article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
in a healthy individual, the cerebrospinal fluid (csf) is clear and colourless. the composition is different than that of the blood due to a highly selective blood brain barrier. any increase in cellular content or protein composition of the cerebrospinal fluid (csf) above the normal range for the specific age group is an absolute indicator of meningeal disease (inflammation). but after death the number of cells in the csf rises, even in the absence of evidence of meningitis, and this is viewed as a postmortem artifact [2, 3 ]. thus counting cells in csf obtained postmortem is not considered to be useful in diagnosis. in this paper we examine the evidence for this assumption. platt and colleagues obtained postmortem specimens of csf from 26 cases of sudden infant death syndrome (sids), 24 paediatric deaths from a hospital setting, and 14 adult deaths. the age range, the postmortem interval, and the csf cell count per cubic mm are shown in table 1. the csf cell count in the sids cases varied from 37 to 3250 cells per cubic mm (mean 647). these counts were significantly higher (p < 0.005) than in the hospital paediatric group and the adult group. the cells were mononuclear ; the authors do not record the presence of neutrophil polymorphs in any of the cases. the typeable cells were 6070% macrophages and 2040% lymphocytes, but beyond 12 hours postmortem, the cells became vacuolated and were difficult to type. none of the postmortem cultures grew bacteria, and sections of the brain revealed no inflammation. wyler and colleagues obtained csf by lumbar puncture from 69 adult deaths aged 16 to 90 years. thirty five of the corpses were stored at room temperature (20c) and 34 were placed in cold storage (4c) shortly after death. the specimens of csf were obtained between 3 and 39 hours for the 35 cases stored at room temperature and 3 and 53 hours for those in cold storage. the csf cell count increased with postmortem interval and the rate of increase was more marked for the bodies stored at room temperature. the csf cell count in the first few hours after death was only slightly raised above the levels regarded as normal in life, and even after 24 hours was below 100 cells per cubic mm. these results are similar to those obtained by platt. in adults, but the csf cell counts are significantly less than those seen in sids and in the paediatric non - sids deaths. the anatomy and physiology of the blood brain barrier is reviewed in detail by fishman in his comprehensive treatise and more recently by ballabh. and abbott.. the leptomeninges have an outer layer of arachnoid mater and an inner layer of pia mater. these membranes are formed of connective tissue, and the subarachnoid space that lies between these layers is traversed by connective tissue trabecula. there are cells lining the pia and arachnoid membranes and desquamation of these cells postmortem could have contributed to the csf mononuclear cells observed in the above studies by platt. and wyler.,. the main barrier to the transfer of protein and cells between the blood and csf is the endothelium of the cerebral capillaries [4, 5 ]. the brain capillaries are different than most systemic capillary vessels in that the endothelial cells have tight junctions and transfer of material is through the cells rather than between the cells. furthermore, the brain endothelial cells have more mitochondria than systemic vessels, and this reflects the additional energy required to pump protein and other chemicals from the lumen through the cell cytoplasm rather than relying on passive diffusion between leaky cell junctions or through endothelial fenestrations. the endothelial cells, however, have lower energy requirements than brain neurons and the brain cells die first if the oxygen supply is disrupted. lymphocytes pass through the endothelial cells by emperipolesis ; this is a complex process in which the inflammatory cell invaginates into the endothelial cell and literally passes through to emerge intact at the opposite side [1, 57 ]. the process depends on the active cooperation of both cells, and it is difficult to imagine how it could occur after death. inflammation in the systemic circulation leads to increased permeability of the vasculature and protein molecules and cells pass between the endothelial cells. if inflammation involves the meninges the tight junctions might open to allow the egress of neutrophils, mononuclear cells, and proteins, but this does not occur in the absence of inflammation [4, 5 ]. the pro - inflammatory cytokines tnf - alpha and il1-beta increase permeability of the blood brain barrier and disrupt tight junctions. these cytokines are released in infection and as a consequence of hypoxic ischaemic change. there are capillary vessels within the dura mater, which are similar to systemic capillaries in having leaky junctions and fenestrations. protein and cells could cross these vessels passively but the arachnoid lining cells have tight junctions and maintain a barrier to diffusion into the csf [4, 5 ]. in the ventricles, the choroids plexus is the site of transfer of protein and other chemicals into the csf. the capillaries in the choroids plexus resemble endothelial cells elsewhere in the body but there are tight junctions between the lining ependymal cells of the choroids plexus, which maintain the blood brain barrier at this level. an interruption to the oxygen supply to the brain will cause cessation of neuronal function and death will ensue. the activity of the cerebral endothelial cells will decrease and the transfer of protein and other substances will be brought to a halt. however, the endothelial cells will survive intact for some time and at least initially we would not expect to see any leakage of protein or cells into the csf from the cerebral circulation. however, the protein concentration varies not only with age but also to a small extent by site. it is lowest in the ventricular csf, intermediate in the cisterna magna, and highest in the lumbar region. the blood brain barrier to the free movement of protein was first defined by ehrlich and his students. they injected aniline dyes intravenously in experimental animals and noted that at postmortem the tissues were stained blue but the csf and the brain were unstained. the aniline dyes attached to albumin and, therefore, the stain reflected the distribution of albumin in the body. the fact that the differential staining was noted at autopsy indicates that the blood brain barrier was maintained after death for at least a short interval. mangin and colleagues investigated csf protein levels in 44 cadavers aged 5 to 74 years. group15 subjects who died suddenly (less than 10 minutes) due to homicidal firearm wounds, stabwounds, or hanging. 15 subjects who died suddenly (less than 10 minutes) due to homicidal firearm wounds, stabwounds, or hanging. group13 subjects whose death agony duration lasted between 10 minutes and 6 hours. no more clinical information is given but these are cases who became acutely unwell and died within 6 hours of the onset of the illness. l (mean sd). 13 subjects whose death agony duration lasted between 10 minutes and 6 hours. no more clinical information is given but these are cases who became acutely unwell and died within 6 hours of the onset of the illness. the csf protein in this group was 1.546 0.46 g / l (mean sd). group16 subjects whose death agony duration was more than 6 hours and who died in spite of intensive care. 16 subjects whose death agony duration was more than 6 hours and who died in spite of intensive care. these results indicate that if death is rapid and the csf protein is normal at the time of death, then it will remain within the normal range for a few hours after death. in those first few hours there is no significant passive leakage because the endothelial cells and their tight junctions are still intact. however, over a period of 24 hours the endothelial cells will start to lyse, the junctions will start to leak, and passive transfer will gradually ensue. the passive leakage involves proteins to a small extent but not red cells and by inference not white cells. in groups 2 and 3, the subjects were unwell prior to death and the most likely explanation is production of cytokines as part of the illness causing a generalized inflammatory process throughout the body including the blood brain barrier. the movement of proteins, and cells, would be an active process in the brain requiring intact and functioning brain capillary endothelial cells but with some loss of permeability due to cytokine secretion. following death, however, the endothelial cells might well lyse more quickly and passive leakage of protein would ensue within 24 hours. thus the raised levels of csf protein noted in groups 2 and 3 are probably a combination of increased levels prior to death and further increases after death. the authors did not count cells in the csf samples, but the inference we can draw is that there would be few or no lymphocytes in group 1 but there could well have been lymphocytes and even neutrophils present in groups 2 and 3 as the proinflammatory cytokines tnf - alpha and il1-beta increase leukocyte transmigration as well as increase blood brain barrier permeability and disrupt tight junctions. they examined 11 cases of head trauma, 7 cases of hypoxia (4 carbon monoxide or drug poisonings and 3 hangings), 7 sudden cardiac deaths, and 9 others (natural and unnatural). the csf levels are markedly raised in all cases and are of no value in diagnosis. but the key difference between this paper and that of mangin. is the postmortem interval. it would appear that the csf protein leak starts in the first 24 hours but gathers speed thereafter. in the study by platt., there was no histological evidence of meningitis even in cases with over 3000 mononuclear cells per cubic mm of csf. since the csf bathes the leptomeninges, we would expect to see a similar concentration of cells in the meninges at autopsy as were found in the csf. but what exactly is the correspondence between the csf cell count determined objectively and our subjective impressions of the mononuclear content of the meninges assessed by histology ? the mean diameter of a high power field is 0.5 mm and the thickness of a histological section is 0.005 mm. thus if 800 cells of the size of a lymphocyte or a neutrophil polymorph were distributed in one cubic mm of tissue and the tissue were serially sectioned, we would have 200 histological sections each with 4 high power fields. there would be one inflammatory cell per high power field (this assumes we count all the cells and never count a cell twice. in fact, we would miss some cells and count some twice but the former error is likely to exceed the latter and therefore the one per high power field estimate will be, if anything, too high). thus even 3000 mononuclear cells per cubic mm of csf will mean fewer than 4 cells per high power field ; not a number that would lead to a diagnosis of meningitis. but 10 lymphocytes per cubic mm of csf in life would be enough for a diagnosis of lymphocytic meningitis in its earliest stages. thus an objective count of mononuclear cells in the csf will be a far more sensitive way of diagnosing meningitis than histological examination of the meninges. in the publication by platt., the following statement occurs in the discussion it is clear from this study that children and adults develop a postmortem csf pleocytosis. however, the degree of pleocytosis is significantly greater in children, particularly in cases of sids. the assumption that the csf pleocytosis is a postmortem artifact is based on two factors. the second is that there was no evidence of any other infection at autopsy to explain the sudden infant death. counting cells in the csf is a more sensitive way of diagnosing meningitis than is examination of histological sections of meninges. and there is now a considerable body of evidence that some cases of sids are caused by bacterial infection even if the autopsy is completely negative. the latest in a long line of publications linking bacterial infection and sids appeared in the lancet in 2008. a group from great ormond street undertook a retrospective review of 546 cases of sudden unexpected death in infancy (sudi) examined at their institution over 10 years. they found that isolation of staphylococcus aureus and escherichia coli from lung, blood, spleen, or csf was more common in unexplained sudi (synonymous with the term sids as used in the platt. s. aureus was found in 16% of cultures from unexplained sudi compared with 9% of cultures from explained, noninfective, sudi (p = 0.005). e. coli was found in 6% of cultures from unexplained sudi compared with 1% of cultures from explained noninfective sudi (p = 0.003). the authors are cautious in their analysis and emphasise that they have shown an association and not proven a causal link. but other evidence from a number of studies, reviewed in a lead article in the same issue of the lancet, supports this link. the organisms s. aureus and e. coli have been linked to unexplained sudi in a number of studies extending back to 1987. there is now sufficient evidence to regard these organisms as a possible cause of some cases of unexplained sudi [1517 ]. the mode of death in unexplained sudi is not known but we do know that it is rapid in many cases. in the cesdi sudi study carried out in england between 1993 and 1996, the majority (76.8%) appeared to be well when last seen, that is, they had a cambridge baby check score of between 0 and 7 in the 24 hours prior to death. amongst the daytime deaths in this group, 38% were observed alive 30 minutes prior to discovery and 9% within 10 minutes of discovery. in the small number of infants who have died whilst on a monitor, the physiological changes of progressive hypoxia, bradycardia, and finally cardiorespiratory arrest take less than 20 minutes. if bacteria such as s. aureus and e. coli present in the blood, but in the absence of overt inflammation, can cause death in a short interval the release of toxins, which directly combine with neural and or cardiac membranes and interfere with homeostatic control of cardiorespiratory function. a heightened or abnormal host response to the bacteria with lymphocyte proliferation, cytokine release, and generalized but subtle signs of inflammation. but since lymphocyte proliferation takes time, there would have to be a subclinical prodromal period prior to the dramatic final episode. a specific mechanism that includes both the above possibilities is the release of pyrogenic toxins (such as toxic shock syndrome toxin [tsst ] and staphylococcal enterotoxin c [sec ]) by s. aureus leading to the explosive release of cytokines from lymphocytes primed by previous episodes of staphylococcal bacteraemia. the cytokine cascade causes toxic shock and a transfer of protein and cells across capillary cell walls in both the systemic and cerebral circulations. the morphology, physiology, and pathology of the blood - brain barrier has been studied in detail in animal models and in human subjects. fishman published a comprehensive review in 1992 and since then there have been further reviews by ballabh. and abbott. however, there is a paucity of information on changes in the blood - brain barrier after death in human subjects, and pathologists have been too ready to dismiss the changes noted in the csf as a postmortem artefact. in life, a normal specimen of csf contains no more than 2 to 4 mononuclear cells per cubic mm and no neutrophil polymorphs. if more cells are found, the sample is not normal and csf pleocytosis is diagnostic of meningeal inflammation as long as an acute csf bleed can be excluded. however, the studies of platt. and wyler. in adults, the number of mononuclear cells in the csf gradually increases over the first 24 hours. this plainly is a consequence of postmortem events and does not indicate or reflect the number of cells in the csf prior to death. the most likely explanation is that cells lining the leptomeninges progressively detach with time after death and float into the csf. but it is much more difficult to postulate a mechanism by which lymphocytes can enter the csf from the blood after death. if death is sudden, the endothelial lining cells of the cerebral blood vessels will remain intact for a few hours at least. it is also what was observed by mangin. in their study of csf protein in cases of sudden death due to shooting, stabbing, and hanging. in those cases, there was not a significant rise in csf protein in the first 24 hours after death. lymphocytes pass from the cerebral blood to the csf by a process of emperipolesis [1, 57 ]. this is a complex movement through the cell in which the endothelial cytoplasm wraps around the lymphocyte. there is no evidence of which we are aware that this process can occur after death. it is theoretically possible that lymphocytes could exit from blood vessels in the dura mater and track through the arachnoid mater into the csf by a passive process. or indeed pass from capillaries in the choroids plexus through into the ventricles. but we would expect them to be prevented by tight junctions in arachnoid lining cells and in choroid plexus ependymal cells in the first few hours after death [5, 11 ]. indeed the observation that the csf protein does not rise in the first few hours after death argues against this route. the csf protein does rise eventually in all cases as shown by the study of osuna., but it is a protein that leaks not red cells. if red cells do not move passively into the csf even after 48 hours, then one would not expect the larger white cells to move in this way. furthermore, platt. did not record the presence of neutrophil polymorphs in the csf, which would be unusual if the lymphocyte entry was purely passive. in summary, if the lymphocyte entry is passive one would expect to see red cells and neutrophil polymorphs as well as mononuclear cells and a much more marked increase in csf protein than was observed in the mangin. study. it is difficult to see how the process could be active after death as endothelial cells depend on energy from mitochondria to move cells and protein into the csf. the final possibility is that the lymphocytes seen in sids cases and in the paediatric hospital death group in the platt. there were two reasons for regarding the lymphocytes seen in the sids cases as a postmortem artifact. the second was that there was no evidence of infection as the cause of death. the first objection is no longer valid because simple calculations indicate that counting cells in the csf is a much more sensitive indicator of meningitis than is histological assessment of the meninges. the second objection is also not valid because there is now a considerable body of evidence pointing to an infectious aetiology of sids [1217 ]. it is time to reassess the pathogenic significance of lymphocytes seen in postmortem csf samples. we need to collect csf samples in the first few hours after death and examine them urgently as we would in life. a cell count is essential but we should also use the full armory of modern immunohistological techniques with a wide range of cluster differentiation (cd) markers to differentiate lymphocytes from other mononuclear cells. we need to compare unexplained sudi with cases in which an explained noninfective cause appears likely. we should also investigate deaths at other ages, not just the paediatric age range but also adults. bacteria are commonly found at autopsy and too readily dismissed as contaminants or as the consequence of agonal events. it could well be that episodes of bacteraemia are a common last event on the road to death in a range of conditions. studies are planned, and in some cases underway, to investigate unexplained sudi using the full array of modern molecular techniques. these include microarray analysis to identify genetic signatures of the host response to infection as well as genetic signatures to mark the presence of pathogens. but we should not forget something which is much simpler - counting lymphocytes in the csf. | the aim of this paper is to reassess the significance of postmortem cerebrospinal fluid pleocytosis. published articles of csf changes after death were reviewed, and reanalysis, in the light of modern views on the significance of bacterial postmortem isolates, was undertaken. there is theoretical and experimental evidence that the blood brain barrier to the movement of protein and cells is preserved in the first few hours after death. the number of mononuclear cells in the cerebrospinal fluid does rise in the first 24 hours after death, and this is most probably due to detachment of leptomeningeal lining cells. but the marked increase in lymphocyte counts seen in some cases of sudden infant death syndrome (sids) and in other deaths in the paediatric age range could well be a marker of inflammation. |
previous studies have examined the role of relative blur and concluded that it only contributes to ordinal (qualitative) depth judgments (mather & smith, 2002 ; marshall, burbeck, ariely, rolland, & martin, 1996). a recent study (held, cooper & banks, 2012) challenges these findings by claiming that blur is used to derive quantitative depth under binocular viewing. a key element of this claim is the geometric similarity between retinal disparity and blur. consider the quantitative depth separation z1 z0 perceived while fixating object 0 located at a distance z0 (figure 1a ; adapted from figure 1 of held. held. drew attention to the geometric similarity between the relation of blur () and disparity () to z1 z0 (equations 1 and 2) to derive equation 3 linking disparity and blur magnitude (a is the pupil diameter and i is the interocular distance) : (1) |1z11z0|, (2) i(1z11z0), (3) = ai. cartoon of viewing geometries (top) and binocular retinal images (bottom) for judging depth between two points. disparities are indicated in the left eye image (dotted circles represent the location of the object image in the right eye). the observer fixates an object 0 to judge the magnitude of separation (z1 z0) between 0 and 1. the observer fixates a point 0 and discriminates the ordinal depth relation z2 > z1 between two points beyond fixation (1 and 2). > 1 in the retinal image without computing quantitative depth z2 z1 or z1 z0 or even comparing z2 > z1. for greater values of z1, this arrangement produces large absolute disparities and diplopia. (c) natural task geometry for judging perceived depth separation (z2 z1) between two points : the observer fixates a region in between 2 and 1. both points will have similar levels of blur (1, 2) for most fixation distances, but relative disparities (1 2) will enable precision judgments of depth separation appropriate to the viewing distance. they claim that disparity is used to compute z1 z0 when it has a small value, whereas defocus blur is used when it has a large value. they base this claim on showing that disparity discrimination is worse than blur discrimination for larger values of z1. however, held. their task measured discrimination thresholds for judging the ordinal depth between two objects beyond fixation (i.e., z2 > z1 ; see figure 1b). to show that blur is used to derive depth separation, they would have had to measure judgments of perceived depth magnitude (z1 z0 or z2 z1) and show that these covary in some systematic way (regardless of accuracy) with differences in blur (1 0 or 2 1). discrimination thresholds are routinely used as a bias - free measure to understand computation of depth from visual cues. however, such measurements are usually done in the context of an existing body of evidence showing that perceived depth varies predictably as a function of the value of these cues (e.g., perspective, disparity, and texture). no such evidence has previously been found for relative blur and held. 's task directly confounded the discrimination of ordinal depth relations with the discrimination of the blur difference itself (a two - dimensional task). this type of confound is particularly prevalent in studies that depend solely on measures of discrimination thresholds to infer metric derivation of depth from retinal cues (see todd, christansen, & guckes, 2010). held. tested a single configuration where the two depth planes (z1 and z2) were both located beyond fixation and higher blur is always associated with the farther depth plane (figure 1b). therefore, the ordinal task can, in principle, be done by just discriminating blur differences in the retinal image. two subjects were authors, and of the two nave observers tested, one confirmed that they used magnitude of blur rather than depth to make the judgment (held., 2012). pilot tested a configuration with closer depth planes, but this does not eliminate the confound, because in this case the closer plane is always correlated with greater blur. held. (2012) drew conclusions about the role of blur in binocular depth perception on the basis of discrimination data from a single fixation distance (28 cm). crucially, their report does not highlight the fact that the availability of detectable and discriminable blur depends on fixation distance (z0) and eccentricity and, therefore, its potential utility as a depth cue will be restricted to a limited region of visual space. cite only estimates of foveal discrimination thresholds to make the wider case for blur as a depth cue (e.g., burge & geisler, 2011 ; walsh & charman, 1988). for spatially extended objects (e.g., figure 1 of held.), the farther object will be imaged several degrees away from the fovea, precluding the kind of discrimination judgment used to measure foveal thresholds (comparing spatially coincident or adjacent target). figure 2a plots empirically measured thresholds for blur detection for different eccentricities on a graph of blur magnitudes for different fixation distances. when the farther object is at a modest 8 eccentricity, defocus blur will be detectable only when the near object is less than about 70 cm away based on data cited by held. moreover, because defocus blur asymptotes with increasing distance beyond fixation, the change in blur beyond the point at which it can be detected will likely be below discrimination thresholds for most fixation distances. (a) plot of defocus blur (blur circle diameter on retina) for a point in space as a function of its distance from the observer for six different fixation distances (0.310 m) assuming a 4.5-mm pupil. a point at fixation is imaged sharply (where the curves touch the abscissa) but points away from fixation are increasingly blurred. dashed lines indicate blur detection thresholds in the near retinal periphery (4, 8 ; wang., 2006). (b) plot of absolute disparity as a function of distance for eight fixation distances (assuming a conservative 54-mm iod). blue dashed line is the disparity detection threshold at 10 eccentricity (blakemore, 1970). (c) regions of visual space where disparity and depth - of - focus blur are detectable and discriminable based on data from blakemore (1970) and wang. blue areas indicate regions of usable disparity and red areas indicate regions of usable blur. foveal disparity detection is far more sensitive, with thresholds near hyperacuity levels (< 10 arcsec ; blakemore, 1970 ; howard & rogers, 2002). thresholds for disparity detection do increase with retinal eccentricity to about 2 arcmin at 10 eccentricity (blakemore, 1970), but this is still well below available for a wide range of fixation distances and depth intervals (figure 2b). moreover, disparity discrimination thresholds in near eccentricity increase more gradually for pedestal disparity than at the fovea. for example, discrimination thresholds for a 60-arcmin pedestal are similar from 010 eccentricity having a value of about 56 arcmin (blakemore, 1970). also, disparity detection and discrimination thresholds decline more gradually in the near periphery for low spatial frequencies (howard & rogers, 2002). thus, in contrast to blur, disparity is detectable and discriminable for a large range of fixation distances and depth separations (figure 2c). the utility of a depth cue for motor tasks depends on its detectability and discriminability under natural task conditions rather than those defined in the laboratory. 's conjectures regarding the use of blur for precision depth judgments and motor tasks are based on an artificial binocular task geometry (figures 1a and b) and fixation distance (28 cm) that create large absolute disparities and diplopia for the farther object. what could be the utility of programming motor tasks or determining precise depth for objects seen only in double vision ? in natural viewing, one generally fixates a region between two points (figure 1c ; e.g., the center of an object to be grasped) or one free scans. tested is significantly shorter than even most natural close - range visual fixation (reading, manual tasks), and would only be used for fine depth tasks and judgments that do not create large disparity pedestals. for farther fixation distances, both absolute disparity pedestal and diplopia reduce sharply beyond fixation, but relative disparities will still be detectable and discriminable. for example, beyond about 4-m fixation, there are no absolute divergent disparities exceeding 60 arcmin ; however, these disparities are of sufficient size to be detectable and discriminable (even outside the fovea) to beyond 40 m (figure 3). thus, disparity is exquisitely suited for making precise depth judgments appropriate to different viewing distances : small depth intervals at near viewing and large depth intervals at far viewing. red lines indicate absolute disparity as a function of distance from the observer for five fixation distances (assuming 54-mm iod). the thick blue dashed line at the bottom of the graph is the disparity detection threshold at 10 eccentricity. the width of the light blue shaded area is the discrimination threshold for zero pedestal. the widths of the two upper blue shaded regions indicate discrimination thresholds for pedestal disparities of 30 and 60 arcmin at 10 eccentricity (blakemore, 1970). note that there are no pedestal disparities greater than 60 arcmin for fixation distances beyond about 4 m. for a fixation distance of 5 m, there are discriminable disparities for objects all the way from less than 1 m up to 30 m beyond fixation (gray dashed line), even for an eccentricity of 10 (middle thin blue dashed line). 's data, when fixating an object less than a foot away (28 cm), blur becomes more discriminable than disparity only when a point is more than 3 cm away from fixation. however, such close visual inspection would typically be used only to discriminate fine depth changes on the order of millimeters, for which disparity is ideally suited. similarly, on the basis of their data, fixating an object at 50-cm (typical of manual tasks) blur would only be discriminable for point separations of more than 15 cm, which is outside the range of most normal grip apertures. for distances of only 1 m moreover, these values for blur are based on assuming the task geometry where one fixates one point to determine the distance to another point (figure 1a). geometries such as figure 1c will provide even less discriminable blur but more optimal relative disparity information. in summary, for most natural depth judgment tasks, disparity is detectable and discriminable for a large range of fixation distances, depth separations, and eccentricities (blakemore, 1970 ; howard & rogers, 2002), whereas detectable and discriminable blur will be restricted to near fixation distances (figure 2c). have demonstrated that defocus blur is more discriminable than disparity at near fixation and high levels of diplopia, but this does not imply that blur can be used to derive quantitative depth as they claim. the depth separations at which they find blur becomes more discriminable bear little utility to fixation - distance - relevant depth judgments. the results therefore do not alter the view that relative defocus blur is likely only an ordinal depth cue (mather & smith, 2002 ; marshall., 1996). this analysis also suggests that it is unlikely that ubiquitous effects in stereoscopic display systems such as the puppet - theatre effect and gigantism are primarily due to a mismatch between disparity and blur acting as complementary depth cues, as claimed by held. these effects occur even at viewing distances of 15 m and beyond (e.g., cinema viewing). at such fixation distances, defocus blur is well below detection / discrimination thresholds (figure 2a) and, therefore, no complementarity between disparities and blur is expected. rather, these effects can be more conventionally explained in terms of the mismatch between depicted familiar object distance / scale and the image distance / scale and disparities. the pattern of blur due to the change in depth - of - focus with viewing distance has been shown to be a quantitative cue to egocentric distance perception (vishwanath & blaser, 2010). depth - of - focus reduces for closer viewing distances, producing a characteristic increase in defocus blur in regions away from the central zone of fixation. the potential role of depth - of - focus blur in near - distance perception was first inferred from the photographic technique of tilt shift miniaturization (vishwanath, 2007). here, objects in photographs of real life scenes appear much closer and miniaturized when blur gradients are simulated in the image with optical or software techniques. this more robust statistical relationship between viewing distance and depth - of - focus (particularly when viewing along a ground plane) suggests that blur may be more useful as an egocentric distance cue than a depth cue for most animals that lack binocularity. however, distance information is required by the visual system to derive absolute depth relations from relative depth cues (howard & rogers, 2002). depth - of - focus blur could contribute to depth perception by scaling relative depth cues (e.g., shading and perspective) to disambiguate absolute depth relations in the absence of vergence and binocular disparities. the video sequence in movie 1 demonstrates an effect that appears to support this idea. photographs of natural scenes with blur gradient applied above and below the central horizontal region of interest (roi) demarcated by the black dotted lines. there are no differences in relative blur in the roi between the blurred versions and the original photographs. compare the impression of depth in the roi between the blur and no - blur versions of the images (click on the image ; a higher quality clip is available for download on the i - perception web site). in the plant images, there is a more definitive sense of separation between leaves and a greater sense of three - dimensionality. in the rock images, there is a greater impression of the undulation of the rock, even though the undulations (bulges and indentations) are orthogonal to the direction of the blur gradient (vertical). the images consist of original photographs of natural scenes and an altered version with a generic blur gradient added to the upper and lower regions. consistent with the role of blur as a distance cue, the objects in the blurred version of each image appear closer. furthermore, depth among components of the scene is also visibly enhanced, an observation confirmed with nave observers (vishwanath & hibbard, 2009). this enhancement can not be explained as a direct effect of relative blur on depth perception because there is no difference in the relative blur of objects / parts in the central region between the two versions of each image. moreover, the blur applied is not locally consistent with depth structure depicted in any of the images. a potential explanation is that such enhancement of depth impression is due to the scaling of relative depth specified by the pictorial cues via the distance information provided by blur (vishwanath, 2010). | the question of whether defocus blur is a quantitative cue for depth perception is a topic of renewed interest. a recent study suggests that relative defocus blur can be used in computing depth throughout the visual field, particularly in regions where disparity loses precision. however, elements of the study 's experimental design and theoretical analysis appear to undermine this claim. first, the study did not provide evidence that blur can be used as a quantitative depth cue. it only measured blur discrimination thresholds, not perceived depth from for blur. second, the study 's conceptualization of the complementary use of blur and disparity, and related conjectures, are based on the specific viewing geometry and fixation distance tested. they do not appear to generalize to natural viewing situations and tasks. i suggest a different way in which defocus blur might affect depth perception. because depth - of - focus blur is a cue to egocentric distance, it could contribute to quantitative depth perception by scaling depth relations specified by other relative depth cues. |
propofol, a widely used drug for induction, often causes local pain when administered into a peripheral vein. several methods have been described to reduce this pain, of which most effective and common are the use of a larger vein and mixing with lignocaine. efficacy of various drugs such as lignocaine, tramadol, ketorolac and ketoprofen have been compared in reducing the propofol - induced pain. furthermore, the analgesic efficacy of drugs such as ketamine and combination of clonidine - ephedrine have been studied by various investigators. 5-hydroxytryptamine-3 (5-ht3) antagonists such as ondansetron, granisetron, ramosetron and palonosetron have been shown to effectively alleviate propofol - induced pain individually. numerous studies have been conducted to know the better among them for prevention of post - operative nausea and vomiting (ponv) but less for reducing propofol - induced pain. ondansetron has been proved to have a local anaesthetic effect, other than antiemetic property. there is no direct evidence for the increased local anaesthetic effect of ramosetron as compared to ondansetron. however, ramosetron is benzimidazole derivative structurally independent of the previously developed 5-ht3 receptor antagonists such as ondansetron, granisetron and tropisetron. since ramosetron is also proved to have higher efficacy than ondansetron for the prophylaxis of ponv, we assumed that it may have a similar usefulness in alleviating propofol - induced pain. ramosetron is one of the potent 5-ht3 antagonist commonly used as an antiemetic and has been found to be effective in prevention of early ponv compared to ondansetron. with this background, we conducted a placebo - controlled study to compare the effect of ondansetron, ramosetron and lignocaine in attenuation of propofol - induced pain during induction of anaesthesia. we included 150 patients belonging to american society of anesthesiologists (asa) physical status (ps) 1 and 2, of either sex, aged 1860 years, weighing between 40 and 80 kg, scheduled for various elective surgical procedures under general anaesthesia. after obtaining approval from the ethical committee and written informed consent from the patients, the study was conducted. the exclusion criteria included patients belonging to asa 3 and 4, patients with known cardiac disorders, other systemic disorders of lungs and liver, pregnant patients, patients for emergency procedures, those allergic to propofol and lignocaine, those with history of motion sickness, history of ponv, on nasogastric tube and patients with difficult airway. patients were randomly divided into one of the three groups using computer - generated random numbers (50 in each group). the drug solution was administered by an anaesthesiologist who was blinded to the constituents of the drug. group l received 0.5 mg / kg of lignocaine and group o received 4 mg of ondansetron and group r received 0.3 mg of ramosetron. all the pre - treatment drugs were made into 2 ml volume with normal saline. prior to surgery, the patients underwent thorough pre - anaesthetic check - up and required investigations. patients were kept fasting for 6 h for solids and were pre - medicated with oral diazepam 10 mg at night. in the operation theatre, intravenous (iv) access was established with 18-gauge cannula in suitable vein on non - dominant hand and was infused with ringer 's lactate solution. vital signs were measured by placing an electrocardiogram, a non - invasive blood pressure monitor, end tidal carbon - dioxide and a pulse oximeter on the patients, followed by a 10 min stabilisation period. patients were given 2 ml of pre - treatment solution iv, containing either lignocaine 0.5 mg / kg (group l), or 4 mg of ondansetron (group o) or 0.3 mg of ramosetron (group r). following 5 s of pre - treatment in all three groups, we manually occluded venous drainage at mid - arm with the help of an assistant. this was followed by injection of 1% propofol (diluted in lct, troypofol, troikaa pharmaceuticals, ahmedabad, gujarat, india) which was drawn immediately before use. one - fourth of the calculated dose was injected over 5 s and 15 s later the patient was assessed for pain during injection of propofol. after induction, patients were intubated and maintained with atracurium and isoflurane. at the end of surgery, residual neuromuscular blockade was antagonised with 0.05 mg / kg of neostigmine and 0.02 mg / kg of atropine. extubation was done when the patients were fully awake and obeying commands. to evaluate the severity of propofol - induced pain, we used a four - point scale with the following values : none (no discomfort at the site of injection, 0 point), mild (the presence of pain without behavioural changes, 1 point), moderate (subjective symptoms or the concurrent presence of behavioural changes, 2 points), and severe (severe pain or the concurrent presence of such responses as making a face, hunching arms or shedding tears, 3 points). considering previous studies, the incidence of propofol - induced pain was assumed as 80% and 50% reduction was considered significant. based on the alpha value of 0.05 and a power value of 80%, our study required at least 41 patients per group. comparison of age, sex, weight and asa ps between the three groups was obtained by student 's t - test. categorical data are reported as numbers and percentages and are analysed using chi - square test or fisher 's exact test as appropriate. the age, weight, gender and asa ps of the patients are summarised in table 1. there was no significant difference in the demographic and baseline characteristics in study groups. the incidence of pain during propofol injection in all groups is represented in table 2. the number of patients with no pain was significantly more in groups l and r compared to group o (p 0.001). the incidence of mild to moderate pain was 28%, 13% and 11% in groups o, r and l, respectively, and that of severe pain was 10% (n = 5) in group o and 2% (n = 1) in both groups r and l. the overall incidence of pain was significantly less in groups r and l compared to group o (p 0.001). iv injection of propofol causes pain at the site of injection and the pain is often reported as severe or even intolerable. the immediate vascular pain on propofol injection is attributed to a direct irritant effect of the drug by stimulation of venous nociceptive receptors or free nerve endings involving myelinated a fibres. the delayed pain of injection has a latency of 1020 s mediated by activation of kallikrein kinin system. numerous studies have been done to investigate the most effective method and drug to reduce propofol - induced pain with variable results. there are several methods to reduce the pain caused by propofol injection including increasing the infusion rate, adding opioids, aspirin and lignocaine, cooling or diluting the propofol, and performing pre - treatment with lignocaine, ephedrine, ondansetron, metoclopramide, nafamostat mesilate, thiopentone or ketamine. there are currently seven types of 5-ht3 receptor antagonists (ondansetron, granisetron, dolasetron, palonosetron, alosetron, tropisetron and ramosetron) and the effect of many of these drugs has been studied in reducing propofol - induced pain. in addition, 5-ht3 receptors are involved in the nociceptive pathway, and this may be the mechanism of these drugs analgesic effect. local anaesthetics contain hydrophilic and hydrophobic structures separated by an intermediate amide or ester linkage. the hydrophilic group is a tertiary or secondary amine, and the hydrophobic group an aromatic moiety. although ondansetron does not possess this aromatic moiety, it has been shown to block sodium channels. recently, ondansetron has been shown to bind to opioid -receptors in humans and exhibit agonist activity. these properties, together with the observation that 5-ht3 receptors are involved in the nociceptive pathways, have been postulated to explain the anti - nociceptive properties of ondansetron. despite that the 5-ht3 receptor antagonist ondansetron and ramosetron share their mechanism of action, they have different chemical structures and exhibit differences in affinity for the receptor, dose response and duration of effect. ramosetron is a tetrahydro - benzimidazole derivative structurally independent of previously developed drugs such as ondansetron, granisetron and tropisetron. ramosetron is more potent and has longer lasting effects because of a slower rate of dissociation from the target receptor and higher binding affinity. since there is no data available regarding the effectiveness of ramosetron compared to ondansetron and lignocaine presently, we conducted this study to evaluate and compare the effect of all three drugs. in a study by ahmed., the incidence of propofol injection pain was reduced from 60% to 15% after granisetron pre - treatment. in another study, severity but not the incidence of pain on injection was significantly reduced by dolasetron (50%) compared with placebo, and there was no significant difference between dolasetron and lignocaine. the incidence of pain was reported to be 60% and 38% respectively with pre - treatment by ramosetron 0.3 mg or combination with ramosetron and lignocaine 20 mg in another study. these results show effective reduction in propofol injection pain. in a study of the effect of pre treatment by palonosetron (0.075 mg) on propofol - induced pain. the results of our study showed that pain caused by propofol had a significant difference between different groups. in contrast, the number of patients without pain in ramosetron and lignocaine groups were 36 (72%) and 38 (76%), respectively. a systematic review of 56 studies, including 6264 patients and 12 various drugs, showed that iv lignocaine (0.5 mg / kg) can reduce the pain up to 60%. lignocaine 1%, 4 ml was shown to reduce the pain of propofol injection by 68% and lignocaine 50 mg was found to be slightly better than ondansetron 4 mg in attenuating pain associated with propofol injection. our studies have also revealed lignocaine to be more effective in reducing propofol - induced pain compared to ondansetron. the incidence of pain was 65% in the placebo group and in lignocaine (40 mg) and ramosetron (0.3 mg) pre - treated groups, it was 35% and 30%, respectively in another study. there is a significant decrease in moderate and severe pain (5% in each) compared with normal saline group (25% and 30%, respectively). in our study, the incidence of pain in ramosetron and lignocaine group were 28% and 24%, respectively. furthermore, the incidence of moderate to severe pain in ramosetron and lignocaine group were 8% and 6%, respectively, in our study. these results show that there is a significant reduction in the pain for propofol injection and both lignocaine and ramosetron are equally effective. the results of a study done by alipour. showed that pain caused by propofol had a significant difference between different groups. the number of patients without pain was 39 in lignocaine and granisetron group (69.64%), 29 in magnesium sulphate group (51.78%), 22 in ondansetron group (39.28%) and 16 in paracetamol group (28.57%), (p 0.001). they concluded that propofol injection pain was less in lignocaine and granisetron groups, in comparison with the others (p 0.001). similarly, in our study, the number of patients without pain were 17 (34%) in ondansetron group, 36 (72%) and 38 (76%) in ramosetron and lignocaine groups, respectively. the effects of lignocaine and ramosetron are similar and higher than the ondansetron group. in the current study, pre - treatment with ramosetron was as effective as lignocaine and more effective than ondansetron in reducing the occurrence of propofol - induced pain. of various types of 5-ht3 receptor antagonists, ramosetron is uniquely effective in the management of early ponv. a study done by swarika. reported that ramosetron 0.3 mg iv was more effective than palonosetron 0.075 mg and ondansetron 8 mg in the early post - operative period. similarly, another study reported that ramosetron 0.3 mg and ondansetron 8 mg were more effective than ondansetron 4 mg for the prevention of ponv (2 h). thus, pre - treatment with ramosetron is an effective method of reducing the occurrence of propofol - induced pain and has the advantage of preventing ponv without the additional administration of other drugs. considering that there was no difference in the outcome of propofol - induced pain with either of the drugs, the choice of agent should, therefore, be individualised with due consideration to the cost - effectiveness and benefit to the patient. pre - treatment with iv ramosetron 0.3 mg and lignocaine 0.5 mg / kg significantly reduced the propofol - induced pain when compared to ondansetron 4 mg. therefore, ramosetron alone can be used to reduce the both propofol - induced pain and ponv. | background and aims : propofol is widely used for induction of anaesthesia, although the pain during its injection remains a concern for all anaesthesiologists. a number of techniques have been adopted to minimise propofol - induced pain. various 5-hydroxytryptamine-3 antagonists have shown to reduce propofol - induced pain. hence, this placebo - controlled study was conducted to compare the efficacy of ondansetron, ramosetron and lignocaine in terms of attenuation of propofol - induced pain during induction of anaesthesia.methods:hundred and fifty adult patients, aged 1860 years, posted for various elective surgical procedures under general anaesthesia were randomly assigned to three groups of 50 each. group r received 0.3 mg of ramosetron, group l received 0.5 mg / kg of 2% lignocaine and group o received 4 mg of ondansetron. after intravenous (iv) pre - treatment of study drug, manual occlusion of venous drainage was done at mid - arm with the help of an assistant for 1 min. this was followed by administration of propofol (1%) after release of venous occlusion. pain was assessed with a four - point scale. unpaired student 's t - test and chi - square test / fisher 's exact test were used to analyse results.results:the overall incidence and intensity of pain were significantly less in groups l and r compared to group o (p 0.001). the incidence of mild to moderate pain in groups o, r and l was 56%, 26% and 20%, respectively. the incidence of score 0 (no pain) was significantly higher in group l (76%) and group r (72%) than group o (34%) (p < 0.001).conclusion : pre - treatment with iv ramosetron 0.3 mg is equally effective as 0.5 mg / kg of 2% lignocaine in preventing propofol - induced pain and both were better than ondansetron. |
in dysphagia of broad aetiology, the accurate diagnosis of pathophysiology underlying swallowing dysfunction is critical for providing appropriately targeted treatments. given the mechanical complexity of swallowing, this has been a major challenge. high resolution solid state manometry (hrm) or hrm with impedance (hrim) are catheter - based diagnostic modalities that are gaining increasing interest as a potential adjunct method for the assessment of pharyngeal function in patients with dysphagia symptoms. it is also mobile and therefore amenable to use at the bedside or in a community clinic setting. used as an adjunct to videofluoroscopy, hrm / hrim the pressure and flow values generated during hrim - measured swallows can be simultaneously analysed using pressure - flow analysis (pfa), an analytical method which unravels greater meaning from the complex sequence of pressure and impedance values than separate analyses of these measures [26 ]. the key to pressure - flow analysis is innovative software, which objectively derives the unique pfa measures of the neuromuscular mechanics of swallowing [7, 8 ]. published studies in adults with pharyngeal dysphagia have shown that pfa measures and a global composite score of swallowing dysfunction, called the swallow risk index (sri), can discriminate normal from abnormal swallows [5, 6 ]. furthermore, individual pfa variables can predict clinically and pathophysiologically relevant aspects of swallowing such as aspiration risk, the presence of postswallow residue, and circumstances of abnormal timing of pharyngeal bolus distension relative to propulsive contraction, a marker of poor oral containment and/or delayed swallow trigger [26 ]. the ability to perform multiple longitudinal, nonradiological hrim measurements of swallowing function over time may have substantial clinical utility. examples include neurodegenerative swallowing decline in motor neurone disease, stroke recovery, iatrogenic dysphagia in head, and neck radiotherapy or assessing interventions such as ues dilatation. the reliability of pfa software has been previously evaluated in two reports utilising hrim studies performed in patients with dysphagia [7, 8 ]. these studies show that software can objectively derive pfa variables and the sri with substantial to excellent inter- and intrarater agreement. presently, the test - retest reliability of repeated hrim recordings, involving reintubation with the same catheter system at a later time - point, is unknown. we therefore aimed to assess the intrarater and interrater agreement as well as test - retest reliability of pfa variables derived by multiple analysts from hrim recordings obtained from the same individuals over two different studies. we report data based on pharyngeal hrim studies performed in five healthy subjects across the age spectrum (2 males, aged 2276 years ; mean age 61 years). we performed the measurements in the department of anaesthesiology, university hospital in rebro, sweden, and these were approved by the central ethics review board in uppsala, sweden (ec : dnr 2013/251 ; approved on 26/06/2013). none of the participants reported any current or past symptoms of dysphagia or upper gastrointestinal diseases, smoked, or took any medications that could affect pharyngeal or esophageal function. we studied volunteers on two different occasions, approximately one week apart, and recorded pressure - impedance data using a 4.2 mm diameter catheter housing 36 circumferential pressure sensors (spaced 1 cm apart) and 18 impedance segments (sierra scientific instruments, inc. catheter placement to straddle the entire pharyngoesophageal segment was performed without topical anaesthesia. following a period of accommodation, participants swallowed 10 10 ml saline boluses on command that were administered via a syringe at > 20 sec intervals. the repeat study was performed with the catheter positioned at the same level of insertion and boluses were administered identically. the master swallow database for this reliability study comprised a total of 100 10 ml swallows (10 swallows two measurements 5 subjects) recorded in manoview (sierra scientific instruments, inc. the acquisition system allowed export of raw pressure and impedance data for each swallow (5 sec window acquired at 100 samples per sec) in text format (.txt) for separate analysis. the deidentified swallows were randomised creating an analyst swallow database numbered from 1 to 100 (figure 1). swallows were consecutively analysed using a purpose designed software platform (aimplot2 ; copyright taher omari, based in matlab version 8.5.0.197613, r2015a ; the mathworks inc.). to operate the software, the analyst opened a colour pressure isocontour plot of each swallow file. with opening, the pressure and impedance data were automatically interpolated (piecewise cubic hermite interpolating polynomial) to increase the data set to a 1 mm spatial resolution. the analysts then defined four space - time landmarks on the plot, as described in the following (see also figure 2):the time of onset of complete ues relaxation;the time of offset of complete ues relaxation;the apogee position of the ues high pressure zone, defined by visualisation of the orad movement of the ues high pressure zone to determine the highest position of the proximal edge of the high pressure zone during the swallowing event;the distal margin position of the ues high pressure zone, defined by lowest position of the distal edge of the high pressure zone before and/or after swallow.guided by definition of these landmarks, the software then automatically generated values for a range of swallow function variables that the analyst copied to a spreadsheet template (microsoft excel ; microsoft corporation, redmond, wa). the time of onset of complete ues relaxation ; the time of offset of complete ues relaxation ; the apogee position of the ues high pressure zone, defined by visualisation of the orad movement of the ues high pressure zone to determine the highest position of the proximal edge of the high pressure zone during the swallowing event ; the distal margin position of the ues high pressure zone, defined by lowest position of the distal edge of the high pressure zone before and/or after swallow. automatically derived swallow variables were separated into three subclasses : one, measures of contractility ; two, measures of intrabolus distension pressure ; and three, measures of flow timing. finally, the swallow risk index (sri), a composite score of global dysfunction, was determined. we provide specific details of all variables in the following (see also figure 2). contractility of the whole pharynx was determined for the pharyngeal stripping wave proximal of the ues apogee position using the average pharyngeal peak pressure (phpp) and the pharyngeal contractile integral (phci) of pressures greater than 20 mmhg from onset of complete ues relaxation to 0.5 sec after offset of relaxation. a discrete hypopharyngeal peak pressure was also obtained at 1 cm proximal to the ues apogee position (hpp). using the e - sleeve method based on maximum axial ues pressures, basal ues pressure (ubp) was determined using the average pressure up to 0.25 sec prior to complete ues relaxation. postrelaxation peak pressure (upp) was determined by the maximum postrelaxation pressure up to 1 sec after relaxation offset. finally, the ues contractile integral (uci) was determined based on postrelaxation pressures greater than 20 mmhg up to 1 sec after relaxation offset. the intrabolus pressure variables measured in this study were for the most part derived using the principle of pressure - flow analysis in that impedance measurement (or its inverse called admittance) guided the position where intrabolus distension pressures should be measured [911 ]. during passage of a highly conductive bolus, the nadir impedance (or maximum admittance, expressed in millisiemens (ms), the unit of electric conductance) corresponds to the time and position where the lumen is most conductive. in normal circumstances this identifies the axial centre, or most distended part, of the intrabolus domain during transport [911 ]. hence, pressure at nadir impedance (or maximum admittance) is an accurate measure of intrabolus distension pressure. intrabolus distension pressure of the whole pharynx (phibp) was determined for the entire pharyngeal region proximal to the ues apogee position using the average pressure at nadir impedance. in addition, discrete hypopharyngeal intrabolus pressures (hibp) were measured 1 cm proximal to the ues apogee position. distension pressure within the ues region was determined based on the 0.25 s integrated ues relaxation pressure (uirp). this is the median of all lowest pressures (contiguous or noncontiguous) recorded measured by the e - sleeve method over a 0.25 sec period [11, 12 ]. the temporal relationship between pharyngeal peak admittance and peak pressure defines the latency from maximum bolus distension to maximal contraction. the distension - contraction latency of the whole pharynx (phdcl) was determined for the pharyngeal region proximal of the ues apogee position using the average time from peak admittance to peak pressure. in addition, a discrete hypopharyngeal distension - contraction latency (hdcl) was also obtained at 1 cm proximal to the ues apogee position. hypopharyngeal flow interval (hfi) defining bolus dwell time in the hypopharynx during the swallow was determined at the level of the hypopharynx and based upon the total time that hypopharyngeal admittance exceeded the threshold of 15 ms, which, in a previous study, optimally defined postswallow luminal closure over the bolus tail. the sri is derived by the formula : sri = ((phibphfi)/(phpp[phdcl + 1]))100. the sri is a composite score capitalising on the observed directionality of four key swallow function variables when assessed in relation to increased dysfunction (as defined by aspiration on videofluoroscopy), namely, decreased contractile vigour (lower phpp), higher intrabolus distension pressure (higher phibp), and aberrant timing (longer hfi and shorter phdcl) [5, 6 ]. six observers repeat - analysed the study database (three medical officers, two speech and language pathologists, and one scientist ; three with previous experience using pfa software). all observers received identical training in the use of the software and the identification of pressure landmarks to derive outcome measures. a demonstration video (30 min) and set of 10 practice swallows enabled the observers to develop a minimum level of understanding and competence in using the analysis software before proceeding to their formal analysis of the database swallows ; then each observer performed repeat analyses of all swallows in their own time. each observer returned two separate data sets of results from their 1st and 2nd analysis of the randomised database comprising 50 primary study swallows and 50 repeat study swallows. analysed data sets were then unrandomised with average values for each metric calculated based on the 10 swallows recorded for each of the five subjects and each of the two studies (i.e., primary and repeat study means for each of the five subjects derived for each of observer analysis runs 1 and 2). we assessed the intrarater agreement (1st analysis versus 2nd analysis), interrater agreement (all rater combinations), and test - retest reliability (primary study versus repeat study) of subject means derived from the analysed data sets (figure 1). reliability measures were derived using the ibm spss statistics package version 22 (ibm corporation, somers, ny, usa). absolute agreement of mean values was assessed using a two - way mixed model of intraclass correlation coefficient (icc) based on single measures. for interrater comparisons, icc was determined for primary study and repeat study using means from the 1st analysis run only. we interpreted the scale of intraclass correlations as follows : 0.000.20 = slight agreement ; 0.21040 = fair ; 0.410.60 = moderate ; 0.610.80 = substantial ; and 0.811.00 = excellent agreement. all observers completed the repeat software - based analysis for all 100 swallows (i.e., total of 200 discrete analysis operations performed by each observer). the intrarater and interrater average intraclass correlation coefficients of swallow function variables showed substantial to excellent agreement across the board (tables 1 and 2, resp.). test - retest results were less reliable with agreement ranging from slight to excellent depending on the class of the swallow function variable examined. contractility variables were less test - retest reliable than intrabolus pressure or bolus flow timing variables (table 3). amongst contractility variables, preswallow ues basal pressure showed excellent agreement from primary to repeat study and measures of ues postrelaxation contractile pressure showed moderate to substantial agreement, whilst agreement of measures of pharyngeal contractile pressure ranged from only slight to substantial (table 3). depending on the contractility variable, the average difference in the pharyngeal contractile pressure measurements from the primary to repeat study ranged from 117 mmhg higher (upp) to 143 mmhg lower (hpp) on repeat (table 4). the test - retest agreement of measures of pharyngeal and ues intrabolus distension pressure was substantial (table 3). depending on the intrabolus pressure variable, the average difference in the distension pressure measurements from the primary to repeat study ranged from 5 mmhg higher (hibp) to 9 mmhg lower (phibp) on repeat (table 4). test - retest reliability of all bolus flow timing measures was substantial to excellent (table 3). the swallow risk index composite score, a global measure of swallowing dysfunction, showed excellent intra- and interrater agreement and substantial test - retest reliability (tables 13) and the average difference in the sri ranged from 2 units higher or 4 units lower on repeat (table 4). using sri calculation from 10 swallows as the benchmark, we performed a separate analysis to determine if the number consecutive swallows used influenced sri reliability. based on 1st analysis results for primary and repeat studies combined (10 measures, two per analyst), the sri derived from the first swallow demonstrated moderate to excellent agreement against the benchmark of 10-swallow average sri (icc range 0.480.88 ; mean 0.73). sri based on the average of at least four consecutive swallows (icc range 0.850.99, mean 0.92) achieved excellent agreement amongst all observers. using data gathered in healthy individuals across the age spectrum, we evaluated the reliability of hrim recordings and swallow function variables. software - derived variables had high intra- and interrater agreement. however, the test - retest agreement of measurements taken in the same individuals 1 week apart was highly dependent upon the variable subtype measured, with intrabolus distention pressures and timing variables displaying the greatest degree of test - retest reliability. the current study, conducted in healthy volunteers, confirms previous evaluations of swallows from patients and healthy subjects showing that software - based analysis of pharyngeal pressure and pressure - impedance recordings can be reliably analysed by different observers, even those with little or no experience with a hrm / hrim procedure [7, 8, 13 ]. we propose that the high degree of reliability stems from the use of highly recognisable spatiotemporal landmarks and the use of objective, software - driven, analysis algorithms. these render to the background any methodological complexities, while at the same time deriving numerical measures easily comparable with reference ranges to detect abnormality and elucidate pathophysiology. it is important to note that the current study tested how reliably results could be generated, but not how reliably they are interpreted. whilst analysts can make reliable measurements, the pathophysiological interpretation of these results is another matter entirely that we have not addressed in our study. in practice, we have applied software - based pfa through derivation of average values for swallows captured following oral administration of a standardised volume and consistency bolus. in the current study, we compared average values derived from 10 10 ml liquid bolus swallows given to each subject during each study. in our view, liquid boluses represent the best system and observer test because they exhibit the greatest swallow to swallow variability due to low viscosity and the potential for air to influence the impedance recordings. whilst we tested and confirmed high levels of interobserver and intraobserver agreement, our primary motivation for performing this study was to assess the test - retest reliability of the method. the reliability of measurements made over repeated hrim investigations is critically important to understand and quantify. this is because the ability to repeat investigations over time improves clinical utility through quantification of changes in swallowing function due to disease or following procedures / interventions. our study shows that intraclass correlations of the test - retest comparisons were lower overall than the intra- and interrater comparisons. hence, by repeating a study, we potentially introduce additional factors superimposed onto the analysis - related factors. this diminishes reliability even though every possible effort was made to standardise conditions that are system - related (e.g., acquisition settings ; catheter processing ; prestudy calibration ; and postacquisition temperature compensation) and/or protocol - related (e.g., clinic room temperature ; time of day ; use of local anaesthetic or not ; nares side ; depth of catheter insertion ; accommodation period ; bolus volume, consistency, and temperature ; and length of study). whilst inter- and intrarater agreement was almost uniformly excellent, we found that test - retest results were less reliable and the level of agreement differed substantially depending on the class of measurement. measures that quantified the isometric pressures generated by the pharyngo - ues stripping contraction agreed least on a test - retest comparison. this was despite the fact that we used state - of - the - art circumferential pressure sensing. indeed, between primary and repeat study, the average absolute contractile pressure and differences exceeded 50 mmhg for most volunteers. poor reliability of the pharyngeal measures of contractility in particular may relate to the fact that the actual location of the catheter within the right, left, or centre of the pharyngeal chamber and movement of the catheter shaft during the swallow was not controlled and could therefore have been different between studies. the pharyngeal constrictors and cricopharyngeus muscle contract asymmetrically and longitudinally as well as in the anteroposterior dimension [14, 15 ]. hence, any longitudinal or axial movement of the catheter combined with subtle positioning differences could have changed the exertion of pressures onto the pressure sensing arrays, potentially altering both measured pressure and ability of observers to see landmarks clearly. on the other hand, test - retest agreement of ues basal pressure and intrabolus distension pressures was substantial to excellent, suggesting that technical factors, such as thermal compensation, pressure drift, sensor failure, and calibration error, are unlikely to explain the selective impairment of the reliability being limited to active contractility measures during swallow. intrabolus distension pressures and measures such as distension - contraction latency, which define timing relationships between waveform peaks, were highly reliable in the test - retest analysis. we believe that this relates to the fact that distension pressures reflect pressures within open distended chamber during bolus flow and, therefore, are not subject to the influences of symmetry. these are furthermore less subject to errors in axial localisation because the bolus distension pressures are usually common over a greater axial distance. on the other hand, timing variables are least affected by these factors because latency measurements do not depend upon the pressure recording being accurate in absolute terms. the fact that distension and timing measures are more reliable may explain why these measures often show significant differences in relation to pathology and bolus - type / consistency. in several populations, bolus distension pressures and flow timing variables appear to be the most critical variables required to differentiate pharyngeal dysphagia patients [26 ]. the swallow risk index combines four key variables into a global composite score predictive of predisposition to aspiration risk. in the current study, the test - retest agreement of sri was substantial and, additionally, we demonstrate that capture of at least four swallows is sufficient for reliable interpretation of the sri. this number is consistent with the findings of a previous study of broad dysphagia patients which showed that at least four swallows are needed to derive an average sri that falls consistently above or below our working diagnostic cut - off (sri 15). whilst a large number of swallows were repeat - analysed (100 swallows, 200 data points for each metric per analyst), the database itself was derived from only five subjects who underwent repeat measurements (10 studies overall). by necessity however, as all measurements were identically and simultaneously derived within the same swallows, we contend that the test - retest comparisons of icc values amongst the different classes of variables (i.e., contractility versus flow timing versus distension pressure variables) are still very meaningful in their interpretation. we also note the very high intra- and interrater agreement in the current study ; this finding is consistent with previous studies that tested intra- and interrater agreement of pressure - flow metrics [7, 8 ]. we did not assess different bolus volumes or consistencies because this would have resulted in an inordinate number of analysis permutations. this was due to the large number of liquid boluses that they would have been required to swallow and the critical need to undergo a repeat measurement, which was not feasible in dysphagia patients. whilst our subjects were healthy, we purposefully included data from aged subjects to enable a wider distribution of results, albeit within the normal range. in conclusion, hrim based pfa measures of swallowing function can be derived using software - based analysis with substantial to excellent intra- and interrater agreement. system - related factors diminish the test - retest reliability of measures of swallowing function. measures of flow timing, intrabolus distension pressure, and a global swallow risk index showed substantial test - retest reliability, whilst measures of pharyngeal and ues contractility show slight to excellent test - retest reliability. | purpose. we evaluated the intra- and interrater agreement and test - retest reliability of analyst derivation of swallow function variables based on repeated high resolution manometry with impedance measurements. methods. five subjects swallowed 10 10 ml saline on two occasions one week apart producing a database of 100 swallows. swallows were repeat - analysed by six observers using software. swallow variables were indicative of contractility, intrabolus pressure, and flow timing. results. the average intraclass correlation coefficients (icc) for intra- and interrater comparisons of all variable means showed substantial to excellent agreement (intrarater icc 0.851.00 ; mean interrater icc 0.771.00). test - retest results were less reliable. icc for test - retest comparisons ranged from slight to excellent depending on the class of variable. contractility variables differed most in terms of test - retest reliability. amongst contractility variables, ues basal pressure showed excellent test - retest agreement (mean icc 0.94), measures of ues postrelaxation contractile pressure showed moderate to substantial test - retest agreement (mean interrater icc 0.470.67), and test - retest agreement of pharyngeal contractile pressure ranged from slight to substantial (mean interrater icc 0.150.61). conclusions. test - retest reliability of hrim measures depends on the class of variable. measures of bolus distension pressure and flow timing appear to be more test - retest reliable than measures of contractility. |
gc is a diffuse glial neoplasm of astrocytic origin that is infiltrating and involving at least 3 cortical lobes. although it is exceedingly rare, gc can occur in children with a length of survival spanning from 6 months to 3 years. this case highlights the need for keeping the possibility of gc in mind when diffuse lesions show a slow response to standard treatment and an earlier tissue diagnosis in such cases. a 12-year - old male presented to a pediatrician with a 1-month history of altered mental status complaining of a headache, neck pain, nausea / vomiting, and vision loss. neurologic examination revealed bilateral papilledema and decreased visual acuity with right sided hemiparesis. magnetic resonance imaging (mri) showed extensive white matter edema in the right temporal and parietal lobes with an enhancing component in the right mesial temporal lobe, mimicking a tubercular granuloma [figure 1 ]. cerebrospinal fluid (csf) showed albumino - cytologic dissociation and cultures were negative for viral, bacterial, and fungal agents. the child was started on alternating triple therapy (att) and intravenous dexamethasone for suspected tubercular encephalitis and appeared to improve clinically showing some interval improvement of the white matter edema on mri. the strange finding on follow - up mri was the disappearance of enhancing component on this treatment [figure 2 ]. however, as the child relapsed, he was referred to us after 6 months. repeat mri again showed the absence of any enhancing component and presence of significant edema involving all three lobes and deep nuclei of the brain. hence, a decision was taken to obtain a tissue diagnosis by right frontal craniotomy and biopsy. stereotactic biopsy was not done in view of the absence of any enhancing component and financial constraints. histopathology revealed round to oval cells with subpial, perineuronal and perivascular spread and mild pleomorphism. contrast - enhanced magnetic resonance imaging depicting an enhancing component in right mesial temporal lobe, mimicking a tubercular granuloma follow - up contrast - enhanced magnetic resonance imaging, after 3 months of steroid therapy and alternating triple therapy, showing disappearance of enhancing component gc in children is rare and difficult to diagnose, often presenting with a variety of signs and symptoms that may mimic encephalitis and other diffusely infiltrative conditions. because tuberculosis is endemic in india and central nervous system involvement very frequent, these similar presentations can confound a diagnosis of gc and delay crucial treatment. both gc and tubercular encephalitis can present with a headache, vomiting and seizures as well as other often vague or site specific neurologic signs. mri is the imaging modality of choice for gc ; however, both conditions are represented as hyperintense lesions on t2-weighted and fluid - attenuated inversion recovery images with variable contrast enhancement rendering imaging studies rather nonspecific. the relative preservation of the blood - brain barrier is the most likely reason for nonenhancement on postcontrast t1-weighted images in most of the cases. neoplastic cells are rarely identified in the csf of patients with gc ; although, in the absence of malignant cells, normal csf studies may be useful in ruling out viral, bacterial and fungal etiologies. evidence of inflammation including pleocytosis and/or increased protein concentrations in csf may point toward a diagnosis of tubercular involvement. the most confusing aspect of this case was the disappearance of enhancing component after starting att, which was probably due to steroids. obtaining tissue for pathologic review is ultimately necessary to confirm the diagnosis of gc. in children these treatments include steroids and anticonvulsants, which unreliably mask symptoms of gc falsely confirming a diagnosis of tubercular encephalitis. as gc can not be excluded in these patients without a biopsy, the physician must risk either delaying treatment in a child with gc or performing an unnecessary invasive brain biopsy on a child with other pathologies. this case report highlights the fact that when there is a slow clinico - radiological improvement after starting att and in view of extensive edema involving all the three lobes, histological evaluation should be done as early as possible. in gc, the glioma cells migrate through the normal parenchyma, collect just below the pial margin (subpial spread), surround neurons and vessels (perineuronal and perivascular satellitosis), and migrate through the white matter tracts (intrafascicular spread). this may reflect the glial cell 's reacquisition of primitive migratory behavior, leading to the spread of individual tumor cells diffusely over long distances and into disparate brain regions. the widespread involvement of near - normal - looking astrocytes has led some neuropathologists to conclude that accurate diagnosis can not be made without a histopathologic study of the entire brain. although most patients with gc undergo disease progression within 1 year, early diagnosis and treatment with radiation have been shown to benefit patient outcomes. there is a small subset of patients with a favorable outcome and increased survival after radiotherapy. kim. reported that the tumor ki-67 labeling index was the only predictor of survival in patients with gc, with increased survival, especially if the ki-67 index is below 10%. | gliomatosis cerebri (gc) is a diffuse infiltrating glial neoplasm of astrocytic origin. gc in children is rare and difficult to diagnose, often presenting with a variety of signs and symptoms that may mimic myriad conditions. we discuss here the presentation and diagnosis of gc in a child who was initially treated on lines of tubercular encephalitis, with transient clinical relief and disappearance of enhancing component of the disease on magnetic resonance imaging. in this report, we highlight the limitations of clinical presentation and neuroimaging as well as the essential role of histological evaluation for the diagnosis of gc in children. also is highlighted a more benign and protracted clinical course following radiotherapy in a subset of patients, with ki index < 10%, thereby stressing earliest possible diagnosis. a new prognostic classification can also be proposed for pediatric gc based on various parameters. since these are rare cases, a combined effort is required for this. |
herein, we describe a unique case of unilateral arm urticaria presenting as a paraneoplastic manifestation of metachronous bilateral breast cancer. similar reports and other paraneoplastic syndromes (pns) associated with breast cancer are described. a 49-year - old premenopausal woman in good health with no chronic disease initially established care at our clinic in february 2013 due to an abnormal mammogram. the screening mammogram revealed abnormal calcifications in the superior lateral and superior medial quadrants of the left breast. review of systems was notable only for a # 12-week history of unilateral left arm urticaria of indeterminate etiology. she had no prior history of urticaria or other dermatological conditions and she denied any new contact or exposures to the left arm. only one of the two areas of calcifications, over a span of 4 mm at the 1:00 position, was reproducible on the diagnostic mammogram. stereotactic - guided biopsy was consistent with atypical ductal hyperplasia with calcifications as well as atypical lobular hyperplasia. a subsequent excisional left breast biopsy by seed localization showed multifocal, grade 1 invasive lobular carcinoma with 3 foci of disease, the largest of which measured 1.2 cm. the patient therefore elected treatment with a left skin - sparing mastectomy with immediate breast reconstruction and left axillary sentinel lymph node biopsy followed by left axillary lymph node dissection after frozen section pathology demonstrated node - positive disease. pathology demonstrated multifocal and multicentric invasive lobular carcinoma, grade ii (out of iii), in a total of four masses comprising a total area of 10 cm. all surgical margins were negative, with 2 (out of 28) lymph nodes sampled positive for metastatic carcinoma (final staging t2 n1 m0, stage iib ; estrogen receptor and progesterone receptor positive, her2 negative with a ki-67 20%). interestingly, the left - sided arm urticaria resolved after resection of the breast cancer without any specific intervention. she received adjuvant dose - dense doxorubicin and cyclophosphamide for 4 cycles followed by 12 weekly doses of paclitaxel. this was followed by radiotherapy to the left reconstructed breast mound and the regional nodal areas. given the hormone receptor - positive disease, she was started on endocrine therapy in the form of tamoxifen with a plan for a minimum 5 years of adjuvant therapy. one year after initiation of tamoxifen and 11 months after a normal screening right mammogram, the patient presented again with severe unilateral arm urticaria and associated excoriations, on the contralateral, right, side (fig. this prompted reimaging in the form of a mammogram which showed a 5 3 mm group of heterogeneous calcification in the right breast at 12 o'clock anterior depth. in addition, there was a 1-mm cluster of calcifications adjacent to the index group. mri of the breast, however, did not show any features suspicious for malignancy. the mammographic findings led to biopsy of the suspicious calcifications, and pathology showed atypical lobular hyperplasia involving 3 or more foci with columnar cell changes. calcifications were also noted in benign ducts and in foci of atypical lobular hyperplasia. given her prior history of urticaria representing a possible pns, her prior node - positive breast cancer despite optimal screening, as well as the high - risk of future breast cancer based on a diagnosis of multifocal atypia, the consensus was to proceed with what was thought to be a risk - reducing nipple - sparing mastectomy and immediate reconstruction on the right side. pathology showed multiple foci of atypical lobular hyperplasia and a single focus of grade i invasive tubular carcinoma, 0.3 cm in greatest dimension (final staging pt1a nx m0, stage ia ; estrogen receptor and progesterone receptor positive, her2/neu negative with a ki-67 0.4%). there was no indication for adjuvant chemotherapy or postmastectomy radiation ; she resumed tamoxifen for adjuvant therapy. the urticaria that was thought to be a paraneoplastic manifestation of the breast cancer again resolved completely and spontaneously after the tumor was resected. there are, however, very few studies addressing the incidence of these various pns in patients with breast cancer and other malignancies. while uncommon, breast cancer can present with varied pns (table 1). these pns can range from mild dermatological symptoms to severe neurological complications and respiratory failure [3, 4, 5, 6, 7 ]. from review of the literature, neurological and dermatological manifestations tend to be the more commonly seen paraneoplastic manifestations, albeit both are relatively rare (table 1). the incidence of various paraneoplastic neurological disorders, for example, was estimated to be around 4% in all patients with breast cancer. other malignancies more commonly associated with paraneoplastic manifestations include lymphoma, gynecologic (ovary) cancers, germ cell tumors, thymomas and lung cancer [10, 11, 12 ]. observation of these pns or manifestations without clear etiology should prompt diagnostics to evaluate for underlying cancers as the etiology. the selection of cancer screening procedures should be guided by patient age and risk factors, with emphasis on the more commonly associated malignancies. early diagnosis in some of these situations is vital to prevent ongoing harm and debility. this, however, is often delayed since the severity of the pns is not necessarily dependent on the size or stage of the tumor. treatment and the overall prognosis are variable depending on the severity and presentation of the paraneoplastic manifestation [8, 15 ]. focused efforts to support symptom management and rehabilitation are important considerations to improve quality of life of patients while concurrently diagnosing and treating the underlying malignancy. removal of the underlying malignancy has been reported to improve or resolve the underlying paraneoplastic process for some of the patients, as in our case [17, 18 ]. pns, including dermatological manifestations, can present with a wide range of signs and symptoms of variable severity. diagnosis of the underlying malignancy is often delayed and is not necessarily dependent on the size or stage of the tumor. knowledge of likely associations with underlying malignancies and age- and risk factor - based appropriate screening in these situations may facilitate prompt diagnosis and treatment of the underlying occult malignancy. the authors are deeply indebted to the patient for allowing us to share her case as a case report. the authors declare that there is no conflict of interest regarding the publication of this article. | various paraneoplastic syndromes (pns) are reported to be associated with breast cancer and can range from mild dermatological symptoms to severe neurological complications. neurological and dermatological manifestations tend to be the more commonly seen paraneoplastic manifestations, albeit both are relatively rare. diagnosis of the underlying malignancy is often delayed since the presence and severity of paraneoplastic manifestations are not dependent on the tumor size or stage. herein, we describe a unique case of unilateral arm urticaria presenting as a paraneoplastic manifestation of metachronous bilateral breast cancer. similar reports and other pns associated with breast cancer are described. recognition of pns associated with underlying malignancies and age - appropriate screening can facilitate diagnosis of the underlying occult malignancy. resection of the underlying malignancy can lead to resolution and/or improvement of the pns for some patients. |
