more predictors of sa are needed to improve the sa prognostic models, particularly the model predicting high sa days. fatigue is a common symptom of ill - health, ranking third in prevalence after back pain and muscular aches in working populations (parent - thirion. (2005) reported that fatigue was the most prevalent indicator of morbidity in the swedish workforce. several studies have already shown that fatigue is associated with future sa (janssen. however, we need more research to investigate whether or not fatigue should be added as predictor to the sa prognostic models. traditionally, the added value of a new predictor to existing prognostic models is investigated by changes in the area under the receiver operating characteristic curve or c - statistic (steyerberg. however, only very strong predictors can increase the performance of well - predicting prognostic models (pepe. the net reclassification index (nri) has been introduced as novel measure to assess the added value of predictor variables (pencina. subjects who develop the outcome are correctly reclassified when they move up into a higher risk category, and subjects who do not develop the outcome are correctly reclassified when they move down into a lower risk category. a disadvantage is that the nri heavily depends on the thresholds of risk stratifications (sundstrm. (2011) defined an nri without using risk categories, but this category - free nri variant has been criticized for its high rates of false - positive conclusions (pepe. is an alternative category - free measure to quantify risk discrimination improvement (pencina. 2008 ; steyerberg. empirical evaluations of the literature showed that reclassification methods and measures are often applied inappropriately, for example, to assess the performance of new prognostic models that differ from the previously established models (tzoulaki. in addition, the reclassification measures nri and idi are frequently misinterpreted (kerr. the objective of the present study was to introduce risk reclassification and related nri and idi measures in an occupational health context by investigating the added value of fatigue to the existing sa prognostic models. reclassification analysis can be a key method for guiding decisions in occupational health care, because it presents the distribution of risks in the population and classifies subjects into relevant risk categories. to illustrate risk reclassification, we used the health check data from a previously described prospective cohort study of 1,137 office workers (roelen. the medical ethics committee of the university medical center groningen granted ethical clearance for the study. good = 3, fair = 2, and poor = 1 (ware. self - rated health (srh) is widely used in health research and has been associated with various morbidity and mortality measures (halford. 2012). the health check questionnaire measured fatigue with the checklist individual strength (cis) consisting of 20 statements (cronbach s = 0.92) on the severity of fatigue and its functional impact. the statements were scored on a seven - point scale ranging from 1 fully agree to 7 fully disagree amounting to a sum score ranging between 20 and 140, with higher scores reflecting higher levels of fatigue. the cis was chosen because it has been validated for measuring fatigue in working populations (beurskens. previous research has shown that the cis has high internal consistency and good content validity for measuring fatigue (beurskens. convergent validity was satisfactory as reflected in correlations between the cis and the fatigue assessment scale (pearson s correlation coefficient r = 0.90 ; michielsen. 2002), fatigue scale (r = 0.87 ; chalder. 1993), and maslach burnout inventory (r = 0.71 ; maslach and jackson 1986). age at baseline and sa in the 2 years prior to baseline were retrieved from the ohs register. sa was defined as temporary paid leave from work due to any (i.e., work - related and non - work - related) injury or illness and was recorded in the ohs register from the first sa day until return to work. the calendar days between the first and last sa day were counted as sa days, regardless of whether these were work days. sa days and episodes in the 2 years prior to baseline were accumulated for the predictor variables prior sa days and prior sa episodes, respectively (roelen. 2013a, b). in agreement with dutch sa insurance policies, sa episodes with less than 28 days worked between them were regarded as one episode. sa days and episodes in 2007 were retrieved from the ohs register. in previous sa prognostic studies, high sa days was defined as 30 cumulated (i.e., not necessarily consecutive) sa days and high sa episodes as 3 sa episodes during 1-year follow - up (roelen. 2013a, b, 2014a). we adopted the same definitions for high sa days and episodes to ensure that the prognostic models in the present study did not differ from the established sa prognostic models. descriptive statistics and logistic regression analysis were done with ibm spss statistics for windows, version 20.0 (ibm corp. reclassification analyses were performed in r (project for statistical computing) using the regression modeling strategies (rms) package (harrell 2013) for calculating nri and the predictabel package (kundu. reclassification after adding fatigue was presented in reclassification tables (cook 2008 ; janes. it is recommended to distinguish between subjects with and without events in reclassification analysis (pencina. therefore, we summarized the reclassification of workers with high sa in the nri for events (nrie) and reclassification of workers without high sa in the nri for nonevents (nrine). p(down|event) representing the net proportion of subjects with events assigned to a higher risk category. nrine = p (down|nonevent) p (up|nonevent) representing the net proportion of subjects without events assigned to a lower risk category. the nri varies between 100 and 100 % ; positive values reflect improved classification, and negative values worsened classification. risk reclassification analysis requires calibrated models (pepe and janes 2011 ; leening. calibration of the sa prognostic models with and without fatigue was addressed with the hosmer lemeshow (h l) goodness - of - fit test ; adequate calibration was concluded for h l p 0.05 (steyerberg. 2010). after investigating the calibration of the sa prognostic models, we considered the models ability to stratify the population into risk categories. the risk categories should be clinically relevant in the sense that changing categories implies that subjects receive different treatments or interventions. as far as we know, relevant risk categories or risk thresholds have not yet been defined in sa research. therefore, we chose two data - driven risk thresholds (10 and 20 % risk of high sa) based on previously reported risk distributions (roelen. in addition, we calculated the idi to evaluate the improvement of the models ability to discriminate between high - risk and low - risk subjects without using categories. the idi reflects the change in discrimination slope (i.e., difference between the mean estimated risk for cases and non - cases) of the model with the new predictor compared to the model with only the established predictors. idi (range 100 to 100 %) represents overall risk discrimination improvement, but its magnitude is hard to interpret. good = 3, fair = 2, and poor = 1 (ware. 2002). self - rated health (srh) is widely used in health research and has been associated with various morbidity and mortality measures (halford. 2012). the health check questionnaire measured fatigue with the checklist individual strength (cis) consisting of 20 statements (cronbach s = 0.92) on the severity of fatigue and its functional impact. the statements were scored on a seven - point scale ranging from 1 fully agree to 7 fully disagree amounting to a sum score ranging between 20 and 140, with higher scores reflecting higher levels of fatigue. the cis was chosen because it has been validated for measuring fatigue in working populations (beurskens. previous research has shown that the cis has high internal consistency and good content validity for measuring fatigue (beurskens. convergent validity was satisfactory as reflected in correlations between the cis and the fatigue assessment scale (pearson s correlation coefficient r = 0.90 ; michielsen. 2002), fatigue scale (r = 0.87 ; chalder. 1993), and maslach burnout inventory (r = 0.71 ; maslach and jackson 1986). age at baseline and sa in the 2 years prior to baseline were retrieved from the ohs register. sa was defined as temporary paid leave from work due to any (i.e., work - related and non - work - related) injury or illness and was recorded in the ohs register from the first sa day until return to work. the calendar days between the first and last sa day were counted as sa days, regardless of whether these were work days. sa days and episodes in the 2 years prior to baseline were accumulated for the predictor variables prior sa days and prior sa episodes, respectively (roelen. 2013a, b). in agreement with dutch sa insurance policies, sa episodes with less than 28 days worked between them were regarded as one episode. sa days and episodes in 2007 were retrieved from the ohs register. in previous sa prognostic studies, high sa days was defined as 30 cumulated (i.e., not necessarily consecutive) sa days and high sa episodes as 3 sa episodes during 1-year follow - up (roelen. 2013a, b, 2014a). we adopted the same definitions for high sa days and episodes to ensure that the prognostic models in the present study did not differ from the established sa prognostic models. descriptive statistics and logistic regression analysis were done with ibm spss statistics for windows, version 20.0 (ibm corp. reclassification analyses were performed in r (project for statistical computing) using the regression modeling strategies (rms) package (harrell 2013) for calculating nri and the predictabel package (kundu. reclassification after adding fatigue was presented in reclassification tables (cook 2008 ; janes. it is recommended to distinguish between subjects with and without events in reclassification analysis (pencina. therefore, we summarized the reclassification of workers with high sa in the nri for events (nrie) and reclassification of workers without high sa in the nri for nonevents (nrine). p(down|event) representing the net proportion of subjects with events assigned to a higher risk category. nrine = p (down|nonevent) p (up|nonevent) representing the net proportion of subjects without events assigned to a lower risk category. the nri varies between 100 and 100 % ; positive values reflect improved classification, and negative values worsened classification. risk reclassification analysis requires calibrated models (pepe and janes 2011 ; leening. calibration of the sa prognostic models with and without fatigue was addressed with the hosmer lemeshow (h l) goodness - of - fit test ; adequate calibration was concluded for h l p 0.05 (steyerberg. 2010). after investigating the calibration of the sa prognostic models, we considered the models ability to stratify the population into risk categories. the risk categories should be clinically relevant in the sense that changing categories implies that subjects receive different treatments or interventions. as far as we know, relevant risk categories or risk thresholds have not yet been defined in sa research. therefore, we chose two data - driven risk thresholds (10 and 20 % risk of high sa) based on previously reported risk distributions (roelen. in addition, we calculated the idi to evaluate the improvement of the models ability to discriminate between high - risk and low - risk subjects without using categories. the idi reflects the change in discrimination slope (i.e., difference between the mean estimated risk for cases and non - cases) of the model with the new predictor compared to the model with only the established predictors. idi (range 100 to 100 %) represents overall risk discrimination improvement, but its magnitude is hard to interpret. a total of 633 (56 %) office workers participated in the health checks. non - participant analysis showed that participants were older (mean age = 44.5, standard deviation [sd ] = 9.3 years) than non - participants (39.0, sd = 9.4 years ; t test p 606010prior sickness absence episodes 011820 113022 211520 37413 46411 > 47813fatigue (range 2140)51.221.0 sd standard deviation study population characteristics (n = 579) sd standard deviation fifty - nine (10 %) office workers had high sa days during 1-year follow - up. prior sa days, srh and fatigue were significantly associated with high sa days, while age was not (table 2). calibration was adequate for the model without fatigue (h l = 13.8, df = 8 ; p = 0.09) and the model with fatigue (h l = 4.7, df = 8 ; p = 0.79). l model chi - square indicated that the risks predicted by the prognostic model with fatigue were more in agreement with the observed frequencies of high sa days.table 2prospective associations with sickness absence (sa) days and episodespredictorhigh (30) sa dayshigh (3) sa episodesor95 % cior95 % ciage0.99 0.741.32 p = 0.920.92 0.701.21 p = 0.56prior sa1.02 1.001.08 p = 0.021.601.411.82 p 10 % events20 % > 20 % 10 % 21720 % 570>10 % 427>20 % 11nrie (95 % ci)5.09 % (5.93 to 16.10 %) nrie (95 % ci)1.69 % (5.02 to 1.63 %) nonevents10 % > 10 % nonevents20 % > 20 % 10 % 3184920 % 5017>10 % 24129>20 % 111nrine (95 % ci)4.81 % (8.03 to 1.59 %) nrine (95 % ci)1.15 % (2.22 to 0.09 %) nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval reclassification table for sickness absence (sa) days nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval sixty - five (11 %) workers had high sa episodes at follow - up. prior sa episodes, srh and fatigue were significantly associated with high sa episodes, whereas age was not (table 2). the prognostic models with fatigue (h l = 3.0, df = 8 ; p = 0.94) and without fatigue (h l = 2.1, df = 8 ; p = 0.98) were both well calibrated. at a risk threshold of 10 %, seven workers (1 %) were reclassified when fatigue was added to the model. none of the workers with high sa episodes was reclassified (table 4). consequently, nrie was not available. of workers without high sa episodes, five were correctly reclassified as low risk and two were incorrectly reclassified as high risk ; nrine was 0.58 % and non - significant (p = 0.26). at a more specific 20 % risk threshold, four workers were reclassified after adding fatigue, although all incorrectly moved up to high risk. nrine was 0.78 % and marginally significant (p = 0.05). idi = 0.11 % (95 % ci 0.18 to 0.41 %) indicated that fatigue did not significantly (p = 0.45) improve risk discrimination.table 4reclassification table for sickness absence (sa) episodesrisk without fatiguerisk with fatiguerisk without fatiguerisk with fatigueevents10 % > 10 % events20 % > 20 % 10 % 16020 % 330>10 % 049>20 % 032nrie (95 % ci)n.a.nrie (95 % ci)n.a.nonevents10 % > 10 % nonevents20 % > 20 % 10 % 355220 % 4624>10 % 5152>20 % 048nrine (95 % ci)0.58 % (0.43 to 1.59 %) nrine (95 % ci)0.78 % (1.54 to 0.00 %) nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval, n.a. not available reclassification table for sickness absence (sa) episodes nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval, n.a fifty - nine (10 %) office workers had high sa days during 1-year follow - up. prior sa days, srh and fatigue were significantly associated with high sa days, while age was not (table 2). calibration was adequate for the model without fatigue (h l = 13.8, df = 8 ; p = 0.09) and the model with fatigue (h l = 4.7, df = 8 ; p = 0.79). l model chi - square indicated that the risks predicted by the prognostic model with fatigue were more in agreement with the observed frequencies of high sa days.table 2prospective associations with sickness absence (sa) days and episodespredictorhigh (30) sa dayshigh (3) sa episodesor95 % cior95 % ciage0.99 0.741.32 p = 0.920.92 0.701.21 p = 0.56prior sa1.02 1.001.08 p = 0.021.601.411.82 p 10 % events20 % > 20 % 10 % 21720 % 570>10 % 427>20 % 11nrie (95 % ci)5.09 % (5.93 to 16.10 %) nrie (95 % ci)1.69 % (5.02 to 1.63 %) nonevents10 % > 10 % nonevents20 % > 20 % 10 % 3184920 % 5017>10 % 24129>20 % 111nrine (95 % ci)4.81 % (8.03 to 1.59 %) nrine (95 % ci)1.15 % (2.22 to 0.09 %) nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval reclassification table for sickness absence (sa) days nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval sixty - five (11 %) workers had high sa episodes at follow - up. prior sa episodes, srh and fatigue were significantly associated with high sa episodes, whereas age was not (table 2). the prognostic models with fatigue (h l = 3.0, df = 8 ; p = 0.94) and without fatigue (h l = 2.1, df = 8 ; p = 0.98) were both well calibrated. at a risk threshold of 10 %, seven workers (1 %) were reclassified when fatigue was added to the model. none of the workers with high sa episodes was reclassified (table 4).. of workers without high sa episodes, five were correctly reclassified as low risk and two were incorrectly reclassified as high risk ; nrine was 0.58 % and non - significant (p = 0.26). at a more specific 20 % risk threshold, four workers were reclassified after adding fatigue, although all incorrectly moved up to high risk. nrine was 0.78 % and marginally significant (p = 0.05). idi = 0.11 % (95 % ci 0.18 to 0.41 %) indicated that fatigue did not significantly (p = 0.45) improve risk discrimination.table 4reclassification table for sickness absence (sa) episodesrisk without fatiguerisk with fatiguerisk without fatiguerisk with fatigueevents10 % > 10 % events20 % > 20 % 10 % 16020 % 330>10 % 049>20 % 032nrie (95 % ci)n.a.nrie (95 % ci)n.a.nonevents10 % > 10 % nonevents20 % > 20 % 10 % 355220 % 4624>10 % 5152>20 % 048nrine (95 % ci)0.58 % (0.43 to 1.59 %) nrine (95 % ci)0.78 % (1.54 to 0.00 %) nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval, n.a. not available reclassification table for sickness absence (sa) episodes nrie net reclassification index for events, nrine net reclassification index for nonevents, ci confidence interval, n.a. not available fatigue is a core symptom of many medical conditions and an important indicator of morbidity in working populations. the present study confirmed that fatigue was prospectively associated with high sickness absence (sa) days and episodes during 1-year follow - up. however, reclassification analysis showed that fatigue did not improve risk predictions for office workers with high sa and worsened risk predictions for office workers without high sa. although reclassification analysis has become very popular, the nri is often misinterpreted as percentage of the population reclassified (kerr. 2014 ; leening. in addition, the nri equally values the consequences of false - negative and false - positive misclassifications. these problems were overcome in the current study by presenting nri for events (nrie) and nonevents (nrine). another problem is that data - driven risk thresholds may spuriously inflate the nri (sundstrm. 2011 ; hilden and gerds 2014). as there are no clinically relevant risk thresholds for sa, we dealt with this problem by analyzing reclassification at different (10 % and 20 %) risk thresholds. for the sa days model, nrie was not significant, whereas nrine was significant. for the sa episodes model, however, the fact that nrine was negative indicated worsened rather than improved risk classification of office workers without high sa. workers without high sa days incorrectly moved up from the low - risk category to the high - risk category when fatigue was added as predictor variable. high false - positive rates can be problematic when resources are limited or when the burden and costs of interventions are high. furthermore, taimela. (2008b) reported that preventive consultations cost - effectively reduced sa only in high - risk workers and not in workers with a moderate or low sa risk. hence, using fatigue as predictor not only increases unnecessary utilization of preventive interventions, but may also reduce cost - effectiveness. nowadays, there are many fatigue instruments because fatigue is recognized as a major symptom of clinical conditions. all instruments are self - report measures, and answers on self - report measures are driven by the respondent s interpretation as well as factors such as personal dispositions, mood, expectations, and previous experiences. furthermore, an instrument developed to measure fatigue in one patient group may not apply to other groups when fatigue experiences depend on the clinical condition. the cis was previously shown to have good psychometric properties for measuring fatigue in working populations (beurskens. however, associations between fatigue and high sa days or episodes may differ when fatigue is measured with other instruments. before drawing definite conclusions of the added value of fatigue to sa predictions, we need more studies investigating fatigue with different instruments or even a combination of instruments, because it is doubtful whether one instrument can capture fatigue, given the wide range of mechanisms underlying fatigue and the differing manifestations of fatigue (dittner. 2004). the study population was limited to 1,137 office workers employed in one company, which is an advantage because it excludes sa variability due to differences in work conditions, work environment, and organizational policies and practices (virtanen. the sa percentage (3.6 %) was slightly lower than in the dutch workforce (4.2 %) in 2007, whereas the mean sa frequency in 2007 was 1.1 episodes in both the study population and the dutch workforce (statistics netherlands 2014). however, this does not implicate that the results can be generalized to other working populations. another limitation of the study is that 56 % of the workers participated in the health checks. (2003) reported a total cis score of 53.4 in a heterogeneous sample (n = 7,495) of non - sicklisted workers participating in the dutch maastricht cohort study. the mean cis score in the present study was 51.2 reflecting lower levels of fatigue (one sample t test p = 0.02). 1999) may have weakened associations between fatigue and high sa, consequently reducing the added value of fatigue to sa predictions. the study population was limited to 1,137 office workers employed in one company, which is an advantage because it excludes sa variability due to differences in work conditions, work environment, and organizational policies and practices (virtanen. the sa percentage (3.6 %) was slightly lower than in the dutch workforce (4.2 %) in 2007, whereas the mean sa frequency in 2007 was 1.1 episodes in both the study population and the dutch workforce (statistics netherlands 2014). however, this does not implicate that the results can be generalized to other working populations. another limitation of the study is that 56 % of the workers participated in the health checks. (2003) reported a total cis score of 53.4 in a heterogeneous sample (n = 7,495) of non - sicklisted workers participating in the dutch maastricht cohort study. the mean cis score in the present study was 51.2 reflecting lower levels of fatigue (one sample t test p = 0.02). such a healthy volunteer effect (etter and perneger 1997 ; froom. 1999) may have weakened associations between fatigue and high sa, consequently reducing the added value of fatigue to sa predictions. in the present study, fatigue increased false - positive rates which may reduce the cost - effectiveness of interventions aimed at preventing sa. the findings illustrate that we have to carefully consider the added value of potential predictors rather than strive for the most comprehensive prognostic models, even when we want to predict a complex multifactorial outcome such as sa. when applied and interpreted appropriately, risk reclassification can be used to gauge the added value of new predictors to established prognostic models. | backgroundprognostic models including age, self - rated health and prior sickness absence (sa) have been found to predict high (30) sa days and high (3) sa episodes during 1-year follow - up. more predictors of high sa are needed to improve these sa prognostic models. the purpose of this study was to investigate fatigue as new predictor in sa prognostic models by using risk reclassification methods and measures.methodsthis was a prospective cohort study with 1-year follow - up of 1,137 office workers. fatigue was measured at baseline with the 20-item checklist individual strength and added to the existing sa prognostic models. sa days and episodes during 1-year follow - up were retrieved from an occupational health service register. the added value of fatigue was investigated with net reclassification index (nri) and integrated discrimination improvement (idi) measures.resultsin total, 579 (51 %) office workers had complete data for analysis. fatigue was prospectively associated with both high sa days and episodes. the nri revealed that adding fatigue to the sa days model correctly reclassified workers with high sa days, but incorrectly reclassified workers without high sa days. the idi indicated no improvement in risk discrimination by the sa days model. both nri and idi showed that the prognostic model predicting high sa episodes did not improve when fatigue was added as predictor variable.conclusionin the present study, fatigue increased false - positive rates which may reduce the cost - effectiveness of interventions for preventing sa. |
hemoptysis for one year developed in a 58-year - old thai woman with medical history of thickening of the skin, face, neck, and both upper extremities with flexion deformity of both hands (figure 1), cool - exposure - cyanotic skin changes and difficulty in the mouth opening for 10 years presented to the 10 zonal tuberculosis and chest disease center, chiang mai, thailand in 2009. ten years previous, she was performed the chest radiograph, high - resolution computed tomography (hrct) of the chest, three consecutive sputum acid - fast bacilli (afb) examinations, and bronchoscopic examinations which revealed reticular and small cystic infiltration with fibrotic change and some ground glass infiltration at the both lower lobes, more at the basal lungs and periphery of the upper lobes (figure 2). tubular bronchiectasis was seen at bilaterally perihilar regions while small cystic bronchiectasis was shown at the both lower lobes (figure 2) without evidence of tuberculosis (tb) or other mycobacterium species from sputum and bronchoscopic examinations. she has received a diagnosis of systemic sclerosis (ssc) with lung involvement without evidence of family history of ssc and has received prednisolone and plaquenil. five - years follow - up of the chest radiograph and the hrct of the chest still revealed reticulocystic lesions indicated bronchiectasis and bronchiolectasis, honeycombing, subpleural bands and septal thickening at the both lower lobes with new patchy - cystic lesion at the right midlung field, new small fibronodular infiltration at periphery of the posterior aspect of the both upper lobes and lower lobes, and new minimal right apical pleural thickening without pleural effusion while the mediastinum was within normal limits (figure 3). five years previous she was also performed the echocardiography due to dysnea on supine position for four years and revealed moderate mitral valve regurgitation with progression to severe form 1 year later without pleural effusion and pulmonary arterial hypertension (pah). two years previous she developed sclerodactyly of both hands with severe anemia. increased dosage of ferrous sulphate had been prescribed for 2 years. there was mildly thickening of the skin of the face, neck, and extremities without dysnea. figure 1showing the thickening of the skin of both upper extremities with sclerodactyly of both hands (a, b). showing the thickening of the skin of both upper extremities with sclerodactyly of both hands (a, b). figure 2posterior - anterior chest radiograph (a) and high - resolution computed tomography of the chest (b) at ten years previous showing reticular and small cystic infiltration with fibrotic change and some ground glass infiltration in the both lower lobes. posterior - anterior chest radiograph (a) and high - resolution computed tomography of the chest (b) at ten years previous showing reticular and small cystic infiltration with fibrotic change and some ground glass infiltration in the both lower lobes. figure 3posterior - anterior chest radiograph (a) and high - resolution computed tomography of the chest (b) at five years previous still showing brochiectasis and bronchiolectasis, honeycombing, subpleural bands and septal thickening in the both lower lobes. posterior - anterior chest radiograph (a) and high - resolution computed tomography of the chest (b) at five years previous still showing brochiectasis and bronchiolectasis, honeycombing, subpleural bands and septal thickening in the both lower lobes. on the first day of the patient 's presentation, we hypothesized that chronic receiving of prednisolone can allow development of pulmonary tb with presenting hemoptysis due to drug - induced immunosuppression. thus, the three consecutive sputum examinations for the afb were performed including sputum cultures for mycobacterium tuberculosis and other mycobacterium species, which revealed negative results. a chest radiograph showed a huge thin - wall cavity with 8 cm in diameter in the right lower lobe, bilaterally diffuse fibrotic infiltration, bilateral pleural effusion, and bilateral basal pleural thickening (figure 4). figure 4posterior - anterior chest radiograph on the first day of the patient 's presentation at our center still showing bronchiectasis, honeycombing in the both lower lobes and bilaterally pleural effusion (a, b) with a new huge - thin - wall cavity in the right lower lobe (a, c), which spontaneously resolved 2 months later (c). posterior - anterior chest radiograph on the first day of the patient 's presentation at our center still showing bronchiectasis, honeycombing in the both lower lobes and bilaterally pleural effusion (a, b) with a new huge - thin - wall cavity in the right lower lobe (a, c), which spontaneously resolved 2 months later (c). ssc is systemic and complex collagen vascular disease of unknown etiology, associated with excessive tissue fibrosis of the skin and various internal organs and small - vessel vasculopathy. numerous known agents induce ssc - like pulmonary disease ; for examples, benzene, toluene, trichloroethylene, bleomycin, pentazocine, trytophan, and d - penicillamine including silica and rapeseed oil denatured with aniline. the patient 's one major criterion of thickening of both hands and two minor criteria of sclerodactyly of both hands and bilaterally basilar idiopathic pulmonary fibrosis (ipf) made the diagnosis of ssc. she has had a history of raynaud 's phenomenon which is a common clinical manifestation (91%) and more than 10 years of ipf which we hypothesized the early clinical sign which was found between 52%70%. hemoptysis found in this patient without evidence of pah, tb and d - penicillamine and other known - induced agents exposure is a rare complication which may complicate bronchial telangiectasia or carcinoma. wangkaew s.. reported their study among thai ssc patients with 59.1% (39 of 275 patients) of pah and 92.3% (36 of 275 patients) of dyspnea on exertion while panicheewa s.. reported of 43.3% with pulmonary involvement among thai ssc patients. only 26.5% (22 of 83 thai ssc patients) were diagnosed pah by echocardiography. a study reported in 2004 of only one case of complicated pulmonary tb among 11 patients with ssc - associated interstitial lung disease treated with azathioprine. serum concentrations of insulin - like growth factor (igf)-1 and igf binding protein, interleukin-15 and chest ultrasonography can early and simply predict the development of pulmonary telangiectasia and ipf, respectively which were not early done in this case. fortunately, only 0.2% of cases with pulmonary hemorrhage or hemoptysis or both are registered as a leading cause of death. honeycombing of the lungs on the last chest hrct indicated more advanced disease and serum anti - topoisomerase autoantibody measurement could strongly predict the patient 's 10-year previous ipf before progression to this pathological lung appearance. on the chest radiograph of the first attendance at this center, it demonstrated a huge thin - wall cavity at the right lower lobe with acute pneumonitis at the right midlung field and bilaterally pleural effusion which could be ssc - associated - infective brochiectasis and this lung cavity spontaneously resolved 2 months later excepted the bilaterally pleural effusion (figure 4). this lower lobe huge - solitary cavity may be complication of the ssc - associated - cystic bronchiectasis seen on the patient 's 10-year previous chest radiograph and hrct of the chest and it can cause hemoptysis which disappeared at the same time of this lung cavity resolution. the patient 's 10-year and 5-year previous chest radiographs and hrcts of the chest showed usual patterns of the disease with previously normal bronchoalveolar lavage examinations and only bilaterally minimalpleural effusion on the last chest radiograph indicated not necessary to perform lung biopsy. on the last attendance the patient revealed very dramatic clinical responses excepted the difficulty in open her mouth, thickening of the skin, and the raynaud 's phenomenon. this case does not need invasive investigations for diagnosis. our case highlights a huge lower - lobe - thin - wall cavity in ssc patient, which has been reported as ssc - associated non - tuberculous mycobacterial pulmonary infections in the medical literature in thailand. this case demonstrates the importance of the chest radiographic follow - up of the ssc - associated - lung cavity with hemoptysis instead of performing the lung biopsy or investigations for non - tuberculous mycobacterial infections. | systemic sclerosis or scleroderma is associated with distal vasculitis, raynaud 's phenomenon, and inflammation of internal organs and the skin. we present on a 58-year - old thai woman with systemic sclerosis who came to the 10th zonal tuberculosis and chest disease center, chiang mai, thailand in 2009 and presented with hemoptysis and a solitary huge - lung cavity as the predominant clinical manifestations which spontaneously resoluted 2 months later. this case demonstrates a solitary huge - lung cavity with hemoptysis and looked like from non - tuberculous mycobacterial infections or malignancy with spontaneous resolution of hemoptysis and the lung cavity, which does not need invasive investigations. |