the use of medicines is known to be one of the most effective therapeutic interventions in health care today, especially when utilized responsibly. the world health organisation (who) defines rational medicines use as when a patient receives medications appropriate to clinical needs, in doses that meet their individual requirements, for an adequate period of time and at the lowest cost to them and their family. this is known to have medical, social and economic benefits both to the individual and the society. on the other hand, irresponsible use of medicines has been identified as a major problem in healthcare worldwide ; for instance, who estimates that at least 50% of all medicines are used irrationally. in developing countries where 2050% of health budgets are spent on drugs and other health commodities, irrational medicines use has been documented to contribute to patient morbidity and mortality, increase individual and government spending, as well as reducing confidence in the health care system. it can take the form of self - medication, misuse and underuse of drugs, polypharmacy, unnecessary use of antibiotics and injections, as well as inappropriate prescribing discordant with clinical guidelines. sierra leone is a developing country with a projected population of 6.2 million people in 2014. they are known to be vulnerable to contracting disease and to the harmful effects of medicines. drug prescribing in this cohort is known to be especially challenging due to peculiarities in organ function and disease state reflecting their age, the paucity of pharmacokinetic, pharmacodynamic, safety and efficacy data for these patients, ethical, financial and regulatory limitations and lack of provider training in pediatric pharmacotherapy. therefore, irrational use of medicines including prescribing in this group of patients has been documented to be widespread. for instance, an increased prevalence of adverse drug reactions, self - medication by carers and excessive use of antibiotics have been documented among pediatric patients in the african region. irrational medicine use among this population is further hampered by off - label use of medicines, counterfeit and substandard products, drug shortages, and unregulated advertising. also, irrational prescribing has been identified as a risk factor for developing adverse drug reactions and medication errors in infants. furthermore, determinants of irrational prescribing by doctors include patient demands or expectations, lack of appropriate role models to copy from, lack of objective drug information, and vigorous drug promotion by drug companies. thus, it is vital to study the drug use pattern of doctors in this population with the aim to optimizing drug therapy. the introduction of the free health care initiative in sierra leone 4 years ago for under - fives, pregnant women, and lactating mothers has seen an increased utilization of health services including drugs. however, its impact on an infant (92 death/1000 births) and under - five (156 deaths/1000 births) mortality rates still remain minimal. although, the causes of these high indices are attributed to preventable diseases such as diarrhea, pneumonia, and malaria, irrational medicines use, especially inappropriate prescribing, could also be a contributing factor. in order to describe the drug use situation in health facilities, who developed a set of standardized drug use indicators which can provide a basis for planning and implementation of rational medicine use strategies if any problems are identified. specifically, the prescribing indicators are useful in identifying problems in general prescribing. they include the following : average number of drugs per encounter (measuring the degree of polypharmacy), percentage of drugs prescribed by generic name (which measures the cost - effectiveness of a health system to procure and use drugs), the percentage of encounters with an antibiotic and injection prescribed (measures the level of use of two important, but commonly overused and costly forms of drug therapy) and the percentage of drugs prescribed from the national essential medicines list (neml). studies in the african region and india have been carried out using these who indicators in many health facilities among pediatric populations. for instance, the studies on drug prescribing at a children 's outpatient clinic and at a teaching hospital in nigeria, prescribing in pediatric wards in ethiopia and prescribing practices in the pediatric department of a north indian university hospital, to name a few. these studies have indicated the irresponsible use of medicines in the form of polypharmacy, increased prescription of antibiotics and injectables and non - adherence to national treatment guidelines and or essential medicines lists (eml). in sierra leone, no such study has been done so far regarding rational drug use in pediatric patients, especially under - fives. to address this gap, we decided to evaluate the prescribing patterns for under - five patients at a tertiary pediatric hospital in sierra leone using the who recommended prescribing indicators for drug use and further assess rational prescribing performance using the index of rational drug prescribing (irdp). this study was conducted at the ola during children 's hospital (odch), the only tertiary paediatric hospital in the sierra leone located at the east end of the capital city freetown. it is the referral center for pediatric cases from primary and secondary health facilities countrywide. it also serves as one of the teaching hospitals of the college of medicine and allied health sciences, university of sierra leone (comahs - usl). a descriptive, cross - sectional, retrospective study, which examined prescriptions from october to december, 2013 was conducted. the study population included all patients under - five years of age who were seen by doctors at the outpatient department of odch and for whom medicines were prescribed. the sampling frame included the prescriptions of all under - five patients seen by doctors at the outpatient department of the odch. prescriptions for the 3 months under review were arranged by dates and those used for the study were selected using systematic random sampling. a data collection tool was used to collect information on patient demographics (age and sex), prescribing indicators and pharmacological classes of drugs prescribed from prescription records at the hospital pharmacy of odch. prescriptions outside the study period, those for inpatients and patients above 5 years of age were excluded. ethical clearance was obtained from the comahs research and ethics committee and informed consent was obtained from the hospital administration. the patient demographic data, who prescribing indicators (average number of medicines prescribed per patient encounter, percentage of drugs prescribed by generic name, percentage of encounters with an antibiotic prescribed, percentage of encounters with an injection prescribed and percentage of medicines prescribed from the neml) and pharmacological classes of medicines prescribed were analyzed using the statistical package for social sciences (spss) version 16.0. the irdp was determined by adopting a previously validated method used by dong. optimal levels of drug prescribing indicators each of the five prescribing indicators has an optimal index of 1 ; the closer to 1 the calculated index is, the more rational prescribing is considered to be. the index of polypharmacy was measured by the percentage of nonpolypharmacy prescriptions ; in this study, those prescriptions with three or less medicines where considered as nonpolypharmacy. the generic name index and essential medicine index were measured by the percentage of drugs prescribed by generic name and from the neml respectively. the index of rational antibiotic prescribing was defined as dividing the optimal level (30%) by the percentage of prescriptions including antibiotic. the index of safety injection was calculated by dividing the optimal level (10%) by the percentage of prescriptions including the injection. the irdp, which has a maximum value of 5, can then be calculated by adding the indices. this study was conducted at the ola during children 's hospital (odch), the only tertiary paediatric hospital in the sierra leone located at the east end of the capital city freetown. it is the referral center for pediatric cases from primary and secondary health facilities countrywide. it also serves as one of the teaching hospitals of the college of medicine and allied health sciences, university of sierra leone (comahs - usl). a descriptive, cross - sectional, retrospective study, which examined prescriptions from october to december, 2013 was conducted. the study population included all patients under - five years of age who were seen by doctors at the outpatient department of odch and for whom medicines were prescribed. the sampling frame included the prescriptions of all under - five patients seen by doctors at the outpatient department of the odch. prescriptions for the 3 months under review were arranged by dates and those used for the study were selected using systematic random sampling. a data collection tool was used to collect information on patient demographics (age and sex), prescribing indicators and pharmacological classes of drugs prescribed from prescription records at the hospital pharmacy of odch. prescriptions outside the study period, those for inpatients and patients above 5 years of age were excluded. ethical clearance was obtained from the comahs research and ethics committee and informed consent was obtained from the hospital administration. the patient demographic data, who prescribing indicators (average number of medicines prescribed per patient encounter, percentage of drugs prescribed by generic name, percentage of encounters with an antibiotic prescribed, percentage of encounters with an injection prescribed and percentage of medicines prescribed from the neml) and pharmacological classes of medicines prescribed were analyzed using the statistical package for social sciences (spss) version 16.0. the irdp was determined by adopting a previously validated method used by dong. optimal levels of drug prescribing indicators each of the five prescribing indicators has an optimal index of 1 ; the closer to 1 the calculated index is, the more rational prescribing is considered to be. the index of polypharmacy was measured by the percentage of nonpolypharmacy prescriptions ; in this study, those prescriptions with three or less medicines where considered as nonpolypharmacy. the generic name index and essential medicine index were measured by the percentage of drugs prescribed by generic name and from the neml respectively. the index of rational antibiotic prescribing was defined as dividing the optimal level (30%) by the percentage of prescriptions including antibiotic. the index of safety injection was calculated by dividing the optimal level (10%) by the percentage of prescriptions including the injection. the irdp, which has a maximum value of 5, can then be calculated by adding the indices. the majority of the patients were between the age bracket of 29 days to 24 months and over half of them were male [table 2 ]. demographic data of under - five patients seen at the outpatient department of odch (original) the average number of medicines per prescription was 3.77 ranging from 1 to 8. seventy - one percent (71.0%) of these were prescribed as generics and 70.6% prescribed from the neml [table 3 ]. seventy - five percent (74.8%) and 21.1% of the prescriptions had at least an antibiotic and an injection prescribed respectively [table 3 ]. prescribing indicators at the outpatient department of odch (original) the most common prescribed medicines were the vitamins (85.4%), antibiotics (83.0%), nonsteroidal anti - inflammatory drugs (nsaids) (79.6%) and antimalarials (79.6%). figure 1 shows the different classes of medicines prescribed by doctors at the outpatient department of odch. pharmacological classes of medicines prescribed at the outpatient department of ola during children 's hospital (original). nsaids - nonsteroidal anti - inflammatory drugs the irdp used as an indicator of rational drug use was 2.71. antibiotic prescribing, polypharmacy and injection prescribing had the lowest indices of 0.40, 0.42 and 0.47, respectively. table 4 depicts the irdp of doctors who worked at the outpatient department of odch. the majority of the patients were between the age bracket of 29 days to 24 months and over half of them were male [table 2 ]. demographic data of under - five patients seen at the outpatient department of odch (original) seventy - one percent (71.0%) of these were prescribed as generics and 70.6% prescribed from the neml [table 3 ]. seventy - five percent (74.8%) and 21.1% of the prescriptions had at least an antibiotic and an injection prescribed respectively [table 3 ]. prescribing indicators at the outpatient department of odch (original) the most common prescribed medicines were the vitamins (85.4%), antibiotics (83.0%), nonsteroidal anti - inflammatory drugs (nsaids) (79.6%) and antimalarials (79.6%). figure 1 shows the different classes of medicines prescribed by doctors at the outpatient department of odch. pharmacological classes of medicines prescribed at the outpatient department of ola during children 's hospital (original). antibiotic prescribing, polypharmacy and injection prescribing had the lowest indices of 0.40, 0.42 and 0.47, respectively. table 4 depicts the irdp of doctors who worked at the outpatient department of odch. the results of this study provide valuable information on the prescribing patterns of doctors for under - five patients at a tertiary paediatric hospital in sierra leone. many of the patients seen were 29 days to 24-month - old and there were more males than females, similar to that obtained in a study of pediatric outpatients at a tertiary teaching hospital in lagos, nigeria. polypharmacy is prescribing more medicines than are clinically indicated or the use of an excessive number of inappropriate medicines. an average of four medicines was prescribed per patient encounter in this study, indicating the presence of polypharmacy as this is higher than the optimal value of <3 drugs. this is comparable to the results of similar studies done among pediatric patients in nigeria, ethiopia and in india but in contrast to another in the gambia in which fewer medicines were prescribed. pressure on prescribers from caregivers to prescribe medication for every symptom or condition - even minor ones and the robust drug promotion by pharmaceutical companies are known to influence doctor 's prescribing practices. polypharmacy is known to increase health care cost ; prolong hospital stay due adverse reactions and drug interactions. therefore, the overprescribing of medicines observed in this study has the tendency to undermine one of the major objectives of the free health care initiative in sierra leone which is the reduction of the currently high infant and under - five mortality rates. although not considered in this study, the impact of the irrational use of medicines in general on the currently run free healthcare initiative for under - five children in sierra leone is an area that needs further research. generic prescribing has been found to reduce the cost of medicines and also promote better communication among healthcare providers which is of great importance in developing countries like sierra leone. in the past decade, an increased trend in generic prescribing in developing and transitional countries has been observed and this resonates with our results in which 71% of all the medicines prescribed during the study period were generics. this is also in line with the results of a similar study done in the gambia but different from those conducted in nigeria and in india in which < 41% of medicines prescribed were generics. the high generic prescribing index seen in this study is likely due to increased compliance by prescribers to using the neml as seen by the high percentage (71%) of drugs that were prescribed from it. the increased monitoring mechanism by the free health care initiative ensuring that medicines are prescribed from the eml, of which most are generics, might have had a huge impact. essential medicines are those that satisfy the priority health care needs of the population, selected with due regard to public health relevance, evidence on efficacy and safety, and comparative cost - effectiveness. prescribing from an essential medicine list has also increased progressively over the past 25 years globally and results from studies in the african region have also recorded a similar pattern. the implementation of the who essential medicine program in many african countries over the past decade has contributed to the increased compliance observed. an increase in the inappropriate use of antibiotics has been reported globally, driven by financial and budgetary constraints, market forces, distortion and behavior of health systems, health practitioners, and drug companies. the development of resistance as a result of irresponsible antibiotic use is known to cause prolonged hospital stay, suboptimal therapeutic outcomes leading to death and increased healthcare expenditure. in our study, antibiotics were prescribed in about three - quarters of patient encounters at odch. this high rate of prescribing antibiotics appears to be a common trend in developing countries as evident from findings in the gambia, ethiopia and in india. in such countries, children are at risk of losing their lives to otherwise treatable infections due to the development of resistance to lifesaving antibiotics. the irrational use of antibiotics evident from the low antibiotic prescribing index observed in this study might be a contributing factor to the disturbingly high infant and under - five mortality in sierra leone. nonadherence to standard treatment guidelines has been reported among pediatric patients in rural sierra leone. this might also be the case at odch and can be considered a contributing factor to the irrational prescribing of antibiotics observed in this study. programs targeted at health providers designed to promote the rational use of medicines, especially antibiotics are highly needed if the overall aim of the free healthcare initiative is to be achieved. the increased utilization of injections as a form of irrational medicines use is also a public health concern. it has been documented to contribute to increase hospital waste where waste management systems are not fully efficient, incurs unnecessary pain to the patient, promote the spread of infections like hiv / aids, hepatitis and abscesses and promote microbial resistance, muscle contractures and nerve injury. furthermore, irrational prescribing of antibiotics and injections is expensive in terms of health care cost and health staff time adding extra strain on the already weak health infrastructure. in this study, injections were being prescribed more than necessary, with at least 20% (irdp of 0.47) of all prescriptions at odch having at least one injection. this is similar to that reported by oshikoya. in lagos, nigeria. comparatively, much lower injection prescribing rates were noted in other studies among under - fives in owerri, nigeria and among pediatric patients in india. anecdotal evidence suggests that most parents or guardians prefer injections for their children as they consider it more effective in treating disease than other dosage forms. the increased use of injections in this study might be explained by doctors being under pressure to prescribe them from caregivers. finally, our study also revealed that vitamins, antibiotics, nsaids and antimalarials were the most commonly prescribed pharmacological group of medicines for this group of patients at odch. this result is also in line with others done in nigeria and ethiopia in which antimicrobials, preferably penicillins were the most common medications use. these commonly prescribed medications are a reflection of the pattern of disease burden in the country, as malaria (41%), respiratory tract infections (17%), anemia (12%) and diarrhea (5%) are the major causes of hospital deaths among under - fives in sierra leone. nsaids and to a lesser extent antibiotics predispose to upper gastrointestinal complications in children, which further re - echoes the need for their rational use. further studies are thus needed to determine the appropriateness of prescribing these medicines and to provide more conclusive evidence as to whether they are prescribed rationally or not. the strength of this study is that it provides baseline information on rational pediatric prescribing to which future assessments can be compared when monitoring prescribing trends and providing interventions if needed. for instance, this is a purely descriptive study, and the appropriateness of and underlying reasons or factors influencing prescribing, especially with regards to antibiotics and injections were not assessed. furthermore, how appropriately medications were prescribed with regards to a specific disease was also not considered in this study. furthermore, prescribing patterns for inpatients was also not evaluated. this makes it difficult to develop and implement appropriate intervention (s) that promote rational prescribing. prescribing for under - five out patients at odch is far from being rational and needs improvement, especially with respect to polypharmacy, antibiotic and injection prescribing, as is evident from the low irdp (2.71 out of 5) reported. this impedes efforts to reduce infant and under - five mortality and minimize undue health care costs and is of concern because as a tertiary referral paediatric hospital in sierra leone, patient care should be of the highest quality. the provision of continuous in - service prescribing education for prescribers and regular evaluation of prescriptions are needed. | purpose : there is limited information on pediatric prescribing in sierra leone. this study evaluated prescribing patterns for under - five patients at ola during children 's hospital (odch) and assessed the extent of rational prescribing.methods:a descriptive, cross - sectional, retrospective study of 294 prescriptions, selected by systematic random sampling was conducted at the outpatient department of odch. the world health organisation prescribing indicators were analyzed using the spss package 16.0. the index of rational drug prescribing (irdp) was calculated to assess rational prescribing.results:the average number of medicines per prescription was 3.77. the percentage of medicines prescribed by generic names was 71.0%, while 74.8% and 21.1% of prescriptions had an antibiotic and injection, respectively. the percentage of medicines prescribed from the national essential medicines list was 70.6%. the most commonly prescribed pharmacological groups of medicines were vitamins (85.37%) and antibiotics (82.99%). the irdp was 2.71, instead of the ideal value of 5.conclusion:pediatric prescribing patterns at the outpatient department of odch can not be said to be entirely rational, especially with regards to antibiotic and injection prescribing. |
lung cancer is the most common cause of cancer - related deaths worldwide, with a five - year survival rate of less than 15%. the high incidence of late - stage diagnosis and a lack of efficient therapeutic strategies remain key contributors to the dismal survival statistics. thus, to improve lung cancer patient outcome, improvement in early detection and a better understanding of the underlying tumor biology that governs response to therapy are necessary. response to systemic therapy has been shown to be strongly associated with a variety of clinical and molecular features. for example, the chemotherapeutics avastin and permetrexed have shown differential response or adverse effects in different histological subtypes of lung cancer [2, 3 ]. tyrosine kinase inhibitors (tkis) targeting the epidermal growth factor receptor (egfr) have shown preferential efficacy in asian females who typically harbor sequence mutations in egfr as well as those individuals who harbored egfr amplifications, egfr mutations, and the absence of kras mutations [46 ]. very recently, inhibitors to alk rearrangement also showed significant response in patients who harbor this genetic alteration. in addition to molecular features that can predict sensitivity, there are also examples of features that can predict resistance. in ovarian cancer, resistance to therapy was observed in those individuals who carried amplifications of genes such as p - glycoprotein as well as specific regions in the genome such as 19q12 and 20q11.22-q13.12 [8, 9 ]. with respect to lung cancer, while there are individuals who do respond to tkis, a large proportion will develop resistance to these therapies by acquiring an additional egfr mutation (t790 m), amplification of the c - met oncogene, or hypermethylation of the pten locus [1012 ]. high levels of ercc1 mrna and protein, a key player in nucleotide excision repair, have been associated with resistance to platinum - based chemotherapy. similarly, low levels of rrm1/2 mrna and protein were associated with favorable gemcitabine response in nsclc patients. although alterations in protein - coding genes remain a main focus to elucidate sensitivity or resistance to chemotherapy, deregulation of micrornas (mirnas) has recently been shown to play a role in chemotherapy response [1517 ]. mirnas are small noncoding rnas approximately 1825 nucleotides in length that negatively regulate gene expression posttranscriptionally [18, 19 ]. mirna biogenesis begins with a long, double - stranded rna known as a pri - mirna, typically hundreds to thousands of nucleotides in length, which is processed into sequentially shorter double - stranded rna sequences by the endonucleases drosha and dicer that are of 70 and 22 nucleotides in size, respectively [20, 21 ]. dissociation of the duplex and incorporation of the mature strand into the rna - induced silencing complex (risc) guides risc to the target mrna, where the mirna exhibits its effect. mirnas bind target transcripts based on sequence similarity typically in the 3utr of the transcript and sometimes in the 5utr and the coding region resulting in inhibition of translation or transcript degradation [18, 19, 23 ]. the relevance of mirna deregulation to cancer biology arises because increased expression of certain mirnas can result in downregulation of tumor suppressor genes, while decreased expression of other mirnas can lead to increased expression of oncogenes [20, 21 ]. often located at chromosomal breakpoint regions, fragile sites, and minimal regions of loss of heterozygosity or amplification, mirna loci are highly susceptible to genomic alterations and subsequently, deregulated expression [2427 ]. aberrant mirna expression is a common feature of both dysplasia and cancer, and mirna expression profiles have been associated with prognosis, disease progression, survival, and outcome prediction [28, 29 ]. further, mirna expression profiles have been found to be superior to global mrna expression profiles for the accurate definition of cancer types [30, 31 ]. for example, sensitivity of nonsmall cell lung cancer (nsclc) to cisplatin treatment was linked to upregulation of mir-181a, while resistance was conferred by upregulation of mir-630. sensitivity to another chemotherapeutic agent, gefitinib, was correlated with loss of mir-128b. several studies have shown that the overexpression of specific mirnas, such as mir-134 and let-7a, can increase drug sensitivity, demonstrating the therapeutic potential of mirnas [34, 35 ]. in this study, we sought to determine the role of dna copy number alterations at mirna loci in chemotherapy response. as a proof of principle, making use of datasets generated by multiple institutions, encompassing we performed an integrative and comparative dna dosage and expression alteration analysis of mirna loci in highly sensitive and resistant lung cancer cell lines for 18 different chemotherapeutics. using a rigorous, stepwise analysis strategy, we identified four mirnas which were frequently gained and overexpressed in lung cancer cell lines resistant to one or two of five different chemotherapeutic agents. subsequent gene expression and gene network analyses for each set of mrna targets of a given mirna revealed functions such as dna replication and repair and cellular assembly and maintenance that were overrepresented in all four sets. these findings demonstrate the feasibility and the value of integrative analysis of multidimensional publicly accessible databases as a strategy for pharmacogenomics discovery. drug response ic50 data for 18 different chemotherapeutics across 350 cancer cell lines (see supplementary material available online at doi : 10.1155/2011/474632 supplemental table 1) was generated as part of the wellcome trust sanger institute and massachusetts general hospital 's (mgh) joint genomics of drug sensitivity in cancer project. briefly, ic50 is the required concentration of a particular drug to cause in vitro growth to be inhibited by 50%, and thus, a measure of drug effectiveness. a low ic50 indicates that a drug is very effective at inhibiting growth while a high ic50 indicates that a drug is less effective and thus requires a higher dosage to function. affymetrix snp 6.0 data for the cancer cell lines were obtained from the wellcome trust sanger institute cgp data archive (http://www.sanger.ac.uk/genetics/cgp/archive/). of the 73 lung cancer cell lines with drug response data, 67 of them also had matching snp array hybridization data (supplemental table 2). snp array data were normalized using default parameters in partek genomics suite (pgs, partek inc, st. the current annotation of autosomal mirnas and their genomic coordinates were obtained from the ucsc genome browser (http://www.genome.ucsc.edu/) using the ncbi36/hg18 mapping. mirna and mrna expression profiles for lung cancer cell lines were downloaded from the broad institute (http://www.broadinstitute.org/cgi-bin/cancer/datasets.cgi) under the sanger cell line project. affymetrix hg - u133a mrna expression data were rma - normalized using the affy package in bioconductor in r [3840 ]. mapping of probes to genes was performed using the affymetrix netaffx annotation file (version na31). of the 73 lung cancer cell lines with drug response data, 64 had matching mirna expression while 68 had matching mrna expression data (supplemental table 2). targetspy (version 1.0) and targetscan (version 5.1) mirna target prediction software were used to identify mrna targets for further analyses [4144 ]. for targetspy, the no seed requirement, high sensitivity set of targets were used, while for targetscan, the nonconserved mirna - mrna targets were used. for the mirnas that were further assessed for target analysis, only mirna - mrna target pairs that were present in both databases were assessed for gene expression differences. for dna alteration analysis, copy number profiles of the cancer cell lines were determined against a pooled reference comprised of 72 cytogenetically normal individuals in the hapmap collection. subsequently, to determine copy number gains and losses, copy number profiles were subjected to segmentation analysis using the genomic segmentation algorithm in pgs with the following parameters : minimum genomic markers = 20, p - value threshold for adjacent regions having significantly different means = 1 10, and p - value threshold for deviation from normal (diploid) copy number = 1 10. in addition to meeting p - value thresholds, a region was deemed gained if the cell line had > 2.3 copies while a region was deemed lost if the cell line has < 1.7 copies. for each cell line, the copy number status for individual mirna loci were determined by mapping the genomic coordinates of the mirna loci to the identified regions of alteration. to determine mirna loci in differentially altered regions of copy number between highly resistant and sensitive cell lines, for each chemotherapeutic the frequency of copy number gain, loss, and retention were compared between the top 1/3 and bottom 1/3 of cancer cell lines using a 3 by 2 fisher 's exact test. a mirna was deemed significant if the p value from the fisher 's exact test was.05. for mirna and mrna expression analysis, similar to the differential copy number analysis, cell lines were ranked based on ic50 for each drug. subsequently, for each mirna, the expression in the top and bottom tertiles of cell lines was compared using a nonparametric mann whitney u test. a mirna was deemed significant if the p value from the mann whitney u test was.05. upon identifying which lung cancer cell lines (lccls) contained matching dna copy number and drug response profiles, for each chemotherapeutic, we compared the patterns of copy number alteration between the most sensitive and resistant lccls for 636 mirna loci. of the resulting differentially altered mirna identified using the above statistical criteria, we filtered out those mirnas which were both preferentially gained and lost in either highly resistant or highly sensitive lccls. we defined these variably altered mirnas as those whose differential alteration frequency (daf) of gain, frequency of gain in highly resistant minus the frequency of gain in highly sensitive, was within 10% of the daf of loss, which is the frequency of loss in highly resistant minus the frequency of loss in highly sensitive. in parallel, upon identifying lccls with both mirna expression and drug response profiles, we compared the mirna expression profiles between the most sensitive and resistant lccls for 254 mirnas using the above - mentioned statistical methods. although 418 unique mirnas are represented on the microarray platform, we restricted this analysis to the 254 mirnas that were expressed in at least 4 lccls. subsequently, for each drug, we identified the mirnas which were both significantly different at the dna copy number and expression levels that matched in the same direction that is, if a mirna had higher copy number in the highly resistant lccls as compared to the highly sensitive lccls, then the expression would also have to be higher, and vice versa. next, for each significant mirna, bioinformatic analysis was performed to identify target mrnas, and mrna expression profiles for these genes were compared in a similar manner to that performed in the differential dna copy number and mirna expression analyses (using targetspy and targetscan ; see above). restricting to those targets whose mrna expression profiles negatively correlate with mirna expression profiles, we performed gene network and function analysis using ingenuity pathway analysis to identify significantly overrepresented functions that were common to all sets of differentially expressed mirna targets. a flow chart illustrating this strategy for each mirna, the set of differentially expressed target genes were analyzed using ingenuity pathway analysis (ingenuity systems, redwood city, ca) to determine statistically overrepresented networks and pathways. briefly, a right tailed fisher 's exact test was employed to calculate a p - value for the probability that enrichment of functions within the gene list of interest and the entire list of genes in the human genome is due to chance alone. only the molecular and cellular functions within the biological functions analysis were assessed. sixty seven lung cancer cell lines with available ic50 data were used to analyze mirna copy number alterations. for each drug, cell lines were sorted based on ic50 values and the frequencies of dna copy number gain, loss, and retention were compared between the highest (most resistant, n = 22) and the lowest (most sensitive, n = 22) tertile of cell lines. of the 636 mirnas assessed, 307 mirnas (48.3%) were significantly different between high and low ic50 for at least one drug, and 20 mirnas (3.1%) were different for at least four drugs (p.05 fisher 's exact test, table 1, supplemental table 3). in addition, among the 307 mirnas, 58.4% were either more frequently gained in high ic50 or more frequently lost in low ic50 while 23.6% were either more frequently lost in high ic50 or more frequently gained in iow ic50 lung cancer cell lines. the remaining 41 mirnas (17.9%), although significantly different, had less than a 10% daf difference between resistant and sensitive lines and were, therefore, deemed variably altered (see methods) and subsequently removed. this brought the total number of mirnas with significant differences in copy number to 266 (figure 2). in terms of the drug with the most striking pattern of differential alteration between high and low ic50 cell lines, tae684, a small molecule alk fusion kinase inhibitor, had 66 mirnas that were significantly different between the most resistant and most sensitive cell lines (figure 3). conversely, mir-662 was the most frequently differentially - altered mirna across all of the drugs, appearing significant in 6 of 18 drugs. mirna expression was assessed in 64 lung cancer cell lines using a similar method to that applied for identifying copy number alteration differences, comparison of the highest and lowest tertile of cell lines (n = 21) based on ic50 values for each drug. however, a number of mirnas have little to no expression. to account for these cases, mirnas with expression in less than four cell lines were removed, leaving 292 probes which corresponded to 254 unique mirnas (figure 2). one hundred thirty four mirnas (represented by 146 probes) of the 254 (52.8%) mirnas with available expression data were significant in at least one drug (p.05, mann whitney u test) (supplemental table 4), with 18 mirnas significant in at least four drugs (table 2). of the 134 differentially expressed mirnas, 40% had higher expression in high ic50, while 60% had higher expression in low ic50 lung cancer cell lines. hki-272 had the most mirnas that were significantly different at the expression level (figure 4), and mir-625 was the most frequently differentially expressed mirna, appearing significant in 7 of 18 drugs. to determine if mirna dosage modulates expression, we compared the 266 mirnas differentially altered at the copy number level and the 134 mirnas differentially expressed in at least one of the drugs analyzed. considering only those mirnas that were significant at both the copy number and mirna expression level for the same drug, the intersection of these two lists yielded five mirnas, mir-10b, -191,-193b, -328, and -628 (figure 2). of these five, only expression of four mirnas, mir-10b, -193b, -328, and -628 matched the direction of their respective copy number alterations. for example, mir-628 is more frequently gained in high ic50 lines compared to low ic50 lines treated with agent pf-2341066 and also shows higher expression in high ic50 lines compared to low ic50 lines (table 3), whereas mir-191 is frequently gained in low ic50 lines when treated with tae684, but shows higher expression in high ic50 lines. the target prediction software targetscan and targetspy were used to identify putative mrna targets of mirnas found to be significantly different at the copy number and mirna expression levels between high - ic50 and low - ic50 cell lines. for the four mirnas (mir-10b, mir-328, mir-193b, and mir-628) identified by integrative analyses, only mirna - mrna targets present in both databases were used for further analysis. mir-10b was identified as having a significant association with response to the proteosome inhibitor mg-132. in total, target prediction analysis found 636 genes that were deemed as putative targets of mir-10b (supplemental table 5). comparison of the gene expression profiles between lung cancer cell lines with high and low ic50 for mg-132 revealed 48 of these target genes to be differentially expressed (p.05, mann whitney u test), with 32 of them showing the expected direction of differential expression (i.e., anticorrelated mrna expression to mirna expression) (table 4). interestingly, mir-193b alteration was significantly associated with response to two therapeutics : az628 and mk0457 (raf and aurora kinase inhibitors, resp.). when a similar analysis to hsa - mir-10b was performed for mir-193b, 518 genes were identified as putative targets of mir-193b (supplemental table 5). for the analysis of gene expression between highly sensitive and resistant az628 cells, 28 of these targets were differentially expressed, with ten of these genes matching the expected direction of differential expression. for mk-0457, 67 of these target genes were differentially expressed with over half (37) matching the expected direction (table 4). alteration of mir-328 was significantly associated with the response to hsp90 inhibitor geldanamycin in lung cancer cell lines. of the 437 genes targeted by mir-328, 49 of these genes were significantly differentially expressed between highly resistant and sensitive cell lines, with 31 of the genes matching the expected direction (supplemental tables 5 and 4). finally, for mir-628, whose alteration was significantly associated with the met inhibitor pf-2341066 response, 392 targets genes were identified with 49 of them being differentially expressed and 22 of those in the appropriate direction (supplemental tables 5 and 4). chemotherapy response can be influenced by a number of clinicopathological and molecular factors. at the molecular level, while a large focus revolves around the role of activating and inactivating sequence mutations as well as copy number amplifications and deletions in protein coding genes, there has been an increasing emphasis on examining the role of mirnas and response to chemotherapy. recent studies have focused on differentially expressed mirnas in conjunction to resistance and sensitivity to a variety of chemotherapeutics [3235, 45, 46 ]. however, the influence of copy number alterations at mirna loci (or gene dosage) in the context of drug response has not been thoroughly investigated. to this end, we have performed an integrative analysis of genome - wide mirna copy number, mirna expression, mrna expression, and drug sensitivity data from 18 different chemotherapeutics on a panel of lung cancer cell lines to identify mirnas that are significantly different at the copy number and expression levels between the most sensitive and resistant cell lines for a given drug. upon comparison of the 636 annotated mirnas throughout the human genome, it was found that 266 of them revealed significant differences in copy number alteration pattern between sensitive and resistant cancer cell lines for at least one drug (supplemental table 3). moreover, of the 266 mirnas, there were more mirnas with increased copy number for the highly resistant versus the highly sensitive lung cancer cell lines than vice versa. the mirna that was found to have a differential pattern of copy number alteration between sensitive and resistant cancer cell lines for the most drugs was mir-662, and, conversely, the drug with most significantly different mirnas was tae684. mir-662 is located on chromosomal region 16p13.3 and was found to be more frequently gained in cell lines highly resistant to az628, erlotinib, geldanamycin, g-6976, hki-272 (neratinib), and mk-0457. all of these drugs, except for geldanamycin, which is an antibody that targets hsp90, are kinase inhibitors. while not much is known of mir-662, it was recently shown that it is transiently upregulated in response to high doses of x - ray radiation in human fibroblasts. it should also be noted that mir-124 - 2, mir-1285 - 2, and mir-548h-2 were significantly altered for five drugs (table 1). however, mir-124 has been shown to play a tumor suppressive role in cervical cancer, hepatocellular carcinoma, and glioblastoma, while mir-1285 inhibits p53 and p21 expression by targeting the 3utr of p53 transcript [4952 ]. to identify differentially expressed mirnas in our dataset, we employed the same approach used to identify differential copy number alterations by assessing the expression of 254 mirnas in 64 lung cancer cell lines. we identified 134 unique mirnas significantly different at the expression level between resistant and sensitive lines in at least one drug. of which, 40% overexpressed in highly resistant and 60% overexpressed in highly sensitive lung cancer cell lines. of these 134 mirnas, mir-625, about which little it was significantly differentially expressed in the analyses of agents paclitaxel, hki-272, g-6976, erlotinib, rapamycin, pha665752, and mg-132. in terms of the drug comparisons with the highest number of differentially expressed mirnas, the comparison between lccls highly sensitive and resistant to hki-272, an irreversible tyrosine kinase inhibitor of her2, revealed 30 differentially expressed mirnas. previous studies of mirna deregulation with respect to response of some of the drugs used in our analyses have identified a number of mirnas whose expression correlates with drug sensitivity. for example, underexpression of mir-34a and overexpression of mir-125b, 2 - 21, -222, and -923 confer paclitaxel resistance in prostate cancer and breast cancer, respectively, while for hepatocellular carcinomas expression of let-7c, mir-122 and mir-193b confer sensitivity to sorafenib. notably, sorafenib is a multikinase inhibitor with highest potency for raf ; this is consistent with our findings that link mir-193b with resistance to the raf inhibitor az628. in addition, underexpression of mir-130a and -126 was correlated with resistance to paclitaxel and imatinib, respectively. from our analyses, we observed mir-130 and -126 to be overexpressed in lung cancer cell lines sensitive to paclitaxel and imatinib. cancer genomes are characterized by widespread genetic aberrations including high - level amplifications, deletions, dna methylation, mutations, and chromosomal rearrangements. within the hundreds of alterations in a cancers genome, only a small subset of these alterations drive tumor initiation and progression and dna alterations with corresponding expression alterations are more likely to contribute to tumorigenesis [60, 61 ]. to identify mirnas likely implicated in drug resistance, we integrated the 266 mirnas that were significantly different at the copy number level and the 134 mirnas that were significantly different at the expression level and subsequently filtered for those mirnas that were differentially expressed and altered in the same drug. our analysis identified four mirnas, mir-10b, -193b, -328, and -628, that met these criteria. while the overlap of significant mirnas in the same drug is minimal, stringent selection criteria such as p.05 for both copy number and expression alterations, and limited mirna expression data, likely contributed to the small number of overlapping mirnas. importantly, many of the mirnas most frequently differentially altered at the copy number level (128 of 266, 48.1%) were not represented on the microarray platform. moreover, when we factored in our expression criteria of expression in at least four cell lines, the number of mirnas with expression profiles and significantly different copy number alterations was reduced to 66. the copy number profiles of these mirnas suggest they may play an important role in drug resistance, dictating the importance and need to assess these uninvestigated mirnas at the expression level. the observation that mir-10b is differentially gained and overexpressed in resistant cell lines treated with mg-132 is consistent with previous findings (figures 5(a) and 5(b)). mir-10b is an oncomir whose overexpression has been identified in a variety of cancers [6267 ]. specifically, overexpression of mir-10b has been demonstrated to promote the development of metastatic disease in breast cancer and correlate with clinical breast cancer progression, poor overall survival in gastric cancer, and higher grades of malignant glioma. it was also found to be an effective therapeutic target by using antagomirs to reduce expression of hoxd10, subsequently suppressing breast cancer metastasis [62, 64, 66, 68 ]. bioinformatic and gene expression analysis of mrna targets of mir-10b revealed 32 of 636 target genes that were underexpressed in highly resistant cell lines, which have high expression of mir-10b. amongst the identified genes rad1 is part of a complex of proteins known as the 9 - 1 - 1 complex, which functions as a heterotrimeric cell cycle checkpoint. the complex, which functions in dna repair, is recruited to the site of dna damage or incomplete replication where it recruits dna polymerases and dna repair enzymes. rad1 has been shown to be important in preventing tumor development in response to dna damage in mice, whereas deletion of rad1 greatly increased the susceptibility for skin tumor development. in addition, rad1 is an important component of nucleotide excision repair (ner) which can have drastic effects on chemotherapy drug response. in drugs that instill double stranded dna breaks, such as the platinum based treatment cisplatin, upregulation of ner increases drug resistance while in certain non - dna damage based chemotherapies, downregulation of ner has been shown to increase resistance [71, 72 ]. in nsclc patients that have low expression of ercc1, a gene also involved with ner, have decreased survival when compared to patients with high ercc1 expression, and in both murine and human cells, low xpc expression, another gene involved in ner, correlated with resistance to the doxorubicin derivative, nemorubicin. intriguingly, one of the overrepresented functions identified by ingenuity pathway analysis of the 32 differentially expressed target genes was dna replication, recombination, and repair (figure 6). high expression of mir-193b is frequently observed in head and neck squamous cell carcinomas and is associated with a high risk of metastatic disease in uveal melanoma [74, 75 ]. conversely, in other cancer types, overexpression of mir-193b has elicited increased tumor suppression as well as sensitivity to specific chemotherapeutics [57, 76, 77 ]. moreover, conflicting results have also been observed within a given cancer type. in malignant cutaneous melanoma, overexpression of mir-193b predicts disease outcome and is associated with poor survival, while induced overexpression in cell lines repressed proliferation through the downregulation of cyclin d1 [78, 79 ]. subsequent gene expression analysis of target mrnas of mir-193b revealed 10 genes that were underexpressed in cell lines highly resistant to az628and 37 genes that were underexpressed in cell lines highly resistant to mk-0457. one of the target genes that was also differentially expressed was ikaros family zinc finger 1 (ikzf1). this transcription regulating gene functions through associations with complexes that are both histone deacetylase (hdac)-dependent and hdac - independent. previous studies have shown that nonhigh - risk all9 patients with ikzf1 deletions show a 12-fold higher rate of relapse compared to patients without ikzf1 deletions and ikzf1 deletion has also been implicated in tyrosine kinase inhibitor (tki) resistance and disease progression in patients with chronic phase- (cp-) chronic myeloid leukemia (cml) [81, 82 ]. overexpression of an isoform of ikzf1 lacking a dna binding domain, ik6, in acute lymphoblastic leukemia (all) patients with the philadelphia chromosome has also been associated with tki resistance. underexpression of ikzf1 as a result of mir-193b targeted degradation may increase resistance to mk-0457 in a similar mechanism to tki resistance. similar to mir-193b, evidence supporting the role of mir-328 in cancer is also unclear. in lung adenocarcinoma, mir-328 has been shown to be overexpressed in tumor tissue relative to matched nonmalignant tissue regardless of egfr or kras mutation status. however, in other cancer types, mir-328 underexpression, for example, enables drug resistance through the upregulation of abcg2 and correlates with cancer progression [8486 ]. our analyses revealed mir-328 to be gained and overexpressed in lung cancer cell lines resistant to geldanamycin, an antibody against hsp90. target and gene expression analysis of mir-328 identified 31 genes underexpressed in cell lines highly resistant to geldanamycin, with one of the targets being the vitamin d receptor (vdr). vdr and its downstream components, have been previously shown to have antiproliferative effects in a wide variety of cancer types. the anticancer effects of vdr signaling are mostly mediated through its active metabolite, 1,25-dihydroxyvitamin d (calcitriol), which has been shown to exhibit anti - inflammatory effects as well as the suppression of tumor angiogenesis, invasion, and metastasis [87, 88 ]. expression of vdr has also been shown to be associated with increased survival in breast, colorectal cancer, and cholangiocarcinoma. it has been recently shown that nuclear vdr status may be a prognostic marker of improved survival in patients with nsclc. another intriguing finding for mir-328-associated mrnas is the implication of both h(+)-monocarboxylate cotransporter (mct) proteins 1 and 4 (slc16a1/mct1 and slc16a3/mct4). inhibition of mct1 in tumors can shift aerobic cancer cells from oxidative phosphorylation (lactate metabolism) to glycolysis (glucose), resulting in the death of hypoxic tumor cells due to glucose deprivation. a recent study revealed that mir-628 was expressed in neuroblastomas with favorable prognosis, while those with unfavorable prognosis were devoid of expression, suggesting a tumor suppressive role in this type of cancer. from our analyses, we identified mir-628 to be gained and overexpressed in resistant lung cancer cell lines treated with agent pf-2341066, a met and alk kinase inhibitor which has recently shown tremendous efficacy in a subset of lung cancer patients. while the direction of expression contradicts the findings in neuroblastoma, mirna tissue specificity may play a role in differential expression patterns. regardless, further analysis of mir-628 is required to better elucidate its role in human cancers. target and gene expression analysis of mir-628 revealed 22 genes which were underexpressed in cell lines highly resistant to pf-2341066, with one of these differentially expressed being caspase 3 (casp3). casp3 is a gene involved in the caspase apoptosis cascade by activating caspases 6, 7, and 9 through cleavage. moreover, it is also used as a general indicator of cell death and apoptosis. notably, pf-2341066, which functions as a tki inhibitor, was found to induce the caspase cell death cascade in vitro through increased levels of casp3. thus, casp3 downregulation, as a result of mir-628 targeting, may play a significant role in resistance to pf-2341066. while all involved in response to different drugs, the targets of these mirnas share certain biological functions. figure 6 illustrates the functions in which the targets of all four mirnas participate at a statistically significant level. broadly, if roles such as cellular maintenance and dna repair were compromised, such cell populations could develop tolerance to the accumulation of mutations, some of which could dictate resistance. participation in small molecule biochemistry has implications in the alteration of how these administered drugs are processed. cellular organization and cell - to - cell signaling, if altered, could confer a more invasive phenotype, contributing to drug resistance. in conclusion, we have demonstrated our method of integrative analysis of multiple dimensions of data including genome - wide mirna copy number, mirna expression, mrna expression, and drug sensitivity data, all available in the public domain, can be a powerful tool to identify mirnas and genes involved in drug sensitivity. through these initial analyses, we have identified mirnas that may have a role in conferring chemoresistance to a number of drugs. further in vitro and in vivo analyses of the mirnas and their respective mrna targets will be necessary to confirm the findings from this study. in addition, given that nearly half of the mirnas that were differentially altered were not even represented on the mirna platform analyzed, evaluation of these mirnas may prove fruitful when new data becomes available. it should also be noted that mirna target prediction approaches and algorithms are constantly evolving and increasing number of mirna - mrna interactions being experimentally validated, potentially revealing important target genes that are not currently implicated. finally, since the mgh / sanger collaboration aims to generate drug response profiles for a large number of chemotherapeutics in over 1000 cancer cell lines, as more data becomes available, our approach could identify candidate mirnas that are associated with multiple drugs which have similar mechanisms of action. moreover, our strategy could also be repeated in a more specific and clinically relevant manner, which could ultimately lead to the identification of prognostic biomarkers and therapeutic indicators for better disease management and patient outcome. | chemotherapy resistance is a key contributor to the dismal prognoses for lung cancer patients. while the majority of studies have focused on sequence mutations and expression changes in protein - coding genes, recent reports have suggested that microrna (mirna) expression changes also play an influential role in chemotherapy response. however, the role of genetic alterations at mirna loci in the context of chemotherapy response has yet to be investigated. in this study, we demonstrate the application of an integrative, multidimensional approach in order to identify mirnas that are associated with chemotherapeutic resistance and sensitivity utilizing publicly available drug response, mirna loci copy number, mirna expression, and mrna expression data from independent resources. by instigating a logical stepwise strategy, we have identified specific mirnas that are associated with resistance to several chemotherapeutic agents and provide a proof of principle demonstration of how these various databases may be exploited to derive relevant pharmacogenomic results. |
acne vulgaris is a disorder of the pilosebaceous unit that is characterized by comedones, papules, cysts, nodules, and scarring. it is one of the top three most commonly encountered dermatological problems in both primary and secondary care (rea., 1976). while the condition is not life threatening, it can cause significant psychological morbidity and lead to lifelong scarring and some cases of facial disfigurement if left untreated. acne vulgaris typically starts around the age of 12 to 14 years but tends to manifest earlier in female patients. patients peak age for severity is 16 to 17 years in female and 17 to 19 years in male patients. simpson (1991) states that 95% of boys and 83% of girls are affected during their adolescent and young adult life. hunter. (2002) concluded that acne has no gender predilection and affects both sexes equally. this article examines acne through the ages and discusses the myths and theories that surround its etiology as well as developments in acne treatments with a focus on isotretinoin and its impact on women s health (fig. eruptions of the face, head, and hands : with the latest improvements in the treatment of diseases of the skin [internet ]. eruptions of the face, head, and hands : with the latest improvements in the treatment of diseases of the skin [internet ]. greek physicians aristotle and hippocrates used the greek words ionthoi and varus to describe acne as a condition that is strongly associated with puberty (grant, 1951). in fact, the singular form of ionthoi translates to the onset of beard growth. in the ebers papyrus (fig. 2), ancient egyptians used the term aku - t, which means boils, blains, sore, pustules, or any inflamed swelling (grant, 1951). given its phonetic resemblance to the term we use today, this likely represents the root word of acne. the term acne vulgaris (vulgaris means common) was first used by fuchs in 1840 and has persisted to the present day (grant, 1951).fig. 2excerpt from the ebers papyrus wherein one passage mentions a prescription dating from the first dynasty (circa 3400 bc). 2 excerpt from the ebers papyrus wherein one passage mentions a prescription dating from the first dynasty (circa 3400 bc). available from : https://commons.wikimedia.org/wiki/file:a_page_from_the_ebers_papyrus,_written_circa_1500_b.c._wellcome_m0008455.jpg?uselang=en-gb skin disease was historically seen as a manifestation of internal problems and thought to represent the need to balance the four humors defined in ancient greek medicine. humors existed as liquids within the body and were identified as blood, phlegm, black bile, and yellow bile. pores in the skin were regarded as orifices through which humors could pass. in the 16th century, sir thomas elyot (fig. 3) in his castell of health described a condition due to an abundance of melancholy blood. elyot may have seen acne as part of a wider endocrinological syndrome because he describes obesity of the upper body that is associated with boils, increased urine, and black pouches (grant, 1951). in 1638, riolanus associated acne with menstruation - related disorders (grant, 1951). vari are little hard tumours on the skin of the face curdled up of a hard thick juice. they are of the bigness of hemp seed, and they infect young people that are inclined to venery and fruitful, but chast withal and continent (grant, 1951 ; fig. 4).fig. 3portrait of sir thomas elyot (1532 - 1533) by hans holbein the youngersource : royal collection at windsor castle [internet ]. 4hemp seeds (left rule divisions in mm)source : photo by erik fenderson [internet ]. 4 portrait of sir thomas elyot (1532 - 1533) by hans holbein the younger source : royal collection at windsor castle [internet ]. available from : https://commons.wikimedia.org/wiki/file:holbein_sir_thomas_elyot.jpg?uselang=en-gb hemp seeds (left rule divisions in mm) source : photo by erik fenderson [internet ]. available from : https://commons.wikimedia.org/wiki/file:hempseed.jpg?uselang=en-gb it was not until the invention of microscopes that skin glands were identified and allowed for advancements in dermatology. italian researcher marcello malphigi discussed pores as the opening of glands in the skin in his book opera postuma (zouboulis. hermann boerhaave, a dutch professor of medicine and botanics, also supported this view (zouboulis., 2014). 5) who described them in his book de sedibus et cause morborum per anatomen indagatis (zouboulis., 2014).fig. 5engraving of giambattista morgagni (1682 - 1771) by g. simoncellisource : burgess r. portraits of doctors and scientists in the wellcome institute. 5 engraving of giambattista morgagni (1682 - 1771) by g. simoncelli source : burgess r. portraits of doctors and scientists in the wellcome institute. [internet ]. available from : https://commons.wikimedia.org/wiki/file:giovanni_battista_morgagni_(1682_-_1771),_italian_anatomist_wellcome_v0004121.jpg?uselang=en-gb german physician karl gustav theodor simon was a hobbyist microscopist based in berlin who, in 1842, saw a living, moving creature when examining tissue that was affected with acne. postulation became certainty when i pressed the object under observation very gently between two glass plates and saw very clearly that it moved simon published his observations in 1848 in his work die hautkrankheiten durch anatomische untersuchungen erlautert (skin conditions explained through anatomical investigation ; plewig and kligman, 2012). english dermatologist samuel plumbe published a practical treatise on the diseases of the skin in 1837 (fig. he described blockage of the sebaceous glands as follows : it has been constantly observed, that persons of sanguine temperament and florid complexion have been most subject to follicular inflammation ; and among these, that young men between the ages of 20 and 25 have been the greatest sufferers from it. females, at the same age, are also subjects in whom its visitations are not infrequently manifested, but, in the latter, it rarely proceeds with such rapidity to suppuration, or produces such unpleasant appearances as to extent (plumbe, 1937).fig. 6excerpt from a practical treatise on the diseases of the skin (electronic resource)- arranged with a view to their constitutional causes and local characters (1838) demonstrating the skin 6 excerpt from a practical treatise on the diseases of the skin (electronic resource)- arranged with a view to their constitutional causes and local characters (1838) demonstrating the skin 7) and thomas bateman, who are regarded by some as the fathers of modern dermatology, divided acne into four types based on the associated lesions : simplex, punctate, indurate, and rosacea (mccaw, 1944). the first three types were identified as local lesions that require local remedies ; however, rosacea was deemed a cutaneous manifestation of underlying stomach or liver problems.fig. 7robert willan, english physician and possible founder of dermatologysource : wikepedia [internet ]. 7 robert willan, english physician and possible founder of dermatology source : wikepedia [internet ]. eduard von jacobi (1903) wrote in atlas der hautkrankheiten that many morbid processes conspire to favour the existence of the disease, a peculiar seborrhoeic condition is frequently present, which gives rise to the formation of comedones. he continued that specific significance attributed to various bacteria found in the pus of acne pustules is contestable. over the centuries, our understanding of the multifactorial pathophysiology of acne vulgaris has improved. there is a genetic component with acne vulgaris that is thought to be familial in half of the cases. studies of monozygotic twins, for example, show a high concordance of the sebum excretion rate in acne ; however, dizygotic twins do not show the same concordance. in the past, acne vulgaris was regarded as an infectious disease but today, it is recognized as an inflammatory process in which propionibacterium acnes and innate immunity trigger a cascade of events at the level of the pilosebaceous unit that break down triglycerides to release free fatty acids, produce substances that are chemotactic for inflammatory cells, and induce the ductal epithelium to secrete pro - inflammatory cytokines (interleukin [il]-1, il-6, il-8, il-10, il-12 and tumor necrosis factor alpha [tnf ]). the inflammatory reaction continues by means of a type iv immune reaction to one or more antigens in the follicle. it was previously thought that abnormal keratinization occurred first but current understanding is that inflammation, namely the expression of il- from the open comedones, precedes abnormal hyperkeratinization (das and reynolds, 2014). a keratin plug forms at the follicular infundibulum from follicular epithelial hyperproliferation and retention of keratinocytes. a complex interplay that involves increased sensitivity to androgens and increased androgen levels, sebum lipid composition, p. acnes overgrowth, and local pro - inflammatory cytokines drive epithelial hyperproliferation. the biofilm that is produced by p. acnes perpetuates comedone formation and the hyperkeratinization process by propagating the infundibular plug (das and reynolds, 2014). while greeks preferred vegetable - based treatments for acne, egyptians typically opted for animal - based products (zouboulis., 2014). the one common treatment they used was honey ; however, given its popularity with both civilizations to treat a wide range of ailments, this may be a mere coincidence. throughout the middle ages, treatment development stagnated and was based on balancing humors, diets, herbal remedies, and prayers. botanical and herbal treatments were still used in 1936 as seen in cosmetic dermatology, a good guide on historical treatments (goodman, 1936). goodman first stated the importance of a good history that includes information about diet, cathartics, periods, urine, blood sugar, ingestion of bromide or iodine drugs, blood purifiers, headache medicine, nerve tonics, and sleep potions. topical treatments were classified into keratolytic, antiseptic, astringent, emollient, and keratoplastic therapies. some examples of keratolytic therapies that were championed by goodman are outlined in box 1.box 1keratolytic therapyvleminckx solution (16 parts lime, 24 parts sublimed sulfur, and 100 parts water)lotio alba nascent gas (50 parts zinc sulfate and 50 parts potassium sulfate)injections of salt solutionkummerfield s lotion (1 part camphor, 2 parts acacia, 4 parts glycerin, 10 parts precipitated sulfur, and 100 parts of rose water)ergot ointment (0.8 part phenol, 8 parts ergot, 8 parts chalk, 8 parts zinc oxide, 24 parts cold cream, and 100 parts lanolin).alt - text : box 1. vleminckx solution (16 parts lime, 24 parts sublimed sulfur, and 100 parts water)lotio alba nascent gas (50 parts zinc sulfate and 50 parts potassium sulfate)injections of salt solutionkummerfield s lotion (1 part camphor, 2 parts acacia, 4 parts glycerin, 10 parts precipitated sulfur, and 100 parts of rose water)ergot ointment (0.8 part phenol, 8 parts ergot, 8 parts chalk, 8 parts zinc oxide, 24 parts cold cream, and 100 parts lanolin). vleminckx solution (16 parts lime, 24 parts sublimed sulfur, and 100 parts water) lotio alba nascent gas (50 parts zinc sulfate and 50 parts potassium sulfate) injections of salt solution kummerfield s lotion (1 part camphor, 2 parts acacia, 4 parts glycerin, 10 parts precipitated sulfur, and 100 parts of rose water) ergot ointment (0.8 part phenol, 8 parts ergot, 8 parts chalk, 8 parts zinc oxide, 24 parts cold cream, and 100 parts lanolin). goodman also discussed peels and recommended an initial application for 1 to 3 hours and, if the patient had no adverse reaction, to extended the peel for a full treatment lasting 12 hours. the peels he described contained (a) 40 parts resoricin, 10 parts zinc oxide, 6 parts kaolin, 100 parts benzoinate lard, and (b) 32 parts resoricin, 20 parts potash soap, 20 parts sulfur lotum, and 100 parts spirits of lavender. antiseptic therapy as recommended by goodman were iodine, picric acid, sodium carbonate, camphor, alcohol, and boric or oleic acids. of note yes. many matrons who grieved in their youth over the structural defects of the skin leading to enlarged pores are the envy of their daughters who are now passing through the same cycle goodman recommended the following astringents to shrink pores : alcohol, tannins (in almond, cinnamon, rose, lavender, or lemon oils), alum, bismuth, acetic / boric / citric / lactic acid, balsam of peru, active beta - naphthol, resoricin, sulfur, lecithin, and metal salts (goodman, 1936). canadian dermatologist william e. pace was the first to recognize the usefulness of benzoyl peroxide to treat acne when he identified it as the active ingredient of squibb s antiseptic quinolor compound ointment (pace, 1965). throughout history, mackee and his team advised in 1922 that avoiding candy, pastry, soda water, ice cream, chocolate, rich foods, fried foods, cocoa and gravy as a bare minimum plus or minus tea, coffee, alcohol and spices (smith and mann, 2011). in addition, goodman (1936) advised to avoid starchy foods, bread rolls, noodles, spaghetti, potatoes, oily nuts, chop suey, chow mein, and waffles. goodman praised the following foods as suitable to cure acne : cooked and raw fruit, farina, rice, wheat, oatmeal, green vegetables, boiled or broiled meat and poultry, clear soup, vegetable soup, and an abundance of water. (1969) showed that excessive intake of chocolate had no bearing on the composition or output of sebum production. mackee also stressed the importance of a daily bowel movement in the prevention of acne by stating that if there is indigestion or intestinal troubles the alimentary canal must be attacked avoidance of excess sexual activity was also cited as a potential therapy in treating acne and masturbation and sexual excess must be avoided furthermore, the menstrual functions and genito - urinary tract should receive attention when treating for acne (smith and mann, 2011). from 1895, when wilhelm roentgen discovered the use of x - rays in medicine, the spectra were used to treat a variety of conditions including acne (cleveland and pirie, 1938). in 1902, american researcher w.a. pusay first published on the use of x - rays as a novel therapeutic agent in the treatment of acne (pusay, 1902). in the 1930s, researchers calibrated x - ray equipment to allow it to be widely used in the 1940s. mackee and cipollaro (1946) described x - rays as the most useful and important single agent in the armamentarium of dermatology. masturbation, intestinal auto - intoxication, faulty diet as potential precipitants (smith and mann, 2011). however, public perception toward the use of x - rays in medicine changed in the 1960s as the effects of the bombing of hiroshima, japan created wide mistrust of radiation. (1996) researched non - melanoma skin cancers that occurred in patients who were treated with ionizing radiation for a variety of conditions. of the 259 patients who received treatment for acne vulgaris, 62 patients (24%) developed basal cell carcinomas compared with 8 of 23 patients (35%) who received radiotherapy for cancer treatment (karagas. in the first half of the 20th century, phototherapy was a popular treatment for acne and quartz mercury vapor lamps in particular were used (armstrong, 1992). one example of an air - cooled lamp was the emesay - hanovia quart mercury vapor lamp. in 1947, otto isler with pharmaceutical company hoffman - la roche developed a commercial synthetic vitamin a. however, it was not until 1959 that dermatologist gunter stttgen worked with retinols for the treatment of dyskeratosis disorders and discovered that retinol was effective after metabolic activation. dr. stttgen s work with hoffman - la roche on tretinoin showed that it worked in the treatment of certain skin conditions (stttgen, 1962). albert montgomery kligman, professor of dermatology at the university of pennsylvania and a trained botanist, also investigated acne and published the first paper on the use of topical retinoids (kligman., 1969). treatment with isotretinoin was thought to be more effective and safer than tretinoin and revolutionized the treatment of acne vulgaris as 9 of 10 patients saw a significant improvement in their skin after only a single course (1 - 2 mg / kg / day) for 16 to 24 weeks (zouboulis., 2014). tretinoin reduces the size of the pilosebaceous unit and dramatically suppresses sebum production, resulting in altered skin surface lipid composition. this mechanism results in the frequently reported side effects of mucocutaneous dryness, grittiness of the eyes, and epistaxis. diffuse hair loss and myalgia are less commonly reported side effects and resolve on discontinuation of the drug. in 1953, sidney q. cohlan (1953) observed that high doses of vitamin a had teratogenic effects on pregnant rats. g. l. peck was initially researching vitamin a for the treatment of darier s disease, ichthyosis, and pityriasis rubra pilaris and discovered its therapeutic effects on acne vulgaris. (1979) also counseled on contraception, as isotretinoin is contraindicated during pregnancy even at doses under 0.5 mg / kg for short treatment periods. women of reproductive age (i.e., 15 to 44 years) account for 90% of isotretinoin prescriptions to female patients (honein., 2001). isotretinoin fetal exposure results in congenital malformations and on rare occasions in intrauterine death, even with conception up to 5 weeks after taking the drug (honein., 2001). despite widespread knowledge of the drug s teratogenicity, more than 80 cases of isotretinoin embryopathy were reported between 1982 and 1990 (honein., 2001). malformations that were observed include microtia or anotia (i.e., small or absent ears), micrognathia, cleft palate, auditory canal defects, thymic hypoplasia, retina or optic nerve abnormalities, and functional impairment (lynberg., 1990). national tetratology information service estimates that with fetal exposure to isotretinoin, 30% of infants with no gross malformations have learning difficulties and up to 60% have impaired neuropsychological function (sladden and harman, 2007). fetal exposure to isotretinoin continued even after the implementation of a pregnancy prevention program (i.e., signed agreement between clinician and patient) that was introduced in 1988 (sladden and harman, 2007). despite the pregnancy prevention program, 1019 of 177,216 pregnancies were identified with fetal exposure to isotretinoin in the slone survey, an independent follow - up survey of women of childbearing age in the united states who were prescribed isotretinoin between 1989 and june 2000 (lee., 2009). of these pregnancies with fetal exposure to isotretinoin, records show that 117 resulted in live births, 681 in elective terminations, 177 in spontaneous abortions, and 29 in ectopic pregnancies. records were examined for 63 pregnancies that resulted in live births and 13% showed documented major malformations and 30% some degree of malformation. ten percent of the live births were recorded as occurring within 30 days after isotretinoin discontinuation (lee. in reaction to these numbers, the ipledge program was introduced in the united states in 2007, which required a negative pregnancy test before treatment with isotretinoin, every month during treatment, at the end of treatment, and 1 month after discontinuation of treatment. one culprit for the continued reporting of isotretinoin pregnancies is the prescription - sharing phenomenon, which has swept the united states over the last decade. of the 700 patients surveyed by goldsworthy. (2008), 22.9% admitted to loaning medications to others and 6.4% to sharing isotretinoin with people who had not been formally prescribed the treatment by a dermatologist. this prescription - sharing behavior has put females of childbearing age at risk of teratogen exposure without the recommended treatment education and monitoring. teratogenic risk is not absolute ; however, it is perceived to persist on completion of the course as described in an example by lee. (2009) who reported a case of a 24-year old female patient who conceived 5 weeks after treatment discontinuation. the patient had been taking 10 mg isotretinoin for nearly 2 years to treat severe acne and used an intrauterine contraceptive device while taking the drug. regular antenatal care that included ultrasound scans at 10 and 20 weeks showed no definite fetal malformations but the baby boy was noted to have a right ear microtic deformity with a visible opening of the ear canal. the area on the left side showed a skin tag - like remnant of the lower part of the ear lobe with no visible opening. sladden and harman (2007) describe the case of a patient who became pregnant while treated with isotretinoin even with appropriate counseling, concomitant oral contraceptive pill therapy, and a negative pregnancy test. the patient was counseled on the risks of fetal exposure to isotretinoin but opted to proceed with the pregnancy. regular ultrasound scans were normal and she delivered a healthy baby girl with no apparent birth defects. at 18 months, the child was reported to be developing normally (sladden and harman, 2007). the psychosocial impact on mothers who have a child with birth defects is astounding and studies report that the worse a child s symptoms are, the more a parent s psychosocial functioning deteriorates over time (lemacks., expectant mothers become preoccupied with medical visits and fears of caring for a sick child haunt their pregnancy. they may forgo baby showers or other celebrations because they feel undeserving or fearful of postnatal outcomes (lemacks., mothers of children with birth defects experience significant depression, marital upset, fear, anxiety, isolation, and feelings of guilt, embarrassment, and shame. if the birth defect requires medical procedures, hospital stays, surgeries, and other interventions, the mother s quality of life is much more likely to be adversely affected. mothers may experience feelings of inadequacy in caring for their child and worry how they will manage financially and logistically since many mothers are forced to give up their careers to become full time care takers. the stages of grief that are experienced when receiving the news of expecting a child with a birth defect is comparable with those of losing a child. the mourning process is thought to stem from the realization that the previous hopes and visions of life with their child are now drastically changed. acne vulgaris is a serious disorder that can disfigure patients and affect the psychosocial health of teenagers and young adults. although understanding of the disease has progressed well since the time of the renaissance, research still continues. isotretinoin has been a major life - changing advance in the treatment of this disease but its teratogenic effects means it must be prescribed with education and care. | acne vulgaris is one of the top three most commonly encountered dermatological problems worldwide in both primary and secondary care. acne diagnosis and treatment date back to ancient greek and egyptian times. this article explores acne through the ages and discusses past theories on etiology and treatment with particular focus on the discovery of retinoids and their impact on women s health. |
this is a prospective case - control clinical trial on patients suffering from sinonasal polyposis disease, admitted to al - zahra and kashani hospitals in isfahan university of medical sciences, isfahan, between spring 2008 and summer 2009. sampling was carried out by simple consecutive type method and assignment to case or control groups was simple randomly performed. patients suffering from aspirin sensitivity were omitted, as were patients with contraindications to corticosteroid or amphotericine b administration. the number of cases was calculated by the formula n = (z1+z2) [p1(1-p1)+p2(1-p2)]/(p1-p2). fifty patients suffering from nasal polyposis entered the study and were assigned to two groups, each consisting of 25 patients : 1) amphotericin b group, 2) normal saline group. all patients data (e.g. age, sex, history of allergies, history of previous sinus surgeries) were recorded in a questionnaire designed for this study. ct scanning of all patients paranasal sinuses was done preoperatively by appropriate algorithms to stage the disease according to lund - mackay staging system (table 1). lund - mackay staging system for sinonasal polyposis in regard to ct scan findings the physician responsible for staging of pre and postoperative ct scans was blinded to the patients group and patients pretreatment stage. all patients filled out subjective data in questionnaire and were treated by functional endoscopic sinus surgery by one of the first two authors. postoperatively, all patients received ciprofloxacin tablets (500 mg daily for 2 weeks, sobhan co, iran) and beclomethason nasal spray (50 microgram each puff, apotex inc. toronto, canada) for 1 month. in the amphotericine b group, patients were instructed to irrigate the nasal cavity with a premade solution of 50 mg amphotericine b (fungizone, bristol - myers squibb, france) in 500 cc sterile water twice daily for 6 months. in the normal saline group, patients used the physiologic normal saline for intranasal douching every 12 hours for 6 months. patients were followed in the first week postoperatively and then every month for 6 months. at the end of the treatment period, another ct scan of paranasal sinuses was performed and the new stage of the disease was recorded. also, patients filled out the subjective postoperative data in the data sheet. data were analyzed using chi square, fisher exact, mann whitney and wilcoxon signed ranks tests according to the different values. the study was carried out on 25 patients in amphotericine b group and 25 patients in normal saline group. mean age of the cohort was 40.2 12.03 years (range : 17 - 64 years) in amphotericine b group and 40.1 10.8 years (range : 23 - 64 years) in normal saline group. independent t test failed to show any significant differences in mean age of the two groups (p = 0.971). focusing on history of allergies, 17 patients in normal saline group (68%) and 21 cases in amphotericine b group (84%) reported history of some kind of allergies. chi square test did not show statistically significant discrepancy between the two groups in this regard (p = 0.160). similarly, the two groups were com - pared for the history of previous sinus surgeries ; 4 cases in normal saline group (16%) and 5 patients in amphotericine b group (20%) had history of previous sinonasal surgery which was statistically insignificant according to fisher exact test (p = 0.710). preoperative and postoperative ct scans of paranasal sinuses were staged according to lund - mackay staging system and data of each group were compared. table 2 shows the frequency distribution of different stage scores pre- and postoperatively in amphotericine b group. frequency distribution of each stage in amphotericin b group, pre- and postoperatively frequency distribution of each stage in normal saline group, pre- and postoperatively in amphotericine b group, according to wilcoxon signed ranks test, stage of the disease improved in 21 patients (84%), remained unchanged in 4 (16%) and a deterioration in ct scan stage was not seen in any of the patients. this observation shows that disease stage has a statistically significant improvement following fess and amphotericine b nasal douching (p < 0.001). in normal saline group, according to wilcoxon signed ranks test, imaging stage improved in 22 patients (88%), remained unchanged in 3 patients (12%) and a deterioration in ct scan stage was noticed in no one. this means that fess in combination with postoperative nasal saline douching results in a statistically significant improvement in ct scan staging (p < 0.001). finally, the two cohorts were compared using mann - whitney test for negative ranks (a reduction in imaging stage) and the test could not show a significant difference between the two groups (p = 0.170). the main aim of the current study was to compare the effect of amphotericine b solution and normal saline in preventing the recurrence of polyps in sinonasal tract following fess. based on the results, amphotericine b solution was effective in reducing the stage score of patients on ct scan after functional endoscopic removal of polyps. similar results were achieved in the normal saline group and statistical analysis failed to show any significance in this regard. this means that although fess and frequent irrigation of nasal cavity helps prevent recurrence of polyposis disease, no significant difference can be observed between physiologic normal saline and amphotericine b solution in ct scan scores. for example, in a study on 116 patients suffering from chronic rhinosinusitis (crs) with polyps, patients were treated with amphotericine b solution for 3 months, but no objective improvement was observed compared to placebo group.11 in another experiment, patients suffering from chronic rhinosinusitis (crs) were treated by nasal irrigation of either amphotericine b or normal saline solutions for 8 weeks postoperatively. the study could not show any meaningful difference in improvement of signs and symptoms in the two subgroups.3 not all researchers agree on the lack of effect of amphotericine b in polyposis. an early study on this dilemma was conducted by ricchetti in 2002/2003 on 74 crs with polyp patients, who were treated with amphotericine b and placebo for 4 weeks after fess. the study concluded that amphotericine was more effective than placebo in reducing disease stage, documenting total resolution of polyps in 62% of mild and 42% of moderate polyposis cases.7 two other studies by ponikau in 2002 and 2005 supported the hypothesis of effectiveness of amphotericine b in reduction of polyposis. interestingly, these studies documented a significant reduction in inflammation and thickness of sinonasal mucosa and eosinophilic inflammatory markers.812 previous studies, either supporting or denying the use of amphotericine b solution, had a drug administration period of 4 to maximally 12 weeks after endoscopic sinus surgery. the present study was designed to omit this possible bias factor by expanding the drug administration duration to 24 weeks before a judgment on the drug effects was made. nonetheless, although amphotericine b solution was successful in reducing ct score of polyposis patients in combination to fess, the present study was unable to show any benefits for this treatment regimen over normal saline. it should be remembered that the probable mechanism of effect for normal saline nasal irrigation is washing out the fungal fragments, depriving the mucosal immune system of the stimulus. in this mechanism, another possible explanation for conflicting results in different studies is that amphotericine b solution might have been more effective in patients suffering from crs and polyposis, who had a background specific allergic reaction to fungi. this would mean that a subset of polyposis patients with allergies to fungi and concomitant high fungal load in sinonasal tract would actually benefit from this treatment. this would be a challenge to be solved by further studies. keeping in mind the side effects of amphotericine b solution such as its high cost, difficult preparation, bothersome maintenance and minor discomfort during administration, it may be a better idea to retreat to the traditional normal saline nasal douching following fess in the treatment of crs with polyposis. although antifungal therapy is theoretically an interesting adjunct treatment in management of sinonasal polyposis, our study was unable to document an actual benefit to this regiment in comparison to routine normal saline nasal irrigation. sticking to the time - tested physiologic saline nasal douching following endoscopic removal of polyps seems a logical and prudent choice for the time being. mk and ho assisted in performing the surgeries, supervised imaging studies and imaging reports, and prepared the manuscript. | background : recurrence of nasal polyposis following surgical intervention is very common. antifungal therapy has been an appealing alternative to reduce its recurrence and severity. early studies showed definite positive response, but recent studies have raised doubts about its efficacy in treatment of polyposis.methods:this prospective case - control clinical trial was conducted on 50 patients suffering from nasal polyposis in isfahan university of medical sciences. all patients underwent functional endoscopic sinus surgery. ct scanning of paranasal sinuses was done preoperatively and 6 months postoperatively to stage the disease. patients were assigned to two groups : amphotericine b group were instructed to irrigate the nasal cavity with a solution of amphotericine b, while the normal saline group used the physiologic normal saline for 6 months.results:68% of patients in normal saline and 84% of cases in amphotericine b group reported history of allergies. in amphotericine b group, stage of the disease improved in 84% of patients and remained unchanged in the rest. in normal saline group, imaging stage improved in 22 patients and remained unchanged in 3. the two cohorts were compared for reduction in imaging stage and no significant difference was found between them.conclusions:this study showed no benefits for topical amphotericin b solution over normal saline. it might be better to retreat to the traditional normal saline nasal douching following functional endoscopic sinus surgery in the treatment of polyposis. |