the dorsomedial hypothalamus (dmh) has been considered an orexigenic nucleus, since its lesion reduces food intake and body weight and induces resistance against diet - induced obesity,. the dmh expresses feeding regulatory neuropeptides including neuropeptide y (npy), cocaine- and amphetamine - regulated transcript (cart), and prolactin - releasing peptide (prrp). it also expresses various receptors, including leptin receptor, melanocortin 3/4 receptors (mc3/4),, y1 receptor, y5 receptor, and cck receptor,. region specific knock down and overexpression studies demonstrated that npy neurons in dmh, which are gabaergic and leptin insensitive,, play a role to promote food intake in rats,,, being consistent with the dmh - lesion studies. however, it was reported that the level of npy expression is very low in mice fed with normal chow, questioning its physiological role, while it is increased in diet - induced obesity. hence, the principal orexigenic neuron in dmh under physiological conditions remains to be identified. it was reported that the mice deficient in leptin receptor specifically in gabaergic neurons develop greater increases in food intake and body weight compared to the mice deficient in leptin receptor specifically in agouti - related protein (agrp), proopiomelanocortin (pomc) or steroidogenic factor 1 (sf1) neurons. these results suggested that gabaergic neurons including those in dmh could be a principal orexigenic neuron targeted by leptin. in the present study, the role of gabaergic neurons in dmh in feeding regulation was analyzed using optogenetic and electrophysiological techniques. we found that dmh gabaergic neurons are hyperpolarized by leptin and depolarized by lowering glucose, and that their optogenetic activation elicits inhibitory synaptic transmission to the paraventricular nucleus of hypothalamus (pvn) where anorexigenic neurons are localized, and promotes food intake. chrfr - c167a, one of bistable variants of chimeric channelrhodopsins, was fused with venus and cloned into aav2-gad1 promoter - wpre - bgh - polya vector. the aav2 virus coded chrfr - c167a - venus was generated using gd1001-rv (genedetect.com ltd. male c57black6/j mice aged 8 weeks were maintained in a 12/12 h light / dark cycle. the aav2-gad1-chrfr - c167a virus (50 nl / injection site) was injected stereotaxically to dmh at 1.4 mm caudal to the bregma in the midline, 0.2 mm lateral and 5.4 mm below the surface of the skull, under anesthesia with tribromoethanol (200 mg / kg). the optical fiber with 250 or 500 m diameter was stereotaxically placed above dmh (at 1.4 mm caudal to the bregma in the midline, 0.5 mm lateral and 4.8 mm below the surface of the skull) or pvn (at 0.6 mm caudal to the bregma in the midline, 0.25 mm lateral and 4.4 mm below the surface of the skull). mice were allowed to recover from the operation for 2 weeks. on the day of experiments, the food was returned to cages at 19:30, and food intake at 0.5, 1, 2, 3, 6 h were measured. exposure to blue laser (473 nm) followed by yellow (589 nm) laser (lucir, tsukuba, japan) was performed via optical fibers with 10 ms pulses, 50 hz for 2 s, repeated every 5 s to the dmh or 3 s yellow pulse following 2 s blue pulse repeated every 10 s to the pvn for 3 h from 19:30 to 22:30. at the end of the experiments, the mice were perfused with 4% paraformaldehyde (pfa) in 0.1 m pb and the coronal sections of the hypothalamus were cut, to histologically verify the position of the virus infection and optical fiber. the animal experiments for this study were carried out in a humane manner after receiving approval from the institutional animal experiment committee of jichi medical university, and in accordance with the institutional regulation for animal experiments and fundamental guideline for proper conduct of animal experiment and related activities in academic research institutions under the jurisdiction of the ministry of education, culture, sports and technology. the brains were rapidly removed from c57bl/6j male mice infected aav2-gad1-chrfr - c167a to dmh under anesthesia with tribromoethanol (200 mg / kg). the isolated brains were placed in ice - cold, carboxygenated (95% o2 and 5% co2) high mannitol solution containing (in mm) 229 mannitol, 3 kcl, 6 mgcl2, 0.5 cacl2, 1 nah2po4, 26 nahco3, and 10 glucose at ph 7.4 with 0.5 m tetrodotoxin (osmolarity ; 300305 mosm). a block of tissue containing the hypothalamus was isolated and coronal slices (300 m) were cut on a vibratome. following recovery for 12 h, slices were moved to a recording chamber mounted on bx51wi upright microscope (olympus) equipped with video - enhanced infrared - differential interference contrast (dic) and fluorescence. slices were perfused with a continuous flow of carboxygenated acsf containing (in mm) 127 nacl, 2.5 kcl, 2 mgcl2, 2 cacl2, 1.23 nah2po4, 26 nahco3, and 2.510 glucose at ph 7.4. briefly, pipettes were used with 39 m resistance after being filled with pipette solution. pipettes were made of borosilicate glass (narishige) using a pp-83 vertical puller (narishige) or a sutter micropipette puller (p-1000). the pipettes with 39 m resistance after being filled with pipette solution were used. the composition of the pipette solution for current clamp recording was (in mm) : 135 k - gluconate (for current clamp recording) or kcl (for ipsc recording), mgcl2 2, hepes 10, egta 1.1, mg - atp 2.5, na2-gtp 0.3, and na2-phosphocreatine 10 at ph 7.3 with koh (osmolarity ; 290295 mosm). axopatch 200b amplifier and clampex 10 software (axon instruments) were used for data acquisition. access resistance was continuously monitored during the experiments. only those cells in which access resistance was stable (changes 30%) the data was analyzed by clamp fit 10 (axon instruments) software and graphpad prism6 software. if a change of membrane potential was at least twice the standard deviation of membrane potential for 2 min before addition of agents, it was considered the response. irradiation was carried out using power leds (each from lumileds, san jose, ca) emitting either blue light (peak, 460490 nm, lxhl - nb98) or yellow light (peak, 587597 nm, lxhl - nl98) controlled by a regulator (sla-1000 - 2, mightex, toronto, canada). if the cumulative distribution of ipsc amplitude for 20 s after light exposure was significantly larger than that before light exposure by kolomogrv - semirnov test, it was considered the induction of light - evoked ipscs. two - way anova followed by sidak multiple range tests was used for food intake experiments and one - way anova followed by dunnet multiple range tests for membrane potential experiments. chrfr - c167a, one of bistable variants of chimeric channelrhodopsins, was fused with venus and cloned into aav2-gad1 promoter - wpre - bgh - polya vector. the aav2 virus coded chrfr - c167a - venus was generated using gd1001-rv (genedetect.com ltd. male c57black6/j mice aged 8 weeks were maintained in a 12/12 h light / dark cycle. the aav2-gad1-chrfr - c167a virus (50 nl / injection site) was injected stereotaxically to dmh at 1.4 mm caudal to the bregma in the midline, 0.2 mm lateral and 5.4 mm below the surface of the skull, under anesthesia with tribromoethanol (200 mg / kg). the optical fiber with 250 or 500 m diameter was stereotaxically placed above dmh (at 1.4 mm caudal to the bregma in the midline, 0.5 mm lateral and 4.8 mm below the surface of the skull) or pvn (at 0.6 mm caudal to the bregma in the midline, 0.25 mm lateral and 4.4 mm below the surface of the skull). mice were allowed to recover from the operation for 2 weeks. on the day of experiments, the food was returned to cages at 19:30, and food intake at 0.5, 1, 2, 3, 6 h were measured. exposure to blue laser (473 nm) followed by yellow (589 nm) laser (lucir, tsukuba, japan) was performed via optical fibers with 10 ms pulses, 50 hz for 2 s, repeated every 5 s to the dmh or 3 s yellow pulse following 2 s blue pulse repeated every 10 s to the pvn for 3 h from 19:30 to 22:30. at the end of the experiments, the mice were perfused with 4% paraformaldehyde (pfa) in 0.1 m pb and the coronal sections of the hypothalamus were cut, to histologically verify the position of the virus infection and optical fiber. the animal experiments for this study were carried out in a humane manner after receiving approval from the institutional animal experiment committee of jichi medical university, and in accordance with the institutional regulation for animal experiments and fundamental guideline for proper conduct of animal experiment and related activities in academic research institutions under the jurisdiction of the ministry of education, culture, sports and technology. the brains were rapidly removed from c57bl/6j male mice infected aav2-gad1-chrfr - c167a to dmh under anesthesia with tribromoethanol (200 mg / kg). the isolated brains were placed in ice - cold, carboxygenated (95% o2 and 5% co2) high mannitol solution containing (in mm) 229 mannitol, 3 kcl, 6 mgcl2, 0.5 cacl2, 1 nah2po4, 26 nahco3, and 10 glucose at ph 7.4 with 0.5 m tetrodotoxin (osmolarity ; 300305 mosm). a block of tissue containing the hypothalamus was isolated and coronal slices (300 m) were cut on a vibratome. following recovery for 12 h, slices were moved to a recording chamber mounted on bx51wi upright microscope (olympus) equipped with video - enhanced infrared - differential interference contrast (dic) and fluorescence. slices were perfused with a continuous flow of carboxygenated acsf containing (in mm) 127 nacl, 2.5 kcl, 2 mgcl2, 2 cacl2, 1.23 nah2po4, 26 nahco3, and 2.510 glucose at ph 7.4. briefly, pipettes were used with 39 m resistance after being filled with pipette solution. pipettes were made of borosilicate glass (narishige) using a pp-83 vertical puller (narishige) or a sutter micropipette puller (p-1000). the pipettes with 39 m resistance after being filled with pipette solution were used. the composition of the pipette solution for current clamp recording was (in mm) : 135 k - gluconate (for current clamp recording) or kcl (for ipsc recording), mgcl2 2, hepes 10, egta 1.1, mg - atp 2.5, na2-gtp 0.3, and na2-phosphocreatine 10 at ph 7.3 with koh (osmolarity ; 290295 mosm). axopatch 200b amplifier and clampex 10 software (axon instruments) were used for data acquisition. access resistance was continuously monitored during the experiments. only those cells in which access resistance was stable (changes 30%) the data was analyzed by clamp fit 10 (axon instruments) software and graphpad prism6 software. if a change of membrane potential was at least twice the standard deviation of membrane potential for 2 min before addition of agents, it was considered the response. irradiation was carried out using power leds (each from lumileds, san jose, ca) emitting either blue light (peak, 460490 nm, lxhl - nb98) or yellow light (peak, 587597 nm, lxhl - nl98) controlled by a regulator (sla-1000 - 2, mightex, toronto, canada). if the cumulative distribution of ipsc amplitude for 20 s after light exposure was significantly larger than that before light exposure by kolomogrv - semirnov test, it was considered the induction of light - evoked ipscs. two - way anova followed by sidak multiple range tests was used for food intake experiments and one - way anova followed by dunnet multiple range tests for membrane potential experiments. to selectively activate gabaergic neurons in dmh, aav2 coded chrfr - c167a - venus under gad1 promoter was infected to dmh. chrfr - c167a, a bistable variant of chimeric channelrhodopsin, provides bimodal regulation : exposure to blue light (470 nm) induces long lasting opening, which is subsequently terminated by exposure to yellow light (592 nm). the mice expressing chrfr - c167a - venus in dmh gabaergic neurons were studied. venus fluorescence was observed in dmh at 2 weeks after virus infection (figure 1a). in acute slices including dmh under current clamp mode, the chrfr - c167a - venus expressing neurons were long lastingly depolarized by blue led light exposure and repolarized by yellow led light (figure 1b). in these mice, food intake was measured with or without blue (473 nm) and yellow (589 nm) laser light exposure for 3 h via optical fiber inserted above dmh. cumulative food intake at 2 and 3 h of light exposure was significantly greater than the corresponding values in mice without light exposure (figure 1c). these data indicated that activation of dmh gabaergic neurons promoted food intake. to further assess the feeding - related property of dmh gabaergic neurons, their responsiveness to systemic metabolic factors, anorexigenic leptin and orexigenic low glucose was examined. neural activity of chrfr - c167a expressing neurons in dmh against leptin and lowering glucose was measured in patch clamp experiments under current clamp mode. in 10 recordings from 4 mice, leptin hyperpolarized approximately 40% of chrfr - c167a expressing neurons from 47.1 1.8 mv to 49.9 1.6 mv (figure 2a, b). lowering glucose from 2.5 to 0.5 mm depolarized approximately 60% of chrfr - c167a expressing neurons from 46.93 1.9 mv to 42.31 1.6 mv (figure 2a, b), and hyperpolarized 30% of them from 51.5 2.2 mv to 55.1 2.4 mv (data not shown). all the leptin - hyperpolarized neurons were depolarized by lowering glucose (figure 2a). these data indicate that the dmh gabaergic neuron is under reciprocal regulation by leptin and lowering glucose and its activation promotes food intake. axonal fibers and terminals of dmh chrfr - c167a expressing neurons were detected by the venus fluorescence fused with chrfr - c167a in pvn (figure 3a), where anorexigenic neuropeptides, oxytocin, crh and nesfatin-1, are expressed. to examine the functional connection between dmh chrfr - c167a expressing neurons and pvn neurons, the effect of light exposure on ipsc onto pvn neurons was examined. in 15 recordings from 5 mice, blue light exposure increased amplitude of ipsc in 47% of pvn neurons (figure 3b, c). this result indicated a functional connection of dmh - chrfr - c167a expressing neurons to pvn neurons, and prompted us to examine whether this connection is linked to feeding behavior. light exposure was performed via optical fiber inserted above pvn and food intake was measured. blue (478 nm) and yellow (584 nm) laser light exposure for 3 h increased cumulative food intake for 3 h and 6 h significantly as well as a trend for increase for 0.5, 1 and 2 h (figure 3d). these data indicated the dmh gabaergic neuron 's inhibitory synaptic transmission to pvn, which promotes food intake. to selectively activate gabaergic neurons in dmh, aav2 coded chrfr - c167a - venus under gad1 promoter was infected to dmh. chrfr - c167a, a bistable variant of chimeric channelrhodopsin, provides bimodal regulation : exposure to blue light (470 nm) induces long lasting opening, which is subsequently terminated by exposure to yellow light (592 nm). the mice expressing chrfr - c167a - venus in dmh gabaergic neurons were studied. venus fluorescence was observed in dmh at 2 weeks after virus infection (figure 1a). in acute slices including dmh under current clamp mode, the chrfr - c167a - venus expressing neurons were long lastingly depolarized by blue led light exposure and repolarized by yellow led light (figure 1b). in these mice, food intake was measured with or without blue (473 nm) and yellow (589 nm) laser light exposure for 3 h via optical fiber inserted above dmh. cumulative food intake at 2 and 3 h of light exposure was significantly greater than the corresponding values in mice without light exposure (figure 1c). to further assess the feeding - related property of dmh gabaergic neurons, their responsiveness to systemic metabolic factors, anorexigenic leptin and orexigenic low glucose was examined. neural activity of chrfr - c167a expressing neurons in dmh against leptin and lowering glucose was measured in patch clamp experiments under current clamp mode. in 10 recordings from 4 mice, leptin hyperpolarized approximately 40% of chrfr - c167a expressing neurons from 47.1 1.8 mv to 49.9 1.6 mv (figure 2a, b). lowering glucose from 2.5 to 0.5 mm depolarized approximately 60% of chrfr - c167a expressing neurons from 46.93 1.9 mv to 42.31 1.6 mv (figure 2a, b), and hyperpolarized 30% of them from 51.5 2.2 mv to 55.1 2.4 mv (data not shown). all the leptin - hyperpolarized neurons were depolarized by lowering glucose (figure 2a). these data indicate that the dmh gabaergic neuron is under reciprocal regulation by leptin and lowering glucose and its activation promotes food intake. axonal fibers and terminals of dmh chrfr - c167a expressing neurons were detected by the venus fluorescence fused with chrfr - c167a in pvn (figure 3a), where anorexigenic neuropeptides, oxytocin, crh and nesfatin-1, are expressed. to examine the functional connection between dmh chrfr - c167a expressing neurons and pvn neurons, the effect of light exposure on ipsc onto pvn neurons was examined. in 15 recordings from 5 mice, blue light exposure increased amplitude of ipsc in 47% of pvn neurons (figure 3b, c). this result indicated a functional connection of dmh - chrfr - c167a expressing neurons to pvn neurons, and prompted us to examine whether this connection is linked to feeding behavior. light exposure was performed via optical fiber inserted above pvn and food intake was measured. blue (478 nm) and yellow (584 nm) laser light exposure for 3 h increased cumulative food intake for 3 h and 6 h significantly as well as a trend for increase for 0.5, 1 and 2 h (figure 3d). these data indicated the dmh gabaergic neuron 's inhibitory synaptic transmission to pvn, which promotes food intake. the present study indicates that dmh gabaergic neurons are activated by lowering glucose, a peripheral orexigenic signal, and inhibited by leptin, a peripheral anorexigenic signal, and that once activated they promote food intake via inhibitory synaptic transmission to the neurons of pvn. although orexigenic function of dmh has long been suggested, definitive role of dmh in the regulation of feeding has remained unclear. this is partly due to that the neuron subpopulation in the dmh that regulates feeding is less specified, in contrast to the arc where orexigenic npy / agrp and anorexigenic pomc / cart neurons have been well established. the present study employed the optogenetics to selectively activate dmh gabaergic neurons, and demonstrated that their activation promotes feeding behavior. furthermore, dmh gabaergic neurons substantially projected and exerted inhibitory synaptic transmission to the neurons of pvn, the integrative center of feeding. moreover, dmh gabaergic neurons were directly regulated by leptin and lowering glucose, the factors reflecting systemic energy states and implicated in physiological regulation of feeding. these results suggest that the projection of dmh gabaergic neurons to the pvn serves as a pathway to promote food intake under physiological conditions. this fits with previous report that leptin action on gabaergic neurons prevents obesity, as evidenced by the study on leptin receptor - deficient gabaergic neurons. in contrast, it was reported that leptin activates dmh neurons expressing lepr, npy, galanin or prrp, and thereby stimulates thermogenesis by brown adipose tissue,,,. thus, it is suggested that in dmh leptin inhibits gabaergic neurons to suppress energy intake and activates another subpopulations of neurons to promote energy expenditure and/or suppress energy intake, all contributing to reduction of body weight. the opposing effects of leptin on different subpopulations of neurons have been well known in arc where leptin inhibits npy / agrp neurons and activates pomc neurons. the present study showed that dmh gabaergic neurons project to pvn, being consistent with previous reports that dmh neurons, including gabaergic neurons, project to pvn,. although the target neuron in pvn remains to be identified, the neurons expressing oxytocin, crh, nesfatin-1 and/or mc3/4, potent anorectic neuropeptides and receptor, are the candidates. the dmh gabaergic projection to pvn may regulate not only feeding but also other functions, in considering diverse functions of dmh and pvn. pvn is part of a multi - synaptic pathway that is responsible for the circadian regulation of several functions including glucocorticoid and melatonin release and feeding behavior,. the dmh gabaergic projection to pvn, found in the present study, could serve as a neuro - circuit that relays dmh to pvn for circadian regulation. we found that light activation of the presynaptic terminal of dmh chrfrr - c167-expressing gabaergic neurons evoked ipsc onto pvn neurons. open and close time constants of chrfr - c167a are slower than those of channelrhodopsin2 under blue light exposure. therefore, we expected that photo - activation of chrfrr - c167 would evoke ipscs continually and hence increase both amplitude and frequency of total ipsc for a certain period, unlike channelrhodopsin2 that evokes single large ipsc immediately after photo - activation. however, our recording showed that ipsc frequency was not changed, although the cumulative distribution of ipsc amplitude was increased dmh gabaergic neurons may project to not only pvn neurons but also gabaergic interneurons around pvn or presynaptic terminals of gabaergic neurons onto pvn neurons. light - evoked gaba release from presynapses of dmh gabaergic neurons could not only directly suppress pvn neurons but also inhibit gabaergic interneurons and/or presynaptic terminals that secondarily suppress pvn neurons. the net effects of these distinct neuro - circuits could result in little change in ipsc frequency. (figure 3c), similarly to arc agrp neurons that project to 49% of pvn neurons. however, activation of dmh gabaergic neurons took more than 2 h to increase food intake, whereas activation of agrp neurons immediately increased food intake. although the mechanisms underlying the different time course of feeding behavior following dmh gabaergic and arc. agrp neuron activation remain to be elucidated, we can speculate a few explanations for the delayed effect of the dmh gabaergic neuron activation on food intake. first, agrp neurons release agrp and npy, well - established potent orexigenic neuropeptides. on the other hand, it is still unclear what neuropeptide(s) dmh gabaergic neurons can release. secondly, dmh gabaergic neurons were found to project to not only pvn but other feeding regulatory nuclei including arc, vmh, lh, and dmnv (data not shown), in consistent with previous reports,. some of these projections could inhibit orexigenic neurons and thereby cancel out the effect of the pvn neuron inhibition that increases food intake, which may take place for the initial few hours. it was also observed that the light administration on dmh and that on pvn increased food intake in slightly different time courses. this could be due to that the former activates additional subpopulations of dmh gabaergic neurons. dmh gabaergic neurons are regulated by metabolic signals leptin and glucose and, once activated, promote food intake via inhibitory synaptic transmission to pvn. | objectivethe dorsomedial hypothalamus (dmh) has been considered an orexigenic nucleus, since the dmh lesion reduced food intake and body weight and induced resistance to diet - induced obesity. the dmh expresses feeding regulatory neuropeptides and receptors including neuropeptide y (npy), cocaine- and amphetamine - regulated transcript (cart), cholecystokinin (cck), leptin receptor, and melanocortin 3/4 receptors. however, the principal neurons generating the orexigenic function in the dmh remain to be defined. this study aimed to clarify the role of the dmh gabaergic neurons in feeding regulation by using optogenetics and electrophysiological techniques.methodswe generated the mice expressing chrfr - c167a, a bistable chimeric channelrhodopsin, selectively in gabaergic neurons of dmh via locally injected adeno - associated virus 2. food intake after optogenetic activation of dmh gabaergic neurons was measured. electrophysiological properties of dmh gabaergic neurons were measured using slice patch clamp.resultsoptogenetic activation of dmh gabaergic neurons promoted food intake. leptin hyperpolarized and lowering glucose depolarized half of dmh gabaergic neurons, suggesting their orexigenic property. optical activation of axonal terminals of dmh gabaergic neurons at the paraventricular nucleus of hypothalamus (pvn), where anorexigenic neurons are localized, increased inhibitory postsynaptic currents on pvn neurons and promoted food intake.conclusiondmh gabaergic neurons are regulated by metabolic signals leptin and glucose and, once activated, promote food intake via inhibitory synaptic transmission to pvn. |
eosinophilic esophagitis (eoe), also known as allergic esophagitis and primary eosinophilic or idiopathic eosinophilic esophagitis,1 is an inflammatory disease of the esophagus that affects children and adults. the disease was first described in children in 1995.2 the increased incidence of eoe in recent years has been explained either by a real increase in its prevalence caused by the global rise in allergic diseases or by better knowledge of the disease s existence, as represented by the performance of a greater number of upper gastrointestinal endoscopies (uge) and esophageal biopsies.3 currently, there are no symptoms, changes to the objective examination, serum biomarkers, or pathognomonic endoscopic findings for this disease. thus, other causes of esophageal eosinophilia must be excluded, including gastroesophageal reflux disease (gerd), eosinophilic gastritis (eg), intestinal parasites, persistent vomiting, inflammatory bowel disease, and immune or tumor pathology. an endoscopic esophageal biopsy is essential for establishing a diagnosis.47 the lack of knowledge regarding eoe - affected children and adults has delayed diagnosis and treatment. given this context, the aim of this study was to present a series of 11 pediatric cases of eoe in northeastern brazil and clinical features that delay diagnosis and treatment. the present investigation was an observational and descriptive study of 11 pediatric patients who were diagnosed with eoe and treated at a teaching hospital in fortaleza in northeastern brazil. the patients were selected from a group of 100 children who underwent an endoscopy to investigate symptoms related to the upper digestive tract. biopsies of the esophagus, antrum, and duodenum were obtained by routine pediatric endoscopy procedures. a diagnosis of eoe was obtained through the histological study of biopsies of the distal esophagus, which were stained with hematoxylin and eosin and reviewed by a single pathologist. the biopsies were considered to be diagnostic when exhibiting more than 15 eosinophils per high power field in the area of greater concentration without concomitant eosinophilic infiltration in the antrum and/or duodenum.47 variables examined included gender, age at diagnosis of eoe, age at the onset of symptoms, clinical complaints, initial clinical diagnoses, tests performed, treatments prior to the histopathological diagnosis of eoe, endoscopic diagnoses, histopathological diagnoses, treatment after histopathological diagnosis, and treatment outcome. the patients caregivers were informed about the purpose of the research and consented to their children s participation in the study. the study was approved by the research ethics committee of the faculdade christus and was registered under the number 116.351. eleven patients were included in the study (table 1) ; eight were male. the mean age of the children was 7.8 3.8 years and at the onset of symptoms was 4.3 2.9 years. the average duration between the onset of symptoms and diagnosis was 3.5 3.8 years. the most common symptoms were abdominal pain in nine (82%) patients, regurgitation 2 per day for more than three weeks in five (45%) patients, difficulty in gaining weight in five (45%) patients, vomiting in five (45%) patients, dysphagia in four (36%) patients, and coughing in three (27%) patients. the patients of pre - school age at the onset of symptoms experienced the following main clinical manifestations : abdominal pain in five (45%) patients, regurgitation 2 per day for more than three weeks in four (36%) patients, and vomiting in three (27%) patients. specific ige concentration for foods was assessed in five (45%) patients and was positive for -lactalbumin and -lactalbumin (class i) in four (36%) patients. the main clinical diagnoses before the diagnosis of eoe were gastroesophageal reflux disease in nine (82%) patients, food allergy in eight (73%) patients, and gastritis in six (55%) patients. endoscopic findings included normal mucosae in five (45%) patients, signs of mucosal thickening with longitudinal shearing in three (27%) patients (fig. 1), erosive esophagitis in two (18%) patients, and a white patchy exudate in one (9%) patient (table 2). histopathological examination revealed that all patients in this series presented more than 30 (ie, ranging from 30 to 80) eosinophils per field (fig. 3), which was higher than the diagnostic criterion of > 15 eosinophils / high - power field. the treatment after the histopathological diagnosis of eoe included the use of a topical corticosteroid in ten (91%) patients and dietary restrictions in eight (73%) patients. eight (73%) patients presented effective responses to treatment, which was characterized by the resolution of symptoms. one patient (9%) reported persistent abdominal pain and dysphagia (table 2). although ten patients received topical corticosteroids for eight weeks, none reported complications such as bleeding or candidiasis. ten patients underwent endoscopic and histological reassessment two months after beginning treatment, which revealed a reduction in the number of eosinophils to 15 eosinophils per field and endoscopic resolution of the initial lesion. we examined the late diagnosis of eosinophilic esophagitis in 11 pediatric patients, taken from a larger group of 100, whose symptoms had been attributed to other diseases, such as food allergies, gastroesophageal reflux disease, and gastritis. these incorrect diagnoses had resulted in the adoption of inappropriate treatments and the persistence of symptoms, affecting the patients quality of life. previous epidemiological studies of eoe and this case series show that pediatric cases are susceptible to non - timely diagnosis. an incidence of 1/10,000 has been reported,7 and it is estimated that 6.8% of patients with esophagitis have eoe.4 the sample analyzed was in accordance with the literature, which describes males as the most affected group at a ratio of 3:1 to 4:1 ; additionally, no association exists between eoe and racial or ethnic background. 8 there is evidence that eoe occurs in families and that most patients have a personal and/or family history of other allergic manifestations (eg, respiratory, cutaneous, and/or food allergies).9 in the patients studied, the onset of symptoms occurred, on average, at the age of four years, with the diagnostic peak at age seven. this differs from ages of diagnoses in previous studies, which describe eoe as affecting more children of school age, frequently between 5 and 10 years, although there are case reports involving younger children.10,11 in this group of patients, symptoms were frequently considered typical of gastroesophageal dysfunction (ie, abdominal pain, regurgitation, difficulty gaining weight, dysphagia, and vomiting), which most likely caused clinical suspicion and an initial diagnosis of diseases such as food allergies, gastroesophageal reflux disease, and gastritis. the patients underwent empirical treatment based on the clinical diagnoses (prior to the uge with biopsy) using medications such as h2 antihistamine, proton pump inhibitors, and gastric motility stimulators, but without a satisfactory outcome. increased serum total ige and skin patch and positive rast can be found in 40%73% of patients,12,13 which is similar to the results observed in this study (45%). peripheral eosinophilia and total ige levels are informative parameters.8 on average, patients were referred to undergo the first uge with biopsy only three years after the onset of their symptoms and treatment attempts without satisfactory clinical responses (table 2).14,15 in most publications, the time interval measured between the onset of symptoms and diagnosis was reportedly an average of 4.3 years, ranging between one and 13 years.16 although the elapsed time for diagnosis was on average lower than that described in literature, it is important to note that the disease was present in patients for 3 or 4 years before being diagnosed. uge is the only accurate diagnostic method for eoe. despite descriptions of the specific aspects of endoscopy, greater than 34% of children with eoe although various manifestations have been reported for endoscopic study, the most characteristic manifestation is corrugated esophagus or concentric rings of mucosa, as well as longitudinal stenosis of the internal diameter. white patchy exudates with the loss of the normal vascular patterns of the esophagus may indicate areas of eosinophilic infiltration. vertical lines in the esophagus and friable mucosa, called crepe paper mucosa, are also suggestive of eoe.12 typically, the esophageal mucosa contains no eosinophils ; therefore, the presence of more than 15 eosinophils per high - power field, which was observed in this sample, is considered a marker of eoe. in reflux esophagitis, the usual number of eosinophils is approximately one (or, at most, ten eosinophils) per high - power field.18,19 cases with scores between 10 and 15 are often considered a questionable diagnosis.18 there is still no consensus on the ideal treatment for patients with eoe. success has been reported in treating allergic eoe with oral fluticasone propionate administered by metered - dose inhalers.20 oral viscous budesonide has also been shown to be effective ; however, esophageal candidiasis has been described in approximately 15% of these patients.20,21 there are no objective criteria for assessing treatment response ; subjective clinical monitoring and/or endoscopy combined with histology have been used for this assessment.12 the clinical symptoms and eosinophil counts after treatment are considered to be markers of improvement. patients in our sample received topical corticosteroids for a short period of two months after the diagnosis of eoe. however, most of the subjects exhibited a favorable clinical response after starting the recommended treatment with swallowed inhaled steroids used either alone or in association with the exclusion of the responsible allergen (if detected). despite the debate regarding whether to treat histologically confirmed eoe in the absence of symptoms, treatment is recommended given the known long - term risks of remodeling, fibrosis, potential esophageal strictures, and lymphoproliferative diseases.20 it has been suggested the use of an algorithm for investigation of pediatric patients with esophageal symptoms in order to provide pediatricians with the information required for clinical suspicion and treatment (fig. the late diagnosis of eosinophilic esophagitis in 11 pediatric patients whose symptoms had been attributed to other diseases, such as food allergies, gastroesophageal reflux disease, and gastritis, resulted in the adoption of inappropriate treatments and the persistence of symptoms that affected the patients quality of life. | we examined 11 pediatric patients with eosinophilic esophagitis with a tardy diagnosis. the symptoms were initially thought to be related to other diseases, leading to the use of inadequate therapeutic approaches. the patients were between 3 and 17 years old (mean 7.8 3.8 years), and 8 of the patients were male. common symptoms included abdominal pain, regurgitation, difficulty in gaining weight, vomiting, dysphagia, and coughing. the mean age for the onset of symptoms was 4.3 2.9 years. endoscopic findings included normal mucosa in five (45%) patients, thickening of the mucosa with longitudinal grooves in three (27%), erosive esophagitis in two (18%), and a whitish stippling in one (9%) patient. treatment included the use of a topical corticosteroid for 10 patients. in eight (73%) cases, the treatment made the symptoms disappear. ten patients underwent histopathological management after treatment, with a decrease in the number of eosinophils. |
free vascularized fibular bone grafts (fvfbgs) can be an important tool for spine surgeons to treat difficult conditions. fvfbg was introduced by huntington in 1905 for partial tibial reconstruction19) and is now used for reconstruction of segmental bone defects throughout the body. its use has recently extended to spine surgery, such as multi - level corpectomies, failed arthrodesis, and poor bone quality due to radiation exposure or infection which inherently has a higher degree for complications1921). a vascular graft transfers living bone and thus retains cellular viability, leading to less bony remodeling and better maintenance of its structural integrity19). compared to avascular bone grafts, vascular grafts in the spine provide stronger, stiffer constructs with higher fusion rates and better functional outcomes71618). failed arthrodeses and posttraumatic deformity have responded to free fibular grafts with reliable rates of union and curvature correction46101214). this technique has also allowed for more aggressive management of spinal neoplasms, including vertebral column resection18). we describe two complex revision cases utilizing a vascularized fibular strut autograft to the spine for failed lumbar spine arthrodeses. our first case patient underwent vascularized grafting to augment his anterior stabilization in the context of chronic l3 vertebral body osteomyelitis. the second patient had a complex history of more than ten previous arthrodesis and revision procedures for complex scoliosis secondary to marfan syndrome. the first patient was a 46-year - old male with prior myocardial infarction and hypertension who was referred to the senior author 's orthopedic spine clinic in february 2006. a motor vehicle accident in 1999 had resulted in an l3 vertebral burst fracture with lower extremity weakness. he underwent an anterior decompression and reconstruction of the l3 vertebral body with fibular strut allograft. he recovered all lower extremity motor function post - operatively, but in 2002, he was involved in a second motor vehicle accident and developed osteomyelitis of the l3 body shortly thereafter. in 2003, he underwent a removal of hardware and irrigation and debridement followed by repeat debridements in 2004 and late 2005. just two weeks prior to referral to the senior author 's clinic, the patient noted a one - centimeter (cm) region of dehiscence with serosanguinous exudate at his previously healed left lateral abdominal incision. computed tomography (ct) imaging demonstrated bridging bone from l2 to l4 with a 2.0 by 1.5 cm subcutaneous fluid collection and a deep abscess anterior to the left psoas muscle measuring 1.3 by 0.8cm(fig the patient was recalcitrant to nonoperative management with iv antibiotic use ; thus, he was scheduled for surgical intervention. in may 2006, the patient underwent the first of a two - stage intervention with decompression of the anterior l3 abscess and posterior spinal fusion with bilateral pedicle screw instrumentation from l2 to l4 and iliac crest autograft. cultures from the l3 vertebral body returned no growth, but the bone pathology showed chronic osteomyelitis. postoperatively he received iv ertapenem until the second stage operation in august 2006, where the patient underwent the second stage anterior fusion with vascularized free fibula grafting. the patient was placed in the left lateral decubitus position and a flank incision was made just below the diaphragm for access to the retroperitoneal space. the l3 vertebral body was accessed at which time five ml of frank pus were expressed. the previous allograft struts were separated from the vertebral body with an osteotome and removed. this debridement left a bony defect measuring 3 cm in length and 2 cm in depth. next, the free fibula graft was harvested with the assistance of a microscopic - surgery trained surgeon. a posterolateral approach to the distal right lower extremity small muscular branches about the fibula were sacrificed when harvesting the pedicle, but the remaining posterior tibial vessels and nerve were retained. the harvested fibula was 3 cm in length, and the remaining fibular bone stock was used as autograft bone about the spine. the epigastric artery and vein attached to omentum were utilized as the recipient vessels to anastomose to the free fibular vessels. a telescoping technique was incorporated in which the fibular vessel was placed within the recipient vessel, and the anastomosis was performed under microscopic guidance with 9 - 0 nylon sutures. a nonvascularized fibular strut was inserted within the midportion of the vertebral body for structural support. the vascularized piece was then resized for a press fit at the corpectomy site and tapped into place. he was able to tolerate ambulation with an assistive device as early as postoperative day number two. he remained hemodynamically stable with good pain control, and was discharged home after 10 days in the hospital. he was fitted for a thoracolumbosacral orthosis for six weeks after surgery. over the next several months, the patient saw improvement in his lower back pain and no further drainage from his incision sites. he was weaned off of antibiotics entirely and has followed annually without complication or recurrence of his infection (fig. 3). the second patient is a 39-year - old female with marfan syndrome who underwent a vascularized fibular strut autograft in 2001. the patient had endured four posterior spinal fusions before the age of 21 in an attempt to correct her severe scoliosis. she had only mild lower back pain but significant difficulty breathing, swallowing, and ambulating. in standing with her knees locked, she had a 45-degree sagittal plane deformity in the thoracolumbosacral region, with severe thoracic lordosis as well as cervical and lumbosacral kyphosis., she had a 35-degree levoscoliosis that corrected to 15 degrees when flexing the right lower extremity. a ct scan confirmed that she had dural ectasia, a known complication of marfan syndrome. in august 1996, the patient began a series of staged osteotomies and revision fusions of her spine over the following three years to address her sagittal imbalance and radiculopathies, including the following : l3 - 5 posterior osteotomies, sacral and pelvic posterior fixation, and removal of the inferior half of her prior luque ring and harrington rod constructs ; anterior l4 corpectomy, l3 - 5 anterior spinal fusion, and harvesting of the right 8 and 9 cartilaginous ribs ; posterior revision of her instrumented fusion from t10 to s1 ; right l3 - 5 decompression of nerve roots and removal of the right l5 pedicle screw and l3 - 4 transverse connector ; revision posterior spinal fusion with removal of fractured inferior rods and iliac screw replacement. over the following year, the patient continued to have persistent lower back pain, decreased function, and worsening deformity. on examination, she had a significant loss of height, sagittal contour, and abdominal volume due to her lumbar spine kyphosis. in december 2000, she underwent yet another revision for luque rod loosening and an l4 - 5 pseudarthrosis. the construct was revised with new left s1 pedicle and iliac screws, a left isola rod, and transfixator proximally at the t12 level. however, her pain continued post - operatively and the deformity again progressed with persistence of the l4 - 5 pseudarthrosis. her continually failing posterior hardware was attributed to a defect in the l4 region anteriorly. it was determined that a vascularized fibular strut autograft would be the most appropriate option to fill this void. in may 2001, the patient underwent an anterior spinal fusion from l3 to sacrum with a vascularized fibular graft. the left common iliac vessels were mobilized in order to allow passage of the anastomosis. the right vascularized fibular graft was harvested and cut to the appropriate length. the fibular artery and vein were end - to - side anastomosed to the inferior mesenteric artery and vein. the l3 vertebral body and left sacral ala were entered and spanned using the vascularized fibular graft. the remaining autograft bone was morcelized and mixed with demineralized bone matrix and packed around the vascularized fibula and excoriated bone surfaces. she had continued back and radicular pain and weakness, treated with therapy and chronic analgesics. she spent several weeks in an inpatient pulmonology center for co - morbidities related to her marfan syndrome. a ct scan performed 1 year postoperatively found that the fibular strut and screw had maintained appropriate anterior stabilization. after two years, she had improved function and mobility but an unchanged level of pain and analgesic use. plain radiographs at that time showed no interval changes or hardware failure. at 3-years postoperative, the patient 's mobility had continued to progress but her level of pain persisted. she still had a large residual scoliosis and a significant thoracic lordosis, but radiographs demonstrated solid consolidation of the fibular strut. at her most recent 13-years postoperative the first patient was a 46-year - old male with prior myocardial infarction and hypertension who was referred to the senior author 's orthopedic spine clinic in february 2006. a motor vehicle accident in 1999 had resulted in an l3 vertebral burst fracture with lower extremity weakness. he underwent an anterior decompression and reconstruction of the l3 vertebral body with fibular strut allograft. he recovered all lower extremity motor function post - operatively, but in 2002, he was involved in a second motor vehicle accident and developed osteomyelitis of the l3 body shortly thereafter. in 2003, he underwent a removal of hardware and irrigation and debridement followed by repeat debridements in 2004 and late 2005. just two weeks prior to referral to the senior author 's clinic, the patient noted a one - centimeter (cm) region of dehiscence with serosanguinous exudate at his previously healed left lateral abdominal incision. computed tomography (ct) imaging demonstrated bridging bone from l2 to l4 with a 2.0 by 1.5 cm subcutaneous fluid collection and a deep abscess anterior to the left psoas muscle measuring 1.3 by 0.8cm(fig the patient was recalcitrant to nonoperative management with iv antibiotic use ; thus, he was scheduled for surgical intervention. in may 2006, the patient underwent the first of a two - stage intervention with decompression of the anterior l3 abscess and posterior spinal fusion with bilateral pedicle screw instrumentation from l2 to l4 and iliac crest autograft. cultures from the l3 vertebral body returned no growth, but the bone pathology showed chronic osteomyelitis. postoperatively he received iv ertapenem until the second stage operation in august 2006, where the patient underwent the second stage anterior fusion with vascularized free fibula grafting. the patient was placed in the left lateral decubitus position and a flank incision was made just below the diaphragm for access to the retroperitoneal space. the l3 vertebral body was accessed at which time five ml of frank pus were expressed. the previous allograft struts were separated from the vertebral body with an osteotome and removed. this debridement left a bony defect measuring 3 cm in length and 2 cm in depth. next, the free fibula graft was harvested with the assistance of a microscopic - surgery trained surgeon. a posterolateral approach to the distal right lower extremity small muscular branches about the fibula were sacrificed when harvesting the pedicle, but the remaining posterior tibial vessels and nerve were retained. the harvested fibula was 3 cm in length, and the remaining fibular bone stock was used as autograft bone about the spine. the epigastric artery and vein attached to omentum were utilized as the recipient vessels to anastomose to the free fibular vessels. a telescoping technique was incorporated in which the fibular vessel was placed within the recipient vessel, and the anastomosis was performed under microscopic guidance with 9 - 0 nylon sutures. a nonvascularized fibular strut was inserted within the midportion of the vertebral body for structural support. the vascularized piece was then resized for a press fit at the corpectomy site and tapped into place. he was able to tolerate ambulation with an assistive device as early as postoperative day number two. he remained hemodynamically stable with good pain control, and was discharged home after 10 days in the hospital. he was fitted for a thoracolumbosacral orthosis for six weeks after surgery. over the next several months, the patient saw improvement in his lower back pain and no further drainage from his incision sites. he was weaned off of antibiotics entirely and has followed annually without complication or recurrence of his infection (fig. the second patient is a 39-year - old female with marfan syndrome who underwent a vascularized fibular strut autograft in 2001. the patient had endured four posterior spinal fusions before the age of 21 in an attempt to correct her severe scoliosis. she had only mild lower back pain but significant difficulty breathing, swallowing, and ambulating. in standing with her knees locked, she had a 45-degree sagittal plane deformity in the thoracolumbosacral region, with severe thoracic lordosis as well as cervical and lumbosacral kyphosis., she had a 35-degree levoscoliosis that corrected to 15 degrees when flexing the right lower extremity. a ct scan confirmed that she had dural ectasia, a known complication of marfan syndrome. in august 1996, the patient began a series of staged osteotomies and revision fusions of her spine over the following three years to address her sagittal imbalance and radiculopathies, including the following : l3 - 5 posterior osteotomies, sacral and pelvic posterior fixation, and removal of the inferior half of her prior luque ring and harrington rod constructs ; anterior l4 corpectomy, l3 - 5 anterior spinal fusion, and harvesting of the right 8 and 9 cartilaginous ribs ; posterior revision of her instrumented fusion from t10 to s1 ; right l3 - 5 decompression of nerve roots and removal of the right l5 pedicle screw and l3 - 4 transverse connector ; revision posterior spinal fusion with removal of fractured inferior rods and iliac screw replacement. over the following year, the patient continued to have persistent lower back pain, decreased function, and worsening deformity. on examination, she had a significant loss of height, sagittal contour, and abdominal volume due to her lumbar spine kyphosis. in december 2000, she underwent yet another revision for luque rod loosening and an l4 - 5 pseudarthrosis. the construct was revised with new left s1 pedicle and iliac screws, a left isola rod, and transfixator proximally at the t12 level. however, her pain continued post - operatively and the deformity again progressed with persistence of the l4 - 5 pseudarthrosis. her continually failing posterior hardware was attributed to a defect in the l4 region anteriorly. it was determined that a vascularized fibular strut autograft would be the most appropriate option to fill this void. in may 2001, the patient underwent an anterior spinal fusion from l3 to sacrum with a vascularized fibular graft. the left common iliac vessels were mobilized in order to allow passage of the anastomosis. the right vascularized fibular graft was harvested and cut to the appropriate length. the fibular artery and vein were end - to - side anastomosed to the inferior mesenteric artery and vein. the l3 vertebral body and left sacral ala were entered and spanned using the vascularized fibular graft. the remaining autograft bone was morcelized and mixed with demineralized bone matrix and packed around the vascularized fibula and excoriated bone surfaces. she had continued back and radicular pain and weakness, treated with therapy and chronic analgesics. she spent several weeks in an inpatient pulmonology center for co - morbidities related to her marfan syndrome. a ct scan performed 1 year postoperatively found that the fibular strut and screw had maintained appropriate anterior stabilization. after two years, she had improved function and mobility but an unchanged level of pain and analgesic use. plain radiographs at that time showed no interval changes or hardware failure. at 3-years postoperative, the patient 's mobility had continued to progress but her level of pain persisted. she still had a large residual scoliosis and a significant thoracic lordosis, but radiographs demonstrated solid consolidation of the fibular strut. at her most recent 13-years postoperative visit, her hardware has remained intact without any signs of failure (fig. when a decision is made to utilize graft material intraoperatively, there are several types of graft substrates available for use. from a basic overview, this includes various formations of cancellous and cortical allografts and autografts. not uncommonly, strut grafts have been used in spinal disease or deformity to span a potential distance and provide structural support to a construct as the fusion process is evolving. nonvascularized grafts, including iliac crest or rib for example, are mechanically weak in the initial remodeling phase because of increased porosity of the bone, and can fatigue fracture in this time period at rates of up to 20%20). these nonvascular graft options have inferior compressive and torsional strengths when compared with vascularized autogenous grafts (such as the fibula) which demonstrate accelerated rates of incorporation related due to its early biomechanical stability24). since these vascularized grafts heal similar to fracture healing in native bone, fusion likely proceeds faster than in their nonvascular counterparts and can potentially respond to external stresses similar to normal bone with reactive hypertrophy. in comparison to vascularized grafts from other anatomic locations such as the rib or iliac crest, the fibula has a particularly reliable vascular pedicle and nutrient artery in addition to a straight tubular shape to facilitate its use in the spine22). fvfbgs have been reported for a variety of spinal conditions including osteomyelitis, neoplasms, neurofibromatosis, and arnold - chiari malformations235615). winters.23) reported a case series of 30 spine patients with fvfbgs. while the authors did not present formal outcomes data, they described various techniques and an assortment of anastomosing vessels that can be used throughout the cervical, thoracic, lumbar, and sacral spine. they highlighted that complex spine cases make patients more susceptible to hypothermia, poor peripheral circulation, and thus deep vein thrombosis (dvt) of the fibular graft site. they reported peroneal dvts in three fibular flaps, which they attributed to a prolonged period between raising the flap and transferring it to the spine. for this reason, the authors recommend keeping the donor site warm and covered for as long as possible and raising the flap as close as possible to the moment of transfer23). utility of the fvfbg is greatest when local tissue is compromised due to infection or radiation, for the combined periosteal and endosteal vascularity of the bone graft enhances healing. for large skeletal defects, fvfbgs demonstrate faster healing, increased structural integrity, and enhanced resistance to infection compared to nonvascular grafts19). as opposed to other vascularized donor sites, such as the iliac crest or rib, the fibula is a long cylindrical bone with a strong cortex, reliable vascular pedicle, and little donor site morbidity913). while much of the prior literature on fvfbg use in the spine has focused on primary fusions of the cervical, thoracic, and sacral spine1267810121517), the two cases presented in this review occurred under revision circumstances in the lumbar spine. grafts in both patients were vascularized successfully using intra - abdominal vessels : the epigastric artery and vein in one patient and the inferior mesenteric artery and vein in the other. the first patient has had no recurrence of his spinal infection, and the second patient has had improved function and mobility without the need for further revision. postoperative revascularization of vascularized fibular grafts can be monitored with advanced imaging techniques including selective angiography, gadolinium - enhanced mri, three - phase technetium-99 m bone scintigraphy, single - photon emission ct, positron emission tomography, or the use of a skin paddle23). of these, only the use of a skin paddle has been demonstrated to be a reliable indicator of the vascularization and viability of the fvfbg11) ; in the case of lumbar spinal reconstruction surgery, the inclusion of a skin paddle is not possible and as such no formal monitoring for revascularization was performed on these patients. however, their successful fusion in an appro priate time window may be considered an indicator of their viability although without formally proving so. the use of free vascularized fibular grafting is an excellent option for a variety of spinal indications, and these two reports indicate that the technology may have an indication for use after multiple failed surgeries for osteomyelitis or correction of a multi - level large spinal deformity secondary to marfan syndrome. | this case report presents two patients who underwent fibular strut grafting for complex revisions of previous lumbar spine arthrodeses. a case review of the electronic medical record at the index institution was performed to evaluate the timeline of events of the two patients who underwent fibular strut grafting for complex revisions of previous lumbar spine arthrodesis, including imaging studies, progress notes, and laboratory results. one patient had developed chronic l3 vertebral body osteomyelitis from a prior fibular allograft and instrumentation placed for a traumatic burst fracture. the second patient had a severe scoliosis recalcitrant to prior arthrodeses in the context of marfan syndrome and a persistent l4 - 5 pseudarthrosis. both patients underwent free vascularized fibular autograft revision arthrodeses. at most recent long - term follow - up, both patients had improved clinically and neither had required further revision. the use of free vascularized fibular grafting is an excellent option for a variety of spinal indications, and these two reports indicate that the technology may have an indication for use after multiple failed surgeries for osteomyelitis or correction of a multi - level large spinal deformity secondary to marfan syndrome. |
the medical physicist in radiology is essential for enabling the practice of safe, state - of - the - art medical imaging. medical physicists in radiology are members of the multi - disciplinary clinical teams that are responsible for radiology services to patients. their role is to provide critical scientific input on the physical processes and technology that underpin the whole radiology service. generally, the medical physicists in radiology design and develop the framework of medical imaging, image processing, image distribution, image storage, radiation dosimetry, quality assurance of the imaging equipment, information and communication technology (ict) aspects of the imaging process, and radiation protection of the patient and operator. specifically, the medical physicists in radiology provide expert advice on the development, implementation, and improvement of imaging techniques and processes. medical physicists in radiology have a leading role in the strategic planning, testing, safe use, and optimization of advances in medical imaging technologies and techniques. both initial and continuing education and training are necessary in order to acquire and maintain sufficient knowledge and an appropriate level of knowledge and competence. the objective of our work was to develop a core curriculum for the education and training of european medical physicists in radiology. this core curriculum for medical physicists in radiology is issued jointly by the european federation of organisations for medical physics (efomp) and the european society of radiology (esr). these recommendations accommodate the contemporary requirements for the knowledge and competency needs in this rapidly evolving field of medicine. in 2004, a european expert group published the first european core curriculum for medical physicists in radiotherapy, and they recently finalized a revised and updated version of this curriculum. the curriculum for medical physics in radiotherapy was developed and revised jointly by efomp and the european society for radiotherapy and oncology (estro). another expert group for the development of a european core curriculum for medical physicists in radiology was initiated and installed by the efomp with participation of esr. the radiology medical physics group represents experts in general projection radiography, mammography, diagnostic fluoroscopy, interventional radiology, computed tomography, magnetic resonance imaging, ultrasound imaging, and radiation protection. the basis for a draft curriculum on radiology medical physics was laid during meetings of the expert group, and in a later phase written feedback from the experts was used to finalize the curriculum. it was decided to develop a curriculum that was consistent in structure and format with the revised radiotherapy medical physics curriculum. it was also decided that the curriculum should define general competencies ; specific knowledge, skills, and competencies in medical physics ; and a research project. the medical physicist in radiology must be able to work together with the multi - disciplinary team in the clinical application of medical imaging and participate in the organizing and structuring of the medical imaging process. the physicist should also ensure that the well - being, interests, and dignity of patients are promoted and safeguarded at all times. to support these requirements, the first part of the curriculum presents general competencies, subdivided into two sections : organization and professionalism. the second part defines specific knowledge, skills, and competencies in medical physics required to operate clinically in a department of radiology. a medical physicist requires clinical and analytical skills and is also expected to remain abreast of developments in medical imaging. both aspects of the job can be trained through the development of research skills. these need not necessarily be acquired through abstract academic research but can equally likely be developed through applied clinical problems. thus, the third and final part of the curriculum describes a research project where these skills are developed. table 1 gives an overview of the structure of the curriculum.table 1the structure of the core curriculum for medical physicists in radiologyi. computed tomography 13 magnetic resonance imaging 14 ultrasound imaging 15 radiation protection 16 diagnostic image display and image processingiv. the european core curriculum for medical physicists in radiology can be used when national curricula are being developed. the core curriculum supports the harmonization of education and training of european medical physicists in radiology, it may help to improve their mobility within europe, and it provides the basis for improved implementation of articles in european medical exposures directives that are related to the medical physics expert. the core curriculum aims at bringing the medical physicist in radiology up to the level of a qualified medical physicist. a qualified medical physicist is an individual who is competent to practice independently and to register as a medical physicist, in one or more of the subfields of medical physics. to act as an expert, further experience is required, and an involvement in a program for continuing professional development radiology involves many subspecialties including radiography, mammography, computed tomography, x - ray guided interventions, and pediatric radiology but also magnetic resonance imaging (mri) and ultrasound imaging. the medical physicist in radiology who is recognized as a medical physics expert must have a high level of expertise in x - ray imaging. in addition, but depending on local conditions, it may also be desirable or even required that the medical physicist in radiology acquires a certain level of expertise in mri, ultrasound imaging, and nuclear medicine. | some years ago it was decided that a european curriculum should be developed for medical physicists professionally engaged in the support of clinical diagnostic imaging departments. with this in mind, efomp (european federation of organisations for medical physics) in association with esr (european society of radiology) nominated an expert working group. this curriculum is now to hand. the curriculum is intended to promote best patient care in radiology departments through the harmonization of education and training of medical physicists to a high standard in diagnostic radiology. it is recommended that a medical physicist working in a radiology department should have an advanced level of professional expertise in x - ray imaging, and additionally, depending on local availability, should acquire knowledge and competencies in overseeing ultrasound imaging, nuclear medicine, and mri technology. by demonstrating training to a standardized curriculum, medical physicists throughout europe will enhance their mobility, while maintaining local high standards of medical physics expertise. this document also provides the basis for improved implementation of articles in the european medical exposure directives related to the medical physics expert. the curriculum is divided into three main sections : the first deals with general competencies in the principles of medical physics. the second section describes specific knowledge and skills required for a medical physicist (medical physics expert) to operate clinically in a department of diagnostic radiology. the final section outlines research skills that are also considered to be necessary and appropriate competencies in a career as medical physicist. |