percutaneous endoscopic gastrostomy (peg) is a safe, minimally invasive procedure for long - term enteral nutrition in patients with impaired oral intake 1 2 3. however, aseptic procedure is difficult to maintain in the pull or push technique with the probable transfer of oral bacterial to the stoma site. peristomal site infection has often been identified as the most common adverse event after peg tube placements 4. administration of systemic prophylactic antibiotics has been demonstrated to be effective in reducing peristomal infection and is often employed before the procedure 5 6 7. nonetheless, fungal infection may still present a problem in the severely ill or immunocompromised patient 8. peg using the introducer technique, in which the gastrostomy tube does not pass through the oral cavity during placement, was first described by hashiba in 1980 9. it was also independently developed and described by inoue and russell later on in 1983 and 1984 respectively 10 11. this technique is extremely useful in patients with difficulty in opening their mouth or stenosis of the upper digestive tract such as head and neck cancer patients 12. while the pull or push techniques may not be feasible in up to 20 % of these patients, the introducer technique using an ultrathin endoscope transnasally not only increases the success rate of tube placement but also decreases the probability of tumor seeding during procedure 13 14. furthermore, because the gastrostomy tube is inserted directly via the abdomen during placement, rates of peristomal site infection have been shown to be reduced in previous studies, including a recent meta - analysis 15 16. one study even concluded that the introducer technique can be performed without the need of prophylactic antibiotic administration 17. although the safety of the introducer technique was greatly enhanced with the introduction of endoscopic gastropexy, one of the limitations of this technique was that almost all commercially available kits used small - caliber gastrostomy tubes of up to 15 fr size, which may be associated with a higher risk of tube obstruction 18 19. in this study, we evaluated the safety and utility of a recently available large - caliber (20 fr) introducer peg kit with an improved puncture needle system compared to a similar size push technique kit used in our hospital. prospectively collected data from patients who received peg at our hospital between january 2014 and december 2015 was analyzed retrospectively. only patients receiving tube placement for enteral feeding were included and after excluding 3 patients (1 patient because tube placement was for gastric decompression and 2 patients because of insufficient data), 136 patients (64 males and 72 females) were enrolled into this study. data regarding baseline characteristics such as age, gender, comorbidities, and preoperative biomarkers (body mass index and blood laboratory markers collected on day of procedure) as well as postoperative findings such as hemodynamic changes immediately after procedure, changes in laboratory data on day 7 after the procedure, postoperative adverse events (peristomal site infection, feeding - related pneumonia etc.) and clinical outcomes of interest (postoperative length of stay and mortality) were compared according to the different peg techniques used. this study protocol was reviewed and approved by the ethics review committee of hiroshima kyoritsu hospital. all patients, or their legal guardians, provided written informed consent for the procedures as well as enrolment into the study. preoperative and postoperative protocols employed were the same no matter which insertion technique was used. prophylactic antibiotics were administered in all patients (as required by existing protocols) but the use of conscious sedation with diazepam was left to the discretion of endoscopists, with careful monitoring of hemodynamic changes at all times during the procedure. patients with antithrombotic therapy (using antiplatelet drugs or anticoagulants) were managed according to the latest guidelines established by the japan gastroenterological endoscopy society. in the push technique, a 20 fr tube (safety peg kit, boston scientific corp. it should be noted that although some previous studies have mistakenly used the term push method when they actually refer to the introducer technique, the push technique in this study refers to the technique originally described by sacks and vine in 1983 20. for the introducer technique, a recently developed kit (fig. 1a, intolief peg kit by create medic co., ltd, yokohama, japan) using a 20 fr gastrostomy tube was used. this kit includes a funada - style gastropexy device as well as a puncture needle / trocar (fig. 1b) with a newly developed sleeve protection system to avoid mispuncture of the opposite stomach wall. 2 is a pictorial diagram of the sleeve protection system during insertion of the puncture needle / trocar. the puncture needle is initially hidden under a protection sleeve before insertion (fig. the penetrating edge of the puncture needle is exposed from the protection sleeve during insertion (fig. 2b) but once resistance from the abdominal and gastric walls is absent, the protection sleeve covers the puncture needle, locking it in as the external peel - away sheath enters the gastric lumen (fig. this not only helps avoid any accidental puncture into the opposing gastric wall but also decreases the risk of needle - stick injury in medical personnel. pictorial diagram showing insertion of puncture needle with protection sleeve. 3 shows endoscopic imaging of peg tube insertion with the introducer technique kit in a 79-year - old female under mechanical ventilation. after determining and sterilizing the puncture site, first, the double needle of the gastropexy device was inserted into the gastric lumen (fig. 3a). after a loop snare was formed from the tip of one needle, the suture thread was then caught by closing the loop snare and after the double needle was withdrawn from the stomach, the thread was tied outside the abdominal wall (fig. this procedure was repeated at least 3 times surrounding the intended puncture site in a triangular pattern with a minimum distance of 2.0 cm apart in order to achieve stable gastropexy. after a 10 mm external incision was performed on the intended puncture site, the puncture needle / trocar (6.7 mm or 20 fr) was then inserted (fig. leaving only the external peel - away sheath, the puncture needle was removed and a 20 fr gastrostomy tube was inserted via the sheath (fig. after inflating the retention balloon with 10 ml of distilled water, the external sheath was peeled away to leave only the peg tube in place (fig. endoscopic imaging of tube insertion using the new introducer peg kit with yellow arrows marking the visible gastropexy sutures. although an ultrathin endoscope can be used transnasally for the introducer technique, procedures are usually performed by oral endoscopy. the choice of peg kit is determined by the operator, influenced by preference or technical skills. nonetheless, use of the introducer peg kit is indicated in patients who can not open their mouth and strongly recommended in cases where single endoscope insertions are thought to be preferable, such as patients with mechanical ventilation. peg feeding usually begins 2 days after the procedure (using standard protocol) and patients are followed up by our nutrition support team where peristomal sites are also evaluated after 7 days. peristomal infection was assessed using a previously validated scoring system (jain s infection score) by assigning a score for erythema (0 to 4), induration (0 to 3) and exudate (0 to 4) 21. infection was defined as development of pus or a combined infection score of 8 or more. comparisons for continuous variables were made using the student t - test for normal data and the mann - whitney u test for non - parametric data. tests for proportionality between groups were made using the chi - square test (or fisher 's exact test when indicated). statistical significance was defined as p < 0.05 and analysis was performed using xlstat2014 for windows (addinsoft ltd., paris, france). prospectively collected data from patients who received peg at our hospital between january 2014 and december 2015 was analyzed retrospectively. only patients receiving tube placement for enteral feeding were included and after excluding 3 patients (1 patient because tube placement was for gastric decompression and 2 patients because of insufficient data), 136 patients (64 males and 72 females) were enrolled into this study. data regarding baseline characteristics such as age, gender, comorbidities, and preoperative biomarkers (body mass index and blood laboratory markers collected on day of procedure) as well as postoperative findings such as hemodynamic changes immediately after procedure, changes in laboratory data on day 7 after the procedure, postoperative adverse events (peristomal site infection, feeding - related pneumonia etc.) and clinical outcomes of interest (postoperative length of stay and mortality) were compared according to the different peg techniques used. this study protocol was reviewed and approved by the ethics review committee of hiroshima kyoritsu hospital. all patients, or their legal guardians, provided written informed consent for the procedures as well as enrolment into the study. preoperative and postoperative protocols employed were the same no matter which insertion technique was used. prophylactic antibiotics were administered in all patients (as required by existing protocols) but the use of conscious sedation with diazepam was left to the discretion of endoscopists, with careful monitoring of hemodynamic changes at all times during the procedure. patients with antithrombotic therapy (using antiplatelet drugs or anticoagulants) were managed according to the latest guidelines established by the japan gastroenterological endoscopy society. in the push technique, a 20 fr tube (safety peg kit, boston scientific corp., it should be noted that although some previous studies have mistakenly used the term push method when they actually refer to the introducer technique, the push technique in this study refers to the technique originally described by sacks and vine in 1983 20. for the introducer technique, a recently developed kit (fig. 1a, intolief peg kit by create medic co., ltd, yokohama, japan) using a 20 fr gastrostomy tube was used. this kit includes a funada - style gastropexy device as well as a puncture needle / trocar (fig. 1b) with a newly developed sleeve protection system to avoid mispuncture of the opposite stomach wall. 2 is a pictorial diagram of the sleeve protection system during insertion of the puncture needle / trocar. the puncture needle is initially hidden under a protection sleeve before insertion (fig. the penetrating edge of the puncture needle is exposed from the protection sleeve during insertion (fig. 2b) but once resistance from the abdominal and gastric walls is absent, the protection sleeve covers the puncture needle, locking it in as the external peel - away sheath enters the gastric lumen (fig. this not only helps avoid any accidental puncture into the opposing gastric wall but also decreases the risk of needle - stick injury in medical personnel. pictorial diagram showing insertion of puncture needle with protection sleeve. 3 shows endoscopic imaging of peg tube insertion with the introducer technique kit in a 79-year - old female under mechanical ventilation. after determining and sterilizing the puncture site, first, the double needle of the gastropexy device was inserted into the gastric lumen (fig. 3a). after a loop snare was formed from the tip of one needle, the suture thread was then caught by closing the loop snare and after the double needle was withdrawn from the stomach, the thread was tied outside the abdominal wall (fig. this procedure was repeated at least 3 times surrounding the intended puncture site in a triangular pattern with a minimum distance of 2.0 cm apart in order to achieve stable gastropexy. after a 10 mm external incision was performed on the intended puncture site, the puncture needle / trocar (6.7 mm or 20 fr) was then inserted (fig. the puncture needle was removed and a 20 fr gastrostomy tube was inserted via the sheath (fig. after inflating the retention balloon with 10 ml of distilled water, the external sheath was peeled away to leave only the peg tube in place (fig. endoscopic imaging of tube insertion using the new introducer peg kit with yellow arrows marking the visible gastropexy sutures. although an ultrathin endoscope can be used transnasally for the introducer technique, procedures are usually performed by oral endoscopy. the choice of peg kit is determined by the operator, influenced by preference or technical skills. nonetheless, use of the introducer peg kit is indicated in patients who can not open their mouth and strongly recommended in cases where single endoscope insertions are thought to be preferable, such as patients with mechanical ventilation. peg feeding usually begins 2 days after the procedure (using standard protocol) and patients are followed up by our nutrition support team where peristomal sites are also evaluated after 7 days. peristomal infection was assessed using a previously validated scoring system (jain s infection score) by assigning a score for erythema (0 to 4), induration (0 to 3) and exudate (0 to 4) 21. infection was defined as development of pus or a combined infection score of 8 or more. comparisons for continuous variables were made using the student t - test for normal data and the mann - whitney u test for non - parametric data. tests for proportionality between groups were made using the chi - square test (or fisher 's exact test when indicated). statistical significance was defined as p < 0.05 and analysis was performed using xlstat2014 for windows (addinsoft ltd., paris, france). seventy - five patients received tube placement with peg kits using the push technique (push kit) and 61 patients received placement with the new introducer peg kit (introducer kit). baseline characteristics of patients (age, gender, comorbidities and preoperative biomarkers) are shown in table 1. the patients ranged in age from 59 years to 97 years and there were no significant differences in age or gender between the two groups. for comorbidities, although there were no differences in prevalence of stroke, neurodegenerative disorders, respiratory disorders, cardiovascular disorders, diabetes mellitus, pressure ulcers and malignancy between both groups, there were significantly more patients with dementia in the push kit group when compared to the introducer kit group (44 % vs. 21.3 %, p < 0.01). as for preoperative biomarkers, there were no differences in body mass indices (bmi), white blood cell counts, hemoglobin levels, platelet counts, serum albumin levels, total lymphocyte counts, c - reactive protein levels, total cholesterol levels and blood urea nitrogen levels between the 2 groups. although the use of antithrombotic therapy did not differ significantly between both groups, patients in the push kit group had a higher international normalized ratio of prothrombin time (pt - inr) compared to those in the introducer kit group (1.21 vs. 1.14, p = 0.02). indications for peg were primarily dysphagia secondary to neurological impairments or insufficient oral intake which may be due to various underlying conditions as listed in the comorbidities section (table 1). sd, standard deviation ; tlc, total lymphocyte count ; pt - inr, international normalized ratio of prothrombin time. tube placements were successful in all patients for both peg kits and hemodynamic monitoring during procedure is summarized in table 2. conscious sedation with diazepam was used in almost 75 % of patients in the push kit group, which was significantly higher than the 57 % of patients in the introducer kit group (p = 0.03). however, when used, the mean diazepam dosage did not differ significantly between the 2 groups. there were no significant differences in mean arterial pressure (map), pulse rate and saturation of peripheral oxygen (spo) at baseline when comparing both groups. postoperative changes (the difference between values taken immediately after procedure and baseline) in hemodynamic markers were also insignificant between both groups although it should be noted that the increase in mean map for the introducer kit group was slightly more prominent. laboratory biomarkers were collected on postoperative day 7 according to protocol and the differences from preoperative values are shown in table 3. the changes in hemoglobin levels, serum albumin levels, blood urea nitrogen as well as inflammatory markers such as white blood count and c - reactive protein levels were similar no matter which peg kit was used. table 4 summarizes the postoperative adverse events and clinical outcomes after peg tube placement. feeding - related aspiration pneumonia (established by clinical symptoms as well as radiological findings) was the most common adverse event, followed by peristomal infection and feeding - related diarrhea. there were significantly fewer occurrences of aspiration pneumonia in the introducer kit group compared to the push kit group (8.2 % vs. 24 %, p = 0.02) and although not statistically significant, fewer cases of feeding - related diarrhea in the introducer kit group as well. the frequency of peristomal infection was similar in both groups but the average jain s infection score of patients in the introducer kit group were significantly lower compared to the push kit group (1.2 vs. 1.6, p < 0.01). there were no significant differences in terms of accidental tube dislodgements, peritonitis and bleeding that required intervention (such as blood transfusion). no tube obstruction was observed in either groups during postoperative clinical course (up to day 90). postoperative length of stay was significantly shorter in the introducer kit group (16 days vs. 23.7 days, p = 0.01). there were also fewer mortalities (in - hospital, 14-day, 30-day, 60-day and 90-day) in the introducer kit group with the 60-day mortality being significantly lower compared to the push kit group (3.3 % vs. 16 %, p = 0.02). there was one procedure - related death in the push kit group (due to excessive bleeding) but the main contributor to all mortality was aspiration pneumonia secondary to gastroesophageal reflux of feed. for long - term enteral tube feeding, peg has been established as a safe and simple procedure. although the pull or push technique remains the most popular method for gastrostomy tube placement, the need of passing the tube through the oral cavity increases the risk of peristomal site infection and negatively affects the success rate of tube placement in patients with upper digestive tract stenosis or trismus. peg using the introducer technique is an alternative method for gastrostomy tube placement which does not require tube transit orally. unlike the pull or push technique, the procedure requires only single insertion of the endoscope and the endoscopist is required to just observe during insertion. however due to several reasons, this method of tube placement is not as widely employed as the pull or push technique. first of all, initial versions of the introducer technique did not use gastropexy, which while making the procedure simpler and faster, also caused adverse events such as displacement of the gastric wall due to trocar insertion or accidental tube dislodgement, which in turn resulted in leakage of stomach contents into the peritoneum and procedural failure 22 23. the introduction of gastropexy before tube placement greatly enhanced the safety of the introducer technique 24 25. however, the need for gastropexy and gastropexy - related devices not only increased total procedure time but also the price of introducer peg kits 17 26 27. furthermore, almost all commercially available kits use small - caliber gastrostomy tubes of up to 15 fr, which may lead to frequent episodes of tube obstruction. tube size is also a matter of concern in japan where the use of semi - solid feed or blended food is quite common to help prevent gastroesophageal reflux and other feeding - related adverse events 28 29. the modified introducer technique (also called the direct method) was developed in 2001 and enabled the placement of large - caliber gastrostomy tubes up to 24 fr 30 31. however, this modification actually made the procedure more complex due to the need of puncture site dilation. prices of modified introducer peg kits are also more expensive than the original introducer peg kits. recently however, an introducer technique using a new large - caliber trocar to insert gastrostomy tubes up to 20 fr was reported 32. although the trocar size is similar to the one used in this study, it lacked the safety features of the sleeve protection system described herein. this is the first study evaluating the safety and utility of a recently developed large - caliber (20 fr) introducer peg kit with an improved puncture needle using a sleeve protection system. as far as we are aware, this is also the first study comparing the introducer technique and the push technique using gastrostomy tubes of the same size. although this is a retrospective non - randomized study, other than the prevalence of dementia, patients in both groups were comparable in terms of baseline characteristics such as age, gender and other comorbidities. preoperative biomarkers also did not differ significantly in both groups except for pt - inr, which was slightly higher in the push kit group. although the higher pt - inr may have indirectly contributed to more incidence of bleeding (including 1 procedure - related death) in the push kit group, it should be noted that the average values for both groups were well within guideline - acceptable levels. as shown in table 3, postoperative changes in hemoglobin levels on day 7 also did not differ significantly between the 2 groups, although the use of blood transfusion was not taken into consideration during analysis. in this study, postoperative changes in data were used to reflect the changes from baseline, meaning that a positive value would indicate an increase and vice versa. hemodynamic changes during procedure (table 2) and postoperative changes in laboratory biomarkers 7 days after procedure (table 3) indicate that the use of the introducer peg kit was well tolerated by patients. the use of sedation (not the dosage however) was significantly lower in the introducer kit group presumably because only single insertion of endoscope was required. this may have influenced the postoperative changes in hemodynamics such as map, albeit not to a statistically significant degree when compared to the push kit group. as for postoperative adverse events, the introducer kit group fared better when it came to feeding - related events such as aspiration pneumonia and diarrhea (for diarrhea, not statistically significant) despite both groups being similar in terms of preoperative nutritional biomarkers and having the same feeding protocols. however, because patients in this study were not randomized accordingly, these favorable outcomes could have resulted from selection bias. although the occurrence of peristomal infection did not differ significantly between the two groups, in agreement with earlier studies, patients in the introducer kit group had significantly lower infection scores compared to the push kit group. previous studies have also reported higher rates of accidental tube dislodgement (removal) in patients receiving tube placement using the introducer technique 19 33. although we contend that the higher rates may be due to the type of gastrostomy tube (balloon - type) employed rather than the insertion technique itself, in this study, tube dislodgements were not significantly higher in the introducer kit group. interestingly, the incidence of bleeding was also not higher in the introducer kit group although gastropexy (meaning more percutaneous gastric punctures) was required. postoperative length of stay was significantly lower and there were fewer mortalities in the introducer kit group, with statistical significance at the 60-day mortality point. this is most probably because patients in the introducer kit group experienced fewer adverse events compared to their push kit group counterparts. notable limitations of this study include its retrospective design with a high probability of selection bias even though baseline characteristics and biomarkers were reasonably comparable between the 2 groups. the study also lacks long term follow - up data beyond 90 days (which is still in progress as an ongoing observational study). it may be worth mentioning that in japan, regular gastrostomy tube replacement (every 3 to 4 months) is common to prevent tube obstruction and other long - term tube - related problems. gastrostomy tubes placed using the pull or push techniques usually have internal mushroom - like bumpers which often require endoscopic removal for optimal safety during replacement while tubes placed using the introducer technique uses retention balloons which upon deflation can be safely and easily replaced without endoscopic intervention. therefore, using the introducer peg kits may also help reduce the cost of initial tube replacements. in conclusion, retrospective evaluation of the safety and utility of a novel large - caliber introducer peg kit with an improvised puncture needle / trocar showed that gastrostomy tubes placed using the new kit produced non - inferior (with some favourable) results when compared to push peg kits of similar tube size. we also contend that the new kit would be very useful, especially in patients with esophageal stenosis, since using the large - caliber tubes will help maintain the same tube patency as tubes inserted using the conventional pull / push techniques. although the new introducer peg kit is considered safe to use, the final choice of gastrostomy tube placement method should be made after taking into consideration patient s circumstances (giving priority to cases with trismus or upper digestive tract stenosis) as well as operator s technical preference. | background and study aims : percutaneous endoscopic gastrostomy (peg) using the introducer technique is not only useful in patients with upper digestive tract stenosis but has been shown to reduce peristomal infection. in this study, we evaluated the safety and utility of a novel large - caliber introducer peg kit (using 20 fr size tube) compared with a push kit of similar size. patients and methods : one hundred and thirty - six patients who received peg at our hospital between january 2014 and december 2015 were retrospectively analyzed. baseline characteristics, laboratory biomarkers, hemodynamic changes, postoperative adverse events and clinical outcomes with both kits were compared. results : the new introducer peg kit was used in 61 patients while the remaining 75 patients received tube placement using a push technique peg kit. except for the prevalence of dementia, which was lower in the introducer peg kit group, baseline characteristics were similar in both groups. tube placements were 100 % successful with both peg kits and there were no significant differences in the change of postoperative hemodynamic or laboratory biomarkers. the introducer peg kit group experienced fewer incidence of feeding - related aspiration pneumonia (8.2 % vs. 24 %, p = 0.02), lower peristomal infection scores (1.2 vs. 1.6, p < 0.01), shorter postoperative length of stay (16 days vs. 23.7 days, p = 0.01) and fewer deaths at day 60 (3.3 % vs. 16 %, p = 0.02). conclusions : gastrostomy using the new large - caliber introducer peg kit is safe and produced non - inferior (with some favourable) results when compared to the push technique using similar size tubes. |
pulmonary hypertension (ph) is a disease characterized by increased pulmonary artery pressure (pap) due to increased pulmonary vascular resistance (pvr) and/or large intracardiac or vascular left - to - right shunts (transfer of systemic pressures to the right side of the heart and pulmonary artery). ph increases right ventricular pressure and may lead to heart failure, disability and finally, death of the patient in most cases. ph can be idiopathic or secondary to other known diseases. the newest classification of ph, known as dana point classification, categorized this disease into 5 main subclasses. these include pulmonary arterial hypertension (pah), ph owing to left heart diseases, ph owing to lung diseases and/or hypoxia, chronic thromboembolic ph (cteph), and ph with unclear multifactorial mechanisms. in 1958, heath and edward presented a pathological classification of ph into 6 progressive grades : i (retention of fetal type pulmonary vessels, ii (medial hypertrophy with cellular intimal reaction), iii (progressive fibrous vascular occlusion), iv (progressive generalized arterial dilatation with the formation of complex dilatation lesions ; plexiform lesions), v (chronic dilation with formation of numerous dilation lesions and pulmonary hemosiderosis), and vi (necrotizing arteritis). although ph is not generally regarded as an inflammatory disease, there are evidences that inflammation plays a great role in the pathogenesis of at least some of its types. there are sufficient evidences that platelets play a causative role in some situations, while a simple association seems to be the best explanation for the others. however, discrimination between a cause - and - effect role and a mere association is difficult for most cases. thrombotic pulmonary vascular lesions, vasoconstriction and remodeling are the basic mechanisms of pulmonary vascular pathology in ph. platelet functional abnormalities, endothelial disintegrity or dysfunction, and impaired fibrinolysis/ antithrombosis were found in idiopathic ph. it is not clear whether these abnormalities are primary and contributory to ph development, or secondary to this disease. then, those types of ph in which platelets seem to have a greater association are reviewed. medline was searched to find english papers published from january 2006 to june 2010 and review articles from january 2000 to the same date, using the combination of words platelet and pulmonary hypertension. whenever the materials found via this basic research were unsatisfactory in providing information about a subitem of this review, older references were added through a more specific search. in addition, many other references were included based on the experts opinions and citations found in the reviewed papers. pulmonary intravascular thrombosis and thrombotic arteriopathy are common pathological findings in ph [1, 3 ]. increased thromboxane (txa2) and serotonin and decreased prostacyclin (pgi2) and nitric oxide (no) enhance platelet aggregation in ph patients. maeda found a subpopulation of ph patients with increased propensity to thrombosis as suggested by increased platelet protease - activated receptor 1 (par1, a key element in the activation of human platelets by thrombin) expression and par - mediated surface exposure of p - selectin (an adhesion molecule, a marker for in vivo platelet activation, and an essential component in thrombus formation), associated with thrombocytopenia. it is not clear whether thrombocytopenia in ph patients is an incidental finding, caused by platelet consumption in pulmonary vasculature, or resulted from platelet shearing due to pulmonary microangiopathy as suggested by herve. interactions with endothelial cells : endothelial cells (ec) participate actively in the process of coagulation. they activate factor x, facilitate the formation of the thrombin - activating prothrombinase complex, activate the extrinsic pathway of coagulation by releasing tissue factor, and produce and release von willebrand factor (vwf). on the other hand ec express thrombomodulin, a high affinity receptor for thrombin, on their surface which prevents cleavage of fibrinogen to fibrin. ec are a source of both tissue plasminogen activator (t - pa), an important activator of plasminogen in the fibrinolytic cascade and plasminogen activator inhibitor-1 (pai-1), an inhibitor of t - pa. these facts show the importance of ec in regulating the fine balance of prothrombotic and antithrombotic processes. there are evidences in favor of an imbalance in ph patients. in 19 out of 27 patients with idiopathic pah, low soluble thrombomodulin, low fibrinolytic activity, and high fibrinolytic inhibitor levels were seen in idiopathic ph patients. those with secondary ph had elevated fibrinogen levels, increased vwf, and a trend to increased t - pa. it is noteworthy that an additional role for pai- 1 in vascular remodeling was suggested. the studies about such a role for pai-1 in ph are limited in number and conflicting. eicosanoids : activated platelets are the major producers of txa2, a vasoconstrictive and proaggregatory eicosanoid. it is a physiological antagonist of txa2, inhibiting platelet aggregation and relaxing vascular smooth muscle. abnormal production of eicosanoids has been demonstrated in idiopathic and secondary ph, including patients with congenital heart diseases before and after surgical correction of these diseases [1419 ]. in children with left - to - right shunts and in adolescents with eisenmenger syndrome, the ratio of txa2 to pgi2 metabolites urinary excretion is elevated as compared to control subjects [14, 15, 19 ]. prostacyclin analogues are important drugs in the treatment of ph, emphasizing the causative role of this eicosanoid in the development of ph. in contrary, it is not known whether txa2 changes are secondary or primary to ph. serotonin : serotonin (5-hydroxytriptamine, 5ht) is produced in the central nervous system (cns), enterochromaffin cells and limitedly in platelets. although platelets are not a large producer of serotonin, they are a major storage site for this mediator outside the cns. platelets readily take up serotonin from plasma, leaving very little circulating. under certain circumstances, first, it is a pulmonary vasoconstrictor, mainly through its 5ht1b receptor. in mice and human, overexpression of 5-ht2b (another serotonin receptor subtype) in the pulmonary arterial tree is associated with the development of ph. second, serotonin has mitogenic activity on pulmonary arterial smooth muscle cells (pasmc), causing their hypertrophy and proliferation [20, 23, 24 ]. it was speculated that highly selective serotonin transporter (sert) plays an important role in this mechanism. patients with ph have pasmc with faster growth rate than normal subjects after stimulation by serotonin or serum. selective serotonin transporter inhibitors fluoxetine and citalopram, but not serotonin receptor antagonists ketanserin (a 5ht2a antagonist) and gr127935 (a selective 5ht1b/1d antagonist) can inhibit those effects [19, 25 ]. sert gene polymorphism was also found to be a determinant of ph severity [19, 26 ]. in addition, a 5hta2-mediated p38 mitogen - activated protein kinase activation with mitogenic effects on pulmonary artery fibroblasts from chronically hypoxic rats was observed [19, 27 ]. last, serotonin stimulates platelet aggregation especially in combination with adenosine diphosphate and txa2 [20, 28 ]. the significance of increased plasma levels of serotonin in ph is not clear. while some studies reported high plasma levels of serotonin in ph patients [5, 29, 30 ], some found normal values in their cohort [30, 31 ]. increased serotonin level may be secondary to its impaired metabolism, as pulmonary ec contribute greatly to its clearance and their damage successful therapy by a potent antiaggregatory agent, epoprostenol, and heart - lung transplantation did not lower plasma serotonin levels [5, 29 ]. breuer found higher urinary excretion of 5-hydroxyindolacetic acid (a major metabolite of serotonin) in ph patients with left to right shunts and contributed it to higher metabolism of serotonin in these patients. vwf is present in the endothelial basement membrane and in plasma. in endothelial basement membrane, vwf acts as a carrier for coagulation factor viii, and within platelet -granules as an adhesive protein. ec stimulation in pathological conditions, like ph is followed by a rapid release of vwf from storage granules into the circulation. plasma level of vwf is used as a marker for ec damage, and increased levels of vwf have been reported in patients with ph [33, 34 ]. plasma antigenic activity of vwf (vwf : ag) can be a useful biochemical index for predicting a short - term prognosis in ph. a plasma vwf : ag higher than 240% of standard activity was 54% sensitive and 93% specific for identifying patients who were unlikely to survive one year, with an overall predictive value of 75%. elevated baseline and follow up vwf levels were showed to be associated with worse survival. nitric oxide : endothelium - derived no (eno) is a potent inhibitor of platelet aggregation in addition to its vasodilatory and antiproliferative effects. deficiency in endothelial no synthase (enos) sensitize mice to hypoxia - induced ph, whereas pulmonary gene transfer of enos could protect the lungs. tetrahydrobiopterin (bh4) is an essential cofactor for the enzymatic activity of all three isoenzymes of nos, including enos. khoo showed that mice deficient in bh4 developed ph which can be reversed by increasing bh4 availability. they also found that augmented bh4 production can be protective against hypoxia - induced ph in mice. platelet activating factor : platelet activating factor (paf) is a phospholipid with diverse physiological and pathological actions. caplan reported high paf plasma levels in newborns with persistent pulmonary hypertension of the newborn (pphn), correlation between plasma paf level and disease severity, and a fall in paf levels as they improved clinically. paf has also been implicated in chronic hypoxia - induced ph in adult rats [4042 ]. bixby found increased paf synthesis in pulmonary arteries, increased paf receptor protein expression, increased paf receptor binding, and an increase in paf induced smooth muscle cell proliferation in fetal lambs exposed to chronic high altitude hypoxia. it is cleaved from plasminogen at the platelet plasma membrane, absorbed by platelet membrane, and released only upon aggregation [4346 ]. overexpression of angiostatin is associated with ph in mice [44, 47 ]. only upon thrombus formation in the pulmonary capillaries would excessive amounts of angiostatin be released in a localized manner, where it could contribute to the ec microfragment formation, injury and/or death, and possibly to the progression of ph. idiopathic pah patients have significantly elevated platelet, but not plasma, angiostatin levels compared to controls. vascular endothelial growth factor : vascular endothelial growth factor (vegf) is a growth factor involved in vasculogenesis and angiogenesis. this factor antagonizes the formation of apoptotic endothelial microfragments by angiostatin [44, 48, 49 ]. a possible role for vegf in the development of ph vegf produced endogenously by ec is also crucial for the maintenance of vascular endothelium [50, 51 ]. cd40 and its ligand : cd40 ligand (cd40l) is a transmembrane protein found on the surface of cd4 + t cells and activated platelets as well as in plasma (soluble form). cd40 can be found on the b cells, macrophages, vascular smooth muscle and ec. damas showed several evidences in favor of a role for this pathway in ph, including higher levels of soluble cd40l in secondary and idiopathic ph but not in cteph patients, lower levels in patients receiving warfarin, higher levels in arterial blood than in mixed venous samples (enhanced release or reduced clearance in pulmonary vasculature), and increased secretion of soluble cd40l by pallets of ph patients. platelet - derived growth factor : platelet - derived growth factor (pdgf) is a disulphide - linked polypeptide comprised of two chains (a and b) and appearing as three dimeric isoforms termed pdgf aa, ab, and bb [53, 54 ]. many cell types including smooth muscle cells, and macrophages secrete pdgf - like molecules [53, 54 ]. existence of pdgf - ab in platelets may be confined to humans [54, 55 ]. pdgf - b is processed in platelets into a soluble and active isoform lacking the retention motif. growth factors such as pdgf may participate in the initiation and/or progression of idiopathic pah. there is an evidence that serotonin transactivates pdgf receptor (pdgfr) through sert in pasmc. light : lymphotoxin - like inducible protein that competes with glycoprotein d for herpesvirus entry mediator on t lymphocytes (light), is a platelet - derived member of the tissue necrosis factor superfamily. serum levels of light are increased in ph patients and its arterial level correlates with mortality. immunostaining of light and its receptors was observed in alveolar macrophages, vascular smooth muscle cells, and ec in lungs from patients with pah. based on these observations, it was suggested that light may have a role in the pathogenesis of ph, although further studies were recommended as well. platelets and angiogenesis : platelets seem to play a significant role in angiogenesis through their proangiogenic and antiangiogenic factors. platelets and megakaryocytes promote angiogenesis through proangiogenic factors like vegf - a, fibroblast growth factor 2, epidermal growth factor, pdgf and matrix metallopeptidase 9 [4861 ]. on the other hand, they inhibit angiogenesis by their antiangiogenic factors like platelet factor 4, thrombospondin 1, 2-macroglobulin, pai-1, and angiostatin. a disordered or misguided angiogenesis was suggested to be present in patients with severe ph. inflammatory and connective tissue diseases : inflammation appears to play a significant role in some types of pah, including those secondary to connective tissue diseases. pah occurs in patients with systemic sclerosis (ss) and crest syndrome (calcinosis, the raynaud phenomenon, esophageal dysfunction, sclerodactyly, and telangiectasia), and less frequently in patients with systemic lupus erythematosus (sle), rheumatoid arthritis, takayasu arteritis, polymyositis, and dermatomyositis. it was hypothesized that the initial lesions appears due to vasoconstriction or vasospasm, but inflammation and excessive platelet adhesion lead to the vasculopathy. activation of the pdgf / pdfgr signaling pathway has been linked to some proliferative and fibrotic disorders including pah and ss. it was suggested that these antibodies may contribute to the development of pah in this disease. pah is also found in 0.5 - 14% of patients with sle, being the third cause of death after infections and organ failure. some of these patients have experienced significant improvements with immunosuppressive therapy, emphasizing the importance of inflammation in this setting. antiphospholipid (apl) antibodies have been detected in pah due to thromboembolism and in the primary plexogenic pah. pah may be the only manifestation of the antiphospholipid syndrome (aps), and patients have been observed with very high levels of apl antibodies. the prevalence of pah in primary aps and secondary aps patients is around 3.5% and 1.8%, respectively. apl antibodies found in a greater percentage of sle patients with pah than in those with normal pap. interaction between apl and ec and the resultant vascular remodeling was suggested as the basis of pah development. human immunodeficiency virus(hiv) infection : several cases of hiv-1 infected patients with idiopathic pah have been reported, raising the question of a causal relationship between these two conditions [57, 7579 ]. the lack of evidence for a direct hiv-1 pulmonary artery infection by means of electron microscopy, immunochemistry, deoxyribonucleic acid in situ hybridization, and polymerase chain reaction in two patients displaying hiv-1-associated idiopathic pah has suggested that hiv-1 may act in these cases through mediator release associated with retroviral infection rather than by direct endothelial infection [57, 76 ]. hemoglobinopathies : pah is one of the complications of sickle cell disease (scd). mild pah (pap 45mmhg) in 10% of the patients. direct inhibition of no by plasma hemoglobin released from damaged red blood cells leads to platelet activation because no is a potent inhibitor of this pathway [8082 ]. clinical studies of patients with scd reveal correlations between the intrinsic rate of intravascular hemolysis and blood levels of procoagulant factors [80, 83, 84 ]. cell - free plasma hemoglobin mediated resistance to no and the development of pah has also been shown in transgenic mouse models of scd and spherocytosis, and in mouse models of alloimmune hemolysis and malaria [80, 85, 86 ]. no bioavailability is decreased not only through no scavenging by plasma hemoglobin and superoxide, but also through arginine depletion by plasma arginase, and increased no inactivation by reactive oxygen species derived from xanthine oxidase, nicotinamide adenine dinucleotide phosphate - oxidase, hemoglobin s autooxidation, and uncoupled endothelial nitric oxide synthase (enos). in scd patients, plasma level of pdgf bb correlated positively with tricuspid valve regurgitation velocity (which reflects systolic pap), while that of vegf negatively correlated. activated platelets might be a source of increased plasma pdgf levels in scd [82, 88 ]. ph is found in 1075% of patients with thalassemia and can be the leading cause of heart failure in these patients [8992 ]. prior splenectomy, older age, and evidence for chronic hemolysis were significantly associated with pah. this can trigger low - grade hypercoagulability, which is enhanced in splenectomized patients [9294 ]. alternatively, there is a growing evidence that hemolysis - induced no scavenging is responsible for the pah development in thalassemia, causing platelet activation, thrombosis, and endothelial dysfunction [92, 95 ]. singer found higher soluble p - selectin levels in pulmonary hypertensive thalassemic patients in comparison with pulmonary normotensive ones. they also found lower protein c in these patients which may contribute to a hypercoagulable state, but its role in the development of pah is unknown. it was reported that a shorter platelets life span in both splenectomized and non - splenectomiszed patients with thalassemia than in non - thalassemic splenectomized patients [96, 97 ]. thromboembolic ph : acute massive pulmonary thromboembolism (pte) increases pap and pvr. in some subjects including a small number (0.1- 3.8%) of pte patients, a chronic state of thromboembolism leads to ph [98, 99 ]. the pathophysiology of cteph is not completely understood : proposed mechanisms include a t - pa / pai-1 imbalance, and lysis - resistant fibrinogen variants [101, 102 ]. a difficult situation is to distinguish an acute ph in an already normal pte patient from an acute embolism in an unrecognized cteph patient as these two conditions need different treatment algorithms. lifelong anticoagulation is required for all cteph patients, while antiplatelet therapy is indicated in some. ph crisis after cardiopulmonary bypass : after cardiac surgery, a sudden increase in pap and pvr may occur.. the pathophysiology of these problematic and sometimes fatal episodes, called pulmonary hypertensive crisis, is complex and not well understood yet. the exposure of platelets to the artificial membrane during cardiopulmonary bypass may activate them and contribute to this process. endothelial injury, hypothermia, and nonpulsatile perfusion may be more important factors than the artificial membrane in this situation. the mechanism of endothelial injury is not well understood ; however, ischemia - reperfusion injury could be its main basis. endothelial injury impairs the balance between vasodilatory and vasoconstrictive mechanisms in favor of the latter, and promotes platelet aggregation and activation. drug- and toxin - induced pah : pah may develop after using anorexigen drugs such as fenfluramines, aminorex and toxins like rapeseed oil. although there is an accepted belief that these drugs potentiate pah through their serotonin releasing properties [22, 105 ], there are controversies as dexfenfluramine can actually lower blood serotonin and may only slightly elevate plasma serotonin to nontoxic levels [105107 ]. often the fenfluramines and phentermine were co - administered. the combination of fenfluramine / phentermine is known to increase sert activity [20, 108 ]. essential thrombocythemia (et) : altintas found ph in 47.8% of et patients. there was a statistically significant difference in platelet counts between et patients with ph and without ph. anticoagulation : abnormalities of the activated clotting system [32, 110112 ], impaired fibrino - lysis [11, 112, 113 ], abnormal platelet function [16, 112, 114 ], histological evidence of microvascular thrombosis [112, 115, 116 ], ec dysfunction and injury, and increased tendency to develop deep vein thrombosis due to low cardiac output and sedentary life in chronic patients are the rationale to use anticoagulants in ph [9, 112 ]. however, there is no randomized controlled trial and only observational studies data supports their administration [9, 112, 117 ]. in a systematic review, johnson reported that five observational studies suggested a survival benefit associated with warfarin in the treatment of idiopathic ph, whereas two others did not support this association. anticoagulants are indicated for idiopathic ph (class iia, level of evidence c) and permitted for secondary ph (class iib, level of evidence c) [117, 118 ]. prostacyclin and its analogues : several reports have shown that prostacyclin therapy directly inhibits platelets [9, 119121 ]. it is not clear whether epoprostenol, ph, or both cause this complication, although the drug seems to play a greater role. in one patient in whom epoprostenol was discontinued, platelet counts improved after discontinuation of epoprostenol despite worsening hemodynamics, and then fell after re - initiation at a lower dose despite improvement in hemodynamics, suggesting that epoprostenol caused the thrombocytopenia. the mechanism of epoprostenol - induced thrombocytopenia is unknown, as well as its significance. in addition, prostacyclin therapy in ph was associated with a significant decrease in serum levels of light. a recent study confirmed platelet inhibitory function of epoprostenol by preventing platelet aggregation and platelet - leukocyte conjugates formation. the observed results on platelet function were postulated to explain, at least partly, the beneficial effects of this drug in ph patients. phosphodiesterase type 5 inhibitors : no is an important molecule in a number of cellular functions, including the regulation of vascular smooth muscle tone [125, 126 ]. the physiological target of no is soluble guanylate cyclase, the enzyme which catalyses the conversion of guanosine triphosphate (gtp) to the intracellular second messenger cyclic guanosine monophosphate (cgmp), mediating no induced relaxation [126, 127 ]. intracellular cgmp is rapidly inactivated to guanosine monophosphate (gmp) by the action of cyclic nucleotide phosphodiesterases (pdes). therefore, cgmp concentration in smooth muscle cells is mainly dependent on the balance between the synthesis by soluble guanylate cyclase and the breakdown by pdes, which represents the unique degradation pathway for this second messenger [126, 128, 129 ]. there exist 11 distinct pde isoenzymes which differ in their substrates, stimulators, inhibitors or gene homology [126, 130 ]. pde5 is the isoenzyme highly presented in pulmonary vasculature [126, 131, 132 ], and pulmonary vasodilatation has been resulted from its inhibition [126, 133135 ]. these inhibitors, specifically sildenafil, received attention for their action on the pulmonary vasculature and the observed beneficial effects in the treatment of ph [126, 136139 ]. as pde5 is present in human platelets, the effect of no and no donors on platelet function is potentiated by sildenafil [82, 140, 141 ]. enhancement of platelet sensitivity to no by pde5 inhibition returns platelet activation to more normal levels in patients with scd and pah. this effect is added to the beneficial effects of sildenafil on endothelial function in these patients. this drug significantly reduced the ca mobilization and ca influx in thrombin - stimulated rabbit washed platelets. nitric oxide : inhaled no is administered for the acute treatment of ph, mostly after cardiac surgery and in pphn. as mentioned previously, this drug is a potent inhibitor of platelet activation. beghetti found that 30 ppm inhaled no inhibits platelet aggregation after stimulation by collagen, arachidonic acid, and epinephrine. it was postulated that platelet effects of no should be mediated through a cgmp - independent mechanism, in contrary to the vascular effects. et-1 is overexpressed in ph and may be an important factor in the initiation or progression of the disease. the et-1 effects can be mediated directly through its receptors on the platelets, or indirectly through activation of prostaglandin synthesis [144, 145 ]. iannone showed that serum levels of the soluble form of platelet ec adhesion molecule-1 (pecam-1) is increased in patients with systemic sclerosis and pah, and bosentan therapy can return it to the normal values. phosphodiesterase type 3 inhibitors : pulmo - nary vasodilation can be induced by milrinone through its action on a cyclic adenylate monophosphate pathway. clinically, it is used for the treatment of pphn and postoperative ph [149, 150 ]. it is not known whether the vasodilatory role of mirinone is solely responsible for its pulmonary antihypertensive action, or its antiplatelet role may be important as well. kikura found no difference in platelet count, bleeding time, and platelet aggregation between cardiac postoperative patients receiving milrinone or not. tanaka speculated that at least part of the pulmonary antihypertensive action of milrinone may be through its platelet inhibitory properties. pdgfr inhibitors : the multi - kinase inhibitor (including pdgfr) imatinib mesylate reversed pulmonary vascular remodeling in rats with monocrotaline - induced pah and in chronically hypoxic mice [154, 155 ]. addition of imatinib to approved ph drugs was reported to improve pulmonary hemodynamics and functional capacity of some patients with severe pah [156159 ]. a completed phase ii clinical trial investigating the safety and efficacy of imatinib mesylate in ph failed to meet the primary efficacy end point of improvement in exercise capacity. the combined inhibition of tyrosine and serine / threonine kinases can provide an option to treat ph and associated right heart remodeling. serotonin antagonists : although there is general agreement that serotonin is important in the pathophysiology of pah, no serotonin antagonist exists with clinically accepted effects in this disease. several agents are targets for investigation in human pah, including the highly selective 5-ht2b antagonist prx-08066 and escitalopram (a serotonin reuptake inhibitor). there is a bulk of evidence in favor of a complex association between platelets and ph. although there is a small number of reports against a causative role and a risk that many of these observations be secondary to ph, it seems that the role of these blood elements can not be overlooked in the pathophysiology of ph. the author tried to provide a comprehensive collection of evidences ; however, the presented list of associations between platelets and ph may be incomplete as these relations are numerous, complex, and many of them not well understood. in addition, ph is a heterogeneous disease with diverse pathophysiological bases, and the relation of platelets to each type may be different. in spite of these evidences, the specific antiplatelet drugs such as aspirin and clopidogrel were not studied sufficiently in ph patients. in addition, no randomized clinical trial studied the role of anticoagulants in ph. these can make the basis of future researches on the relation of platelets and ph. pulmonary intravascular thrombosis and thrombotic arteriopathy are common pathological findings in ph [1, 3 ]. increased thromboxane (txa2) and serotonin and decreased prostacyclin (pgi2) and nitric oxide (no) enhance platelet aggregation in ph patients. maeda found a subpopulation of ph patients with increased propensity to thrombosis as suggested by increased platelet protease - activated receptor 1 (par1, a key element in the activation of human platelets by thrombin) expression and par - mediated surface exposure of p - selectin (an adhesion molecule, a marker for in vivo platelet activation, and an essential component in thrombus formation), associated with thrombocytopenia. it is not clear whether thrombocytopenia in ph patients is an incidental finding, caused by platelet consumption in pulmonary vasculature, or resulted from platelet shearing due to pulmonary microangiopathy as suggested by herve. interactions with endothelial cells : endothelial cells (ec) participate actively in the process of coagulation. they activate factor x, facilitate the formation of the thrombin - activating prothrombinase complex, activate the extrinsic pathway of coagulation by releasing tissue factor, and produce and release von willebrand factor (vwf). on the other hand ec express thrombomodulin, a high affinity receptor for thrombin, on their surface which prevents cleavage of fibrinogen to fibrin. ec are a source of both tissue plasminogen activator (t - pa), an important activator of plasminogen in the fibrinolytic cascade and plasminogen activator inhibitor-1 (pai-1), an inhibitor of t - pa. these facts show the importance of ec in regulating the fine balance of prothrombotic and antithrombotic processes. there are evidences in favor of an imbalance in ph patients. in 19 out of 27 patients with idiopathic pah, low soluble thrombomodulin, low fibrinolytic activity, and high fibrinolytic inhibitor levels were seen in idiopathic ph patients. those with secondary ph had elevated fibrinogen levels, increased vwf, and a trend to increased t - pa. it is noteworthy that an additional role for pai- 1 in vascular remodeling was suggested. the studies about such a role for pai-1 in ph are limited in number and conflicting. eicosanoids : activated platelets are the major producers of txa2, a vasoconstrictive and proaggregatory eicosanoid. it is a physiological antagonist of txa2, inhibiting platelet aggregation and relaxing vascular smooth muscle. abnormal production of eicosanoids has been demonstrated in idiopathic and secondary ph, including patients with congenital heart diseases before and after surgical correction of these diseases [1419 ]. in children with left - to - right shunts and in adolescents with eisenmenger syndrome, the ratio of txa2 to pgi2 metabolites urinary excretion is elevated as compared to control subjects [14, 15, 19 ]. prostacyclin analogues are important drugs in the treatment of ph, emphasizing the causative role of this eicosanoid in the development of ph. in contrary, it is not known whether txa2 changes are secondary or primary to ph. serotonin : serotonin (5-hydroxytriptamine, 5ht) is produced in the central nervous system (cns), enterochromaffin cells and limitedly in platelets. although platelets are not a large producer of serotonin, they are a major storage site for this mediator outside the cns. platelets readily take up serotonin from plasma, leaving very little circulating. under certain circumstances, first, it is a pulmonary vasoconstrictor, mainly through its 5ht1b receptor. in mice and human, overexpression of 5-ht2b (another serotonin receptor subtype) in the pulmonary arterial tree is associated with the development of ph. second, serotonin has mitogenic activity on pulmonary arterial smooth muscle cells (pasmc), causing their hypertrophy and proliferation [20, 23, 24 ]. it was speculated that highly selective serotonin transporter (sert) plays an important role in this mechanism. patients with ph have pasmc with faster growth rate than normal subjects after stimulation by serotonin or serum. selective serotonin transporter inhibitors fluoxetine and citalopram, but not serotonin receptor antagonists ketanserin (a 5ht2a antagonist) and gr127935 (a selective 5ht1b/1d antagonist) can inhibit those effects [19, 25 ]. sert gene polymorphism was also found to be a determinant of ph severity [19, 26 ]. in addition, a 5hta2-mediated p38 mitogen - activated protein kinase activation with mitogenic effects on pulmonary artery fibroblasts from chronically hypoxic rats was observed [19, 27 ]. last, serotonin stimulates platelet aggregation especially in combination with adenosine diphosphate and txa2 [20, 28 ]. the significance of increased plasma levels of serotonin in ph is not clear. while some studies reported high plasma levels of serotonin in ph patients [5, 29, 30 ], some found normal values in their cohort [30, 31 ]. increased serotonin level may be secondary to its impaired metabolism, as pulmonary ec contribute greatly to its clearance and their damage can be a sign of idiopathic ph. successful therapy by a potent antiaggregatory agent, epoprostenol, and heart - lung transplantation did not lower plasma serotonin levels [5, 29 ]. breuer found higher urinary excretion of 5-hydroxyindolacetic acid (a major metabolite of serotonin) in ph patients with left to right shunts and contributed it to higher metabolism of serotonin in these patients. vwf is present in the endothelial basement membrane and in plasma. in endothelial basement membrane, vwf acts as a carrier for coagulation factor viii, and within platelet -granules as an adhesive protein. ec stimulation in pathological conditions, like ph is followed by a rapid release of vwf from storage granules into the circulation. plasma level of vwf is used as a marker for ec damage, and increased levels of vwf have been reported in patients with ph [33, 34 ]. plasma antigenic activity of vwf (vwf : ag) can be a useful biochemical index for predicting a short - term prognosis in ph. a plasma vwf : ag higher than 240% of standard activity was 54% sensitive and 93% specific for identifying patients who were unlikely to survive one year, with an overall predictive value of 75%. elevated baseline and follow up vwf levels were showed to be associated with worse survival. nitric oxide : endothelium - derived no (eno) is a potent inhibitor of platelet aggregation in addition to its vasodilatory and antiproliferative effects. deficiency in endothelial no synthase (enos) sensitize mice to hypoxia - induced ph, whereas pulmonary gene transfer of enos could protect the lungs. tetrahydrobiopterin (bh4) is an essential cofactor for the enzymatic activity of all three isoenzymes of nos, including enos. khoo showed that mice deficient in bh4 developed ph which can be reversed by increasing bh4 availability. they also found that augmented bh4 production can be protective against hypoxia - induced ph in mice. platelet activating factor : platelet activating factor (paf) is a phospholipid with diverse physiological and pathological actions. caplan reported high paf plasma levels in newborns with persistent pulmonary hypertension of the newborn (pphn), correlation between plasma paf level and disease severity, and a fall in paf levels as they improved clinically. paf has also been implicated in chronic hypoxia - induced ph in adult rats [4042 ]. bixby found increased paf synthesis in pulmonary arteries, increased paf receptor protein expression, increased paf receptor binding, and an increase in paf induced smooth muscle cell proliferation in fetal lambs exposed to chronic high altitude hypoxia. it is cleaved from plasminogen at the platelet plasma membrane, absorbed by platelet membrane, and released only upon aggregation [4346 ]. overexpression of angiostatin is associated with ph in mice [44, 47 ]. only upon thrombus formation in the pulmonary capillaries would excessive amounts of angiostatin be released in a localized manner, where it could contribute to the ec microfragment formation, injury and/or death, and possibly to the progression of ph. idiopathic pah patients have significantly elevated platelet, but not plasma, angiostatin levels compared to controls. vascular endothelial growth factor : vascular endothelial growth factor (vegf) is a growth factor involved in vasculogenesis and angiogenesis. this factor antagonizes the formation of apoptotic endothelial microfragments by angiostatin [44, 48, 49 ]. a possible role for vegf in the development of ph is suggested but not approved yet. vegf produced endogenously by ec is also crucial for the maintenance of vascular endothelium [50, 51 ]. cd40 and its ligand : cd40 ligand (cd40l) is a transmembrane protein found on the surface of cd4 + t cells and activated platelets as well as in plasma (soluble form). cd40 can be found on the b cells, macrophages, vascular smooth muscle and ec. damas showed several evidences in favor of a role for this pathway in ph, including higher levels of soluble cd40l in secondary and idiopathic ph but not in cteph patients, lower levels in patients receiving warfarin, higher levels in arterial blood than in mixed venous samples (enhanced release or reduced clearance in pulmonary vasculature), and increased secretion of soluble cd40l by pallets of ph patients. platelet - derived growth factor : platelet - derived growth factor (pdgf) is a disulphide - linked polypeptide comprised of two chains (a and b) and appearing as three dimeric isoforms termed pdgf aa, ab, and bb [53, 54 ]. many cell types including smooth muscle cells, and macrophages secrete pdgf - like molecules [53, 54 ]. existence of pdgf - ab in platelets may be confined to humans [54, 55 ]. pdgf - b is processed in platelets into a soluble and active isoform lacking the retention motif. growth factors such as pdgf may participate in the initiation and/or progression of idiopathic pah. there is an evidence that serotonin transactivates pdgf receptor (pdgfr) through sert in pasmc. light : lymphotoxin - like inducible protein that competes with glycoprotein d for herpesvirus entry mediator on t lymphocytes (light), is a platelet - derived member of the tissue necrosis factor superfamily. serum levels of light are increased in ph patients and its arterial level correlates with mortality. immunostaining of light and its receptors was observed in alveolar macrophages, vascular smooth muscle cells, and ec in lungs from patients with pah. based on these observations, it was suggested that light may have a role in the pathogenesis of ph, although further studies were recommended as well. platelets and angiogenesis : platelets seem to play a significant role in angiogenesis through their proangiogenic and antiangiogenic factors. platelets and megakaryocytes promote angiogenesis through proangiogenic factors like vegf - a, fibroblast growth factor 2, epidermal growth factor, pdgf and matrix metallopeptidase 9 [4861 ]. on the other hand, they inhibit angiogenesis by their antiangiogenic factors like platelet factor 4, thrombospondin 1, 2-macroglobulin, pai-1, and angiostatin. a disordered or misguided angiogenesis was suggested to be present in patients with severe ph. inflammatory and connective tissue diseases : inflammation appears to play a significant role in some types of pah, including those secondary to connective tissue diseases. pah occurs in patients with systemic sclerosis (ss) and crest syndrome (calcinosis, the raynaud phenomenon, esophageal dysfunction, sclerodactyly, and telangiectasia), and less frequently in patients with systemic lupus erythematosus (sle), rheumatoid arthritis, takayasu arteritis, polymyositis, and dermatomyositis. it was hypothesized that the initial lesions appears due to vasoconstriction or vasospasm, but inflammation and excessive platelet adhesion lead to the vasculopathy. activation of the pdgf / pdfgr signaling pathway has been linked to some proliferative and fibrotic disorders including pah and ss. it was suggested that these antibodies may contribute to the development of pah in this disease. pah is also found in 0.5 - 14% of patients with sle, being the third cause of death after infections and organ failure. some of these patients have experienced significant improvements with immunosuppressive therapy, emphasizing the importance of inflammation in this setting. antiphospholipid (apl) antibodies have been detected in pah due to thromboembolism and in the primary plexogenic pah. pah may be the only manifestation of the antiphospholipid syndrome (aps), and patients have been observed with very high levels of apl antibodies. the prevalence of pah in primary aps and secondary aps patients is around 3.5% and 1.8%, respectively. apl antibodies found in a greater percentage of sle patients with pah than in those with normal pap. interaction between apl and ec and the resultant vascular remodeling was suggested as the basis of pah development. human immunodeficiency virus(hiv) infection : several cases of hiv-1 infected patients with idiopathic pah have been reported, raising the question of a causal relationship between these two conditions [57, 7579 ]. the lack of evidence for a direct hiv-1 pulmonary artery infection by means of electron microscopy, immunochemistry, deoxyribonucleic acid in situ hybridization, and polymerase chain reaction in two patients displaying hiv-1-associated idiopathic pah has suggested that hiv-1 may act in these cases through mediator release associated with retroviral infection rather than by direct endothelial infection [57, 76 ]. hemoglobinopathies : pah is one of the complications of sickle cell disease (scd). mild pah (pap 45mmhg) in 10% of the patients. direct inhibition of no by plasma hemoglobin released from damaged red blood cells leads to platelet activation because no is a potent inhibitor of this pathway [8082 ]. clinical studies of patients with scd reveal correlations between the intrinsic rate of intravascular hemolysis and blood levels of procoagulant factors [80, 83, 84 ]. cell - free plasma hemoglobin mediated resistance to no and the development of pah has also been shown in transgenic mouse models of scd and spherocytosis, and in mouse models of alloimmune hemolysis and malaria [80, 85, 86 ]. no bioavailability is decreased not only through no scavenging by plasma hemoglobin and superoxide, but also through arginine depletion by plasma arginase, and increased no inactivation by reactive oxygen species derived from xanthine oxidase, nicotinamide adenine dinucleotide phosphate - oxidase, hemoglobin s autooxidation, and uncoupled endothelial nitric oxide synthase (enos). in scd patients, plasma level of pdgf bb correlated positively with tricuspid valve regurgitation velocity (which reflects systolic pap), while that of vegf negatively correlated. activated platelets might be a source of increased plasma pdgf levels in scd [82, 88 ]. ph is found in 1075% of patients with thalassemia and can be the leading cause of heart failure in these patients [8992 ]. prior splenectomy, older age, and evidence for chronic hemolysis were significantly associated with pah. this can trigger low - grade hypercoagulability, which is enhanced in splenectomized patients [9294 ]. alternatively, there is a growing evidence that hemolysis - induced no scavenging is responsible for the pah development in thalassemia, causing platelet activation, thrombosis, and endothelial dysfunction [92, 95 ]. singer found higher soluble p - selectin levels in pulmonary hypertensive thalassemic patients in comparison with pulmonary normotensive ones. they also found lower protein c in these patients which may contribute to a hypercoagulable state, but its role in the development of pah is unknown. it was reported that a shorter platelets life span in both splenectomized and non - splenectomiszed patients with thalassemia than in non - thalassemic splenectomized patients [96, 97 ]. thromboembolic ph : acute massive pulmonary thromboembolism (pte) increases pap and pvr. in some subjects including a small number (0.1- 3.8%) of pte patients, a chronic state of thromboembolism leads to ph [98, 99 ]. the pathophysiology of cteph is not completely understood : proposed mechanisms include a t - pa / pai-1 imbalance, and lysis - resistant fibrinogen variants [101, 102 ]. a difficult situation is to distinguish an acute ph in an already normal pte patient from an acute embolism in an unrecognized cteph patient as these two conditions need different treatment algorithms. lifelong anticoagulation is required for all cteph patients, while antiplatelet therapy is indicated in some. ph crisis after cardiopulmonary bypass : after cardiac surgery, a sudden increase in pap and pvr may occur.. the pathophysiology of these problematic and sometimes fatal episodes, called pulmonary hypertensive crisis, is complex and not well understood yet. the exposure of platelets to the artificial membrane during cardiopulmonary bypass may activate them and contribute to this process. endothelial injury, hypothermia, and nonpulsatile perfusion may be more important factors than the artificial membrane in this situation. the mechanism of endothelial injury is not well understood ; however, ischemia - reperfusion injury could be its main basis. endothelial injury impairs the balance between vasodilatory and vasoconstrictive mechanisms in favor of the latter, and promotes platelet aggregation and activation. drug- and toxin - induced pah : pah may develop after using anorexigen drugs such as fenfluramines, aminorex and toxins like rapeseed oil. although there is an accepted belief that these drugs potentiate pah through their serotonin releasing properties [22, 105 ], there are controversies as dexfenfluramine can actually lower blood serotonin and may only slightly elevate plasma serotonin to nontoxic levels [105107 ]. the combination of fenfluramine / phentermine is known to increase sert activity [20, 108 ]. essential thrombocythemia (et) : altintas found ph in 47.8% of et patients. there was a statistically significant difference in platelet counts between et patients with ph and without ph. anticoagulation : abnormalities of the activated clotting system [32, 110112 ], impaired fibrino - lysis [11, 112, 113 ], abnormal platelet function [16, 112, 114 ], histological evidence of microvascular thrombosis [112, 115, 116 ], ec dysfunction and injury, and increased tendency to develop deep vein thrombosis due to low cardiac output and sedentary life in chronic patients are the rationale to use anticoagulants in ph [9, 112 ]. however, there is no randomized controlled trial and only observational studies data supports their administration [9, 112, 117 ]. in a systematic review, johnson reported that five observational studies suggested a survival benefit associated with warfarin in the treatment of idiopathic ph, whereas two others did not support this association. anticoagulants are indicated for idiopathic ph (class iia, level of evidence c) and permitted for secondary ph (class iib, level of evidence c) [117, 118 ]. prostacyclin and its analogues : several reports have shown that prostacyclin therapy directly inhibits platelets [9, 119121 ]. it is not clear whether epoprostenol, ph, or both cause this complication, although the drug seems to play a greater role. in one patient in whom epoprostenol was discontinued, platelet counts improved after discontinuation of epoprostenol despite worsening hemodynamics, and then fell after re - initiation at a lower dose despite improvement in hemodynamics, suggesting that epoprostenol caused the thrombocytopenia. the mechanism of epoprostenol - induced thrombocytopenia is unknown, as well as its significance. in addition, prostacyclin therapy in ph was associated with a significant decrease in serum levels of light. a recent study confirmed platelet inhibitory function of epoprostenol by preventing platelet aggregation and platelet - leukocyte conjugates formation. the observed results on platelet function were postulated to explain, at least partly, the beneficial effects of this drug in ph patients. phosphodiesterase type 5 inhibitors : no is an important molecule in a number of cellular functions, including the regulation of vascular smooth muscle tone [125, 126 ]. the physiological target of no is soluble guanylate cyclase, the enzyme which catalyses the conversion of guanosine triphosphate (gtp) to the intracellular second messenger cyclic guanosine monophosphate (cgmp), mediating no induced relaxation [126, 127 ]. intracellular cgmp is rapidly inactivated to guanosine monophosphate (gmp) by the action of cyclic nucleotide phosphodiesterases (pdes). therefore, cgmp concentration in smooth muscle cells is mainly dependent on the balance between the synthesis by soluble guanylate cyclase and the breakdown by pdes, which represents the unique degradation pathway for this second messenger [126, 128, 129 ]. there exist 11 distinct pde isoenzymes which differ in their substrates, stimulators, inhibitors or gene homology [126, 130 ]. pde5 is the isoenzyme highly presented in pulmonary vasculature [126, 131, 132 ], and pulmonary vasodilatation has been resulted from its inhibition [126, 133135 ]. these inhibitors, specifically sildenafil, received attention for their action on the pulmonary vasculature and the observed beneficial effects in the treatment of ph [126, 136139 ]. as pde5 is present in human platelets, the effect of no and no donors on platelet function is potentiated by sildenafil [82, 140, 141 ]. enhancement of platelet sensitivity to no by pde5 inhibition returns platelet activation to more normal levels in patients with scd and pah. this effect is added to the beneficial effects of sildenafil on endothelial function in these patients. this drug significantly reduced the ca mobilization and ca influx in thrombin - stimulated rabbit washed platelets. this action enhances pulmonary vasodilatory effect of vardenafil. nitric oxide : inhaled no is administered for the acute treatment of ph, mostly after cardiac surgery and in pphn. as mentioned previously, this drug is a potent inhibitor of platelet activation. beghetti found that 30 ppm inhaled no inhibits platelet aggregation after stimulation by collagen, arachidonic acid, and epinephrine. it was postulated that platelet effects of no should be mediated through a cgmp - independent mechanism, in contrary to the vascular effects. et-1 is overexpressed in ph and may be an important factor in the initiation or progression of the disease. the et-1 effects can be mediated directly through its receptors on the platelets, or indirectly through activation of prostaglandin synthesis [144, 145 ]. iannone showed that serum levels of the soluble form of platelet ec adhesion molecule-1 (pecam-1) is increased in patients with systemic sclerosis and pah, and bosentan therapy can return it to the normal values. phosphodiesterase type 3 inhibitors : pulmo - nary vasodilation can be induced by milrinone through its action on a cyclic adenylate monophosphate pathway. clinically, it is used for the treatment of pphn and postoperative ph [149, 150 ]. it is not known whether the vasodilatory role of mirinone is solely responsible for its pulmonary antihypertensive action, or its antiplatelet role may be important as well. kikura found no difference in platelet count, bleeding time, and platelet aggregation between cardiac postoperative patients receiving milrinone or not. tanaka speculated that at least part of the pulmonary antihypertensive action of milrinone may be through its platelet inhibitory properties. pdgfr inhibitors : the multi - kinase inhibitor (including pdgfr) imatinib mesylate reversed pulmonary vascular remodeling in rats with monocrotaline - induced pah and in chronically hypoxic mice [154, 155 ]. addition of imatinib to approved ph drugs was reported to improve pulmonary hemodynamics and functional capacity of some patients with severe pah [156159 ]. a completed phase ii clinical trial investigating the safety and efficacy of imatinib mesylate in ph failed to meet the primary efficacy end point of improvement in exercise capacity. the combined inhibition of tyrosine and serine / threonine kinases can provide an option to treat ph and associated right heart remodeling. serotonin antagonists : although there is general agreement that serotonin is important in the pathophysiology of pah, no serotonin antagonist exists with clinically accepted effects in this disease. several agents are targets for investigation in human pah, including the highly selective 5-ht2b antagonist prx-08066 and escitalopram (a serotonin reuptake inhibitor). there is a bulk of evidence in favor of a complex association between platelets and ph. although there is a small number of reports against a causative role and a risk that many of these observations be secondary to ph, it seems that the role of these blood elements can not be overlooked in the pathophysiology of ph. the author tried to provide a comprehensive collection of evidences ; however, the presented list of associations between platelets and ph may be incomplete as these relations are numerous, complex, and many of them not well understood. in addition, ph is a heterogeneous disease with diverse pathophysiological bases, and the relation of platelets to each type may be different. in spite of these evidences, the specific antiplatelet drugs such as aspirin and clopidogrel were not studied sufficiently in ph patients. these can make the basis of future researches on the relation of platelets and ph. in summary, platelets not only participate actively in thrombus formation, but also produce (txa2, light, angiostatin, and pdgf), store (serotonin, vwf, and vegf), and release mediators that may contribute to the initiation or aggravation of ph (fig. platelets are related to all three basic mechanisms of ph : vasoconstriction (serotonin and txa2), thrombotic lesions (aggregation, serotonin, txa2, cd40l, and vwf), and remodeling (serotonin, cd40l, proangiogenic and antiangiogenic factors). summary of the major mechanisms of platelets associations with pulmonary vasoconstriction, thrombus formation, and remodeling in the pulmonary vessels. antiang : antiangiogenic facrors (platelet factor 4, thrombospondin 1, 2-macroglobulin, plasminogen activator inhibitor-1, and angiostatin) ; cd40l, cd40 ligand ; proang : proangiogenic factors (vascular endothelial growth factor a, fibroblast growth factor 2, epidermal growth factor, platelet - derived growth factor and matrix metallopeptidase 9) ; txa2 : thromboxane a2 ; vwf : von willebrand factor. | pathophysiology of pulmonary arterial hypertension is based on three basic mechanisms : thrombotic pulmonary vascular lesions, vasoconstriction and vascular remodeling. platelets are related to all of these mechanisms by their aggregation, production, storage and release of several mediators. the role of platelets is more prominent in some types of pulmonary arterial hypertension, including those which are secondary to inflammatory and infectious diseases, hemoglobinopathies, essential thrombocythemia, drugs, thromboembolism, and cardiac surgery. most pulmonary antihypertensive drugs have a negative effect on platelets. in this review, the mechanisms of platelets association with pulmonary arterial hypertension, those types of pulmonary arterial hypertension with greatest platelet contribution to their pathophysiology, and the effects of pulmonary antihypertensive drugs on platelets are summarized. |
subjectivity should be distinguished because the qol is a unique perception for each individual, which reflects the patient 's self - assessment about their own health, defined by medical and nonmedical aspects of their lives. in fact, patients use the possible negative impact or treatment side effects for the evaluation of any medical intervention. therefore, the success or failure of a medical intervention is the qol acquired or recovered after it, in spite of success or technical failure of the procedure itself. moreover, qol is a multidimensional concept that comprised not only aspects directly related to health but also other nonmedical aspects, but the autonomy, the retention of employment, the impact on family relationships, the economic resources, and many other life circumstances are connected as well. thus, it has been defined as the value assigned by an individual per year of life, modified by the social disadvantage, the perception, the functional status, or deficiencies due to illness, treatment or accident, while the who definies it as : the perception that individual makes about his position in life, within its cultural context and value system, and related to its goals and vital objectives. " perhaps one of the rough and clear definitions referred to qol is the measure resulted from the physical, mental, and social well - being, such as is perceived by each individual. the medical and nonmedical factors are both related : the illness, as well as having an impact on the physical area of a person, has impact on the personal psychological state and his social relations. so we use the term health related quality of life, which could have been formally defined as the extent to which one 's usual or expected physical, emotional and social well - being is affected by a medical condition or its treatment. the concept of health related - quality of life (hrqol) covers the impact of the disease or medical actions on the physical symptoms, functional status, and mental and social functioning [13 ]. chronic kidney disease (ckd) has a great impact on hrqol [47 ]. symptoms appear and induce substantial changes in lifestyle from the early stages of the disease to the substitution treatment such as hemodialysis (hd), peritoneal dialysis (pd), or renal transplantation (rt). ckd is invariably associated with decreased hrqol, and there is a correlation between the magnitude of the effect on hrqol and glomerular filtration rate. the most affected hrqol areas are work and leisure, family life, and sleep and rest. although an adequate treatment of patients during the predialysis stage may slow the progression of ckd and that is recognized as an important factor of morbidity and mortality (and therefore of hrqol) of kidney patients, the start of dialysis treatment is the patients ' turning point in their concept of quality of life. they go from a situation of normal life " (often idealized) to a state of mortal danger " or (i) the well - beingthe repetition and frequency of dialysis procedure constantly reminds one of the disease, favouring self - analysis that exaggerates physiological phenomena. on the other hand, decreased sexual desire and activity (present in up to 50% of patients) are experienced as a sign of advanced age and interfere with relationships. finally, dietary restrictions are perceived (and therefore often ignored) as the deprivation of the last pleasure " that patients keep. the repetition and frequency of dialysis procedure constantly reminds one of the disease, favouring self - analysis that exaggerates physiological phenomena. on the other hand, decreased sexual desire and activity (present in up to 50% of patients) are experienced as a sign of advanced age and interfere with relationships. finally, dietary restrictions are perceived (and therefore often ignored) as the deprivation of the last pleasure " that patients keep. (ii) body imageissues like skin colour, body odour, loss of urinary function, sexual impotence, internal arteriovenous fistula or peritoneal catheter presence, scars, or abdominal distension help patients to perceive their bodies negatively and with inferiority feeling. and these feelings will limit the social and family relationships, encouraging introversion. issues like skin colour, body odour, loss of urinary function, sexual impotence, internal arteriovenous fistula or peritoneal catheter presence, scars, or abdominal distension help patients to perceive their bodies negatively and with inferiority feeling. and these feelings will limit the social and family relationships, encouraging introversion. (iii) autonomythe frequency of dialysis (either hd or exchange sessions in pd) interferes and limits the lifestyle of patients. on the other hand, inferiority feelings facilitate physical deterioration, passivity, neglect, and dependency, often enhanced by the good - intentioned help from patient 's family and social environment. the frequency of dialysis (either hd or exchange sessions in pd) interferes and limits the lifestyle of patients. on the other hand, inferiority feelings facilitate physical deterioration, passivity, neglect, and dependency, often enhanced by the good - intentioned help from patient 's family and social environment. (iv) the mental attitudeanxiety is always in the background due to daily contact with the disease and the risk of death. and that anxiety leads to distress, somatisation, obsessive attitudes, depression, aggression, and so forth. anxiety is always in the background due to daily contact with the disease and the risk of death. and that anxiety leads to distress, somatisation, obsessive attitudes, depression, aggression, and so forth. today, due to scientific and medical advances, patients survive with problems that were deadly time ago, but this survival is often associated with various degrees of disability, causing dependence and a greater need of both medical and social care. the progressive aging of the dialysis population and greater comorbidity is a fact, and the close relationship between hrqol and mortality score confirms the importance of including quality - of - life markers in the clinical management of patients. moreover, now patients not only have an expectation to survive but also expect to achieve a certain level of well - being. as most of the components of hrqol can not be observed directly, to quantify this so broad and confused " term we need measuring instruments such as hrqol questionnaires. the subjective assessments involve any aspect of patients ' health status that comes directly from the patient without interpretation of the response by a health care provider. the objective assessment of patient status is needed to evaluate the impact of health on quality of life and formulate clinical intervention strategies [1, 3, 4, 7 ]. the dimensions usually measured by hrqol questionnaires are physical function : mobility, self - care, and work, emotional function : well - being, satisfaction, depression, and anxiety, social function : social support, family, and social relationships, cognitive function : ability to reason, think, concentrate, and remember, other general or specific symptoms : sleep disturbance, sexual function, energy / vitality, pain, life satisfaction, body image, and so forth. hrqol questionnaires were designed and validated for specific populations and cultures, and therefore they need to be adapted to the language and culture in which it will be used, preserving the semantic content and thus leading to the equivalence between the two populations. this process of adaptation must be made according to scientific standards and has a complex but validated methodology. it is often preferable to use a hrqol questionnaire adapted to a new one, because in this way not only studies can be made to compare large groups, but also this use will be faster and cheaper. hrqol instruments are used for three main purposes : to discriminate between patients with better and worse hrqol at one time, to assess how much the quality of life has changed between two different time points, and to predict future hrqol from a current measurement. for accomplishing these purposes, the questionnaires must meet certain requirements to ensure valid and reliable clinical data [1, 3 ]. these requirements are the following. (i) viabilitythe best questionnaire will be useless if its implementation is difficult, costly, and complex for both patient and health professionals. this is why aspects such as simplicity, brevity and clarity of the questions, and ease of completion and correction must be valued. the best questionnaire will be useless if its implementation is difficult, costly, and complex for both patient and health professionals. this is why aspects such as simplicity, brevity and clarity of the questions, and ease of completion and correction must be valued. (ii) reliabilityit indicates the degree to which a measurement is free from random error and refers to the degree to which they can reproduce the results obtained under constant conditions, even in an extended series of repeated assessments. it indicates the degree to which a measurement is free from random error and refers to the degree to which they can reproduce the results obtained under constant conditions, even in an extended series of repeated assessments. (iii) coveragethe questionnaire should include all basic dimensions that are important to members of the patient population and susceptible to being affected, positively or negatively, by interventions. the questionnaire should include all basic dimensions that are important to members of the patient population and susceptible to being affected, positively or negatively, by interventions. (v) sensitivity to changeit shows the ability to detect and reflect true changes or differences in patient health. it shows the ability to detect and reflect true changes or differences in patient health. (vi) clinical significancethe definition of minimal clinical important difference, which is the rate of change in score of hrqol questionnaire that should make the medical treatment, will be implanted., which is the rate of change in score of hrqol questionnaire that should make the medical treatment, will be implanted. (vii) reproducibilityit shows stability over time, with little variation between intra- and interobservations. (viii) internal consistencyall questions in one dimension (physical, emotional, etc.) generics questionnaires can be broadly used in different diseases and patient groups because they cover a wide range of dimensions of hrqol, while the disease - specific questionnaires are designed for a population or a disease including the most relevant dimensions for patients affected by a particular condition. disease - specific instruments are more sensitive to clinical changes but do not allow hrqol comparisons among patients with different pathologies. the most comprehensive assessment of hrqol includes an assessment of both generic and disease - specific questionnaires. the generic questionnaires most commonly used in nephrology are the following. the short form-36 (sf-36). it is a short form of hrqol scoring system with 36 items forming eight multi - item scale measuring physical functioning, role of physical, bodily pain, general health, vitality, social functioning, and role of emotions and emotional health [7, 9 ]. it is one of the most commonly used hrqol questionnaires used in ckd patients with or without maintenance dialysis therapy. it consists of 38 items to measur 6 dimensions and is widely used because of its simplicity. it was initially designed for cancer patients and is an ordinal scale ranging from a score 100 (normal state) to 0 (dead) which focuses exclusively on physical functioning and on role of limitations imposed by physical health (see figure 1). it is an established instrument that seeks to asses qol on the basis of the domains that patients feel important [5, 7 ]. (i) kidney disease quality of life questionnaire (kdqol)it includes the sf-36 as the generic core, supplemented with multi - item scales targeted at particular concern of patients with ckd and on dialysis. it includes the sf-36 as the generic core, supplemented with multi - item scales targeted at particular concern of patients with ckd and on dialysis. (ii) kdqol - sfit is a short form of kdqol that consists of the sf-36 plus a small set of 43 kidney - disease - targeted items. it is a short form of kdqol that consists of the sf-36 plus a small set of 43 kidney - disease - targeted items. (iii) parfrey testit is a specific test for patients on hemodialysis and consists of 24 items distributed in two dimensions (physical and emotional). it is a specific test for patients on hemodialysis and consists of 24 items distributed in two dimensions (physical and emotional). early hrqol studies conducted in ckd were published for more than 20 years. initially served to analyze the quality of life of uremic patients compared with the general population, showing in general lower scores in patients with ckd. the following studies focused on comparing patients on dialysis (any modality) and renal transplant, confirming a better hrqol in the last, coming to score similar as to that of healthy populations. most recent studies focus on the hemodialysis population (largest) and those technique and treatment factors that may influence morbidity and mortality of patients. so, kdqol - sf has been used in hemo and dopps studies [15, 16 ]. the hemo study is randomized multicenter prospective one, which studies the effect of ckd and hemodialysis treatment on quality of life. the dopps (dialysis outcomes and practice patterns study) is a prospective, multicenter study over a population of 10,000 patients that found an independent relationship between the physical dimension score of the sf-36 and hospitalization and mortality ; this relationship was not shown in the mental dimension. the opposite results, however, were observed in the spanish multicenter study, caldivia, in which the mental dimension was the score that predicted hospitalization and mortality. the choice health experience questionnaire, which has 5 esrd - specific domains (diet, freedom, body image, dialysis access, and symptoms) added to 8 generic domains in the sf-36 and 8 additional generic domains, is an instrument for measuring heath - related quality of life for patients with esrd designed to evaluate the effectiveness of alternative dialysis modalities and prescriptions. in general, most of hrqol studies are observational and do not appreciate the change in hrqol scores after interventions to improve health status. there are few, and most of them are comparative with haemodialysis, so many of the differences between the two populations reflect different policies for inclusion of patients on peritoneal dialysis [1821 ]. patients who are on peritoneal dialysis for the first time and by own choice tend to have better clinical state (physical, emotional, autonomous, social) maintain longer residual clearance, with the clinical implications that it supposes. although a priori the automated mode (dpa) should have better hrqol scores both for the technical characteristics and for the patient 's autonomy, this has not been confirmed in recent reviews in which automated peritoneal dialysis has not been shown to provide a relevant improvement in hrqol compared to manual mode, except in a greater availability of free time [2225 ]. among the studies comparing different modalities of dialysis therapy, we highlight the necosad study group 's that analyzes the effect of starting dialysis with haemodialysis or peritoneal dialysis modalities on survival adjusted for quality of life, the meta - analysis of cameron. that studies hrqol of patients undergoing different types of renal replacement therapy and the diaz - buxo 's report analyzing quality of life in hemodialysis and peritoneal dialysis patients. comparing the two types of peritoneal dialysis, we can outline the van biesen. that did not find significant differences between the hrqol in manual or automated peritoneal dialysis, as will as the de wit. 's report which shows only a slight improvement in mental health in patients on automated peritoneal dialysis and the bro 's study in which patients on apd had improved social and family issues and worse scores in the section on sleep. from the various studies about hrqol conducted in different populations of kidney patients, factors with a proven to relationship and affecting the quality of life were identified. thus, it is shown that the improvement of various parameters of the quality of life of patients was achieved with a better hematocrit. other factors whose relationship has been confirmed are the predialysis control, the tolerance to dialysis procedure, the psychological situation, and finally sex and age. treatment of depression, pain, and sleep disorders and changes in the regimen of dialysis therapy have been suggested to have positive effects on hrqol. it is obvious that it would be much easier for everyone to translate the results of therapeutic measures of hrqol to specific therapeutic manoeuvres, but unfortunately, and due to the peculiarities of the concept of quality of life, that is not possible. many times, the subjective factors, derived or not from actual physical situations, determine the self - concept of quality of life of patients. that is why the results of the questionnaires should be analyzed carefully and thoroughly, dedicating to the discussion with the patient the necessary time to carry out actions aimed at improving the deficient aspects. a recent paper focuses on this subject suggesting that these tests could be applied as a nurse - led case management programme. the measurable parameters (hematocrit, ktv, albumin, etc.) are not always the only ones on which we must depend, and responses to questionnaires of hrqol can focus on what is more important for the patients. here are some simple measures applicable to peritoneal dialysis that can benefit many aspects assessed with hrqol questionnaires. (i) body imagea lower insertion of a shorter peritoneal catheter makes it easily concealable even under swimwear ; reducing the exchange volume as much as adequacy permits ; avoiding the premature loss of residual renal function ; giving instructions about skin care and oral hygiene. a lower insertion of a shorter peritoneal catheter makes it easily concealable even under swimwear ; reducing the exchange volume as much as adequacy permits ; avoiding the premature loss of residual renal function ; giving instructions about skin care and oral hygiene. (ii) physical statecontrolling the anaemic status, the nutrition, and the possible associated diseases (digestive, vascular, cardiac) ; starting dialysis sequentially. controlling the anaemic status, the nutrition, and the possible associated diseases (digestive, vascular, cardiac) ; starting dialysis sequentially. (iii) work and social lifeaccommodating as much as possible the schedules of peritoneal exchanges to the usual scheme of patient 's life ; offering automated peritoneal dialysis ; facilitating alternative schedules of treatment or guidelines for the various social contingencies that may arise. accommodating as much as possible the schedules of peritoneal exchanges to the usual scheme of patient 's life ; offering automated peritoneal dialysis ; facilitating alternative schedules of treatment or guidelines for the various social contingencies that may arise. (iv) mobility and hospital dependenceminimizing hospitalization, spacing periodic controls (telemedicine), facilitating telephone contact, and cooperating with home care services. minimizing hospitalization, spacing periodic controls (telemedicine), facilitating telephone contact, and cooperating with home care services. (v) the self - careavoiding overload the patients with a hospitalary method for their daily care that will constantly remind them of their illness, but without letting them feel abandoned ; seeking alternatives to a possible lack of infrastructure to perform the technique : involving the family only just to discourage the feeling of dependency or disability ; using the minimum number of exchanges that adequacy permits. avoiding overload the patients with a hospitalary method for their daily care that will constantly remind them of their illness, but without letting them feel abandoned ; seeking alternatives to a possible lack of infrastructure to perform the technique : involving the family only just to discourage the feeling of dependency or disability ; using the minimum number of exchanges that adequacy permits. (vi) the emotional statemaintaining a fluid dialogue between caregiver and patient ; discussing all aspects of nephrology treatment ; resolving doubts and problems, looking for extrarenal situations that may interfere with the perception of well - being ; stopping the progress of any depressive state. maintaining a fluid dialogue between caregiver and patient ; discussing all aspects of nephrology treatment ; resolving doubts and problems, looking for extrarenal situations that may interfere with the perception of well - being ; stopping the progress of any depressive state. (vii) dietreducing as much as possible the diet restrictions (a little bit of everything, a lot of anything) and making that patient see the reason for the limitations indicated ; giving menu suggestions, dietary supplements where necessary, or oral moisturizers to reduce the thirst sensation. reducing as much as possible the diet restrictions (a little bit of everything, a lot of anything) and making that patient see the reason for the limitations indicated ; giving menu suggestions, dietary supplements where necessary, or oral moisturizers to reduce the thirst sensation. (viii) sex, sleep, and painasking patients directly and openly about these issues and trying to alleviate them (and not considering them as inevitable disease 's consequences). asking patients directly and openly about these issues and trying to alleviate them (and not considering them as after almost 20 years from implementation, hrqol questionnaires are not used routinely, perhaps because its usefulness is not known, not only in the field of research (analysis after pharmacological or therapeutic interventions, cost - effectiveness assessment of new technologies) but also in the clinical setting (descriptive analysis of population, like a parameter of clinical quality). k - doqi guidelines 2000 recommend, in form of opinion, the periodic assessment of hrqol of patients in any of the stages of ckd and in the specific population on peritoneal dialysis. instruments recommended are the sf-36, kdqol, and coop - woka sheets, advising to always use the same one to improve data analysis over time. for practical purposes, and while experience is not acquired in handling and interpretation, the karnofsky scale and ccop - wonca sheets are easily applicable instruments : the time spent in filling them is little, they are attractive to patients and easy to evaluate, and their use lights clinical aspects that otherwise would be ignored. | the studies of quality of life (qol) are becoming increasingly interesting in clinical setting because their findings have implications for making decisions on resource allocation and health policies. the assessment of health - related qol is especially directed to patients with chronic illnesses that cause progressive deterioration and limitations, and consume the bulk of financial resources for health. among these chronic kidney disease and, more specifically the renal replacement therapy, is an important condition. due to the diagnostic and therapeutic advances, we see a gradual increase both in the number of the dialysis population and its age, which leads to a growing interest in the study of these patients ' qol, as evidenced by more than one thousand articles published on this subject. |