sole author developed case definitions (except for that of an sae case which is the standard definition used by merck & co., inc.), performed data entry, analyzed and interpreted the data, and prepared the manuscript. a serious adverse event is defined as follows : " an adverse experience following treatment with a drug that results in any of the following : life - threatening adverse drug experience in - patient hospitalization or prolongation of an existing hospitalization persistent or significant disability / incapacity congenital anomaly or birth defect overdose (accidental or intentional). important medical events that may not result in death, be life - threatening, or require hospitalization may be considered a serious adverse drug experience when, based upon appropriate medical judgment, they may jeopardize the patient or subject, and may require medical or surgical intervention to prevent one of the outcomes listed in the definition above : such events should also be reported. " (merck & co., inc., adapted from the definitions of the international conference on harmonisation of technical requirements for registration of pharmaceuticals for human use) the definitions of ' probable ' and ' possible ' cases of l. loa encephalopathy following ivermectin treatment are as follows : probable case of l. loa encephalopathy encephalopathy (without seizures, usually with fever) in a person previously healthy and has no other underlying cause for encephalopathy, and onset of progressive central nervous system (cns) symptoms and signs within 7 days of treatment with ivermectin ; illness progressing to coma without remission, and peripheral blood l. loa > 10,000 microfilariae per milliliter of peripheral blood (mf / ml) pre - treatment, or > 1,000 mf / ml within 1 month post - treatment, or > 2700 mf / ml within 6 months of treatment ; and/or l. loa microfilariae present in cerebrospinal fluid (csf). encephalopathy (without seizures, usually with fever) in a person previously healthy and has no other underlying cause for encepahalopathy, and onset of progressive cns symptoms and signs within 7 days of treatment with ivermectin ; illness progressing to coma without remission, and semi - quantitative or non - quantitative (i.e. +, + +, + + +) positive l. loa microfilariae in peripheral blood within 1 month post - treatment. these definitions are adapted from those originally put forth by the independent experts that consulted for the mdp in 1995, in the report " central nervous system (cns) complications of loiasis and adverse cns events following treatment : report of an invited consultation, 23 october 1995 " (atlanta, ga : mectizandonation program, 1996). the author wishes to express great appreciation to field program partners of the mectizandonation program who reported the saes and to dr. annual frequency of saes reported to have occurred following ivermectin mass treatment from 1989 to 2001 cases reported as of august 31, 2002 geographical distribution of all saes reported to have occurred following mass treatment with ivermectin from 1989 to 2001 (as of august 31, 2002) proportion of saes reported to have occurred following ivermectin mass treatment from 1989 to 2001, by reporting country ; cases reported as of august 31, 2002 ; all reported cases from sudan are from the southern region ; other reporting countries are ethiopia (n = 1), liberia (n = 1) and central african republic (n = 1). annual frequency of saes reported to have occurred following ivermectin mass treatment from 1989 to 2001, by reporting country ; cases reported as of august 31, 2002 ; all reported cases from sudan are from the southern region ; other reporting countries are ethiopia (n = 1), liberia (n = 1) and central african republic (n = 1). incidence of reported saes following ivermectin mass treatment from selected countries in central africa, 1989 to 2001 ; cases reported as of august 31, 2002 ; car = central african republic ; drc = democratic republic of congo ; all reported cases from sudan are from the southern region. age distribution of sae cases reported to have occurred following ivermectin mass treatment from 1989 to 2001 cases reported as of august 31, 2002 ; the ages of 8 cases remain unknown. presenting symptoms and signs of sae cases reported to have occurred following ivermectin mass treatment from 1989 to 2001 cases reported as of august 31, 2002 ; total of individual percentages is greater than 100 because most patients presented with multiple symptoms and signs. presumptive diagnostic categories assigned to reported sae cases following mectizantreatment all cases met the definition of an sae (see note 1) before being assigned one of these presumptive diagnoses ; adapted from mcgavin ddm (1998). gc cook gc) w. b. saunders co. ltd, london, p. 248 ; adapted from gardon j.. presumptive diagnoses of sae cases reported to have occurred following ivermectin mass treatment from 1989 to 2001 cases reported as of august 31, 2002 ; see table 3 for definitions of presumptive diagnoses. therapeutic interventions used in the management of sae cases reported to have occurred following ivermectin mass treatment from 1989 to 2001 cases reported as of august 31, 2002 ; total of individual percentages is greater than 100 because multiple treatments were administered per person in most cases. known clinical outcomeof sae cases reported to have occurred following ivermectin mass treatment from 1989 to 2001 cases reported as of august 31, 2002 ; there were 2 cases of scarring due to drug skin reaction, 1 case of permanent soft tissue damage due to severe decubitus ulcers, and 1 case of nephrotic syndrome which predated the sae ; the clinical outcome was not documented in 70 cases. reported encephalopathic cases following ivermectin mass treatment from 1989 to 2001 cases reported as of august 31, 2002 ; see note 2 for definitions ; case of cerebral malaria ; central african republic = 1 case ; sudan (southern) = 1 case ; ||democratic republic of congo = 2 cases ; sudan (southern) = 1 case ; nigeria = 1 case. | this paper presents a summary of reported cases of serious adverse events (saes) following treatment with mectizan (ivermectin, merck, sharpe & dohme) in onchocerciasis mass treatment programs from january 1, 1989 to december 31, 2001 through a passive surveillance system. a total of 207 sae cases were reported out of approximately 165 million reported treatments delivered during the period under review, giving rise to a cumulative incidence of 1 reported sae per 800,000 reported treatments. the mean age was 40 years and 70% of the cases were males. the mean time between ivermectin intake and onset of illness was 1 day. for 57% of the cases (n = 118), that was their first exposure to ivermectin. the majority of cases were reported from cameroon (n = 176 ; 85%) with peaks in the incidence of sae reporting in 19891991 and 19941995 when the program expanded to ivermectin - nave populations. fifty - five percent of the cases from cameroon (i.e. 97 out of 176 cases) were encephalopathic and were reported from the central - southern region of the country ; two - thirds of these cases were ' probable ' or ' possible ' cases of loa loa encephalopathy temporally related to ivermectin treatment. reporting bias may explain some but not all of the differences in sae reporting between the 34 onchocerciasis - endemic countries that have, or have had, mass treatment programs. further research is needed to understand the apparent clustering of encephalopathy cases in central - southern cameroon since l. loa infection alone probably does not explain the increased incidence of this type of sae from this region. |
the drosophila enhancer of rudimentary, e(r), gene encodes enhancer of rudimentary homolog (erh), a small protein of 104 amino acids [1, 2 ]. erh is a highly conserved protein that has been found in plants, animals, and protists. drosophila erh is 76% identical to the vertebrate erh, 49% identical to the c. elegans erh, and 40% identical to the plant (arabidopsis) erh. the vertebrate erh homologues are very highly conserved. the human, mouse, and xenopus proteins are identical and differ from the zebrafish erh by a single conservative amino - acid change. the mouse and human proteins have been synthesized and purified from e. coli and the crystal structures determined [3, 4 ]. the protein contains three -helices and a -sheet that fold into a novel three - dimensional structure that comprises a single domain. human erh exists as a dimer and the dimerization occurs via binding between the -sheets of the two monomers. the binding is accomplished through primarily seven highly conserved amino acids (figure 1). these include a transcription factor, dcoh / pcd in xenopus, a protein involved in the regulation of dna replication in humans, pdip46/skar, and ciz1, a nuclear zinc - finger protein that may regulate dna synthesis and cyclin dependent kinases in humans [7, 8 ]. erh has been shown to coimmunoprecipitate with spt5, a transcription elongation factor, and with fcp1, a tfiif - associating component of ctd phosphatase. erh has also been shown to interact with the spliceosome protein snrpd3 and to be required for the splicing of the mrna of cenp - e, a mitotic motor protein. this diverse set of nuclear interactions suggests that erh may be involved in a number of general nuclear functions involving dna replication, transcription, and mrna splicing. this prediction is supported by the nuclear localization of an egfp - erh fusion protein in transfected nih/3t3 cells. further studies with antibodies to drosophila erh showed that the endogenous erh is localized to the nucleus in drosophila schneider cell lines and in cells of the early drosophila embryo. searches for potential nuclear localization signals in drosophila and human erh by computer programs designed to identify nuclear localization signals (predictprotein, wolf psort, and cnls mapper) fail to identify any. we define the sequence needed for the nuclear localization of erh and describe the identification of new potential nuclear binding partners of erh. the amino - acid sequences of erh that are necessary for binding to its partners and for its nuclear localization are the same. this suggests that erh is nuclearly localized through binding to these proteins or other binding partners. for these procedures, all of the yeast strains, plasmids, and cdna prey libraries were obtained from the labs of dr. the host saccharomyces cerevisiae strain egy191 is a his3, ura3, trp1, and leu2 auxotroph carrying a chromosomal insertion of lexa binding sites upstream of the endogenous leu2 gene. this strain also contained the plasmid prb1840, which contains lexa dna - binding sites in front of a lacz reporter gene. egy191/prb1840 was then transformed with the bait plasmid peg202 containing the appropriate lexa - e(r) fusion gene to be used in the interaction - trap screens or the interaction assays. the d. melanogaster e(r) coding region was amplified from an e(r) cdna via pcr using the primers 5 ggggatccccatgtcgcacaccatcct 3 and 5 ggctcgagttaggtattg gaactaa 3 (table 1), digested with bamhi and xhoi, and ligated into the polylinker of the parent bait plasmid peg202 as a bamh1-xho1 fragment. the human e(r) coding region was amplified via pcr using the primers 5 tggaattcatgtctcacaccattttg 3 and 5 ctcgagttatttcccagcctgtt 3 (table 1), digested with ecori and xhoi, and ligated into the polylinker of peg202 as an ecor1-xho1 fragment. these procedures fuse the e(r) genes in frame with the lexa dna - binding domain. egy191/prb1840 was transformed with either the drosophila e(r) as the bait, peg202-der, or the human e(r) as the bait, peg202-her. bait proteins expressed from peg202 will enter the yeast nucleus and bind lexa operators upstream of the two reporter genes leu2 and lacz but, alone, will fail to activate their transcription. a drosophila 012-hour embryo cdna library was screened for genes encoding erh - interacting proteins. the library was created in the plasmid pjg4 - 5 and contains 4 10 independent clones. the prey genes in the library consist of a transcription activation domain fused to a random cdna. if the coding region encodes an erh - binding protein, then it will bind to lexa - erh at the lexa promoters of the leu2 and lacz genes. this will result in the activation of both genes resulting in a leu2 lacz colony. another requirement of the screen is that the leu2 lacz phenotypes be galactose - dependent, since the prey genes are under the control of a gal1 promoter. the egy191/prb1840/peg202-der strain was first transformed with the pjg4 - 5 cdna library, and a total of 102,000 transformants were isolated. a total of 5213 colonies were isolated as putative galactose - dependent leu2 colonies. upon retesting, of the 172 colonies, 12 were galactose - dependent lacz. finally, the library plasmid from each of these colonies was isolated and retested for its dependence on the bait plasmid, peg202-der, for producing the galactose - dependent leu2 lacz phenotype. eight of these clones proved to be bait - dependent and were saved for further analysis. a hela cell cdna library was screened to isolate genes encoding human proteins that interact with human erh. a similar procedure to the drosophila screen was performed except that peg202-her was used. a total of 73,000 individual colonies transformed with the hela cdna library. from these five bait - dependent colonies were identified for further analysis. plasmid dna from the positive clones was isolated and used as the template for pcr. two pjg4 - 5 specific primers 5 ccagcctcttgctgagtggagatg 3 and 5 gacaagccgacaaccttgattgga 3 were used. these primers flank the ecori and xhoi sites in pjg4 - 5 and can be used to amplify the inserted cdna. the amplified dna was sequenced and homology searches using blast (https://blast.ncbi.nlm.nih.gov/blast.cgi) were performed to identify the clones. yeast expressing lexa - der and ha - rps3 was grown in 50 ml minimal galactose medium at 30 with shaking for 48 to 72 hours. to verify the expression of lexa - erh the cells were pelleted by centrifugation in a microcentrifuge for 5 min at 12,000 rpm, the supernatant was removed, and the pellet was resuspended in 40 l laemmli loading buffer (bio - rad laboratories, inc.) with -me. after resuspension, the sample was stored at 20 until being analyzed by sds - page. the remaining culture was centrifuged at 3000 rpm for 15 min to pellet the cells. the pellet was resuspended in 5 ml cip buffer (50 mm tris - hcl ph 7.5, 100 mm nacl, and 5 mm edta 0.1% triton x-100) and protease inhibitor and cooled on ice. a volume of glass beads (sigma - aldrich) equal to the volume of the cell pellet was added, and the sample was vortexed 5 times at 30 seconds bursts to shear the cells, with cooling on ice between vortexes. cell debris was removed from the sample by centrifugation at 3,000 rpm for 5 minutes at 4. the protein containing supernatant was removed and kept on ice. a rabbit polyclonal anti - ha antibody (santa cruz biotechnology) was added (1 : 500) to the sample and incubated on ice for 1 hour, with brief mixing in between. 100 l of protein a beads (pierce chemical co.) was added and allowed to incubate for 1 hour on ice. brief mixing of the sample was done throughout the 1-hour incubation to keep the beads in suspension. the sample was centrifuged for 3 minutes at 1,500 rpm to pellet the beads and the supernatant was removed. the final bead pellet was resuspended in 40 l laemmli loading buffer with -me and boiled for 1 minute. as a negative control, yeast expressing lexa and ha - rps3 was treated in parallel with the sample above. also, yeast expressing ha and lexa - der was treated in the same manner to insure der was not sticking to the protein a beads. 40 l of each sample was loaded in the order : crude yeast extract expressing lexa / ha - rps3, yeast extract expressing lexa / ha - rps3 treated with anti - ha, crude yeast extract expressing lexa - der / ha - rps3, yeast extract expressing lexa - der / ha - rps3 treated with anti - ha, crude yeast extract expressing lexa - der / ha, yeast extract expressing lexa - der / ha treated with anti - ha, and marker. the samples were run on a 10% polyacrylamide gel (invitrogen nupage, np0341box) in 1x invitrogen nupage mes sds running buffer (np0002) and transferred to a nitrocellulose membrane (pierce chemical co.) using invitrogen nupage transfer buffer (np0006) via electroblotting using a bio - rad trans - blot sd semi - dry transfer cell and an ec150 (e - c apparatus corporation) power source at 20v for one hour. after transfer, total protein was detected using a reversible membrane protein staining solution (pierce chemical co.). the membrane was blocked in blocking buffer (5% fat - free powdered milk in ttbs : 9.68 g tris buffer, 116.96 g nacl, 1760 l tween-20 in 4 l dh2o, ph to 7.5) for one hour before probing following standard western techniques. the membrane was probed with a goat anti - lexa antibody (1 : 1000) in blocking buffer for one hour with gentle shaking. the goat anti - lexa antibody was detected with a mouse anti - goat igg - hrp conjugated secondary antibody (1 : 5000) for one hour with gentle shaking. the membrane was rinsed and the conjugate was detected using supersignal west femto substrate (pierce chemical co.) and the blot exposed on film. to map the regions of the human and drosophila erh that were necessary for interacting with their partners, sets of primers were used to amplify different regions of the coding sequence for ligating to the lexa coding region in peg202 (table 1). for the drosophila erh these primers were used to amplify coding sequences for amino acids 151, 52104, 124, and 2551. for the human erh, coding sequences for amino acids 151 and 52104 were amplified, digested with ecori and xhoi, and ligated into peg202. the newly constructed baits were transformed into egy191/prb1840/pjg4 - 5-rps3 or egy191/prb1840/pjg4 - 5-rpl19 and tested for the galactose - dependent leu2 lacz phenotype. gfp - erh constructs were generated by cloning the human and drosophila e(r) fragments encoding amino acids 1104, 151, and 52104 and the drosophila erh fragments 124 and 2551 into the expression vector pegfp - c1. specific primer pairs (table 1) were used to amplify the sequences, which were digested with bamhi and xhoi and ligated into pegfp - ci. sk - hep cells were grown in emem plus 10% calf serum for two days to allow them to adhere to round microscope slide covers. barry bode, department of biology, saint louis university (current address department of biological sciences, northern illinois university). prior to transfecting the cells, the transfection mix was prepared as follows : 1 g dna was added to 389 l eagle 's minimal essential medium, emem (serum - free), and vortexed. to this mix, 9 l of tfx-20 reagent (promega corporation) was added, and the mix was vortexed and allowed to incubate for 1015 min at room temp. after the incubation period, the growth medium was aspirated off the cells, and the cells were returned to the 37 incubator for 2 hours. at the end of the incubation period, 300 l emem with 10% calf serum the cells were returned to the incubator and allowed to grow for another two days before viewing with a fluorescent compound microscope with a gfp filter. to identify possible binding partners for drosophila erh, a yeast two - hybrid screen was performed using drosophila lexa - erh as bait to screen a prey library consisting of drosophila embryo cdna clones fused to the transcription activation domain of gal4. to construct the lexa - erh fusion gene, pcr was performed to amplify the e(r) coding region with restriction sites for cloning into peg202 (table 1). the prey plasmid from each positive clone was isolated and a partial sequence of the cdna insert was determined to identify the putative erh - binding partner. five of the clones were of rps3 (ribosomal protein s3) and three of the clones were of rpl19 (ribosomal protein l19). another yeast two - hybrid screen was performed using the human erh as bait and a human hela cell cdna prey library. three of the clones were human rps3 and two were human ddit4 (dna damage inducible transcript 4). all of the putative binding partners of dmerh and hserh are known nuclear proteins, which is consistent with previous studies that localized erh to the nucleus [6, 12 ]. the fact that rps3 was identified as a binding partner of erh in both drosophila and humans suggests a conserved function of erh in both humans and drosophila. the yeast two - hybrid screen is a genetic test to show protein - protein interactions. to verify that drosophila erh and rps3 actually bind to each other, the first experiment was designed to show the requirement for the presence of rps3 for the precipitation of erh. yeast cells were grown which expressed lexa - erh and either ha or ha - rps3. lexa - erh was not present in the immunoprecipitate from the cells expressing ha (figure 2(a), lane 5) but was present in the immunoprecipitate from the cells expressing ha - rps3 (figure 2(a), lane 3). controls showed that both cell types expressed lexa - erh (figure 2(a), lanes 2 and 4). while these experiments showed that rps3 is necessary for the immunoprecipitation of lexa - erh, rps3 could conceivably bind to either lexa or erh. to show that rps3 was not binding to lexa lexa did not coprecipitate, demonstrating the necessity for erh in the coimmunoprecipitation (figure 2(b), lane 2). structural studies on purified human erh reveal that the protein likely forms a single domain with three -helices and one -sheet composed of four antiparallel -strands [3, 4 ]. the crystal structure also suggests that the -sheet serves as a surface for protein - protein binding. given this structural information, it was of interest to determine the amino - acid sequences of erh that are necessary for its binding to its partners, rps3 and rpl19. the yeast two - hybrid interaction assay was used to map the erh sequences necessary for binding. pcr was used to amplify specific regions of the erh coding region, which were then ligated into the lexa bait plasmid, peg202 (table 1). in this way, lexa - erh baits containing drosophila erh amino acids 151, 52104, 124, and 2551 were generated and tested for their ability to interact with rps3 and rpl19. the results are summarized in table 2. as a positive control, the full - length erh (1104) it also binds to the human rps3, indicating that this protein - protein interaction is conserved. amino acids 151 were shown to bind to rps3 and rpl19, whereas amino acids 52104 did not. amino acids 124 bind to rps3 and rpl19, while amino acids 2551 do not. the human erh was subdivided into amino acids 151 and 52104 and examined for their ability to bind to hsrps3. similar to the results with dmerh, amino acids 151 bind to hsrps3, while amino acids 52104 do not (table 3). previous studies on the immunolocalization of erh in drosophila s2 cells and early embryos demonstrated that in drosophila melanogaster endogenous erh is nuclearly localized. those results corroborate studies in human cell lines in which egfp - hserh fusion proteins were localized to the nucleus. these data argue that erh must have a nuclear localization signal ; however, scans of the drosophila and human erh amino - acid sequences using predictprotein (http://predictprotein.org/), wolf psort (http://www.genscript.com/wolf-psort.html/), and cnls mapper (http://nls-mapper.iab.keio.ac.jp/cgi-bin/nls_mapper_form.cgi/) have not revealed any nuclear localization signals. this leaves unanswered the questions as to how erh is nuclearly localized and what amino - acid sequences are necessary for nuclear localization. we decided to utilize the gfp system to identify the sequences necessary for the nuclear localization of erh. pcr was used to amplify all or part of the coding regions for ligation into the plasmid, pegfp - c1, for the creation of gfp - dmerh and gfp - hserh fusions (table 1). plasmids containing the fusion genes were transfected into human sk - hep cells and cellular localization was visualized with gfp. the results are summarized in table 4. for both erh and herh, the full - length protein localizes to the nucleus (figures 3(a) and 4(a)). the n - terminal half of each protein (amino acids 151) can also direct nuclear localization (figures 3(b) and 4(b)), while the c - terminal half of each protein (amino acids 52104) does not (figures 3(c) and 4(c)). for drosophila erh, the n - terminal half was further subdivided into amino acids 124 and 2551. amino acids 124 direct the localization of gfp to the nucleus (figure 3(d)), although there appeared to be more cytoplasmic expression of gfp than what was seen when amino acids 151 (figure 3(b)) or the entire protein (figure 3(a)) was used. these data localize the minimal sequence needed for nuclear localization to amino acids 124. as a negative control, egfp by itself the data argue that the first 24 amino acids are sufficient for the nuclear localization of erh. there are two arginines within this region of drosophila erh, but nothing looks like a nuclear localization signal. interestingly, this 24-amino - acid region is the same region that is necessary for erh to bind to its binding partners, rps3 and rpl19 (table 2). the drosophila rps3 in particular has a strong nls starting at amino acid 6 (piskkrk__fv). the human rps3 has a similar nls starting at amino acid 4 (qiskkrk__fv). in addition, rps3 has been shown to localize to the nucleus in both drosophila melanogaster and humans. together these data suggest that erh may be entering the nucleus through piggy backing onto one of its binding partners, such as rps3. the n - terminal 24-amino - acid region, which is necessary for both the nuclear localization of erh and its binding to rps3 and rpl19, is comprised of two antiparallel -strands that are part of a four - strand -sheet. this -sheet serves as a hydrophobic surface in protein binding [3, 4 ]. five out of the seven residues within the -sheet, which have been identified as important in the dimerization of erh, are contained within the first two -strands. these residues are conserved between human and drosophila erh (figure 1), suggesting their importance in protein binding in both species, and may explain how drosophila erh can bind to both drosophila and human rps3. our current results also indicate that while the four strands of the -sheet form a face for protein binding, the first two -strands are necessary and sufficient for protein binding and nuclear localization. although amino acids 124 are sufficient for nuclear localization, this sequence appears not to localize gfp to the nucleus as strongly as do amino acids 152 and 1104 (figure 3). these additional amino acids (25104) are not sufficient for nuclear localization, but they may help stabilize the structure of amino acids 124 for optimal protein binding. amino acids 2552 comprise a major -helix that is positioned behind the two -strands of amino acids 124. amino acids 6682 comprise the last two -strands that, along with amino acids 124, form the -sheet that is necessary for the binding of erh to its partners. these -strands, while helping to stabilize the -sheet, also contain two amino acids that have been shown to be contact points in protein - protein binding of erh. these amino acids should strengthen the interactions and thus strengthen the nuclear localization of erh. the present studies identified three new putative binding partners for erh, rps3, and rpl19 in drosophila and rps3 and ddit4 in humans. rps3, besides being a ribosomal protein, is a dna repair enzyme [16, 18 ] and ddit4 is a protein whose expression is induced in response to dna damage. also, human rps3 has been shown to translocate from the cytoplasm to the nucleus in response to genotoxic stress treatment with hydrogen peroxide or dna alkylating agents. these findings suggest the possibility that erh has a role in dna damage repair and that this function can be regulated by regulating its nuclear localization through its binding to rps3 both are 104 amino acids in length and can be lined up without gaps along their entire lengths. the tertiary structure or the drosophila erh, predicted by swiss - model, is nearly identical to the solved tertiary structure of the human / mouse erh [3, 4 ]. for the human / mouse erh, seven amino acids were identified as critical in protein binding (5i, 7l, 17r, 19y, 21d, 70l, and 79y). the one difference is a conservation amino acid substitution at residue 70 (m for l). the first five of these amino acids are contained within the n - terminal 24 amino acids that this study has shown to be important for both binding of erh to rps3 and rpl19 and the nuclear localization of erh. this high structural conservation suggests that the human and drosophila erh may be functionally equivalent. the drosophila erh coding region was replaced with the human erh coding region in the drosophila genome without any noticeable effect on the fly. all of the known mutant phenotypes associated with the deletion of the drosophila e(r) gene were rescued by the human e(r) gene, indicating that the human erh can functionally replace the drosophila erh. the evolutionary conservation in the structure and function of the human and drosophila erh suggest that its roles in the cell may also be conserved between humans and drosophila. given this possibility, the fact that the present study identified rps3 as a possible binding partner for both the human and drosophila erh is intriguing. they share an 83% amino acid identity and an 89% amino acid similarity and both have been shown to be dna repair proteins [16, 18 ]. it may be that the roles and mechanisms of erh and rps3 in growth and dna repair are conserved between humans and drosophila. rpl19 and rps3 are both upregulated in high growth situations, specifically in certain cancer cells [2427 ]. rps3 has also been shown to be a transcription factor. as a subunit of nf-b, it is responsible for the activation of specific nf-b target genes. these nuclear functions, along with previously identified nuclear functions, implicate erh in transcription initiation, transcription elongation, mrna splicing, dna synthesis, and dna repair. erh is a very small protein and to date the only biochemical function that has been attributed to it is protein binding. it may be that erh is modulating the activity of a number of different nuclear complexes purely through binding to specific subunits of the complexes. yeast two - hybrid interaction trap assays identified rps3, rpl19, and ddit4 as binding partners of erh. similarities in the function of these proteins suggest a role of erh in dna repair and cell growth. amino acids 124 of erh were shown to be sufficient and necessary for the binding to rps3 and rpl19. the role of this region in these two properties of erh suggests a model for its nuclear localization. erh, which appears not to have an nls, may be localizing to the nucleus via binding to one of its partners which has an nls. | the protein enhancer of rudimentary homolog, erh, is a small, highly conserved protein that has been found in animals, plants, and protists. genetic and biochemical interactions have implicated erh in the regulation of pyrimidine biosynthesis, dna replication, transcription, mrna splicing, cellular proliferation, tumorigenesis, and the notch signaling pathway. in vertebrates and insects, erh is nuclearly localized ; however, an examination of the erh amino - acid sequence does not reveal any nuclear localization signals. in this paper we show that the first 24 amino acids contain sequences necessary and sufficient for nuclear localization. through yeast two - hybrid screens, three new binding partners of erh, rps3, rpl19, and ddit4, were identified. rps3 was isolated from both human and drosophila screens. these interactions suggest functions of erh in cell growth, cancer, and dna repair. the erh sequences necessary for the interactions between erh and rps3 and rpl19 are mapped onto the same 24-amino - acid region in erh which are necessary for nuclear localization, suggesting that erh is localizing to the nucleus through binding to one of its dna - binding partners, such as rps3 or rpl19. |