admission for nonfatal overdose is a good opportunity to identify and refer patients who are at risk of suicide or drug abuse.1 clinical practice guidelines recommend that a psychosocial assessment, including an evaluation of risk factors for current and subsequent self - harm, be offered to all patients admitted for self - harm, many of whom have overdosed themselves.2,3 psychiatrists and/or mental health nurses typically perform these assessments.4 however, the potential benefits of these psychosocial assessments in real - world settings for patients admitted due to overdose are unknown. some studies found a protective effect of psychosocial assessment on recurrent self - harm,510 but others failed to show an association.1113 these inconsistent results may be due to the failure to evaluate effect modification by treatment by psychiatrists before overdose. in addition, to date, little research has focused on the effect of prescribing patterns after nonfatal overdose on recurrent overdose.1 psychotropic medications are one of the most frequently ingested substances for overdose, whereas opioid medications are rarely ingested in japan.1416 among psychotropic medications, previous studies have suggested that daily dosage of benzodiazepine increased the risk of incident overdose.15,17 however, this association between prescribing patterns of psychotropic medications and recurrent overdose is unknown. therefore, we aimed to estimate the risk of recurrent overdose associated with psychosocial assessment by psychiatrists during hospitalization for nonfatal overdose and prescribing patterns of psychotropic medications after discharge, using two cohorts of patients in japan stratified by treatment by psychiatrists before overdose. we also determined the effect of psychosocial assessment on the continuity of post - discharge psychiatric care. we hypothesized that psychosocial assessment during hospitalization for overdose would have a greater benefit in patients not treated by psychiatrists before admission than in those treated. we conducted a 1-year cohort study using the national database of health insurance claim information and specified medical checkups (ndb). the study design and sample characteristics have been described elsewhere.18 the ndb includes all claims submitted electronically from 99% of hospitals in japan,19 a country with a population of 126 million.20 the ndb captures almost all patients who received medical care services under the universal health insurance system.21 the claims include clinical and procedural information such as a patient identification number (generated from the insurance identification number, birth date, and sex), an institution identification number, sex, age, date of admission, date of discharge, drug codes, procedural codes, and diagnosis codes. our study was reviewed and approved by the institutional review board at the institute for health economics and policy (h26 - 002). the ethical guideline in japan (ethical guidelines for medical and health research involving human subjects) waives the requirement for informed consent when researchers use only anonymous data. we included all overdose episodes among 19- to 64-year - old patients who were admitted to a japanese medical facility between october 2012 and september 2013. overdose was defined as a definitive diagnosis of drug poisoning at hospital admission (t360t509 in the international classification of diseases [icd]-10 codes). although we intended to focus on intentional overdose rather than unintentional overdose, we included all types of overdose (ie, intentional, unintentional, and undetermined intent) as in previous studies.2224 this was done for several reasons. first, the delineation of the intention behind overdose is often difficult and overlaps substantially.22 second, the number of admissions for intentional overdose is much higher than that for unintentional overdose with the exception of children and elderly population.25 third, data on external causes (icd-10 codes : v01y98) were not recorded in the ndb. to increase the likelihood that the overdose was intentional, we excluded patients who were diagnosed with overdose after hospital admissions as well as patients aged > 64 years. we also excluded patients aged 0 to 15 mg), high (> 15 to 30 mg), and excessive (> 30 mg). daily antidepressant dosage, expressed in imipramine equivalents, was categorized as none (0 mg), normal (> 0 to 300 mg), and high (> 300 mg). daily antipsychotic dosage, expressed in chlorpromazine equivalents, was categorized as none (0 mg), normal (> 0 to 450 mg), and high (> 450 mg). these daily dosage categorizations were based on the package inserts and previous studies.15,27 the cutoff values of normal / high dosage were defined by the maximum recommended daily dosage in the package inserts. the cutoff value of high / excessive dosage for benzodiazepines was defined by the twofold greater value of the maximum recommended daily dosage in the package inserts. daily dosage was set to none from the first day after the discharge date of the index episode until the date of the first prescription for psychotropic medications after the overdose. to account for the delay incurred by refilling, we allowed a 7-day grace period between two consecutive prescriptions (eg, between the date of first prescription plus number of days supplied and the date of the second prescription). we obtained demographic (age and sex), clinical (number of chronic conditions and diagnostic history of borderline personality disorder, substance use disorders, and overdose), and procedural (psychotropic prescriptions before index episode and length of stay) variables before and during the index episode. these variables are listed in table s2 and were selected as potential confounders according to evidence from previous studies.1,22,23 to assess the number of chronic conditions, we identified diagnostic history of 17 chronic conditions, such as myocardial infarction, congestive heart failure, and peripheral vascular disease, defined in the charlson s comorbidity index.28 we also identified diagnostic history of borderline personality disorder (icd-10 code : f603), substance use disorders (icd-10 codes : f10f16 and f18f19), and overdose (icd-10 codes : t360t509). we obtained data on average daily dosage of psychotropic medications within 60 days before the index episode and the length of stay during the index episode. all analyses were conducted separately for the psychiatrist cohort and the no - psychiatrist cohort, according to the hypothesis that psychosocial assessment during hospital admission might have a different benefit depending on the treatment by psychiatrists before overdose. average daily dosage and prescription of psychotropic medications were described for the following three periods as in the previous study:1 60 days before the admission date of the index episode, days 3190 after the discharge date of the index episode, and days 91365 after the discharge date of the index episode. meier event curves with 95% confidence intervals (cis) for the primary and secondary outcomes were constructed by treatment patterns before and after discharge. risk differences (rds) were calculated by subtracting the cumulative risk of the outcomes at 365 days after discharge in the exposed group from that in the unexposed group. cox proportional hazard models with time - varying covariates were used to assess the hazard of recurrent overdose and termination of continuous psychiatric care, expressed as hazard ratios (hrs) with 95% cis. the cox models allowed us to adjust for a number of potential confounders, such as average daily dosage of benzodiazepines before overdose and barbiturate prescriptions before overdose. instead of nonusers, normal - dose users were used as a reference group for daily dosages of benzodiazepines, antidepressants, and antipsychotics to demonstrate the relative effect of high - dose vs normal - dose users. we conducted a 1-year cohort study using the national database of health insurance claim information and specified medical checkups (ndb). the study design and sample characteristics have been described elsewhere.18 the ndb includes all claims submitted electronically from 99% of hospitals in japan,19 a country with a population of 126 million.20 the ndb captures almost all patients who received medical care services under the universal health insurance system.21 the claims include clinical and procedural information such as a patient identification number (generated from the insurance identification number, birth date, and sex), an institution identification number, sex, age, date of admission, date of discharge, drug codes, procedural codes, and diagnosis codes. our study was reviewed and approved by the institutional review board at the institute for health economics and policy (h26 - 002). the ethical guideline in japan (ethical guidelines for medical and health research involving human subjects) waives the requirement for informed consent when researchers use only anonymous data. we included all overdose episodes among 19- to 64-year - old patients who were admitted to a japanese medical facility between october 2012 and september 2013. overdose was defined as a definitive diagnosis of drug poisoning at hospital admission (t360t509 in the international classification of diseases [icd]-10 codes). although we intended to focus on intentional overdose rather than unintentional overdose, we included all types of overdose (ie, intentional, unintentional, and undetermined intent) as in previous studies.2224 this was done for several reasons. first, the delineation of the intention behind overdose is often difficult and overlaps substantially.22 second, the number of admissions for intentional overdose is much higher than that for unintentional overdose with the exception of children and elderly population.25 third, data on external causes (icd-10 codes : v01y98) were not recorded in the ndb. to increase the likelihood that the overdose was intentional, we excluded patients who were diagnosed with overdose after hospital admissions as well as patients aged > 64 years. we also excluded patients aged 0 to 15 mg), high (> 15 to 30 mg), and excessive (> 30 mg). daily antidepressant dosage, expressed in imipramine equivalents, was categorized as none (0 mg), normal (> 0 to 300 mg), and high (> 300 mg). daily antipsychotic dosage, expressed in chlorpromazine equivalents, was categorized as none (0 mg), normal (> 0 to 450 mg), and high (> 450 mg). these daily dosage categorizations were based on the package inserts and previous studies.15,27 the cutoff values of normal / high dosage were defined by the maximum recommended daily dosage in the package inserts. the cutoff value of high / excessive dosage for benzodiazepines was defined by the twofold greater value of the maximum recommended daily dosage in the package inserts. daily dosage was set to none from the first day after the discharge date of the index episode until the date of the first prescription for psychotropic medications after the overdose. to account for the delay incurred by refilling, we allowed a 7-day grace period between two consecutive prescriptions (eg, between the date of first prescription plus number of days supplied and the date of the second prescription). we obtained demographic (age and sex), clinical (number of chronic conditions and diagnostic history of borderline personality disorder, substance use disorders, and overdose), and procedural (psychotropic prescriptions before index episode and length of stay) variables before and during the index episode. these variables are listed in table s2 and were selected as potential confounders according to evidence from previous studies.1,22,23 to assess the number of chronic conditions, we identified diagnostic history of 17 chronic conditions, such as myocardial infarction, congestive heart failure, and peripheral vascular disease, defined in the charlson s comorbidity index.28 we also identified diagnostic history of borderline personality disorder (icd-10 code : f603), substance use disorders (icd-10 codes : f10f16 and f18f19), and overdose (icd-10 codes : t360t509). we obtained data on average daily dosage of psychotropic medications within 60 days before the index episode and the length of stay during the index episode. all analyses were conducted separately for the psychiatrist cohort and the no - psychiatrist cohort, according to the hypothesis that psychosocial assessment during hospital admission might have a different benefit depending on the treatment by psychiatrists before overdose. average daily dosage and prescription of psychotropic medications were described for the following three periods as in the previous study:1 60 days before the admission date of the index episode, days 3190 after the discharge date of the index episode, and days 91365 after the discharge date of the index episode. meier event curves with 95% confidence intervals (cis) for the primary and secondary outcomes were constructed by treatment patterns before and after discharge. risk differences (rds) were calculated by subtracting the cumulative risk of the outcomes at 365 days after discharge in the exposed group from that in the unexposed group. cox proportional hazard models with time - varying covariates were used to assess the hazard of recurrent overdose and termination of continuous psychiatric care, expressed as hazard ratios (hrs) with 95% cis. the cox models allowed us to adjust for a number of potential confounders, such as average daily dosage of benzodiazepines before overdose and barbiturate prescriptions before overdose. instead of nonusers, normal - dose users were used as a reference group for daily dosages of benzodiazepines, antidepressants, and antipsychotics to demonstrate the relative effect of high - dose vs normal - dose users. in the psychiatrist cohort, a total of 6,790 patients were eligible for analysis (figure s1). among this cohort, 48.1% were aged 1934 years, 77.0% were women, 44.0% had a history of chronic conditions, 9.4% had an overdose history, and 28.7% received the psychosocial assessment (table s2). before the overdose, benzodiazepines were the most frequently prescribed (93.8%) psychotropic medication, followed by antidepressants (66.9%), antipsychotics (59.5%), mood stabilizers (32.2%), and barbiturates (14.9%) (table 1). a high or excessive dose of benzodiazepines was prescribed to 47.1% of patients before the overdose and 33.3% on days 91365 after the overdose. barbiturates were prescribed to 14.9% of patients before the overdose and 12.4% on days 91365 after the overdose. a high dose of antidepressants was prescribed to < 5% of patients. during the follow - up period of 365 days, there were 1,038 patients with recurrent overdose (15.3% [95% ci : 14.5%16.2% ]), of which 483 (46.5%) were re - admitted to the same hospital as in the index episode. psychosocial assessment did not significantly decrease the risk of recurrent overdose (hr = 0.97, 95% ci : 0.841.11 ; rd = 0.0% ; table 2 ; figure 1a). a dose response relationship was found between daily dosages of benzodiazepines after overdose and recurrent overdose (table 2 ; figure 1b). the risk of recurrent overdose was lower among nonusers of benzodiazepines than in normal - dose users of benzodiazepines (hr = 0.53, 95% ci : 0.420.66 ; 7.6% vs 15.3% ; rd = 7.7%), and the risk was higher among high - dose users (hr = 1.41, 95% ci : 1.171.71 ; 22.0% vs 15.3% ; rd = 6.7%) and excessive - dose users (hr = 1.61, 95% ci : 1.302.00 ; 27.7% vs 15.3% ; rd = 12.4%). prescription of barbiturates increased the risk of recurrent overdose (hr = 1.42, 95% ci : 1.111.81 ; rd = 15.2% ; table 2 ; figure 1c). patients who took a high dosage of antidepressants were more likely to have a recurrent overdose, although the estimates were unstable due to a wide ci (table 2 ; figure s2a). prescription of antipsychotics and stabilizers did not have a significant effect on recurrent overdose (table 2 ; figure s2). psychosocial assessment did not significantly decrease the risk of psychiatric care discontinuation (hr = 0.96, 95% ci : 0.891.03 ; rd = 0.7% ; table 2 ; figure 1d). the proportion of patients receiving psychiatric care in the assessed group decreased from 87.3% at 28 days to 32.6% at 365 days, and the range of these proportions in the non - assessed group decreased from 85.6% to 31.9% (figure 1d). in the no - psychiatrist cohort, the prevalence of psychotropic medication prescriptions before the index overdose was much lower in the no - psychiatrist cohort than in the psychiatrist cohort (table 1). during the follow - up period of 365 days, there were 295 patients with recurrent overdose (6.0% [95% ci : 5.3%6.6% ]), of which 149 (50.5%) were re - admitted to the same hospital as in the index episode. similar to the results from the psychiatrist cohort, psychosocial assessment did not significantly decrease the risk of recurrent overdose in the no - psychiatrist cohort (hr = 0.95, 95% ci : 0.731.24 ; rd = 0.7% ; table 2 ; figure 2a). the risk of recurrent overdose was lower among nonusers than in normal - dose users of benzodiazepines (hr = 0.40, 95% ci : 0.270.61 ; 4.1% vs 9.0% ; rd = 4.9%) and higher among high - dose users (hr = 1.75, 95% ci : 1.112.77 ; 18.0% vs 9.0% ; rd = 9.0%) and excessive - dose users (hr = 1.75, 95% ci : 0.943.26 ; 24.3% vs 9.0% ; rd = 15.3%) (table 2 ; figure 2b). the proportion of barbiturate prescriptions was relatively small (~3% patients), resulting in an unstable estimate (hr = 1.43, 95% ci : 0.732.80 ; rd = 20.9% ; figure 2c). unlike the findings from the psychiatrist cohort, psychosocial assessment had a significantly decreased risk of psychiatric care discontinuation in the no - psychiatrist cohort (hr = 0.75, 95% ci : 0.710.81 ; rd = 1.9% ; table 2 ; figure 2d). the proportion of psychiatric care in the assessed group decreased from 36.9% at 28 days to 4.2% at 365 days ; however, in the non - assessed group, this number decreased from 20.9% to 2.3% (figure 2d). in the psychiatrist cohort, a total of 6,790 patients were eligible for analysis (figure s1). among this cohort, 48.1% were aged 1934 years, 77.0% were women, 44.0% had a history of chronic conditions, 9.4% had an overdose history, and 28.7% received the psychosocial assessment (table s2). before the overdose, benzodiazepines were the most frequently prescribed (93.8%) psychotropic medication, followed by antidepressants (66.9%), antipsychotics (59.5%), mood stabilizers (32.2%), and barbiturates (14.9%) (table 1). a high or excessive dose of benzodiazepines was prescribed to 47.1% of patients before the overdose and 33.3% on days 91365 after the overdose. barbiturates were prescribed to 14.9% of patients before the overdose and 12.4% on days 91365 after the overdose. a high dose of antidepressants was prescribed to < 5% of patients. during the follow - up period of 365 days, there were 1,038 patients with recurrent overdose (15.3% [95% ci : 14.5%16.2% ]), of which 483 (46.5%) were re - admitted to the same hospital as in the index episode. psychosocial assessment did not significantly decrease the risk of recurrent overdose (hr = 0.97, 95% ci : 0.841.11 ; rd = 0.0% ; table 2 ; figure 1a). a dose response relationship was found between daily dosages of benzodiazepines after overdose and recurrent overdose (table 2 ; figure 1b). the risk of recurrent overdose was lower among nonusers of benzodiazepines than in normal - dose users of benzodiazepines (hr = 0.53, 95% ci : 0.420.66 ; 7.6% vs 15.3% ; rd = 7.7%), and the risk was higher among high - dose users (hr = 1.41, 95% ci : 1.171.71 ; 22.0% vs 15.3% ; rd = 6.7%) and excessive - dose users (hr = 1.61, 95% ci : 1.302.00 ; 27.7% vs 15.3% ; rd = 12.4%). prescription of barbiturates increased the risk of recurrent overdose (hr = 1.42, 95% ci : 1.111.81 ; rd = 15.2% ; table 2 ; figure 1c). patients who took a high dosage of antidepressants were more likely to have a recurrent overdose, although the estimates were unstable due to a wide ci (table 2 ; figure s2a). prescription of antipsychotics and stabilizers did not have a significant effect on recurrent overdose (table 2 ; figure s2). psychosocial assessment did not significantly decrease the risk of psychiatric care discontinuation (hr = 0.96, 95% ci : 0.891.03 ; rd = 0.7% ; table 2 ; figure 1d). the proportion of patients receiving psychiatric care in the assessed group decreased from 87.3% at 28 days to 32.6% at 365 days, and the range of these proportions in the non - assessed group decreased from 85.6% to 31.9% (figure 1d). in the no - psychiatrist cohort, a total of 4,950 patients were eligible for analysis (figure s1). the prevalence of psychotropic medication prescriptions before the index overdose was much lower in the no - psychiatrist cohort than in the psychiatrist cohort (table 1). during the follow - up period of 365 days, there were 295 patients with recurrent overdose (6.0% [95% ci : 5.3%6.6% ]), of which 149 (50.5%) were re - admitted to the same hospital as in the index episode. similar to the results from the psychiatrist cohort, psychosocial assessment did not significantly decrease the risk of recurrent overdose in the no - psychiatrist cohort (hr = 0.95, 95% ci : 0.731.24 ; rd = 0.7% ; table 2 ; figure 2a). the risk of recurrent overdose was lower among nonusers than in normal - dose users of benzodiazepines (hr = 0.40, 95% ci : 0.270.61 ; 4.1% vs 9.0% ; rd = 4.9%) and higher among high - dose users (hr = 1.75, 95% ci : 1.112.77 ; 18.0% vs 9.0% ; rd = 9.0%) and excessive - dose users (hr = 1.75, 95% ci : 0.943.26 ; 24.3% vs 9.0% ; rd = 15.3%) (table 2 ; figure 2b). the proportion of barbiturate prescriptions was relatively small (~3% patients), resulting in an unstable estimate (hr = 1.43, 95% ci : 0.732.80 ; rd = 20.9% ; figure 2c). unlike the findings from the psychiatrist cohort, psychosocial assessment had a significantly decreased risk of psychiatric care discontinuation in the no - psychiatrist cohort (hr = 0.75, 95% ci : 0.710.81 ; rd = 1.9% ; table 2 ; figure 2d). the proportion of psychiatric care in the assessed group decreased from 36.9% at 28 days to 4.2% at 365 days ; however, in the non - assessed group, this number decreased from 20.9% to 2.3% (figure 2d). this is the first study to evaluate the effectiveness of treatment patterns before and after discharge in patients hospitalized for nonfatal overdose. response relationship for the association of benzodiazepine prescription after overdose with subsequent overdose, even after accounting for average daily dosage of benzodiazepines before overdose and other confounders. our findings are consistent with those of a previous study, which detected a strong association between opioid dosage after a nonfatal opioid overdose and risk of subsequent opioid overdose.1 the present study extends the previous study by not limiting patients to those with opioid overdose.1 because multidrug overdose is common in patients hospitalized with overdose, it makes sense to use a broader definition of overdose. our findings also add to the literature by demonstrating that prescribing barbiturates after overdose was associated with subsequent overdose.15 these results suggest that initiation of benzodiazepine and/or barbiturate reduction strategies after overdose might have a protective effect on recurrent overdose. patients with nonfatal overdose may benefit from the strategies such as gradual dose - tapering with structured education, written self - help instructions, and cognitive behavioral therapy.29 we found that psychosocial assessment during hospital admission had no significant effect on subsequent overdose, irrespective of treatment by psychiatrists before overdose. although a direct comparison with previous studies is difficult because of differences in definitions of patients, exposures, and outcomes,5,713 our findings are inconsistent with those of kanehara,6 who found that psychosocial assessment was associated with a 21% decreased risk of re - hospitalization to the same hospital using almost the same definitions of patients and exposures as in our study. one possible explanation for the discrepancy is that the outcome in the previous study may have had a low positive predictive value for overdose admission to any hospitals, which may have induced misclassification bias.6 indeed, our analyses showed that ~50% patients were re - admitted to the same hospital as in the index episode. in addition, our findings provide evidence that psychosocial assessment was associated with a 25% decreased risk of psychiatric care discontinuation after overdose only in the cohort of patients without recent psychiatric treatment. this supports our hypothesis that psychosocial assessment has greater benefit in patients without psychiatric treatment before overdose than in those who had psychiatric treatment. we found that most patients did not receive continuous care by psychiatrists as time passed after overdose. even in the cohort of patients with recent psychiatric treatment, the proportion of patients receiving psychiatric care markedly decreased from 85% soon after discharge to 32% at 365 days after overdose. previous studies reported that 43%50% of discharged patients received follow - up psychiatric care soon after discharge.30,31 our study extends previous findings by showing a decreasing trend across time in the proportion of patients receiving continuous psychiatric care. interventions that include active contact and follow - up via postcard and/or telephone may decrease the risk of recurrent overdose.32,33 our study had several strengths. first, we studied a large and representative sample of almost all patients hospitalized for overdose in japan. third, we could explicitly define time to recurrent overdose as the period between the discharge date of the index episode and the date of the subsequent overdose admission to inpatient and outpatient facilities. first, we can not draw conclusion regarding the underlying mechanisms of the association between treatment patterns after discharge and subsequent overdose. use of benzodiazepines and barbiturates may lead to behavioral disinhibition, whereas patients at sustained risk of suicide even after discharge are more likely to be prescribed a drug with more sedative effects. second, the rate of recurrent overdose in the present study might be underestimated because of the traceability problem in the database. namely, we could not identify those who did not continue to enroll in the same health insurance. third, we were unable to identify patients who completed suicide by overdose without any treatments and those who attempted suicidal behaviors that were not related to drug overdose. fourth, we were unable to distinguish unintentional overdose from intentional overdose, because we used the claims database in which data on external causes (icd-10 codes : v01y98) were not recorded in japan. fifth, we focused only on patients hospitalized with nonfatal overdose and those who were without transfers to psychiatric wards, which may limit the generalizability of our findings to nearly lethal methods of self - harm, such as hanging and jumping. future research should focus on patients who require transfer to psychiatric hospitals / wards to confirm the effects of psychosocial assessment. first, we studied a large and representative sample of almost all patients hospitalized for overdose in japan. third, we could explicitly define time to recurrent overdose as the period between the discharge date of the index episode and the date of the subsequent overdose admission to inpatient and outpatient facilities. first, we can not draw conclusion regarding the underlying mechanisms of the association between treatment patterns after discharge and subsequent overdose. use of benzodiazepines and barbiturates may lead to behavioral disinhibition, whereas patients at sustained risk of suicide even after discharge are more likely to be prescribed a drug with more sedative effects. second, the rate of recurrent overdose in the present study might be underestimated because of the traceability problem in the database. namely, we could not identify those who did not continue to enroll in the same health insurance. third, we were unable to identify patients who completed suicide by overdose without any treatments and those who attempted suicidal behaviors that were not related to drug overdose. fourth, we were unable to distinguish unintentional overdose from intentional overdose, because we used the claims database in which data on external causes (icd-10 codes : v01y98) were not recorded in japan. fifth, we focused only on patients hospitalized with nonfatal overdose and those who were without transfers to psychiatric wards, which may limit the generalizability of our findings to nearly lethal methods of self - harm, such as hanging and jumping. future research should focus on patients who require transfer to psychiatric hospitals / wards to confirm the effects of psychosocial assessment. our study indicated that higher benzodiazepine dosage after nonfatal overdose had an increased risk of recurrent overdose and that the proportion of patients with psychiatric care decreased as time passed after overdose. these findings suggest that admissions for nonfatal overdose are a potential opportunity to identify patients who are at risk of subsequent overdose and who require continuous psychiatric care. cumulative proportion of overdose repetition by treatment patterns before and after discharge. notes : solid line represents kaplan meier event curve, and shaded area represents the 95% confidence interval. (a) antidepressants in psychiatrist cohort, (b) antipsychotics in psychiatrist cohort, (c) stabilizers in psychiatrist cohort, (d) antidepressants in no - psychiatrist cohort, (e) antipsychotics in no - psychiatrist cohort, and (f) stabilizers in no - psychiatrist cohort. sulpiride of < 300 or 300 mg / day was counted as an antidepressant or an antipsychotic, respectively. characteristics of cohort that did and did not have psychiatric treatment before overdose cox proportional hazard models evaluating risk factors for overdose repetition and termination of continuous psychiatric care abbreviations : hr, hazard ratio ; ci, confidence interval. | objectivewe aimed to estimate risk of recurrent overdose associated with psychosocial assessment by psychiatrists during hospitalization for nonfatal overdose and prescribing patterns of psychotropic medications after discharge.methodsa retrospective cohort study was conducted using a nationwide claims database in japan. we classified patients aged 1964 years hospitalized for nonfatal overdose between october 2012 and september 2013 into two cohorts : 1) those who had consulted a psychiatrist prior to overdose (n=6,790) and 2) those who had not (n=4,950). all patients were followed up from 90 days before overdose until 365 days after discharge.resultsoverall, 15.3% of patients with recent psychiatric treatment had a recurrent overdose within 365 days, compared with 6.0% of those without psychiatric treatment. psychosocial assessment during hospital admission had no significant effect on subsequent overdose, irrespective of treatment by psychiatrists before overdose. there was a dose response relationship for the association of benzodiazepine prescription after overdose with subsequent overdose in either cohort, even after accounting for average daily dosage of benzodiazepines before overdose and other confounders. in patients with recent psychiatric treatment, the cumulative proportion of recurrent overdose at 365 days was 27.7% for patients receiving excessive dosages of benzodiazepines, 22.0% for those receiving high dosages, 15.3% for those receiving normal dosages, and 7.6% for those receiving no benzodiazepines. in patients without psychiatric treatment, the cumulative proportion of recurrent overdose at 365 days was 24.3% for patients receiving excessive dosages of benzodiazepines, 18.0% for those receiving high dosages, 9.0% for those receiving normal dosages, and 4.1% for those receiving no benzodiazepines.conclusionlower dose of benzodiazepines after overdose is associated with lower risk of subsequent overdose. |
the cardiofaciocutaneous (cfc) syndrome (omim 115150) is a syndrome where patients have multiple congenital anomalies or mental retardation, failure to thrive, psychomotor delay, a characteristic face, congenital heart defects, and abnormalities of the skin, eyes, gastrointestinal tract and central nervous system. the syndrome was first described 20 years ago by reynolds in eight children. additional reports soon followed and, according to a recent review, about 59 patients have been reported, providing the basis for an accurate delineation of the phenotypic spectrum of the syndrome. nevertheless, a question has lingered for many years whether cfc is a unique and separate condition, or a variant of the noonan syndrome (omim 163950)[39 ] or of the costello syndrome (omim 218040). a useful diagnostic approach was provided with the creation of a cfc index based on 82 clinical traits and their frequencies in the population with the cfc syndrome. however, matters changed radically only with the discovery of different genes whose mutations cause each one of these syndromes : the protein tyrosine phosphatase shp-2 gene ptpn11 for noonan syndrome, hras for costello syndrome, and kras, braf, mitogen - activated protein / extracellular signal - regulated kinase mek1 and mek2 for cfc. one - year - old indian boy was referred to our center at 8 months of age with some dysmorphic features and developmental delay for evaluation. he was a product of a full - term normal delivery with a birth weight of 3.6 kg (more than the 95 percentile). developmental history showed a delay from the beginning with the child unable to crawl, sit or hold objects in hand or produce any sounds like the normal children. family history revealed the child being the third sibling after two normal children and two early abortions. clinically his weight was 10 kg (90 percentile), height 73 cm (75 percentile), and head circumference 44.5 cm (25 percentile). dermatological evaluation showed a dysmorphic child with asymmetrical face, bitemporal narrowing and prominant metopic sutures, epicanthic fold, wide mouth, sparse hair, and absent eye brows [figures 1a c ]. his skin was dry and mildly hyperkeratotic ; eczematous lesions were found on his neck and extremities, keratosis pilaris on his arms [figure 2 ], seborrheic dermatitis on his scalp, and miliaria on his back. dysmorphic face with asymmetry, bitemporal narrowing and prominant metopic sutures, epicanthic fold, wide mouth, sparse hair and absent eye brows close - up view of facial features dry and mildly hyperkeratotic skin. eczematous lesions found on his neck and extremities, keratosis pilaris on his arms there was an evidence of a vascular hemangiomatous plaque measuring 5 cm3.5 cm involving the medial aspect of right lower limb [figure 3 ]. a vascular hemangiomatous plaque involving the right lower limb the results of routine hematological examination, blood biochemistry analysis, urinalysis, thyroid function tests, and serum zinc level assessment were within the normal ranges. mri scanning of the brain showed bifrontal subdural t2 hyperintense areas plus prominence of the frontotemporal subarachnoid space and corpus callosum hypoplasia. cfc syndrome is a sporadic developmental disorder involving characteristic craniofacial features, cardiac defects, ectodermal abnormalities, and developmental delay. the syndrome is caused by gain - of - function mutations in four different genes braf, kras, mitogen - activated protein / extracellular signal - regulated kinase mek1 and mek2, all belonging to the same ras extracellular signal - regulated kinase (erk) pathway that regulates cell differentiation, proliferation and apoptosis. it is characterised by failure to thrive, relative macrocephaly, a distinctive face with prominent forehead, bitemporal constriction, absence of eyebrows, hypertelorism, downward - slanting palpebral fissures often with epicanthic folds, depressed nasal root and a bulbous tip of the nose. the cutaneous involvement consists of dry, hyperkeratotic, scaly skin, sparse and curly hair, and cavernous hemangiomata. most patients have a congenital heart defect, most commonly pulmonic stenosis and hypertrophic cardiomyopathy. neurological involvement in the cfc syndrome is extensive, and can involve functions of the cortex, brain stem and ventricular system. we established the diagnosis in our patient based on typical dysmorphic features concordant with cfc syndrome. noonan syndrome and costello syndrome, especially the former, can be phenotypically similar to cfc syndrome and should be excluded. noonan syndrome differs by less severe psychomotor delay bordering to normality, low posterior hairline with thick hair, cubitus valgus, neck abnormalities, ectodermal involvement characterized by nevi, caf - au - lait spots, familial occurrence. coarse face, nasal and/or anal papillomata and a predisposition to child tumors such as neuroblastoma, redundant skin of hands and feet with deep palmar and plantar creases, elbow joint limitation. | the cardiofaciocutaneous (cfc) syndrome is a condition of sporadic occurrence, with patients showing multiple congenital anomalies and mental retardation and characteristic dysmorphic features. we, thus, report a rare case of this syndrome in a 1-year - old child who presented with typical features of cfc syndrome. |
congenital complete atrioventricular heart block (cavb) is a rare pathology with an incidence of 1/14 000 - 1/22 000 live births. in 25% to 33% of patients the isolated form usually coexists with systemic lupus erythematosus (sle) or sjgren syndrome in pregnant women. clinical presentation of prenatally diagnosed isolated cavb, although usually found incidentally, is associated with generally poor prognosis and the rate of 19% to 31% mortality. fetal medical therapy with betamethasone the diagnosis of refractory cavb is rarely reported as the indication for pacing in the first 24 hours after birth, usually in patients with compromised cardiac output and circulatory collapse, in a staged strategy. despite the advancement of contemporary pacing therapies pacemaker implantation in small babies remains a challenge, although the technological progress in generators, leads and programmability enables permanent stimulation in newborns, with spectacular reports of premature low body weight patients treated with artificial stimulation. we present a case of a one - day old newborn with fetal diagnosis of cavb at the 17 week of gestation, who underwent successful planned permanent pacemaker implantation immediately after birth. a term birth newborn boy (body weight 3 kg), delivered by cesarean section in the 38 gestational week from a collagenosis negative mother, was admitted to the department of pediatric cardiac surgery, pomeranian centre of traumatology in gdansk (poland), with the diagnosis of congenital complete atrioventricular block (cavb) observed from the 17 week of gestation. the initial drug therapy with intravenous isoproterenol and dobutamine appeared ineffective, the heart rhythm remained 54 beats per minute (fig. 1), while control echocardiographies performed every four hours showed the decrease of the left ventricular function with the increase of mitral insufficiency. with regard to fetal diagnosis and the symptoms of critical heart block, the newborn was qualified for immediate permanent pacemaker implantation. preoperative and postoperative electrocardiograms (paper speed 25 mm / s) : note the initial complete av block hr 120/min (b) after the parents of the described child had given their informed consent for implantation of the pacemaker, the baby was prepared for the procedure in a routine fashion, with vascular access lines and tracheal intubation typical for cardiovascular procedures. the double approach with transxiphoid lower ministernotomy and additional abdominal wall cuff was chosen because of limited space in a small patient, preventing the procedure of epicardial lead application and generator implantation via a single incision. after a limited midline pericardiotomy the anterior and inferior walls of the heart were exposed. a bipolar catheter with an electrode eluting two steroids (medtronic capsule, medtronic inc. minneapolis, usa) was implanted on the anterior and inferior surface of the right ventricle. the y wire of 25 cm was passed through and placed into the left - sided abdominal pocket, where the medtronic (adapta adsr01, medtronic inc, minneapolis, usa) pulse generator was implanted. a small incision between the left rectus abdominal muscle and the posterior sheath was performed, to create the cavity for the generator and the wire (fig. 2). the pacemaker was self - captured just after initial management of the impedance and control of the pacing. the initial rate of the generator was set for 120 beats per minute, with the output 0.5 volts in vvi stimulation. postoperative chest x - ray the electrodes on the right ventricle and the medtronic generator implanted in the left sided upper abdominal wall are seen the baby was extubated two hours after the procedure, and referred for final treatment in the cardiology department. the final good result of treatment of the presented newborn with critical cavb was related to very precise and effective prenatal diagnostics, as well as close cooperation between referral gynecology, neonatology and cardiac centers. the prenatal program makes it possible to screen the population for congenital heart defects and arrhythmias, with prenatal introduction of circulatory drugs, and in - utero interventions when indicated. the true value derived is a modern strategy to treat prenatally diagnosed heart defects in a so - called planned fashion, with teams of specialists, technical support and pre - trained skills to perform the most complicated diagnostics and interventional procedures in newborn cardiac patients. nevertheless, the risk factors associated with a poor outcome in isolated atrioventricular block in the fetus are gestation < 20 weeks, ventricular rate 50 bpm, hydrops, and impaired left ventricular function. in our patient the pacing system itself and the whole procedure were planned from the very beginning of the labor, and thus the baby was treated with definitive single - stage permanent stimulation, without the need for temporary epicardial external pacing typical for cardiac procedures. there is no doubt that permanent pacing in the pediatric population is a well - established and effective strategy [1, 6 ]. nevertheless, there still appear additional technical problems, with the most important being the oversize of the generators and leads, especially when there is a need to implant the set in a very small heart. the transxiphoid approach with abdominal cuff is our routine technique in small babies, although other lateral incisions could be effectively considered in such a situation [2, 6 ]. it would be an ideal option to implant the ventricular electrode on the left, rather than right ventricle. this would provide some sort of resynchronization, and may protect from pacing - induced heart failure. in our opinion, however, the risk related to gaining access to the left ventricle in a newborn would be too high, especially as a life - saving strategy. ventricularonly stimulation in a patient with sinus rhythm is far from physiologic in the longer run ; therefore, upgrade to a dualchamber device seems to be unavoidable in our patient. we believe that the generator exchange in the future will appear possible without the need for troublesome resternotomy, because of its abdominal location and the spare length of the wires collected in place. we usually make maximal efforts to avoid any predictable complications, the most important being peritoneal opening, bleeding, mediastinal infections and local hernias. the surgical trauma appeared acceptable, and the patient was successfully extubated immediately, with regular antibiotics and laboratory tests after surgery. the pacemaker parameters were controlled, no pacing disturbances were noted, and no dislocation of the generator was reported. the procedure of planned permanent pacemaker implantation on the first day of life was safe and effective, without any concomitant complications. the benefits from planned emergency interventions come from precise cooperation with the specialist who successfully performs the prenatal program in our institutions. | we present a case of a severely ill newborn with congenital atrioventricular heart block (cavb) diagnosed prenatally. the initial drug therapy just after birth was ineffective, the heart rhythm remained 54 beats per minute, and control echocardiographies showed forthcoming decrease of the left ventricular function with mitral insufficiency. a permanent pacing system with bipolar electrodes eluting two steroids (medtronic capsule, medtronic inc. minneapolis, usa) and medtronic adapta pulse generator (medtronic inc, minneapolis, usa) was implanted on the first day of life. the pace control as well as wound healing were uncomplicated, and the baby was discharged home without additional medication. the procedure of permanent pacemaker implantation on the first day of life was safe and effective, as a benefit from a successfully performed prenatal program in our cooperating institutions. |
chronic obstructive pulmonary disease (copd) is characterized by exertional dyspnea, wheezing, and sputum production, and often decreased daily life activities. acute exacerbations of copd (aecopd) are defined as changes in sputum volume, color, or consistency, accompanied by an increase in dyspnea. exacerbations usually result in decreases in lung function, exercise tolerance, and quality of life (qol). it has been shown that, even with optimal medical treatment during hospitalization, patients at discharge need considerable time to recover to baseline levels of physical function and health status. up to 25% of patients after an acute exacerbation the recovery period of health status is very long, but there is no further exacerbation. frequent exacerbators have a reduced response to treatment of aecopd in terms of inflammatory indices and quality of life. pulmonary rehabilitation (pr) pr includes respiratory system interventions (e.g., smoking cessation and medications), psychological support (e.g., patients education, and psychological and social support), and physical exercise, and there is evidence showing that pr is able to improve exercise capacity and qol [79 ]. most studies on pr have been done in stable copd patients, and trials with small sample size also suggest that pr is feasible and effective in patients with exacerbations of copd [1013 ]. therefore, an early pr has become a component of recovery programs in the management of acute copd. the main reasons might be that physicians need more knowledge on pr, and concern about whether pr is safe after exacerbations of copd, especially in patients with severe copd. therefore, this study was conducted to assess the effectiveness and safety of pr after exacerbation of copd. the feasibility and safety of an early pr was evaluated in aecopd inpatients, and the effects of pr on the exercise capacity and qol were determined. this was a prospective, randomized, open trial conducted in inpatients admitted due to aecopd. these patients received standard medical treatments and were then randomized to receive either routine care (control group) or pr (pr group) from the second day of admission until discharge. we recruited 101 consecutive inpatients with aecopd between december 2011 and november 2013 from tongji hospital, school of medicine of tongji university. the diagnosis and determination of copd severity were conducted according to the global initiative for chronic obstructive lung disease guidelines. an exacerbation of copd was defined as the worsening of respiratory symptoms beyond normal day - to - day variation and leading to a change in medication. patients were eligible if they reported a limitation in daily activities due to dyspnea on exertion, as categorized using the modified medical research council (mmrc) dyspnea grade > 0. when patients had any disease not associated with copd (e.g., uncontrolled heart failure, sever lower limb arthritis, and symptomatic peripheral vascular disease, which may affect the outcome of dyspnea or exercise tolerance) they were excluded from this study. other exclusion criteria included severe orthopedic or neurological disorders limiting exercise performance, unstable cardiac disease, and inability to understand or complete questionnaires. this study was registered in the chinese clinical trial registry (chictr - trc-13003068) and approved by the human research ethics board of affiliated tongji hospital of tongji university in shanghai, china (2011 - 161). baseline measurements were age, gender, body mass index (bmi), smoking status, use of long - term oxygen therapy (ltot), and pulmonary function. the outcome measures in this study were dyspnea and functional status, functional exercise capacity, limitation in daily activities, and health status. spirometry, static lung volumes, and lung diffusion capacity for carbon monoxide were also measured in accordance with a standard protocol. arterial blood gas analysis was done at rest, or in the presence of oxygen supplementation for subjects receiving ltot. subjects were asked to point to the borg scale, and rate the severity of perceived breathlessness. the test was performed twice on consecutive days and the longest distance [6-minute walk distance (6mwd) ] was used for analysis. oxygen saturation was monitored continuously throughout the test, and the test was terminated if oxygen saturation fell to below 80%.. heart rate (hr) was monitored continuously throughout the test (polar, polar electro, oy, finland). in the 6-minute walk test, the same flow rate of supplemental oxygen was used as was prescribed for their normal daily activities in subjects receiving ltot. all follow - up exercise tests were performed in subjects using the same flow rate of supplemental oxygen as applied in the exercise test at baseline. limitations in daily life activities were assessed using an activity of daily living dyspnea scale (adl - d scale), which was a validated scale for copd patients. paul. reported that the cat correlated well with crq - sas domains and sgrq scores in health status measures in pulmonary rehabilitation. thus, qol was measured using the chronic respiratory questionnaire - self administered standardized (crq - sas) scale and copd assessment test (cat). briefly, each pr session included exercise training, relaxation, and breathing retraining and education. patients were trained at between 3 and 5 on the borg breathlessness score (moderate to severe). resting oxygen saturation, hr, and blood pressure were measured and recorded before, during, and at the end of pr. lower - limb endurance training was performed using a treadmill with the initial workload prescribed at 60% of the peak work rate achieved in the 6-minute walk test at baseline. walking was controlled within 510 min and progressively increased, within symptom tolerance, to 20 min of continuous walking. upper - limb endurance training comprised repetitive bilateral shoulder flexion and abduction using a light weight and was synchronized with expiration for 2 min. one set of 10 repetitions was initially prescribed and then increased to 3 sets when the subject could perform the exercises without any difficulty. arterial oxygen saturation was monitored, and supplemental oxygen was given to maintain arterial oxygen saturation above 85%. breathing retraining consisted of relaxation with breathing control, pursed - lip breathing, and pacing during exercise training and daily life activities. the pursed - lip breathing was to assist subjects to control their breathing by reducing respiratory frequency. the education component was provided by a physiotherapist at each class and consisted of the benefits and importance of daily exercise, pacing and energy - conservation techniques to manage daily - life activities, and self - management strategies for coping with an exacerbation of copd. student s unpaired t - test was used for comparisons of age, bmi, brinkman index, and days of pr, and lung function after determination of normal distribution. student s paired t - test was used for comparisons of data before and after 6-mwd, borg, mmrc score, cat score, crq - sas score, adl - d score, and bode score. this was a prospective, randomized, open trial conducted in inpatients admitted due to aecopd. these patients received standard medical treatments and were then randomized to receive either routine care (control group) or pr (pr group) from the second day of admission until discharge. we recruited 101 consecutive inpatients with aecopd between december 2011 and november 2013 from tongji hospital, school of medicine of tongji university. the diagnosis and determination of copd severity were conducted according to the global initiative for chronic obstructive lung disease guidelines. an exacerbation of copd was defined as the worsening of respiratory symptoms beyond normal day - to - day variation and leading to a change in medication. patients were eligible if they reported a limitation in daily activities due to dyspnea on exertion, as categorized using the modified medical research council (mmrc) dyspnea grade > 0. when patients had any disease not associated with copd (e.g., uncontrolled heart failure, sever lower limb arthritis, and symptomatic peripheral vascular disease, which may affect the outcome of dyspnea or exercise tolerance) they were excluded from this study. other exclusion criteria included severe orthopedic or neurological disorders limiting exercise performance, unstable cardiac disease, and inability to understand or complete questionnaires. this study was registered in the chinese clinical trial registry (chictr - trc-13003068) and approved by the human research ethics board of affiliated tongji hospital of tongji university in shanghai, china (2011 - 161). baseline measurements were age, gender, body mass index (bmi), smoking status, use of long - term oxygen therapy (ltot), and pulmonary function. the outcome measures in this study were dyspnea and functional status, functional exercise capacity, limitation in daily activities, and health status. spirometry, static lung volumes, and lung diffusion capacity for carbon monoxide were also measured in accordance with a standard protocol. arterial blood gas analysis was done at rest, or in the presence of oxygen supplementation for subjects receiving ltot. subjects were asked to point to the borg scale, and rate the severity of perceived breathlessness. the test was performed twice on consecutive days and the longest distance [6-minute walk distance (6mwd) ] was used for analysis. oxygen saturation was monitored continuously throughout the test, and the test was terminated if oxygen saturation fell to below 80%.. heart rate (hr) was monitored continuously throughout the test (polar, polar electro, oy, finland). in the 6-minute walk test, the same flow rate of supplemental oxygen was used as was prescribed for their normal daily activities in subjects receiving ltot. all follow - up exercise tests were performed in subjects using the same flow rate of supplemental oxygen as applied in the exercise test at baseline. limitations in daily life activities were assessed using an activity of daily living dyspnea scale (adl - d scale), which was a validated scale for copd patients. paul. reported that the cat correlated well with crq - sas domains and sgrq scores in health status measures in pulmonary rehabilitation. thus, qol was measured using the chronic respiratory questionnaire - self administered standardized (crq - sas) scale and copd assessment test (cat). briefly, each pr session included exercise training, relaxation, and breathing retraining and education. patients were trained at between 3 and 5 on the borg breathlessness score (moderate to severe). resting oxygen saturation, hr, and blood pressure were measured and recorded before, during, and at the end of pr. lower - limb endurance training was performed using a treadmill with the initial workload prescribed at 60% of the peak work rate achieved in the 6-minute walk test at baseline. walking was controlled within 510 min and progressively increased, within symptom tolerance, to 20 min of continuous walking. upper - limb endurance training comprised repetitive bilateral shoulder flexion and abduction using a light weight and was synchronized with expiration for 2 min. one set of 10 repetitions was initially prescribed and then increased to 3 sets when the subject could perform the exercises without any difficulty. arterial oxygen saturation was monitored, and supplemental oxygen was given to maintain arterial oxygen saturation above 85%. breathing retraining consisted of relaxation with breathing control, pursed - lip breathing, and pacing during exercise training and daily life activities. the pursed - lip breathing was to assist subjects to control their breathing by reducing respiratory frequency. the education component was provided by a physiotherapist at each class and consisted of the benefits and importance of daily exercise, pacing and energy - conservation techniques to manage daily - life activities, and self - management strategies for coping with an exacerbation of copd. student s unpaired t - test was used for comparisons of age, bmi, brinkman index, and days of pr, and lung function after determination of normal distribution. student s paired t - test was used for comparisons of data before and after 6-mwd, borg, mmrc score, cat score, crq - sas score, adl - d score, and bode score. a total of 101 patients were enrolled into this study, of whom 94 completed this study and 7 withdraw after randomizations. the characteristics of 94 patients in 2 groups before pr are presented in table 1. they had moderate - to - severe copd, and most were males and smokers. there were no significant differences in age, bmi, brinkman index, and fev1% predicted at baseline between the 2 groups. the 6mwd was increased by 49.0 m in pr group as compared to that at baseline (242.015.03 m vs. 291.014.61 m, p<0.001). in contrast, the 6mwd was increased by 9.9 m (263.920.75 m vs. 273.720.03 m) in the control group as compared to that at baseline, showing no significant difference (p=0.620, figure 1). there was a significant improvement in resting spo2 at rest in the pr group as compared to baseline. there was a significant improvement in the dyspnea at rest as measured by borg dyspnea score in both the pr and control groups as compared to that at baseline. however, a significant improvement was observed in dyspnea at exercises (p=0.008) only in the pr group, but not in the control group (p=0.108). these findings suggested that there was a significant improvement in the exercise capacity after pr (table 2). there was a significant improvement in cat score (the lower the score, the better the qol was) in both the pr group and the control group. there was a significant improvement in crq - sas score in the pr group from baseline to post - pr (p<0.001) and a slight decline in the control group (figure 2). the adl - d score was improved as indicated by an increase in total score from 40.42.19 to 60.72.31 in the pr group, and a significant increase was observed after pr. adl - d score was also improved as indicated by an increase in total score form 53.32.19 to 58.072.43 in the control group, but there was no significant difference (figure 3). one of the major goals of copd treatment is to attenuate dyspnea. to measure the severity of dyspnea during exercise and daily life activities, results showed that the mmrc was improved from 3.10.93 at baseline to 2.20.09 after pr in the pr group, showing a significant difference. the mmrc was improved from 2.90.65 at baseline to 2.70.71 in the control group without marked difference (figure 4a). the bode index is a multi - dimensional grading system determined on the basis of bmi, fev1%, mmrc dyspnea score, and 6mwd. the bode index has been validated in copd patients, and is responsive to pr. our study indicated that the bode index was improved from 5.60.24 at baseline to 3.80.24 after pr in the pr group, showing a significant difference. the bode index was improved from 5.60.27 at baseline to 4.90.32 in the control group without significant difference (figure 4b). a total of 101 patients were enrolled into this study, of whom 94 completed this study and 7 withdraw after randomizations. the characteristics of 94 patients in 2 groups before pr are presented in table 1. they had moderate - to - severe copd, and most were males and smokers. there were no significant differences in age, bmi, brinkman index, and fev1% predicted at baseline between the 2 groups. no adverse events were recorded during exercise training. the 6mwd was increased by 49.0 m in pr group as compared to that at baseline (242.015.03 m vs. 291.014.61 m, p<0.001). in contrast, the 6mwd was increased by 9.9 m (263.920.75 m vs. 273.720.03 m) in the control group as compared to that at baseline, showing no significant difference (p=0.620, figure 1). there was a significant improvement in resting spo2 at rest in the pr group as compared to baseline. there was a significant improvement in the dyspnea at rest as measured by borg dyspnea score in both the pr and control groups as compared to that at baseline. however, a significant improvement was observed in dyspnea at exercises (p=0.008) only in the pr group, but not in the control group (p=0.108). these findings suggested that there was a significant improvement in the exercise capacity after pr (table 2). there was a significant improvement in cat score (the lower the score, the better the qol was) in both the pr group and the control group. there was a significant improvement in crq - sas score in the pr group from baseline to post - pr (p<0.001) and a slight decline in the control group (figure 2). the adl - d score was improved as indicated by an increase in total score from 40.42.19 to 60.72.31 in the pr group, and a significant increase was observed after pr. adl - d score was also improved as indicated by an increase in total score form 53.32.19 to 58.072.43 in the control group, but there was no significant difference (figure 3). one of the major goals of copd treatment is to attenuate dyspnea. to measure the severity of dyspnea during exercise and daily life activities, results showed that the mmrc was improved from 3.10.93 at baseline to 2.20.09 after pr in the pr group, showing a significant difference. the mmrc was improved from 2.90.65 at baseline to 2.70.71 in the control group without marked difference (figure 4a). the bode index is a multi - dimensional grading system determined on the basis of bmi, fev1%, mmrc dyspnea score, and 6mwd. the bode index has been validated in copd patients, and is responsive to pr. our study indicated that the bode index was improved from 5.60.24 at baseline to 3.80.24 after pr in the pr group, showing a significant difference. the bode index was improved from 5.60.27 at baseline to 4.90.32 in the control group without significant difference (figure 4b). our study provides preliminary evidence that it is safe and feasible to perform pr in inpatients with aecopd. of 94 patients completing this trial, none experienced a serious adverse event, nor had an increase in hospital stay. in a large population of severely impaired copd patients with high exacerbation rates, a significant reduction in exacerbation and hospitalization frequency was observed after participation in a comprehensive pulmonary rehabilitation program. in a previous study, 14 of 126 patients with stable copd experienced a serious adverse event during pr in a community setting. the relaxation training (e.g., stretches and strength training before exercise training, breathing training, and symptom - limited exercise training) may help these patients to finish pr. our results showed that the pr group had significant improvements in 6mwd, resting spo2, and exercise borg dyspnea score, indicating that pr is beneficial in improving the exercise capacity of patients with aecopd. in addition, greater improvement in total crq - sas score and lower cat score were also observed in the pr group, indicating that pr is helpful to improve the qol of patients with aecopd. pr was applied with symptom - limited exercise training, which is a low - intensity exercise. moderate - to - high - intensity exercise may be inappropriate for acutely ill patients with a compromised respiratory function. in other studies, low - intensity exercise has been found to benefit patients experiencing aecopd. a second contribution to the improvements was that the respiratory conditioning of pr was a procedure for improving the flexibility of the chest with the correction of posture and the stretching and mobilization of the rib cage. our pr incorporated physical therapist - assisted manual stretching of the respiratory muscles to reduce dyspnea before starting exercise training. respiratory conditioning was reported to decrease the chest wall stiffness by stretching the respiratory muscles of the chest wall during breathing, and contributed to expanding expiratory flow and reducing hyperinflation of the lungs at rest. in addition, by decreasing chest wall stiffness and increasing its flexibility, the reduced hyperinflation of the lung at rest may generate greater mobility of the diaphragm. consequently, this effect improves the exercise capacity. in this context, respiratory conditioning in our pr ameliorated symptoms, and raised exercise capacity. moreover, physical therapist - assistant manual compression and relaxation of the thoracic cage of our respiratory conditioning created a strong interaction between patient and physical therapist, thereby decreasing the anxiety about exercise training and reducing the breathlessness, which is another factor playing a role in the improvement of daily life activities and qol. our pr may ensure that all the patients including the severe copd patients can finish their exercise sessions. our pr included pursed - lips breathing and diaphragmatic breathing, aiming to alter the respiratory muscle recruitment, improve respiratory muscle performance, and reduce dyspnea, which have been reported to improve the 6mwd. our study has several limitations : the sample size was relatively small ; the majority of patients were males, reflecting the gender difference in disease morbidity ; and we did not assess social background. an awareness of the clinical sequelae of acute exacerbation of chronic obstructive pulmonary disease enables approaches, such as early post - exacerbation rehabilitation to mitigate its negative effects. however, it is still not adequately used in china, and the major barriers are the low referral rate in the primary - care center and difficulty in accessing suitable programs. studies from shanghai, china reported that pr was rarely used in local hospitals. the main reason was that respiratory physicians have only limited knowledge about pr, which leads to a poor attendance of copd patients to pr. therefore, research on the availability of suitable and safe pr programs and interrelated issues of referral and access is needed. the present study provides evidence that it is safe and feasible to implement an early pr for inpatients with aecopd, and clinicians should promote pr after aecopd no matter how severe aecopd is. | backgroundpulmonary rehabilitation (pr) is able to improve dyspnea, endurance capacity, and health - related quality of life in chronic obstructive pulmonary disease (copd) patients, but it is rarely used in china. this study aimed to assess the effectiveness and safety of pr after exacerbation of copd.material/methodspatients admitted to hospital due to an exacerbation of copd were randomized to receive either pr or routine care (control group). the pr program was performed from the second day of admission until discharge. the pre - post changes in 6-minute walk distance (6mwd), self - reported quality of life (qol) assessed by cat score and crq - sas score, and activity of daily life assessed by adl - d score were determined. the perceived end - effort dyspnea (borg scale) was measured throughout the study.resultsa total of 101 patients were enrolled, of whom 7 withdrew after randomization, and 94 completed this study. there were 66 patients in the pr group and 28 in the control group. the 6mwd, resting spo2, and exercise borg dyspnea score were significantly improved in the pr group. in addition, the pr group had greater improvement in the total crq - sas score and had a lower cat score. significant improvements were also found in the adl - d and bode index in the pr group. no adverse events were recorded during exercise.conclusionsour study provides evidence that it is safe and feasible to apply an early pr in patients with acute exacerbation of copd. |
endovascular neurointerventions form a significant part of a neuroradiologist 's practice, and can be very challenging especially at the start of the individual practice. the author had undergone 3 years of training program followed by 1 year and 4 months of supervised practice before starting an independent practice within a team also having vascular neurophysician and neurosurgeon, with a dedicated stroke care unit and a neuro - rehabilitation team. the challenges at the start of the practice are many, and the author aimed to evaluate the procedural data in the first year of practice. this would set the tone for the further practice patterns of the author as well as serve as a guide to other young neurointerventionalists. a registry of all cases between january 02, 2012 and december 31, 2012 performed independently by the author was maintained. the author had at his disposal a dedicated interventional cathlab suite with flat panel (siemens artis zee, erlangen, germany) machine, along with trained technicians and nurses (predominantly with cardiac background and short term trainings of neuro- and/or peripheral interventions). all cases were also clinically evaluated by one or both of a vascular neurophysician and neurosurgeon. whenever required, the patients were managed in surgical intensive care unit, ward, or daycare units. the author accepted these broad categories of patients : diagnostic digital subtraction angiography (dsa) of adults, with any kind of cerebro- or spinal vascular pathology ; interventions for acute ischemic stroke, aneurysms, tumor embolization, and extracranial vascular malformations. the author performed two types of interventions for acute stroke : either clotbust sonothrombolysis or intraarterial thrombolysis (iat) depending upon the clinical profile and the imaging features, in discussion with the neurophysician. the following broad groups were not accepted by the author : pediatric age group patients, intracranial arteriovenous malformation (avm)/dural arteriovenous fistula (davf) embolization, extracranial or intracranial angioplasty with or without stenting (except in the setting of acute stroke) ; stent - assisted aneurysm coiling (balloon - assisted aneurysm coiling was accepted). the type of procedures performed with individual numbers are given below [table 1 ]. the details procedures performed, complications and procedural success there were three direct procedure - related complications : one case of large vessel thromboembolism, and another case of distal vessel thromboembolism [figure 1 ], both during aneurysm coilings. thromboembolic complication of aneurysm coiling : a 54-year - old male with grade 1 sah and ruptured acom artery aneurysm ; endovascular aneurysm coiling done with complete aneurysm exclusion from circulation with distal thromboemboli. (b) left ica angiogram showing acom aneurysm directed superiorly, and to right side (arrow). (c) postcoiling left ica angiogram showing well coiled aneurysm completely excluded from circulation. (d) next morning dwi image showing restricted diffusion areas in left mca and aca territories all but four procedures could be completed satisfactorily with all information obtained during diagnostic procedures and the intended therapy provided in interventional procedures. one case of aneurysm coiling could only be done partially [figure 2 ] and another case could not be done due to large thromboembolism and patient deteriorating on table. a case of acute stroke could be only partially recanalized during thrombolysis and another case of clotbust sonothrombolysis had to be abandoned due to oral bleeding during the therapy. rerupture of partially coiled aneurysm : a 46-year - old male with grade 1 sah and ruptured right mca bifurcation aneurysm ; after an hour of extubation after partial coiling, patient developed left hemiparesis followed by pupillary dilatation. (a) right ica injection frontal view showing mca bifurcation aneurysm with broad base (arrow). (b) postcoiling right ica injection frontal view showing secured dome of the aneurysm with the patent lower part (c) ct done after patient developed hemiparesis, showing increased sah with hydrocephalus, and large right sylvian / temporal hematoma three - month outcome data of the patient 's interventions are summarized in table 2. the type of procedures performed with individual numbers are given below [table 1 ]. the details procedures performed, complications and procedural success there were three direct procedure - related complications : one case of large vessel thromboembolism, and another case of distal vessel thromboembolism [figure 1 ], both during aneurysm coilings. thromboembolic complication of aneurysm coiling : a 54-year - old male with grade 1 sah and ruptured acom artery aneurysm ; endovascular aneurysm coiling done with complete aneurysm exclusion from circulation with distal thromboemboli. (b) left ica angiogram showing acom aneurysm directed superiorly, and to right side (arrow). (c) postcoiling left ica angiogram showing well coiled aneurysm completely excluded from circulation. (d) next morning dwi image showing restricted diffusion areas in left mca and aca territories all but four procedures could be completed satisfactorily with all information obtained during diagnostic procedures and the intended therapy provided in interventional procedures. one case of aneurysm coiling could only be done partially [figure 2 ] and another case could not be done due to large thromboembolism and patient deteriorating on table. a case of acute stroke could be only partially recanalized during thrombolysis and another case of clotbust sonothrombolysis had to be abandoned due to oral bleeding during the therapy. rerupture of partially coiled aneurysm : a 46-year - old male with grade 1 sah and ruptured right mca bifurcation aneurysm ; after an hour of extubation after partial coiling, patient developed left hemiparesis followed by pupillary dilatation. (a) right ica injection frontal view showing mca bifurcation aneurysm with broad base (arrow). (b) postcoiling right ica injection frontal view showing secured dome of the aneurysm with the patent lower part (c) ct done after patient developed hemiparesis, showing increased sah with hydrocephalus, and large right sylvian / temporal hematoma three - month outcome data of the patient 's interventions are summarized in table 2. endovascular neurointervention is an interdisciplinary modality of patient management offering minimally invasive diagnostic and therapeutic options to often challenging and difficult neurovascular cases. in this regard, the start of individual career of any neurointerventionalist is particularly difficult and fraught with risk of complications and poor outcomes. however, adequate training and supervision combined with inherent ability to select appropriate patients and diseases can produce good results comparable to those in the literature, and give encouragement to the practitioner to progressively embark on a journey of learning and teaching. the author had undergone 3 years training program followed by 1 year and 4 months of supervised practice in a large group of neurointerventionalists, before starting fully independent practice (in a 330-bed suburban hospital without any existent neurointerventional services). this allowed understanding the nitty - gritty of choosing the right case authoritatively as also to formulate management plans or refer out the patients. the author refused cases that demanded extreme understanding of the anatomy, pathology, and physiology or needed fantastic dexterity. such cases included complex avms and davfs, intracranial angioplasty and stenting, neck vessel angioplasties in patinets with comorbidities, severe flow restricting stenosis or poor vessel / plaque morphology. the authors mostly concentrated on providing complete diagnostic services and therapy for acute cases to the hospital and included acute stroke and aneurysms. all types of cases were taken up and included aneurysms, avm, davf, extracranial or intracranial stenotic conditions, and tumors. this compares well with the literature, for example, a large series of 19,826 cases by kaufmann. had shown 4.2% puncture site complications, 2.63% neurologic deficits (including, 0.14% stroke with permanent disability), and 0.06% death. in yet another series of 2899 cases by willinsky., there were 1.3% neurologic complications, including 0.5% permanent disability from stroke. various factors have been reported to be associated with complications of angiography, and include increasing age, atherosclerotic cerebrovascular disease, subarachnoid hemorrhage (sah), frequent transient ischemic attack, cardiovascular disease, and long fluoroscopic times. in the elective patient management practice, the author makes sure that noninvasive angiography (computed tomography angiography [cta ] and or magnetic resonance angiography [mra ]) is performed in such patient groups as far as possible, as also in patients with long - term diabetes mellitus, hypertension, renal disease, severe obesity (to avoid groin puncture site complications). the author is a neuroradiologist, involved in reading the patient 's imaging as well as doing transcranial doppler (tcd) and performing the endovascular procedures. after deciding upon the necessity of an intervention, in collaboration with the vascular neurophysician, intravenous thrombolysis (ivt), clotbust sonothrombolysis or iat. depending upon the individual case (predominantly the presence of large vessel occlusion) and patient / family preference, one of the three was done. the author was entrusted upon with the latter two types of intervention. in all, six cases of clotbust sonothrombolysis [figure 3 ] and six cases of iat were done. five more cases were taken up for iat, but after the angiogram, intervention was deemed not suitable / not required and hence not proceeded with [figure 4 ]. these five cases are included under the head of diagnostic cerebral angiography. clotbust sonothrombolysis therapy with good outcome : a 70-year - old male with cad, ckd and acute left mca territory stroke of 4 h. (a) admission dwi at level of basal ganglia. (b) dwi at level of centrum semiovale ; diffusion restriction noted in left temporo - parietal region with dwi - aspects of 6. (d) tcd waveform and parameters, at the end of the procedure ; flow is still not very good but the velocities are within normal limits. (e) ncct head done next morning with established infarct in left temporoparietal area a 43-year - old female with right hemiparesis since 2 h (a) admission ct head -aspects 10 ; ivt was started. (b) post - ivt ct with ischemia in left gangliocapsular region (thin arrow). (f) left va injection, ap view, show good collaterals ; no further intervention done. (h) coronal t2wi showing patent left aca, mca and supraclinoid ica with still occluded cavernous ica the technique of clotbust sonothromobolysis used was as described in literature. we went through the reasons for the success and found the following : well - oiled acute stroke management machinery was in place. our team tried to cut down the time of transit between various rooms and did not opt for prolonged imaging protocols or sedation. the average time for patient to move through the emergency to computed tomography (ct) and then to stroke care unit was 20 min and in no case was more than 30 minthe tcd procedure was started very early, as soon as the patient returned from the ct room into the stroke care unit. in fact the rtpa (recombinant tissue plasminogen activator) injection could be started at an average time of approximately 30 min after the start of the tcda trained nurse stood by the side of the patient making sure that the tcd went on smoothly, and also did the mandatory neuro - vital monitoringthe author himself made sure that the ct interpretation was done on the consolethe patient and attendants were counseled personally during the transitall cases had start of rtpa injection within 1 h of arrivalthe tcd continued for a full duration of 2 h, irrespective of the change in neurological functions and the status of the rtpa injection. our team tried to cut down the time of transit between various rooms and did not opt for prolonged imaging protocols or sedation. the average time for patient to move through the emergency to computed tomography (ct) and then to stroke care unit was 20 min and in no case was more than 30 min the tcd procedure was started very early, as soon as the patient returned from the ct room into the stroke care unit. in fact the rtpa (recombinant tissue plasminogen activator) injection could be started at an average time of approximately 30 min after the start of the tcd a trained nurse stood by the side of the patient making sure that the tcd went on smoothly, and also did the mandatory neuro - vital monitoring the author himself made sure that the ct interpretation was done on the console the patient and attendants were counseled personally during the transit all cases had start of rtpa injection within 1 h of arrival the tcd continued for a full duration of 2 h, irrespective of the change in neurological functions and the status of the rtpa injection. for iat, the author mostly used rtpa and mechanical thrombectomy was done in one of the cases, along with 2 mg rtpa infusion. out of the six cases of iat, tici 2b / tici 3 (thrombolysis in cerebral infarction ; tici) reperfusion was achieved in five, and all these cases had good outcome at 3 months. one case had minimal recanalization and fared average at 3 months with mrs of 2. all combined, the results of iat compare with those in existing literature. in the integrated stroke care services offered in the institute, the author was involved at each step of patient care of in - patients with aneurysms (ruptured or unruptured). all ct scans were read by the author, and daily tcds on sah patients were done. patients / attendants were offered either cta or dsa for sah evaluation and depending upon their choice, one was done. aneurym coiling was performed by the author after discussion with the stroke team. in all, six coiling procedures were done. one patient had thromboembolic event, which could not be recanalized in spite of all techniques tried, and another patient with right middle cerebral artery (mca) bifurcation aneurysm died after 4 h of a partial coiling procedure due to massive rebleed [figure 2 ]. in the remaining patients, complete or near complete aneurysm filling could be achieved, with only interstitial filling or dog - ear remnants seen after the completion of procedure. balloon assistance was needed in two cases, and no thromboembolic complications were seen in either. one was a case of a spinal hemangioblastoma, which had undergone surgery twice earlier, no doubt failed, and taken up for embolization. the tumor could be partially embolized and the patient then underwent a successful repeat surgery. another patient has a large sacral schwannoma, which was embolized near completely via both internal iliac arterial branches, and then underwent successful tumor removal [figure 5 ]. a 39-year - old female with sacral schwannoma ; pva particle embolization with complete tumor devascularization (a) sagittal postcontrast t1wi shows enhancing dumbbell shaped sacral mass. (d) right internal iliac artery injection, showing the enlarged tortuous feeders and the moderately vascular mass. (e) post - pva particle embolization, right internal iliac artery injection, showing complete cessation of flow to the tumor the author performed diagnostic angiographies of avms, ruptured or unruptured. no embolizations were done (the author has now started embolizing avms in the 2 year of practice). the author strongly feels that a neurointerventionalist has to undergo a proper training program with adequate number of cases, academic sessions, lectures and discussions, and most important of all, adequate duration. this has been substantiated in a number of articles recently, with factors independently associated with a decreased risk of neurologic complication being increasing chronologic year in which the procedure was performed and involvement of a trainee in the procedure. also, now more and more low volume centers have started taking up neurointerventional cases. while this is not at all mandatory, the programs have to be made sufficiently lengthy and diagnostic angiographies were the largest group of procedures. altogether, 36 cases of diagnostic cerebral and 2 spinal dsas were performed. all types of cases were taken up and included aneurysms, avm, davf, extracranial or intracranial stenotic conditions, and tumors. this compares well with the literature, for example, a large series of 19,826 cases by kaufmann. had shown 4.2% puncture site complications, 2.63% neurologic deficits (including, 0.14% stroke with permanent disability), and 0.06% death. in yet another series of 2899 cases by willinsky., there were 1.3% neurologic complications, including 0.5% permanent disability from stroke. various factors have been reported to be associated with complications of angiography, and include increasing age, atherosclerotic cerebrovascular disease, subarachnoid hemorrhage (sah), frequent transient ischemic attack, cardiovascular disease, and long fluoroscopic times. in the elective patient management practice, the author makes sure that noninvasive angiography (computed tomography angiography [cta ] and or magnetic resonance angiography [mra ]) is performed in such patient groups as far as possible, as also in patients with long - term diabetes mellitus, hypertension, renal disease, severe obesity (to avoid groin puncture site complications). the author is a neuroradiologist, involved in reading the patient 's imaging as well as doing transcranial doppler (tcd) and performing the endovascular procedures. after deciding upon the necessity of an intervention, in collaboration with the vascular neurophysician, intravenous thrombolysis (ivt), clotbust sonothrombolysis or iat. depending upon the individual case (predominantly the presence of large vessel occlusion) and patient / family preference, one of the three was done. the author was entrusted upon with the latter two types of intervention. in all, six cases of clotbust sonothrombolysis [figure 3 ] and six cases of iat were done. five more cases were taken up for iat, but after the angiogram, intervention was deemed not suitable / not required and hence not proceeded with [figure 4 ]. these five cases are included under the head of diagnostic cerebral angiography. clotbust sonothrombolysis therapy with good outcome : a 70-year - old male with cad, ckd and acute left mca territory stroke of 4 h. (a) admission dwi at level of basal ganglia. (b) dwi at level of centrum semiovale ; diffusion restriction noted in left temporo - parietal region with dwi - aspects of 6. (d) tcd waveform and parameters, at the end of the procedure ; flow is still not very good but the velocities are within normal limits. (e) ncct head done next morning with established infarct in left temporoparietal area a 43-year - old female with right hemiparesis since 2 h (a) admission ct head -aspects 10 ; ivt was started. (b) post - ivt ct with ischemia in left gangliocapsular region (thin arrow). (f) left va injection, ap view, show good collaterals ; no further intervention done. (h) coronal t2wi showing patent left aca, mca and supraclinoid ica with still occluded cavernous ica the technique of clotbust sonothromobolysis used was as described in literature. we went through the reasons for the success and found the following : well - oiled acute stroke management machinery was in place. our team tried to cut down the time of transit between various rooms and did not opt for prolonged imaging protocols or sedation. the average time for patient to move through the emergency to computed tomography (ct) and then to stroke care unit was 20 min and in no case was more than 30 minthe tcd procedure was started very early, as soon as the patient returned from the ct room into the stroke care unit. in fact the rtpa (recombinant tissue plasminogen activator) injection could be started at an average time of approximately 30 min after the start of the tcda trained nurse stood by the side of the patient making sure that the tcd went on smoothly, and also did the mandatory neuro - vital monitoringthe author himself made sure that the ct interpretation was done on the consolethe patient and attendants were counseled personally during the transitall cases had start of rtpa injection within 1 h of arrivalthe tcd continued for a full duration of 2 h, irrespective of the change in neurological functions and the status of the rtpa injection. our team tried to cut down the time of transit between various rooms and did not opt for prolonged imaging protocols or sedation. the average time for patient to move through the emergency to computed tomography (ct) and then to stroke care unit was 20 min and in no case was more than 30 min the tcd procedure was started very early, as soon as the patient returned from the ct room into the stroke care unit. in fact the rtpa (recombinant tissue plasminogen activator) injection could be started at an average time of approximately 30 min after the start of the tcd a trained nurse stood by the side of the patient making sure that the tcd went on smoothly, and also did the mandatory neuro - vital monitoring the author himself made sure that the ct interpretation was done on the console the patient and attendants were counseled personally during the transit all cases had start of rtpa injection within 1 h of arrival the tcd continued for a full duration of 2 h, irrespective of the change in neurological functions and the status of the rtpa injection. for iat, the author mostly used rtpa and mechanical thrombectomy was done in one of the cases, along with 2 mg rtpa infusion. out of the six cases of iat, tici 2b / tici 3 (thrombolysis in cerebral infarction ; tici) reperfusion was achieved in five, and all these cases had good outcome at 3 months. one case had minimal recanalization and fared average at 3 months with mrs of 2. in the integrated stroke care services offered in the institute, the author was involved at each step of patient care of in - patients with aneurysms (ruptured or unruptured). all ct scans were read by the author, and daily tcds on sah patients were done. patients / attendants were offered either cta or dsa for sah evaluation and depending upon their choice, one was done. aneurym coiling was performed by the author after discussion with the stroke team. in all, six coiling procedures were done. one patient had thromboembolic event, which could not be recanalized in spite of all techniques tried, and another patient with right middle cerebral artery (mca) bifurcation aneurysm died after 4 h of a partial coiling procedure due to massive rebleed [figure 2 ]. in the remaining patients, complete or near complete aneurysm filling could be achieved, with only interstitial filling or dog - ear remnants seen after the completion of procedure. balloon assistance was needed in two cases, and no thromboembolic complications were seen in either. one was a case of a spinal hemangioblastoma, which had undergone surgery twice earlier, no doubt failed, and taken up for embolization. the tumor could be partially embolized and the patient then underwent a successful repeat surgery. another patient has a large sacral schwannoma, which was embolized near completely via both internal iliac arterial branches, and then underwent successful tumor removal [figure 5 ]. a 39-year - old female with sacral schwannoma ; pva particle embolization with complete tumor devascularization (a) sagittal postcontrast t1wi shows enhancing dumbbell shaped sacral mass. (d) right internal iliac artery injection, showing the enlarged tortuous feeders and the moderately vascular mass. (e) post - pva particle embolization, right internal iliac artery injection, showing complete cessation of flow to the tumor no embolizations were done (the author has now started embolizing avms in the 2 year of practice). the author strongly feels that a neurointerventionalist has to undergo a proper training program with adequate number of cases, academic sessions, lectures and discussions, and most important of all, adequate duration. this has been substantiated in a number of articles recently, with factors independently associated with a decreased risk of neurologic complication being increasing chronologic year in which the procedure was performed and involvement of a trainee in the procedure. also, now more and more low volume centers have started taking up neurointerventional cases. many authors today feel that neurointerventional training programs should be abandoned altogether. while this is not at all mandatory, the programs have to be made sufficiently lengthy and the author setup an interventional neuroradiology service in a suburban hospital, completing a dedicated stroke care team, and the first year of the service produced high procedural success rate and acceptable complications with patient outcome rates comparable to the existing literature. | context : endovascular neurointervention (interventional neuroradiology) is a highly demanding science requiring deep understanding of disease, anatomy, clinical skills and manual dexterity, consequently with a long learning curve and thus posing significant challenges to a physician entering new into the competitive arena.aim:to evaluate the procedural success, complications and outcome in the first year of independent endovascular neurointervention practice in a suburban hospital.materials and methods : retrospective analysis of prospectively maintained data of all diagnostic and therapeutic neurointerventional cases performed by the author between the period of january 02, 2012 and december 31, 2012.results:a total of 61 procedures were performed. the performance success rate of the diagnostic procedures was 100% (38/38) and that of therapeutic procedures was 82.6% (19/23). the periprocedural complication rates were nil and 13%, respectively, for diagnostic and therapeutic procedures. the 3-month patient outcome for therapeutic procedures was good outcome (modified rankin scale < 2) in 87% cases (20/23), and poor outcome in 13% (2 dead and 1 debilitated with modified rankin scale of 3).conclusion : for a well - trained endovascular neurointerventionalist, the first year of practice had high procedural success rate and acceptable complication with patient outcome rates comparable to the existing literature. |
preeclampsia is a pregnancy - specific hypertensive disorder classically characterized by proteinuria and edema after the twentieth week of gestation. preeclampsia is a common complication of pregnancy, with an incidence of ~510% of all pregnancies. though the underlying mechanisms of preeclampsia are not well understood, a central factor believed to be important in the development of the disease is placental ischemia and hypoxia which result from a failure of the maternal uterine vasculature to remodel into high - capacitance vessels, leading to placental hypoperfusion [35 ]. in response to hypoxia, the placenta begins to produce a number of soluble factors which are secreted into the maternal circulation. once, in circulation, these factors induce widespread maternal endothelial dysfunction, one of the key hallmarks of this disorder [6, 7 ]. there are a number of molecular pathways which are involved in the cascade from placental ischemia to maternal endothelial dysfunction. two pathways which have been the subject of intense research are the production of the soluble form of the vascular endothelial growth factor (vegf) receptor - denominated soluble fms - like tyrosine kinase (sflt-1) and the production of placental hypoxia - induced reactive oxygen species (ros). when, in circulation, sflt-1 binds to free vegf and placental growth factor (plgf) sequestering them and making them unavailable for proper signaling. sflt-1 can be directly induced by hypoxia through the actions of hif-1 and has been shown to be produced by human placental trophoblasts and villi in response to decreased oxygen [1012 ]. it has also been shown to be produced in the placenta during preeclampsia and is found to be elevated in the circulation of preeclamptic women, often before the onset of maternal symptoms [13, 14 ]. in addition, numerous experimental models have demonstrated the importance of sflt-1 overexpression in the development of preeclampsia [1518 ]. oxidative stress has been shown to be elevated in both the placenta and the maternal vasculature of women with preeclampsia [1921 ]. the symptoms associated with experimental rodent placental hypoperfusion have also shown to be attenuated by either the superoxide dismutase mimetic tempol or the nadph oxidase inhibitor apocynin [22, 23 ]. this suggests that oxidative stress, at least partially induced by nadph oxidase, is a crucial factor in the symptomatic manifestation of preeclampsia. one potential palliative agent suggested for the normalization of these two pathways is the enzyme heme oxygenase-1 (ho-1). ho-1 typically catalyzes the rate - limiting step in the heme salvage pathway, converting the prooxidant heme to biliverdin, which is then rapidly converted by biliverdin reductase to bilirubin, a known antioxidant [24, 25 ]. as a side product, ho-1 releases carbon monoxide, a vasodilator. recently, it has been reported that ho-1 could negatively regulate vegf or interferon--induced sflt1- release in vitro. also, we have recently demonstrated that induction of ho-1 in a rodent placental ischemia model attenuated the associated hypertension and angiogenic imbalance. in the present work, we have extended this previous work to examine the direct effects of ho-1 and its byproducts co and bilirubin on hypoxia - induced oxidative stress and sflt-1 production. all animal protocols were approved by the university of mississippi medical center institutional animal care and use committee and followed the national institutes of health guidelines for the care and use of laboratory animals. animals were maintained at constant temperature (23c) with a 12 : 12 h light : dark cycle. on day 19 of gestation, the animals were sacrificed by pneumothorax and cardiac excision followed by tissue harvest. briefly, after tissue excision, placentas were immediately placed into cold dulbecco 's phosphate buffered saline (sigma, st. the villous explants were plated in 24-well cell culture plates coated with 0.2 ml of matrigel matrix basement membrane from bd bioscience (bedford, mass). explants were grown in dulbecco 's modified eagle 's media - ham 's f-12 supplemented with 10% fbs, 100 g / ml streptomycin, 100 u / ml penicillin, and 25 g / ml ascorbic acid as previously described. the explants were maintained at constant oxygen tensions of either 6% or 1% in double gas incubators purged with nitrogen. control explants were incubated in media with no supplementation. the ho-1 inducer cobalt (iii) protoporphyrin ix chloride (copp, frontier scientific, logan, utah) was prepared in 0.1 m naoh in saline, and the ph was adjusted to a final ph of 8.5 copp was utilized at a final concentration in culture of 20 m. corm-3 has been previously described and was prepared in media immediately before use at a final concentration of 40 m. bilirubin was utilized at a final concentration of 100 m. at 48 hours after treatment, the cell culture media was removed from the explants and both media and tissue were frozen for further analysis. total intracellular protein was extracted by 5x repeated freeze - thaw lysis in ft buffer (600 mm kcl, 20 mm tris - cl, ph 7.8, 20% glycerol, 0.4 mg / ml pefabloc, 10 g / ml leupeptin, 10 g / ml pepstatin, and 5 g / ml aprotinin). protein concentration was determined by bradford assay (bio - rad). for western blots, 30 g of protein was subjected to sds - page on 420% gradient sds - polyacrylamide gels (bio - rad). membranes were blocked with odyssey blocking buffer (li - cor, lincoln, neb) for two hours at room temperature. primary incubation was undertaken overnight at 4c with a rabbit anti - ho-1 polyclonal antibody (stressgen, vancouver, calif) at 1 : 2000 and a mouse anti--actin antibody (gentest) at 1 : 5000. secondary antibody incubation was done with alexa fluor 680 goat anti - rabbit (molecular probes) and irdye 800 goat anti - mouse igg (rockland) for one hour at room temperature. fluorescence was detected on an odyssey infrared imager (li - cor) for simultaneous detection of both species. blot analysis was performed with the supplied odyssey software, and ho-1 was normalized to -actin, with n = 6 in each group. individual wells of a black 96-well microtiter plate were filled with 200 ul of 5 m dhe (invitrogen) diluted into phosphate buffered saline. fluorescence was monitored by excitation at 510 nm and emission at 610 nm. fluorescence was monitored every 2 minutes for a total of one hour and the resulting measurements averaged over the life of the experiment. for each group, n = 713. total protein concentration of the cell culture supernatants was determined by the bicinchoninic acid (bca) assay (pierce, rockford, ill) using bovine serum albumin (bsa) as a standard. measurement of s - flt1 was performed by sandwich elisas (r&d systems, minneapolis, minn) according to manufacturer protocols. the plates were read on a tecan genios microplate reader, and quantitation was performed with megellan version 4.1 software. sflt-1 levels were normalized to the total amount of media protein, and the results graphed with origin pro 8 (microcal), which was also used for all statistical analyses. statistical significance was determined by one - way anova, with a significance threshold of p < 0.05. in order to assess the effect of hypoxia and copp on ho-1 expression in placental villi, villous explants were excised from the trophospongium and labyrinth of rodent placentas on day 19 of gestation. these tissues were cultured on synthetic basement membrane in either 6% (normoxic) or 1% (hypoxic) oxygen, reflecting the approximate oxygen tension of a normal and hypoxic placenta, respectively. as can be seen in figure 1, at 48 hours, villous bundles in the hypoxic exhibited an approximate 30% reduction in their -actin normalized ho-1 expression (6% = 1 0.11 versus 1% = 0.69 0.02, p < 0.05). in response to copp, there was no significant difference in the expression of ho-1 in the 6% treated group (0.89 0.08). when copp was administered to villi exposed to 1% oxygen, however, there was a significant normalization of ho-1 expression when compared to hypoxic controls (1% = 0.69 0.02 versus 1% + copp = 1.07 0.08, p < 0.05), indicating that copp can restore ho-1 expression in hypoxic villi. we next assessed the effects of both ho-1 levels and the direct effect of the ho-1 product bilirubin, a known antioxidant, on hypoxia - induced superoxide production. as seen in figure 2, in response to hypoxic exposure, there is a significant increase in the tissue levels of superoxide of approximately 60% as determined by dihydroethidium fluorescence (6% = 1 0.03 versus 1% = 1.63 0.19, p < 0.05). administration of copp had no significant difference under normoxic conditions (0.86 0.06), but hypoxic tissues treated with copp exhibited a marked decrease in dhe fluorescence when compared to hypoxic controls (1% = 1.63 0.19 versus 1% + copp = 1.01 0.14, p < 0.05). incubation with bilirubin had a marked effect on detected superoxide in both normoxic and hypoxic tissues. under 6% oxygen, there was a significant decrease in dhe fluorescence when compared to normoxic controls (6% = 1 0.03 versus 6% + bili = 0.040 0.11, p a similar level of dhe fluorescence was seen in hypoxic tissues, which were also significantly different from their hypoxic controls (1% = 1.63 0.19 versus 1% + bili = 0.54 0.15, p < 0.05). these data suggest that both ho-1 and bilirubin significantly attenuate hypoxia - induced superoxide in placental villi. we also wished to determine what effect ho-1 and its byproducts would have on the hypoxia - induced production of sflt-1. as seen in figure 3, in response to hypoxia treatment, secreted sflt-1 is significantly increased in response to hypoxia exposure (6% = 1649 12.1 pg / mg versus 1% = 1854 35 pg / mg, p < 0.05). administration of copp decreased the amount of sflt-1 secreted under both normoxic (6% = 1649 12.1 = 1477 54 pg / mg, p < 0.05) and hypoxic (1% = 1854 35 pg / mg versus 1349 32 pg / mg, p < 0.05) conditions when compared to their respective controls. while bilirubin had no significant effect on sflt-1 under normoxic conditions (1753 56 pg / mg), in hypoxia - exposed explants, there was a significant decrease in the production of sflt-1 when compared to hypoxic controls (1% = 1854 35 pg / mg versus 1542 76 similarly, administration of a co donor molecule had no significant effect on the production of sflt-1 under normoxic conditions (6% = 1649 12.1 pg / mg versus 6% + corm = 1542 53 pg / mg) but exhibited a marked attenuation of sflt-1 under hypoxic conditions (1% = 1854 35 collectively, these data suggest that ho-1 through both co and bilirubin suppresses hypoxia - induced sflt-1 in placental villi. preeclampsia remains a major health concern, affecting at least one out of every twenty pregnancies. besides the immediate risk for mother and fetus, there is increasing evidence that preeclampsia confers increased risk for cardiovascular complications to the offspring in later life. one of the major roadblocks in the management of preeclampsia is the lack of an effective pharmacological intervention for its treatment. a potential therapy which has been proven effective in numerous experimental forms of hypertension is the manipulation of the ho-1 pathway [3639 ]. bilirubin has been shown in numerous systems to function as a powerful antioxidant [24, 25 ]. as it is recognized that production of reactive oxygen species is a major component of varied forms of hypertension, moderate increases in bilirubin could act to decrease overall oxidative stress. co acts as a potent vasodilator, functioning in a manner similar to endothelium - derived relaxing factor. of particular interest to preeclampsia, ho-1 and co have been shown to directly inhibit production of vegf and interferon--induced secretion of sflt-1. additionally, it has been reported that co derived from ho-1 in vascular smooth muscle could inhibit production of endothelin-1, a protein shown to be a final common pathological factor in several experimental models of preeclampsia. we have recently demonstrated that induction of the ho-1 pathway could significantly attenuate the preeclampsia - like pathological manifestations associated with experimental placental ischemia in the rodent. specifically, ho-1 attenuated the associated hypertension, with concomitant decreases in placental sflt-1 and oxidative stress, and increased circulating bioavailable vegf. however, in this in vivo model, it was not possible to determine the direct effects of ho-1 and the individual metabolites on the regulation of each of these factors within the placenta. in the present work, we have utilized a previously established model of placental vascular bundle culturing to determine the importance of each of these factors in the regulation of oxidative stress and sflt-1 in response to hypoxia. western blotting analysis demonstrated that hypoxia exposure significantly decreased the expression of ho-1 in the vascular bundles. this is surprising, as numerous reports have indicated hypoxia induces an increase in ho-1 [4143 ]. copp administration had no effect under normoxic conditions but in hypoxia restored ho-1 to normoxic levels. this is consistent with our previous data which shows that copp induces ho-1 in the placenta only with the secondary insult of placental ischemia / hypoxia. in response to hypoxia exposure, copp administration significantly decreased sflt-1 secretion to levels which were below even normoxic controls. though co has been shown to negatively regulate vegf and interferon--induced sflt-1 in placental explants, its effect on hypoxia - induced sflt-1 as suggested in the literature, co did indeed significantly attenuate hypoxia - induced sflt-1, returning to levels equivalent to copp induction. perhaps most surprisingly, administration of bilirubin also significantly decreased the secretion of sflt-1 during hypoxia. this may suggest that oxidative stress is playing a role in the induction of sflt-1, though the s ameliorative effect of bilirubin was not as great as either copp or co, suggesting that co is the major factor in ho-1 's effect on sflt-1. superoxide was also increased in the explants exposed to hypoxia when compared to normoxic controls. treatment with copp, which does not induce ho-1 expression under normoxic conditions, had no effect on superoxide levels. however, under hypoxic conditions where copp normalizes ho-1 levels, there was a significant reduction in the amount of superoxide produced by the explants. tellingly, the exogenous application of bilirubin to the explants under either normoxic or hypoxic conditions led to a significant decrease in superoxide when compared to their respective controls. this is perhaps an intuitive result given the known antioxidant properties of bilirubin but strongly suggests that moderate elevations in bilirubin production as a result of increased ho-1 are driving the reduction in oxidative stress. this demonstrates a second pathway through which ho-1 induction is directly affecting hypoxia - induced changes in the placental vasculature. it seems evident from these data as a whole, that ho-1 induction, through both co and bilirubin production, is having a direct effect on the placental vasculature during ischemia / hypoxia. continued studies into the safety and efficacy of agents to increase ho-1 or deliver these metabolites directly is warranted. we have demonstrated here that induction of ho-1, or delivery of its bioactive metabolites co and bilirubin, is capable of significantly downregulating two major hypoxia - induced factors (oxidative stress and sflt-1) implicated in the etiology of preeclampsia. future studies both in vitro and in vivo are necessary to fully elucidate the therapeutic potential of this approach. | one of the most prevalent complications of pregnancy is preeclampsia, a hypertensive disorder which is a leading cause of maternal and perinatal morbidity and premature birth with no effective pharmacological intervention. while the underlying cause is unclear, it is believed that placental ischemia / hypoxia induces the release of factors into the maternal vasculature and lead to widespread maternal endothelial dysfunction. recently, ho-1 has been shown to downregulate two of these factors, reactive oxygen species and sflt-1, and we have reported that ho-1 induction attenuates many of the pathological factors of placental ischemia experimentally. here, we have examined the direct effect of ho-1 and its bioactive metabolites on hypoxia - induced changes in superoxide and sflt-1 in placental vascular explants and showed that ho-1 and its metabolites attenuate the production of both factors in this system. these findings suggest that the ho-1 pathway may be a promising therapeutic approach for the treatment of preeclampsia. |
larval substrate containing third - instar larvae of m. domestica (hewitt 1914) was collected from the kansas state university dairy facility (riley county, manhattan, ks) in august and october 2014. this natural fly developmental substrate consisted almost entirely of accumulated residue of managed manure from the ksu dairy herd. approximately 100 g of manure in a sterile 16 oz polypropylene container with larvae (n = 20 - 25) was placed in a secondary plexiglass container (25 by 25 by 20 cm) to minimize contamination and maintained at 28c under a photoperiod of 14:10 (l : d) h. manure was observed daily for presence of puparia, which were subsequently removed with sterile forceps, surface sanitized (described below), and placed in individual sterile 15 ml conical tubes for imago emergence. for microbe culture, samples (1.0 g manure and 5 third - instar larvae) were collected on day 0, on days 78 (five late - stage pupae), and on days 910 (five newly emerged adults and matching puparia). fly stages (larvae, pupae, or adults) were surface sanitized by sequential washes in 0.5% sodium hypochloride, 70% ethanol, and sterile deionized water, 2 min each. samples were homogenized in sterile phosphate buffered saline and cultured on tryptic soy agar (fisher scientific, atlanta, ga) at 37c overnight. total colony forming units (cfu) were enumerated and distinct colony morphotypes were subcultured on tryptic soy agar, after which a single colony was picked for 16s rdna - polymerase chain reaction (pcr) bacterial identification. pcr amplification of the 16s rrna gene was performed using universal eubacterial primers : 8f (5-agagtttgatcctggctcag-3) and 806r (5- ctaccagg gtatctaat-3) (hugenholtz. 1998). pcr products were purified with dna clean & concentrator (zymo research, irvine, ca) and sequenced by clemson university genomics institute using the same pcr primers. sequences were manually edited in codoncode aligner (version 3.7.1) (codoncode corporation) and taxonomically identified by blast (basic local alignment search tool) search of the ncbi genbank database (http://blast.ncbi.nlm.nih.gov/blast.cgi). total cfu recovered from manure on day 0 were 8.0 10 cfu / g for august and 2.6 10 cfu / g for october. all larval cultures (5/5 for each collection) displayed bacterial growth ranging from 1.30 10 to 2.25 10 cfu in august (mean : 7.94 9.85 10 cfu per larva) and 2.43 10 to 3.0 10 in october (mean : 1.39 1.34 10 cfu per larva). variation observed across larval samples and collection dates could be attributed to feeding versus nonfeeding third - instar larvae as well as the abundance and diversity of bacteria in the manure. all pupae had bacterial growth (10/10), ranging from 4.58 10 to 4.10 10 cfu per pupa for august (mean : 2.22 1.82 10 cfu per pupa) and 1.55 10 to 2.78 10 cfu per pupa for october collection (mean : 1.66 1.32 10 cfu per pupa). of the 10 teneral adults cultured, 6 had recoverable amounts of bacteria ranging from 5.0 to 1.5 10 cfu per adult in august (mean : 1.00 0.707 10 cfu per adult) and 7.25 10 to 1.03 10 cfu per adult in october (mean : 8.98 1.56 10 cfu per adult). all 10 puparia corresponding to these adults were positive for bacteria, with concentrations ranging from 1.88 10 to 1.31 10 cfu per puparium in august (mean : 3.64 6.02 10 cfu per puparium) and 1.85 10 to 2.98 10 cfu per puparium in october (mean : 1.02 1.36 10 cfu per puparium). distinct morphotypes of these isolates were subcultured and sequenced for taxonomic identification (tables 1 and 2). interestingly, while this may be a result of the limitations of culture - based techniques and visual selection of morphotypes, this phenomenon is also attributable to digestive processes within the larvae. bacterial taxa present in manure but not in larvae indicate ingestion and digestion of the microbes. similarly, it follows that species detected in larvae and pupae, but not detectable in manure, were not digested within the larvae and instead accumulated in the gut, as has been previously suggested (su. some of these taxa have been reported previously as being associated with manure (banjo. 2005), larvae, or wild - caught flies (zurek. 2000, nazni.. table 1.identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (august 2014)samplepositive culturesidentification% idlength (bp)manurehomoserinomonas sp.97716pseudochrobactrum sp.96686third instars5/5aeromonas sp.100709enterococcus sp.100737escherichia sp.99716leucobacter sp.96704microbacterium sp.99701providencia stuartii100716providencia sp.99720serratia marcescens100693pupae5/5acinetobacter sp.98534a. sonorensis99680 table 2.identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (october 2014)samplepositive culturesidentification% idlength (bp)manurearthrobacter sp.97716vibrio sp.98716third instars5/5a. faecalis99716micrococcus luteus99700pseudochrobactrum asaccharolyticum98671 identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (august 2014) identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (october 2014) several bacterial genera present in pupae and puparia were not detected in emerging adults including alcaligenes faecalis, arthrobacter sp., brevundimonas sp., and acinetobacter sp. in august and october (tables 1 and 2). bacterial species present in larvae and pupae but not cultured from either puparia or the emerged adults presumably were destroyed by the histolytic and proteolytic processes occurring during metamorphosis or were undetectable due to very low abundance. four taxa were cultured and identified from emerging adults : august collection, bacillus sonorensis from two adults, and october collection, micrococcus luteus, a. faecalis, and pseudochrobactrum sp., where the last two species were both isolated from one adult (tables 1 and 2). b. sonorensis previously has been isolated from dairies and is a potential contaminant during milk production processes (buehner. 2014). while the ability of flies to disseminate b. sonorensis was not determined, sanitary practices in the dairy parlor potentially can be impacted if newly emerged flies harbor this microbe. a. faecalis has been isolated from dung, soil, and flies (agers and sandvang 2005, su. 2010, resende. 2014). because a. faecalis has the potential to harbor antibiotic resistance genes (agers and sandvang 2005, resende. 2014), transstadial carriage in house flies and possible dissemination from manure should be of concern in the design of manure and fly management practices. 2010) ; this bacterium is typically associated with soil and can cause opportunistic infections in humans (kmpfer. carriage of bacteria across stages of house fly life history has been previously demonstrated. using artificial rearing media (wheat bran and calf mana), su. (2010) showed carry - over of several bacterial taxa through larval stages to newly emerged adult house flies using a molecular - based approach. tebbutt (1912) showed variable, low abundance carryover of pathogenic bacteria from larvae to emerged adult flies. similarly, radvan (1960) showed survival of pathogenic bacteria to house fly pupal stages but no significant transstadial carriage to adults. greenberg (1959) showed that persistence of pathogens across house fly life history was species specific, at least for salmonella spp. salmonella paratyphi, but not salmonella typhi, survived through metamorphosis in some flies and was cultured from emerged adults, even when larvae are reared in medium naturally contaminated with other ubiquitous microbes. studies where house fly third - instar larvae were fed escherichia coli via culture plate showed 100% of puparia and 78% of emerging adults harbored bacteria (rochon. 2005). however, this number dropped to 66% when flies were previously rinsed, indicating that some of the emerged adults primarily harbored bacteria on their external surfaces. using a traceable bioluminescent strain of e. coli, schuster. (2013) showed dose - dependent transstadial carriage of bacteria in flies reared from larvae on sterilized manure inoculated with various concentrations (0, 3, 5, and 8 log10 cfu / ml). while the approach used in this study had probable limitations of detection, our aim was to identify only viable bacteria. in contrast, while using solely a molecular - based approach (i.e., pcr of dna extracts from our samples) is more sensitive, it can not distinguish viable from nonviable bacteria (gupta. future studies can be improved by growing cultures at several temperatures on both selective and nonselective media, which would allow for a more extensive survey of viable bacterial species richness. nonetheless, we showed evidence of transstadial carryover of several species of bacteria in flies that emerged after rearing in a natural developmental substrate (managed manure residue). the potential of newly emerged flies to harbor and disseminate bacteria, even with manure management strategies in place, warrants further study. total cfu recovered from manure on day 0 were 8.0 10 cfu / g for august and 2.6 10 cfu / g for october. all larval cultures (5/5 for each collection) displayed bacterial growth ranging from 1.30 10 to 2.25 10 cfu in august (mean : 7.94 9.85 10 cfu per larva) and 2.43 10 to 3.0 10 in october (mean : 1.39 1.34 10 cfu per larva). variation observed across larval samples and collection dates could be attributed to feeding versus nonfeeding third - instar larvae as well as the abundance and diversity of bacteria in the manure. all pupae had bacterial growth (10/10), ranging from 4.58 10 to 4.10 10 cfu per pupa for august (mean : 2.22 1.82 10 cfu per pupa) and 1.55 10 to 2.78 10 cfu per pupa for october collection (mean : 1.66 1.32 10 cfu per pupa). of the 10 teneral adults cultured, 6 had recoverable amounts of bacteria ranging from 5.0 to 1.5 10 cfu per adult in august (mean : 1.00 0.707 10 cfu per adult) and 7.25 10 to 1.03 10 cfu per adult in october (mean : 8.98 1.56 10 cfu per adult). all 10 puparia corresponding to these adults were positive for bacteria, with concentrations ranging from 1.88 10 to 1.31 10 cfu per puparium in august (mean : 3.64 6.02 10 cfu per puparium) and 1.85 10 to 2.98 10 cfu per puparium in october (mean : 1.02 1.36 10 cfu per puparium). distinct morphotypes of these isolates were subcultured and sequenced for taxonomic identification (tables 1 and 2). interestingly, while this may be a result of the limitations of culture - based techniques and visual selection of morphotypes, this phenomenon is also attributable to digestive processes within the larvae. bacterial taxa present in manure but not in larvae indicate ingestion and digestion of the microbes. similarly, it follows that species detected in larvae and pupae, but not detectable in manure, were not digested within the larvae and instead accumulated in the gut, as has been previously suggested (su. some of these taxa have been reported previously as being associated with manure (banjo. 2005), larvae, or wild - caught flies (zurek. 2011). table 1.identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (august 2014)samplepositive culturesidentification% idlength (bp)manurehomoserinomonas sp.97716pseudochrobactrum sp.96686third instars5/5aeromonas sp.100709enterococcus sp.100737escherichia sp.99716leucobacter sp.96704microbacterium sp.99701providencia stuartii100716providencia sp.99720serratia marcescens100693pupae5/5acinetobacter sp.98534a. sonorensis99680 table 2.identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (october 2014)samplepositive culturesidentification% idlength (bp)manurearthrobacter sp.97716vibrio sp.98716third instars5/5a. faecalis99716micrococcus luteus99700pseudochrobactrum asaccharolyticum98671 identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (august 2014) identification of bacterial isolates from cow manure and house flies based on 16s rdna sequencing (october 2014) several bacterial genera present in pupae and puparia were not detected in emerging adults including alcaligenes faecalis, arthrobacter sp., brevundimonas sp., and acinetobacter sp. in august and october (tables 1 and 2). bacterial species present in larvae and pupae but not cultured from either puparia or the emerged adults presumably were destroyed by the histolytic and proteolytic processes occurring during metamorphosis or were undetectable due to very low abundance. four taxa were cultured and identified from emerging adults : august collection, bacillus sonorensis from two adults, and october collection, micrococcus luteus, a. faecalis, and pseudochrobactrum sp., where the last two species were both isolated from one adult (tables 1 and 2). b. sonorensis previously has been isolated from dairies and is a potential contaminant during milk production processes (buehner. 2014). while the ability of flies to disseminate b. sonorensis was not determined, sanitary practices in the dairy parlor potentially can be impacted if newly emerged flies harbor this microbe. a. faecalis has been isolated from dung, soil, and flies (agers and sandvang 2005, su. 2014). because a. faecalis has the potential to harbor antibiotic resistance genes (agers and sandvang 2005, resende. 2014), transstadial carriage in house flies and possible dissemination from manure should be of concern in the design of manure and fly management practices. 2010) ; this bacterium is typically associated with soil and can cause opportunistic infections in humans (kmpfer. carriage of bacteria across stages of house fly life history has been previously demonstrated. using artificial rearing media (wheat bran and calf mana), su. (2010) showed carry - over of several bacterial taxa through larval stages to newly emerged adult house flies using a molecular - based approach. tebbutt (1912) showed variable, low abundance carryover of pathogenic bacteria from larvae to emerged adult flies. similarly, radvan (1960) showed survival of pathogenic bacteria to house fly pupal stages but no significant transstadial carriage to adults. greenberg (1959) showed that persistence of pathogens across house fly life history was species specific, at least for salmonella spp. salmonella paratyphi, but not salmonella typhi, survived through metamorphosis in some flies and was cultured from emerged adults, even when larvae are reared in medium naturally contaminated with other ubiquitous microbes. studies where house fly third - instar larvae were fed escherichia coli via culture plate showed 100% of puparia and 78% of emerging adults harbored bacteria (rochon. however, this number dropped to 66% when flies were previously rinsed, indicating that some of the emerged adults primarily harbored bacteria on their external surfaces. using a traceable bioluminescent strain of e. coli, schuster. (2013) showed dose - dependent transstadial carriage of bacteria in flies reared from larvae on sterilized manure inoculated with various concentrations (0, 3, 5, and 8 log10 cfu / ml). while the approach used in this study had probable limitations of detection, our aim was to identify only viable bacteria. in contrast, while using solely a molecular - based approach (i.e., pcr of dna extracts from our samples) is more sensitive, it can not distinguish viable from nonviable bacteria (gupta. future studies can be improved by growing cultures at several temperatures on both selective and nonselective media, which would allow for a more extensive survey of viable bacterial species richness. nonetheless, we showed evidence of transstadial carryover of several species of bacteria in flies that emerged after rearing in a natural developmental substrate (managed manure residue). the potential of newly emerged flies to harbor and disseminate bacteria, even with manure management strategies in place, warrants further study. | house flies (diptera : muscidae ; musca domestica l.) associate with microbe - rich substrates throughout life history. because larvae utilize bacteria as a food source, most taxa present in the larval substrate, e.g., manure, are digested or degraded. however, some species survive and are present as third - instar larvae begin pupation. during metamorphosis, many bacteria are again lost during histolysis of the larval gut and subsequent remodeling to produce the gut of the imago. it has been previously demonstrated that some bacterial species survive metamorphosis, being left behind in the puparium, present on the body surface, or in the gut of the emerged adult. we used a combined culture - molecular approach to identify viable microbes from managed manure residue and a wild population of house fly larvae, pupae, puparia, and adults to assess transstadial carriage. all larval (10/10), pupal (10/10), and puparial (10/10) cultures were positive for bacteria. several bacterial species that were present in larvae also were present either in pupae or puparia. four viable bacterial species were detectable in 6 of 10 imagoes reared from manure. of note is the apparent transstadial carriage of bacillus sonorensis, which has been associated with milk spoilage at dairies, and alcaligenes faecalis, which can harbor numerous antibiotic resistance genes on farms. the potential of newly emerged flies to harbor and disseminate bacteria from managed manure on farms is an understudied risk that deserves further evaluation. |
primary pulmonary lymphoma (ppl) is an uncommon entity of non - hodgkin lymphoma (nhl), which accounts for < 1% of all cases of lymphoma, 34% of all the extranodal manifestations of nhl, and only 0.51% of all primary pulmonary malignancies. most of the cases of the primary lymphoma of the lung originate from the b - cell lineage. in 90% case, ppl is low - grade lymphoma ; however, it can transform to high - grade lymphoma. there have been only few case reports in the literatures reporting the usefulness of positron emission tomography - computed tomography (pet - ct) in the ppl. here, we discuss two rare cases of ppl of diffuse large b - cell lymphoma. a 26-year - old male patient presented to our department for the initial staging of nhl. since pulmonary tuberculosis is highly prevalent in this part of the world, based on clinical and radiological investigations, he was put on antitubercular treatment (att). there was no clinical and or radiological improvement noted with 6 months of att treatment. contrast - enhanced computed tomography (cect) of the chest showed left lung upper lobe mass. ct guided fine needle aspiration cytology (fnac) did not reveal any definite diagnosis, but findings were suspicious for malignancy. based on fnac finding, open chest thoracotomy biopsy was done which confirmed the diagnosis of diffuse large b - cell lymphoma. fluorine fluoro - deoxy - glucose (f - fdg) pet - ct performed to know the extent of the disease demonstrated increased fdg uptake (suvmax- 10.7) in the left lung upper lobe mass measuring 5.5 cm 6.5 cm 7.0 cm with no extrapulmonary involvement [figure 1 ]. patient received 6 cycles of (rituximab, cyclophosphamide, cyclophosphamide, doxorubicin, vincristine, and prednisolone) chemotherapy. a follow - up posttreatment, f - fdg pet / ct scan done 6 weeks postchemotherapy showed complete resolution of left lung upper lobe mass [figure 2 ]. a 26-year - old male patient presented with a history of mild chest pain and fever for last 1 year. whole body fluorine fluoro - deoxy - glucose positron emission tomography - computed tomography baseline scan obtained for initial staging : coronal and transaxial sections of computed tomography (a and d) showing left lung upper lobe mass with no extrapulmonary involvement. coronal and transaxial sections of positron emission tomography (b and e, arrow) and positron emission tomography - computed tomography (c and f, arrow) shows left lung upper lobe mass with increased fluoro - deoxy - glucose uptake. the distribution of fluoro - deoxy - glucose in the rest of the body is within normal limits. the findings are suggestive of metabolically active disease involving left lung upper lobe whole body fluorine fluoro - deoxy - glucose positron emission tomography - computed tomography follow - up posttherapy scan obtained for evaluation of treatment response : coronal and axial sections of computed tomography (a and d), positron emission tomography (b and e), and positron emission tomography - computed tomography (c and f) showing no abnormal mass or tracer uptake noted in the left lung. the distribution of fluoro - deoxy - glucose in the entire body is within normal limits. the findings are suggestive of complete resolution of metabolically active disease involving left lung upper lobe seen in baseline whole body positron emission tomography - computed tomography a 60-year - old female patient presented with a history of dry cough and easy fatigability for last 8 months. f - fdg pet / ct performed for initial staging to know the extent of the disease showed increased fdg uptake (suvmax - 6.4) in the right lung middle lobe mass measuring 8.3 cm 6.8 cm 6.7 cm with no extrapulmonary involvement [figure 3 ]. biopsy was done from right lung mass which showed diffuse large b - cell lymphoma. patient was advised for chemotherapy. a 60-year - old female patient presented with a history of dry cough and easy fatigability for last 8 months. whole body fluorine fluoro - deoxy - glucose positron emission tomography - computed tomography scan obtained for staging : transaxial computed tomography (a) showing right lung middle lobe mass with increased tracer uptake in positron emission tomography (b, arrow) and positron emission tomography - computed tomography (c, arrow) images. maximum intensity projection (d, arrow) image shows fluoro - deoxy - glucose avid right lung middle lobe mass with no extrapulmonary involvement. a 26-year - old male patient presented to our department for the initial staging of nhl. since pulmonary tuberculosis is highly prevalent in this part of the world, based on clinical and radiological investigations, he was put on antitubercular treatment (att). there was no clinical and or radiological improvement noted with 6 months of att treatment. contrast - enhanced computed tomography (cect) of the chest showed left lung upper lobe mass. ct guided fine needle aspiration cytology (fnac) did not reveal any definite diagnosis, but findings were suspicious for malignancy. based on fnac finding, open chest thoracotomy biopsy was done which confirmed the diagnosis of diffuse large b - cell lymphoma. fluorine fluoro - deoxy - glucose (f - fdg) pet - ct performed to know the extent of the disease demonstrated increased fdg uptake (suvmax- 10.7) in the left lung upper lobe mass measuring 5.5 cm 6.5 cm 7.0 cm with no extrapulmonary involvement [figure 1 ]. patient received 6 cycles of (rituximab, cyclophosphamide, cyclophosphamide, doxorubicin, vincristine, and prednisolone) chemotherapy. a follow - up posttreatment, f - fdg pet / ct scan done 6 weeks postchemotherapy showed complete resolution of left lung upper lobe mass [figure 2 ]. a 26-year - old male patient presented with a history of mild chest pain and fever for last 1 year. whole body fluorine fluoro - deoxy - glucose positron emission tomography - computed tomography baseline scan obtained for initial staging : coronal and transaxial sections of computed tomography (a and d) showing left lung upper lobe mass with no extrapulmonary involvement. coronal and transaxial sections of positron emission tomography (b and e, arrow) and positron emission tomography - computed tomography (c and f, arrow) shows left lung upper lobe mass with increased fluoro - deoxy - glucose uptake. the distribution of fluoro - deoxy - glucose in the rest of the body is within normal limits. the findings are suggestive of metabolically active disease involving left lung upper lobe whole body fluorine fluoro - deoxy - glucose positron emission tomography - computed tomography follow - up posttherapy scan obtained for evaluation of treatment response : coronal and axial sections of computed tomography (a and d), positron emission tomography (b and e), and positron emission tomography - computed tomography (c and f) showing no abnormal mass or tracer uptake noted in the left lung. the distribution of fluoro - deoxy - glucose in the entire body is within normal limits. the findings are suggestive of complete resolution of metabolically active disease involving left lung upper lobe seen in baseline whole body positron emission tomography - computed tomography a 60-year - old female patient presented with a history of dry cough and easy fatigability for last 8 months. f - fdg pet / ct performed for initial staging to know the extent of the disease showed increased fdg uptake (suvmax - 6.4) in the right lung middle lobe mass measuring 8.3 cm 6.8 cm 6.7 cm with no extrapulmonary involvement [figure 3 ]. biopsy was done from right lung mass which showed diffuse large b - cell lymphoma. patient was advised for chemotherapy. a 60-year - old female patient presented with a history of dry cough and easy fatigability for last 8 months. whole body fluorine fluoro - deoxy - glucose positron emission tomography - computed tomography scan obtained for staging : transaxial computed tomography (a) showing right lung middle lobe mass with increased tracer uptake in positron emission tomography (b, arrow) and positron emission tomography - computed tomography (c, arrow) images. maximum intensity projection (d, arrow) image shows fluoro - deoxy - glucose avid right lung middle lobe mass with no extrapulmonary involvement. extranodal forms of lymphoma though common and represent 2450% of cases of nhl, but primary extranodal lymphomas comprise only 35% of all lymphomas and are mostly reported in the stomach and gastrointestinal tract. secondary involvement of the lung in patients with a history of lymphoma is much more frequent and has an incidence of 2540%. ppl defines as lymphoid proliferation affecting a single lung or both and that has not spread outside the lungs with no detectable extrapulmonary involvement at the time of diagnosis or does not spread in the following 3 months. world health organization 's classification system has divided ppl into b - cell primary pulmonary nhl and lymphomatoid granulomatosis. the first group subdivides into low - grade b - cell ppls (5887%), high - grade b - cell ppls (1119%), primary pulmonary plasmacytoma, and intravascular pulmonary lymphomas. ninety percent of low - grade b - cell ppls are composed of marginal zone b - cell lymphoma of mucosa - associated lymphoid tissue type (malt lymphoma) or bronchus - associated lymphoid tissue (balt). their development depends on malt of the bronchus that is thought to be acquired as a result of chronic antigenic stimulation such as smoking, autoimmune disease (systemic lupus erythematosus, multiple sclerosis, hashimoto 's thyroiditis, and particularly gougerot - sjgren 's syndrome), or infection. ppl usually pursue indolent courses, remaining localized to the lung for long periods before dissemination. treatment options are various, ranging from close observation to radiation, surgery, or combination chemotherapy. in a retrospective study of 24 patients, who were treated with a variety of modalities such as observation, surgery, and single or combination chemotherapy, the overall survival rate at 3 years was 86% with a median follow - up of 32-months. aggressive ppl is less frequently detected and may arise from the transformation of an indolent lymphoma or occurs in individuals with an underlying disorder such as acquired immunodeficiency syndrome. these patients generally require aggressive treatment with combination chemotherapy and prognosis seems to be worse than for low - grade malt lymphoma. in immunodeficient patients with high - grade ppl, the median survival is 4 months. therefore, it is very important to find out as soon as possible, if particular therapy is effective or not in these patients. hence, that expensive, ineffective, and toxic chemotherapy can be discontinued, and more aggressive and effective therapy can be initiated as early as possible. radiological imaging techniques commonly used for evaluation of treatment response is chest radiography, ct, and magnetic resonance imaging (mri). currently, ct is the most commonly used technique for staging and evaluation of treatment response, owing to the short examination time and its wide availability. according to revised response evaluation criteria in solid tumors criteria, a decrease in 30% the size of a tumor after completion of treatment as compared with the pretreatment scan is considered as a response. though ct / mri is widely accepted for evaluation of treatment response in clinical practice these anatomical modalities can not differentiate viable residual tissue from scar after the completion of treatment. approximately, two - thirds of patients with hodgkin 's disease and half of patients with high - grade nhl present with fibrotic or recurrent mass lesions in the location of a previous tumor manifestation, but only one - quarter of these patients ultimately relapse. f - fdg pet is a functional modality targeting glucose metabolism, which is markedly increased in most malignant tumors including lymphomas. f - fdg pet / ct can assess treatment response during (after one or two cycles) or after completion of therapy as changes in glucose metabolism are much earlier than structural changes. recently, pet has been combined with ct, permitting combined anatomical and functional imaging information in one setting. f - fdg pet is a well - established new modality in the evaluation of nodal and extranodal nhl. few reports have been described in the past regarding the role of f - fdg pet / ct in patients with ppl. most of them represent isolated case reports and two articles concentrates on a small group of patients [table 1 ]. ppl can be rarely presented as multiple cavitating pulmonary nodules ; however, cavitation has been reported more frequently in the setting of hiv infection. in a report by madan., author showed intense fdg uptake in bilateral cavitary pulmonary nodules which histopathologically diagnosed as primary pulmonary diffuse large b - cell lymphoma. hence, pulmonary involvement by lymphoma should be considered in the differential diagnosis of multiple cavitating pulmonary nodules.. showed differences in radiological features between primary (ppl) and secondary pulmonary lymphoma (spl). radiologically, ppl were mainly manifested with lung masses, while those of spl were mainly pleural involvement and mediastinal and hilar lymph node enlargement. pet / ct study may be helpful for the initial diagnosis and staging of pulmonary lymphoma ; however, misdiagnosis rate of pulmonary lymphoma was high, and diagnosis must rely on lung tissue biopsy and immunohistochemistry. chen. reported a rare case of primary intravascular large b - cell lymphoma which manifests as diffuse ground glass shadow, or nodular consolidations in the lung. fdg pet / ct is an important and significant diagnostic modality in its early diagnosis. primary endobronchial marginal zone b - cell lymphoma also called balt presented as solitary intraluminal nodule which shows homogeneous and mild fdg uptake on pet. yoon. studied in seven patients with primary endobronchial marginal zone b - cell lymphoma, in which six patients showed nodular lesion in trachea or bronchus, and one patient with diffuse wall thickening of distal trachea. on f - fdg pet / ct (n = 5), four lesions showed homogeneous uptake with maximum standardized uptake values (suvmax), ranging 2.35.7 (mean suvmax : 3.3) and one lesion showed no significant hypermetabolic activity. studied response assessment with fdg pet / ct in a rare case of marginal zone b - cell nhl in a patient with sjogren 's syndrome. fdg pet has been shown to be considerably more accurate than anatomical imaging in response assessment because of its ability to distinguish between viable tumor and nonviable posttreatment findings and can identify individuals with treatment resistance to certain forms of chemotherapy, early in the course which provides the clinician, a sufficient time window to change the therapeutic strategy. shin. reported a rare case of primary pulmonary peripheral t - cell lymphoma. on pet / ct study, it was presented with multiple hypermetabolic masses with photopenic defects in correlates well with central necrosis on ct in both lungs which showed progression despite that the patient had undergone chemotherapy. tumor necrosis is uncommon finding in lymphoma ; however, it generally correlates with hypoxia and is a predictor of a poor prognosis for patients with malignant tumor. cases of primary pulmonary lymphoma reported in the literature using positron emission tomography - computed tomography in the first case, patient presented with diffuse large b - cell lymphoma and disease activity was seen localized to lungs on baseline pet / ct scan. follow - up posttherapy pet / ct scan findings were consistent with clinical and radiological response with no fdg uptake. in the second case, pet / ct was done for initial staging and to know extent of disease, which showed disease localized to lung with no extrapulmonary involvement. in conclusion, we feel pet / ct is a good modality in the management (initial staging and evaluation of therapy response) in patients with ppl, especially with dlbcl type. | primary pulmonary lymphoma (ppl) is an uncommon entity of non - hodgkin lymphoma, which accounts for < 1% of all cases of lymphoma. we present two rare cases of ppl of diffuse large b - cell lymphoma, which underwent 18fluorine fluoro - deoxy - glucose positron emission tomography - computed tomography for initial staging and response evaluation after chemotherapy. |
heavy metals pollution in water, soils, and sediment is increasingly serious in china along with the rapid industrialization and urbanization [1, 2 ]. heavy metals as a type of persistent toxic pollutants are unbiodegradable in the environment. thus, the residual heavy metals in environment are threatening human health and ecosecurity [4, 5 ]. the main sources of heavy metals in the water are atmospheric precipitation, discharge of industrial wastewater and urban sewage, mineral mining, and infusion of surface runoff [6, 7 ]. heavy metals are insoluble in the receiving water, and the majority of them are transformed from the aqueous phase to the solid phase and finally deposit in the sediment. due to this process, the contents of heavy metals in sediments were higher than those in aqueous phase ; hence, that can be regarded as the accumulation library of heavy metals. however, the heavy metals in the sediments can be released into the environment again, causing secondary pollution of the water and chronically damaging the ecoenvironment [13, 14 ]. the heavy metals as nondegradable toxic substances in the water can be enriched via food chains from low- to high - level organisms. such enrichment leads to direct or indirect accumulation of heavy metals in human body, causing chronic poisoning and threatening human health or even life [5, 17, 18 ]. the rapid economic development in northeast china has led to the quick increase of urban water demand and the expanding discharge of industrial wastewater and sewage, polluting the water system there severely. this paper aims to investigate the heavy metal pollution in groundwater and the sediments, and the spatial distribution characterization of the heavy metals in water system. the risks of heavy metal pollution in groundwater and the degrees and potential ecological risks of heavy metal pollution in sediments were assessed. the migration scope of as in water system was predicted by using the groundwater modeling system (gms). the study area was dominated by croplands along the river, and the elevation (mean 4550 m) generally declined from northeast to southwest. totally 33 groundwater sampling sites were distributed along the water flow direction of the river. totally 12 sampling sites of sediment were distributed from 12310 to 12328e, with reference to the sampling sites of groundwater. cr, as, cd, and pb were selected as monitoring factors based on the historical research data of environment pollution in the study area as well as the tasks of this study. samples of sediments were dried in an oven at 105c for 24 h and the samples were microwave digested with nitric acid, hydrochloric acid, hydrofluoric acid, and hydrogen peroxide before determination, as described in a previous study. the contents of heavy metals (cr(vi), as, cd, and pb) in groundwater samples and in sediment samples digested were measured using an inductively coupled plasma mass spectrometer (icp - ms). analytical quality control included analysis of reagent blank, sample blank, reference material, and three parallel samples. the content distributions of cr(vi), as, cd, and pb in groundwater were plotted in figure 2 using arcgis according to the test results. cr(vi), as, cd, and pb pollution in groundwater was assessed on basis of chinese national quality standard for groundwater (gb / t 14848 - 93). clearly, the as, cr(vi), and cd contents in groundwater did not exceed the thresholds in sanitary standard for drinking water (gb 5749 - 2006), and the contents of heavy metals in most sites met class i in gb / t 14848 - 93 (figure 2). however, the pb contents in some sampling sites exceeded the thresholds in the above two standards. two kinds of risk assessment models of heavy metal pollution degree were used to evaluate the heavy metal pollution in the groundwater in the study area. single - factor pollution index (i) is used to assess how a single heavy metal pollutes groundwater at a sampling site:(1)ii = cisi, where c i is the measured content of pollutant i in surface water (ml) and s i is the evaluation standard of pollutant i in surface water (ml). when i i is > 1, the content of that heavy metal exceeds the standard. the results of single - factor pollution index of heavy metals in groundwater in the study areas are showed in figure 3 using the class ii standards in gb / t 14848 - 93. the is of cd at sites 10 and 17 were > 1, indicating cd contents exceeded the standard. the is of cr(vi) and as did not exceed 1, indicating the contents of these two heavy metals met the class ii standards in gb / t 14848 - 93. nemerow pollution index (ni) is used to assess how several heavy metals pollute groundwater at a sampling site. this index considers the mean and maximum values of single - factor pollution index and highlights the pollutants with high pollution degrees. it is expressed as (2)ni=1/nci / si2+maxci / si221/2,where n is the number of indices ; c i is the measured content of heavy metal i ; s i is the standard value. the heavy metal pollution in groundwater the pollution degree and pollution level of heavy metals in groundwater were assessed with ni. the heavy metal pollution was evaluated using class ii standard in gb / t 14848 - 93. the nis of heavy metals in groundwater in the study area are showed in figure 4. the ni at site 28 exceeded the standard ; the nis at sites 10, 17, and 18 were at warming level. the solute transport of as was simulated by using gms with the above models and the results, under the natural state without adding any external factors such as anthropogenic impact. the forms and distribution of pollution halo were characterized and the contents of specific pollutants in groundwater were predicted. the solute transport was simulated by using the measured as contents as initial conditions without considering other pollution sources. the simulated as transport at different time periods in the study area is illustrated in figure 5. the distribution area of as at different concentration ranges in different years was calculated by using the arcgis software. the simulated results showed that the as polluted area was 286.28 km in the west of the study area and 98.36 km in the east of the study area at the moment, which indicated the main polluted area was in the downstream of the hun river. g / l in the west polluted area with 1.02 km ; the as content in the second district was 3.5 g / l with 2.28 km, followed by the as content being 2.25 g / l with 23.41 km, 1.5 g / l with 38.91 km, and 1.0 g / l with 286.28 km, respectively. the contents and the areas after as transfer in different years were showed in table 2. the results showed that the polluted areas were decreased gradually for the 10-year transfer in low content districts and decreased gradually for first 5-year transfer and increased gradually for last 5-year transfer in high content districts. after 10 years of transfer, the as polluted areas were 2.25 km with 4.25 g / l, 12.63 km with 3.5 g / l, 24.22 km with 2.25 g / l, 36.13 km with 1.5 g / l, and 119.30 km with 1.0 the reason why the as polluted areas were increased in high content districts because these were some pump wells downstream, which pumped about 2000 m / d each well and made the solute transfer upstream because of the funnels formed. into the severely polluted areas, a continuous pollution source with constant pollution concentration was added and the solute transfer was simulated. the simulated results were showed in figure 6. with the addition of a pollution source, the simulated results showed that as transfer areas did not change largely from those under the initial conditions ; the as polluted area was 286.28 km in the west of the study area at the moment. the highest as content in the center was 4.25 g / l in the west polluted area with 3.82 km, 3.5 g / l with 4.63 km, 2.25 g / l with 24.88 km, 1.5 g / l with 42.04 km, and 1.0 g / l with 295.09, respectively. the contents and the areas after as transfer in different years were showed in table 3. the results showed that the changing trend of polluted areas was almost the same with those as initial conditions. however, the highest as content area was not changed almost because of the addition of a pollution source. after 10 years of transfer, the as polluted areas were 3.23 km with 4.25 g / l, 14.24 km with 3.5 g / l, 27.31 km with 2.25 g / l, 35.94 km with 1.5 g / l, and 135.80 km with 1.0 the contents of heavy metals in sediment reflect the degree of heavy metal pollution in the water. to clarify the sources of heavy metals in groundwater, we also collected sediment at varying depth. the contents of cr(vi), as, cd, and pb were measured using icp - ms. the results are showed in table 4. clearly, cr pollution was the most severe in sediment of hun river, and the cr contents in most samples exceeded the background value, followed by pb. cd content only at site n21 - 2 exceeded the background value, and no as content exceeded the background value. single - factor pollution index c f is expressed as follows:(3)cfi = cdicri, where c d is the measured heavy metal content in sediment and c r is the background content of a heavy metal (table 4). c f > 1 indicates pollution of a heavy metal, and c f < 1 indicates a clean compound pollution index (cpi) was used to assess the heavy metal pollution in sediment, which is expressed as follows : (4)cpi=i=1mcfim, where c f is a single - factor index of a heavy metal and m is the number of heavy metal types. cpi < 1 indicates no heavy metal pollution in sediment ; cpi 1 indicates heavy metal pollution. the pollution levels of the heavy metal were clarified in table 6. based on these results, we can see that cr pollution was the most severe in the river sediment, and the cr contents in most sampling sites exceeded the background value, followed by pb (tables 5 - 6). cd content only at site n21 - 2 exceeded the background value, and no as content exceeded the background value. n21 - 2, and s20 - 1 were at comprehensive pollution, and in particular, the cpi of n21 - 2 was 2.1716. the potential ecological risk index of a heavy metal, e r, is expressed as follows : (5)eri = tricfi, where t r is the toxicity response coefficient of that heavy metal and reflects the toxicity of the heavy metal and the water body 's sensitivity to the heavy metal pollution ; c f is the coefficient of pollution. the potential ecological risk index of multiple heavy metal (ri) is expressed as follows : (6)ri=i=1meri. the ecological risk of the study area was assessed using the classification of all potential ecological risk indices (table 7). clearly, e r of four heavy metals was < 40, indicating the four heavy metals were at low potential ecological risks. the major states of heavy metals include weak acid - extractable form, reducible form, oxidizable form, and residual form. we analyzed the forms of heavy metals at the severely polluted sites (n19 - 2, s20 - 1, n21 - 1, and n21 - 2) according to soil and sediment sequential extraction procedure of speciation of 13 trace elements (gb / t25282 - 2010). the results are showed in table 8. clearly, the proportions of bioavailability forms of cd were all the highest among the four metals at four sites, especially the weak acid - extractable form. the forms indicate that cd is most soluble in rivers and its migration features facilitate its migration via the water into groundwater, which is basically consistent with the heavy metal pollution situations in groundwater described in section 3.1. then pb was mainly in the reducible form, indicating that pb can be easily released into the environment to pollute the water. therefore, we deduce that the release of heavy metals from sediment is a major pollution source of heavy metals in groundwater. (1) the comprehensive pollution at groundwater site 28 reached the pollution level, sites 10, 17, and 18 reached warning level, and other sites were all clean. the changes and migration scope of as content indicate that as migrated downstream to hun river in recent 10 years ; the polluted areas were decreased gradually in low content districts and decreased gradually first and increased gradually later in high content districts because these were some pump wells downstream to form groundwater depression cone, which made the solute transfer upstream. (2) both the cr(vi) and pb contents in most sediment samples exceeded the national background values. the potential ecological risk of cd was very high at site n21 - 2, but not at other sites. (3) through the morphological analysis of heavy metals at four sites where the contents were the highest, the proportions of biodegradable form of cd were all the highest among the four metals at four sites, secondly was the weak acid - extractable, which all indicated cd could be easily released into the water and polluted the groundwater due to the migration. pb was mainly in the reduction form, indicating that pb also can be released into the environment and pollute the water. therefore, we deduce that the release from sediment is a major source of heavy metal pollution in groundwater. | the areas with typical municipal sewage discharge river and irrigation water function were selected as study sites in northeast china. the samples from groundwater and river sediment in this area were collected for the concentrations and forms of heavy metals (cr(vi), cd, as, and pb) analysis. the risk assessment of heavy metal pollution was conducted based on single - factor pollution index (i) and nemerow pollution index (ni). the results showed that only one groundwater sampling site reached a polluted level of heavy metals. there was a high potential ecological risk of cd on the n21 - 2 sampling site in river sediment. the morphological analysis results of heavy metals in sediment showed that the release of heavy metals can be inferred as one of the main pollution sources of groundwater. in addition, the changes in the concentration and migration scope of as were predicted by using the groundwater modeling system (gms). the predicted results showed that as will migrate downstream in the next decade, and the changing trend of as polluted areas was changed with as content districts because of some pump wells downstream to form groundwater depression cone, which made the solute transfer upstream. |
the overall decline in caries prevalence and improved understanding of the pathology of the caries process [14 ] have led to a change in treatment approach. the importance of early detection and preventive intervention before the development of irreversible damage is now generally accepted. however, for such a treatment approach to function in general dental practice, the dentist needs access to methods which allow not only detection of early lesions but also monitoring of the effect of interventions, that is, to observe progression, arrest, or regression of such lesions over time. there is therefore a need for more reliable and accurate detection methods than traditional visual inspection and tactile examination. the method has shown quite high sensitivity for detection of dentin caries on approximal surfaces, but is of limited value for detecting early lesions in enamel [6, 7 ]. though the method is widely used in clinical practice, exposure of patients to ionizing radiation is a matter of concern. in the current context of low caries prevalence and slow progression of new lesions, it is suggested that radiographs are no longer routinely required for all patients : adequate selection criteria should be applied to determine when radiographs are indicated [8, 9 ]. this approach, however, precludes frequent monitoring of early lesions and response to preventive measures. to meet the need for more accurate and noninvasive detection methods one such instrument is digital imaging fiber optic transillumination (difoti), a refinement of its predecessor, fiber - optic transillumination (foti), based on transillumination of teeth with intense fiber - optic light. the optical properties of a caries lesion are different from those of the surrounding sound dental tissues, and foti amplifies the change in scattering and absorption of light photons in the carious tissue thereby making the caries lesion appear as a dark shadow. the method has been applied as an aid to visual examination but yields qualitative information that is nonreproducible and needs subjective interpretation. the major advantage of the method is that it is noninvasive and can therefore be as frequently used as needed. the difoti system was designed to overcome the limitations of foti by providing digital image capture. such images can be stored in digitized form and compared with previously acquired images. the method has been applied in a few in vitro studies, with somewhat contradictory results. schneiderman. (1997) reported that compared to conventional film radiography, difoti had greater sensitivity for detection of approximal, occlusal, and smooth - surface caries lesions. however, young and featherstone reported that difoti was more sensitive than film radiography to initial surface changes, but failed to yield accurate quantitative information. to date, the only clinical study on diagnostic accuracy of difoti concluded that the method could increase sensitivity when used in conjunction with digital or film radiography. the purpose of diagnostic accuracy / efficacy studies is to determine how closely the results of the method being tested agree with a reference standard, under controlled conditions. the selected reference standard should be the best available method to confirm the true condition. in in vitro caries the aim of this in vitro study was therefore to compare the diagnostic accuracy / efficacy of difoti and conventional digital and film radiography in detection of approximal caries at two different diagnostic thresholds, using histology and microradiography as standard references. as the biological material comprising the study sample could not be traced to an individual donor, the regional ethics committee in stockholm, sweden, determined that the study was not subject to the law of ethical approval (2006/3:4). the material comprised 56 premolar teeth, extracted on orthodontic indications and stored in thymol saturated saline. the approximal surfaces of the selected teeth presented a range of conditions, from sound to noncavitated and cavitated caries lesions. the teeth were rinsed in 10% sodium hypochlorite solution for 20 min, followed by rinsing in distilled water for 20 min. the teeth were then arranged in groups of 4 and mounted in plastic blocks, simulating the anatomic position in the dental arch. eight observers (, hd, jg, ms, lel, pn, seh, and st) participated in the study. they examined each set of images twice, with a minimal interval of one week between examinations, and scored on a scale of 04. all examiners were experienced in the use of radiographs for clinical caries detection and quantification but only three had a research background within the field of caries detection (, lel, and st). six observers had no previous experience of difoti (hd, jg, ms, lel, pn, and seh). all difoti images were captured by a trained operator () under standardized darkroom conditions. the difoti instrument (electro - optical sciences inc, ny) was used as recommended by the manufacturer. images were captured from three different sites : buccal, lingual, and occlusal, using both the occlusal and the approximal handpieces. microsoft powerpoint 2002 was then used to arrange the images so that all images for each surface appeared simultaneously. the images were viewed on a 15-inch hewlett packard (l1520) monitor. before the difoti examination the observation sessions were then conducted in the same manner as described later for the digital radiographs. findings were scored on a scale of 0 to 4 score 0 = no shadow, score 1 = shadow restricted to outer half of enamel, score 2 = shadow reaching inner half of enamel, score 3 = shadow reaching outer half of dentin, and score 4 = shadow reaching inner half of dentin. in order to ensure the quality of the radiographs, a pilot study had been undertaken to determine optimal exposure time, type of soft tissue equivalent, and projection geometry. following the pilot study, a special holder used in the present study was constructed. the holder arranged the components in the following order : the cone was placed at a distance of approximately 3 cm from the teeth and 5 cm from the film or the sensor. to simulate soft tissue, a 15-inch hewlett packard (l1520) monitor was used for viewing the digital radiographs and difoti images. the observers were instructed to adjust their sitting position so that the images being viewed were at eye level, at a distance of approximately 50 cm. the radiographs were evaluated according to a scale of 04 : score 0 = no visible radiolucency, score 1 = radiolucency visible in the outer half of the enamel, score 2 = radiolucency visible in the inner half of the enamel, score 3 = radiolucency visible in the outer half of the dentine, and score 4 = radiolucency visible in the inner half of the dentine. the radiographs were taken using planmeca intraoral radiographic equipment (planmeca, helsinki, finland) and kodak ektaspeed plus films, with settings of 70 kv and 7 ma and an exposure time of 0.25 s. the film radiographs were placed on a table with a light source, in a darkroom with no additional light sources, and examined using mathsson binoculars with 2-fold magnification. focus intraoral radiographic equipment, involving a sigma direct digital sensor and cliniview software (instrumentarium, tuusula, finland), was used. the settings were 60 kv and 7 ma, with an exposure time of 0.20 s. the images were manipulated in order to standardize brightness and contrast, using imagej software (imagej, u.s. the images were viewed using microsoft powerpoint 2002 under standardized conditions, as described above. after all examinations were completed, the teeth were removed from the blocks and divided buccolingually. all approximal surfaces were then sectioned, perpendicular to the enamel and the occlusal surfaces, into approximately 300 m thick sections at preselected sites, using a buehler isomet low speed precision saw (buehler, illinois, usa). for microradiography, the sections were then exposed to ni - filtered cu k radiation at 20 kv and 20 ma with an exposure time of 2 h, using kodak high speed holographic film so 253. after standardised development of the films, three operators (ana,, and st) examined both the microradiograms and the tooth sections independently under a stereomicroscope, at a magnification factor of 16. lesion depths were scored on a scale from 0 to 4 : 0 = no demineralization, 1 = demineralization extending to outer half of the enamel, 2 = demineralization extending to inner half of the enamel, 3 = demineralization extending to outer half of the dentin, and 4 = demineralization extending to the inner half of the dentin. this procedure for histological validation has been used at the institute of odontology, karolinska institutet, stockholm, sweden, for 20 years. one of the observers (st) has 10 years ' experience of the technique, and the other two observers (ana and) underwent a training session prior to the histological validation. on completion of validation, consensus was reached for histological and microradiogram observations, respectively, by adopting the most common score of all three observers for each surface. if all three disagreed, the score of the experienced examiner (st) was used. when comparing histological and microradiogram observations, the highest score for each surface was used as a reference standard (rs). the evaluation of the reference standard was carried out by calculating weighted kappa (w) agreement among the three observers. a mean w value for each method was calculated and minimum and maximum values specified. two cut - off levels, based on histology, were used for calculations of sensitivity, specificity, and auc : area under the receiver operating characteristic curve (roc). cut - off 1 represents the d1 threshold : enamel and dentin caries. cut - off 2 represents the d3 threshold : dentin caries. to compare diagnostic performance between methods, sensitivity, specificity, and auc values analyse - it (analyse - it software, ltd., leeds, uk) and statistica (statsoft scandinavia ab, sweden) were used for statistical analyses. the material comprised 112 approximal surfaces, of which 15 were irreparably damaged during preparation of the samples for histological validation. to assess the effect of this loss of material on the results, the most common score of all examiners and all methods was used. the surfaces were scored as follows : 10 as sound, 2 as enamel caries lesions and 3 as dentin caries lesions. due to the high proportion of sound surfaces in the damaged material it is assumed that loss of these observations would not have influenced the results, as all methods showed acceptable specificity at both thresholds. the reference standard comprised 35% score 0, 36% score 1, 14% score 2, 10% score 3, and 5% score 4 (figure 1). the w values for the histological validation were 0.89, 0.89, and 0.93 for each pair of examiners. figure 1 shows a comparison of the mean numbers for each detection score for each method and the distribution of the true score (rs). figure 2 presents roc curves for all methods at diagnostic threshold d1. in figure 3 the reproducibility of each method in the form of mean intra- and interexaminer agreement, based on the eight observers participating in the study, is shown in table 1. sensitivity, specificity, and auc for all examiners, for all methods, are presented in table 2. table 3 presents a comparison of the methods by wilcoxon matched pairs test. in table 4, figure 4 shows three sets of images, difoti and digital radiography, of surfaces with score 1, 2, and 3. thorough validation is an essential step in the development of new diagnostic methods and instruments for caries detection. initially, technical efficacy should be confirmed. diagnostic accuracy and efficacy in identifying lesions at different diagnostic thresholds the efficacy of a diagnostic method indicates how well the method works under controlled conditions. under such conditions efficacy should be high, because it can be assumed that in the clinical setting, lower effectiveness will be achieved. to date there are no published studies validating the diagnostic accuracy and efficacy of difoti in vitro at different diagnostic thresholds. hence the present in vitro study, testing diagnostic accuracy in terms of sensitivity, specificity, and auc, was undertaken as an important step in validating this instrument. the difoti method was compared to methods more familiar to most clinicians, film and digital radiographs. when viewing radiographs, examiner performance is determined by skill and experience, viewing conditions, and the material being examined. in the present study, viewing conditions were therefore standardized, and the material was selected in order to reflect the currently low prevalence of dentin caries observed in the population [2, 3 ]. the eight dentists who participated as observers in the study did, however, have different backgrounds and experience, and this probably influenced their performance [15, 16 ]. although a 15-minute training session on the difoti method was undertaken, it may be assumed that lack of familiarity with the method in combination with their experience and background may have influenced their interpretation of difoti images. this probably explains in part the great variance in interexaminer agreement for all methods, while intraexaminer agreement was in general much better. with respect to reproducibility of the three methods, however, it can be concluded that no pronounced differences emerged. when testing diagnostic accuracy and efficacy of a new method it is important to differentiate between the main and surrogate diagnostic endpoints. a main diagnostic endpoint influences treatment decisions, thereby differentiating between nonoperative treatment decisions and operative interventions. in an in vitro study treatment decisions are not only based on lesion depth and surface integrity, but also on lesion activity and diagnosis of the patient caries activity which is not available for in vitro material. the two endpoints tested in this study were therefore endpoints based on lesion depth and stand for the ability of the method to detect all caries lesions, even the early enamel lesion, d1, and the ability of the method to detect the more advanced form of the disease, lesion extending to dentin, d3. this should therefore be further tested under clinical conditions with better defined endpoints, thereby testing the instruments diagnostic thinking efficacy as well as therapeutic efficacy. detection of initial caries lesions is of high clinical relevance, as the presence of such lesions implies increased caries activity and the need for additional, noninvasive intervention intended to arrest or reverse lesion progression. in this context, the difoti method allows noninvasive capture of images which can be used as a reference between appointments and thereby used to monitor changes in lesion depth. at diagnostic threshold d1, the difoti method showed significantly better sensitivity than the other methods, but similar specificity (table 3). thus compared to radiography, the method seems to be able to identify lesions at an earlier stage, without increasing the number of sound surfaces incorrectly identified as carious. the diagnostic accuracy of the difoti method was further supported by significantly greater area under the roc curve than the radiographs (figure 2). these results are in accordance with earlier studies reporting low sensitivity of radiographs in detecting initial lesions. the difoti method has also been shown to be more sensitive than radiographs to early changes in enamel. the results of the present study therefore suggest that at the d1 threshold difoti images provide more accurate information than radiographs. at the d3 level, the differences in performance between difoti and radiography were less pronounced (figure 3). the differences in sensitivity were nonsignificant, but both types of radiograph showed better specificity than difoti ; that is, the number of lesions incorrectly identified as dentin lesions was higher for difoti than for radiography. in this context, however, it is of interest to note that as shown in table 2, six out of the eight examiners achieved good specificity with difoti. with respect to area under the roc curve, differences between methods were non - significant, suggesting similar diagnostic accuracy for all three methods at the d3 threshold. as shown in table 4, the difoti method showed best overall agreement with the reference standard : difoti observations by six out of eight examiners showed good to very good agreement. in contrast, for film and digital radiography observations, good agreement was achieved by only two of the eight examiners. thus the difoti method showed better correlation with actual lesion depth than the other methods. these results are in contrast to those of young and featherstone, reporting that difoti was inferior to radiographs in judging lesion depth. in that study, small artificial lesions were used to test the diagnostic accuracy of the method in contrast to our study where natural caries with great variance in lesion depth was examined, which might explain the difference to some extent. the instrument might be able to identify great change in lesion depth although small changes in the mineral content of the enamel lesion are not detectable. the results of the present study therefore suggest that difoti records lesion depth more accurately than radiography. it should, however, be borne in mind that the material involved a high proportion of enamel caries (figure 1) which can favor the difoti method. in conclusion, the results suggest that within the limitations of the study, the diagnostic accuracy / efficacy of difoti is superior to radiography at diagnostic threshold d1 and comparable to radiography at diagnostic threshold d3. lesion depths according to difoti show closer correlation with the reference standard than those recorded by film or digital radiography. these conclusions, drawn from an in vitro study, have certain limitations and should not be directly extrapolated to in vivo conditions. however, the promising results of the present study suggest that further investigation of the difoti method under clinical conditions is warranted. | the aim of the present study was to compare the diagnostic accuracy / efficacy of digital imaging fiber - optic transillumination (difoti) with film and digital radiography, in detection of approximal caries lesions. one hundred and twelve approximal surfaces were scored for caries, using difoti images film and digital radiographs. all three sets of images were examined twice by 8 observers, with a minimal interval of one week between examinations. validation of histological sections served as a reference standard. reproducibility, based on intra- and interobserver agreement, was similar for all three methods. at diagnostic threshold d1 (enamel and dentin caries), difoti showed significantly higher sensitivity, but differences in specificity between methods were nonsignificant. diagnostic accuracy in the form of area under the receiver operating characteristic curve (auc) was significantly higher for difoti. at diagnostic threshold d3 (dentin caries), the differences in sensitivity and auc among methods were nonsignificant, but difoti showed significantly lower specificity. compared with the radiographs, difoti showed closer agreement, expressed as weighted kappa values, with the reference standard. the results show that under in vitro conditions, the diagnostic accuracy of difoti in detecting early approximal enamel lesions is greater than that of film and digital radiography, while the potential for detecting lesions in dentin is similar for all three methods. |