primary hyperparathyroidism (ph), together with type 2 diabetes and thyroid diseases, belongs to the most common endocrine disorders. the morbidity rates range from 1 to 7 per 1,000 inhabitants, depending on the given population. ph is characterized by an abnormally increased synthesis and release of parathyroid hormone (pth) in the parathyroid cells. this leads to enhanced resorption of calcium from the skeletal system and its increased adsorption from the gastrointestinal tract, as well as increased calcium and phosphate excretion in the urine. the spectrum of symptoms that may represent the clinical manifestation of ph is very wide. it includes, inter alia, mental disorders, gastrointestinal disorders, nephrolithiasis symptoms, as well as bone and joint pain due to a generalized or focal osteoporosis. despite the abundant ph symptomatology, the majority of ph cases are currently detected in asymptomatic patients based on hypercalcemia revealed by routine laboratory tests. ph diagnosis is based on biochemical outcomes, i.e. increased serum pth and total or ionized calcium levels as well as hypercalciuria. the diagnosis is also based on pth levels in the upper normal range with abnormally increased serum calcium levels, which may in some of the patients inhibit pth release. adenoma of one of the parathyroid glands is the most common cause of ph (approximately 85% of cases). ph can occur in a sporadic or familial form (about 5% of patients), most often secondary to multiple endocrine neoplasia syndrome type 1 (men 1) (pituitary tumors and neuroendocrine tumors of the pancreas are also included in the syndrome) and type 2a (men 2a) (coexists with medullary thyroid cancer and pheochromocytoma). regardless of ph etiology, after initial asstessment of disease stage, surgical treatment is the recommended management strategy. if there are no contraindications, it should be proposed to all patients with clinical symptoms. in the case of asymptomatic patients, the current guidelines recommend surgical treatment in patients with total serum calcium levels exceeding the upper limit of normal by 1 mg / dl. indications for surgical treatment further include impaired renal function (nephrolithiasis or renal parenchymal calcification in the imaging studies, creatinine clearance of 400 mg / day coexisting with an increased risk of nephrolithiasis) as well as skeletal abnormalities (spinal fracture shown in the imaging study, the t - score of < 2.5 in dxa study). the urgency of the indications depends on symptom severity and biochemical disorders. bilateral neck exploration (bne), described by mandl in 1925, has been a widely used method of surgical treatment in ph patients for many years. many authors emphasize that the efficacy of this procedure largely depends on the experience of the operating team. in the recent years, minimalinvasive parathyroidectomy (mip) has been increasingly performed due to its smaller extent, shorter duration and lower rates of complications. its efficacy is determined by a precise location of parathyroid tissue using preoperative imaging techniques. complementary role of both these tests is emphasized in the literature. at the same time, a discussion is held on improving the already existing algorithms or implementing new diagnostic tools. broadband, high - frequency (817 mhz) linear probes are used for the identification of lesions in the parathyroid glands. probes with the frequency of 58 mhz may be useful in patients with obesity or large thyroid goiter. the test should be performed in the supine position, with the patient 's head tilted back. it is recommended to obtain cross - sectional and longitudinal images of the anterior region of the neck, bilaterally in the region from the common carotid arteries to the midline as well as from the level of the common carotid artery bifurcation to the sternal notch. if possible, the examined area should be extended to the superior part of mediastinum, by setting the probe at an appropriate angle and asking the patient to swallow own saliva. during the test, special attention should be paid to the posterior surface of the thyroid lobes as well as the area below the lower thyroid poles. the glands usually present the appearance of flattened oval disks ; they are 5 3 1 mm in size and weigh about 40 mg. unchanged parathyroid glands are isoechogenic relatively to normal thyroid tissue and are not usually visible in the ultrasound image. found in their study that the weight of adenomas in 165 surgically treated patients ranged between 40 and 16,300 mg, however, 2/3 of the described lesions had a weight of less than 1,000 mg. the smallest adenoma visualized by the authors in the usg image had a weight of 75 mg and size of 7 3 3 mm. parathyroid adenomas are typically visualized as solid, wellcircumscribed, oval or oblong structures with lower echogenicity compared to the surrounding thyroid tissue. large lesions may have a polycyclic shape and contain fluid structures (corresponding to regressive lesions) and calcifications (fig. b - mode usg images of the right lower parathyroid adenoma : hypoechoic, inhomogeneous, well - circumscribed focal lesion located posteriorly to the right thyroid lobe. owing to the courtesy of prof. iwona sudo - szopiska md, phd, katarzyna dobruch - sobczak md, phd., rafa sapa md, phd the sensitivity and specificity of ultrasound in the detection of enlarged parathyroid glands were assessed by a number of authors and ranged between 69% and 90% as well as 90% and 98%, respectively. small size of adenomas is one of the causes of false - negative test results. in the above, only 35% of lesions weighing less than 200 mg were visible on ultrasound. the study also showed a significant correlation between the size of parathyroid lesions and the diagnostic accuracy of ultrasonography. ectopic parathyroid location, most often in the acoustic shadow (e.g. in the retrotracheal space or in the mediastinum), is another cause of false - negative results. the superior parathyroid glands, which are derived from the fourth branchial pouch, are typically located at the posterior aspect of the upper parts of both thyroid lobes ; in the vicinity of the intersection of the recurrent laryngeal nerve and the lower thyroid artery in 80% of cases. the location of the inferior parathyroid glands, which are derived from the third branchial pouch, shows greater variability. although 60% of these glands are located in the vicinity of the lower poles of the thyroid, they may be present in the region from the mandible to pericardium. many cases of ectopic parathyroid glands located retrotracheally, retroesophageally, in the vicinity of carotid vessels or along the vagus nerve, also in the mediastinum, were described in the literature. in the general population, additional parathyroid glands, which are usually located in the thymus region, ultrasound shows low sensitivity in detecting this type of lesions. in a study by haber., the sensitivity of ultrasound in the diagnosis of ectopically located adenomas of the parathyroid glands was only 25%. the sensitivity of ultrasound in detecting focal lesions of the parathyroid glands was 36% in this patient population. for comparison, as reported in the already mentioned study by reading., the sensitivity and specificity of ultrasound in a subgroup of 21 patients with previous surgical treatment were 80% and 92%, respectively. parathyroid adenomas located in the thyroid are another diagnostic issue. as shown in postmortem studies, the incidence of the intra - thyroid location of the parathyroid glands was estimated at less than 0.2%, and 25% in ph patients. the same rate was estimated as less than 1% in a retrospective study by goodman including more than 10,000 patients. intrathyroidal adenomas are difficult to distinguish from lesions that are typically visualized on ultrasound in the course of thyroid goiter. fine needle aspiration biopsy (fnab) is a method that allows to differentiate between the two diseases. in a study by owens., patients with identified intrathyroidal parathyroid tissue were also shown to have increased pth levels in the needle washings compared to serum pth levels. with the advent of new technologies, attempts were made to increase the sensitivity and specificity of ultrasound. in one of these attempts, the parathyroid glands are usually vascularized by the thyroid artery branches, most often from the lower thyroid artery. the presence of an artery forming an arch on the adenoma periphery, which tends to branch into the adenoma with subsequent vascular amputation, is typical (fig. the characteristic type of vascularization helps differentiate adenomas and lymph nodes supplied by vessels centrally penetrating the lymph node in the hilus region. showed that the visualized blood flow in the feeding artery using color or power doppler increased the sensitivity of this method from 73% up to 83% compared to grey - scale ultrasound. color and power doppler : characteristic vessels peripherally branching into the lesion. owing to the courtesy of prof. iwona sudo - szopiska md, phd, katarzyna dobruch - sobczak md, phd., rafa sapa md, phd there is no doubt that preoperative ultrasonographic assessment of ph patients has many advantages, such as low cost, high availability, no patient exposure to ionizing radiation, good visualization of the neck morphology. however, it should be noted that there are some limitations to the method, including low sensitivity in the detection of focal ectopic parathyroid tissue and small lesions. furtherthemore, nodular goiter or enlarged lymph nodes are potential causes of false - positive results..at the same time it should be emphasized that the knowledge and experience of the examiner may contribute to decrease in the number of false diagnosis. in the 80 's, the scintigraphic examination of the parathyroid glands was performed using thallium-201 (tl) and assessed combined with thyroid scintigraphy using pertechnetate (tc). in the next decade radiopharmaceuticals, which had been used in myocardial perfusion scintigraphy. a large number of mitochondria within parathyroid adenoma cells and the abundant vascularization in the affected tissue result in an increased uptake of both tracers. the exceptional pharmacokinetic properties of tc - sestamibi allowed to develop a method of a two - phase parathyroid scintigraphy. following intravenous injection, tc - sestamibi accumulates both in the parathyroid glands and the thyroid, however it is more rapidly washed out from the thyrocytes. the focus of increased tracer accumulation, which is maintained in the delayed phase of the test indicates the presence of parathyroid adenoma. while tc - sestamibi and tc - tetrofosmin accumulate both, in the parathyroid and thyroid tissue, the iodine-123 (i) and tc - pertechnetate are not taken up by the parathyroid cells. there are a few existing protocols of this method. in the final computer analysis scintigrams the focus of increased tc - sestamibi or tc - tetrofosmin corresponding to the absence of iodine-123 (i) or tcpertechnetate accumulation indicates the presence of parathyroid adenoma (fig. a focus of increased tc - sestamibi accumulation corresponding to a focus with no tc - pertechnetate uptake in the projection of the lower right parathyroid gland. both scintigraphic methods were compared in a number of study protocol modifications in order to find the optimal solution. the percentage of non - diagnostic tests for subtraction and delayed acquisition method, respectively, after 1, 2, and 3 hours was evaluated with the obtained results of 21%, 38%, 43% and 56%, respectively, for the individual protocols. the authors emphasized that a combined use of both methods is necessary to achieve the optimal accuracy of the preoperative assessment of patients. the use of both techniques resulted in 81% accuracy (assuming the correct location of the side and pole of the thyroid, where granuloma was found) and 90% accuracy (for a correct location of the side). interestingly, the study showed no advantage of the three - dimensional image acquisition techniques (spect or spect / ct) over planar imaging technique. the 2015 meta - analysis included 18 studies published over the last 25 years to compare different image acquisition techniques : planar imaging, spect and spect / ct in the preoperative assessment in ph patients. the sensitivity of these methods was 63%, 66%, 84%, respectively, and the positive predictive value (ppv) was 90%, 82% and 95%, respectively(fig. 4 and 5). a focus of increased tc - sestamibi accumulation in the lower left parathyroid gland parathyroid spect / ct scan. a focus of increased tc - sestamibi accumulation in the lower right parathyroid gland the use of pinhole collimators is an interesting suggestion to increase the sensitivity of the method. showed that planar imaging with pertechnetate and tc - sestamibi using spect and pinhole collimators allowed for an increase in the sensitivity up to 93% with 91% specificity. the main advantages of scintigraphy include higher sensitivity compared to ultrasound in detecting ectopic lesions. assessed the sensitivity of ultrasound and scintigraphy in the detection of ectopically located parathyroid adenomas : in the thymus, retroesophageally, in the thyroid, in the mediastinum, undescended (situated at least 1 cm above the upper thyroid pole) as well as in the vicinity of carotid arteries. the sensitivity of ultrasound and scintigraphy for the detection of this type of lesions was 59% and 89%, respectively. the advantage of scintigraphy over ultrasound was shown in 28 out of 59 patients, whereas ultrasound was superior in only 3 cases. as in the case of ultrasound, false - negative results are mostly due to the small size of adenomas whereas thyroid nodular goiter is the most common cause of false - positive results. the use of radiopharmaceuticals also allows to use the gamma probe for intraoperative localization of parathyroid adenomas. it was shown, however, that this type of management can not replace the preoperative scintigraphy in the imaging of adenomas in ph patients. the issue of the complementary role of ultrasound and scintigraphy in the preoperative assessment of ph patients has been repeatedly discussed in the literature during the recent years. in 2000, de feo.. noted in their prospective study that the combined use of ultrasound and scintigraphy resulted in 96% sensitivity and 83% specificity. for comparison, the sensitivity and specificity when using only one method were 67% and 94% for ultrasound and 71% and 89% for scintigraphy, respectively. the same study additionally assessed the use of magnetic resonance imaging (mri) both as the only diagnostic method as well as in combination with scintigraphy and ultrasound in a small group of patients. no advantage of mri / scintigraphy and/or mri / ultrasound study protocols over ultrasound / scintigraphy protocol was shown. the retrospective part of the cited study assessed the sensitivity and specificity of computed tomography, and lower values were obtained. in the same year, casara. focal lesions of the parathyroid glands in the course of ph were correctly localized in 20 of 21 patients (95.2%) assessed prior to a minimally invasive surgery. a combined use of both imaging techniques is recommended by ozkaya. in one of the latest papers in the subject, based on the fact that such management allows to achieve more than 90% accuracy and equally high positive predictive value. the efficacy of combined use of spect / ct and ultrasound was assessed by patel. according to the authors, ultrasound allowed for a correct detection of 64% of lesions, whereas spect / ct for 90% of lesions. the sensitivity and specificity for both methods were up to 95% and 91%, respectively. an interesting suggestion, reflecting the tendency towards a combined interpretation of both methods, was made by bluemla. however, the assessment of this type of management requires further research in larger groups of patients to compare the method against the existing standards. when analyzing the developmental trends in the diagnostic imaging in ph patients, innovative studies in the field of nuclear medicine assessing the efficacy of novel radiopharmaceuticals, particularly those used in the positron emission tomography / computed tomography (pet / ct), are worth noting. in the recent years, high hopes have been associated with the use of f - fluorocholine and c - methionine. particularly promising observations were presented by michaud., who evaluated the outcomes of pet / ct using f - fluorocholine. in a group of 12 patients with inconclusive usg and/or scintigraphy outcomes, the sensitivity of pet / ct was 89%, with 2 false - positive tests and 1 false - negative test.. showed in their study including 24 patients that the sensitivity and specificity of pet / ct using f - fluorocholine were 92% and 100%, respectively. less optimistic conclusions were drawn by the investigators assessing the efficacy of c - methionine. hayakawa. showed no significant differences in sensitivity between spect / ct using tc - sestamibi and pet using c - methionine. the same method was assessed in a group of 15 patients with negative spect / ct by traub - weidinger. showed a decreased sensitivity of this method for the detection of parathyroid adenomas compared to usg and scintigraphy in their retrospective analysis. the efficacy of innovative technologies that could increase the imaging quality was also assessed in the field of ultrasonography. the first study assessing focal lesions of the parathyroid glands using real - time elastography ultrasound technique was published in 2012. a total of 72 patients with adenomas or hyperplasia in the course of primary, secondary or tertiary hyperparathyroidism were enrolled in the study. also, statistically significantly lower deformability was shown in this group compared to patients with parathyroid hyperplasia (fig. iwona sudo - szopiska md, phd, katarzyna dobruch - sobczak md, phd., rafa sapa md, phd in 2014, agha. showed a very high, more than 95% sensitivity of contrast ultrasound in the detection of parathyroid adenomas. particular attention should be paid to an attempt of a simultaneous use of ultrasounds as both diagnostic and therapeutic method. kovatcheva. described the use of ultrasound (us)-guided high - intensity focused ultrasound (hifu) as a method for simultaneous parathyroid adenoma detection and treatment. the authors achieved a complete remission in 23% and a good disease control in 69% of patients. day. achieved 89% sensitivity in detecting parathyroid focal lesions which could not be identified using ultrasound or scintigraphy. pet / mri and magnetic resonance using hyperpolarized contrast agents are highly innovative diagnostic methods, which rapidly gain new applications. unfortunately, the lack of studies evaluating their in vivo utility prevents the assessment of their diagnostic value compared to other imaging techniques used in ph patient diagnostics. the authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication. | primary hyperparathyroidism (ph) represents one of the most common endocrine diseases. in most cases, the disorder is caused by parathyroid adenomas. bilateral neck exploration has been a widely used treatment method for adenomas since the 20 's of the twentieth century. in the last decade, however, it has been increasingly replaced by a minimally invasive surgical treatment. smaller extent, shorter duration and lower complication rate of such a procedure are emphasized. its efficacy depends on a precise location of parathyroid tissue during the preoperative imaging. scintigraphy and ultrasound play a major role in the diagnostic algorithms. the efficacy of both methods has been repeatedly verified and compared. the still - current guidelines of the european association of nuclear medicine (2009) emphasize the complementary role of scintigraphy and ultrasonography in the preoperative diagnostics in patients with primary hyperparathyroidism. at the same time, attempts are made to improve both these techniques by implementing new study protocols or innovative technologies. publications have emerged in the recent years in the field of ultrasonography, whose authors pointed out the usefulness of elastography and contrast media. nuclear medicine studies, on the other hand, focus mainly on the assessment of new radiotracers used in the positron emission tomography (pet). the aim of this article is to present, based on literature data, the possibilities of ultrasound and scintigraphy in the preoperative diagnostics in patients with primary hyperparathyroidism. furthermore, the main directions in the development of imaging techniques in ph patients were evaluated. |
the potential benefits for clinical pathology of adopting well - designed digital technologies have been solidly established. essentially, there are strong arguments pointing to improved patient care and more efficient care pathways in the digital era. the reality, however, often is that the path toward realizing this potential is not straightforward. the clinical adoption is multi - faceted and for each domain, customized solutions may be required. there are many efforts around the world aiming to pave the way for digital pathology into routine clinical use, and a particular concentration of development work is happening in the nordic countries (sweden, denmark, norway, finland, and iceland). for example, full histology scanning and extensive digital primary review are a reality since several years in the hospitals of linkping and kalmar. recently, gvle hospital started a digital review for parts of the clinical routine, and concrete implementation plans are being carried out in many more institutions. the nordic symposium on digital pathology (ndp) was created in 2013 to promote global exchange of state - of - the - art knowledge, taking advantage of this nordic digital greenhouse. the specific focus of ndp is advancing toward the clinical adoption of whole - slide imaging (wsi) and other digital technologies in pathology. in particular, a founding principle is the insight that effective progress requires strong collaboration among health care, industry, and academia, and ndp is designed to be a forum where professionals from all these domains can meet. this third installment of ndp marks a continued evolution from the two previous events in 2013 and 2014, in terms of participant numbers (190 compared to 125 and 144, respectively) and depth of issues discussed. below we provide a summary of ndp 2015, in the form of a meeting overview, results from the symposium 's validation workshop, speaker contributions, and finally brief conclusions. a total of 190 attendees gathered, of which 43% listed health care as the primary affiliation, 40% industry, and 16% academia. the health care representatives were dominated by pathologists, but also managers, laboratory technologists, and it staff were in significant numbers. the participants represented 15 different countries with the nordic attendees making up the majority (82%), but less so than in the 2014 symposium (87%). invited talks constituted the backbone of the program, together with a collaborative workshop on validation aspects of digital pathology. the contents of these sessions will be outlined in the sections below. in the science and innovation session, this resulted in three jpi papers published alongside this editorial : consultation of urological specimens using real - time digital microscopy : optimizing the workflow for referred cancer patients (henrik holten - rossing.), improving the creation and reporting of structured findings during digital pathology review (ida cervin.), and feature - based analysis of mouse prostatic intraepithelial neoplasia in histological tissue sections (pekka ruusuvuori.). in addition, the ndp included an industrial exhibition consisting of 13 vendors, showing a wide range of products and services related to digital pathology operations. figure 1 shows a snapshot from the symposium, and the program details are available at the ndp website www.ndp2015.se. the nordic symposium on digital pathology 2015 audience gathered for the keynote presentation of prof paul j. van diest a key part of the ndp program was the workshop discussing validation of digital pathology. the workshop was organized as an open floor discussion with broad participation from the attendees. as an introduction, a systematic review of previous digital pathology validation research was presented by bethany williams, leeds university. moreover, a survey among the health care attendees themselves, distributed in advance of the symposium, served as fuel for debate. it is important to acknowledge that the survey respondents represent a biased selection among the pathology community. since only ndp participants were asked, this means that respondents are likely to be among the most positive to digital pathology and also among the most experienced. there is also a strong geographical dominance from the nordics and, in particular, sweden. of 83 it is likely that the pathologist dominance was even higher for some questions that require deep knowledge of clinical practice. role distribution of survey respondents the survey first asked : today, to what degree do you use digital images of histology slides in your practice ? the results are shown in figure 3, showing moderate levels of adoption but no use in about 50% of respondents. (another bias to note for these questions is that several people from the same institution may have responded). current use of digital pathology among survey respondents the same question was asked for the predicted situation at the end of 2016. as the 2016 prediction was also asked in the ndp2014 survey, as in the previous year, a vast majority expects to soon do digital to some degree, but the difference in predicted adoption rate indicates that the plans for digitization are progressing slightly slower than anticipated. this development pace moderation is in line with reports from the symposium attendees that both funding allotment and procurement processes are causing delays in their digitization efforts. predicted use of digital pathology for primary review at the end of 2016. right : prediction from nordic symposium on digital pathology 2015 survey validation of digital pathology means controlling potential risks of the digitization step, i.e., scanning and reproduction on a computer screen. in the college of american pathologists (cap) guidelines, wsi validation is defined as a process that aims to demonstrate that the new method performs as expected for its intended use and environment prior to its application for patient care. an important aspect is to decide on an acceptable level of risk. while it is attractive to adopt zero tolerance for errors due to digitization, this may lead to an unbalanced distribution of efforts. if the risks in other parts of the diagnostic chain are much larger than the ones in the digitization step, the mitigation and control efforts in those areas should come first. therefore, to understand the perceived relative risk of digitization, the survey asked : compared with other parts of the sample preparation and diagnostic process, how big do you think the added safety risk of the digitization step is ? the results, presented in figure 5, show that health care ndp attendees clearly consider the added risk from digitization to be smaller than risks in the diagnostic review, staining, sectioning, and grossing steps. perceived added safety risk from digitization (scanning and image reproduction on screen) relative to risks stemming from other parts of the diagnostic pipeline. overall, the results point to lower perceived risk, i.e., that digitization is perceived as less error - prone there is an ongoing debate in the community regarding what type or scale of validation that is needed before adoption of digital pathology in diagnosis. to elicit the overall opinion, the survey asked : what 's your personal view on the need for validation efforts to increase the confidence for digital pathology in clinical practice ? for this group having substantial experience of clinical use of wsi, the dominant view (68%) is that current knowledge is sufficient for going ahead with digital pathology adoption and that further validation is characterized as a continuous improvement effort. this may again reflect the high proportion of early adopters in the audience. as seen in figure 6, the majority sees further validation as a part of continued progress, but not as prohibitive for adoption in general validation can be performed, documented, and disseminated in many ways and by several types of stakeholders. as the decision to adopt digital pathology often boils down to the conviction of individuals, it is interesting to know which sources of safety assurance that have the highest credibility. the survey asked : assurance that digital pathology is safe for clinical use can come from many sources. for your own decision, if digital pathology is safe, how much confidence would you get from the following sources ? the results in figure 7 show that personal experience along with high - quality scientific trials is associated with the highest confidence, whereas ce marking and food and drug administration approval of systems are less assuring, relatively. personal experience and high - quality trials are considered the most trustworthy sources after the survey results were presented, a guided discussion among all participants took place. overall, the points of view shared demonstrated the many facets of validation to consider. a fundamental prerequisite is that digital pathology does introduce new process steps that need to be scrutinized : the image digitization and the visualization (display and interaction) in a digital workstation. there are now many concordance studies showing reassuring overall results. at the same time, potential concerns are that there are few well - designed large studies to date and that despite high overall concordance with light microscopy, this may conceal the possibility that for some case types, digitization might introduce problems not existing in microscope glass slide review. in line with the first statement of the cap guidelines, ndp attendees expressed the need for validation activities at each individual laboratory implementing wsi. in this preliminary stage, no clear consensus on scope and depth of such activities emerged from the discussion, but ongoing initiatives in sweden and the united kingdom are directed toward developing concrete support for validation work. another aspect voiced was that even if agreeing that digital pathology adds a slight risk, this should be compared to the risk of nonadoption. for example, an increased risk may be acceptable if the benefits of increased reproducibility or easier consultations across the healthcare enterprise clearly outweigh any additional risk. a positive effect of the validation effort of digital pathology can also be that components of current practice, actually having evolved with a low level of scrutiny, are revisited with a critical eye. the conclusion from the discussion is that there is a broad consensus in this group that continued efforts to scrutinize digital pathology are needed, whereas the views differ as to what degree this affects the pace of adoption. paul j. van diest, professor and head of pathology at the university medical center utrecht, the netherlands, presented their digital pathology program, including both past efforts and future plans. the experience includes many years of scanning all slides, working integration with their report system, and validation efforts with positive results. currently, utrecht is implementing new systems and workflows to take the step to digital primary review, and prof. van diest emphasized the need for establishing a solid and continuous change management process in the department, in contrast to a one - off implementation activity. nasir rajpoot, associate professor at qatar university, qatar, and university of warwick, uk, gave a comprehensive overview of opportunities and challenges in image analysis for pathology. he presented a wide range of methods developed in his research groups constituting a toolbox for detection and classification on several levels : nucleus, cell, gland, and entire tissue. rajpoot also stressed the benefits of an open exchange of methods and data for the scientific community to effectively make advances in the field. petra lindstedt, former head of the diagnostic division at region gvleborg, sweden, spoke to the benefits that had been the main motivation for their decision to go fully digital, a process now underway with several pathologists doing their main primary review on digital slides. a benefit particular to smaller, rural hospitals is that a digital environment opens new possibilities for specialist careers based on a consultation volume from other providers. johnny eriksson, cto at telemedicine clinic, spain, and cto radiology it at the university hospital rebro county, sweden, described the opportunities stemming from enterprise - wide digital image management. the experience from radiology, including services such as running off - hour diagnostic routine for european hospitals from australia, demonstrates the potential but also the need to assiduously address the technical challenges involved. anna bodn, pathologist and digitization project manager at linkping university hospital, sweden, presented the experiences from implementing a second generation of large - scale digital pathology in their clinic. issues given increased consideration this time around included achieving highly stable and fast viewing, running scanners from multiple vendors in parallel, careful selection of monitors, and support for large slides. manuel salto - tellez, professor and molecular pathologist at queen 's university belfast, uk, provided a compelling vision of improved health care, thanks to advances within reach for joint efforts in pathology and genomics. several examples of such efforts from his research group were presented, including testing for braf, kras, and egfr mutations in cancer. salto - tellez strongly emphasized the need for effectively combining the two disciplines of molecular and digital pathology, since the genomic findings require a context of phenotype and morphometry. andr homeyer, scientist at the fraunhofer mevis research institute in bremen, germany, presented their group 's software framework for image analysis in pathology. key objectives are to exploit image features across several scales and to meet high interactivity requirements by carefully designed feature extraction in the preprocessing stage. simon hger of sectra, linkping, sweden, talked about how to construct a business case for digital pathology. yee - wah tsang from coventry university, uk, presented the large validation study recently performed in coventry. visiopharm arranged a talk from henrik holten - rossing from rigshospitalet copenhagen, denmark, presenting studies and experiences of advanced quantitative image analysis. finally, a special session on education and collegial exchange was held, led by dr. mats wolving, head of quality development at the swedish society of pathology and pathologist at sahlgrenska university hospital, gothenburg, sweden, and martin svenson of sectra. they presented ongoing innovation efforts to develop new