an acute gastroenteritis outbreak occurred at an elementary school in norwalk, oh, usa. used immune electron microscopy and an infectious stool filtrate to observe the virus particles and identified them as small round - structured viruses. the nonbacterial pathogen was called the norwalk virus after the outbreak region and renamed the norovirus (nov) at the international congress of virology in paris in 2002. the nov is the species of the genus of norwalk - like viruses in the caliciviridae family. the nov consists of a positive - sense, single - strand rna (ssrna) genome sequence of approximately 7.5 kb with 3 open reading frames (orfs). the first open reading frame (orf1) contains approximately 5 kb of sequences, which may enable 195 kda polyproteins to support virus duplication. during the duplication phase, polyproteins are divided into at least 6 nonstructural proteins, such as p48, nucleotide triphosphatase (ntpase), p22, vpg, proteinase, and rna - dependent rna polymerase [46 ]. orf2 is approximately 1.8 kb long, which may transform into 60 kda major structural protein vp1 with the following functions : self - assembly and capsid formation, receptor recognition, host specificity, strain diversity, and immunogenicity. orf3 consists of 0.6 kb nucleotides, which may translate into a 20 kda minor structural protein (vp2), which facilitates the expression and stability of major structural protein vp1 [4, 8 ]. the nov structure is formed by 180 capsid protein monomers organized into 90 dimeric capsomers. each capsid protein consists of an n - terminal shell (s) domain and a c - terminal protrusion (p) domain. the s domain forms a contiguous 8-stranded beta - barrel shell of the capsid and is commonly found in the capsid proteins of other viral families. the arch - like structure extending from the shell is formed by the p domain, which can be composed of p1 and p2 subdomains. the p2 subdomain is the critical segment because of its location on the capsid surface and because it exhibits the most variable sequence. because traditional cell cultures can not replicate novs, the phylogenetic relationship is mainly investigated by using genome - sequencing techniques. based on the phylogenetic analysis of genome sequences, 5 genogroups exist : gi, gii, giii, giv, and gv. giii is found in cattle [11, 12 ], gv is found in mice, and human novs are divided into 2 major genogroups, gi and gii. the sequence search tool on the pfam website was used to collect approximately 30 nov gii genotype 4 sequences to find their corresponding pfam domains. the 7 main families are cacli_pp_n (pf08405), rna helicase (pf00910), peptidase_c37 (pf05416), rdrp_1 (pf00680), calici_coat (pf00915), calici_coat_c (pf08435), and rna_capsid (pf03035). because the p2 subdomain is associated with antigenicity by binding to histoblood group antigen receptors, the infection relationship may be hidden by the interactions of pfam domains extracted from nov sequences. this study attempts to distinguish the protein - protein interactions (ppis) from the domain - domain interactions (ddis) and to use the ppis to determine the biological regulation of novs. three main types of cloud computing services exist : infrastructure as a service (iaas), software as a service (saas), and platform as a service (paas). when managing many ppis, the distributed characteristic of cloud techniques enhances the efficiency of exploring the biological regulation caused by novs. this provides an opportunity to examine the relationship between hosts and novs and to investigate clinical applications and drug design. seven pfam domains were extracted from approximately 30 genome sequences from gii genotype 4 using the sequence search tool on the pfam website. four domains (pf08405, pf00910, pf05416, and pf00680) exist in orf1 (figure 1). two domains (pf00915 and pf08435) exist in orf2, and one domain (pf03035) exists in orf3. the domine database (version 2.0) was used to investigate interactions between domains, including known and predicted protein domain interactions. for each of the 7 nov domains, if a related ddi was found in domine, the interaction and interactive domains were recorded. the interactive domains and the 7 nov domains were grouped into a domain set of depth 1. the interactive domain set with interactions in the depth this method was used to collect domain sets of increasingly higher depth (figure 2). the number of domains and ddis increases as the depth increases. depth 2 has 17 times more domains and 27 times more interactions than depth 1. depth 3 has 10 times more domains and 24 times more interactions than depth 2. the number of domains and the number of interactions plateau gradually after depth 4. the set of ddis within each depth was used to locate corresponding proteins for each domain and to construct the putative ppi network. corresponding proteins were collected by either using the nov - related domains or by extending the domains within depth 1 to build a ppi network to identify similar metabolic pathways. for each domain from a certain depth, all related proteins were extracted from the uniprot knowledgebase (release 2011_07) a comprehensive database containing protein sequence and function information. proteins were grouped by the pfam domain (version 25.0) from the integrated source database, interpro (version 33.0). an attempt was made to find connections between proteins based on the ddis and to explore their accompanying protein functions. however, the protein interaction network was too complex to identify the proteins relevant to the novs. it would be beneficial to retain the most common ppis that have been verified by the expert curators of the molecular interaction database, mint. human proteins consisting of pfam domains were selected to investigate the interaction relationship because the nov uses people as hosts. to examine the ddi strength, the depth is defined as the distance of a domain from the previous domain. however, the number of domains associated with interactions increases by almost 17 times in depth 2. the number of domains and interactions only increase slightly in depth 4, meaning that the number of ddis reached a boundary value. four pfam domains (pf00910, pf00680, pf08435, and pf00915) were found in the interaction network of the 7 nov - related domains. the first 2 domains are from orf1, and the last 2 domains are from orf2. the 4 nov - related domains are shown in the top - right corner of figure 6. the complex interactions are caused by 2 undirected domains (pf00270 and pf00271), which are centers for undirected domains and connect several related domains. to show the complexity of the ppi network from each depth, ppi statistics and distinct proteins are listed in table 1. from depth 2 to depth 3, the number of ppis increases rapidly, and the number of proteins almost triples. of the 1061 proteins in depth 2, 107 proteins have higher links into other proteins, including atp - dependent rna helicase, dna annealing helicase and endonuclease, putative dna repair and recombination protein, and the transcription termination factor. the ppi network from depth 2 is shown in figure 7 to show the interaction complexity between proteins. the 3 circles in the figure do not represent the proteins directly related to the 7 nov domains and proteins in depths 1 and 2. it is possible that proteins closer to the center have more putative linkages with other proteins. high - throughput genome - sequencing technologies generate vast amounts of sequence data efficiently and economically. they play important roles in living organisms such as catalysis, signal transduction, and the transport of nutrients. this approach assumes that one type of domain combination represents a protein and that the interaction between proteins could be performed through ddis. although domains are smaller units than proteins, extending ppis from the domain level is feasible. this causes 2 main problems : the vast number of protein connections from ddis and the ability to examine available ppis for novs. cloud computing techniques are available to overcome these obstacles. applying biological knowledge to organism specificity and infection pathways would assist in comprehending novs. this may help researchers develop medical therapies for novs. domains are basic protein folding and evolution units ; therefore, investigating internal ddi relationships is valuable. for this study, we extracted nov - related domains from the pfam database to investigate the biological processes during nov infection phases. novs can cause acute gastroenteritis and foodborne illnesses, affecting lives and increasing health care costs. the regulation of ppis extending from domains may help identify the relationship between hosts and novs. | severe gastroenteritis and foodborne illness caused by noroviruses (novs) during the winter are a worldwide phenomenon. vulnerable populations including young children and elderly and immunocompromised people often require hospitalization and may die. however, no efficient vaccine for novs exists because of their variable genome sequences. this study investigates the infection processes in protein - protein interactions between hosts and novs. protein - protein interactions were collected from related pfam nov domains. the related pfam domains were accumulated incrementally from the protein domain interaction database. to examine the influence of domain intimacy, the 7 nov domains were grouped by depth. the number of domain - domain interactions increased exponentially as the depth increased. many protein - protein interactions were relevant ; therefore, cloud techniques were used to analyze data because of their computational capacity. the infection relationship between hosts and novs should be used in clinical applications and drug design. |
amyotrophic lateral sclerosis (als), characterized by progressive muscle wasting and weakness, is a progressive, fatal neurodegenerative disorder characterized by the preferential loss of motoneurons. the precise pathogenic mechanisms on motoneuron death need to be clearly elucidated, although several theories, including oxidative stress, glutamate toxicity, calcium - mediated toxicity, neurotrophic factor withdrawal, genetic defects, immune - inflammation, and accumulation of abnormal proteins, have been proposed as pathogenic mechanisms of familial / sporadic als [18 ]. however, recent discoveries of copper - zinc superoxide dismutase (sod1) mutant genes, which cause familial als, have significantly contributed to the current understanding of the pathogenic mechanisms of als [1, 48 ]. glycogen synthase kinase-3 (gsk-3), originally identified as a regulator of glycogen synthesis, is now known to be a multifaceted enzyme affecting a diverse range of biological functions from gene expression to cellular architecture and apoptosis. two closely related isoforms of gsk-3, gsk-3, and gsk-3, exist in mammals. moreover, the role of gsk-3 has been identified as one of the important enzymes regulating pathogenic mechanisms of alzheimer 's disease (ad) and parkinson 's disease (pd). the abnormal increase in the level and activity of gsk-3 has been associated with neuronal death, paired helical filament tau formation, and neurite retraction in ad and in gsk-3 mediated 6-hydroxydopamine - induced neuronal death in in vitro and in vivo models of pd [1214 ]. recently, it has been reported that the role of gsk-3 is important in the pathogenic mechanisms of als. for example, gsk-3 is increased in the thoracic spinal cord tissue of patients with sporadic als and in motoneurons transfected with g93a or the a4v mutant hsod1 gene [13, 15 ]. in this review, we will focus our discussion on the following topics : (1) a description of gsk-3, (2) the role of gsk-3 in neuronal cell death, (3) the role of gsk-3 in als, and (4) the development of new gsk-3 inhibitors. gsk-3 is a serine / threonine protein kinase and a key enzyme involved in glycogen metabolism. activated gsk-3 phosphorylates and inactivates glycogen synthase, converting glucose to glycogen. in mammals, gsk-3 and gsk-3 are constitutively active and usually phosphorylate substrates that are prephosphorylated. especially focused on gsk-3, many studies have shown that gsk-3 is activated by phosphorylation of the tyrosine 216 residue (tyr216) located in the kinase domain and inactivated by phosphorylation of the amino - terminal serine 9 residue (ser9) and that gsk-3 participates in a variety of cellular processes, including the insulin and wnt / wingless signaling pathways, and in the regulation of metabolic, structural, and signaling protein functions, such as activator protein-1, cyclic amp response element binding protein, the nuclear factor of activated t cells, heat shock factor-1, and -catenin [10, 1620 ]. gsk-3 is also known to directly affect the ccaat / enhancer binding protein, myc ; the heat shock transcription factor-1 (hstf-1), tau ; nuclear factor b (nfb) ; p53 ; caspase-3 ; the release of cytochrome c [1520 ]. specifically, insulin enhances the activation of phosphatidylinositol 3-kinase (pi3k), which in turn increases the expression of antiapoptotic proteins and inhibits the activity of proapoptotic proteins. phosphorylated akt (pakt) subsequently phosphorylates and inhibits gsk-3. when excessive stress occurs, however, cell death is induced and activates the phosphatase and tensin homolog (pten), a 3-phosphatase that converts pi(3,4)p2 to pi(4)p and pi(3,4,5)p3 to pi(4,5)p2, in cells, and activated pten then inactivates pi3k via the suppression of pi(3,4,5)p3. inactivated pi3k can not phosphorylate akt, and the decrease in pakt reduces phosphorylation of gsk-3, all of which causes an increase in the active form of gsk-3 [1520 ]. activated gsk-3 inhibits hstf-1, resulting in the mitochondrial death pathway and the release of cytochrome c from mitochondria. finally, released cytochrome c induces apoptosis by activating caspase-9 and caspase-3 [2123 ]. gsk-3 is also involved in the wnt signaling pathway, which also inhibits gsk-3 activity and the phosphorylation and degradation of substrates by gsk-3 [24, 25 ]. regarding gsk-3 localization, gsk-3 has traditionally been classified as a predominantly cytosolic enzyme ; however, it was recently shown that smaller but much more active pools of gsk-3 are present in the nucleus and mitochondria. as described above, there are two isoforms of gsk-3 in mammals, gsk-3 and gsk-3. gsk-3 is more prominent in the nervous system and has been reported to play an important role in neuronal cell death [15, 19, 27 ], although it has recently been proposed that gsk-3 also plays a role in this process. gsk-3 has been identified as one of the principal enzymes involved in the pathogenic mechanisms of neurodegenerative disorders and ischemic stroke. there are numerous studies showing that abnormal increases in the level and activity of gsk-3 induce neuronal cell death paired helical filament tau formation, and neurite retraction in alzheimer 's disease (ad). in particular, it is commonly accepted that amyloid beta protein activates gsk-3, and activated gsk-3 mediates phosphorylation of tau protein, induces neuronal cell death, and disrupts axonal transport through an nmda receptor - dependent mechanism. -synuclein protein deposition into lewy bodies is a pathologic marker of pd, and -synuclein induces neurotoxicity. it has been reported that -synuclein activates gsk-3, enabling the hyperphosphorylation of tau proteins ; however, the precise mechanism by which -synuclein contributes to the activation of gsk-3 remains to be elucidated. in stroke, gsk-3 has been reported to be involved in neuronal cell death, whereas treatment with gsk-3 inhibitors in the acute state reduces infarction volume and improves neurobehavioral function [31, 32 ]. in the chronic state, gsk-3 inhibitors promote neurovascular remodeling after stroke and improve postischemic stroke sequelae [33, 34 ]. recent studies have reported that an abnormal increase in gsk-3 is found in in vitro and in vivo models of als, in the thoracic spinal cord tissue of patients with sporadic als, and in the frontal and temporal cortices of als patients. moreover, its suppression attenuates disease progression in an als mouse model [3537 ]. specifically, hu. reported that protein kinases, such as gsk-3, are increased in the thoracic spinal cord tissue of patients with sporadic als. yang. reported that the expression of gsk-3 and phospho - beta - catenin, which reflects the activity of gsk-3, was increased in als patients compared to that of controls and that gsk-3 immunoreactive neurons were mainly located in layer ii and layer iii of the frontal cortex and in layer ii of the hippocampus. in our previous findings, both gsk-3 expression and activity were increased in motor neurons transfected with the g93a, or a4v mutant hsod1 genes and in motor neurons transfected with the g93a or a4v mutant hsod1 genes [15, 38 ]. taken together, these findings support the potential role for gsk-3 as a therapeutic target in als. there have been many studies showing that gsk-3 inhibition can suppress disease progression of als in both in vitro and in vivo models. we have reported that gsk-3 inhibition, using a specific inhibitor or using materials with gsk-3 inhibitory effects, reduced motor neuronal cell death in motor neurons transfected with the g93a or a4v mutant hsod1 genes in an in vitro model of als [15, 39 ]. recently, calder. also reported that lithium, a gsk-3 inhibitor, prevents the excitotoxic cell death of motor neurons. our group also reported that disease onset, disease progression, and survival in als mouse models were prolonged by the treatments of specific inhibitors of gsk-3 or materials with gsk-3 inhibitor effects. the protective mechanisms of gsk-3 inhibition in in vitro and in vivo models of als are as follows. gsk-3 inhibition decreases motoneuronal cell death by restoring survival - related signals, such as hstf-1 ; by reducing death - related signals, such as cytochrome c, thereby reflecting mitochondrial injury, activated caspase-3, and cleaved forms of poly (adp - ribose) polymerase ; by decreasing inflammation - related signals such as cyclooxygenase-2 and intercellular adhesion molecule 2. based on previous reports, including studies from our laboratory, we hypothesize that the disturbance of signaling proteins upstream of gsk-3, which control the activity or the expression of gsk-3, might cause overactivation or overexpression of gsk-3. for example, a decrease in or the abnormality of proteins involved in the pi3k pathway, such as pi3k and akt, might be associated with overactivation of gsk-3 in als, considering the many reports showing that a specific pi3k activator or materials with a pi3k - activating effect modify gsk-3 activity and reduce motoneuronal cell death [4146 ]. there was, however, a report showing that changes in the pi3k / akt survival pathway were not found in spinal cord motor neurons in a mouse model of familial als. clear answers to these issues should be elucidated in future studies and could be helpful for the development of new and effective therapeutic strategies for als. considering that gsk-3 is overactivated in als and that it plays an important role in motoneuronal cell death, the development of new gsk-3 inhibitors might be helpful in the treatment of als, so there are many new gsk-3 inhibitors under development (table 1). in the development of new gsk-3 inhibitors, it should be considered that overinhibition of gsk-3 activity can conversely cause neuronal cell death because of gsk-3 's role in a variety of cellular processes such as glucose metabolism. we previously showed that treatment with higher concentrations of gsk-3 inhibitors, above the optimal concentrations that prevent neuronal cell death by oxidative stress, induced neuronal cell death. another consideration is that chronic inhibition of gsk-3 could increase several transcription factors and -catenin, which could contribute to the development of cancer. in detail, -catenin binds to transcription factors and to other proteins, such as axin, a component of the wnt signaling pathway. chronic inhibition of gsk-3, however, increases -catenin and other proteins, such as adenomatous polyposis coli (apc), and this process may lead to higher incidences of cancer [24, 25 ]. taken together, newly developed gsk-3 inhibitors for the treatment of als should have an optimal and balanced inhibitory effect on gsk-3, and the appropriate dose needs to be carefully examined. furthermore, it is extremely desirable to identify the gsk-3 inhibitor dose that results in no effect on -catenin degradation, to prevent cancer formation. gsk-3 plays extremely important roles in the motoneuronal cell death related to als, and the development of specific gsk-3 inhibitors might be an effective strategy for the treatment of als. | glycogen synthase kinase-3 (gsk-3) is known to affect a diverse range of biological functions controlling gene expression, cellular architecture, and apoptosis. gsk-3 has recently been identified as one of the important pathogenic mechanisms in motor neuronal death related to amyotrophic lateral sclerosis (als). therefore, the development of methods to control gsk-3 could be helpful in postponing the symptom progression of als. here we discuss the known roles of gsk-3 in motor neuronal cell death in als and the possibility of employing gsk-3 modulators as a new therapeutic strategy. |
with the advancements of interventional radiology (ivr), the majority of traumatic liver injuries can be conservatively treated. however, severe type traumatic liver injury is still a major cause of mortality after blunt abdominal trauma. therefore, the best way to proceed with any kind of medical intervention should be carefully considered in each case. a variety of liver lacerations have so far been reported. however, to our knowledge, no reports of a complete dissection of the hepatic segment exist in the literature. in the present report, we describe this rare type of liver injury and also discuss the management options. a 21-year - old male patient was transferred to hospital after receiving a blunt abdominal injury in a traffic accident. at the time of the patient 's admission, his blood pressure was 81/62 mm hg with a heart rate of 100 beats / min. intravenous fluids were immediately administered, and abdominal computed tomography (ct) revealed a massive hematoma along with a deep liver laceration and a retroperitoneal hematoma likely due to the right renal injury. the patient was transferred to our emergency department. at the time of admission, his blood pressure was 140/89 mm hg, and his heart rate was 89 beats / min following continuous fluid administration. at physical examination, laboratory tests revealed a wbc count of 32,770 cells / ml and a hb level of 14.2 g / dl. liver enzymes analyses revealed an ast level of 787 iu / l, an alt level of 644 iu / l, and an alp level of 351 iu / l ; crp level was normal with 0.01 mg / dl. in the coagulation test, the prothrombin time level was 75.4% (inr : 1.17). in the blood gas test, mild acidosis with a ph level of 7.32 and a be level of 3.0 was recognized. at the initial ct, there was a low concentration in the anterior segment, and no obvious extravasation of the contrast agent was recognized around the liver. the severity of liver injury was considered to be grade v. abdominal ct revealed a massive hematoma in the abdominal cavity that was associated with deep hepatic lacerations in the right lobe. significantly, some solid tissue possibly containing pneumobilia was observed above the greater omentum (fig. the operative findings revealed a massive hematoma and pulsatile bleeding from the lacerated liver and retroperitoneal hepatoma, possibly due to a subcapsular injury of the right kidney. in accordance with the preoperative imaging studies, a pale liver fragment on the greater omentum was observed, which was morphologically consistent with the defect in the posterior segment of the liver. since the damaged area of the liver broadly followed the course of the middle hepatic vein, we carefully inspected and isolated the inflow vessels and eventually performed a right hepatic lobectomy. surgical time was 265 min, blood loss was 1,160 ml, and the required blood transfusion was 560 ml (fig. the postoperative course was uneventful, and the patient was discharged on postoperative day 17 (fig. he is currently undergoing follow - up on an outpatient basis, and the status of liver regeneration is favorable. the liver is largely protected by the rib cage and the spinal column, but it can sometimes suffer fatal injuries. the reasons why the liver is susceptible to severe bleeding include (1) the low level of coating and compression of the surrounding tissue, (2) respiratory movement inhibiting hemostasis, (3) absence of a venous valve, (4) low contractility of the hepatic veins, and (5) the leaked bile juice decreasing blood coagulability. more than 60% of fatalities due to liver injury occur due to massive uncontrollable bleeding. however, recent advancements in ivr have made the number of non - surgical treatments increase and led to completion rates as high as 85%. the mortality rate among severe cases remains > 50% [2, 3 ], and it is important to rapidly determine whether laparotomy is necessary for evaluating the extent of the liver injury. to determine the severity of the liver injury, the liver injury scale of the american association for the surgery of trauma has frequently been utilized so far as shown in table 1. the present patient presented with a complete dissection of the liver tissue accompanied by the injury to the middle hepatic vein and was therefore diagnosed with grade v injury. to the best of our knowledge, there have been no reports describing complete hepatic dissection in the literature. the mechanisms of liver damage can be explained as follows : trauma to the right side of the abdomen often leads to damage of the right hepatic lobe or the right kidney, whereas trauma to the left side of the abdomen often leads to damage in the spleen and the left kidney, such as in cases of liver trauma caused by vertical movements such as a fall, and can damage the hepatic round ligament and the triangular ligament. in cases of anteroposterior movements, such as in a head - on collision, the liver moves forward with the triangular ligament as a fulcrum, and the right lobe is susceptible to damage. in the present case, it is assumed that a blunt abdominal injury caused by the seat belt compression in a traffic accident may have created severe liver lacerations with complete liver dissection. in terms of therapeutic strategies, trauma patients should initially be categorized as either responders, transient responders, or non - responders based on their response to initial fluid therapy to select the subsequent treatment [5, 6, 7 ]. however, no specific criteria for classification have been developed [8, 9, 10 ]. as shown in the algorithms, initial treatment is broadly divided into three types, including ivr, surgery, and conservative therapy. findings that proceed with ivr include (1) extravasations, arterial blushing, and a - p shunts found in abdominal contrast ct scans, and (2) blood pressure above 90 mm hg which can be maintained with a rapid administration of intravenous fluids. to reduce the extent of bleeding from the injured liver, ivr has often been performed [11, 12 ]. surgery is suitable in the following cases : (1) blood pressure above 90 mm hg can not be maintained even with rapid administration of intravenous fluids, (2) intestinal damage or damage of any other solid organ is suspected, and (3) cases in whom bleeding is persistent and blood pressure is unstable even after ivr. cases in whom conservative therapy is suitable are those who do not apply to any of the above factors. perihepatic packing is an effective technique for achieving hemostasis after severe liver trauma in a hemodynamically unstable case [13, 14 ]. other options such as hepatotomy, selective artery ligation, resectional debridement, and anatomical resection are also effective for achieving hemostasis, but they invariably result in a loss of functioning liver tissue. in the present case, the patient responded well to the rapid administration of intravenous fluids and there was no damage to any other internal organs. delayed surgery should be considered in cases of biloma, hepatic necrosis, abdominal compartment syndrome, intraperitoneal abscess, and peritonitis due to delayed intestinal damage. in the present case, we performed emergency laparotomy based on the findings that included progressive anemia, completely disrupted liver tissue on ct conducted 6 h after the injury, and the fact that hepatic necrosis of the affected region could not be ruled out. in reports from other institutions, the incidence of intraperitoneal abscesses in brade iv or v cases was as high as 68.2%, and delayed complications after ivr occurred in 28.9% of cases. in summary, we performed hepatic lobectomy in a patient with severe liver injury accompanied by a complete dissection of a hepatic segment, and the patient had a favorable clinical outcome. currently, ivr is an indispensable option for therapeutic consideration of the liver. when a patient 's condition allows it, anatomical resections can therefore be safely performed. | a 21-year - old male patient was transferred to the emergency room of our hospital after suffering seat belt abdominal injury in a traffic accident. abdominal computed tomography revealed a massive hematoma in the abdominal cavity associated with deep hepatic lacerations in the right lobe. the presence of a solid tissue possibly containing pneumobilia was observed above the greater omentum. these findings were consistent with a tentative diagnosis of hepatic laceration due to blunt trauma ; therefore, this prompted us to perform emergency laparotomy. the operative findings revealed a massive hematoma and pulsatile bleeding from the lacerated liver and a retroperitoneal hepatoma, which was most likely due to subcapsular injury of the right kidney. in accordance with the preoperative imaging studies, a pale liver fragment on the greater omentum was observed, which was morphologically consistent with the defect in the posterior segment of the liver. since the damaged area of the liver broadly followed the course of the middle hepatic vein, we carefully inspected and isolated the inflow vessels and eventually performed a right hepatic lobectomy. the patient 's postoperative course was uneventful, and he was doing well at 10 months after surgery. |
single - molecule (sm) spectroscopic techniques are routinely used to study the structure and dynamics of complex materials. a current challenge in sm spectroscopy host interactions that influence sm phenomena such as photoluminescence intermittency (pi). investigations of pi generally involve measuring the distributions of emissive (on) and nonemissive (off) event durations under different environmental conditions, and correlating changes in environment with changes in these distributions. emissive and nonemissive event durations can often span multiple decades in time and are often assumed to be power - law distributed, although these claims are now under dispute. nevertheless, power - law distributions (and their distributional relatives) can arise when the rate constants for populating and depopulating a nonemissive or dark state evolve over the course of the measurement. for organic luminophores, a common model for dark - state formation is the production of the radical form of the luminophore through photoinduced electron transfer to the surrounding environment. in this model for pi, a distribution of electron - transfer sites or energy barriers is presumed to exist within the host, providing for a corresponding distribution of electron - transfer rate constants. also inherent in this model for pi is the expectation that the electron - transfer rate constant will depend on the local dielectric constant (). the relationship between and pi has been explored by others, who proposed that an increase in the host dielectric constant serves to stabilize the charge - separated state, resulting in prolonged nonemissive event durations. for single terrylene molecules as well as semiconducting nanocrystals, the nonemissive event duration distributions shift to longer times with increased, consistent with electron transfer being responsible for the pi exhibited by these emitters. recently, there has been renewed interest in exploring the relationship between pi and for semiconductor nanocrystals. however, a complicating issue with these studies is that variation in was accomplished by changing the chemical composition of the host, including their fundamental solvation properties. in our recent study of nile red (nr) in poly(vinylidene fluoride) (pvdf), we found that polymer films expressed in the ferroelectric () phase consist of a wide distribution of dielectric environments ranging from 2 to 70. using the solvatochromic shift of nr, which extends from 520 nm in hexane (= 1.88) to 614 nm in acetonitrile (= 37.5), we were able to spatially map the dielectric environments of pvdf with domains sizes ranging from a few hundred nanometers to microns in diameter. this finding suggests that the nr / pvdf guest host system provides a novel opportunity to investigate the dependence of pi on the local environment without varying the chemical composition of the luminophore or host. here, we present a study where both the intensity and emission energy from single nr molecules is measured as a function of time, allowing for the simultaneous measurement of pi and the local dielectric constant of the environment. we find that for nr in pvdf, the median emissive event durations increase 5-fold with an increase in from 2.2 to 74. a more complex dependence on is observed for nr nonemissive event durations, with the median nonemissive event duration initially increasing as increases from 2.2 to 3.4, but then decreasing in duration as continues to increase. employing the photophysical properties of nr and pvdf, we have constructed a simple model for the photoinduced electron transfer between nr and pvdf. using this model, the variation in emissive event durations with in addition, the photostability of nr increases with, suggesting that the local dielectric environment plays an important role in defining the photostability of nr in pvdf. thin films of nile red (nr, aldrich, 99+% pure by lc - ms) embedded in poly(vinylidene fluoride) (pvdf, sigma - aldrich, mw 534 000 by gpc) were prepared as described previously. films were 300 nm thick as determined by ellipsometry, with sample preparation tailored to express the ferroelectric phase of pvdf, as described in the literature. heavily dyed samples demonstrated no degradation in fluorescence intensity or optical density over periods of months. the 488 nm (novalux, protera) excitation field was circularly polarized using a /4 waveplate to excite all dye orientations within the films. an excitation power of 3 w, as measured at the entrance port of the microscope, was employed, and sms were located by raster scanning the film across the objective (nikon, plan - fluor) focal volume in 100 nm steps. the emission was split by a 600 nm short - pass dichroic mirror, with the reflected (r) and transmitted (t) fields focused onto two separate avalanche photodiode detectors (apd, perkinelmer spcm - aqr-16). an overall emissive intensity threshold of 500 counts per 100 ms was used to trigger automated data collection for 150 s with a bin time of 5 ms. sm pi data were first assessed for overall emissive intensity employing a threshold of 12 counts per 5 ms bin, corresponding to three standard deviations above the background. pi traces were visually examined, and only those demonstrating emissive activity for at least 20 s were analyzed. in addition, only data from molecules demonstrating > 500 nm separation and single step photodecomposition were included in our analysis. an overall reflected / transmitted ratio (r / t) value was calculated by summing photons on each detector for time points where the sum of the two channels exceeded the threshold and then dividing to obtain the time - averaged ratio for emissive events. the data were then categorized into five r / t categories (defined in table 1) as determined for this optical configuration previously. data were collected until at least 100 molecules populated each r / t category. the pi data were analyzed by identifying change points in emissive intensity using the bayesian detection of intensity changes method (bdic ; see the supporting information) reported by ensign and pande. this approach represents an evolution of the maximum likelihood change point detection (cpd) algorithm previously employed in our laboratory. the bdic algorithm has one adjustable level of sensitivity, negating the need for look - up tables and error matrices. bdic also demonstrates greater accuracy at locating change points ; however, neither cpd nor bdic is able to capture short emissive events (1030 ms) present within long nonemissive segments due to the overwhelming number of background counts relative to a few bins of signal. to detect these emissive bursts, the analysis searches for additional emissive events within long nonemissive segments (below the intensity threshold of 12 counts per bin) defined as exceeding 5 s in duration. a burst is defined as a segment with intensity greater than five standard deviations above the mean nonemissive intensity within the segment in question. once change points were detected, intensity states greater than two standard deviations above the root - mean - square noise (9 counts/5 ms) were designated as emissive, and those below were designated as nonemissive. an emissive duration is defined as the total time that the molecule s intensity exceeds the emissive threshold, with a corresponding definition used for nonemissive durations. through comparison with the initial sorting threshold of 12 counts/5 ms, we found that the results are not impacted by choice of threshold. the bdic algorithm calculates the average intensity between change points, thereby eliminating spurious crossings caused by noise. the 95% threshold employed avoids confusing low - intensity emissive segments with nonemissive events. molecules that exhibited at least two emissive periods and at least one nonemissive period before photodecomposition were accepted as blinking and are included in the final data set. the conversion of r / t values to the wavelength of the emission briefly, a mapping of the r / t ratio to emission wavelength maxima was performed by convolving ensemble nr fluorescence emission spectra in hexane, toluene, and acetonitrile with the apd efficiency curves, the emission filter transmission curve, and the 600 nm dichroic reflectance and transmission curves to calculate the expected reflected (r) and transmitted (t) spectra. by numerically shifting the solvent spectra and combining them to calculate a hybrid curve that takes into account the emission line shape of nr in solvents of differing polarity, the r / t ratio was transformed to the emission wavelength maximum (em) of nr. finally, the relationship between energy and dielectric constant was established using the solvatochromic properties of nr. a plot of the emission energy max of nr in these solvents versus the known dielectric constant (figure 1) was fit to a two - term exponential function that provides a conversion from emissive energy to the dielectric constant.1 fluorescence maximum of nr (in wavenumbers) versus the dielectric constant. arrows indicate the dielectric constant and average energy of the dielectric categories discussed in the text (shown here are five of the eight categories) ; 1 = 2.2 (gray), 2 = 3.4 (cyan), 3 = 4.8 (teal), 4 = 13 (orange / brown), and 5 = 44 (dark red). analysis of the emissive and nonemissive event durations begins with the construction of cumulative distribution functions (cdfs), defined to be the probability that an observed event duration is between tmin and t, and is zero for t 600) and transmitted (red, 500 > em > 600) intensities. the inset presents the histogram of emission wavelengths observed from the deconvolved emissive segments with an average emission wavelength of 612 nm. (b) pi trace produced by summing the intensities from the reflected and transmitted channels (solid gray line), emissive threshold (dotted black line), and intensity states identified using the bdic algorithm (light blue line). the inset presents a 10 s section of the trace enlarged to illustrate the bdic algorithm s sensitivity to emissive intensity changes. histograms of calculated emission energies for five selected dielectric categories (table 2) are shown in the right - hand column of figure 3. this figure illustrates that the emissive segments identified by the bdic algorithm are broadly distributed in terms of emissive energies, even for categories with a narrow range of average dielectric constants. the motivation for comparing cdfs is the ability to gain mechanistic information without assuming a parametric form for the underlying pdfs. attempts to fit the cdfs to power - law and log - normal distributions were made, but the fits were poor. we note, however, that log log representations of the cdfs demonstrate significant curvature across 4 decades in time, confirming that the underlying pdfs are not power - law. the differing shapes of the emissive and the nonemissive event cdfs indicate that the underlying pdfs are different. this can likely be attributed to different mechanisms for dark - state formation and decay. additionally, we see that both the emissive and nonemissive event distributions have significant probabilities at large duration times, with 10% of the nonemissive events figure 3a demonstrates that the emissive event durations continuously increase with increasing, while figure 3b shows an initial increase in nonemissive event durations and a subsequent decrease as increases. complementary cdfs for the emissive (a) and nonemissive events (b) of single nr molecules in pvdf for the selected categories defined in table 2. color code : 1 (gray), 2 (cyan), 3 (teal), 4 (orange / brown), and 5 (dark red). the right panel contains histograms of the emission energy for the deconvolved emissive segments for each category. the average number of emissive segments is 44 11 per molecule. to explore the relationship between event durations and, the median event times were calculated and plotted versus for all eight dielectric categories (table 2), as shown in figure 4. the median is a better measure of the central tendency than the mean in heavy - tailed distributions as it is insensitive to outliers. the median event duration corresponds to the time at which the cdf is equal to 0.5 (see eq 2). the median emissive event durations demonstrate a 5-fold increase over the range of observed here, with most of the increase occurring between = 2 and 4. the nonemissive event durations demonstrate a different trend, with the median event duration initially increasing with until 3.4, after which a decrease in the median is observed as continues to increase. the pi results presented here demonstrate a clear relationship between a simple measure of the central tendency in the raw emissive and nonemissive event distributions and. median emissive (a) and nonemissive (b) event durations versus the average dielectric constant for each category defined in table 2. error bars correspond to the 95% confidence interval, calculated from 10 000 bootstrap samples. insets in both (a) and (b) provide an expanded view of the data from 2 the connection between pi and the local dielectric environment poses a significant issue in interpreting the pattern of emissive intensity exhibited by sms. establishing the relationship between the rates of dark - state formation and decay and the polarity of the surrounding environment provides unique insights into potential mechanisms for pi. the results presented here represent a simple, unbiased treatment of sm data that establishes that the pi exhibited by nr is indeed sensitive to the local dielectric environments provided by pvdf. in our analysis, three easily implemented statistical tools are used to decompose the pi data into emissive and nonemissive durations and to present the resulting distributions graphically. first, the pi data were parsed using the bdic algorithm to identify statistically significant changes in emissive intensity using a single adjustable parameter to tune the sensitivity of the algorithm. using the relationship between emissive energy and (figure 1), we are able to determine the average local dielectric constant of each individual nr molecule. second, generation of the cdfs provides the ability to analyze changes in the distributions without having to assume a parametric form while also allowing for a simple investigation into the functional form of the underlying pdf. finally, by recognizing that the emissive and nonemissive event duration distributions are heavy - tailed, we are able to employ the median as a simple measure of the distribution s central tendency, which allows us to directly monitor the impact of on pi. host pair provides the opportunity to study the effect of the local dielectric environment on pi without altering the chemical composition of the guest or host. this is possible as pvdf films expressed in the ferroelectric phase consist of a mixture of nonpolar (- tgtg configuration) and polar (- tttt configuration) domains corresponding to a variation in the dielectric constant. meanwhile, the solvatochromic properties of nr report directly on the different dielectric domains and their stability with time. spectral diffusion within the dielectric categories is evident by the broad tailing distributions of the emissive segment energies. this indicates that the polarity of the surrounding environment fluctuates, consistent with other observations of spectral diffusion in soft and complex materials. qualitatively, the cdfs for nr as a function of (figure 3) are markedly different for emissive versus nonemissive events. this observation suggests that the mechanisms for dark - state formation and decay are not the same. this result is further confirmed through the observation of a variation in median emissive and nonemissive event durations with (figure 4). finally, the nonemissive durations are much longer on average than the emissive durations, consistent with a larger driving force for dark - state formation relative to decay of this state. the prevailing hypothesis for dark - state formation in organic guest host systems is photoinduced electron transfer. to test the viability of this hypothesis for nr / pvdf pvdf is aprotic and has been classified as an n - type semiconducting polymer, with electron trap energies distributed between 0.46 and 0.73 ev below the conduction band. the ferroelectric properties of pvdf are highly dependent on the movement of electrons, with filling of the electron traps proposed to be part of the mechanism for domain alignment. nr has been extensively used as a solvent polarity probe, with the photoexcited state of nr depending on the solvent. for instance, in polar aprotic solvents, photoexcited nr has a planar geometry and is classified as a locally excited state with a change of 5 d in dipole moment. in polar protic solvents, twisted intramolecular charge transfer can occur between the donor amine and phenoxazinone moiety, which quenches fluorescence. flash photolysis studies of nr in acetonitrile have confirmed the formation of a radical cation with absorption at 680 nm. this observation is consistent with an oxidation potential of nr in acetonitrile of + 0.95 v. further electrochemical and physical parameters for nr and pvdf are presented in table 3. these parameters suggest photoinduced electron transfer between electron donor nr and acceptor pvdf as a possible mechanism for pi. nr is expected to be the donor due to the favorable formation of the radical cation and the poor capacity for aprotic solvents to stabilize anion formation. a corresponding energy level diagram derived using the parameters reported in table 3 is presented in figure 5. this figure illustrates that pvdf electron traps are in energetic proximity to the lumo of nr, allowing for photoinduced electron transfer between nr and these traps. energy level diagram for nr, nr, pvdf, and pvdf traps. in the proposed photoinduced electron - transfer model, electron transfer from nr to traps generates nr, and the transferred electron fills the trap, promoting population of the conduction band. electrochemical and physical parameters used to construct this diagram are listed in table 3. a simple model for nr / pvdf photoinduced electron transfer can be constructed using the semiclassical marcus expression for the electron - transfer rate (ket)4a4b4cin the above expressions, el represents the electronic coupling energy between the reactant and product states, is the reorganization energy, gel is the free energy, kb is the boltzmann constant, and t is the temperature. the electron - transfer rate has two contributing parts, the energetics of the reaction corresponding to the reorganization energy and the free energy for the reaction and the coupling between states (el). the electronic coupling is modeled as shown in eq 4c, where dcc is the distance between reaction centers of the donor and acceptor and describes the fall off of the orbital interaction between the donor and acceptor with distance. we approximated the distance to the nearest trap to be on the order of the pvdf domain size, which ranges from 10 to 40 nm. using a typical value of = 0.85 the reorganization energy in eq 4a represents the sum of the internal reorganization energy (structural changes within the donor and acceptor) and the outer - shell reorganization energy (solvent reorganization). under the assumption that the nr cation ground - state structure is similar to that of neutral nr, the internal reorganization energy will be small, and solvent reorganization will dominate the total reorganization energy. the solvent reorganization energy is modeled using5 in the above expression, rd / a are the radii of the donor and acceptor species, respectively, is the index of refraction of the solvent, e is electronic charge, 0 is the permittivity of free space, and is the dielectric constant of the solvent. with regards to the driving force for the reaction, the oxidation potential of the donor (ed / d0) is known ; however, to account for the fact that we are considering photoinduced electron transfer, the free energy is adjusted by the energy difference between the equilibrated neutral excited state and the neutral ground state (e00) of the donor. additionally, to account for the oxidation potential of nr being measured in acetonitrile (= 37), we include a solvent - separated ion pair energy term (an approximation commonly attributed to rehm and weller) in determining the reaction driving force. finally, we include the energy released upon coulombic attraction of the two ions, resulting in the full expression for gel6the solvent dependence of e00 has been measured previously and is given by eq 1. while most of the parameters needed to evaluate eq 6 have been measured, the final quantity needed is the reduction potential of the pvdf electron traps (etrap / trap). previous single emitter studies found that the power - law exponent describing the nonemissive event durations decreased with an increase in environment polarity (achieved by changing the chemical composition of the host), consistent with increased stabilization of the charge - separated state in more polar environments. building on this earlier study, the reduction potentials of the traps are modeled using the field stabilization energy and the initial trap potential (etrap)7 in the above expression, e(1) can be thought of as representing the width of the trap distributions, measured to be 0.3 v, over the range of observed dielectric constants., we estimate the initial trap reduction potential to be etrap = 2.35 ev, consistent with resistance to filling an electron trap. using etrap as the only adjustable parameter, the median emissive events were modeled using the half - life as a proxy for the median emissive event duration (half - life = log(2)/ket). the increase in half - life with dielectric constant is in qualitative agreement with the increase in median emissive event durations, as shown in figure 4. specifically, the model predicts a rapid increase in half - life as increases from 2 to 5 and then a slower increase with further increase in. these results show that by using a basic approximation for the free energy that considers the solvent effects on the oxidation and reduction potentials of the donor and acceptor, the energetics of the nr excited state, and the pvdf dynamic trap energies, the evolution in median emissive event durations can be reproduced. the half - life serves as a proxy for the median emissive event durations. the observed trend for half - life with dielectric constant finally, we calculate the activation energy (g) for the electron transfer using8the variation in, gel, and g with dielectric constant from our model is shown in figure 7. figure 7 demonstrates that > gel at all dielectric constants, indicating that electron transfer occurs in the normal marcus regime. the activation barrier increases with dielectric constant, which gives rise to a decrease in ket with increasing. in addition, gel > 0, indicating that the reaction is uphill in energy. this is consistent with the observation of a larger number of nonblinking molecules with an increase in (table 1), as well as a narrowing in the emissive energy histograms with increasing (figure 3). reorganization energy (light gray dashed line), free energy gel (dark gray dotted line), and activation energy g (black solid line) versus the dielectric constant. these three parameters define the relative position and crossings of the reactants and product potentials for the electron transfer. while the emissive event durations can be modeled using a photoinduced electron - transfer mechanism, the nonemissive events are not as simply described by a back - electron - transfer model. while the initial increase in nonemissive event durations is consistent with the hypothesis that an increase in provides for stabilization of the charge - separated state (and correspondingly longer nonemissive event durations as others have suggested), the subsequent decrease in nonemissive event durations as continues to increase is more difficult to explain. it could be that the back electron transfer occurs through another mechanism (e.g., tunneling) as the comparison of the emissive and nonemissive event cdfs suggests. differentiation between these electron - transfer mechanisms should be evidenced by different pdfs describing emissive and nonemissive event durations. the challenge is to directly determine the pdfs from the pi data without a priori assumptions of the pdf functional form, a new pi analysis tool on which we will report shortly. we have measured the variation in pi with the local dielectric environment for nr in pvdf. by employing the nr / pvdf guest / host system, a direct correlation between pi and can be determined while maintaining the chemical composition of both the guest and host. through comparative analysis of the cdfs and the median event durations, we find that the emissive event durations continually increase with. in contrast, the nr nonemissive event durations initially increase with but then gradually decrease with a further increase in. we were able to demonstrate that the emissive event results can be rationalized using a photoinduced electron - transfer model for pi. in addition, an increase in nr photostability with an increase in was observed, suggesting that the dielectric constant plays an important role in defining the molecular photostability in pvdf. | the dependence of single - molecule photoluminescence intermittency (pi) or blinking on the local dielectric constant () is examined for nile red (nr) in thin films of poly(vinylidene fluoride) (pvdf). in previous studies, variation of the local dielectric constant was accomplished by studying luminophores in chemically and structurally different hosts. in contrast, the nr / pvdf guest host pair allows for the investigation of pi as a function of while keeping the chemical composition of both the luminophore and host unchanged. the solvatochromic properties of nr are used to measure the local, while fluctuations in nr emission intensity over time provide a measure of the pi. pvdf is an ideal host for this study because it provides submicron - sized dielectric domains that vary from nonpolar (2) to very polar (70). the results presented here demonstrate that the local dielectric environment can have a pronounced effect on pi. we find that the nr emissive events increase 5-fold with an increase in from 2.2 to 74. a complex dependence on is also observed for nr nonemissive event durations, initially increasing as increases from 2.2 to 3.4 but decreasing in duration with further increase in. the variation in emissive event durations with is reproduced using a photoinduced electron - transfer model involving electron transfer from nr to pvdf. in addition, an increase in nr photostability with an increase in is observed, suggesting that the dielectric environment plays an important role in defining the photostability of nr in pvdf. |
visualization of site - specific labels in long linear or circular dna allows unambiguous identification of various local dna structures, such as bent dna (13), as well as the protein binding sites (46) at predicted distances from the labels. the formation and stability of local structures, as well as protein functions, depend on the level of superhelical tension in dna, therefore there is a great demand for a simple labeling procedure that does not change the dna topology. some of them utilize the site - specific binding of oligonucleotides (79) or pna fragments (1012). the major drawbacks of these approaches are the complexity of their designs and the involvement of multiple experimental steps, and/or their dependence on dna supercoiling. restriction enzymes and methylases rendered inactive by mutations have been suggested for direct dna labeling (13), however moderate specific affinities of 10 to 10 m limit their use for routine labeling. we have recently used afm to study very stable complexes of the restriction enzyme sfii with dna which was kept undigested by replacing mg cations in the buffer with ca (14). sfii binds as a tetramer (total molecular weight of 124 kda), which is easily identified in the afm images. thus, sfii appears to be an excellent candidate label of specific sites in circular dna. however, the requirement of two dna recognition sites for the stable complex formation complicates the use of sfii for site - specific labeling : (i) sfii poorly binds to an isolated recognition site ; (ii) sfii binding to dna molecules with more than one recognition site results in dna looping that changes the overall dna topology and therefore limits the propensity of dna molecules for intrinsic and protein - induced structural rearrangements. here we show that these complications can be overcome by inducing stable sfii binding to its target site in dna with the help of a short dna duplex that provides the second sfii recognition site. using the oligonucleotide duplex in excess to target dna preferentially drives the formation of an intermolecular (trans) synaptic complexes which contain sfii, long dna molecule and the oligonucleotide duplex, rather than the trans complex formed by sfii - mediated bridging of two recognition sites in two long dna fragments or an intramolecular or cis complex formed by sfii binding to the two recognition sites in the same circular molecule. this labeling procedure does not interfere with cruciform formation and has very low dependence on the dna supercoiling. in addition, the complex dissociates slowly in moderately acidic (ph 5) or alkaline (ph 9) media.. concentrations of commercial sfii stocks were determined by comparing the densitometric traces of a coomassie blue - stained sds the puc8-derivative plasmids peo200, peof200 and peof250 were prepared as described previously (14). each plasmid contains two sfii recognition sites (sfii recognition sequence is underlined) : 5-ggccaccccggcc-3 and 5-ggcctcgagggcc-3 (peo200 and peof200) and 5-ggccttgtgggcc-3 and 5-ggcctcgagggcc-3 (peof250). the two sites are separated by 200 bp of random sequence in plasmid peo200 and by 300 bp in plasmid peof200. the latter plasmid contains a 106 bp inverted repeat f14c (16), centrally located between the recognition sites. plasmid peof250 also contains the f14c inverted repeat asymmetrically located between the sfii sites that are 350 bp apart. open circular dna was obtained by digestion of supercoiled plasmids with a nicking enzyme nt.bstnbi as recommended by the supplier. after phenol the 362 bp dna fragment with one sfii recognition site was obtained by a double digestion of plasmid peof250 with nspi and hindiii restriction endonucleases. the fragment was purified from an agarose gel using the qiaquick gel extraction kit (qiagen inc., valencia, ca), ethanol precipitated and dissolved in he buffer (10 mm hepes and 1 mm edta, ph 7.5). its concentration was determined from dna absorption at 260 nm using the nanodrop spectrophotometer (nanodrop technologies, wilmington, de). the 17 bp duplex was prepared from the oligonucleotide 5-ggggcctcgagggccat-3 and its complement (integrated dna technologies, coralville, ia) by mixing in tnm buffer (10 mm tris hcl, 50 mm nacl and 10 mm mgcl2), heating to 95c and slow cooling to room temperature. a typical labeling reaction mixture contained a 2:1 molar ratio of the sfii tetramer per dna recognition site, e.g. 100 fmol of sfii tetramer and 25 fmol of plasmid dna (two recognition sites in each molecule), in 10 l of reaction buffer a (10 mm hepes, 50 mm nacl, 2 mm cacl2, 0.1 mm edta and 1 mm dtt, ph 7.5). the mixture was incubated for 15 min at room temperature followed by addition of the dna duplex and subsequent incubation for 15 min. the complex was purified by filtration through a millipore ufc7 column, and the protein - bound dna was eluted with 20 l of reaction buffer. to test the stability of labeled dna at different ph, the buffer was changed after the first round of filtration and additional two rounds of filtration were done with another buffer on the same column. low ph acetate buffer (100 mm sodium acetate, 2 mm cacl2 and 1 mm dtt, ph 5.0) and high ph bicarbonate buffer (100 mm sodium bicarbonate, cacl2 and 1 mm dtt, ph 9.0) were used for this procedure. briefly, freshly cleaved mica was treated with 167 m water solution of aminopropylsilatrane (17) for 30 min. dna samples (34 l) were placed onto aps - mica for 2 min ; then the sample was rinsed with deionized water (labconco co., kansas city, mo) and dried in argon flow. images were acquired in air with multimode spm nanoscope iv system (veeco / digital instruments, santa barbara, ca) and tesp probes (tapping mode etched silicon probes, spring constant 42 n / m and resonant frequency 320 khz). image processing was performed with the femtoscan software (advanced technologies center, moscow, russia). statistical analysis of the yield of different dna structures was performed with the sets of 200400 molecules for each sample.. concentrations of commercial sfii stocks were determined by comparing the densitometric traces of a coomassie blue - stained sds the puc8-derivative plasmids peo200, peof200 and peof250 were prepared as described previously (14). each plasmid contains two sfii recognition sites (sfii recognition sequence is underlined) : 5-ggccaccccggcc-3 and 5-ggcctcgagggcc-3 (peo200 and peof200) and 5-ggccttgtgggcc-3 and 5-ggcctcgagggcc-3 (peof250). the two sites are separated by 200 bp of random sequence in plasmid peo200 and by 300 bp in plasmid peof200. the latter plasmid contains a 106 bp inverted repeat f14c (16), centrally located between the recognition sites. plasmid peof250 also contains the f14c inverted repeat asymmetrically located between the sfii sites that are 350 bp apart. open circular dna was obtained by digestion of supercoiled plasmids with a nicking enzyme nt.bstnbi as recommended by the supplier. after phenol the 362 bp dna fragment with one sfii recognition site was obtained by a double digestion of plasmid peof250 with nspi and hindiii restriction endonucleases. the fragment was purified from an agarose gel using the qiaquick gel extraction kit (qiagen inc., valencia, ca), ethanol precipitated and dissolved in he buffer (10 mm hepes and 1 mm edta, ph 7.5). its concentration was determined from dna absorption at 260 nm using the nanodrop spectrophotometer (nanodrop technologies, wilmington, de). the 17 bp duplex was prepared from the oligonucleotide 5-ggggcctcgagggccat-3 and its complement (integrated dna technologies, coralville, ia) by mixing in tnm buffer (10 mm tris hcl, 50 mm nacl and 10 mm mgcl2), heating to 95c and slow cooling to room temperature. a typical labeling reaction mixture contained a 2:1 molar ratio of the sfii tetramer per dna recognition site, e.g. 100 fmol of sfii tetramer and 25 fmol of plasmid dna (two recognition sites in each molecule), in 10 l of reaction buffer a (10 mm hepes, 50 mm nacl, 2 mm cacl2, 0.1 mm edta and 1 mm dtt, ph 7.5). the mixture was incubated for 15 min at room temperature followed by addition of the dna duplex and subsequent incubation for 15 min. the complex was purified by filtration through a millipore ufc7 column, and the protein - bound dna was eluted with 20 l of reaction buffer. to test the stability of labeled dna at different ph, the buffer was changed after the first round of filtration and additional two rounds of filtration were done with another buffer on the same column. low ph acetate buffer (100 mm sodium acetate, 2 mm cacl2 and 1 mm dtt, ph 5.0) and high ph bicarbonate buffer (100 mm sodium bicarbonate, cacl2 and 1 mm dtt, ph 9.0) were used for this procedure. atomic force microscopy (afm) procedure has been described previously (14,17). briefly, freshly cleaved mica was treated with 167 m water solution of aminopropylsilatrane (17) for 30 min. dna samples (34 l) were placed onto aps - mica for 2 min ; then the sample was rinsed with deionized water (labconco co., kansas city, mo) and dried in argon flow. images were acquired in air with multimode spm nanoscope iv system (veeco / digital instruments, santa barbara, ca) and tesp probes (tapping mode etched silicon probes, spring constant 42 n / m and resonant frequency 320 khz). image processing was performed with the femtoscan software (advanced technologies center, moscow, russia). statistical analysis of the yield of different dna structures was performed with the sets of 200400 molecules for each sample. the possibility to use sfii for the site - specific dna labeling was tested with the 362 bp dna fragment with a well - defined position of the sfii binding site. in the presence of sfii two fragment molecules form the x - shaped synaptic structure with the protein positioned at a cross point (figure 1a). can normally bind to dna, however its cleavage activity is inhibited (18). at dna concentration in the nanomolar range, the yield of the two - fragment synaptic complex decreased to 4555% when the 17 bp dna duplex was added to the reaction mixture even at the 1:1 molar ratio. at the same time these were the synaptic complexes involving the 362 bp fragment and the 17 bp duplex. images of the sfii / dna complexes prepared at a 1000-fold excess of the 17 bp duplex over the 362 bp fragment are shown in figure 1b. the short arm length of 53 2 nm and the total fragment length of 125 5 nm correspond to the 169 bp distance between the recognition site and one fragment end, and the total fragment length of 362 bp. the contour length measurements show that the protein position on the 362 bp fragment is slightly asymmetric and perfectly coincided with the expected position of the sfii binding site. a minor number of unspecific complexes could be found with protein sitting at the end of the fragment. only 3 of 1716 complexes analyzed had the position of the protein exceeding 3 sd values. the standard deviation for the measurements of the sfii position taken over > 300 complexes was 7.3% of the mean value compared with 5.5% for the contour length measurements on bare dna. this means that the accuracy for the sfii labeling procedure is only 20% less than contour length measurements regardless of the inevitable loss of accuracy due to the large protein size. the dependencies of the yields of different types of complexes on the duplex - to - fragment ratio are shown in figure 1d. this graph shows that even at the equimolar duplex - to - fragment ratio, 15% of protein dna complexes involved labeled 362 bp fragments. the yield of the protein - labeled dna fragments increased with increasing duplex concentration and reached 30%. overall, the data obtained support the feasibility of using the sfii based approach for site - specific labeling. to extend the proposed approach to labeling supercoiled dna we used plasmid peo200 containing two recognition sites at a 200 bp distance. enzyme binding to two sites should either result in dna looping if the sfii tetramer brings together two recognition sites in the same plasmid, or in a short duplex - assisted binding of two sfii tetramers to both recognition sites in the plasmid (double - labeled circular dna). afm images of the complex formed by sfii with plasmid peo200 in the absence of the 17 bp duplex are shown in figure 2a where dna loops closed by the sfii tetramer are seen. the loop size of 72 5 nm is very close to the expected value of 68 nm for the 200 bp distance between the two sfii binding sites. in the presence of the 17 bp duplex, double - labeled plasmids are observed in addition to those containing the sfii - closed loops. at a 1000-fold molar excess of the 17 bp duplex over the plasmid, the plasmid molecules labeled at both recognition sites (figure 2b) are the major type of the complexes (60%). the measured distances between the labels have a narrow distribution around the mean value of 73 5 nm (figure 2c), which is the same as the size of the sfii - closed loops and which agrees well with the expected distance of 68 nm or 200 bp between the two recognition sites. we also tested plasmid labeling in a broad range of the 17 bp duplex concentrations and determined the yields of various products (figure 2d). at increasing duplex concentrations, the yield of double - labeled plasmids increased at the expense of plasmids with the sfii - closed loops. the percentage of double - labeled molecules leveled off at 5560% when the molar duplex - to - plasmid ratio was > 1000:1. thus, the data obtained show unambiguously that the proposed methodology is capable of labeling two sites within the plasmid. the experiments described above were performed with a natively supercoiled dna sample (superhelical density, = 0.05). it levels off at 100:1 for this sample. also, since plasmid superhelicity may vary in a broad range, we tested whether the labeling efficiency was affected by dna supercoiling. to evaluate the effect of dna supercoiling, we performed experiments with an open circular dna obtained by the treatment of plasmid peo200 with the site - specific nicking enzyme nt.bstnbi (figure 3). sfii binding to the plasmid in the absence of the 17 bp duplex resulted in the formation of sfii - closed dna loops (figure 3a). 30% of total different complexes) taken for the sample prepared at the 1000-fold molar excess of the 17 bp duplex over relaxed plasmid. similarly to the previous data for supercoiled dna (figure 2d), the experiments with different duplex : plasmid ratios were performed and various types of the sfii complexes were counted. the yields of the complexes with open circular dna leveled off when the duplex / plasmid ratio reached 1000:1 (figure 3c). interestingly, the double labeling of relaxed dna was two times less efficient compared with the supercoiled dna. given the higher probability of the site juxtaposition in supercoiled dna compared with an open circular dna, one should anticipate an opposite trend higher efficiency of the short duplex - assisted sfii binding to separate sites in relaxed dna. however, the obtained results suggest that other factors, such as the relative orientation of protein binding sites (phasing) and local dna winding angles, both of which depend on dna supercoiling, can contribute to the stability of the cis synaptic complex in supercoiled dna. we also tested for the possible interference of this labeling procedure with the formation of alternative dna structures stabilized by negative dna supercoiling. we used plasmid peof200 which differs from plasmid peo200 by insertion of the inverted repeat f14c, capable of cruciform formation at the supercoiled density below = 0.03 (2,19), into the 200 bp segment between the two sfii binding sites. if the cruciform extruded, the distance between the recognition sites would be 200 bp. selected images of the plasmid peof200 complexed with sfii in the absence and presence of the 17 bp duplex are shown in figure 4a and b, respectively. in the absence of the 17 bp duplex, 86% of plasmid molecules had sfii - closed loops (figure 4a) with the cruciform positioned at the loop apex (the cruciforms are indicated with arrows). the number of looped complexes decreased two times (to 40%) when the 1000-fold molar excess of the 17 bp duplex was added to the reaction mixture. this decrease was accompanied primarily by the formation of the double - labeled complexes shown in figure 4b. the contour length measurements show that the labels are positioned at the distance of 35 2 nm from the center of the cruciform (figure 4c), which correlates well with the expected 100 bp distance between the recognition sites and the cruciform. statistical analysis performed over more then 300 molecules showed that the standard deviation for the sfii position measured relative to the cruciform position is 6.3%. this value is slightly exceeding the accuracy for the length measurements (5.5%) suggesting that the accuracy of the labeling is 15% less than the accuracy for the contour length measurements. the titration data obtained in a broad range of duplex concentrations (figure 4d) show that the percentage of the sfii - closed loops decreased with the increase of the duplex concentration and reached a plateau at 40% when the duplex - to - plasmid ratio was above 1000:1. at the same time, the number of double - labeled molecules increased up to 35%, whereas the number of molecules labeled at the single position increased slowly to 20%. if sfii / dna complexes are to be used for identification of ph - dependent local dna structures, such as h - dna (16), it is instructive to evaluate the stability of complexes at different ph. for this experiment, sfii was bound to plasmid peo200 at the duplex - to - plasmid ratio of 1000:1 to obtain a high yield of the double - labeled complexes. the sample, prepared at ph 7.5, was divided into three aliquots and the ph was adjusted to 5.0 and 9.0 in two of them. figure 5 shows that the percentage of the double - labeled molecules decreased from 50% at ph 7.5 to 38 and 26% at ph 5.0 and ph 9.0, respectively. this decrease in double - labeled molecules was accompanied by an increase in the amount of unlabeled dna (from 3 to 4% at ph 7.5 to 12% at ph 5.0 and to 25% at ph 9.0). it is quite surprising that the complex remains stable under conditions quite far from the most optimal ones. such a relatively high complex stability is a useful feature for the labeling procedure extending the range of the conditions for its use. the data obtained show that the restriction enzyme sfii can be used as a site - specific label for circular dna molecules if a short dna duplex is used as a helper to stabilize the formation of the site - specific synaptic complex. sfii binds as tetramer of the total molecular weight ca 124 kda which is easily distinguished on the dna molecule by afm (and em). importantly, the weak dependence of labeling efficiency on dna supercoiling, significantly broadens the range of the labeling application protocol. the fact that labeling does not interfere with the formation of cruciforms is another important feature of the developed method in applications where alternative structures are involved. the tolerance of the complex to the ph change is another important feature of the sfii based protocol extending the application from ph 5 to 9. although the major focus of the paper is the labeling of circular dna, the procedure can be applied to labeling of linear molecules. the labeling of linear molecules can be useful if the molecules are long and the position of the sfii site is in relatively close proximity to the areas of interest. the proposed approach utilizes sfii enzyme that requires relatively long site for the recognition that may not present in the plasmid of interest. the procedure can be extended to other type ii enzymes recognizing shorter dna sequences the enzymatic activity of which is blocked by replacing mg with ca (e.g. ngomiv). our recent experiments showed that ecorii restriction enzyme belonging to the same type ii family (20) can be another potential candidate. this enzyme forms the synaptic complexes in the dimeric form compared to the tetrameric form for sfii. it also does not cut in the absence of mg cations and is capable of binding dna in the absence of divalent cations. however these properties in terms of the accuracy of the labeling need to be investigated thoroughly. (a) afm images of the sfii / dna fragment complexes. 82% of dna fragments are involved in a trans x - shaped synaptic complex containing the sfii tetramer and two fragment molecules. (b) afm images of the sfii / dna fragment complexes prepared in the presence of the 17 bp duplex at a 1000-fold excess over the fragment. (c) the contour length measurements for dna fragment with the protein bound (blue) and the distance of the sfii position from the end of the fragment (pink). (d) the yields of unlabeled dna (0) and different type of the sfii / dna complexes : complex containing two 362 bp fragments (x - trans) and complex containing one 362 bp fragment and one 17 bp duplex (1), at different duplex - to - fragment ratios in the reaction mixture. sfii binding to supercoiled plasmid peo200 containing two enzyme recognition sites. (a) images of the plasmid in complex with sfii. (b) afm images of the double - labeled dna prepared in the presence of the 17 bp duplex at a 1000-fold excess over the plasmid. (c) the contour length (cl) measurements between two sites in double - labeled molecules. (d) the yields of unlabeled dna (0) and different type of the sfii / dna complexes : the sfii - closed loop (loop) and complexes containing the 17 bp duplex at one (1) or both sfii recognition sites (2), at different duplex - to - plasmid ratios in the reaction mixture. (a) afm images of the molecules with sfii - closed loops obtained in binding reactions without 17 bp duplex. (b) images of the double - labeled molecules prepared in the presence of the 17 bp duplex at a 1000-fold excess over the plasmid. (c) the yields of unlabeled dna (0) and different type of the sfii / dna complexes : the sfii - closed loop (loop) and complexes containing the 17 bp duplex at one (1) or both sfii recognition sites (2), at different duplex - to - plasmid ratios in the reaction mixture. (a) afm images for the sfii / dna complexes prepared without the duplex ; 86% of molecules have the sfii - closed loop and the cruciform. (b) selected afm images of the double - labeled molecules in the sample obtained in the presence of the 17 bp duplex at a 1000-fold excess over the plasmid. (c) measurements of the contour length (cl) between the cruciform and either of the labeled positions. (d) the yields of unlabeled dna (0) and different type of the sfii / dna complexes : the sfii - closed loop (loop) and complexes containing the 17 bp duplex at one (1) or both sfii recognition sites (2), at different duplex - to - plasmid ratios in the reaction mixture. the ph effects on the yield of various types of sfii complexes with plasmid peo200. protein binding to dna was accomplished in the presence of the 17 bp duplex at a 1000-fold excess over the plasmid. percentages of unlabeled dna (0, black bars) and different type of the sfii / dna complexes : the sfii - closed loop (loop, red bars) and complexes containing the 17 bp duplex at one (1, green bars) or both sfii recognition sites (2, blue bars). | visualization of site - specific labels in long linear or circular dna allows unambiguous identification of various local dna structures. here we describe a novel and efficient approach to site - specific dna labeling. the restriction enzyme sfii binds to dna but leaves it intact in the presence of calcium and therefore may serve as a protein label of 13 bp recognition sites. since sfii requires simultaneous interaction with two dna recognition sites for stable binding, this requirement is satisfied by providing an isolated recognition site in the dna target and an additional short dna duplex also containing the recognition site. the sfii / dna complexes were visualized with afm and the specificity of the labeling was confirmed by the length measurements. using this approach, two sites in plasmid dna were labeled in the presence of a large excess of the helper duplex to compete with the formation of looped structures of the intramolecular synaptic complex. we show that the labeling procedure does not interfere with the superhelical tension - driven formation of alternative dna structures such as cruciforms. the complex is relatively stable at low and high ph (ph 5 and 9) making the developed approach attractive for use at conditions requiring the ph change. |