tools and workflows in this domain, and the audience contributed in an enlightening discussion regarding possibilities and obstacles with regards to this area of clinical practice. a key part of the ndp program was the workshop discussing validation of digital pathology. the workshop was organized as an open floor discussion with broad participation from the attendees. as an introduction, a systematic review of previous digital pathology validation research was presented by bethany williams, leeds university. moreover, a survey among the health care attendees themselves, distributed in advance of the symposium, served as fuel for debate. it is important to acknowledge that the survey respondents represent a biased selection among the pathology community. since only ndp participants were asked, this means that respondents are likely to be among the most positive to digital pathology and also among the most experienced. there is also a strong geographical dominance from the nordics and, in particular, sweden. it is likely that the pathologist dominance was even higher for some questions that require deep knowledge of clinical practice. role distribution of survey respondents the survey first asked : today, to what degree do you use digital images of histology slides in your practice ? (in percentage of all histology cases). the results are shown in figure 3, showing moderate levels of adoption but no use in about 50% of respondents. (another bias to note for these questions is that several people from the same institution may have responded). current use of digital pathology among survey respondents the same question was asked for the predicted situation at the end of 2016. as the 2016 prediction was also asked in the ndp2014 survey,, a vast majority expects to soon do digital to some degree, but the difference in predicted adoption rate indicates that the plans for digitization are progressing slightly slower than anticipated. this development pace moderation is in line with reports from the symposium attendees that both funding allotment and procurement processes are causing delays in their digitization efforts. predicted use of digital pathology for primary review at the end of 2016. right : prediction from nordic symposium on digital pathology 2015 survey validation of digital pathology means controlling potential risks of the digitization step, i.e., scanning and reproduction on a computer screen. in the college of american pathologists (cap) guidelines, wsi validation is defined as a process that aims to demonstrate that the new method performs as expected for its intended use and environment prior to its application for patient care. while it is attractive to adopt zero tolerance for errors due to digitization, this may lead to an unbalanced distribution of efforts. if the risks in other parts of the diagnostic chain are much larger than the ones in the digitization step, the mitigation and control efforts in those areas should come first. therefore, to understand the perceived relative risk of digitization, the survey asked : compared with other parts of the sample preparation and diagnostic process, how big do you think the added safety risk of the digitization step is ? the results, presented in figure 5, show that health care ndp attendees clearly consider the added risk from digitization to be smaller than risks in the diagnostic review, staining, sectioning, and grossing steps. perceived added safety risk from digitization (scanning and image reproduction on screen) relative to risks stemming from other parts of the diagnostic pipeline. overall, the results point to lower perceived risk, i.e., that digitization is perceived as less error - prone there is an ongoing debate in the community regarding what type or scale of validation that is needed before adoption of digital pathology in diagnosis. to elicit the overall opinion, what 's your personal view on the need for validation efforts to increase the confidence for digital pathology in clinical practice ? for this group having substantial experience of clinical use of wsi, the dominant view (68%) is that current knowledge is sufficient for going ahead with digital pathology adoption and that further validation is characterized as a continuous improvement effort. as seen in figure 6, about 20% are more hesitant and require further validation as a condition for adoption. the majority sees further validation as a part of continued progress, but not as prohibitive for adoption in general validation can be performed, documented, and disseminated in many ways and by several types of stakeholders. as the decision to adopt digital pathology often boils down to the conviction of individuals, it is interesting to know which sources of safety assurance that have the highest credibility. the survey asked : assurance that digital pathology is safe for clinical use can come from many sources. for your own decision, if digital pathology is safe, how much confidence would you get from the following sources ? the results in figure 7 show that personal experience along with high - quality scientific trials is associated with the highest confidence, whereas ce marking and food and drug administration approval of systems are less assuring, relatively. personal experience and high - quality trials are considered the most trustworthy sources after the survey results were presented, a guided discussion among all participants took place. overall, the points of view shared demonstrated the many facets of validation to consider. a fundamental prerequisite is that digital pathology does introduce new process steps that need to be scrutinized : the image digitization and the visualization (display and interaction) in a digital workstation. there are now many concordance studies showing reassuring overall results. at the same time, potential concerns are that there are few well - designed large studies to date and that despite high overall concordance with light microscopy, this may conceal the possibility that for some case types, digitization might introduce problems not existing in microscope glass slide review. in line with the first statement of the cap guidelines, ndp attendees expressed the need for validation activities at each individual laboratory implementing wsi. in this preliminary stage, no clear consensus on scope and depth of such activities emerged from the discussion, but ongoing initiatives in sweden and the united kingdom are directed toward developing concrete support for validation work. another aspect voiced was that even if agreeing that digital pathology adds a slight risk, this should be compared to the risk of nonadoption. for example, an increased risk may be acceptable if the benefits of increased reproducibility or easier consultations across the healthcare enterprise clearly outweigh any additional risk. a positive effect of the validation effort of digital pathology can also be that components of current practice, actually having evolved with a low level of scrutiny, are revisited with a critical eye. the conclusion from the discussion is that there is a broad consensus in this group that continued efforts to scrutinize digital pathology are needed, whereas the views differ as to what degree this affects the pace of adoption. paul j. van diest, professor and head of pathology at the university medical center utrecht, the netherlands, presented their digital pathology program, including both past efforts and future plans. the experience includes many years of scanning all slides, working integration with their report system, and validation efforts with positive results. currently, utrecht is implementing new systems and workflows to take the step to digital primary review, and prof. van diest emphasized the need for establishing a solid and continuous change management process in the department, in contrast to a one - off implementation activity. nasir rajpoot, associate professor at qatar university, qatar, and university of warwick, uk, gave a comprehensive overview of opportunities and challenges in image analysis for pathology. he presented a wide range of methods developed in his research groups constituting a toolbox for detection and classification on several levels : nucleus, cell, gland, and entire tissue. dr. rajpoot also stressed the benefits of an open exchange of methods and data for the scientific community to effectively make advances in the field. petra lindstedt, former head of the diagnostic division at region gvleborg, sweden, spoke to the benefits that had been the main motivation for their decision to go fully digital, a process now underway with several pathologists doing their main primary review on digital slides. a benefit particular to smaller, rural hospitals is that a digital environment opens new possibilities for specialist careers based on a consultation volume from other providers. johnny eriksson, cto at telemedicine clinic, spain, and cto radiology it at the university hospital rebro county, sweden, described the opportunities stemming from enterprise - wide digital image management. the experience from radiology, including services such as running off - hour diagnostic routine for european hospitals from australia, demonstrates the potential but also the need to assiduously address the technical challenges involved. anna bodn, pathologist and digitization project manager at linkping university hospital, sweden, presented the experiences from implementing a second generation of large - scale digital pathology in their clinic. issues given increased consideration this time around included achieving highly stable and fast viewing, running scanners from multiple vendors in parallel, careful selection of monitors, and support for large slides. manuel salto - tellez, professor and molecular pathologist at queen 's university belfast, uk, provided a compelling vision of improved health care, thanks to advances within reach for joint efforts in pathology and genomics. several examples of such efforts from his research group were presented, including testing for braf, kras, and egfr mutations in cancer. salto - tellez strongly emphasized the need for effectively combining the two disciplines of molecular and digital pathology, since the genomic findings require a context of phenotype and morphometry. andr homeyer, scientist at the fraunhofer mevis research institute in bremen, germany, presented their group 's software framework for image analysis in pathology. key objectives are to exploit image features across several scales and to meet high interactivity requirements by carefully designed feature extraction in the preprocessing stage. simon hger of sectra, linkping, sweden, talked about how to construct a business case for digital pathology. yee - wah tsang from coventry university, uk, presented the large validation study recently performed in coventry. visiopharm arranged a talk from henrik holten - rossing from rigshospitalet copenhagen, denmark, presenting studies and experiences of advanced quantitative image analysis. finally, a special session on education and collegial exchange was held, led by dr. mats wolving, head of quality development at the swedish society of pathology and pathologist at sahlgrenska university hospital, gothenburg, sweden, and martin svenson of sectra. they presented ongoing innovation efforts to develop new tools and workflows in this domain, and the audience contributed in an enlightening discussion regarding possibilities and obstacles with regards to this area of clinical practice. the need for, and interest in, knowledge exchange with regards to the clinical routine use of wsi and related it tools continues to be strong, as demonstrated by the increasing attendance at this third installment of the ndp. as digital pathology evolves and initial hurdles are managed, the symposium touched on many topics of digital pathology, some of which are growing in importance with increased digital maturity. the feedback from the attendees is that this type of experience sharing across organizations, disciplines, and sectors is important for the progress in the field. as organizers, we are happy to conclude that ndp 2015 has made a substantial contribution to this end. finally, we gladly note the increasing ratio of non - nordic attendees and encourage colleagues from all over the world to come and benefit from future ndp symposia. darren treanor is a member of the aperio / leica advisory board and sectra advisory board. darren treanor is a member of the aperio / leica advisory board and sectra advisory board. | cross - disciplinary and cross - sectorial collaboration is a key success factor for turning the promise of digital pathology into actual clinical benefits. the nordic symposium on digital pathology (ndp) was created to promote knowledge exchange in this area, among stakeholders in health care, industry, and academia. this article is a summary of the third ndp symposium in linkping, sweden. the nordic experiences, including several hospitals using whole - slide imaging for substantial parts of their primary reviews, formed a fertile base for discussions among the 190 ndp attendees originating from 15 different countries. this summary also contains results from a survey on adoption and validation aspects of clinical digital pathology use. |
transforming growth factor beta (tgf - beta), a multifunctional cytokine and growth factor, plays a key role in scarring and fibrotic processes because of its ability to induce extracellular matrix proteins and modulate the growth and immune function of many cell types. these effects are important in inflammatory disorders with fibrosis and cancer. the asbestos - related diseases are characterized by fibrosis in the lower respiratory tract and pleura and increased occurrence of lung cancer and mesothelioma. we performed immunohistochemistry with isoform - specific antibodies to the three tgf - beta isoforms on 16 autopsy lungs from quebec, canada, asbestos miners and millers. there was increased immunolocalization of all three tgf - beta isoforms in the fibrotic lesions of asbestosis and pleural fibrosis. the hyperplastic type ii pneumocytes contained all three isoforms. by contrast, there was differential spatial immunostaining for the tgf - beta isoforms in malignant mesothelioma, with tgf - beta 1 in the stroma but tgf - beta 2 in the tumor cells. these data are consistent with an important role for tgf - beta in accumulation of extracellular matrix and cell proliferation in asbestos - related diseases.imagesfigure 1.figure 2.figure 3.figure 4.figure 5.figure 6.figure 7.figure 8.figure 9. |
|
gallstones ileus is defined as mechanical intestinal obstruction caused by a large gallstone lodged in the bowel lumen. this condition accounts for only 1% of case with small bowel obstructions and 2% of patients with gallstone disease. it is uncommon but it is seen most often in women and the elderly population which accounts for up to 20% in the latter group. the pathophysiology of gallstone ileus is related to the formation of cholecystoenteric fistula which allows gallstones to enter the intestinal lumen. most (75%) of these fistulas develop between the gallbladder and duodenum, although it is possible that the gallstone gains entry to the duodenum via a fistula with the biliary tract. patients with gallstone ileus may have a history of gallbladder - related symptoms without previous surgery or hernia on physical examination. they usually present with acute intestinal obstruction, either partial or complete, depending on the size of the stone. classically, the stones are almost always 2.5 cm or more in diameter and can be found impacted at about 60 cm proximal to ileocaecal valve. abdominal radiograph findings include dilated small bowel, the presence of gas in the biliary system (pneumobilia), and a gallstone in the right iliac fossa. although pneumobilia is one of the radiological features of gallstones ileus, other conditions may also demonstrate this finding, including incompetent sphincter of oddi, infection of the gallbladder (emphysematous cholecystitis), and rarely gallbladder cancer and blunt trauma. the initial management of gallstone ileus is to relieve the bowel obstruction by performing a small enterotomy. the bowel is also inspected for any evidence of ischemic bowel with resection of any infracted segments. in patients who can tolerate it, cholecystectomy is also performed at the same time as the enterotomy. an 82-year - old woman presented to the emergency department with a 1 week history of vomiting, mild abdominal discomfort, and absolute constipation. the latter was preceded by gradual worsening of bile - stained non - projectile vomiting. she was a non - smoker and denied recent alcohol consumption. on physical examination, she was apyrexial, pulse rate was 78 beats per minute, blood pressure was 110/60 mmhg, and respiratory rate was 25 breaths per minute. her abdomen was soft and non - distended, but there was mild generalized tenderness elicited on palpation. laboratory tests were as follows : white blood cells, 16.55 10/l ; hb, 14.1 g / dl ; platelet, 387 10/l 10/l ; na, 118 mmol / l ; k, 2.8 mmol / l ; urea, 16.1 mmol / l ; creatinine, 101 mmol / l ; bilirubin (total), 18 mol / l ; alkaline phosphatase, 72 iu / l ; and amylase, 69 iu / l. the arterial blood gas measurement suggested a hypochloremic metabolic alkalosis (ph 7.55, pco2 6.17 kpa, bicarbonate 39.5 mmol / l, chloride 68 mmol / l, and lactate 1.7 mmol / l). urine dipstick was negative for glucose, bilirubin, ketone, blood, protein, nitrates, and leukocytes. an erect chest radiograph was normal with no evidence of subdiaphragmatic air [figure 1 ]. abdominal radiograph showed dilated small bowel loop in the central of abdomen [figure 2 ]. for a detailed evaluation of the level of bowel obstruction, a contrast computed tomography (ct) of the abdomen and pelvis was requested. ct examination of the abdomen and pelvis showed findings consistent with proximal small bowel obstruction, pneumobilia located in the right hepatic lobe [figure 3 ], and a gallstone in the distal small bowel [figure 4 ]. an erect chest radiograph : no evidence of air beneath the diaphragm abdominal radiograph : central, dilated loops of small bowel (white arrow). note the plicae circulares or valvulae conniventes (yellow arrow), a feature of small bowel, which confirms that the dilated structure is small bowel. there is no gas within the large bowel suggesting a complete or nearly complete mechanical small bowel obstruction axial ct image of the upper abdomen : there is diffuse pneumobilia (black arrow) axial ct image of the pelvis : there is a calculus (white arrow) identified within the small bowel lumen. note the presence of both dilated and non - dilated small bowel after initial fluid resuscitation with 0.9% sodium chloride, correction of electrolyte imbalance, and nasogastric decompression, the patient underwent midline laparotomy. numerous small bowel stones [figure 5 ] of variable size were milked distally. the largest stone measured 3.5 cm in diameter was retrieved from the small bowel lumen [figure 6 ]. each section of the bowels was inspected in a segmental fashion for sign of ischemia and other intra - luminal faceted gallstones. an abdominal washout was performed using warm saline in order to prevent gross peritoneal contamination. the abdominal incision was closed by a mass closure technique using an absorbable loop maxon suture and staples to the skin. the pathophysiology of formation of a fistula is associated with chronic inflammation of the gallbladder. a typical history of gallstone ileus is an intermittent and episodic abdominal complaint as the calculus passes down the intestinal tract. diagnosis of this rare condition should be suspected in the elderly who presented with symptoms and sign of bowel obstruction without a history of previous abdominal surgery or hernia on physical examination. a plain abdominal radiograph may show dilatation of small bowel (small bowel obstruction), air in the biliary tree (pneumobilia), and opacity in the right iliac fossa (ectopic gallstone). the feature of small bowel obstruction, pneumobilia, and ectopic gallstone represents rigler 's triad which is consistent with a diagnosis of gallstone ileus. the triad presents only 14.81% on plain film of the abdomen, 11.11% on abdominal sonography, and 77.78% on abdominal ct scan. this is not surprising because plain abdominal radiograph reveals radio opaque gallstones in only 10% of cases. in the latter study, it was shown that pneumobilia can be detected up to 89% of all cases of gallstone ileus. in the past, plain abdominal radiography and ultrasound are helpful in diagnosing gallstone ileus but the sensitivity of both modalities is low. ct scan is the investigation of choice for evaluating gallstone ileus as it has high sensitivity (93%) and specificity (100%). a ct scan can accurately measure the size of the gallstone and establish the anatomical site and the nature of the obstruction. therefore, ct scan is usually a preferred diagnostic modality because of its high resolution in detecting gallstones and provides details of anatomical localization of the gallstone and fistula. sensitivity and specificity of different modalities in diagnosing gallstone ileus the initial management of gallstone ileus is to relieve the obstruction by removing the gallstone through a proximal enterotomy. spontaneous resolution of symptoms of gallstone ileus has been reported but uncommon. at present the choice of a one - stage or two - stage surgical procedure or enterotomy alone is still debatable. the reported mortality rates of gallstone ileus are generally consistent at about 20% for the first time ileus presentation and at subsequent recurrent episodes. most of the retrospective studies conducted so far suggested that higher mortality rates were observed in the one - stage procedure [table 2 ]. to date, the largest single published review of this condition, by reisner and cohen found that one - stage procedure carries higher risk of mortality compared to simple enterotomy. associated factors of a higher mortality rate may attribute to : (1) pre - operatively, (2) intra - operatively, and (3) post - operatively. first, pre - operatively : elderly patients with poor general medical conditions, delayed diagnosis, and prompt treatment of this uncommon condition as well as inadequate physiological state optimization pre - operatively prior to the time of emergency laparotomy may result in a poorer surgical outcome. second, intra - operatively : longer operating time for the one - stage procedure may lead to higher mortality. third, post - operatively : deaths may not be related to the surgery, for example, myocardial infarction or pulmonary embolism. comparison of mortality rates of two main surgical approaches in treating gallstone ileus, one - stage and two - stage procedure in this brief report, we compared mortality rates of the two main surgical approaches, one - stage procedure (comprising enterotomy, cholecystectomy, and fistula repair) and two - stage procedure (enterotomy with or without subsequent cholecystectomy and fistula repair). there is no general consensus on gold standard surgical intervention and the controversy of these is still remaining arguable. of all selected 13 studies that provide adequate data comparing mortality rates in one - stage and two - stage procedures, we found a higher mortality rate in one - stage procedure (16.8%) compared to two - stage procedure (11.8%). surprisingly, the results from these collective studies are similar to the previously reported data by reisner and cohen. a majority of the studies observed higher mortality rates in one - stage procedure except deitz. the author observed a higher mortality rate in two - stage procedure (16.7%). pavlidis., selectively performed two - stage operation for all patients with american society of anesthesiologists (asa) score three or more. he concluded that two - stage procedure should be performed in patients with unfavorable asa score. one can argue that laparoscopy increases operative time of the surgery due to technical difficulty finding the gallstone and requires specialist trained surgeons. on the other hand, laparoscopy inflicts less operative trauma on the patient, which may result in less morbidity and mortality. some recent reports have been published on the efficacy of the laparoscopic approach in the management of gallstone ileus. to date, there are five studies regarding the use of laparoscopy in the treatment of gallstone ileus. these reports demonstrate that laparoscopy is effective in both diagnosis and treatment of gallstone ileus. the number of patients in each study is small ; therefore, we do not have enough clinical data to allow comparison between one - stage and two - stage procedures performed laparoscopically. therefore, a prompt diagnosis followed by urgent optimization of patient prior to appropriate surgical intervention is essential. a two - stage procedure should be considered in all elderly patients with significant co - morbidities. a one - stage procedure, on the other hand, should be reserved for young, fit, and low - risk patient with a favorable asa score. | gallstones ileus is an uncommon cause but important cause of small bowel obstruction. the gallstone enters the intestinal lumen via a fistula located in the duodenum (cholecystoduodenal), or rarely, in the colon (cholecystocolonic) or stomach (cholecystogastric). this may result in large bowel or gastric outlet obstruction (bouveret 's syndrome). gallstone ileus affects the elderly females pre - dominantly and is associated with a high morbidity and mortality rate if diagnosis and urgent surgical intervention are delayed. in this paper, we report on the case of an elderly lady who presented with classical symptoms and signs of small bowel obstruction. she was subsequently diagnosed with gallstone ileus due to a large gallstones lodged in the intestinal lumen. we perform a literature review on this rare disease and discuss the two main surgical approaches in managing this condition. gallstone ileus should be considered in the differential diagnosis of small bowel obstruction especially in elderly women who have no history of abdominal surgery or abdominal hernia. early intervention is important because of the high mortality rate due to the poor general condition that often exists in this subgroup of patients. there is no general consensus on gold standard surgical approach in these cases but a two - stage procedure (either enterotomy alone or enterotomy and subsequent cholecystectomy) has been shown to be associated with lower mortality rates. |
this prospective cohort study was approved by the institutional review board of chang gung memorial hospital. patients with ra aged 20 to 70 years who were approved by the bureau of national health insurance for tnf- therapy were included. the hand radiographs were collected and evaluated blindly in chronological order, using the criteria from sharp score modified by van der heijde. for each patient, an erosion score, a joint - narrowing score, and a total radiographic score the radiographs were scored in random order by an experienced observer (shih - wei hsu) without knowledge of the clinical data. the ultrasound scans were scored in random order by an experienced observer (jia - feng chen) without knowledge of the clinical data. each patient underwent a musculoskeletal systematic multiplanar grayscale and power doppler ultrasound examination using a mylab 70 (esaote, firenze, italy) system equipped with a multifrequency linear array transducer (618 mhz). the b - mode frequency ranged from 12 to 18 mhz for second and third mcp joint, and the power doppler pulse repetition frequency was 750 hz with a doppler frequency of 6.7 to 11.1 mhz, and low wall filters were used. at the beginning of each scanning session at different sites, the focus was positioned at the level of the region of interest. color gain was adjusted just below the degree that caused the appearance of noise artefacts. the color box was positioned at the level of the assessed site, and enlarged to the upper part of the image. the ultrasound assessments included elbow (anterior recess, posterior recess), wrist (dorsal, ulnar, and palm side), second mcp (dorsal side, palmar side), third mcp (dorsal side, palmar side), second pip (dorsal side, palmar side), and third pip joint (dorsal side, palmar side) (table 1). the joints presently assessed and the scans used for the semiquantitative scoring (03) of b - mode and power doppler ultrasonography grayscale synovitis was graded from 0 to 3 based on the system of szkudlarek and colleagues, with the equivocal minimal thickening graded as follows : grade 0, normal ; grade 1, synovial thickening bulging over the line linking the tops of the periarticular bones ; grade 2, grade 1 plus extension to 1 bone diaphysis ; grade 3, grade 1 plus extension to both bone diaphyses. synovitis in other joints was graded 0 to 3 as follows : 0, normal ; 1, mild ; 2, moderate ; and 3, severe, in which grade 1 was defined as synovial thickening in excess of the mean plus 2 standard deviations of reference range when available. synovial hyperemia was measured by power doppler in each recess, and the maximal score was graded according to szkudlarek : 0, absence ; 1, isolated signals ; 2, confluent signals in less than half of the synovial area ; and 3, confluent signals in more than half of the synovial area. global ultrasound indices for grayscale synovitis and power doppler were calculated by adding the scores from all joints. ultrasound scans were performed before and at 1, 3 months after anti - tnf therapy. the relationship between ultrasound activity and progression of radiological joint damage the progression of 5 points during the 1 year of follow - up was defined as progression. intraobserver reliability was evaluated before patients ' inclusion by scoring for synovitis and pd signal in 20 recorded images of the joints included in the grayscale and pdus assessment from 20 patients with active ra, by the investigator who coordinated the study (jia - feng chen). repeated measures analysis of variance was used to analyze the serial changes in ultrasound score. intrarater reliabilities were evaluated using a 2-way mixed effects model using a consistency definition, in which the between - measure variance is excluded from the denominator variance, and both single measure and average measure intraclass correlation coefficients (iccs) were calculated for total scores of both grayscale synovitis and pdus. in addition, weighted values were calculated on a joint - by - joint level for both bm and pdus scores. intraclass correlation coefficient values and values are comparable ; scores above 0.60 are considered good and scores above 0.80 are very good. intraobserver reliability was evaluated before patients ' inclusion by scoring for synovitis and pd signal in 20 recorded images of the joints included in the grayscale and pdus assessment from 20 patients with active ra, by the investigator who coordinated the study (jia - feng chen). repeated measures analysis of variance was used to analyze the serial changes in ultrasound score. intrarater reliabilities were evaluated using a 2-way mixed effects model using a consistency definition, in which the between - measure variance is excluded from the denominator variance, and both single measure and average measure intraclass correlation coefficients (iccs) were calculated for total scores of both grayscale synovitis and pdus. in addition, weighted values were calculated on a joint - by - joint level for both bm and pdus scores. intraclass correlation coefficient values and values are comparable ; scores above 0.60 are considered good and scores above 0.80 are very good. from december 2011 to december 2014, 32 patients were approved by the bureau of national health insurance to receive biological therapy (24 adalimumab, 8 etanercept). the patients had a mean age of 56.9 years ; all had severe ra, and most were female. the mean bmi was 21.6 4.3 kg / m, and the mean das28 was 7.3 0.3 wa (table 2). the baseline grayscale synovitis score was 29.71 8.13, and the power doppler score was 17.79 12.14. after anti - tnf therapy, the grayscale synovitis score decreased to 22.96 9.12 at 1 month and 17.38 4.33 at 3 months. the power doppler score decreased to 3.92 3.32 at 1 month and 3.50 2.34 at 3 months (table 3). while the hand radiography showed progression in 41.6% of patients. clinical and laboratory characteristics of the patients at baseline serial sonographic composite scores before and after anti - tnf therapy for grayscale synoviotis and pdus the median (range) percentages of intrareader exact agreements were 81.6 and 65.2, respectively, and of close agreements 89.9 and 79.9, respectively. intraobserver iccs for the baseline radiographs were 0.83 (95% confidence interval [ci ], 0.650.92) for the erosion score, 0.91 (95% ci, 0.790.95) for the jsn score, and 0.96 (95% ci, 0.890.99) for the total score. intraclass correlation coefficients for the 12-month radiographs were 0.72 (95% ci, 0.280.91) for the erosion score, 0.87 (95% ci, 0.620.92) for the jsn score, and 0.90 (95% ci, 0.690.97) for the total score. we evaluated the factors contributing to radiographic progression and found that baseline age, sex, bmi, das28, esr, and crp levels could not predict radiological progression. in addition, ultrasound parameters showed that no improvements in grayscale synovitis after 1 month of anti - tnf therapy could predict radiological changes (p = 0.011), and that no change in grayscale at 3 months and the power doppler score at 1 and 3 months could not predict future radiological progression (table 4). for grayscale synoviotis and pdus the median (range) percentages of intrareader exact agreements were 81.6 and 65.2, respectively, and of close agreements 89.9 and 79.9, respectively. intraobserver iccs for the baseline radiographs were 0.83 (95% confidence interval [ci ], 0.650.92) for the erosion score, 0.91 (95% ci, 0.790.95) for the jsn score, and 0.96 (95% ci, 0.890.99) for the total score. intraclass correlation coefficients for the 12-month radiographs were 0.72 (95% ci, 0.280.91) for the erosion score, 0.87 (95% ci, 0.620.92) for the jsn score, and 0.90 (95% ci, 0.690.97) for the total score. we evaluated the factors contributing to radiographic progression and found that baseline age, sex, bmi, das28, esr, and crp levels could not predict radiological progression. in addition, ultrasound parameters showed that no improvements in grayscale synovitis after 1 month of anti - tnf therapy could predict radiological changes (p = 0.011), and that no change in grayscale at 3 months and the power doppler score at 1 and 3 months could not predict future radiological progression (table 4). the accurate assessment of joint inflammation and sensitive monitoring of disease activity in patients with ra is essential when evaluating responses to treatment and disease outcome. in ra, synovitis appears to be the primary abnormality responsible for structural joint damage ; therefore, the monitoring of therapy of patients with ra should focus on synovitis. it is known that synovial inflammation consists of periarticular vasodilatation followed by synovial proliferation, which is accompanied by angiogenesis resulting in intra - articular blood vessel formation. hypervascularization and angiogenesis of the synovial membrane are considered to be the primary pathogenic mechanisms responsible for the invasive behavior of rheumatoid pannus. joint synovitis has traditionally been assessed indirectly by means of inflammatory subjective clinical data and laboratory parameters. however, imaging techniques such as musculoskeletal ultrasound are playing an increasingly important role in the evaluation and monitoring of patients with chronic inflammatory arthritis. grayscale ultrasound is used to visualize joint structures, enabling a distinction between synovial hypertrophy and other causes of apparent joint swelling such as subcutaneous edema and tenosynovitis. power doppler allows for the assessment of synovial vascularity and hence a distinction between inflamed and nonvascular synovial swelling. nevertheless, few studies have reported on the predictive value of longitudinal ultrasound joint assessments on radiological progression in ra. in this study, a combination of grayscale (presence of joint effusion and/or synovial hypertrophy) and power doppler findings (presence and grade of intra - articular power doppler signals) in ultrasound was used. although changes in grayscale synovitis and power doppler ultrasound parameters were parallel throughout the study, we find delay improvement in grayscale synovitis at 1 month to be a measurement of radiological progression independent of standard clinical and laboratory variables after 1 year of anti - tnf therapy. taylor previously evaluated the prognostic value of ultrasound in ra in a randomized controlled trial of patients with early ra receiving anti - tnf therapy. they reported that the baseline synovial vascularization detected by power doppler in mcp joints correlated with the radiographic joint damage over the following year. however, severe ra is associated with high das28, esr, and crp levels, so when using anti - tnf to treat this group it is difficult to predict radiological progression using these markers alone. in fact, in our study, none of these parameters could predict radiological progression, and so we used ultrasound. using ultrasound, we found that no improvements in grayscale synovitis at 1 month could be used to predict radiological progression, and that no improvements in the power doppler synovitis score could not be used to predict damage in anti - tnf user. a possible reason for this may be that grayscale synovitis reflects pannus formation, so after 1 month of anti - tnf treatment the lack of improvements in synovitis may reveal severe pannus formation with a poor response to anti - tnf suppression, which would then lead to future radiological progression. power doppler synovitis only reflects the change in hyperemia, which may be dissociated from improvements of pannus formation. consistent with this hypothesis, several studies have reported that anti - tnf therapy can halt radiological progression, despite no improvements in power doppler activity. if patients on anti - tnf therapy did not use longitudinal ultrasound assessment, we could not found the changes in synovial hypertrophy and loss the data of no improvement in synovial proliferation. so the prediction of future radiological progression will be only based on clinical assessment, but as in our data, das28, esr, and crp were poor predictors in these situations. if we used ultrasound as a serial follow - up tool, we can see more intra - articular changes, and gained more information on prediction future effect and radiological prognosis. therefore, we suggest that it would be better to use the grayscale synovitis score to predict radiological changes in the patients receiving anti - tnf therapy. first, the study was conducted in accordance with daily clinical practice, and the patients were treated with various disease modifying anti - rheumatic drugs (dmards), oral corticosteroids, and nsaids at variable doses during the study. therapeutic decisions were made without knowledge of the ultrasound findings, and therefore we could not compare the predictive value of power doppler ultrasound variables based on the dmards prescribed, evaluate the potential role of different dmards in power doppler ultrasound parameters, or study the effect of power doppler ultrasound findings when making therapeutic decisions. moreover, the rheumatologist who performed the ultrasound scans could not be completely unaware of the joint signs and symptoms of the patients. to avoid as much bias as possible, the ultrasound examinations were carried out by an independent operator. despite the decreased power doppler activity in ultrasound, we evaluated the factors and found that a poor improvement in grayscale synovitis at 1 month was associated with progression. therefore, the detection of no improvements in grayscale synovitis in ra could be considered a strong predictor of disease aggressiveness in anti - tnf treatment, which is important when making treatment decisions. lack of improvement in grayscale synovitis between baseline and 1 month more accurately reflects 1-year radiological damage than conventional measures such as das28 score and crp level in ra receiving tnf antagonist therapy. lack of improvement in grayscale synovitis between baseline and 1 month more accurately reflects 1-year radiological damage than conventional measures such as das28 score and crp level in ra receiving tnf antagonist therapy. | objectivesthis prospective study aimed to compare synovial ultrasound scores to conventional measures (das28, crp levels) in predicting radiographic progression in patients with rheumatoid arthritis under tnf antagonist therapy.methodspatients with ra who received tnf antagonist therapy were enrolled, all of whom underwent clinical, laboratory, and ultrasonographic assessments with grayscale and power doppler assessments of bilateral elbows (anterior and posterior recess), wrists (dorsal, palmar, and ulnar aspects), second and third mcp joints (dorsal and palmar recess), and pip ii and iii (dorsal and palmar) at baseline and at 1, 3 months. hand radiographic damage was evaluated using van der heijde modified total sharp score (tss) at baseline and 12 months.resultsthirty-two patients (384 joints, 832 synovial sites) continued the same treatment regimen for 12 months and completed the study, 41.6% of whom showed radiographic progression during the study period. baseline das28 (p = 0.123), crp level (p = 0.177), grayscale synovitis (p = 0.092), and power doppler synovitis (p = 0.120) could not predict radiological damage in the tnf antagonist therapy group. however, tss was significantly related to changes in grayscale synovitis between baseline and 1 month (p = 0.011), but not at 3 months (p = 0.591), and was not related to changes in the power doppler score at 1 (p = 0.634) and 3 months (p = 0.298).conclusionsour data confirm that delayed improvement in grayscale synovitis between baseline and 1 month more accurately reflects 1-year radiological damage than conventional measures such as das28 score and crp level. therefore, we recommend serial ultrasound follow - up of patients with ra receiving tnf antagonist therapy. |
dna is organized with histone and other proteins to form nucleosomes, which in turn are packaged into chromosomes. two groups of enzymes control the acetylation status of histones : histone acetyltransferase (hat) and histone deacetylase (hdac). since aberrant hdac activity leads to transcriptional repression of tumor suppressor genes, hdac inhibitors have been investigated for their anti - tumor effects. several preclinical studies found that hdac inhibitors augment the effects of anti - cancer agents such as chemotherapy and ionizing radiation [2 - 4 ]. numerous in vitro and animal experiments note that hdac inhibition enhances radiosensitivity of diverse cancer cells. hdac inhibition may enhance radiation response by affecting cell functions such as gene expression, cell cycle and dna damage repair. in hdac inhibitors - induced radiosensitization, temporal sequences between agents have a relevance to clinical practicability as well as mechanistic implications. in other words, clinical application of hdac inhibitors as adjunct to radiotherapy should make the most use of a scheduling strategy that is logistically feasible and optimal for radiation enhancement. most studies evaluated the effect of hdac inhibition on radiosensitivity by exposing cells to hdac inhibitors before irradiation. this strategy is likely to elicit maximum epigenetic modulation, and has generally proven the effectiveness of preirradiation treatment with hdac to enhance radiation response [6 - 10 ]. however, some investigators opine that hdac inhibition after irradiation is crucial to elicit optimal radiosensitization. contrary to most studies, they found that preirradiation treatment with hdac inhibitors has little effect on radiosensitivity, while significant radiosensitization is induced when cells are exposed both before and after irradiation [11 - 13 ]. thus, the question regarding optimal combination scheduling of hdac inhibitors and irradiation has not been yet answered. the present study was conducted to investigate the effect of different sequences of hdac inhibition and irradiation on radiosensitivity of human lung cancer cells. cells were exposed to hdac inhibitors trichostatin a (tsa) and sk-7041 before and after irradiation. we found that preirradiation tsa and sk-7041 treatment resulted in radiosensitization, while post - treatment showed much reduced effects. a549 cell line was obtained from korean cell line bank (seoul, korea). cells were grown as attached monolayers in rpmi 1640 media (jbi, daegu, korea) supplemented with 10% fetal bovine serum (jrh biosciences, lenexa, ks) and 12.5 g / ml gentamicin (gibco, grand island, ny). cells were incubated at the exponential growth phase in humidified 5% co2/95% air atmosphere at 37. cells from the exponential phase were used for subsequent experiments. sk-7041 (4-dimethylamino - n-[4-(2-hydroxylcarbamoyl - vinyl) benzyl ] benzamide 1), class i hdac inhibitor previously reported, was a kind gift from prof yung - jue bang (department of internal medicine, seoul national university college of medicine, seoul). hdac inhibitors were dissolved as concentrated stock solutions in dimethyl sulfoxide (dmso), stored at -20 and diluted in culture medium before use. cells were harvested from exponentially growing culture, and specified numbers were seeded into each well of six - well culture plates. cells were treated with hdac inhibitors for specified time, and the media was replaced by fresh inhibitor - free media before irradiation. cultures were irradiated using 4-mv x - ray from a medical linear accelerator (clinac 4/100, varian medical systems, palo alto, ca) at a dose rate of 2.46 gy / min. cells were incubated for 14 - 21 days after irradiation till they were fixed with methanol and stained with 0.5% crystal violet. cell survival data were fitted to a linear - quadratic model using jmp software (sas institute inc., sensitizer enhancement ratio (ser) was defined as the ratio of radiation dose in the absence of hdac inhibition to that in the presence of hdac inhibition to produce a specified surviving fraction. comparison of ser was done using paired t - test (microsoft excel 2010) between cells treated with hdac inhibitors and untreated cells. null hypotheses of no difference were rejected if p - values were less than 0.05. cells were washed, scraped and resuspended in cold lysis buffer (intron biotechnology, seoul, korea). the lysates were solubilized by sonication and centrifuged at 13,000 rpm for 20 minutes at 4, and the supernatant was collected. equal amounts of protein were separated by 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis and electroblotted onto polyvinylidene difluoride membranes (millipore corp., membranes were blocked with tbst blocking solution containing 10 mm tris - hcl (ph 7.5), 150 mm nacl, 0.1% tween 20 and 5% dry milk for 1 hour. then, membranes were probed with polyclonal rabbit anti - acetyl - histone h3 immunoglobulin g (upstate, lake placid, ny) at 1:2,000 dilution in 4 overnight, and washed and incubated with peroxidase - conjugated goat anti - rabbit immunoglobulin g (jackson immuno research laboratories, west grove, pa) at 1:3,000 dilution for 1 hour. the same membranes were probed with monoclonal anti--tubulin antibody (sigma) at 1:5,000 dilution at room temperature for 2 hours and incubated with peroxidase - conjugated goat anti - mouse immunoglobulin g (jackson immuno research laboratories) at 1:3,000 dilution for 1 hour. antibody binding was detected using enhanced chemiluminescence detection kit (amersham biosciences, piscataway, nj). the optical density of each band was measured using image j version 1.33u (national institute of health, bethesda, md). for quantitative analysis, density of acetylated histone h3 bands cells were harvested using 0.25% trypsin and fixed in 1 ml of 80% ethanol (1 - 210 cells per sample). cells were washed twice with phosphate buffered saline (pbs) and incubated in dark for 30 minutes at 37 in 1 ml of pbs containing 5 g / ml propidium iodide (molecular probes, eugene, or) and 0.1% rnase a (sigma). flow cytometric analysis was done using facscan flow cytometer (becton dickinson, franklin lakes, nj). a549 cell line was obtained from korean cell line bank (seoul, korea). cells were grown as attached monolayers in rpmi 1640 media (jbi, daegu, korea) supplemented with 10% fetal bovine serum (jrh biosciences, lenexa, ks) and 12.5 g / ml gentamicin (gibco, grand island, ny). cells were incubated at the exponential growth phase in humidified 5% co2/95% air atmosphere at 37. cells from the exponential phase were used for subsequent experiments. benzamide 1), class i hdac inhibitor previously reported, was a kind gift from prof yung - jue bang (department of internal medicine, seoul national university college of medicine, seoul). hdac inhibitors were dissolved as concentrated stock solutions in dimethyl sulfoxide (dmso), stored at -20 and diluted in culture medium before use. cells were harvested from exponentially growing culture, and specified numbers were seeded into each well of six - well culture plates. cells were treated with hdac inhibitors for specified time, and the media was replaced by fresh inhibitor - free media before irradiation. cultures were irradiated using 4-mv x - ray from a medical linear accelerator (clinac 4/100, varian medical systems, palo alto, ca) at a dose rate of 2.46 gy / min. cells were incubated for 14 - 21 days after irradiation till they were fixed with methanol and stained with 0.5% crystal violet. cell survival data were fitted to a linear - quadratic model using jmp software (sas institute inc., sensitizer enhancement ratio (ser) was defined as the ratio of radiation dose in the absence of hdac inhibition to that in the presence of hdac inhibition to produce a specified surviving fraction. comparison of ser was done using paired t - test (microsoft excel 2010) between cells treated with hdac inhibitors and untreated cells. null hypotheses of no difference were rejected if p - values were less than 0.05. cells were washed, scraped and resuspended in cold lysis buffer (intron biotechnology, seoul, korea). the lysates were solubilized by sonication and centrifuged at 13,000 rpm for 20 minutes at 4, and the supernatant was collected. equal amounts of protein were separated by 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis and electroblotted onto polyvinylidene difluoride membranes (millipore corp., bedford, ma). membranes were blocked with tbst blocking solution containing 10 mm tris - hcl (ph 7.5), 150 mm nacl, 0.1% tween 20 and 5% dry milk for 1 hour. then, membranes were probed with polyclonal rabbit anti - acetyl - histone h3 immunoglobulin g (upstate, lake placid, ny) at 1:2,000 dilution in 4 overnight, and washed and incubated with peroxidase - conjugated goat anti - rabbit immunoglobulin g (jackson immuno research laboratories, west grove, pa) at 1:3,000 dilution for 1 hour. the same membranes were probed with monoclonal anti--tubulin antibody (sigma) at 1:5,000 dilution at room temperature for 2 hours and incubated with peroxidase - conjugated goat anti - mouse immunoglobulin g (jackson immuno research laboratories) at 1:3,000 dilution for 1 hour. antibody binding was detected using enhanced chemiluminescence detection kit (amersham biosciences, piscataway, nj). the optical density of each band was measured using image j version 1.33u (national institute of health, bethesda, md). for quantitative analysis, cells were harvested using 0.25% trypsin and fixed in 1 ml of 80% ethanol (1 - 210 cells per sample). cells were washed twice with phosphate buffered saline (pbs) and incubated in dark for 30 minutes at 37 in 1 ml of pbs containing 5 g / ml propidium iodide (molecular probes, eugene, or) and 0.1% rnase a (sigma). flow cytometric analysis was done using facscan flow cytometer (becton dickinson, franklin lakes, nj). pretreatment - induced radiosensitization was closely associated with duration of hdac inhibition. as a549 cells were treated for a longer time prior to irradiation ser of 18-hour treatment of tsa and sk-7041 were 1.68 and 1.60, respectively. to investigate the effect of hdac inhibition after irradiation, a549 cells underwent a series of combination sequences of hdac inhibitor treatment and irradiation. hdac inhibitors were added to culture medium immediately, at 3 hours, 6 hours, or 12 hours after exposure to x - rays, and clonogenic survival was determined (fig. in contrast to sk-7041 treatment prior to irradiation, cell radiosensitivity was not apparently altered when a549 cells were exposed to sk-7041 immediately following irradiation or afterwards (fig. immediate postirradiation tsa and sk-7041 exposure induced radiosensitization by ser of 1.64 and 1.17, respectively. as treatment of hdac inhibitors was delayed further following irradiation, their effect on cell radiosensitivity gradually diminished (fig. 3d). to address the mechanism through which hdac inhibitors enhance radiation cell killing, analysis of acetyl histone h3 assessed the association of hdac inhibition and the extent of radiosensitization. a549 cells were treated with tsa prior to or following irradiation and acetyl histone h3 was immunoblotted. acetyl histone h3 increased by 5.7-fold in cells exposed to tsa compared to in untreated cells (fig. x - ray by itself had no effect on the level of acetyl histone h3. in contrast to irradiation of untreated cells, irradiation of tsa - treated cells induced additional 2-fold increase in acetyl histone h3 compared with tsa treatment without irradiation. when the sequence was reversed, postirradiation tsa treatment induced 6.7-fold increase in the level of histone h3 acetylation, comparable to that by tsa treatment only (5.7-fold increase). to investigate the effect of postirradiation hdac inhibition on cell cycle progression, flow cytometric analysis was used to evaluate cell cycle distribution in a549 cells treated with various hdac inhibition sequences. flow cytometry revealed that either x - ray or tsa treatment arrested cell cycles at the g2/m phase (fig. postirradiation as well as preirradiation tsa treatment arrested cells in the g2/m phase. to distinguish the effects of radiation and hdac inhibition, temporal changes in postirradiation g2/m phase proportion were analyzed. in tsa - nave cells, the proportion of g2/m phase peaked (71.7% at 12 hours) after irradiation and rapidly plummeted below the baseline level at 36 hours (fig. immediate postirradiation tsa treatment had no effect on the peak extent of g2/m phase following irradiation. delayed postirradiation tsa treatment (from 12 hours to 30 hours after irradiation) showed no apparent effect on the time course in g2/m phase proportion. pretreatment - induced radiosensitization was closely associated with duration of hdac inhibition. as a549 cells were treated for a longer time prior to irradiation to investigate the effect of hdac inhibition after irradiation, a549 cells underwent a series of combination sequences of hdac inhibitor treatment and irradiation. hdac inhibitors were added to culture medium immediately, at 3 hours, 6 hours, or 12 hours after exposure to x - rays, and clonogenic survival was determined (fig. in contrast to sk-7041 treatment prior to irradiation, cell radiosensitivity was not apparently altered when a549 cells were exposed to sk-7041 immediately following irradiation or afterwards (fig. immediate postirradiation tsa and sk-7041 exposure induced radiosensitization by ser of 1.64 and 1.17, respectively. as treatment of hdac inhibitors was delayed further following irradiation, their effect on cell radiosensitivity gradually diminished (fig. to address the mechanism through which hdac inhibitors enhance radiation cell killing, analysis of acetyl histone h3 assessed the association of hdac inhibition and the extent of radiosensitization. a549 cells were treated with tsa prior to or following irradiation and acetyl histone h3 was immunoblotted. acetyl histone h3 increased by 5.7-fold in cells exposed to tsa compared to in untreated cells (fig. x - ray by itself had no effect on the level of acetyl histone h3. in contrast to irradiation of untreated cells, irradiation of tsa - treated cells induced additional 2-fold increase in acetyl histone h3 compared with tsa treatment without irradiation. when the sequence was reversed, postirradiation tsa treatment induced 6.7-fold increase in the level of histone h3 acetylation, comparable to that by tsa treatment only (5.7-fold increase). to investigate the effect of postirradiation hdac inhibition on cell cycle progression, flow cytometric analysis was used to evaluate cell cycle distribution in a549 cells treated with various hdac inhibition sequences. flow cytometry revealed that either x - ray or tsa treatment arrested cell cycles at the g2/m phase (fig. postirradiation as well as preirradiation tsa treatment arrested cells in the g2/m phase. to distinguish the effects of radiation and hdac inhibition, temporal changes in postirradiation g2/m phase proportion were analyzed. in tsa - nave cells, the proportion of g2/m phase peaked (71.7% at 12 hours) after irradiation and rapidly plummeted below the baseline level at 36 hours (fig. immediate postirradiation tsa treatment had no effect on the peak extent of g2/m phase following irradiation. delayed postirradiation tsa treatment (from 12 hours to 30 hours after irradiation) showed no apparent effect on the time course in g2/m phase proportion. although the radiosensitizing capacity of hdac inhibitors has been documented by preclinical studies [6 - 13,15 ], the optimal sequence of hdac inhibition and radiation has not been fully defined. suboptimal scheduling in the clinical setting might fail to elicit the full effect of radiosensitization by hdac inhibitors. the majority of these studies found that preirradiation hdac inhibition effectively induced a sensitization response [6 - 10,15 ]. zhang. reported that fk228 treatment prior to irradiation augmented cell radiosensitivity, while fk228 had no effect if cells were exposed to hdac inhibitor following radiation. combined with the present data, their findings support preirradiation hdac inhibition as essential to elicit sensitization. for any given hdac inhibitors, it is crucial that hdac inhibition should be temporally coordinated with radiation to achieve optimal synergy. only a few researchers directly investigated the optimal sequence of hdac inhibition and radiation [11 - 13 ]. reported that valproic acid induced comparable radiosensitization irrespective of sequences of hdac inhibition and irradiation. the most effective scheduling to induce radiation enhancement is that cells are subjected to hdac inhibition both before and after irradiation. other studies from the same group, using ms-272 and valproic acid, corroborated the argument that continued hdac inhibition after irradiation is essential for maximal radiosensitization. given the diverse biologic effects of hdac inhibitors, multiple mechanisms are implicated in enhancing radiation response. hdac inhibitors epigenetically change gene expression profiles, which might render cells more susceptible to radiation killing. based on the observation that delayed valproic acid treatment induces radiosensitization as effectively as preirradiation exposure, hdac inhibition might interfere with late phases of dna repair process by modulating chromatin remodeling. van nifterik. recently reported that postirradiation valproic acid treatment had no effect on radiosensitivity in human glioma cells, while preirradiation valproic acid exposure effectively augmented radiation lethality. using the same hdac inhibitor (valproic acid) and similar in vitro model (human glioma cells), two groups reported conflicting results with regard to optimal scheduling of valproic acid with irradiation. the present findings clearly showed that postirradiation hdac inhibition by tsa and sk-7041 had little effect on cell radiosensitivity. only pre - irradiation treatment of tsa or sk-7041 induces radiosensitization, which corroborates well the findings of van nifterik. and these conflicting results might reflect a complex interplay between various hdac inhibitors and different cell types in inducing radiosensitization. existing evidence suggests that the relative contribution of preirradiation and postirradiation hdac inhibition might differ among cell types and inhibitors. thus, omission of preirradiation hdac inhibitor treatment might risk suboptimal sensitization, until proven otherwise. several studies found a close association of hdac and/or hat with early responding components of dna damage repair mechanisms. sun. demonstrated that atm is rapidly acetylated through interaction with tip60 hat after dna damage. they observed that the acetylation of atm via tip60 is a prerequisite for activation of downstream signal transducers, such as p53 and chk2. although abundant literature exists regarding hdac inhibitor - induced radiosensitization, research into hat as a potential target for radiation response modulation has been limited. suppression of tip60 is associated with increased sensitivity to radiation lethality, suggesting a potential application of hat inhibition as radiation response enhancer. corroborating these observations, sun. reported that treatment with anacardic acid, which inhibits p300 and pcaf hat, sensitizes tumor cells to radiation toxicity via inhibiting hat activity of tip60 and dependent activation of atm and dna - pks. existing research suggests that cellular sensitivity is augmented by pharmacologic inhibition of either of counteracting enzyme activity : hdac [6 - 13,15 - 17 ] or hat. these counterintuitive results suggest that the nature of relationship of hdac / hat with radiosensitivity is far from straightforward. the present results also suggest that inhibition of hat activity plays an important role in modulation of radiosensitivity. irradiation induces the expression of acetylated histone h3 only in hdac - suppressed cells (fig. radiation - induced histone h3 acetylation may be a manifestation of cellular radiation response driven by uninhibited hat activity in hdac - suppressed milieu. this view is corroborated by observations that that radiation - induced histone acetylation is lost unless irradiation is preceded by hdac inhibition. the temporal window for hdac inhibition to enhance radiation lethality coincides with that for irradiation - triggered histone h3 acetylation. thus, the interpretation of the present data might be that both hdac and hat are involved in immediate responses to ionizing radiation. hdac inhibition might induce radiosensitivity by disrupting coordinated function of hdac / hat in the early phase of dna damage response. peri - irradiation hdac inhibition is closely associated with regulation of radiation - induced g2/m - phase arrest. g2/m - phase arrest is an early response that cells adopt following exposure to ionizing radiation. the arrest of eukaryotic cells in g2 phase after irradiation is a universal phenomenon regardless of p53 gene status, and is associated with suppression of cyclin b. there seems a direct association between g2 delay and cellular susceptibility to ionizing radiation : the longer the g2 phase delay, the more resistant cells are. this has led to a speculation among researchers that modulation in g2/m checkpoint might be a tool to enhance dna damage after irradiation. studies have demonstrated that augmentation of radiation lethality follows the inhibition of g2/m phase delay in human cancer cells by various pharmacologic agents such as caffeine, staurosporine derivative, c - met inhibitor, and hdac inhibitors. in the present investigation, radiation - induced g2/m - phase arrest was blocked by preirradiation hdac inhibition, but was not affected by hdac inhibitor exposure after irradiation (fig. 5). these observations lead to the speculation that preirradiation hdac inhibition is crucial for radiosensitization, corroborated by the findings that hdac inhibitors treatment prior to irradiation augmented radiation lethality in an exposure time - dependent manner (fig. the current results demonstrate that the capacity of hdac inhibitors tsa and sk-7041 to enhance radiation response requires preirradiation hdac inhibition. mechanisms underlying hdac inhibitor sensitization might involve perturbation of early radiation response by suppressing hdac activity and rendering hats uninhibited, thus disrupting coordinated hdac / hat function in dna damage repair. before hdac inhibitors are used as adjuvant to radiotherapy, optimal scheduling of two agents should be established from preclinical studies. until the underlying mechanism is comprehensively described, it seems sensible to include preirradiation hdac inhibition for maximal radiosensitization. | purposethis preclinical study is to determine whether the capacity of histone deacetylase (hdac) inhibitors to enhance radiation response depends on temporal sequences of hdac inhibition and irradiation.materials and methodsthe effects of hdac inhibitors trichostatin a (tsa) and sk-7041 on radiosensitivity in human lung cancer cells were examined using a clonogenic assay, exposing cells to hdac inhibitors in various sequences of hdac inhibition and radiation. we performed western blot of acetylated histone h3 and flow cytometry to analyze cell cycle phase distribution.resultstsa and sk-7041 augmented radiation cell lethality in an exposure time - dependent manner when delivered before irradiation. the impact of tsa and sk-7041 on radiosensitivity rapidly diminished when hdac inhibition was delayed after irradiation. radiation induced the acetylation of histone h3 in cells exposed to tsa, while irradiation alone had no effect on the expression of acetylated histone h3 in tsa - nave cells. preirradiation exposure to tsa abrogated radiation - induced g2/m - phase arrest. when delivered after irradiation, tsa had no effect on the peak of radiation - induced g2/m - phase arrest.conclusiontsa and sk-7041 enhances radiosensitivity only when delivered before irradiation. unless proven otherwise, it seems prudent to apply scheduling including preirradiation hdac inhibition so that maximal radiosensitization is obtained. |