the most important force involved in the expulsion of a fetus is produced by maternal intra - abdominal pressure, and in most cases, bearing down is reflexive and spontaneous during the second stage of labor. increased intra - abdominal pressure is generated by simultaneous muscle contraction and forced respiratory efforts with a closed glottis, which is commonly referred to as " pushing. " uterine fundal pressure is described as an external force applied to the uppermost portion of the uterus in a caudal direction, typically with the intent of shortening the duration of the second stage of labor. although uterine fundal pressure is commonly used in the management of a prolonged second stage of labor, particularly when maternal exhaustion or a non - reassuring fetal heart rhythm occurs during fetal head crowning, the role of uterine fundal pressure is understudied and remains controversial. limited data exist on the safety and efficacy of fundal pressure (2) ; and there are no publications to date that report the use of fundal pressure in the second stage of labor because documentation of such a technique is often missing from medical records (3). the aim of this study is to assess the effect of a labor assister (baidy m-420/curexo, inc., seoul, korea) on uterine fundal pressure, which is an inflatable abdominal belt synchronized to apply uniform fundal pressure during spontaneous uterine contractions during the second stage of labor. this randomized, controlled, and prospective study was conducted from november 2006 to august 2007. this study was approved by the institutional review board of the college of medicine pochon cha university, and written informed consent was obtained from all patients. one hundred twenty - three pregnant women were recruited during the first stage of labor upon admission to the delivery unit. they were divided into two groups by randomly numbered envelopes upon full dilatation of the cervix ; 62 were assigned to the active group and 61 to the control group (table 1). the effects and safety of uniform fundal pressure and obstetric outcomes were then prospectively compared between the two groups. all enrolled women were 20 - 35 yr of age, at term (37 - 41 weeks gestation), with a singleton cephalic presentation, a clinically adequate pelvis, and cervical dilatation 5 cm or multiple in number), history of gestational trophoblastic disease, known maternal medical diseases (hypertension, gestational diabetes mellitus, etc.), abnormal placental location, placental abruption, polyhydramnios, oligohydroamnios, suspected chorioamnionitis, abnormalities of the abdominal wall (hematoma or erythema), abnormal fetal heart monitoring at the time of enrollment, abnormal uterine activity, current history of drug or alcohol abuse, meconium - stained amniotic fluid, and intrauterine fetal growth restriction. a power analysis was performed to determine the appropriate sample size in relation to the difference of the duration of second stage. assumed the difference of second stage of labor for calculation was 15 min and standard deviation was 30 min based upon previous study (4). a sample size of 50 in each group was planned, initial enrollment of 127 women, and 124 women completed the study protocol. the labor assister consists of a tocotransducer, a control unit, and an inflatable belt (fig. the tocotransducer on the inflatable belt detects uterine contractions and sends the signal to the control unit, which then injects 200 mmhg of air into the belt for 30 sec. all patients wore the belt in the first stage of labor, but were unable to see the belt due to a draped screen. in addition, all the women, whether randomized to the belt or the control group, received standard management of the second stage of labor, which includes one - to - one support, continuous electronic fetal heart rate monitoring, and care from midwife. augmentation of labor by an intravenous infusion of oxytocin and analgesia by an intramuscular injection of nalbupine or an epidural anesthesia were available at the discretion of the obstetrician. operative deliveries were performed if clinically indicated. upon full dilation of the cervix, indicating the onset of the second stage of labor, the labor assister was switched on in the active group. as a uterine contraction started, the inflatable obstetric belt was inflated synchronously and maintained at 200 mmhg for 30 sec. the labor assister was not used for more than 3 hr and was discontinued when delivery was imminent, when the obstetrician decided to remove the device, or when the patient requested removal of the device. after delivery, all participants were followed up by questionnaire to grade their level of satisfaction. active versus control group differences were analyzed for statistical significance by using student 's t test, chi - square test, and fisher 's exact test. contributing factors for the duration of the second stage of labor were analyzed with multiple regression analysis and stepwise - selection method. there were no significant differences between the active and control groups in terms of maternal age, gestational age, cervical dilation on admission, maternal height, and weight. rupture of membranes was less frequent in the active group (19.35%) compared with the control group (31.14%). there was a significant decrease in duration of the second stage of labor in the active group as compared with the control group (41.55 min compared with 62.11 min, p=0.001). there was also a lower incidence of operative vaginal deliveries, perineal lacerations, and use of oxytocin in the active group, although these observations were not statistically significant. there were no considerable differences in birth weight, neonatal head circumference, apgar scores, number of neonatal intensive care unit (nicu) admissions, meconium - stained amniotic fluid, epidural anesthesias, or length of stay for either the mother or neonate (table 2). based on multiple regression analysis, the independent variables related to the duration of the second stage of labor was determined. a positive relationship existed with maternal age, use of oxytocin, birth weight, neonatal head circumference, and fetal head position ; however, these were not statistically significant. a negative relationship was not significant between the duration of the second stage of labor and maternal height, maternal weight, or administration of epidural analgesia, with the exception of use of the labor assister (coefficient, -20.57 ; standard error, 6 ; p=0.001 ; table 3). thus, fundal pressure exerted by the labor assister was the most powerful contributor for shortening the duration of the second stage of labor. two cases of maternal complications and 10 cases of neonatal complications were found in the active group, and 5 cases of maternal complications and 8 cases of neonatal complications were found in the control group (table 4). regarding the maternal complications, one patient with dysuria and one vaginal laceration were noted in the active group, and a perineal laceration, a vaginal hematoma, two vaginal lacerations, and one vulvar hematoma were noted in the control group. the following neonatal complications were recorded in the active group : persistent fetal circulation (n=1), talipes (n=1), sepsis (n=1), feeding disorder (n=3), small for gestational age (n=1), neonatal aspiration (n=2), and transient tachypnea of the newborn (n=3). complications noted in the control group included sepsis (n=2), cephalhematoma (n=1), intercostal retractions (n=1), neonatal asphyxia (n=1), neonatal aspiration (n=2), and transient tachypnea of the newborn (n=3). there were no serious complications reported, and none were thought to be associated with the use of the labor assister. based on a postpartum questionnaire, more women reported positively about the device in the active group in terms of confidence, comfort, and satisfaction. this randomized controlled trial with the labor assister, which was developed to detect uterine contractions and apply synchronous uniform fundal pressure, demonstrates a significant reduction in duration of the second stage of labor. there were no considerable differences in perinatal outcomes or complications between groups attributed to the use of the labor assister. there are few studies about the safety and efficacy of fundal pressure (2). in 1991, zhao (4) demonstrated that the use of this mechanical device during the second stage of labor shortened its duration (40 min 23 sec vs. 59 min 59 sec) and reduced the incidence of instrument deliveries. however, cox. (5) reported that this inflatable obstetric belt did not reduce the duration of the second stage of labor or operative delivery rates in nulliparas with epidural anesthesia in 1999. in 2002, buhimschi. (6) demonstrated that contraction - enhancing maneuvers with semi - inflated disposable cuffs during the second stage of labor increased intrauterine pressure by 86% with valsalva and fundal pressure and by 28% with fundal pressure during spontaneous uterine contractions. in this study, more than half of the maximal force originates from the uterine contraction, 30% from valsalva and 17% from fundal pressure. in our previous study (7), we observed continuous intrauterine pressure was maintained by the labor assister during uterine contractions, although manual fundal pressure and maternal valsalva pushing produced higher intrauterine pressure with irregular intensity (72 mmhg with labor assister vs. 112 mmhg with manual fundal pressure and 129 mmhg with maternal valsalva pushing)., there has been a significant increase in the use of epidural anesthesia during labor as a method of pain relief. epidural anesthesia may induce some disadvantages, such as prolongation of the first and second stages of labor (8) and an increased amount of oxytocin (9). in addition, it is associated with an increased chance for malrotation of the fetal head and instrument deliveries (10). physiologic mechanisms utilized by epidural anestheia to affect the normal course of labor include a reduction in endogenous oxytocin release (attenuation of ferguson 's reflex) (11) or a decrease in uterine myometrial contractility via sympathetic neural blockade (9). these hypotheses are supported by evidence that intrauterine pressure in the second stage of labor is decreased with an epidural anesthesia (12). various trials have been performed in an attempt to minimize these disadvantages, but none have been successful. decreased intrauterine pressure, which is one of the main disadvantages of epidural anesthesia, would be expected to be neutralized by means other than increasing intrauterine pressure ; and fundal pressure could be an alternative method. in previous studies, uterine fundal pressure during the second stage of labor was found to increase complications such as shoulder dystocia (13), perineal lacerations (14), uterine rupture (15), and uterine inversion (16). excessive fundal pressure can increase fetal intracranial pressure, resulting in a significant decrease in cerebral blood flow and non - reassuring fetal heart rate patterns. cord compression and functional alterations in the intervillous spaces caused by the mechanical forces of fundal pressure compromise fetal status, leading to fetal hypoxemia and asphyxia (17). in addition, legal and professional practice guidelines concerning the use of fundal pressure in the normal second stage of labor do not currently exist. the labor assister provides uniform fundal pressure during spontaneous uterine contractions in the second stage of labor, which could help maternal pushing, prevent maternal fatigue and exhaustion, and shorten the duration of the second stage of labor. in this study, complications associated with the device were not noted. the application of fundal pressure in the second stage could be uncomfortable due to the pain of uterine contractions ; however, according to the results of the questionnaire, none of the patients complained about the device, and a greater number of patients responded positively with respect to confidence, comfort, and satisfaction. in the future, a larger scale study will be needed to determine the clinical usefulness of the labor assister. in conclusion, the labor assister is relatively safe and helpful in both reducing duration of the second stage of labor and preventing prolongation. | this study was designed to assess the effect of inflatable obstetric belts on uterine fundal pressure in the management of the second stage of labor. one hundred twenty - three nulliparas with a singleton cephalic pregnancy at term were randomized. standard care was performed in the control group, and uterine fundal pressure by the labor assister (baidy m-420/curexo, inc., seoul, korea) was utilized in addition to standard care in the active group. the labor assister is an inflatable obstetric belts that synchronized to apply uniform fundal pressure during a uterine contraction. the 62 women in the active group spent less time in the second stage of labor when compared to the 61 women in the control group (41.5530.39 min vs. 62.1135.99 min). there was no significant difference in perinatal outcomes between the two groups. in conclusion, the uterine fundal pressure exerted by the labor assister reduces the duration of the second stage of labor without attendant complications. |
clinical longevity of light cure resin composites used for restoration of both anterior and posterior teeth has been studied extensively. adequate curing of resin composites is important as it influences its mechanical properties, prevents bulk, or marginal fracture, adverse tissue reactions, and secondary caries. traditionally, halogen based curing lamps, which use filters to restrict the emitted light to blue region of the spectrum for polymerization have been used to activate the photo initiator system in the composites. however, they have several drawbacks such as overheating of the incandescence lamp, limited effective lifetime of the halogen bulbs, and degradation of internal components (bulb, reflector, and filter) overtime. to overcome these drawbacks, blue light emitting diode (led), light curing units (lcu) led 's have lifetimes of more than 10,000 h and undergo little degradation of light output over time. in order to minimize polymerization shrinkage of composites without affecting the degree of conversion, various polymerization modes have been formulated, such as soft start, pulse delay, pulse cure, and ramp mode. a continued development in composite resins resulted in materials with reduced particle size and increased filler loading, significantly improving the universal applicability of light - cured composite resins. micro - hybrid composites are a combination of micro fill and larger filler particles with an average size of 0.01 - 0.1 m. these have the advantage of improved physical properties, high percent fill and excellent aesthetics. the main drawback of this group, as determined by larger particle size, is the difficulty in maintaining long - term high polish. to overcome this, nano - filled composites, which have nanomeric particles and nanoclusters in a conventional resin matrix were introduced. several studies have compared the efficacy of quartz - tungsten halogen (qth) lcu with led lcu using micro fill, hybrid, and micro - hybrid composite resins. the curing efficacy of recently developed nanocomposites, which have different optical properties have not been studied extensively with different curing modes of led units. hence, this study was undertaken to compare the efficacy of polymerization of micro - hybrid and nanocomposites cured with qth, and led lcus by hardness testing method. the null hypothesis tested was that there is no difference in the vicker hardness of micro - hybrid and nanocomposite cured with qth lcu, standard regimens of two led lcus, and pulse cure mode of led lcu at top and bottom surfaces of composite specimens respectively. in addition, the depth of cure of the composites cured with qth and led lcu was determined. two light cured resin based composites, nano - composite (z350, 3m espe dental products, st. paul, usa ; a2 shade), and micro - hybrid composite (z100, 3 m espe dental products, st. paul, usa ; a2 shade), were used in this study. these were cured with qth lcu (elipar 2500, 3 m espe dental products, st. paul, mn, usa), and 2 led lcus (smartlite ps, pen style high power led curing light, dentsply caulk, dentsply, milford, and ulight pb-070 led curing light, fine vision electronics co. ltd. [fve, taiwan ] ; designated as first led and second led respectively). the two led lcus differed in their spectrum range (450 - 490 nm and 440 - 480 nm respectively) and curing modes. the first led was curable only in standard mode whereas the second led was curable in fast, ramp, and pulse mode as well as standard mode. each composite type was cured using four different curing protocols giving a total of eight experimental groups : group 1 : nanocomposite cured with qth lcu group 2 : nanocomposite cured with first led lcu in standard mode group 3 : nanocomposite cured with second led lcu in standard mode group 4 : nanocomposite cured with second led lcu in pulse cure mode group 5 : micro - hybrid composite cured with qth lcu group 6 : micro - hybrid composite cured with first led lcu in standard mode group 7 : micro - hybrid composite cured with second led lcu in standard mode group 8 : micro - hybrid composite cured with second led lcu in pulse cure mode method for assessing the effectiveness of cure was in accordance with that used by yap. ten disk shaped specimens in each group were formed, giving a total sample size of eighty. the discs were prepared using the teflon mould (dentsply, milford) measuring 5 mm in diameter and 2 mm in thickness. the moulds were placed on flat glass plates on top of acetate strips and then filled with resin based composites using cement carrier and condenser. the resin was covered with another acetate strip and gently pressed with another glass plate against the mould to extrude excess material and to ensure a level of the plane on the top and bottom surfaces. all the specimens were then irradiated by touching the lcu guide on the top acetate strip for 40 s using the respective lcus. the led 's were charged according to manufacturer 's recommendations, and placed back in their battery chargers after each specimen was polymerized. the light intensity of all the curing lights were checked with a radiometer (demetron 100, demetron research corp, usa.), prior to use, to ensure consistency in intensity output from the light source. all the lcus used in the study had intensity readings above 300 mw / cm, which is the minimum required intensity for complete polymerization. the specimens were then stored in a light proof container in distilled water at 37c for 24 h prior to microhardness testing. the vickers hardness measurements were carried out under a load of 50 g for 15 s using a vicker hardness tester (model micro vickers (mv) 1-pc (personal computer based) (fie) fuel instruments and engineers private limited. all the measurements were carried out by a single trained independent examiner. the mean vickers hardness number (vhn) of the top and bottom surfaces was calculated. to determine the depth of cure, the hardness ratio was calculated by dividing the bottom surface vhn by the top surface vhn. data was analyzed using spss (statistical package for social sciences) for windows release 11.5 (spss, chicago, il, usa). one - way anova was used to find the differences between the groups and tukey honestly significant difference post hoc test, for intergroup comparisons. table 1 shows the mean vhn values and hardness ratio of all the groups. the highest mean hardness value of both the top and bottom surface was observed for group 1 and one - way anova revealed significant difference in the mean hardness values of the top surface (p = 0.002), but no significant difference was seen in the bottom surface. when comparing the mean values of the hardness ratio, it was seen that all the groups scored higher than 0.80 indicating adequate depth of cure, and the difference between the hardness ratios were not significant. mean and standard deviation of vicker hardness measurements and hardness ratio for both nanocomposites, (group 1 - 4) and micro - hybrid composite resins (group 5 - 8), the highest mean hardness values for both the top and bottom surfaces were for the ones cured with qth lcu and the lowest mean hardness values were observed for the ones cured with second led lcu using standard mode. one - way anova showed that the mean vhn of both the top and bottom surfaces of nanocomposite specimens cured with qth lcu was significantly higher (p = 0.001 and 0.028 respectively), but not for micro - hybrid composite there was a statistically significant difference between the groups cured with qth lcu and the second led lcu in standard mode irrespective of the composite resin type used. hardness testing, an indirect method, is a good indicator of the degree of conversion, and vhn exhibits a good correlation with infrared spectroscopy, a direct method. in this study, these are the effectiveness of light transmission (light tips being free from scratches and debris), thickness, and shade of restorative material, exposure time, distance of the light source from the restorative material, and light intensity. to minimize the effects of colorants on light polymerization, a2 shade of both the composite resins was used. as light intensity decreases with increasing distance from the light cure tip, curing time was limited to 40 s as per the manufacturer 's recommendations. in this study, both top and bottom hardness values were obtained as the effectiveness of cure at the top surface does not ensure proper polymerization throughout the restoration. light intensity is greatly reduced as light passes through the bulk of the material due to scattering of light by the filler particles and the resin matrix. as the bottom surface is more critically affected by the light intensity, it is considered as a better gauge of the effectiveness of cure of composite. the bottom surfaces of all the specimens had lesser vhn than the top surface, which means that the degree of curing decreases with depth. the difference in the mean hardness ratio was not significant, indicating no significant difference in the mean hardness values of top and bottom surfaces. thus, it can be inferred that the specimens had undergone an almost uniform degree of polymerization from top to bottom. this can be due to the 2 mm thickness of the specimens, which has been determined to be of an adequate depth for proper curing. ideally, the hardness ratio should be one if polymerization is completely effective, as the hardness of the bottom surface should be the same as the top surface. taking into account light scattering and absorption within composite, the hardness gradient should not exceed 10 - 20% or hardness ratio should be 0.8 or greater for composites to be adequately polymerized. all light curing mode combinations fulfilled this criteria. curing nanocomposite with qth lcu resulted in significantly higher top hardness indicating qth cures nanocomposite better as compared to led lcus. even in case of micro - hybrid composite specimens, curing with qth lcu resulted in higher hardness values, though the difference was not statistically significant. thus, the hypothesis that there is no difference between vhn of micro - hybrid, and nanocomposites cured with various curing protocols were proved to be null and void. light intensity readings of all the lcus were standardized to be above 300 w / cm, as decreased light intensity is shown to affect the mechanical properties such as compressive strength. the lcus used in this study varied in their power density (400 mw / cm, 950 mw / cm and 1000 mw / cm), but their energy density was above 16 j / cm. at this level, the difference in the power density does not influence the polymerization kinetics. the difference between the hardness values may be explained by the differences in the ability of led and qth to excite the photoinitiators present in the materials. most resin based materials have camphoroquinone as the initiator of curing, which is sensitive to light at the blue region of the visible spectrum. however, camphoroquinone has some limitations ; hence, some materials contain other initiators of cure that are not excited within the wavelength range covered by led lamps. the bis - acyl - phosphine oxide and the 1-phenyl-1, 2-propanodione, for example, are initiators with absorption peaks at 380 nm and 410 nm, respectively, which are not effectively polymerized by led lcus due to its narrow spectrum range. the lcus used in this study had spectrum range of 400 - 500 nm for qth lcu, 450 - 490 nm for first led lcu and 440 - 480 nm for second led lcu. thus the better curability of composite resins with qth lcu could be due to its wider spectrum range. in a study done by peris., where the micro hardness of micro fill and micro - hybrid composite resins cured with different curing units was evaluated, it was found that the qth gave the highest hardness values than the leds. similar results have been obtained in studies carried out by dunn and bush, cefaly. and oberholzer. where the micro hardness values of micro fill and micro - hybrid composite resins cured with qth was greater than that by leds. furthermore, it was found that amongst all the groups, the highest mean value for the top surface was for nanocomposite (filtek z350) specimens cured with qth lcu, the difference being statistically significant. in a study conducted by topcu. also, nanocomposite material showed the highest hardness values in all polymerization types at the top and bottom surfaces. this could be, because, the particle size of nanofillers are below the wavelength range of visible light and thus, they do not scatter or absorb visible light. the extremely small size of nanofillers allows the particles to fit into spaces between other particles and effectively increases the overall filler level. did a study comparing surface micro hardness of four different resin composites cured using a halogen light, an led and a plasma arc unit. it was found that the nanocomposite gave the highest hardness values, with led lcu yielding highest hardness for nanocomposites followed by hybrid resin composites. in a study carried out by soh. where they compared the effectiveness of cure of two led lcus to conventional, high intensity and very high intensity halogen lights, it was found that the effectiveness of composite cure with led lcu is product dependent, due to variations in design and the size of the led used. in this study also, it was found that qth lcu and first led lcu were comparable, however, second led lcu with standard mode gave statistically significant difference when compared with the qth lcu. when comparing the different modes in the same lcu, it was found that both the composite resins cured with second led lcu in pulse cure mode (groups 4 and 8) cured better than the ones cured in standard mode (groups 3 and 7) though not statistically significant, which is in accordance with neo. contradictory findings have been observed in other studies such as by soh. where the standard modes gave significantly higher hardness values than the other curing modes when composite resin cured with different curing regimens were subjected to micro hardness test. the intermittent method of cure with qth had the higher knoop hardness number knoop hardness number (khn) than continuous mode of cure with both qth and led. this could be because hardness measurements were made 24 h after removal of the light source in the present study as compared to other studies where it was done immediately. composites cured with different curing modes continue to polymerize but to different extents after the light source is removed. pulse curing slows down the polymerization reaction, and this may be transferred to the post - irradiation polymerization of composites. one disadvantage of this study was use of teflon moulds, which tend to give higher micro hardness values than that carried out on natural teeth. furthermore, this was an in vitro study, which tends to overestimate the micro hardness values hence results should be attributed cautiously to clinical conditions. under the conditions of this in vitro study, the following conclusions were made : effectiveness of led lcus as compared to qth lcu is dependent on the type of product as well as the type of composite resin.curing nano composites with qth lcu results in better surface hardness at both the top and bottom surfaces.for micro hybrid composites, qth lcu and led lcus result in comparable surface hardness at both top and bottom surfaces.curing with both the qth and led lcus results in adequate depth of cure for both nano and microhybrid composite resins as the mean hardness ratio of all the groups were comparable.pulse cure mode in led lcu does not effectively increase micro hardness than the standard mode of curing. effectiveness of led lcus as compared to qth lcu is dependent on the type of product as well as the type of composite resin. curing nano composites with qth lcu results in better surface hardness at both the top and bottom surfaces. for micro hybrid composites, qth lcu and led lcus result in comparable surface hardness at both top and bottom surfaces. curing with both the qth and led lcus results in adequate depth of cure for both nano and microhybrid composite resins as the mean hardness ratio of all the groups were comparable. pulse cure mode in led lcu does not effectively increase micro hardness than the standard mode of curing. | aim : to compare the polymerization efficacy of micro - hybrid and nanocomposites cured with quartz - tungsten halogen (qth) and light emitting diode (led) light curing units (lcus). the effectiveness of pulse cure mode in led lcu was also investigated.materials and methods : both micro - hybrid and nanocomposite specimens were cured using four different curing protocols giving a total of eight experimental groups. ten cylindrical specimens were prepared for each group, and light cured for 40 s on the top surface, thus giving a total of eighty specimens. vicker hardness measurements were carried out on the top and bottom surfaces after 24 h and hardness ratio was calculated.results:for both micro - hybrid and nanocomposites, highest mean vhn was observed for the group cured with qth lcu, and the lowest was observed for the group cured with second led lcu in standard mode but the difference was significant only in case of nanocomposite.conclusion:curing nanocomposites with qth lcu results in better micro hardness. pulse cure mode does not effectively increase polymerization efficacy than the standard mode of curing. |
dna helicases are motor proteins that play essential roles in dna replication, repair, and recombination [1, 2 ]. in the replicative hexameric helicase, the fundamental reaction is the unwinding of double - stranded dna (dsdna) into single - stranded dna (ssdna) intermediates to provide ssdna templates for dna polymerases at the replication fork. ecdnab participates in the initiation of dna replication once the oric region of e. coli is bound by the dnaa initiator protein [5, 6 ]. it continues to act during the priming and elongation phases of dna replication, and it catalyzes atp hydrolysis and migrates on the dna template with a strict 5-3 direction. atp hydrolysis may drive the movement of the helicase toward the 3 end of the lagging strand. few therapies are effective against the six antibiotic - resistant eskape pathogens (enterococcus faecium, staphylococcus aureus, klebsiella pneumoniae, acinetobacter baumannii, pseudomonas aeruginosa, and enterobacter species) [9, 10 ]. k. pneumoniae (kp) is a ubiquitous opportunistic pathogen that causes severe diseases such as septicemia, pneumonia, urinary tract infections, and soft tissue infections. since dnab helicase is required for dna replication, blocking the activity of dnab helicase would be detrimental to bacterial survival. in addition, because the structure and function between eukaryotic and prokaryotic dnab - like helicases are different [5, 12 ], the k. pneumoniae dnab helicase (kpdnab) and other bacterial dnab - like proteins may be a promising target in developing antibiotics. previously, we determined the three - dimensional structures of the geobacillus kaustophilus dnab - family protein (gkdnab) and its complex with ssdna. although the overall structure of the apo and the complex forms of gkdnab is similar, the largest difference is found in their loop i region, which undergoes a strong conformational change during the helicase 's action. these structural and functional analyses are useful in helping our understanding of the mechanism of dna translocation in replication forks, and the resulting information may be useful in designing compounds that target bacterial dnab helicases. recently, we established that the 4 flavonols (figure 1) myricetin (myr), quercetin (que), kaempferol (kae), and galangin (gal) can interact with kpdnab and prevent dntp binding. flavonoids are the most common group of plant polyphenols, and are responsible for much of the flavor and color of fruits and vegetables. over 5000 different flavonoids have been described ; many of these compounds display structure - dependent biological and pharmacological activities. the 6 major subclasses of flavonoids are flavonols, flavones, flavanones, flavanols, anthocyanidins, and isoflavones. flavonols, composed of 2 aromatic rings linked by a heterocyclic pyran-4-one ring, are known to have antioxidant, antiradical, and antibacterial activities. in the present study, we further investigated the effect of flavonols on the inhibition of the ssdna binding, atpase activity, and dsdna - unwinding activity of kpdnab. a new assay that enables the real - time measurement of dna helicase activity was also developed. all restriction enzymes and dna - modifying enzymes were purchased from new england biolabs (ipswich, ma, usa) unless explicitly stated otherwise. all custom oligonucleotide primers were obtained from invitrogen corporation (carlsbad, ca, usa). all chemicals were purchased from sigma - aldrich (st. louis, mo, usa) unless explicitly stated otherwise. the encoding region of kpdnab was put on pet21e expression vector and expressed with a hexahistidine tag at the c - terminus of the recombinant protein. madison, wi, usa), to avoid having the n - terminal t7 tag fused with the gene product. details of the construction of pet21e - kpdnab expression vector and protein purification have been described previously. the purified protein was dialyzed against buffer b (20 mm hepes, 100 mm nacl ; ph 7.0), and concentrated to 5 mg / ml. protein purity remained greater than 95% as determined by coomassie - stained sds - page (figure 2). emsa for kpdnab was carried out using the same protocol as described previously for ssb proteins [2022 ], with a minor modification. ssdna oligonucleotides were custom synthesized by mdbio, inc., frederick, md, usa. radiolabeling was carried out with [p]atp (6000 ci / mmol ; perkinelmer life sciences) and t4 polynucleotide kinase (promega, madison, wi, usa). kpdnab (0, 90, 170, 340, 680, 1360, 2730, and 5450 nm) was incubated for 30 min at 25c with 1.7 nm ssdna substrate (dt30) and 16.7 m flavonol in a total volume of 10 l in 20 mm hepes (ph 7.0) and 100 mm nacl. aliquots (5 l) were removed from each reaction solution and added to 2 l of gel - loading solution (0.25% bromophenol blue and 40% sucrose, w / v). the resulting samples were resolved on a native 8% polyacrylamide gel (8.3 7.3 cm) at 4c in tbe buffer (89 mm tris borate and 1 mm edta) for 1 h at 100 v and visualized by phosphorimaging. the phosphor storage plate was scanned, and the data for complexed and free dna bands were digitized for quantitative analysis. the ssdna binding ability (kd, app value) for the protein was estimated from the protein concentration that binds 50% of the input dna [2325 ]. each kd value is calculated as the average of at least three measurements s.d. to monitor the 5-3 dna helicase activity of kpdnab in real - time, we developed an assay on the basis of fluorescence resonance energy transfer (fret) method. the dsdna substrate was prepared with the fluorescent strand, 5-tagtaccgccaccctcagaacc-3 with alexa fluor 488 (maximum excitation / emission = 495/519 nm) coupled to the 5-end, and the complementary quencher strand, 3-atcatggcggtgggagtcttggtttttttttttttt-5 with bhq1 coupled to the 3-end, at a 1 : 1.2 concentration ratio. the dsdna substrate was formed in 20 mm hepes (ph 7.0) and 100 mm nacl, by brief heating at 95c for 5 min and then followed by slow cooling to room temperature overnight. the fluorescence helicase assay was performed in 20 mm hepes (ph 7.0), 100 mm nacl, 3 mm mgcl2, 50 nm dsdna substrate, and 5 mm atp in 2.0 ml of reaction volume. the unwinding reaction was started by adding kpdnab (200 nm) and was carried out at 37c for 60 min using a spectrofluorimeter (hitachi f-2700 ; hitachi high - technologies, tokyo, japan). the fluorescence intensity was recorded every 5 s. the dna helicase activity was calculated as the initial reaction velocity from the linear part of the progress curve using the linear regression method. the protocol for measuring the atpase activity of purified kpdnab is based on the colorimetric determination of inorganic phosphate (pi) released by the hydrolysis of atp. the atpase activity assay for kpdnab (2050 ng) was performed in 20 mm hepes (ph 7.0), 100 pmol of x - ssdna, 10 m flavonol, 100 mm nacl, 3 mm mgcl2, and 5 mm atp in 100 l of reaction volume. liberated pi was detected using ammonium molybdate and malachite green solutions, and absorbance was measured at 610 nm using a uv / vis spectrophotometer (thermo scientific helios omega ; thermo fisher scientific inc., waltham, ma, usa). the atpase activity of kpdnab was calibrated with sodium phosphate (nah2po4) of known concentrations. the amino acid sequences of kpdnab, ecdnab, gsdnab, and gkdnab were aligned using clustalw2. the model of kpdnab was built from the coordinates of 2r6d (crystal structure of gsdnab), 2vyf (crystal structure of gkdnab), and 2vye (crystal structure of gkdnab in complex with ssdna) by using swiss - model, http://swissmodel.expasy.org/. the coordinate and topology file of the flavonols, myr, que, kae, and gal, was found in drugbank, http://www.drugbank.ca/. the flavonol was individually computationally docked into the three - dimensional models of kpdnab by using patchdock, http://bioinfo3d.cs.tau.ac.il/patchdock/. the gene kpn04439, encoding k. pneumoniae dnab helicase, was initially found using a database search through the national center for biotechnology information (ncbi). based on the known nucleotide sequence, the predicted kpdnab monomer protein has a length of 471 amino acid residues and a molecular mass of 52.5 kda, with a pi of 4.93. analysis of the primary structure of kpdnab revealed the presence of the putative walker a motif (aa 232238), walker b motif (aa 340343), atp binding sites (aa 237238, 343, 384, 420, 442, and 453), and dna binding sites (348, 349, 356358, 383391, 419 - 420, and 432 - 433) ; these are common in all known dnab helicases. figure 3 shows an alignment of the amino acid sequences of k. pneumoniae, e. coli, geobacillus stearothermophilus, and geobacillus kaustophilus dnab helicases ; their atp (boxed) and dna binding sites (shaded in gray) are highly conserved. the atpase activity of purified kpdnab is based on the vanadate - sensitive colorimetric determination of inorganic phosphate released by the hydrolysis of atp. figure 4(a) shows a standard linear regression curve generated by plotting the optical density (od) at 610 nm against the concentrations of sodium phosphate (nah2po4). after some preliminary experiments to establish a suitable range of concentrations for the reagents (including kpdnab) used for the assay, 3 mm mgcl2, 5 mm atp, 10 m flavonol, and 2050 ng of kpdnab were chosen for analysis of inhibition of kpdnab atpase activity by the flavonol. in the absence of the flavonol and x - ssdna, the specific activity of kpdnab was 0.42 0.09 molminmg. in the presence of x - ssdna, the specific activity of kpdnab these data are similar to reported values for ecdnab ; the activity of ecdnab is 3.3 10 (without m13 ssdna) and 6.4 10 pmolminmg (with m13 ssdna), respectively,. thus, the atpase activity of kpdnab was stimulated by ssdna, a property common to all dnab helicases. previously, we showed that the binding of kpdnab to dntp is inhibited by the flavonols myr, kae, gal, and que. here, as shown in figure 4(b), the atp hydrolysis activity of kpdnab was also inhibited by the flavonols. in the presence of myr, que, kae, or gal, the specific activity of kpdnab was decreased to 59%, 75%, 65%, and 57%, respectively, meaning that gal exhibited the strongest inhibitory effect on the atp hydrolysis of kpdnab in the presence of x - ssdna. to investigate whether the ssdna - binding ability of kpdnab is inhibited by the flavonol, we used emsa to study the binding of kpdnab to dt30 (figure 5) when mixed with myr, que, kae, or gal. in the absence of any flavonol, kpdnab formed a stable complex with dt30, as shown by electrophoresis (figure 5(a)). in the presence of 16.7 m gal (figure 5(b)), kae (figure 5(c)), que (figure 5(d)), or myr (figure 5(e)), kpdnab still bound to dt30, but the binding activity was slightly decreased. the apparent dissociation constant (kd, app) values of kpdnab bound to dt30 in the absence of any flavonol or presence of myr, que, kae, or gal, as determined from the titration curves, were 0.97 0.07, 1.11 0.05, 1.03 0.07, 1.10 0.05, and 1.03 0.06 m, respectively. it should be noted that the observed inhibition was dependent on protein concentration (figure 5(f)) ; the disruption of formation of the kpdnab - dt30 complex did disappear when its concentration was increased to 2.72 m, a value that the [flavonol]/[kpdnab monomer ] ratio is ~6.1 (16.7/2.73 = 6.14). to investigate whether the helicase activity of kpdnab is also inhibited by flavonols, the fluorescence helicase assay was carried out in the absence or presence of myr or gal. this assay, modified from that for hcv ns3 3-5 rna helicase, was found to be useful for kpdnab. the dsdna substrate was prepared by annealing 2 oligonucleotides, a 5 fluorophore - labeled (alexa fluor 488) 22-nucleotide donor and a 3 quencher - labeled (bhq1) 36-nucleotide quencher (figure 6(a)). when the dsdna substrate is unwound by the helicase, the fluorophore (f) emits upon its release from the quencher (q). the fluorescence quenching efficiency (signal - to - background ratio) for this substrate was > 90%, suggesting high sensitivity for monitoring helicase activity, similar to that for hcv ns3 rna helicase. because of its high inhibitory effects on the atpase activity of kpdnab (figure 4(b)), myr and gal were selected for this assay. when kpdnab was added, fluorescence was continuously emitted, whereas no increase in fluorescence occurred in the absence of kpdnab (as the negative control). these results indicate that the observed fluorescence emission arose from the unwinding of the dsdna substrate by purified kpdnab (figure 6(b)). when assaying the helicase activity of kpdnab in the presence of myr or gal, a linear increase in fluorescence emission in addition, the initial velocity for kpdnab helicase activity was nearly identical with or without flavonol (~1 10 fluorescence intensity / s). in contrast, unlike fluorescence emission of kpdnab that continued to increase, the fluorescence emission of kpdnab assayed in the presence of the flavonol myr or gal soon reached its maximal point. the magnitude of fluorescence activity for kpdnab was in the following order : no flavonol added > myr present > gal present. although kpdnab shows a high degree of sequence identity with ecdnab, its crystal structure is not yet reported. to deeply understand the structure - function relationship of the flavonol - kpdnab - ssdna complex(es), we decided to model its three - dimensional structure by homology modeling. the model of kpdnab was built from the coordinates of 2r6d (crystal structure of gsdnab), 2vyf (crystal structure of gkdnab) and 2vye (crystal structure of gkdnab in complex with ssdna) by using swiss - model, http://swissmodel.expasy.org/. kpdnab and gkdnab share 47% identity and 69%, similarity, and kpdnab and gsdnab share 46% identity and 69% similarity, respectively, in the amino acid sequences level. the three - dimensional model of the hexameric kpdnabs all forms a ring structure (figure 7(a)), of which the loop i position in gkdnab - ssdna complex based model was different. we propose that, as in the gkdnab complexes, loop i of kpdnab undergoes a conformational change, and thereby playing an important role in stabilizing dna binding. it should be noted that the ntp - binding site, walker a and b motifs, is adjacent to the dna interaction site loop i (figure 7(b)). the flavonol, found in drugbank, was individually computationally docked into the three - dimensional models of kpdnab by using patchdock, http://bioinfo3d.cs.tau.ac.il/patchdock/. after uploading the coordinate and topology file of the flavonol and kpdnab, the docking was automatically performed. the docking results for kpdnab (gkdnab based model) interacting with myr or que are shown in figure 8 and table 1. myr (figure 8(a)) and que (figure 8(b)) were found to be docked in the atp - binding pocket of kpdnab ; however, there were also a few binding poses docked outside the pocket (figure 8(b)). despite a similar structure, these flavonols were found to be docked with distinct binding poses in the atp - binding pocket of both dna - unbound and dna - bound models of kpdnab. for example, the binding pose of kpdnab to myr is different from that of que (figure 9(a)). que, the compound with 2 hydroxyl groups on the b ring, interacts with l214 and n215, whereas myr (3 hydroxyl groups) interacts with l214, n247, and f460. in addition, the same compound is also found to be docked in different positions of the atp - binding pocket of both dna - unbound and dna - bound models of kpdnab. for instance, myr interacts with l214, n247, and f460 in the dna - unbound model, and interacts with l214 and n462 in the dna - bound model of kpdnab, respectively (figure 9(b)). generally, l214 is a key residue in all dna - unbound and dna - bound modeled structures regardless of which flavonol was used. the development of clinically useful small molecule antibiotics has been a seminal event in the world of infectious diseases. dna replication is one of the most basic biological functions and should be a prime target in antibiotic development. for example, some novel inhibitors were discovered to target topoisomerase [36, 37 ], dna gyrase, rna polymerase, helicase - primase, and retroviral reverse transcriptase [41, 42 ]. since dna helicases are important components of the cellular replication machinery in all organisms, inhibition of helicase activity would be detrimental to bacterial survival as well. previously, we have shown that some flavonoid compounds can directly bind to kpdnab and inhibit its binding ability to nucleotides, thus interfering with the growth of k. pneumoniae. flavonoids are the most common group of plant polyphenols with antioxidant, antiradical, and antibacterial activities. it is now clear that some flavonoids are atp - inhibiting agents as competitors for atp - binding proteins. for example, several flavonoid derivatives have been developed as therapeutic agents for cancer. in this study, we used several assays to analyze the effects of 4 flavonols, namely, myr, que, kae, and gal which contain different numbers of hydroxyl substituents on the aromatic rings on the ssdna binding, atp hydrolysis, and dsdna unwinding abilities of kpdnab. for the first time, our results demonstrated that these flavonols were capable of inhibiting the unwinding activity of the helicase. previously, we showed that the binding of kpdnab to dntp is inhibited by the flavonols myr, kae, gal, and que. this study further investigated the flavonol - mediated inhibition of kpdnab binding to dntp, which may have led to the associated decrease in atpase activity in the presence of ssdna (figure 4). the atp - hydrolyzing activity of kpdnab was inhibited by flavonols in the following order of decreasing efficiency : gal > myr > kae > que. although it is well established that flavonoids have several hydroxyl groups, and thus have marked potentials to bind any protein, the strength of inhibition of kpdnab atp - hydrolyzing activity did not correlate with the number of hydroxyl substituents on the flavonol aromatic rings. in addition, the structural model of kpdnab shows that these flavonols bind to kpdnab with distinct binding poses in the atp - binding pocket (figure 9). this situation is also found in several atp - binding proteins that bind to different flavonoids. crystal structures of pim1 kinase in complex with quercetagetin and myr reveal 2 distinct binding poses in the atp - binding pocket, namely, orientations i and ii. myr, adopting orientation ii, has flipped 180 in pim1 kinase, in contrast to quercetagetin (orientation i), such that the b ring is oriented toward the entrance of the atp pocket. these orientations in pim1 are also found to closely resemble those of que and myr in phosphatidylinositol 3-kinase. although the atp - binding pocket in these proteins, including kpdnab, is different, cases of pim1 and phosphatidylinositol 3-kinase with different binding poses,, flavonols may bind to kpdnab by using different mechanisms, as shown in the structural models (figures 8 and 9). this may explain why the strength of inhibition in kpdnab atpase activity was not correlated with the number of hydroxyl substituents on the flavonol aromatic rings. other studies showed that myr noncompetitively inhibits e. coli dnab helicase with an ic50 of approximately 10 m ; however, we have recently discovered that gal, kae, que, and myr can inhibit dntp binding to kpdnab, indicating a specific inhibitory process. it is not known whether this disparity is due to the inherent differences among the species, or an alternative (allosteric) binding site(s) in dnab helicase. however, the docking results also show that a few binding poses of the flavonol outside the atp - binding pocket (figure 8), suggesting that there may be more than one site for flavonol binding in the dnab helicase. in addition, we also showed flavonol - mediated inhibition of kpdnab - ssdna complex formation, which depended on the [flavonol]/[kpdnab monomer ] ratio ; at a ~6 fold ratio, the inhibitory effect did disappear (figure 5). since these flavonols inhibited not only the atpase activity of kpdnab but also the ssdna - binding ability, we believe that there may be more than one site in kpdnab for flavonol binding., we describe a new in vitro fluorescence assay for measuring 5-3 dna helicase activity by using dsdna substrate (figure 6). this assay enables the real - time, high - throughput measurement of dna helicase activity, and does not require time - consuming procedures like the conventional gel - based assays. for example, on the basis of this assay, we observed that the initial velocity of kpdnab for the unwinding activity assayed in the absence of the flavonol, or with myr or gal were very similar ; however, their maximal activities were different. while fluorescence was continuously emitted without the addition of flavonol to the kpdnab solution, the fluorescence increase stopped at ~300 s and ~600 s for myr and gal, respectively (figure 6(b)). this real - time unwinding kinetics of the dna helicase can not be easily observed by the conventional gel - based assays. all dna - unbound and dna - bound modeled structures showed flavonols binding to kpdnab with distinct poses. however, these models all displayed a key residue involved in the flavonol binding, namely, l214. the l214 residue in dnab helicases is highly conserved (figure 3), but its role has not yet been determined. on the basis of these results, we propose that these flavonols may inhibit kpdnab in 2 possible ways. first, since dnab helicase binding to dntp causes a large conformational change [31, 47, 48 ] to become a translocase, these flavonols may partially occupy the atp - binding pocket of the dnab helicase and inhibit conformational change, thereby causing varying degrees of inhibition. this is a possible inhibition mechanism because the l214 residue of kpdnab is not involved in atp binding (figure 3), but most structural models indicate its importance in binding flavonols (figure 9). second, more than one flavonol binds to kpdnab ; 1 is at the active site, and the other(s) is at an unknown site. the overall inhibition possibly results from the interactions between the flavonols and the enzyme. this may be a reason why flavonols not only bind at the atp pocket of the dna helicase, but can also non - competitively inhibit the atpase activity of the dna helicase. our crystal structure of gkdnab in complex with ssdna previously suggested that atp hydrolysis may drive the movement of the helicase toward the 3 end of the lagging strand. in addition, the dntp - binding site of the helicase at loop i, part of the walker b motif, is adjacent to the dna interaction site. in conclusion, the flavonol likely inhibits the dna helicase (translocase) activity by affecting the atp binding of kpdnab, to ultimately shut down and lock the enzyme in the atp - unbound state. | dnab helicases are motor proteins essential for dna replication, repair, and recombination and may be a promising target for developing new drugs for antibiotic - resistant bacteria. previously, we established that flavonols significantly decreased the binding ability of klebsiella pneumoniae dnab helicase (kpdnab) to dntp. here, we further investigated the effect of flavonols on the inhibition of the ssdna binding, atpase activity, and dsdna - unwinding activity of kpdnab. the ssdna - stimulated atpase activity of kpdnab was decreased to 59%, 75%, 65%, and 57%, in the presence of myricetin, quercetin, kaempferol, and galangin, respectively. the ssdna - binding activity of kpdnab was only slightly decreased by flavonols. we used a continuous fluorescence assay, based on fluorescence resonance energy transfer (fret), for real - time monitoring of kpdnab helicase activity in the absence and presence of flavonols. using this assay, the flavonol - mediated inhibition of the dsdna - unwinding activity of kpdnab was observed. modeled structures of bound and unbound dna showed flavonols binding to kpdnab with distinct poses. in addition, these structural models indicated that l214 is a key residue in binding any flavonol. on the basis of these results, we proposed mechanisms for flavonol inhibition of dna helicase. the resulting information may be useful in designing compounds that target k. pneumoniae and other bacterial dnab helicases. |
for the case cohort, ethical approval was obtained from the local institutional review boards at each of the participating centres. informed consent was obtained from all participants, or from their parents / legal guardians in the case of children. in the discovery phase, control genotype data from healthy individuals of uk ancestry were obtained from the wellcome trust case control consortium 2 (wtccc2). in the replication phase, control genotype data from healthy individuals of northern european ancestry were obtained from the twinsuk resource. only the first twin from each pair of genotyped twins (2603 unrelated individuals) contributed to the present study. although no specific measures were taken to exclude chd in the control cohorts, the prevalence of chd in adult populations (~0.31%) indicates that any loss of power due to misspecification of controls would be negligible. genotyping of the discovery cohort used the illumina660wquad array, and genotyping of replication snps used sequenom maldi - tof. genotyping was carried out at the centre national de genotypage (evry cedex), france. qc procedures were carried out in plink version 1.07 with visualisation performed in r. genotype data was initially generated at 557124 snps across the genome for 1995 individuals with chd. we excluded individuals with genotype call rates 95% of individuals and with a hardy - weinberg equilibrium test p value > 10). these exclusion thresholds were chosen based on visual inspection of the call rates and heterozygosities in order to retain the majority of individuals while excluding outlying individuals (supplementary figure 7). we generated a smaller set of 40521 autosomal snps (successfully genotyped in > 95% of individuals, with a hardy - weinberg equilibrium test p value > 10, with minor allele frequencies > 0.4 and pruned to show low levels of ld using the plink command --indep 50 5 2) that were used to check relationships / sample duplications and ethnicities. genome - wide identity - by - descent (ibd) sharing was calculated using the --z - genome command in plink and one of each pair of related individuals (defined as having probability > 8% of sharing 0 alleles multidimensional scaling of our samples together with 210 unrelated phase ii hapmap individuals from four populations (ceu, jpt, chb, yri) (genotyped at the same set of 40521 autosomal snps) was performed and identified 22 individuals in our study that did not cluster with the ceu samples, suggesting non - european ancestry (supplementary figure 7). we used the --check - sex option in plink to check (on the basis of average x chromosomal heterozygosity) that the gender of our samples matched its expected value, and excluded samples for which we were unable to resolve inconsistencies. following qc, we were left with 1819 unrelated chd cases, whose genotypes were compared with genotype data from 5159 uk population - based controls obtained from the wtccc2. these controls comprised 2673 samples from the 1958 british birth cohort (58c) and 2486 national blood service (nbs) samples (selected from an initially genotyped set of 2930 58c samples and 2737 nbs samples). we excluded the same controls as had been excluded in the wtccc2 and wtccc3 studies, plus an additional 4 controls that we found to be outliers following a principal components analysis using the smartpca routine of the eigensoft package. within each of the case and control cohorts, we excluded any snps with minor allele frequencies 2% missing genotypes) and plate effects (exclude if p value from an n - degree of freedom test of plate association 95% of individuals and with a hardy - weinberg equilibrium test p value > 10). these exclusion thresholds were chosen based on visual inspection of the call rates and heterozygosities. we carried out testing of relationships / sample duplications and ethnicity using the same approach as described above for the chd cohort, and excluded first twins that did not cluster with the ceu hapmap samples and one of each pair of first twins that showed high ibd sharing (mean proportion of alleles ibd > 0.05). we also used plink to perform multidimensional scaling of the twinsuk samples together with the discovery cases and controls, and excluded those twins that did not cluster sufficiently closely with the discovery cases and controls. this resulted in a final set of 2520 twinsuk controls to be used in the replication study. multidimensional scaling plots for all discovery samples (cases and controls) and replication controls that were included in the final analyses (calculated after the exclusion of any outlying individuals) are shown in supplementary figure 12. association in the replication cohort was assessed initially using the cochran - armitage trend test implemented in plink, and subsequently (for all snps taken forward for replication) via logistic regression analysis in plink. to combine the discovery and replication results we performed a standard fixed - effects meta analysis on the basis of the estimated log odds ratios and their standard errors, implemented via the --meta - analysis command in plink. we used the program impute version 2 to carry out imputation in the discovery cohort across the 4p16 region, using the -pgs option to replace genotyped snps with their imputed values. data from the 1000 genomes project (phase i version 3 integrated data, released march 2012) was used as a reference panel, with 392 snps that had been genotyped in both cases and controls in the 2 mb region around rs870142 used to inform the imputation. post - imputation qc involved excluding any snps likely to be poorly imputed (specifically those with an info score 95% of individuals and with a hardy - weinberg equilibrium test p value > 10). these exclusion thresholds were chosen based on visual inspection of the call rates and heterozygosities in order to retain the majority of individuals while excluding outlying individuals (supplementary figure 7). we generated a smaller set of 40521 autosomal snps (successfully genotyped in > 95% of individuals, with a hardy - weinberg equilibrium test p value > 10, with minor allele frequencies > 0.4 and pruned to show low levels of ld using the plink command --indep 50 5 2) that were used to check relationships / sample duplications and ethnicities. genome - wide identity - by - descent (ibd) sharing was calculated using the --z - genome command in plink and one of each pair of related individuals (defined as having probability > 8% of sharing 0 alleles multidimensional scaling of our samples together with 210 unrelated phase ii hapmap individuals from four populations (ceu, jpt, chb, yri) (genotyped at the same set of 40521 autosomal snps) was performed and identified 22 individuals in our study that did not cluster with the ceu samples, suggesting non - european ancestry (supplementary figure 7). we used the --check - sex option in plink to check (on the basis of average x chromosomal heterozygosity) that the gender of our samples matched its expected value, and excluded samples for which we were unable to resolve inconsistencies. following qc, we were left with 1819 unrelated chd cases, whose genotypes were compared with genotype data from 5159 uk population - based controls obtained from the wtccc2. these controls comprised 2673 samples from the 1958 british birth cohort (58c) and 2486 national blood service (nbs) samples (selected from an initially genotyped set of 2930 58c samples and 2737 nbs samples). we excluded the same controls as had been excluded in the wtccc2 and wtccc3 studies, plus an additional 4 controls that we found to be outliers following a principal components analysis using the smartpca routine of the eigensoft package. within each of the case and control cohorts, we excluded any snps with minor allele frequencies 2% missing genotypes) and plate effects (exclude if p value from an n - degree of freedom test of plate association 95% of individuals and with a hardy - weinberg equilibrium test p value > 10). these exclusion thresholds were chosen based on visual inspection of the call rates and heterozygosities. we carried out testing of relationships / sample duplications and ethnicity using the same approach as described above for the chd cohort, and excluded first twins that did not cluster with the ceu hapmap samples and one of each pair of first twins that showed high ibd sharing (mean proportion of alleles ibd > 0.05). we also used plink to perform multidimensional scaling of the twinsuk samples together with the discovery cases and controls, and excluded those twins that did not cluster sufficiently closely with the discovery cases and controls. this resulted in a final set of 2520 twinsuk controls to be used in the replication study. multidimensional scaling plots for all discovery samples (cases and controls) and replication controls that were included in the final analyses (calculated after the exclusion of any outlying individuals) are shown in supplementary figure 12. association in the replication cohort was assessed initially using the cochran - armitage trend test implemented in plink, and subsequently (for all snps taken forward for replication) via logistic regression analysis in plink. to combine the discovery and replication results we performed a standard fixed - effects meta analysis on the basis of the estimated log odds ratios and their standard errors, implemented via the --meta - analysis command in plink. we used the program impute version 2 to carry out imputation in the discovery cohort across the 4p16 region, using the -pgs option to replace genotyped snps with their imputed values. data from the 1000 genomes project (phase i version 3 integrated data, released march 2012) was used as a reference panel, with 392 snps that had been genotyped in both cases and controls in the 2 mb region around rs870142 used to inform the imputation. post - imputation qc involved excluding any snps likely to be poorly imputed (specifically those with an info score 95% of individuals and with a hardy - weinberg equilibrium test p value > 10). these exclusion thresholds were chosen based on visual inspection of the call rates and heterozygosities in order to retain the majority of individuals while excluding outlying individuals (supplementary figure 7). we generated a smaller set of 40521 autosomal snps (successfully genotyped in > 95% of individuals, with a hardy - weinberg equilibrium test p value > 10, with minor allele frequencies > 0.4 and pruned to show low levels of ld using the plink command --indep 50 5 2) that were used to check relationships / sample duplications and ethnicities. genome - wide identity - by - descent (ibd) sharing was calculated using the --z - genome command in plink and one of each pair of related individuals (defined as having probability > 8% of sharing 0 alleles multidimensional scaling of our samples together with 210 unrelated phase ii hapmap individuals from four populations (ceu, jpt, chb, yri) (genotyped at the same set of 40521 autosomal snps) was performed and identified 22 individuals in our study that did not cluster with the ceu samples, suggesting non - european ancestry (supplementary figure 7). we used the --check - sex option in plink to check (on the basis of average x chromosomal heterozygosity) that the gender of our samples matched its expected value, and excluded samples for which we were unable to resolve inconsistencies. following qc, we were left with 1819 unrelated chd cases, whose genotypes were compared with genotype data from 5159 uk population - based controls obtained from the wtccc2. these controls comprised 2673 samples from the 1958 british birth cohort (58c) and 2486 national blood service (nbs) samples (selected from an initially genotyped set of 2930 58c samples and 2737 nbs samples). we excluded the same controls as had been excluded in the wtccc2 and wtccc3 studies, plus an additional 4 controls that we found to be outliers following a principal components analysis using the smartpca routine of the eigensoft package. within each of the case and control cohorts, we excluded any snps with minor allele frequencies 2% missing genotypes) and plate effects (exclude if p value from an n - degree of freedom test of plate association 95% of individuals and with a hardy - weinberg equilibrium test p value > 10). these exclusion thresholds were chosen based on visual inspection of the call rates and heterozygosities. we carried out testing of relationships / sample duplications and ethnicity using the same approach as described above for the chd cohort, and excluded first twins that did not cluster with the ceu hapmap samples and one of each pair of first twins that showed high ibd sharing (mean proportion of alleles ibd > 0.05). we also used plink to perform multidimensional scaling of the twinsuk samples together with the discovery cases and controls, and excluded those twins that did not cluster sufficiently closely with the discovery cases and controls. this resulted in a final set of 2520 twinsuk controls to be used in the replication study. multidimensional scaling plots for all discovery samples (cases and controls) and replication controls that were included in the final analyses (calculated after the exclusion of any outlying individuals) are shown in supplementary figure 12. association in the replication cohort was assessed initially using the cochran - armitage trend test implemented in plink, and subsequently (for all snps taken forward for replication) via logistic regression analysis in plink. to combine the discovery and replication results we performed a standard fixed - effects meta analysis on the basis of the estimated log odds ratios and their standard errors, implemented via the --meta - analysis command in plink. we used the program impute version 2 to carry out imputation in the discovery cohort across the 4p16 region, using the -pgs option to replace genotyped snps with their imputed values. data from the 1000 genomes project (phase i version 3 integrated data, released march 2012) was used as a reference panel, with 392 snps that had been genotyped in both cases and controls in the 2 mb region around rs870142 used to inform the imputation. post - imputation qc involved excluding any snps likely to be poorly imputed (specifically those with an info score < 0.5). 8405 snps passing post - imputation qc (from an original 36461 imputed snps) were analysed via a frequentist allelic association test in the program snptest version 2.1.1 using the in situ hybridisation to demonstrate expression of msx1 in developing mouse heart was performed as previously described. a 500bp econi - sphi fragment of the 3utr of mouse msx1 (nm_010835 ; bp1161 - 1697) was used as a template for the msx1 antisense probe. segments of genomic sequence spanning each of the three snps showing association with asd in 4p16 were used as queries for a blast search of human expressed sequence tags (ests). an unspliced est (genbank accession number bi192733.1) derived from an epithelioid carcinoma cell line the corresponding full - length est clone was obtained (source bioscience, nottingham, uk) and the insert sequenced completely, showing no significant open reading frame. a poly - a tail was present in the transcript despite the absence of a consensus polyadenylation signal. the poly - a tail of this transcript was shown to be present in the genomic sequence. an rt - pcr assay was performed to assess expression of the transcript in the developing human heart. 1 g of human fetal heart total rna, which was extracted from pooled heart tissue derived from fetuses between 9 and 20 weeks (clontech, mountain view, ca, catalogue no. 636583), and 1g of human testis total rna (clontech, catalogue no. 636533) were reverse transcribed using 400ng random hexamers (thermo scientific, thermo fisher scientific inc, usa) and 200u m - mulv reverse transcriptase (new england biolabs, uk), in a final volume of 25 l. synthesised cdna was used as the template for rtpcr, which was carried out in a reaction volume of 25l containing 1l cdna, 21l megamix (microzone ltd, uk) and 10m of each primer (supplementary table 4). thermocycling consisted of an initial step at 96c for 5 minutes then 34 cycles consisting of denaturing at 96c for 45 seconds, annealing at 58.3c for 45 seconds and extension at 72c for 1 minute with a final extension at 72c for 5 minutes. human left ventricular samples were obtained from 181 non - diseased hearts of unrelated organ donors of european descent whose hearts were either explanted to obtain pulmonary and aortic valves for transplant surgery, or intended for transplantation but not used for logistical reasons. the tissues were collected at the university of szeged, hungary (n=65), vanderbilt university, usa (n=54), the university of miami, usa (n=37) and the university of sydney, australia (n=25). procurement and handling of the material was approved by the ethical review boards of each centre. preparation of crna (totalprep-96 rna amplification kit) and chip hybridisation (illumina humanht-12 v4) for genome - wide expression analyses were performed at servicexs (leiden, the netherlands), according to the manufacturer s instructions. probes containing common snps (hapmap phase iii release 2) and probes whose sequence did not align unambiguously to the human reference genome (hg19) were excluded. snp genotyping was carried out using illumina humanomniexpress beadchips at the genome analysis center, helmholz center, munich, germany. imputation was performed using mach and the hapmap phase iii release 2 data. only snps imputed with high confidence were retained. after pre - processing and qc, a total of 129 samples remained for eqtl analysis. loc100507266 transcript levels were tested for association with genotypes at rs870142, rs6824295 and rs16835979 using linear models, with age, gender and recruitment centre as covariates. | we carried out a genome - wide association study (gwas) of congenital heart disease (chd). our discovery cohort comprised 1,995 chd cases and 5,159 controls, and included patients from each of the three major clinical chd categories (septal, obstructive and cyanotic defects). when all chd phenotypes were considered together, no regions achieved genome - wide significant association. however, a region on chromosome 4p16, adjacent to the msx1 and stx18 genes, was associated (p=9.5107) with the risk of ostium secundum atrial septal defect (asd) in the discovery cohort (n=340 cases), and this was replicated in a further 417 asd cases and 2520 controls (replication p=5.0105 ; or in replication cohort 1.40 [95% ci 1.19 - 1.65 ] ; combined p=2.61010). genotype accounted for ~9% of the population attributable risk of asd. |
in diagnostic medical imaging the performance of imaging modalities needs to be tested and evaluated on a regular basis in order to ensure correct functionality and optimal image quality. systems are analyzed by a variety of methods [1, 2 ]. for pet scanners in particular, the national electrical manufacturers association (nema) has defined a standard to assess the performance of the tomographic system. such image quality control measurements also need to be conducted in pet / mr hybrid imaging for pet performance measurements when introducing a new system [1, 2 ] or, on a regular basis, when monitoring quality of a specific pet system over time. comparability in clinical studies evaluating pet / ct and pet / mr imaging performance in patient studies also relies on nema iq phantom measurements [4, 5 ]. furthermore, accurate nema iq phantom measurements are a precondition for studies investigating the attenuating influence of new hardware components such as radiofrequency (rf) coils [6, 7 ] and radio therapy planning equipment that are designed for use in pet / mr systems. dose optimization studies that have been reported for pet / mr hybrid imaging also rely on nema iq phantom measurements. all these studies have in common that they build on accurate methods for attenuation correction (ac) of the phantoms involved. to obtain quantitative pet images that can be used to determine the scanner performance parameters, the acquired pet data need to be corrected for attenuation of the photons caused by the scanned object as well as by the attenuating hardware components of the system. in pet / ct imaging, information about the attenuating characteristics of the scanned object is derived from the ct scan itself. in pet / mr patient imaging, mr - based attenuation correction (ac) methods are applied to correct for attenuation caused by human tissue, however, the applicability in phantom imaging has not yet been quantified. current mr - based ac only considers the fluid phantom filling as it provides sufficient mr signal, but it does not correct for plastic or glass materials commonly used in pet phantom housings, as these can not be reliably detected in standard mr imaging (fig. b mr imaging (in - phase image) of the nema iq phantom using the mr ac dixon vibe sequence showing only fluid phantom filling (water). the phantom housing (plexiglas) is not visible in mr imaging and thus, also not considered in the mr - based -map of the phantom (c). note that the glass spheres are displayed as signal voids (dark rims in b) that are segmented as water in the mr - based -map (c) a the nema iq phantom. b mr imaging (in - phase image) of the nema iq phantom using the mr ac dixon vibe sequence showing only fluid phantom filling (water). the phantom housing (plexiglas) is not visible in mr imaging and thus, also not considered in the mr - based -map of the phantom (c). note that the glass spheres are displayed as signal voids (dark rims in b) that are segmented as water in the mr - based -map (c) in this study, therefore, an alternative strategy for performing nema iq phantom measurements is evaluated. the use of ct - based ac maps and templates for attenuation correction of hardware components such as the pet / mr system patient table and various stationary and mechanically rigid radiofrequency (rf) coils can be considered as the current standard approach for hardware component ac in combined pet / mr systems across all vendors. consequently, this study proposes to use a pre - acquired ct - based template -map of the filled nema iq phantom in conjunction with a phantom holder and to install this template -map on the pet / mr system to be used for ac whenever nema iq phantom experiments are performed. this study investigates the standard nema iq test utilizing ct - based ac for the biograph mmr pet / mr hybrid system (siemens healthcare, erlangen, germany). contrast recovery, background variability and signal - to - noise ratio are determined as a function of different reconstruction parameters. in comparison, the effect of mr - based ac is evaluated and the impact on the image quality parameters assessed. all phantom experiments were performed on an integrated pet / mr whole - body hybrid system (biograph mmr, siemens ag). the mr component of the hybrid system consists of a 3.0 tesla static magnetic field, a radiofrequency (rf) transmit body coil and a gradient coil system which provides a maximum amplitude of 45 mt / m and a maximum slew rate of 200 t / m / s. the pet component is comprised of 8 detector rings, each consisting of 56 detector blocks. one detector block consists of 8x8 lutetium oxyorthosilicate (lso) scintillator crystal elements connected to 3 x 3 avalanche photodiodes (apds). according to the nema nu 22007 standard, image quality parameters of pet scanners are obtained by measuring a specific international electrotechnical commission (iec) 616751 emission phantom (nema image quality phantom) (fig. 1a, ptw, freiburg, germany). this image quality phantom mimics the shape of an upper human body and is built of acrylic glass material. it comprises 6 hollow glass spheres (inner diameters 37, 28, 22, 17, 13, and 10 mm) which can be inserted into the large phantom compartment. additionally a cylindrical insert containing styrofoam with an average density of 0.3 0.1 g ml (simulates patient lung tissue (lung - insert ~ 0.026 cm) and is positioned in the center of the phantom. the volume of the tested phantom (ptw, freiburg, germany, fig. 1a) was measured to be 9.5 l 1 % when the spheres and lung cylinder are inserted. the phantom housing has a thickness of approximately 3 mm along the phantom body, and 10 mm (in few parts 20 mm) at the lids at both ends of the phantom. the glass material (0.118 cm) of the spheres has a thickness of around 1 mm. when nema iq measurements with a ct - based phantom template -map are performed, the phantom needs to be placed at a pre - defined position in the pet field of view (fov) with a known reference to the patient table, to ensure alignment between the -map and the position of the phantom. to guarantee a reproducible phantom placement, a defined set of phantom holders a spacer is positioned adjacent to the rf head coil connection port on the patient table in order to create a defined and reproducible distance of the nema iq phantom to the stronger photon - attenuating rf coil port. the nema iq phantom is placed next to the spacer on a foam block, which was designed in order to align the phantom at a pre - defined patient table position. as required by the nema standard, a scatter phantom (a 70 cm long plastic cylinder with an activated line source) is positioned contiguously to the nema iq phantom to generate scattered and random coincidences from outside the fov, such as in a patient examination (fig. 2).fig. 2the nema iq phantom imaging setup as performed in this study. the schematic drawing in (a) and the image in (b) show the spacer (1), the nema iq phantom (2), and the scatter phantom (3) arranged on top of the pet / mr system patient table the spacer (1) ensures a predefined and reproducible position of the phantom (2) on the patient table the nema iq phantom imaging setup as performed in this study. the schematic drawing in (a) and the image in (b) show the spacer (1), the nema iq phantom (2), and the scatter phantom (3) arranged on top of the pet / mr system patient table. the spacer (1) ensures a predefined and reproducible position of the phantom (2) on the patient table the background volume of the nema iq phantom and the four smallest spheres were filled with f - fdg mixed with pure water using a 4:1 sphere - to - background activity concentration ratio, as specified by nema. the initial tracer activity concentration was specifically calibrated to the start of the measurement : 5.3 kbq / ml 1 % in the phantom background and 21.2 kbq / ml 5 % in the four smallest spheres. the non - radioactive cylindrical insert simulating lung tissue was placed in the center of the phantom. the line source contained in the large scatter phantom was injected with 110 mbq of f - fdg. the defined measurement time by the nema nu 22007 standard is dependent on the axial imaging distance of the pet system and amounted to 12 min in one bed position for the biograph mmr. this imaging time resulted from the specification of nema nu 22007 that 100 cm of axial imaging distance shall be covered in 60 min. the pet images were reconstructed using the 3d ordinary poisson ordered - subset - expectation - maximization (op - osem) reconstruction algorithm as implemented in the system. according to the nema nu 22007 protocol, pet image quality is analyzed by means of two parameters : contrast recovery and background variability [3, 15 ]. these parameters are calculated by evaluation of various regions of interest (rois) in the transverse image slice that contains the centers of the spheres, as well as in adjacent slices (fig. 3position of the regions of interest (rois) placed over the active spheres (red), nonradioactive spheres (blue) and the phantom background (green) of the reconstructed pet images, which are used for analysisdrawn over the spheres as well as in the background region as is illustrated in fig. 3. in this study the evaluation of the rois was performed with the open - source image analysis tool imagej (fiji). position of the regions of interest (rois) placed over the active spheres (red), nonradioactive spheres (blue) and the phantom background (green) of the reconstructed pet images, which are used for analysis the percentage contrast recovery (in an ideal case = 100 %) is determined for each hot sphere j by:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { q}_{h, j}=\frac{\raisebox{1ex}{${c}_{h, j}$}\!\left/ \!\raisebox{-1ex}{${c}_{b, j}$}\right. - 1}{\raisebox{1ex}{${a}_h$}\!\left/ \!\raisebox{-1ex}{${a}_b$}\right. - 1}100\ \left[\%\right ] $ $ \end{document}qh, j = ch, jcb, j1ahab1 100% ch, j = average counts in the roi for sphere j cb, j = average counts in the background roi for sphere j ah = activity concentration in the hot spheres ab = activity concentration in the background for each nonradioactive sphere j the percentage contrast recovery qc, j is given by:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { q}_{c, j } = \left(1 - \frac{c_{c, j}}{c_{b, j}}\right)100\ \left[\%\right ] $ $ \end{document}qc, j=1cc, jcb, j100% cc, j = average counts in the roi for sphere j cb, j = average of all background roi counts for sphere j in order to determine the percentage background variability nj as a measure for the image noise for sphere j (in an ideal case = 0 %), the following equation is used:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { n}_j = \frac{s{d}_j}{c_{b, j}}100\ \left[\%\right ] $ $ \end{document}nj = sdjcb, j100% sdj = standard deviation of the background roi counts for sphere j cb, j = average of all background roi counts for sphere j to evaluate the effect of neglecting acrylic glass and glass material in the attenuation correction of the nema iq phantom emission data, reconstructions with an mr - based -map containing only the fluid phantom filling were performed and nema iq parameters were calculated. linear attenuation coefficients of water were assigned to the whole phantom content including phantom liquid and glass inserts, despite of higher attenuation of the glass material of the spheres. for reconstruction, the above - mentioned op - osem algorithm was used with 3 iterations, 21 subsets, 172 matrix size, and 4 mm gaussian post - smoothing filter. mr - based ac was performed by a 3d dixon vibe - based approach with the following imaging sequence parameters : tr : 4.07 ms, te in - phase : 2.46 ms, te opposed - phase : 1.23 ms, flip angle : 10, slice thickness : 3.12 mm, field of view : 500 mm x 328 mm and matrix size : 128 x 84. the system s built - in rf transmit body coil was used for rf transmission and signal reception. all other rf coils were removed from the patient table to avoid additional pet photon attenuation. the assigned -values were restricted to two -values for water and air for the performed phantom measurements. in general, imaging the nema iq phantom filled with pure water on a 3.0 tesla mr system leads to artifacts and signal inhomogeneities due to standing - rf - wave phenomena and t1 effects, thus affecting mr - based ac of the nema phantom in pet / mr hybrid imaging (as shown in). manually reducing the initial voltage of the rf transmitter adjustment algorithm led to a lower adjusted transmitter voltage of 92.7 volts, instead of the default value for patient imaging (~300 v), and resulted in fairly homogeneous -maps of the nema iq phantom filling (fig. alternatively the addition of substances (e.g. niso4) could be considered that decrease the t1 relaxation time of water and as a consequence decrease the mentioned image artefacts, as discussed in. 4 a mr - based -map in transversal and coronal orientation only contains discrete attenuation values for water and air, and therefore only corrects for photon attenuation caused by the water content of the phantom and not by the phantom housing materials, as these materials can not be detected with standard mr imaging. b, c ct - based -map contains continuous attenuation values including -values for the phantom housing, glass spheres, and styrofoam block used as phantom holder (displayed in c). b and c visualize the same content, however windowing properties were adjusted individually in order to visualize either the phantom content (b) or the styrofoam holder, on which the phantom is placed (c) a mr - based -map in transversal and coronal orientation only contains discrete attenuation values for water and air, and therefore only corrects for photon attenuation caused by the water content of the phantom and not by the phantom housing materials, as these materials can not be detected with standard mr imaging. b, c ct - based -map contains continuous attenuation values including -values for the phantom housing, glass spheres, and styrofoam block used as phantom holder (displayed in c). b and c visualize the same content, however windowing properties were adjusted individually in order to visualize either the phantom content (b) or the styrofoam holder, on which the phantom is placed (c) the ct image of the phantom, which was used to generate the ct - based template -map (fig. 4b and c), was acquired on a 128-slice pet / ct system (biograph 128, siemens ag) with the following parameters : 500 effective mas and 140 kvp. images were reconstructed with 0.6 mm slice thickness, 512 x 512 image matrix size and a b30f convolution kernel. following a 2 mm gaussian filtering and bilinear scaling of the ct hounsfield units to linear attenuation coefficients at the pet energy level of 511 kev, the ct - based -map was installed on the pet / mr system in order to be used for ac whenever nema iq measurements are performed. the phantom holder minimizes misalignment between the actual phantom position and the ct - based template ac map of the phantom as much as possible. in case of remaining slight misplacement between ct - based phantom template and actual phantom position, a practical use of a ct - ac method as proposed in this study by potential future pet / mr users will require the registration to be performed based solely on the images available. thus the registration in this study was also performed by means of the available information from the pet and ct images in order to simulate a realistic case. this was performed by using the inherent landmarks of the phantom such as the glass spheres, the lung insert and the phantom outer boundary that function as orientation when performing manual image registration. for the pet measurements utilizing ct - based ac, reconstruction parameters were set to 3d op - osem with 3 iterations, 21 subsets, 172 matrix size and 4 mm gaussian filtering, as also used with mr - based ac. pet performance parameters, as well as the visibility of lesions in phantom and patient images, in general strongly depend on the applied reconstruction algorithm parameters. to investigate this effect in the specific context of nema iq phantom imaging particularly for the biograph mmr system and its pet detector geometry and reconstruction algorithm, different reconstructions of the same pet phantom data acquisition using ct - based attenuation correction were evaluated. hereby the number of iterations (15 iterations), the image matrix size (172 x 172, 344 x 344 matrix) and the gaussian filter (2 mm, 4 mm) were varied and the resulting impact on the image quality was investigated, as has been discussed often in the literature and is described e.g. in. the number of subsets was kept constant at 21 as this is the default setting on the scanner console. to determine the optimal reconstruction parameters for best nema iq phantom image quality with high lesion contrast and low background noise, the signal - to - noise ratio (snr) was selected as a representative image quality measure and was calculated for each active sphere and for all listed reconstruction parameter combinations. the snr for sphere j was determined, as described in the literature when performing similar evaluations for pet / ct imaging [20, 21 ], according to the following equation:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ sn{r}_j = \frac{signa{l}_j- background}{\sigma_b\ } $ $ \end{document}snrj = signaljbackgroundb signalj = average counts in the roi for sphere j background = average counts in a roi placed in a uniform area outside the b = standard deviation of the background roi counts, corresponding to noise in the image all phantom experiments were performed on an integrated pet / mr whole - body hybrid system (biograph mmr, siemens ag). the mr component of the hybrid system consists of a 3.0 tesla static magnetic field, a radiofrequency (rf) transmit body coil and a gradient coil system which provides a maximum amplitude of 45 mt / m and a maximum slew rate of 200 t / m / s. the pet component is comprised of 8 detector rings, each consisting of 56 detector blocks. one detector block consists of 8x8 lutetium oxyorthosilicate (lso) scintillator crystal elements connected to 3 x 3 avalanche photodiodes (apds). according to the nema nu 22007 standard, image quality parameters of pet scanners are obtained by measuring a specific international electrotechnical commission (iec) 616751 emission phantom (nema image quality phantom) (fig. 1a, ptw, freiburg, germany). this image quality phantom mimics the shape of an upper human body and is built of acrylic glass material. it comprises 6 hollow glass spheres (inner diameters 37, 28, 22, 17, 13, and 10 mm) which can be inserted into the large phantom compartment. additionally a cylindrical insert containing styrofoam with an average density of 0.3 0.1 g ml (simulates patient lung tissue (lung - insert ~ 0.026 cm) and is positioned in the center of the phantom. the volume of the tested phantom (ptw, freiburg, germany, fig. 1a) was measured to be 9.5 l 1 % when the spheres and lung cylinder are inserted. the phantom housing has a thickness of approximately 3 mm along the phantom body, and 10 mm (in few parts 20 mm) at the lids at both ends of the phantom. the glass material (~ 0.118 cm) of the spheres has a thickness of around 1 mm. when nema iq measurements with a ct - based phantom template -map are performed, the phantom needs to be placed at a pre - defined position in the pet field of view (fov) with a known reference to the patient table, to ensure alignment between the -map and the position of the phantom. to guarantee a reproducible phantom placement, a defined set of phantom holders a spacer is positioned adjacent to the rf head coil connection port on the patient table in order to create a defined and reproducible distance of the nema iq phantom to the stronger photon - attenuating rf coil port. the nema iq phantom is placed next to the spacer on a foam block, which was designed in order to align the phantom at a pre - defined patient table position. as required by the nema standard, a scatter phantom (a 70 cm long plastic cylinder with an activated line source) is positioned contiguously to the nema iq phantom to generate scattered and random coincidences from outside the fov, such as in a patient examination (fig. 2the nema iq phantom imaging setup as performed in this study. the schematic drawing in (a) and the image in (b) show the spacer (1), the nema iq phantom (2), and the scatter phantom (3) arranged on top of the pet / mr system patient table. the spacer (1) ensures a predefined and reproducible position of the phantom (2) on the patient table the nema iq phantom imaging setup as performed in this study. the schematic drawing in (a) and the image in (b) show the spacer (1), the nema iq phantom (2), and the scatter phantom (3) arranged on top of the pet / mr system patient table. the spacer (1) ensures a predefined and reproducible position of the phantom (2) on the patient table the background volume of the nema iq phantom and the four smallest spheres were filled with f - fdg mixed with pure water using a 4:1 sphere - to - background activity concentration ratio, as specified by nema. the initial tracer activity concentration was specifically calibrated to the start of the measurement : 5.3 kbq / ml 1 % in the phantom background and 21.2 kbq / ml 5 % in the four smallest spheres. the non - radioactive cylindrical insert simulating lung tissue was placed in the center of the phantom. the line source contained in the large scatter phantom was injected with 110 mbq of f - fdg. the defined measurement time by the nema nu 22007 standard is dependent on the axial imaging distance of the pet system and amounted to 12 min in one bed position for the biograph mmr. this imaging time resulted from the specification of nema nu 22007 that 100 cm of axial imaging distance shall be covered in 60 min. the pet images were reconstructed using the 3d ordinary poisson ordered - subset - expectation - maximization (op - osem) reconstruction algorithm as implemented in the system. according to the nema nu 22007 protocol, pet image quality is analyzed by means of two parameters : contrast recovery and background variability [3, 15 ]. these parameters are calculated by evaluation of various regions of interest (rois) in the transverse image slice that contains the centers of the spheres, as well as in adjacent slices (fig. 3position of the regions of interest (rois) placed over the active spheres (red), nonradioactive spheres (blue) and the phantom background (green) of the reconstructed pet images, which are used for analysisdrawn over the spheres as well as in the background region as is illustrated in fig. 3. in this study the evaluation of the rois was performed with the open - source image analysis tool imagej (fiji). position of the regions of interest (rois) placed over the active spheres (red), nonradioactive spheres (blue) and the phantom background (green) of the reconstructed pet images, which are used for analysis the percentage contrast recovery (in an ideal case = 100 %) is determined for each hot sphere j by:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { q}_{h, j}=\frac{\raisebox{1ex}{${c}_{h, j}$}\!\left/ \!\raisebox{-1ex}{${c}_{b, j}$}\right. - 1}{\raisebox{1ex}{${a}_h$}\!\left/ \!