medicines registration is a critical regulatory function of the government (ministry of health) that should ensure that all medicines that are available within the nation 's health system are safe, effective, and of good quality (2). the process of medicines registration evaluates the efficacy of a given medicine for a specific clinical indication as well as its safety and adverse effect profile (9). it is important to stress that the registration process should approve a particular product (dosage form and dosage strength) from a specific manufacturer only, as opposed to the singular generic active ingredient. in addition, medicines registration sets the standards that regulate the presentation and use of all medicinal products (e.g. labeling, storage conditions, marketing, warnings, and prescription requirements) (2, 5). even though one generic medicine may be available nationally as many different products (i.e. dosage forms and strengths) from a variety of manufacturers, each of these individual products should undergo individual review and registration by the registering authorities (3). it is also critical to stress that medicines registration should not be limited to the approval of new medicines, but should also include the periodical review of existing products on the national market (2). weak, inefficient, or hasty non - systematic medicine registration systems increase the potential for infiltration of the national healthcare system with poor quality, irrational, substandard, or counterfeit medicines (1014). the public health consequences of substandard or counterfeit medicines can undermine the whole healthcare process and waste national healthcare resources (14). substandard medicines impose a silent threat to healthcare systems that can lead to morbidity or, at worst, mortality. antimicrobial medicines are of particular concern. substandard quantities or unwanted inclusion of other antimicrobial medicines or contaminants in a medicinal product could cause treatment failure, have safety implications, or aggravate problems of antimicrobial resistance (12). despite the fact that a medicines regulatory authority should be a vital component of any national health system, the who estimates that only one in six nations worldwide have fully functioning medicine registration systems ; most of which are located in high - resourced nations (15). in developing nations, many barriers undermine the availability and/or the efficiency of medicine registration systems (13). according to caudron. these barriers include a limited understanding of the significance of medicines registration as a key and critical regulatory step by national decision makers, the lack of essential infrastructure such as quality assurance laboratories, and appropriately trained human resources. these barriers have rendered registration of medicines in developing countries a process that is mainly based on document review and estimation by national decision makers. as stated previously, such deficiencies can undermine the entire healthcare sector and waste scarce national resources (13, 16). in libya, the libyan health law act number 106 of 1973 and its explanatory notes of 1975 state that registration of medicines within the libyan ministry of health should precede the availability of any medicine in the libyan market. however, the act (and regulations) only offers a general statement and does not detail the technical requirements and requisites needed for sound medicines registration as recommended by the who (2). the limitations of medicines registration in libya have been highlighted by libyan researchers (7, 8) as well as the who (6). in 2003, faitoori. noted the lack of an active registration process and the negative impact of this flaw on the quality of medicines in libya (7). in 2005, ekhshaibah also stated that medicine registration is inactive and is mainly hindered by a lack of independence, minimal infrastructure, and the lack of appropriately trained personnel (8). the who has stated that medicines registration in libya not only lacks the availability of a defined independent body, but also operates with a limited technical capacity and infrastructure that is not sufficient for the optimal approval of the quality, safety, and efficacy of medicines in the libyan healthcare system (6, 8, 15). the who also stated that appropriately equipped government quality assurance laboratories are lacking and quality assurance is mainly undertaken in some schools of pharmacy with limited expertise and operating facilities (6). although acknowledged as an area that requires improvement, there is no current available data in relation to how many products may be substandard in libya (8), but media reports have indicated an alarming problem with medicines quality in libya (1). in summary, medicines registration in libya requires review, restructuring, and the implementation of a revised, thorough system in line with who guidelines. it is also important to reinforce the requirement of universal medicines registration for all subsidized and privately available medicines in libya. medicines vary in efficacy and price, therefore not every registered medicine is a candidate for government subsidy. a limited subset of registered medicines needs to be selected for the purpose of government subsidy (3, 4). logically, this subset of medicines should be selected in reference to predefined criteria that ensure efficient coverage of the general pharmaceutical needs of the national population (2, 9). the who has created the essential medicines concept (emc) as a standardized framework that aids in appropriate medicines selection (17, 18). the emc revolves around the selection of a subset of government subsidized medicines that are safe, clinically effective, and also cost effective. these government subsidized medicines should be available to treat the commonest national diseases and health conditions. the who has named this subset of medicines as essential medicines (19). essential medicines are : those that satisfy the priority health care needs of the population. they are selected with due regard to public health relevance, evidence on efficacy and safety, and comparative cost - effectiveness. essential medicines are intended to be available within the context of functioning health systems at all times, in adequate amounts, in the appropriate dosage forms, with assured quality and adequate information, and at a price the individual and the community can afford. the implementation of the concept of essential medicines is intended to be flexible and adaptable to many different situations. exactly which medicines are regarded as essential remains a national responsibility (17). the definition of essential medicines clearly identifies the public health relevance of selected medicines, evidence on efficacy and safety, comparative cost effectiveness, and the availability of essential medicines in the appropriate dosage forms as the baseline criteria of medicines selection for government subsidy schemes. the list that encompasses national essential generic medicines has been named by the who as the national essential medicines list (neml) (17). according to the who, the neml should be the basis of medicines selection for public procurement (government subsidy schemes) as well as other medicines use activities in the public health system (20, 21). the process of medicines selection for the neml should be formalized by allocation of the task of medicines selection to a defined committee that is equipped with the appropriate technical skills. appropriate technical skills include : current knowledge of clinical studies and therapeutics, adverse drug reactions, national morbidity and mortality shifts, and pharmaco - economics and cost evaluation studies (9). the process of medicines selection should also be open and dynamic, i.e. the neml should undergo periodical review in order to keep up with advances in therapy and national morbidity shifts (5). in addition, a sound national health information system is a necessary prerequisite to enable the compilation and review of a country 's most prevalent diseases and conditions (6, 22, 23). since the actual task of medicines selection for a neml is technically complex and requires an array of resources and skilled professionals that may not be available in developing countries (3, 5, 9), the who has identified a subset of medicines that are safe, effective, and cost effective for the world 's most common diseases and conditions. this subset of medicines is listed in the who model list of essential medicines (wmlem) and the list has been regularly updated since 1977. essential medicines listed in the wmlem represent the minimum number of medicines that are recommended to be available within any fully functioning healthcare system and should be the foundation of any neml (17, 18, 24). in the past, the national pharmaceutical and medical equipment company (npmec) was responsible for medicines selection for public procurement as well as distribution to public healthcare facilities in libya in accordance with act number 69 of 1972, for regulating the drug trade (7). historically, medicines were selected for public procurement (full government subsidy of medicines) from the national standard list of medicines, commonly known as the libyan pharmaceutical list (lpl). the lpl was originally formulated by the libyan ministry of health and is a list of all registered medicines in the libyan healthcare system. for several decades, the lpl was employed by the npmec for public procurement in order to cater for the subsidized pharmaceutical needs of libyan society with safe and quality medicines that did not financially overburden healthcare by allowing open purchases of medicines from the international market. however, the selection of medicines in libya, as represented by the lpl, was flawed at multiple levels (7, 8). the lpl was too vast, since it included all registered medicines in the libyan healthcare system ; therefore, regular procurement of all medicines listed on the lpl was impractical and imposed a burden on the libyan healthcare budget. as a result, officials allocated with the task of procuring medicines had to select a limited subset of medicines for public procurement. however, their selection method was unsystematic and based on local estimations of need. this non - systematic approach ultimately affected the reliability and consistency of medicine supply to national public health facilities. in addition, the lpl was obsolete since it encompassed several superseded and unnecessary medicines (8, 15). this was largely the result of an inefficient medicines registration system that hindered addition or deletion of any medicines that were listed on the lpl. it is also important to note that the actual contents and details of the lpl were not freely available for scrutiny by libyan health professionals, particularly physicians (7). in 2003, local researchers recommended the implementation of a neml in order to rectify the problem of medicines management in libya (7). according to local information (8) and information from the who (6), the national committee of drugs was formulated in 2003 and entrusted with the task of reviewing the lpl. local information showed that this task was held back by the lack of national expertise on appropriate medicines selection (8). in 2005, a draft list was published on the who website. however, the lpl was cancelled and replaced by a new libyan national standard list of medicines the libyan pharmaceutical list of essential medicines (lplem). according to the department of pharmacy and medical equipment in the libyan ministry of health, the lplem encompassed only essential medicines (rather than all registered medicines in the health system) as advocated by the who. the lplem continues to be the current libyan national standard list for general procurement (full government subsidy of medicines). the overview of the history of medicines selection in libya indicates that the process of medicines selection for public procurement purposes in libya lacks a declared methodical procedure that follows the who guidelines and that is available for scrutiny by libyan healthcare professionals. in addition, review of the libyan standard reference list has never been undertaken at regular temporal intervals since it requires a directive from the libyan cabinet (7). such directives are not automatically generated, therefore a regular review of the list has been haphazard. the emc revolves around the selection of a subset of government subsidized medicines that are safe, clinically effective, and also cost effective. these government subsidized medicines should be available to treat the commonest national diseases and health conditions. the who has named this subset of medicines as essential medicines (19). essential medicines are : those that satisfy the priority health care needs of the population. they are selected with due regard to public health relevance, evidence on efficacy and safety, and comparative cost - effectiveness. essential medicines are intended to be available within the context of functioning health systems at all times, in adequate amounts, in the appropriate dosage forms, with assured quality and adequate information, and at a price the individual and the community can afford. the implementation of the concept of essential medicines is intended to be flexible and adaptable to many different situations. exactly which medicines are regarded as essential remains a national responsibility (17). the definition of essential medicines clearly identifies the public health relevance of selected medicines, evidence on efficacy and safety, comparative cost effectiveness, and the availability of essential medicines in the appropriate dosage forms as the baseline criteria of medicines selection for government subsidy schemes. the list that encompasses national essential generic medicines has been named by the who as the national essential medicines list (neml) (17). according to the who, the neml should be the basis of medicines selection for public procurement (government subsidy schemes) as well as other medicines use activities in the public health system (20, 21). the process of medicines selection for the neml should be formalized by allocation of the task of medicines selection to a defined committee that is equipped with the appropriate technical skills. appropriate technical skills include : current knowledge of clinical studies and therapeutics, adverse drug reactions, national morbidity and mortality shifts, and pharmaco - economics and cost evaluation studies (9). the process of medicines selection should also be open and dynamic, i.e. the neml should undergo periodical review in order to keep up with advances in therapy and national morbidity shifts (5). in addition, a sound national health information system is a necessary prerequisite to enable the compilation and review of a country 's most prevalent diseases and conditions (6, 22, 23). since the actual task of medicines selection for a neml is technically complex and requires an array of resources and skilled professionals that may not be available in developing countries (3, 5, 9), the who has identified a subset of medicines that are safe, effective, and cost effective for the world 's most common diseases and conditions. this subset of medicines is listed in the who model list of essential medicines (wmlem) and the list has been regularly updated since 1977. essential medicines listed in the wmlem represent the minimum number of medicines that are recommended to be available within any fully functioning healthcare system and should be the foundation of any neml (17, 18, 24). in the past, the national pharmaceutical and medical equipment company (npmec) was responsible for medicines selection for public procurement as well as distribution to public healthcare facilities in libya in accordance with act number 69 of 1972, for regulating the drug trade (7). historically, medicines were selected for public procurement (full government subsidy of medicines) from the national standard list of medicines, commonly known as the libyan pharmaceutical list (lpl). the lpl was originally formulated by the libyan ministry of health and is a list of all registered medicines in the libyan healthcare system. for several decades, the lpl was employed by the npmec for public procurement in order to cater for the subsidized pharmaceutical needs of libyan society with safe and quality medicines that did not financially overburden healthcare by allowing open purchases of medicines from the international market. however, the selection of medicines in libya, as represented by the lpl, was flawed at multiple levels (7, 8). the lpl was too vast, since it included all registered medicines in the libyan healthcare system ; therefore, regular procurement of all medicines listed on the lpl was impractical and imposed a burden on the libyan healthcare budget. as a result, officials allocated with the task of procuring medicines had to select a limited subset of medicines for public procurement. however, their selection method was unsystematic and based on local estimations of need. this non - systematic approach ultimately affected the reliability and consistency of medicine supply to national public health facilities. in addition, the lpl was obsolete since it encompassed several superseded and unnecessary medicines (8, 15). this was largely the result of an inefficient medicines registration system that hindered addition or deletion of any medicines that were listed on the lpl. it is also important to note that the actual contents and details of the lpl were not freely available for scrutiny by libyan health professionals, particularly physicians (7). in 2003, local researchers recommended the implementation of a neml in order to rectify the problem of medicines management in libya (7). according to local information (8) and information from the who (6), the national committee of drugs was formulated in 2003 and entrusted with the task of reviewing the lpl. local information showed that this task was held back by the lack of national expertise on appropriate medicines selection (8). in 2005, a draft list was published on the who website. however, the lpl was cancelled and replaced by a new libyan national standard list of medicines the libyan pharmaceutical list of essential medicines (lplem). according to the department of pharmacy and medical equipment in the libyan ministry of health, the lplem encompassed only essential medicines (rather than all registered medicines in the health system) as advocated by the who. the lplem continues to be the current libyan national standard list for general procurement (full government subsidy of medicines). the overview of the history of medicines selection in libya indicates that the process of medicines selection for public procurement purposes in libya lacks a declared methodical procedure that follows the who guidelines and that is available for scrutiny by libyan healthcare professionals. in addition, review of the libyan standard reference list has never been undertaken at regular temporal intervals since it requires a directive from the libyan cabinet (7). such directives are not automatically generated, therefore a regular review of the list has been haphazard. the procurement activity involves the task of the actual purchasing of medicines in an efficient manner. the interaction between drug manufacturers and the national healthcare system takes place at this critical interface (3, 5, 9). procurement involves a spectrum of duties such as quantification of national pharmaceutical needs, bulk purchasing, establishment of bidding contests, technical analysis of offers, allocation of financial resources, payments, receipts of purchased medicines, quality assurance checks, and stock management. these activities also need to be standardized and carried out in a systematic manner in order to ensure sound and efficient procurement of medicines (9). sound procurement requires a robust neml, reliable data on actual consumption of medicines in national healthcare facilities, personnel trained in appropriate procurement practices, and sufficient financial resources in order to appropriately quantify and purchase national pharmaceutical needs (3, 5, 9). in the libyan healthcare system, procurement is undertaken via reference to the national standard reference list, currently the lplem. according to the available evidence, procurement in the libyan health system is not a temporally standardized process and occurs via annual or biennial tenders according to random estimation of national needs (7, 8). appropriate procurement is also hindered by the lack of a systematic process of quantification of medicines as well as the lack of properly trained personnel in relation to the technical details of appropriate procurement techniques and practices (7). medicines procurement in libya requires indepth attention as it is not undertaken in concordance with current who guidelines. in the libyan healthcare system, procurement is undertaken via reference to the national standard reference list, currently the lplem. according to the available evidence, procurement in the libyan health system is not a temporally standardized process and occurs via annual or biennial tenders according to random estimation of national needs (7, 8). appropriate procurement is also hindered by the lack of a systematic process of quantification of medicines as well as the lack of properly trained personnel in relation to the technical details of appropriate procurement techniques and practices (7). medicines procurement in libya requires indepth attention as it is not undertaken in concordance with current who guidelines. the main function of a national medicines distribution system is to ensure efficient delivery of purchased pharmaceuticals to national warehouses and dispensing outlets. efficient distribution systems must have storage facilities including refrigeration units that fulfill who recommendations in order to ensure that medicines are stored and transported in the appropriate conditions that preserve the therapeutic qualities of medicines. security measures should also be in place in order to minimize the risk of theft and medicines seepage outside the national public healthcare system. in addition, it is important to ensure the accurate flow of inventory information as a critical aspect of medicines distribution in order to make certain that stocks are appropriately managed and supplied (2, 3, 9). according to faitoori., distribution in the libyan pharmaceutical sector of the libyan healthcare system has endured several limitations that hinder efficient performance (7). such limitations include, but are not limited to, weak transportation systems, obsolete inventory management systems (medicines expire in storage), lack of coordination between storage and transportation systems, lack of computerized information systems, and weak security and monitoring systems that lead to seepage of medicines outside the healthcare system. medicines distribution processes in libya also require review and reorganization in order to comply with current who guidelines. according to faitoori., distribution in the libyan pharmaceutical sector of the libyan healthcare system has endured several limitations that hinder efficient performance (7). such limitations include, but are not limited to, weak transportation systems, obsolete inventory management systems (medicines expire in storage), lack of coordination between storage and transportation systems, lack of computerized information systems, and weak security and monitoring systems that lead to seepage of medicines outside the healthcare system. medicines distribution processes in libya also require review and reorganization in order to comply with current who guidelines. it is here that patients experience either the benefits or the detriments of the pharmaceuticals provided by the national healthcare system. this activity area is the most difficult to assess since it involves the interplay of physicians, pharmacists, patients, and others who may have conflicting interests that can compromise medicines use in the national healthcare system (5, 9). the who recognizes inappropriate (irrational) use of medicines as a common practice worldwide (15). according to the who, more than half of all medicines are prescribed, dispensed, or sold inappropriately, and that only about half of all patients use medicines in a correct manner. the who has proposed a framework on the rational use of medicines as an essential component of the emc (21). according to the who, medicines use should be formalized, standardized, and governed by regulatory as well as educational interventions (21). the problem of irrational medicines use exists in both low resource as well as high resource countries (15). however, the problem is more significant in developing countries due to many aggravating contextual factors that hinder the appropriate (rational) use of medicines (25). standardization of medicines use is an important component of national medicine policies (2) and modern healthcare delivery ; since misuse, overuse or under use of medicines can impose a silent but serious threat to public health and, as a result, wastes the limited national resources (15). a neml that has been formulated in concordance with who guidelines is central to the rational use of medicines as it improves medicines availability and enhances all educational efforts (for health professionals as well as patients) on the rational use of medicines. liang. also recommended ten approaches that can be utilized by national decision makers in developing countries to standardize the medicines use process (20). these approaches include the implementation of a neml that is linked to robustly developed standard treatment guidelines, drug information centers that provide health professionals with up - to - date independent drug information as well as other training and managerial measures. it is also important to mention that the problem of irrational use of medicines requires collaborative efforts from all stakeholders in the pharmaceutical sector (physicians, pharmacists, government officials (the ministry of health), national medical associations, academia, and others) (26), therefore, measures and initiatives for the rational use of medicines should be administrated at the government level. the who asserts that activities on the rational use of medicines in libya need to be assessed and developed (6). the availability of information on patterns of use of medicines has been hindered by the general scarceness of published research in libya (6, 27). absence of health systems research as an integral part of national health development can be considered as we identified one study published in 1988 that investigated the prescribing patterns in six out - patient clinics in tripoli (28). the study found that anti - infective medicines were prescribed at a high rate (85% of studied prescriptions). vitamins (63%), analgesics (61%), antihistamines (35%), medicines acting on the gastrointestinal tract (19%), and hematinics (11%) were also commonly prescribed to patients. another study published in 2003 identified a potential medication use problem (over prescribing of antibiotics and pain - killers), however, this problem was embedded in an availability of medicines in libyan public healthcare facilities review (7). more research examining the current quality of medicines use in libya is critical and will assist in improving healthcare in libya (2, 25). also of note, the website of the libyan board of medical specialities does not currently include any educational activities in relation to the rational use of medicines as advocated by the who. in addition, specific practice guidelines, including therapeutic guidelines on the appropriate use of medicines are currently lacking at all levels of the healthcare system (6). inter professional collaboration and evidence - based decision making are essential components for activities on the rational use of medicines and modern healthcare delivery (21, 26). the libyan healthcare system needs to encourage professional collaboration and evidence - based decision making (6). overcoming such constraints is the first step toward the rational and effective use of medicines in libya. the who asserts that activities on the rational use of medicines in libya need to be assessed and developed (6). the availability of information on patterns of use of medicines has been hindered by the general scarceness of published research in libya (6, 27). absence of health systems research as an integral part of national health development can be considered as we identified one study published in 1988 that investigated the prescribing patterns in six out - patient clinics in tripoli (28). the study found that anti - infective medicines were prescribed at a high rate (85% of studied prescriptions). vitamins (63%), analgesics (61%), antihistamines (35%), medicines acting on the gastrointestinal tract (19%), and hematinics (11%) were also commonly prescribed to patients. another study published in 2003 identified a potential medication use problem (over prescribing of antibiotics and pain - killers), however, this problem was embedded in an availability of medicines in libyan public healthcare facilities review (7). more research examining the current quality of medicines use in libya is critical and will assist in improving healthcare in libya (2, 25). also of note, the website of the libyan board of medical specialities does not currently include any educational activities in relation to the rational use of medicines as advocated by the who. in addition, specific practice guidelines, including therapeutic guidelines on the appropriate use of medicines are currently lacking at all levels of the healthcare system (6). inter professional collaboration and evidence - based decision making are essential components for activities on the rational use of medicines and modern healthcare delivery (21, 26). the libyan healthcare system needs to encourage professional collaboration and evidence - based decision making (6). overcoming such constraints is the first step toward the rational and effective use of medicines in libya. in order to ensure sound performance of the pharmaceutical sector, most activities in medicines management need to operate in a transparent manner that allows scrutiny by national healthcare professionals and other stakeholders (5, 9). for instance, national medicines regulatory authorities (registration systems) need to be formalized and applied in an open and reliable manner that complies with who guidelines. there is no place for personal judgment or inappropriate practices that imperil the quality of medicines or their use in the national healthcare system (2, 3, 5, 9). information in relation to the committee entrusted with the task of selecting medicines for the neml should be publicly disclosed (on a website or similar channels) in order to ensure accountability and avoid inappropriate practices that endanger the quality and availability of medicines in the national healthcare system (5, 9, 17). it is also important to mention that the stability of the pharmaceutical sector is a key component that secures long - term planning and sustainability of pharmaceutical services in any health system (2, 3). stability has been a major issue that has undermined development, review, and improvement of the libyan pharmaceutical sector (7, 8). the sound and systematic management of the pharmaceutical sector is a critical requisite for the appropriate supply and use of medicines in the national healthcare system. in order to improve the pharmaceutical sector, the processes involved in medicines management need to be clearly defined in the libyan national healthcare system. in addition, scarceness of research evidence and review in relation to all activities undertaken within the pharmaceutical sector is an area that can and needs to be addressed by appropriate research. the libyan management of the pharmaceutical sector does not measure up to the standards recommended by the who. a key reason for the suboptimal performance of the pharmaceutical sector in libya is the lack of stability, appropriate infrastructure, and well - trained personnel. urgent attention and support from national decision makers is required for the optimal performance of the sector, which is critical to the healthcare of libyan society. we therefore recommend : effective adoption of the who guidelines in relation to all five critical activities in the pharmaceutical sector.encouraging research projects that will assess and, ultimately improve, the libyan pharmaceutical and healthcare system.adoption of transparent measures in all five critical activities in order to enhance performance and accountability. effective adoption of the who guidelines in relation to all five critical activities in the pharmaceutical sector. encouraging research projects that will assess and, ultimately improve, the libyan pharmaceutical and healthcare system. adoption of transparent measures in all five critical activities in order to enhance performance and accountability. the authors have not received any funding or benefits from industry or elsewhere to conduct this study. | medicines are health technologies that can translate into tangible benefits for numerous acute as well as chronic health conditions. a nation 's pharmaceutical sector needs to be appropriately structured and managed in order to ensure a safe, effective and quality supply of medicines to society. the process of medicines management involves the sequential management of five critical activity areas ; namely ; registration, selection, procurement, distribution and use. formalized and standardized management of all five critical activity areas positively influences the availability, quality and affordability of medicines and ultimately increases the reliability and quality of the national healthcare system.aimthe aim of this review is to examine the current structure and operation of medicines management (i.e. the pharmaceutical sector) in libya.conclusionin the libyan healthcare system all five critical activity areas are compromised. restructuring of the pharmaceutical sector in libya is required in order to provide and sustain sound pharmaceutical services for libyan society and improve the national public health outcomes. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.