\raisebox{-1ex}{${a}_b$}\right. - 1}100\ \left[\%\right ] $ $ \end{document}qh, j = ch, jcb, j1ahab1 100% ch, j = average counts in the roi for sphere j cb, j = average counts in the background roi for sphere j ah = activity concentration in the hot spheres ab = activity concentration in the background for each nonradioactive sphere j the percentage contrast recovery qc, j is given by:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { q}_{c, j } = \left(1 - \frac{c_{c, j}}{c_{b, j}}\right)100\ \left[\%\right ] $ $ \end{document}qc, j=1cc, jcb, j100% cc, j = average counts in the roi for sphere j cb, j = average of all background roi counts for sphere j in order to determine the percentage background variability nj as a measure for the image noise for sphere j (in an ideal case = 0 %), the following equation is used:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { n}_j = \frac{s{d}_j}{c_{b, j}}100\ \left[\%\right ] $ $ \end{document}nj = sdjcb, j100% sdj = standard deviation of the background roi counts for sphere j cb, j = average of all background roi counts for sphere j to evaluate the effect of neglecting acrylic glass and glass material in the attenuation correction of the nema iq phantom emission data, reconstructions with an mr - based -map containing only the fluid phantom filling were performed and nema iq parameters were calculated. linear attenuation coefficients of water were assigned to the whole phantom content including phantom liquid and glass inserts, despite of higher attenuation of the glass material of the spheres. for reconstruction, the above - mentioned op - osem algorithm was used with 3 iterations, 21 subsets, 172 matrix size, and 4 mm gaussian post - smoothing filter. mr - based ac was performed by a 3d dixon vibe - based approach with the following imaging sequence parameters : tr : 4.07 ms, te in - phase : 2.46 ms, te opposed - phase : 1.23 ms, flip angle : 10, slice thickness : 3.12 mm, field of view : 500 mm x 328 mm and matrix size : 128 x 84. the system s built - in rf transmit body coil was used for rf transmission and signal reception. all other rf coils were removed from the patient table to avoid additional pet photon attenuation. the assigned -values were restricted to two -values for water and air for the performed phantom measurements. attenuation caused by the styrofoam material in the lung insert was not accounted for. in general, imaging the nema iq phantom filled with pure water on a 3.0 tesla mr system leads to artifacts and signal inhomogeneities due to standing - rf - wave phenomena and t1 effects, thus affecting mr - based ac of the nema phantom in pet / mr hybrid imaging (as shown in). manually reducing the initial voltage of the rf transmitter adjustment algorithm led to a lower adjusted transmitter voltage of 92.7 volts, instead of the default value for patient imaging (~300 v), and resulted in fairly homogeneous -maps of the nema iq phantom filling (fig. 1c, fig. alternatively the addition of substances (e.g. niso4) could be considered that decrease the t1 relaxation time of water and as a consequence decrease the mentioned image artefacts, as discussed in. 4 a mr - based -map in transversal and coronal orientation only contains discrete attenuation values for water and air, and therefore only corrects for photon attenuation caused by the water content of the phantom and not by the phantom housing materials, as these materials can not be detected with standard mr imaging. b, c ct - based -map contains continuous attenuation values including -values for the phantom housing, glass spheres, and styrofoam block used as phantom holder (displayed in c). b and c visualize the same content, however windowing properties were adjusted individually in order to visualize either the phantom content (b) or the styrofoam holder, on which the phantom is placed (c) a mr - based -map in transversal and coronal orientation only contains discrete attenuation values for water and air, and therefore only corrects for photon attenuation caused by the water content of the phantom and not by the phantom housing materials, as these materials can not be detected with standard mr imaging. b, c ct - based -map contains continuous attenuation values including -values for the phantom housing, glass spheres, and styrofoam block used as phantom holder (displayed in c). b and c visualize the same content, however windowing properties were adjusted individually in order to visualize either the phantom content (b) or the styrofoam holder, on which the phantom is placed (c) the ct image of the phantom, which was used to generate the ct - based template -map (fig. 4b and c), was acquired on a 128-slice pet / ct system (biograph 128, siemens ag) with the following parameters : 500 effective mas and 140 kvp. images were reconstructed with 0.6 mm slice thickness, 512 x 512 image matrix size and a b30f convolution kernel. following a 2 mm gaussian filtering and bilinear scaling of the ct hounsfield units to linear attenuation coefficients at the pet energy level of 511 kev, the ct - based -map was installed on the pet / mr system in order to be used for ac whenever nema iq measurements are performed. the phantom holder minimizes misalignment between the actual phantom position and the ct - based template ac map of the phantom as much as possible. in case of remaining slight misplacement between ct - based phantom template and actual phantom position, a practical use of a ct - ac method as proposed in this study by potential future pet / mr users will require the registration to be performed based solely on the images available. thus the registration in this study was also performed by means of the available information from the pet and ct images in order to simulate a realistic case. this was performed by using the inherent landmarks of the phantom such as the glass spheres, the lung insert and the phantom outer boundary that function as orientation when performing manual image registration. for the pet measurements utilizing ct - based ac, reconstruction parameters were set to 3d op - osem with 3 iterations, 21 subsets, 172 matrix size and 4 mm gaussian filtering, as also used with mr - based ac. pet performance parameters, as well as the visibility of lesions in phantom and patient images, in general strongly depend on the applied reconstruction algorithm parameters. to investigate this effect in the specific context of nema iq phantom imaging particularly for the biograph mmr system and its pet detector geometry and reconstruction algorithm, different reconstructions of the same pet phantom data acquisition using ct - based attenuation correction hereby the number of iterations (15 iterations), the image matrix size (172 x 172, 344 x 344 matrix) and the gaussian filter (2 mm, 4 mm) were varied and the resulting impact on the image quality was investigated, as has been discussed often in the literature and is described e.g. in. the number of subsets was kept constant at 21 as this is the default setting on the scanner console. to determine the optimal reconstruction parameters for best nema iq phantom image quality with high lesion contrast and low background noise, the signal - to - noise ratio (snr) was selected as a representative image quality measure and the snr for sphere j was determined, as described in the literature when performing similar evaluations for pet / ct imaging [20, 21 ], according to the following equation:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ sn{r}_j = \frac{signa{l}_j- background}{\sigma_b\ } $ $ \end{document}snrj = signaljbackgroundb signalj = average counts in the roi for sphere j background = average counts in a roi placed in a uniform area outside the b = standard deviation of the background roi counts, corresponding to noise in the image the resulting nema iq parameters utilizing mr - based ac are listed in table 1. regarding the four smallest spheres filled with tracer activity (radioactive spheres) the performance values using mr - based ac are lower than the expected values for the underlying pet component when comparing as a general orientation to results reported in the literature for the biograph mmr system. the contrast recovery values for the two largest spheres filled with non - radioactive water only (non - radioactive spheres) (table 1) show higher values when compared to the results reported in the literature for the biograph mmr system.table 1contrast recovery and background variability parameters when applying mr - based acsphere size [mm]radioactive / non - radioactive contrast recovery [% ] background variability [% ] 10radioactive16.8 1.94.8 0.813radioactive31.7 2.94.0 0.417radioactive52.7 3.03.6 0.322radioactive64.8 4.13.4 0.428non - radioactive68.9 1.53.2 0.437non - radioactive76.1 0.63.1 0.3 the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering contrast recovery and background variability parameters when applying mr - based ac the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering table 2 presents the resulting nema iq parameters when applying ct - based ac of four independent measurements with separate fillings on four different days. in comparison to values obtained when applying mr - based ac (table 1), contrast recovery was, for instance for the smallest sphere, almost approximately twice as high when using ct - based ac. the larger the size of the spheres, the smaller the deviation in contrast recovery to mr - based ac becomes. the results using ct - based ac are in the same range as results obtained in the literature.table 2contrast recovery and background variability parameters when applying ct - based acsphere size [mm]radioactive / non - radioactive contrast recovery [% ] background variability [% ] 10radioactive30.5 1.33.8 0.813radioactive50.5 2.43.0 0.517radioactive72.9 1.92.5 0.222radioactive74.5 3.32.3 0.228non - radioactive56.6 2.32.0 0.237non - radioactive64.8 0.91.8 0.1 the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering contrast recovery and background variability parameters when applying ct - based ac the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering the influence of varying reconstruction parameters is demonstrated for the four smallest spheres in table 3 and plotted in fig. it can be determined that contrast recovery increases with an increasing number of iterations at the cost of higher background variability, which is essentially noise.table 3contrast recovery and background variability values in % for each active sphere for different reconstruction parameters of the 3d op - osem reconstruction algorithm when using ct - based ac contrast recovery [% ] background variability [% ] sphere 10 mmsphere 13 mmsphere 17 mmsphere 22 mmiteration172 x 172344 x 344172 x 172344 x 344172 x 172344 x 344172 x 172344 x 344113.8 2.515.8 2.828.1 2.329.6 2.548.5 2.151.3 2.353.7 2.156.0 2.2224.3 3.228.1 3.543.8 2.645.3 2.866.8 2.369.7 2.370.0 1.972.0 2.2330.5 3.835.0 4.350.5 3.051.1 3.272.9 2.575.2 2.674.5 2.376.3 2.4434.3 4.438.7 4.953.4 3.353.3 3.575.4 2.777.5 2.876.5 2.578.2 2.6536.8 4.840.8 5.354.8 3.554.3 3.876.9 2.978.7 3.077.6 2.679.2 2.7 4 mm gaussian filtering and 21 subsets were kept constant for all reconstructions. 5contrast recovery vs. background variability using ct - based ac shown for the four smallest spheres with 172x172 matrix size (hollow symbols) and 344x344 matrix size (solid symbols) and 4 mm gaussian filter. the values from left to right represent the results for an increasing number of iterations (15) of the reconstruction algorithm contrast recovery and background variability values in % for each active sphere for different reconstruction parameters of the 3d op - osem reconstruction algorithm when using ct - based ac 4 mm gaussian filtering and 21 subsets were kept constant for all reconstructions. the values represent the mean of four independent measurements contrast recovery vs. background variability using ct - based ac shown for the four smallest spheres with 172x172 matrix size (hollow symbols) and 344x344 matrix size (solid symbols) and 4 mm gaussian filter. the values from left to right represent the results for an increasing number of iterations (15) of the reconstruction algorithm when comparing two different matrix sizes (344 x 344 and 172 x 172), it can be observed that with higher image matrix the contrast increases but at the same time it causes an increase in noise. these effects can also be perceived in the phantom images in fig. 6images of the first five iterations reconstructed with 3d op - osem for different matrix and gaussian filter sizes and using ct - based ac. note : increasing the number of iterations is associated with increasing lesion sharpness while also increasing background noise. this also applies when increasing the image matrix size from 172 x 172 to 344 x 344 images of the first five iterations reconstructed with 3d op - osem for different matrix and gaussian filter sizes and using ct - based ac. note : increasing the number of iterations is associated with increasing lesion sharpness while also increasing background noise. this also applies when increasing the image matrix size from 172 x 172 to 344 x 344 the mean snr of four independent measurements as a function of iterations for all investigated reconstruction parameter combinations is plotted for each of the four smallest spheres in fig. the best choice of matrix size, gaussian filter size and number of iterations can be determined from the peak snr value for each sphere in the graphs. as can be seen, highest snr is achieved for all spheres using a 4 mm gaussian filter. for the two larger spheres (17 and 22 mm) 2 iterations led to highest snr, whereas for the two smallest spheres (10 and 13 mm) the peak snr was achieved at 3 iterations. no significant difference in resulting snr values can be observed when comparing 344 x 344 to 172 x 172 matrix size. 7the signal - to - noise ratio (snr) calculated for different reconstruction parameter combinations for the four active spheres : 10 mm (a), 13 mm (b), 17 mm (c) and 22 mm (d). the values represent the mean of four independent nema iq measurements using ct - based ac the signal - to - noise ratio (snr) calculated for different reconstruction parameter combinations for the four active spheres : 10 mm (a), 13 mm (b), 17 mm (c) and 22 mm (d). the values represent the mean of four independent nema iq measurements using ct - based ac the resulting nema iq parameters utilizing mr - based ac are listed in table 1. regarding the four smallest spheres filled with tracer activity (radioactive spheres) the performance values using mr - based ac are lower than the expected values for the underlying pet component when comparing as a general orientation to results reported in the literature for the biograph mmr system. the contrast recovery values for the two largest spheres filled with non - radioactive water only (non - radioactive spheres) (table 1) show higher values when compared to the results reported in the literature for the biograph mmr system.table 1contrast recovery and background variability parameters when applying mr - based acsphere size [mm]radioactive / non - radioactive contrast recovery [% ] background variability [% ] 10radioactive16.8 1.94.8 0.813radioactive31.7 2.94.0 0.417radioactive52.7 3.03.6 0.322radioactive64.8 4.13.4 0.428non - radioactive68.9 1.53.2 0.437non - radioactive76.1 0.63.1 0.3 the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering contrast recovery and background variability parameters when applying mr - based ac the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering table 2 presents the resulting nema iq parameters when applying ct - based ac of four independent measurements with separate fillings on four different days. in comparison to values obtained when applying mr - based ac (table 1), contrast recovery was, for instance for the smallest sphere, almost approximately twice as high when using ct - based ac. the larger the size of the spheres, the smaller the deviation in contrast recovery to mr - based ac becomes. the results using ct - based ac are in the same range as results obtained in the literature.table 2contrast recovery and background variability parameters when applying ct - based acsphere size [mm]radioactive / non - radioactive contrast recovery [% ] background variability [% ] 10radioactive30.5 1.33.8 0.813radioactive50.5 2.43.0 0.517radioactive72.9 1.92.5 0.222radioactive74.5 3.32.3 0.228non - radioactive56.6 2.32.0 0.237non - radioactive64.8 0.91.8 0.1 the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering contrast recovery and background variability parameters when applying ct - based ac the values represent the mean values and standard deviation of four independent measurements for the reconstruction : 3 iterations, 21 subsets, 172 matrix and 4 mm gaussian filtering the influence of varying reconstruction parameters is demonstrated for the four smallest spheres in table 3 and plotted in fig. it can be determined that contrast recovery increases with an increasing number of iterations at the cost of higher background variability, which is essentially noise.table 3contrast recovery and background variability values in % for each active sphere for different reconstruction parameters of the 3d op - osem reconstruction algorithm when using ct - based ac contrast recovery [% ] background variability [% ] sphere 10 mmsphere 13 mmsphere 17 mmsphere 22 mmiteration172 x 172344 x 344172 x 172344 x 344172 x 172344 x 344172 x 172344 x 344113.8 2.515.8 2.828.1 2.329.6 2.548.5 2.151.3 2.353.7 2.156.0 2.2224.3 3.228.1 3.543.8 2.645.3 2.866.8 2.369.7 2.370.0 1.972.0 2.2330.5 3.835.0 4.350.5 3.051.1 3.272.9 2.575.2 2.674.5 2.376.3 2.4434.3 4.438.7 4.953.4 3.353.3 3.575.4 2.777.5 2.876.5 2.578.2 2.6536.8 4.840.8 5.354.8 3.554.3 3.876.9 2.978.7 3.077.6 2.679.2 2.7 4 mm gaussian filtering and 21 subsets were kept constant for all reconstructions. 5contrast recovery vs. background variability using ct - based ac shown for the four smallest spheres with 172x172 matrix size (hollow symbols) and 344x344 matrix size (solid symbols) and 4 mm gaussian filter. the values from left to right represent the results for an increasing number of iterations (15) of the reconstruction algorithm contrast recovery and background variability values in % for each active sphere for different reconstruction parameters of the 3d op - osem reconstruction algorithm when using ct - based ac 4 mm gaussian filtering and 21 subsets were kept constant for all reconstructions. the values represent the mean of four independent measurements contrast recovery vs. background variability using ct - based ac shown for the four smallest spheres with 172x172 matrix size (hollow symbols) and 344x344 matrix size (solid symbols) and 4 mm gaussian filter. the values from left to right represent the results for an increasing number of iterations (15) of the reconstruction algorithm when comparing two different matrix sizes (344 x 344 and 172 x 172), it can be observed that with higher image matrix the contrast increases but at the same time it causes an increase in noise. these effects can also be perceived in the phantom images in fig 6images of the first five iterations reconstructed with 3d op - osem for different matrix and gaussian filter sizes and using ct - based ac. note : increasing the number of iterations is associated with increasing lesion sharpness while also increasing background noise. this also applies when increasing the image matrix size from 172 x 172 to 344 x 344 images of the first five iterations reconstructed with 3d op - osem for different matrix and gaussian filter sizes and using ct - based ac. note : increasing the number of iterations is associated with increasing lesion sharpness while also increasing background noise. this also applies when increasing the image matrix size from 172 x 172 to 344 x 344 the mean snr of four independent measurements as a function of iterations for all investigated reconstruction parameter combinations is plotted for each of the four smallest spheres in fig. the best choice of matrix size, gaussian filter size and number of iterations can be determined from the peak snr value for each sphere in the graphs. as can be seen, highest snr is achieved for all spheres using a 4 mm gaussian filter. for the two larger spheres (17 and 22 mm) 2 iterations led to highest snr, whereas for the two smallest spheres (10 and 13 mm) the peak snr was achieved at 3 iterations. no significant difference in resulting snr values can be observed when comparing 344 x 344 to 172 x 172 matrix size. 7the signal - to - noise ratio (snr) calculated for different reconstruction parameter combinations for the four active spheres : 10 mm (a), 13 mm (b), 17 mm (c) and 22 mm (d). the values represent the mean of four independent nema iq measurements using ct - based ac the signal - to - noise ratio (snr) calculated for different reconstruction parameter combinations for the four active spheres : 10 mm (a), 13 mm (b), 17 mm (c) and 22 mm (d). the values represent the mean of four independent nema iq measurements using ct - based ac in this study, a strategy for using ct - based phantom attenuation correction in the context of nema iq measurements in pet / mr hybrid imaging has been evaluated. the proposed strategy features a pre - acquired ct - based 3d attenuation template of the nema iq phantom in conjunction with a phantom holder providing exact and reproducible repositioning of the phantom on the systems patient table. this strategy for phantom ac is straightforward and in line with currently implemented ac methods for hardware component ac such as rf coils on the available sequential and integrated pet / mr systems. respective image quality and activity quantification parameters were systematically investigated using mr - based and ct - based ac of the nema iq phantom. furthermore, reconstruction parameters for nema iq phantom measurements were optimized for the biograph mmr system by evaluating image quality parameters using the ct - based approach. it was demonstrated that the tested mr - based ac leads to insufficient quantification results and to degraded image quality as compared to ct - based ac for the evaluated nema iq phantom. specifically, the activity quantification values for the four radioactive spheres were lower than activity values reported in the literature for nema iq measurements on the biograph mmr system. the low values indicate insufficient ac of the phantom, which is associated with the fact that mr - based ac only considers the fluid phantom filling but neglects the attenuating phantom housing made from acrylic glass and glass components. on the other hand, the contrast recovery values for the two non - radioactive spheres show higher values when compared to the values reported in the literature. because these spheres are filled with non - radioactive water only, the corresponding contrast recovery values are highest when no counts are detected from inside these spheres. applying an insufficient attenuation correction, such as the mr - based ac, leads to less counts being detected from inside the non - radioactive spheres resulting in a higher contrast recovery value than when using ct - based ac. based on the resulting contrast recovery parameters for radioactive and non - radioactive spheres it can be concluded that mr - based attenuation correction performed with the current ac sequence is inadequate to determine representative pet image quality parameters in the tested nema iq phantom. the proposed method, using pre - acquired ct - based nema iq phantom attenuation templates instead of mr - based ac, takes the complete phantom into account, including the fluid filling, phantom housing, lung insert and foam phantom holder. using this approach leads to nema pet image quality parameters similar to values reported in the literature. the ct - based approach can thus be considered adequate for representing the performance characteristics of the biograph mmr pet component. the suggested ct - based ac requires the nema iq phantom to be located at a known position on the patient table during the measurements. this was achieved by a foam block that carries the nema iq phantom and fits the shape of the systems patient table. to allow for exact and reproducible positioning of the foam block in z - direction on the patient table, the proposed approach can theoretically be implemented on any current pet / mr system (tri - modality, sequential or integrated) as a practical method to perform pet nema image quality measurements. in theory, other methods are conceivable to obtain improved mr - based ac of the nema iq phantom. in principle this requires that the phantom fluid is displayed in homogeneous manner across the entire phantom. another precondition is that the phantom housing made e.g. of plexiglas is also considered in mr - based ac. this may be achieved by using mr imaging sequences capable of displaying structures made of plastic, e.g. ultrashort echo time (ute) sequences. alternatively, the virtual addition of a defined rim of attenuating pixels to the outer borders of the phantom fluid visible in mr imaging may provide a method for consideration of the phantom housing in mr - based ac. additionally, a 511 kev transmission scan of the phantom may also be a possibility to generate a phantom ac map. however, a very long scan would be required in order to limit the noise properties, which are much higher in comparison to ct, and achieve acceptable spatial resolution. in addition, since the advent of combined pet / ct scanners access to pet only scanners with transmission sources is very limited. in the present study we have focused on the ct - based ac strategy since it is straightforward, accurate, and can be implemented on current pet / mr systems in the same manner hardware component ac is performed for rf coils. a goal of this study was to assess a solution to be able to perform nema pet image quality evaluations on a pet / mr system as closely to the nema nu 22007 standard as possible. nema nu 22007 specifies that the iq phantom shall be positioned in the isocenter of the pet fov. since the patient table does not accommodate this vertical phantom position, a suggested phantom holder ensures the required positioning in a reproducible manner. it reduces misplacement of the phantom in all three spatial dimensions as much as possible and consequently, the position of the phantom during a nema measurement matches the position of the ct - based template ac map of the phantom. in case of remaining slight misalignment, the phantom -map was registered manually to the non - attenuation corrected pet data. possibly, manual or automatic registration to mr data may be another alternative, however, due to suboptimal image quality of the mr data acquired with the rf body coil, this was not performed for the presented data. for the 3d op - osem reconstruction in this nema iq phantom study, an optimized lesion snr was achieved by reconstructing with 3 iterations, 21 subsets and 4 mm gaussian filtering. every lesion in patient data sets has a different optimal reconstruction parameter setting to obtain the highest individual lesion snr. therefore, the parameter optimization in this study can be considered only a general guideline when performing pet patient measurements on the biograph mmr hybrid system. this study validates nema (nu 22007) pet image quality performance measurements by applying ct - based attenuation correction for an integrated pet / mr hybrid system. the necessity and superiority of ct - based nema iq phantom ac is demonstrated by a comparison to results using mr - based ac. furthermore, optimized image reconstruction parameters are provided for highest lesion snr in the context of nema iq phantom measurements on the biograph mmr system. the results of this study can thus be seen as an important step towards standardization and image quality control of pet measurements in the context of pet / mr hybrid imaging. | backgroundin integrated pet / mr hybrid imaging the evaluation of pet performance characteristics according to the nema standard nu 22007 is challenging because of incomplete mr - based attenuation correction (ac) for phantom imaging. in this study, a strategy for ct - based ac of the nema image quality (iq) phantom is assessed. the method is systematically evaluated in nema iq phantom measurements on an integrated pet / mr system.methodsnema iq measurements were performed on the integrated 3.0 tesla pet / mr hybrid system (biograph mmr, siemens healthcare). ac of the nema iq phantom was realized by an mr - based and by a ct - based method. the suggested ct - based ac uses a template -map of the nema iq phantom and a phantom holder for exact repositioning of the phantom on the systems patient table. the pet image quality parameters contrast recovery, background variability, and signal - to - noise ratio (snr) were determined and compared for both phantom ac methods. reconstruction parameters of an iterative 3d op - osem reconstruction were optimized for highest lesion snr in nema iq phantom imaging.resultsusing a ct - based nema iq phantom -map on the pet / mr system is straightforward and allowed performing accurate nema iq measurements on the hybrid system. mr - based ac was determined to be insufficient for pet quantification in the tested nema iq phantom because only photon attenuation caused by the mr - visible phantom filling but not the phantom housing is considered. using the suggested ct - based ac, the highest snr in this phantom experiment for small lesions (< = 13 mm) was obtained with 3 iterations, 21 subsets and 4 mm gaussian filtering.conclusionthis study suggests ct - based ac for the nema iq phantom when performing pet nema iq measurements on an integrated pet / mr hybrid system. the superiority of ct - based ac for this phantom is demonstrated by comparison to measurements using mr - based ac. furthermore, optimized pet image reconstruction parameters are provided for the highest lesion snr in nema iq phantom measurements. |
the need for safe, powerful, and efficient energy storage devices has led to a high level of interest in the improvement of battery technologies. currently, most commercially available li - ion batteries contain organic polymer - based electrolytes, leading to multiple safety issues such as poor chemical and electrochemical stability, leakage, and flammability. therefore, next - generation li - ion battery concepts are based on all - solid - state technologies using ceramic li - ion conductors as electrolytes. li - stuffed oxide garnets containing more than three li ions per formula unit are among the most promising solid - state li electrolytes. llzo shows a high li - ion conductivity as well as superior chemical and thermal stability. its electrochemical inertness over a wide potential window and its stability against li metal makes llzo an especially promising material for use as a solid - state li electrolyte. pure llzo occurs in two structural modifications. the tetragonal low - temperature phase in space group (sg) i41/acd has a fully ordered li arrangement and shows a low ion conductivity of 10 s cm at room temperature (rt). the garnet - type ia3d structure consists of a framework of 8-fold coordinated la (24c) and octahedrally coordinated zr (16a). li occupies interstitial sites with tetrahedral (24d), octahedral (48 g), and distorted 4-fold (96h) coordination. in contrast to the tetragonal modification, the cubic modification with sg ia3d shows a disordered li distribution. the cubic modification can be stabilized at rt by the introduction of supervalent cations. it was recently shown that the introduction of ga leads to a different structural modification with acentric cubic sg i43d (figure 1). the formation of this sg is attributed to the site preference of ga, which causes a splitting of the 24d position of sg ia3d into two different sites, namely, li1 (12a) and li2 (12b). blue dodecahedra represent 8-fold coordinated la (wyckoff position 24d) and green octahedra 6-fold coordinated zr (16c). red spheres correspond to tetrahedrally coordinated li ions at the li1 (12a) site ; orange spheres represent tetrahedrally coordinated li ions at the li2 (12b) site, and yellow spheres represent distorted 6-fold coordinated li ions at the li3 (48e) site. this study demonstrates that llzo stabilized with fe also shows the acentric sg i43d. coarse - grained samples of fe - stabilized llzo were prepared by solid - state reaction and characterized by scanning electron microscopy (sem)/backscattered electron imaging (bse) and energy - dispersive x - ray spectroscopy. the structural characterization was achieved by a rich portfolio of techniques, including x - ray powder diffraction (xrpd), single - crystal x - ray diffraction (sc - xrd), neutron powder diffraction (npd), and fe mbauer spectroscopy. electrochemical impedance spectroscopy (eis) of fe - stabilized llzo reports a li - ion bulk conductivity of up to 1.38 10 s cm at rt, which is among the highest values reported for this group of materials. a series of li73xfexla3zr2o12 compounds with intended fe concentrations (x) of 0.10, 0.16, 0.18, 0.20, 0.25, and 0.30 atoms per formula unit (pfu) were prepared by high - temperature sintering in air. the preparation route is equivalent to the procedure described by wagner. li2co3 (99%, merck), fe2o3 (99.945%, alfa aesar), la2o3 (99.99%, alfa aesar), and zro2 (99.0%, roth) were used as reagents. for the preparation of samples for fe mbauer spectroscopy, 15% of the intended fe content was added as fe - enriched fe2o3 (isoflex, 95.47% enriched) and 85% as conventional fe2o3 containing the natural mixture of isotopes. the starting materials were weighed out in their intended stoichiometric proportions with an excess of 10 wt % li2co3 to compensate for the loss of li2o due to evaporation during sintering. the reagents were mixed and ground in an agate mortar and then cold - pressed into pellets. the sample pellets were placed on a pellet of pure llzo and then put into an alumina crucible. after being heated at a rate of 5 c min to 850 c and sintered for 4 h, the pellets were ground in an agate mortar and ball - milled under isopropyl alcohol for 1 h (fritsch pulverisette 7, 800 rpm, 2 mm zro2 balls). the resulting powder was pressed into pellets and put into an alumina crucible. to avoid the incorporation of al from the crucible, the sample pellet was again placed on a pellet of pure llzo. to reduce the li2o loss of the samples, the sample pellet was covered with another pellet of pure llzo. the samples were heated at a rate of 5 c min to 1230 c and sintered for 6 h. sem investigations were performed with a zeiss ultra plus device to study the grain size, morphology, phase composition, and chemical homogeneity, i.e., the distribution of fe, la, and zr, by using bse imaging mode and standard - free edx measurements with an acceleration voltage of 20 kv. special regard was given to the detection of al and ga, as well. for sem characterization, polycrystalline chips from the pellets were embedded in an epoxy holder, polished with diamond paste, and coated with carbon. for the preparation of xrpd samples, small fragments from the sintered pellets were ground in an agate mortar. xprd measurements were taken with a bruker d8 advance davinci design diffractometer with a lynxeye solid - state detector using cu k radiation. data were collected at 2 positions between 10 and 80. evaluation of xrpd data was performed by rietveld refinement using bruker diffracplus topas (version 4.2). sc - xrd measurements were performed on a bruker smart apex ccd diffractometer. single crystals from gently crushed pellets were selected under the binocular on the basis of their optical properties. selected crystals were glued on top of glass capillaries and tested on the diffractometer. to obtain good statistics, full sets of intensity data were collected on several crystals for each sample composition, resulting in a total of 18 data sets. in general, all tested crystals were of high quality and showed sharp reflections. the detector was positioned at 2 positions of 30 and 50 using an -scan mode strategy at four different positions (0, 90, 180, and 270) for each 2 position. for each run, 630 frames with = 0.3 were collected, so data were acquired in a large q range up to minimum d values of 0.53 to obtain accurate anisotropic displacement parameters and to reduce the correlation between atomic displacement parameters and site occupation numbers. three - dimensional data were integrated and corrected for lorentz, polarization, and background effects by using the apex2 software. structure solution with direct methods and subsequent weighted full - matrix least - squares refinements on f further structural analysis and visualizations of the crystal structure were performed by using the vesta 3 program. neutron powder diffraction data for samples with x = 0.18 pfu and x = 0.25 pfu were collected at the research reactor ber ii at the helmholtz - zentrum berlin. both samples were stored under ar directly after the synthesis to prevent the incorporation of h and other reactions with h2o and co2 from air. powder diffraction data were acquired at 1.8 and 298 k in constant wavelength mode using the fine - resolution powder diffractometer firepod with = 1.7982(1). the experimental spectra were recorded using the standard setup of the mbauer lab at the university of salzburg. a co / rh single - line thin source (initial activity of 50 mci) was used to collect fe mbauer spectra of fe - enriched samples with x = 0.18 pfu and x = 0.25 pfu. transmission powder spectra were recorded at rt with a multichannel analyzer (1024 channels) operating in conjunction with an electromechanical drive system with a symmetrical sawtooth velocity shape. for each composition, 50 mg of powdered sample was placed between plastic discs fitted into a cu ring with a 10 mm inner diameter covered with al foil on one side. the two simultaneously obtained spectra (512 channels each) were folded, calibrated against -iron, and evaluated using recoil. thin films of platinum (200 nm) and titanium (10 nm) were sputtered on the top and bottom sides of the sample and act as ionically blocking electrodes. titanium is needed to improve the adhesion of the platinum layer. for the eis measurements, a novocontrol alpha analyzer was used in the frequency range of 3 10 to 10 hz. cooling and heating of the sample were performed with a julabo f-25 he instrument, which is a thermal bath fluid - based cooling and heating device. the temperature, measured by a thermocouple at the sample, was in the range of 7 to 25 c. for all compositions, coarse - grained samples with grain sizes of > 100 m were obtained. single grains separated by gaps are mainly found in the peripheral part of the pellets. in contrast to this, grains in the central part of the pellets do not show pronounced grain boundaries. open voids are found as inclusions within single llzo grains (see figure s1). in some cases, edx measurements of llzo grains show the presence of la, zr, and fe. for all samples, the la / zr ratio is fe edx mapping did not show a zoning of llzo grains with regard to la, zr, and fe. the xrpd patterns of li73xfexla3zr2o12 with intended fe concentrations of x = 0.10, 0.16, 0.18, 0.20, 0.25, and 0.30 pfu are shown in figure 2. all samples show reflections matching the patterns observed for cubic llzo ; however, a definite distinction between the two cubic llzo modifications with sg i43d and ia3d can not be determined by xrpd. only for the highly substituted sample with x = 0.30 is the characteristic 310 reflection for sg i43d at 2 = 21.65 (d = 4.10) observed. for some samples, la2zr2o7 and la2o3 are observed as extra phases resulting from the loss of li during sintering. the sample with the lowest intended fe content of 0.10 pfu still shows 23 wt % tetragonal llzo. comparison of xrpd patterns of li73xfexla3zr2o12 with x = 0.10 (bottom pattern), 0.16, 0.18, 0.20, 0.25, and 0.30 (top pattern). reflections originating from extra phases are marked with violet (la2zr2o7) and blue (la2o3) bars ; the characteristic reflection for sg i43d at 2 = 21.65 is marked with a red bar. the inset shows pictures of two sintered pellets with different fe contents as well as a sem - bse image of a polished fragment of the x = 0.25 sample. single - crystal x - ray intensity data processing gives strong evidence of the cubic crystal system for all 18 data sets collected. for samples with a refined fe content of x > 0.09, the analysis of intensity statistics and systematic extinctions yields the acentric sg i43d (no. 220). therefore, for the garnet family, atypical sg i43d is found not only within the llzo : ga series, as described in great detail very recently by wagner., but also for the incorporation of fe into the llzo structure. for more details about differences between common ia3d and the acentric i43d structure, the reader is referred to ref (15). only for samples with a refined fe content of x 13. as the lattice parameter values reported in this study are in the range of 12.97 and thus well in accordance with those of other unaltered llzo samples, we do not expect any significant protonation of the llzo : fe samples used in this study. it is conspicuous that both members of the llzo group with sg i43d show superior ionic conductivity compared to that of the llzo : al group with sg ia3d, even if the differently stabilized samples were synthesized by the very same preparation route. already discussed possible explanations for the improved ionic conductivity of llzo : ga compared to that of llzo : al. besides other factors, they also supposed that the phase transformation from sg ia3d to sg i43d partially accounts for the enhanced electrochemical properties. the results of this study reinforce these assumptions, as the ionic conductivities of llzo : fe reported in this study are among the highest values reported for this class of materials. however, further electrochemical investigations will be needed to evaluate the aptitude of llzo : fe as a solid - state electrolyte, as the electrochemical stability of the transition element cation fe might be inferior compared to those of other stabilizing cations such as al and ga. this study reveals that fe - stabilized llzo shows the acentric cubic sg i43d (no. 220). this crystal structure was recently reported for ga - stabilized llzo and is different from those of other members of the li oxide garnet group that show sg ia3d (no. 230). similar to that of ga - stabilized llzo, the phase transformation seems to be caused by the site preference of fe. results of fe mbauer spectroscopy confirm the preference of fe for the tetrahedral li1 (12a) site. electrochemical impedance spectroscopy exhibits very high li - ion bulk conductivity up to 1.38 10 s cm at rt. these results confirm that garnet - similar llzo materials with sg i43d show superior li - ion conductivity compared to that of conventional llzo garnets with sg ia3d. again, it must be highlighted that understanding the structure property relationship is essential for understanding the electrochemical properties of these electrolyte materials. | fast li - ion - conducting li oxide garnets receive a great deal of attention as they are suitable candidates for solid - state li electrolytes. it was recently shown that ga - stabilized li7la3zr2o12 crystallizes in the acentric cubic space group i43d. this structure can be derived by a symmetry reduction of the garnet - type ia3d structure, which is the most commonly found space group of li oxide garnets and garnets in general. in this study, single - crystal x - ray diffraction confirms the presence of space group i43d also for li73xfexla3zr2o12. the crystal structure was characterized by x - ray powder diffraction, single - crystal x - ray diffraction, neutron powder diffraction, and mbauer spectroscopy. the crystal chemical behavior of fe3 + in li7la3zr2o12 is very similar to that of ga3 +. the symmetry reduction seems to be initiated by the ordering of fe3 + onto the tetrahedral li1 (12a) site of space group i43d. electrochemical impedance spectroscopy measurements showed a li - ion bulk conductivity of up to 1.38 103 s cm1 at room temperature, which is among the highest values reported for this group of materials. |
there is considerable evidence that eosinophils, a prominent feature in the characteristic inflammatory infiltrates of immediate hypersensitivity reactions, and of related chronic conditions, including allergic asthma [13 ], play a pathogenetic role by releasing granular cytotoxic proteins, cytokines, and lipid mediators [46 ]. in acute eosinophilic inflammation, infiltrating eosinophils eventually die through apoptosis and are cleared by resident macrophages, leading to resolution. by contrast, a sustained increase in bone - marrow eosinophil production (eosinopoiesis), as well as prolonged survival in the peripheral inflammatory site, is believed to promote chronic allergic inflammation in humans and mice [810 ]. furthermore, there is evidence that eosinophil progenitors accumulate in the challenged lungs of sensitized mice, suggesting that extramedullary eosinopoiesis also contributes to the hematological response to allergen exposure [11, 12 ]. there is interest in characterizing the mechanisms that ensure the selective increases in eosinopoiesis, both inside and outside the bone - marrow, following exposure to allergen challenge in sensitized subjects. these mechanisms were initially shown to act systemically, because the bone - marrow is not directly exposed to allergen but responds to factors generated in the lungs, which are demonstrable in plasma by a transfer protocol. more recently, tnf- and corticosterone, a stress hormone released by the adrenal glands, were shown to be required for the increase in eosinopoiesis in response to allergen challenge of sensitized mice. however, neither tnf- nor corticosterone is eosinophil - selective in their effects, and their production is not restricted to sensitized / challenged animals. this highlights the need to identify additional coupling elements which could account for the eosinophil - selective response in bone - marrow or in sites of extramedullary hemopoiesis. here we have examined whether the 5-lipoxygenase (5-lo) pathway plays a role in the hematological response to allergen challenge, a possibility which is suggested by numerous observations, clinical and experimental. 5-lo generates a wide variety of mediators, through the action of specialized terminal enzymes variously expressed in different cell types, which act on the initial 5-lo products and their immediate derivatives, like leukotriene (lt) a4, to yield leukotriene b4 and the cysteinyl - leukotrienes (cyslt), ltc4, ltd4, and lte4 [1315 ]. there is evidence of an important role of cyslt in the pathophysiology of asthma and other allergic diseases, consistent with the clinical benefits of blocking their synthesis or their actions [1315 ]. cells expressing 5-lo are present in bone - marrow, and hemopoietic cells from both bone - marrow and other sites respond to 5-lo products, especially to cyslt [1618 ]. eosinophils both produce and respond to cyslt. in bone - marrow cultures stimulated by interleukin (il)-5, the major eosinopoiesis - promoting cytokine and lineage - specific survival factor [13, 7, 17 ], exogenously added cyslt, significantly enhance eosinopoiesis [19, 20 ]. furthermore, type 1 cyslt receptors (cyslt1r) mediate the enhancing actions of the nonsteroidal anti - inflammatory drugs, indomethacin and aspirin, and of the proallergic cytokines, eotaxin / ccl11 and interleukin (il)-13, on eosinopoiesis. finally, cyslt protects developing eosinophils from the proapoptotic effects of various mediators of inflammation, including prostaglandin (pg) e2 and interferon- (ifn-) (gaspar - elsas, queto., submitted). even though il-5 signals through a common chain (c), which is also used by gm - csf and il-3 to signal through their own receptors, il-5, unlike the other cytokines in this group, is preferentially expressed in the eosinophil lineage and is necessary for physiological eosinopoiesis. hence, interactions between il-5 and 5-lo products in vivo could promote a lineage - specific hematological response to allergen challenge. although the observations in bone - marrow culture suggest this possibility, they were made with bone - marrow from naive mice, after addition of exogenous agents (cyslt ; nsaid ; cytokines). on the other hand, suggestive evidence was obtained in a murine model of asthma, through the demonstration of a beneficial effect of diethylcarbamazine (dec), an antifilarial drug. dec, known to suppress leukotriene synthesis, abolishes the eosinopoietic response to allergen challenge in sensitized mice, as well as eosinophil infiltration in the challenged lungs [24, 25 ]. this observation pointed to the possibility that leukotrienes, produced in vivo after challenge, contribute to the hematological response in these conditions and that inhibition of leukotriene synthesis by dec underlies its effectiveness. if so, similar effects should be demonstrable in animals submitted to blockade or inactivation of the 5-lo pathway, independently of dec. this hypothesis was tested in sensitized and challenged wild - type mice of different strains, as well as in mutants lacking 5-lo, by evaluating the effectiveness of various drugs capable of interfering with leukotriene synthesis, or with cyslt1r signaling, to prevent the bone - marrow response to allergen exposure. in addition, we examined the effects of sensitization and challenge on the accumulation of eosinophils in the spleen, as well as the effectiveness of dec in preventing this component of the hematological response to challenge. fcs was from hyclone (logan, ut) ; culture media rpmi 1640 from rhyclone, thermoscientific, (waltham, ma) ; recombinant murine interleukin-5 (il-5) from r&d systems (minneapolis, mn, usa) ; grade ii ovalbumin (cat. m0387) from sigma (st. louis, mo, usa) ; aluminium ammonium sulfate [alnh4(so4)212h2o, alum ] (cat. 01s1048.01.af) (manufacturer, synth, brazil), grade v ovalbumin (cat. 950 512), from icn biomedicals (usa) ; and mk886 (cat. wild - type mice of the balb / c and 129s2/svpas (pas) strains and 129s2/svpas - alox (alox) mutants lacking functional 5-lipoxygenase genes, bred at cecal - fiocruz, rio de janeiro, brazil, were used at 68 weeks of age for sensitization, challenge, and drug treatment experiments in vivo and as a source of bone - marrow cells for ex vivo analyses, following institutionally approved (ceua - fiocruz # l-010/04 and ceua - fiocruz # l-002/09, and ceua - ccs - ufrj 181) protocols. mice were sensitized with two subcutaneous injections of ovalbumin (100 g ovalbumin mixed in 1.6 mg alum in a total volume of 0.4 ml saline), 7 or 14 days apart. the animals received one intranasal challenge (10 g grade v ova/25 l of saline) on day 14 or three intranasal challenges (25 g grade v ova/25 l of saline) on days 19, 20, and 21. alternative challenge protocols were used in selected experiments : aerosol challenge at day 14, once, for 1 h, with 2.5% grade ii ovalbumin in pbs, and intraperitoneal challenge, once, at day 14, with 10 g grade v ova/400 l of saline. in selected experiments, mice were given mk886 orally, 1 mg / kg, in 0.1% methylcellulose / deionized water, on days 13 and 14, the latter dose being administered 1 h before challenge. mice were given dec orally, 12 mg / kg, in deionized water, for 12 days beginning at day 14 or at days 19, 20, and 21, with dec treatment 2 h before each daily challenge. controls received the same volume of vehicle. in selected experiments, mice were given montelukast orally, 10 mg / kg, in 2% dmso / pbs 1x, administered 1 h before challenge. peritoneal lavage fluid was collected after washing 3x the peritoneal cavity with 10 ml of chilled rpmi1640 medium (serum - free) using a 22 g needle. the sample was centrifuged and the cell pellet were resuspended in 2 ml of the same medium with 1% fcs, for total (after dilution in turk 's stain) and differential (after staining for eosinophil peroxidase ; [27, 28 ]) counts on haemocytometer and cytocentrifuge slides, respectively. spleen cells were prepared as single cell suspensions from individual spleens where indicated, by mincing the spleen with scissors and needles and repeatedly passing the cell suspension through a syringe with no needle attached. numbers of total nucleated cells and eosinophils were determined by hemocytometer and cytocentrifugate counts, as above. bone - marrow cells were collected from both femurs of individual nave mice, washed, counted in a haemocytometer, seeded at 10 in 1 ml of rpmi 1640 medium, 10% fcs, and rmil-5 (1 ng / ml ; optimal concentration, as previously defined) in 48-well clusters, and incubated at 37c, 5% co2/95% air, for 7 days. eosinopoiesis in liquid culture was strictly dependent on il-5, and culture conditions were adequate for demonstrating both enhancing and suppressive effects [9, 29, 30 ]. cells present in 7-day culture were resuspended, collected, counted, cytocentrifuged, and stained for eosinophil peroxidase (epo ; cyanide - resistant peroxidase), a murine eosinophil lineage - specific marker, present from the earliest precursors to terminally differentiated eosinophils [27, 28 ], and scored as detailed in. data (mean sem) were analyzed by factorial analysis of variance with the tukey hsd correction for groups of equal size, using systat for windows version 4 software from systat inc. (evanston, il). for groups of unequal size, the bonferroni correction was used. we initially examined whether the integrity of the 5-lo pathway was required for allergen challenge to induce an increase in bone - marrow eosinophil production. figure 1 shows the results of sensitization and intranasal ((a)-(b)) or intraperitoneal ((c)(f)) challenge with ova in 5-lo - deficient alox mice and the wild - type controls (pas) of the same genetic background. in pas mice, the number of epo+ cells in freshly harvested femoral bone - marrow from ova / ova was significantly increased (figure 1(a)), relative to the ova / sal controls, as had previously been reported for other inbred mouse strains (balb / c and c57bl/6). by contrast, in alox mutants sensitized and challenged with ova, there was no significant increase in day 0 epo+ cell numbers, relative to the respective ova / sal controls (figure 1(a)). the response in pas mice was eosinophil - lineage selective, because we did not observe significant differences in the numbers of total bone - marrow nucleated cells (all lineages considered) in these conditions (figure 1(b)). we next examined whether a requirement for 5-lo was also demonstrable when challenge was done through the intraperitoneal route, with no involvement of the airways. ova challenge, a significant increase in the number of epo+ cells in bone - marrow, in comparison with ova / sal controls (figure 1(c)). in addition, i.p. challenge induced, as expected, eosinophil accumulation in the peritoneal cavity of challenged pas mice, which was significant (p < 0.001), relative to the ova / sal controls (figure 1(d)). by contrast, ova - challenged alox mice showed no significant increase in the numbers of eosinophils in freshly harvested bone - marrow, relative to the respective ova / sal controls (figure 1(c)). nevertheless, alox mice presented significant accumulation of eosinophils in the challenge site (peritoneal cavity), in comparison with the same controls (figure 1(d)). despite the statistical significance of the response, its magnitude amounted to no more than one - third of that found in the wild - type controls. importantly, this protocol allowed us to distinguish challenge effects on the bone - marrow from those in the peripheral challenge site, as the latter were decreased, but not abolished, by 5-lo deficiency, in sharp contrast to the former. because neutrophils are also included in the infiltrating population and are known to respond to 5-lo - derived chemoattractants, such as ltb4, we also examined the neutrophil counts in peritoneal lavage fluid of mice in these experimental groups. this shows that 5-lo - deficiency, as expected, affects the migration of neutrophils, in addition to migration of eosinophils. the total cell counts, which include a major component of mononuclear phagocytes (monocytes / macrophages), with very few lymphocytes, were significantly increased by allergen challenge in both pas and alox mice (figure 1(f)), showing that the decrease in eosinophil and neutrophil migration is not due to a general failure of leukocyte recruitment. to rule out the possibility that these observations were somehow dependent on the microscopic readout system, which involves a human observer, we performed additional controls using an automated assay for eosinophil peroxidase. as previously reported, measurement of epo activity is in excellent agreement with microscopic scoring of epo+ cells (not shown). priming in vivo for an increased ex vivo response to the eosinophil - selective growth and differentiation factor, interleukin (il)-5, is an important component of the hematological response to allergen challenge, which parallels in vivo eosinophilia but is independently regulated. as shown in figure 2, in pas mice sensitized and challenged with ova, eosinophil production in bone - marrow cultures established with il-5 was significantly increased, relative to the respective ova / sal control. by contrast, in alox mice, a comparable increase was not observed. the difference in eosinophil production between ova / ova mice of both strains was highly significant. we have examined the relationship of 5-lo to the hematological response to allergen challenge through an independent, pharmacological approach, by using the inhibitor of 5-lipoxygenase activating protein inhibitor, mk886, to block the 5-lo pathway before challenge (figure 3). balb / c mice were sensitized with ova and challenged either by aerosol (figure 3(a)) or by i.p. sensitized mice, treated with vehicle before challenge with ova (ova / veic / ova), presented a significant increase in epo+ cell numbers in freshly harvested bone - marrow, relative to the saline - challenged controls (ova / veic / sal). treatment with mk886 before ova challenge (ova / mk / ova) prevented the increase in bone - marrow eosinophils in response to allergen challenge, both by aerosol (figure 3(a)) and by the i.p. route (figure 3(b)), as shown by the significant differences relative to the respective ova / veic / ova controls. if the effect of dec in allergic pulmonary inflammation is mediated by inhibition of leukotriene synthesis, dec should be effective in mice which can produce leukotrienes but not in 5-lo deficient animals, showing that its effectiveness does not involve a secondary pharmacological mechanism unrelated to 5-lo. we initially tested this hypothesis using repeated challenge over a 3-day period, at the end of a 12-day course of dec, because these are the conditions in which dec activity was originally demonstrated. figure 4 shows the effect of dec treatment on the bone - marrow response to allergen challenge, in wild - type pas controls and in mutant alox mice. in pas mice submitted to the repeated i.n. challenge (figure 4(a)), there was a significant increase in the numbers of epo+ cells in freshly harvested bone - marrow from ova / veic / ova (positive) donors, relative to the ova / veic / sal unchallenged (negative) controls. importantly, this increase was abolished by dec pretreatment (p = 0.019 for the difference between ova / dec / ova and ova / veic / ova). by contrast, alox mice did not show an increase in bone - marrow eosinophilia even after repeated challenge, nor a significant change from the baseline when pretreated with dec. while this shows that pas mice behave like other strains (balb / c, c57bl/6) previously shown to respond to dec in these experimental conditions, alox mice, which are from the same background but have no functional 5-lo, show absolutely no detectable hematological response to challenge nor to dec. these observations were extended to the aerosol challenge model (figure 4(b)), with essentially identical results. pas controls showed significant responses to challenge (p < 0.003 for the difference between positive and negative controls and p < 0.026 for the difference between dec treatment and the positive control). dec treatment in saline - challenged controls had no effect of itself, as shown before. again, alox mice showed no increase in eosinophil numbers following challenge, nor a significant response to dec in any direction. together, these observations establish that dec, in these experimental conditions, is effective in the presence of 5-lo and has no detectable effect in the absence of 5-lo, which is consistent with the hypothesis of a mechanism involving leukotriene synthesis inhibition, as opposed to the hypothesis of a secondary (i.e., 5-lo - independent) pharmacological target. we further examined whether dec would have an impact on eosinophil numbers in the spleen, which contains large numbers and leukocytes, and is, in specific circumstances, capable of supporting extramedullary hemopoiesis. we did that using the strain (balb / c) and protocol (i.n. challenge over a 3-day period) originally used to demonstrate the effect of dec on allergen - stimulated bone - marrow eosinophilia, to be sure that dec was effective on bone - marrow in the experimental conditions used to examine the spleen. unexpectedly, the numbers of epo+ cells in spleen of these animals were significantly affected by both allergen challenge and dec, although in opposite ways. intranasal challenge induced a large increase in the eosinophil counts from the spleen of sensitized balb / c mice (figure 5). these represented more than 5-fold the eosinophil counts in the femoral bone - marrow of the same animals. this shows that, in sensitized and challenged mice of this strain, the spleen accumulates, over a 3-day period a large population of eosinophils, which to our knowledge has not been previously described. most interesting, this expansion of the splenic eosinophil pool as a function of allergen exposure in the airways was preventable by dec pretreatment, as previously reported for the main hemopoietic site, bone - marrow. furthermore, the effect of dec on spleen eosinophil counts showed the same pattern as the effect of dec on bone - marrow eosinophilia (figure 5(b)), because (a) a shorter course of dec, given only during the challenge period, and preceding each challenge, was as effective as the traditional 12-day course ; (b) the effectiveness of dec would be lost if a single challenge exposure had taken place without dec pretreatment. in view of the effectiveness of 5-lo inactivation / blockade, on the one hand, and of dec, on the other hand, in preventing eosinophilia in this model, both inside and outside the bone - marrow, it is important to establish whether targeting cyslt effects with a cyslt type i receptor antagonist would be just as effective. montelukast abolished the increase in bone - marrow eosinophil counts induced by allergen challenge of pas mice. by contrast, it had no effect on eosinophil counts in sensitized and challenged alox mutants. this shows that montelukast is as effective as deletion of 5-lo in preventing the hematological response to allergen challenge and that its effectiveness, as expected, depends on the presence of cyslt, which can not be made in alox mice. in this study, we reexamined the relationship between 5-lo function, the hematological response to sensitization and challenge in allergy models, and the effectiveness of dec in these conditions, by a series of complementary approaches. we tested the hypothesis that if dec was acting through leukotriene synthesis inhibition, its effects would be duplicated in murine bone - marrow by inactivation of the leukotriene biosynthetic pathway, as well as by other drugs acting on the same target. overall, there is an excellent agreement between the observations made through these distinct approaches, and an important role for the 5-lo pathway in the hematological response to allergen challenge in mice was established. the same experiments showed that this is a general phenomenon, not restricted to airway challenge and allergic pulmonary inflammation, and further provided evidence that the eosinophilia of the bone - marrow (central) and of the peritoneal cavity (peripheral) can be dissociated in specific experimental conditions. alox mutants and the pas mice of the same background provided an excellent combination to assess the effect of 5-lo inactivation and were very useful in confirming the relationship of drug effects to the presence of a functional 5-lo. for inhibition of the 5-lo pathway, we chose mk886 because it is considered specific [14, 15 ] and does not have an effect on the bone - marrow by itself [19, 20 ]. importantly, neither mk886 treatment nor 5-lo inactivation changed significantly the baseline of epo+ cell numbers in bone - marrow, showing that neither condition affects steady - state eosinophil production. this is consistent with previously published studies on eosinophils from alox mice in vivo as well as in vitro [19, 20 ]. hence, the effect of 5-lo inactivation / blockade was significant only for the selective increase in eosinopoiesis inside bone - marrow from sensitized mice induced by in vivo allergen exposure, which is the primary effect of dec in murine allergy. by contrast, that il-5 is necessary for both the steady - state (baseline) production and the increased production prompted by an immune response, as documented by the classical study of nishinakamura and colleagues. hence, 5-lo and il-5 play complementary and distinct roles, with il-5 being the indispensable lineage - selective growth factor, while 5-lo is necessary for the modification of il-5 effects, which ultimately result in an increased eosinophil production. the usefulness of combining genetic and pharmacological approaches is demonstrated in this study by our ability to establish a link between 5-lo and the effectiveness of dec and montelukast in blocking the hematological response to challenge. this was accomplished by showing an effect for both drugs in wild - type mice, which respond to allergen challenge, together with the absence of any effect in mutants lacking 5-lo, which do not respond to challenge. the conclusion was based on a positive result (blockade of the response to allergen challenge in wild - type mice), together with a negative control result (no effect of any of the drugs in mice lacking their putative pharmacological target, namely, the 5-lo pathway). the inclusion of a negative control branch in these experiments may seem unnecessary or even exaggerated, as the drugs we used could reasonably be assumed to have no effect in an animal which lacks the physiological response to challenge that they are expected to block. however, caution is recommended when a drug, or a drug panel, is evaluated, because many drugs have been shown in the past to have unexpected actions, due to effects on previously uncharacterized pharmacological targets, distinct from those assumed by the investigators to be relevant. neither diethylcarbamazine nor montelukast had any significant impact on eosinophil production in mice lacking 5-lo. for montelukast, the results support the assumption that it is selective for cyslt1 receptors. for diethylcarbamazine, which has biochemical effects other than inhibition of leukotriene production, we feel more confident about its dependence on 5-lo because it had no effect in alox bone - marrow. furthermore, we have examined whether montelukast would duplicate the effects of mk886 and of 5-lo inactivation, as expected if cyslt were the relevant 5-lo products lacking in the presence of mk886 or an inactive 5-lo. the results show that montelukast is as effective in wild - type mice as mk886 and, like dec, does not work in alox mutants. this is consistent with the effect of allergen challenge in mice being accounted for by cyslt, as suggested by previous human studies, and argues against an important role for ltb4 or lipoxins, which are not counteracted by cyslt receptor blockade, in this response. a further prediction is that mice lacking cyslt type i receptors should behave as mice pretreated with montelukast and show no eosinopoietic response to allergen challenge, an issue that should be addressed in future studies. priming of bone - marrow in vivo for an increased ex vivo response to il-5 in bone - marrow culture is a very reproducible effect of allergen challenge [9, 10 ]. allergen challenge of sensitized animals in different models has been shown to result in il-5 [9, 10, 12 ] and cyslt production [13, 15 ]. montelukast, which blocks cyslt actions on eosinopoiesis in vitro [19, 20 ], acted in vivo to block the primary effect of allergen challenge on the bone - marrow, which is an increased eosinophil count, usually accompanied by priming for increased responses to il-5 in culture [9, 10 ]. hence, it is reasonable to assume that priming involves an effect of cyslt that can be blocked by montelukast and is therefore mediated by cyslt1r. priming in our experiments took place in the 48 h period after challenge, during which bone - marrow is likely to have been exposed to both il-5 and cyslt. so, cyslt do not prime eosinophils in the absence of il-5 for an increased response to a subsequent exposure to il-5. instead, the exposure of bone - marrow in vivo to both il-5 and cyslt primed for an increased exposure to il-5 alone. importantly, both il-5 and 5-lo / cyslt (as shown here) are required for the hematological response to allergen challenge. this means that selective increases in eosinopoiesis can be accounted for by a synergic combination of il-5 and cyslt, in which il-5 is eosinophil - selective, while cyslt act on cells stimulated by il-5 to enhance il-5 effects. because the target of cyslt depends on il-5 to be stimulated, the synergic combination of cyslt and il-5 necessarily works as lineage - selective stimulus. one should be cautious when comparing the above situation with that in bone - marrow cultures established from naive (nonsensitized) mice [19, 20 ]. it has been shown that cyslt, when added in vitro together with il-5, significantly enhance the production of eosinophils in bone - marrow culture [19, 20 ]. in these conditions, cyslt are ineffective in the absence of il-5, as they do not support eosinophil production in bone - marrow culture by themselves (unpublished observations). while priming can be studied in vitro, by separate addition to the cultures of the priming agent (cyslt) and the growth factor (il-5), this is probably informative only for the in vitro situation, where one can control the time of exposure to (exogenous) leukotriene and il-5. this experimental design can not be extrapolated to the analysis of events in vivo, where such manipulation can not be done without changing the underlying conditions of the entire study. finally, an unexpected finding in the study of the relationship of dec to 5-lo was its effectiveness against the large - scale accumulation of eosinophils in the spleen of sensitized / challenged balb / c mice, which is induced by challenge, and therefore builds up in the course of 3 days (the repeated challenge period). several lines of evidence indicate that the accumulation of eosinophils in these two sites (spleen and bone - marrow) is part of an integrated hematological response to sensitization and challenge. eosinophilia in both sites is (a) induced by challenge in balb / c mice over the same three - day period ; (b) prevented with identical effectiveness by long - term (12-day) and short - term (3-day) courses of dec ; and (c) resistant to dec treatment after a single unprotected challenge. the magnitude of the eosinophil response in the spleen is itself surprising, as it largely surpasses the counts in femoral bone - marrow, suggesting that after challenge the spleen may quickly become the largest reservoir of eosinophils in vivo, through a leukotriene - dependent mechanism, which clearly deserves further examination, by its magnitude as well as by its fast responsiveness to dec therapy. this phenomenon, to our knowledge, has not been described in a murine model of allergic disease. however, there have been reports of splenic eosinophilia in humans, associated with fatal anaphylactic reactions, which are paralleled by massive mast cell degranulation in splenic tissue, a finding that suggests that the spleen is a major shock organ in systemic anaphylaxis. if so, the findings in the murine model suggest that massive accumulation of eosinophils in the spleen also occurs during nonfatal allergic reactions and is dependent on 5-lo and responsive to dec treatment. this should prompt future examination of the possible benefit of dec treatment in models of systemic anaphylaxis. one important implication of these findings is that the mechanism of dec actions in the hematological response to allergen challenge must be reevaluated, taking into account that it requires 5-lo. previous studies [24, 25 ] had shown dec effects to be dependent on inducible no synthase, which is an essential part of a proapoptotic pathway activated by a variety of soluble ligands. the present study makes it unlikely that dec induces or activates inos directly, as no effect of dec was observed in 5-lo - deficient mice. however, there may be an indirect relationship of dec to inos such that inos activation or expression in the bone - marrow of sensitized / challenged mice requires blockade of 5-lo. this should be examined in the future, by direct monitoring of inos and 5-lo in bone - marrow exposed to the same panel of drugs used in this study. | diethylcarbamazine (dec), which blocks leukotriene production, abolishes the challenge - induced increase in eosinopoiesis in bone - marrow from ovalbumin- (ova-) sensitized mice, suggesting that 5-lipoxygenase (5-lo) products contribute to the hematological responses in experimental asthma models. we explored the relationship between 5-lo, central and peripheral eosinophilia, and effectiveness of dec, using pas or balb / c mice and 5-lo - deficient mutants. we quantified eosinophil numbers in freshly harvested or cultured bone - marrow, peritoneal lavage fluid, and spleen, with or without administration of leukotriene generation inhibitors (dec and mk886) and cisteinyl - leukotriene type i receptor antagonist (montelukast). the increase in eosinophil numbers in bone - marrow, observed in sensitized / challenged wild - type mice, was abolished by mk886 and dec pretreatment. in alox mutants, by contrast, there was no increase in bone - marrow eosinophil counts, nor in eosinophil production in culture, in response to sensitization / challenge. in sensitized / challenged alox mice, challenge - induced migration of eosinophils to the peritoneal cavity was significantly reduced relative to the wild - type pas controls. dec was ineffective in alox mice, as expected from a mechanism of action dependent on 5-lo. in balb / c mice, challenge significantly increased spleen eosinophil numbers and dec treatment prevented this increase. overall, 5-lo appears as indispensable to the systemic hematological response to allergen challenge, as well as to the effectiveness of dec. |
the first objective was to describe findings from 6 us state or county health departments that have been funded by cdc to perform enhanced surveillance for hcv infection. the second objective was to discuss the limitations and challenges of conducting population - based surveillance for hcv infection in the united states. the sites where enhanced hepatitis surveillance was conducted during 20062007 were colorado, connecticut, minnesota, new york (excluding new york city), and oregon ; pinellas county, florida, a sentinel counties (8) site, also contributed hepatitis c reports. the combined population under surveillance from the 5 states and 1 county was an estimated 29.3 million in 2007 (table). in each of these jurisdictions, clinical laboratories are required to report positive results from hcv assays. for this analysis, a confirmed case of hcv infection was identified in any person who, from july 1, 2006 through june 30, 2007, had at least 1 of the following : 1) a positive result for an hcv recombinant immunoblot assay (riba), 2) a positive nucleic acid test (nat) result for hcv rna, 3) a documented hcv genotype, or 4) a positive result for a screening test for antibodies against hcv (anti - hcv) with a signal - to - cutoff (s : co) ratio predictive of a true positive result for the given assay. hcv, hepatitis c virus ; riba, recombinant immunoblot assay ; anti - hcv, antibodies against hcv ; s : co, signal - to - cutoff. a confirmed case requires laboratory confirmation. laboratory criteria consist of at least 1 of the following : a positive result for a hcv riba, a positive result for a nucleic acid test for hcv rna, an hcv genotype, or enzyme immunoassay with detection of anti - hcv and a s : co ratio predictive of a true positive result for a particular assay (see www.cdc.gov/ncphi/disss/nndss/casedef/hepatitisccurrent.htm for the 2005 council of state and territorial epidemiologists / centers for disease control and prevention case definition). excludes new york, new york. cases could be reported with more than minimum laboratory criteria ; totals add up to > 100%. other sources of reports included private healthcare providers, facilities such as hospitals and outpatient clinics, and institutions such as prisons, blood banks, and drug treatment centers, among others. laboratories and providers continuously reported positive results for hcv markers (e.g., anti - hcv, riba, nat, genotype) to state or local health departments. health department staff checked patients names and dates of birth from each report against a surveillance database to determine whether a case had been previously reported. newly reported cases (i.e., previously not captured in the database of this jurisdiction) were entered into this database along with hepatitis test results. health department staff investigated cases and collected basic demographic and clinical information to confirm the case definition and to epidemiologically describe the case. we calculated rates of newly reported cases by using denominators available from the 2007 population estimates from the us bureau of the census (www.census.gov/compendia/statab). staff at each site monitored a convenience sample of laboratory reports and measured the number excluded, reasons for exclusion, and the number that eventually were classified as newly reported cases. for this task, cdc drew a random sample of 10 cases per site from among those reported during the 12-month reporting period (n = 60) and extracted the following variables : date of birth, county of residence, sex, race, and clinical test results associated with hcv infection. we measured agreement between the information initially reported and the information collected during the validation using a statistic (9). the 6 sites reported a total of 20,285 cases of confirmed hcv infection that were previously unreported in their respective jurisdictions (table). of these, 66% of case - patients were male and 56% were 4054 years of age (men and women combined) (table). more than half (52%) of the reports lacked information on race or ethnicity. the laboratory criterion most frequently reported was a positive result for hcv rna (53%). the rate of new reports of past or present hcv infection was 69/100,000 population (range 25108/100,000). sites monitored all incoming reports on average for 8 days (range 516 days). a total of 2,180 reports were received and, among these, 491 (23%, range 13%52%) met the case definition and were considered newly reported cases ; oregon had the highest proportion of newly reported cases (52%) and the newest registry. the remaining reports fell into the following categories : already in the database (68%, range 30%78%), lacking value for s : co ratio (5%, range 3%13%), negative test results for an hcv marker (2%, range 1%4%), or missing key demographic data (1%, range 0%2%). agreement was high for age (= 1.0, p<0.001), sex (= 0.96 ; p<0.001), and county of residence (= 1.0 ; p<0.001) ; county data were missing for 6 (10%) cases. we documented that for every 4 laboratory reports, 1 newly reported case of hcv infection was identified. the overall annual rate of new case reports was 69/100,000 population in 6 sites that were conducting enhanced surveillance. in the 4 states (colorado, connecticut, minnesota, oregon) for which comparable data were available, the number of newly reported cases of hcv infection was at least 4 the number of newly reported hiv infections in 2006 (10). the 1 county in florida was not included in the comparison because no hiv data were available. first, we do not know how many of the newly reported cases represent current infections. in the united states, 80% of prevalent anti - hcv positive cases are hcv rna positive (2) ; thus, most laboratory confirmed cases reported to surveillance are likely chronic infections, but could also represent acute or resolved infections. electronic laboratory reporting is the most efficient way to identify potential cases (11), but because no current laboratory test can distinguish acute from chronic hcv infections, identification of acute - phase cases requires contacting the provider or patient to determine whether acute symptoms were present. due to the high volume of reports received, providers are inconsistent about eliciting risk factor information and about testing and referring patients to specialists (12). patient access to care and structural factors in institutions (e.g., incentives and disincentives for testing at jails, prisons, and drug treatment programs) and in the community (e.g., screenings) also affect testing and, therefore, the reporting rate. the greatest value of conducting surveillance for chronic hcv at the state and local level is to measure local frequency of disease. local and state health departments share information such that changes of residence of cases within the state over time would not result in a duplicate case count. however, in aggregating these data at the national level, an infected person who moved from 1 state to another would likely trigger a new report in another state, thus resulting in an overestimate of the national prevalence. therefore, as a coordinated surveillance system for chronic hcv is developed, a mechanism to prevent duplication of cases across states will need to be developed. many factors affect case reporting, such as, local public health reporting requirements, the sophistication and capacity of laboratories to electronically report de - duplicated positive test results, availability of health department staff to conduct investigations and follow - up on reports, time since registry was initiated, and the capacity of the system to maintain ongoing surveillance efforts. without an understanding of these factors, interpreting the meaning of new hcv infection case reports is difficult. local health departments need chronic hcv infection surveillance to document effects of disease, identify persons in need of linkage to care, and prevent complications among persons infected (13). however, accurately collecting the necessary information is challenging for health departments, and we currently lack evidence that obtaining these data will result in a lower incidence of illness and death. a full assessment of the benefits and costs of conducting comprehensive surveillance for chronic hcv infection is overdue. currently, the enhanced hepatitis surveillance sites are developing recommendations for best practices and plan to share methods and tools with all interested health departments. future studies should evaluate what level of surveillance for chronic hcv is feasible and whether the prevention benefit is worth the effort. | surveillance for hepatitis c virus infection in 6 us sites identified 20,285 newly reported cases in 12 months (report rate 69 cases/100,000 population, range 25108/100,000). staff reviewed 4 laboratory reports per new case. local surveillance data can document the effects of disease, support linkage to care, and help prevent secondary transmission. |
fifty years have passed since novotny and alvis performed the first fluorescein angiography (fa). this invasive method uses intravenous fluorescein to produce fluorescence images of circulating blood in the human retina. for many years this procedure has been considered the gold standard for imaging the retinal vasculature network. from its commercialization, both time and spectral domain (sd) optical coherence tomography (oct) modalities have dramatically changed the daily clinical practice in ophthalmology [3, 4 ]. with the introduction of sd - oct, thus it was possible to generate clinically useful cross - sectional and 3-dimensional (3d) images of the retinal layers. a limit remains in that this imaging modality can not visualize and thus can not provide functional information of retinal microcirculation. recently, a novel dyeless method of microvasculature imaging called oct angiography (oct - a) was introduced. several prototypes used the normal movement of the red blood cells in the retinal capillaries as intrinsic contrast medium to generate flow imaging. the phase - based and amplitude - based modalities showed feasibility of rendering deeper structural details of retinal and choroidal microvascular structures when motion - based contrast techniques are used [69 ]. three examples that are currently in use are as follows : phase variance oct (pv - oct), phase contrast oct (pc - oct), and split spectrum amplitude decorrelation angiography (ssada) (angio - oct). these methods were implemented using both sd and swept - source oct (ss - oct) imaging systems in order to detect the transverse and axial flow thus differing from doppler oct that measures just the axial velocity. pilot studies that investigated these oct systems in patients with age - related macular degeneration and glaucoma [1012 ] confirmed their utility. amplitude - based oct signal analysis may be advantageous for ophthalmic imaging since it uses a speckle variance method that does not suffer from phase noise artifacts and does not require complex phase correction methods. both phase - based and amplitude - based oct provide noninvasive visualization of both larger blood vessels and capillary networks in the retina and choroid [6, 8 ]. the results obtained with these modalities were comparable to currently used invasive angiographic imaging [6, 8 ] in addition to being able to separately characterize features of the superficial and deep vascular plexuses, which can not be distinguished in fa. the aim of this study was to evaluate the ability of oct - a for imaging retina of subjects affected with vascular diseases to assess perfused and nonperfused areas and choroidal neovascularization (cnv), using xr avanti angiovue oct (optovue, inc, fremont ca, usa). this prospective unmasked study adhered to the tenets of the declaration of helsinki, and informed consent was obtained from all patients prior to their enrolment. seven eyes of seven consecutive caucasian patients (four males and three females) ranging in age from 54 to 64 years (mean 59.1 years), referred to the ophthalmic clinic of university chieti - pescara, italy, for the presence of retinal vascular diseases from october 1 to 31, 2014, were examined. two healthy subjects with no significant medical history and no signs or symptoms of retinal vascular disease were included as controls. fa was performed in all subjects with the spectralis hra + oct (heidelberg engineering gmbh). indocyanine green angiography (icga) was performed only in patients with suspected choroidal neovascularization (cnv). all eyes were also scanned with the sd - oct xr avanti (optovue inc, fremont ca, usa), using the following settings : high speed (70,000 a - scans / seconds), 840 nm wavelength (band - width 45 nm), and an axial resolution of 5 m. this algorithm identifies blood flow by calculating the decorrelation of signal amplitude from consecutive b - scans performed at the same retinal acquisition plane. decorrelation of oct signal amplitude between b - scans taken at the same nominal position could be caused by flow, bulk tissue motion, scanner position error, and background noise. to enhance true flow in the images and improve the signal - to - noise ratio for flow detection, the decorrelation due to bulk motion and background noise were eliminated. the ssada data was separated into retinal and choroidal regions with the dividing boundary set at the retinal pigment epithelium (rpe). the depth (z position) of the highly reflective rpe was identified through the analysis of the reflectance and reflectance gradient profiles in depth. the region above the rpe was the retinal layer and the region below was the choroidal layer. since the retina is a laminar structure with a stratified blood supply, en face x - y projection angiograms were produced by selecting the maximum decorrelation value along the axial (z) direction in each layer. segmentation of the retina in specific layers provided a simple en face visualization of the corresponding vascular supply for that layer. automatic segmentation was used to identify retinal layers. when a retinal pathology was present (i.e., presence of subretinal fluid or serous pigment epithelial detachment), manual correct of the segmentation was necessary in order to avoid both image processing software and segmentation errors. the allowable field of view (fov) in the retina ssada scans is 2 2, 3 3, 6 6, and 8 8 mm. a 3 3 mm fov is the recommended default size for visualization of retinal capillaries. the 6 6 or 8 8 mm scans are the recommended scans for performing large area scans of the retina. in healthy subjects oct - a visualized major macular vessels and detailed capillary networks around the foveal avascular zone. the vascular network was similar to those reported using fa (figure 1(a)). notably, oct - a revealed more capillary details compared to fa in the superficial and, especially, in the deep retinal layer (figures 1(b) and 1(c)). patients 1 and 2 were affected with ischemic branch retinal vein occlusion (brvo). a composite map composed of three 8 8 mm scans from patient 1 and an 8 8 mm oct - a scan from patient 2 are shown in figures 2 and 3(b), respectively. in both cases, oct - a distinguished perfused and nonperfused areas located in both the posterior pole and mid periphery (figures 2 and 3). the main finding was the low flow area in oct - a, which correlated with the area of hypofluorescence in fa due to retinal artery hypoperfusion. moreover, the en face image adapted to the rpe surface showed the presence of ischemia - induced area of hyporeflectivity and longitudinal b - scan revealed focal thickening and hyperreflectivity within both inner and deep capillary plexuses (figure 4). in patient 4, the color - mode oct - a aided in detecting the vascular network of myopic cnv and in defining specific morphological features (figure 5). the entire vascular pattern was seen with enhanced details compared to simultaneous fa and icga frames. color - mode oct - a in patient 5, affected by myopic cnv, showed the response to therapy with intravitreal antivascular endothelial growth factor medications (figure 6). analysis of oct - a changes indicated a reduction in size and flow of cnv and the resolution of subretinal fluid observed in b - scan. patients 6 and 7 were affected with cnv secondary to age - related macular degeneration (amd). classic cnv (figure 7) focused on the outer capillary plexus and above the rpe. retinal angiomatous proliferation (figure 8) was detected at the level of the deep capillary plexus. by using oct - a, cnv was clearly recognizable and the rim and area of neovascularization were more easily detectable compared to fa and icga. this study aimed at examining the ability of oct - a, a promising and noninvasive imaging modality, to image the vascular modifications within the inner and outer retinal layers in several retinovascular diseases. currently, fa and icga are considered the gold standard for defining functional and morphological features in patients affected with ocular vascular diseases. however, both techniques are invasive since they require intravenous dye injection and are bothersome for some patients who complain of side effects that range from nausea / vomiting to serious anaphylactic reactions (although the latter is rare). moreover, fa can only show vessels in a nearly transparent structure with a thickness that is on the order of only hundreds of micrometers. this allows a good visualization of the superficial capillary network of the retina but not of the deep capillary layer [15, 16 ]. on the other hand, oct angiography obtained with the ssada algorithm provides images of both the superficial and deep retinal vascular plexuses. in the present study both oct - a and fa provided clinically useful images of the inner retinal vascular plexus this was in accordance with results of imai. who used swept - source oct in patients with brvo, reporting a good agreement between fa and oct - a in assessing the area and colocalization of nonperfused area. the authors concluded that oct angiography was a valuable alternative imaging modality for studying ischemic diseases in both the diagnostic phase and during follow - up. in support of this, vein occlusions and inflammatory vascular diseases may be selectively involved, as suggested by modifications of middle layers in oct b - scans. one of the most promising fields for the application of oct - a is cnv imaging. other structural oct imaging modalities can not directly identify the cnv structure, but only the presence of changes such as abnormal tissue above or below the rpe. therefore, the present study showed that oct - a was also valuable in imaging and quantifying cnv in myopia and amd since the neovascularization was successfully identified in all patients presenting this lesion. the ssada algorithm was crucial in differentiating cnv from the surrounding outer retinal tissue, rpe, and hemorrhages. this confirmed the preliminary data reported by jja. in a swept - source oct prototype study. notably, cnv vascular network patterns were more distinct in oct - a scans compared to fa and icga, particularly in terms of location, size, and presence of feeder vessels. it is important to keep in mind that subretinal and surrounding cnv fluid appeared as a low flow area in oct - a (because ssada identifies only moving flow), whereas it produced a hyperfluorescent pattern in fa ; where the fluid outside of the blood vessels generates dye leakage overall, oct - a was not completely comparable to fa and icga angiograms. in fact, oct - a provided static images of the vascular flow, without providing dynamic information, which was conversely provided by classical ocular angiographies with dyes. however, the integration of structural and quantitative data obtained with oct has the potential to be a new useful tool for studying retinal vascular diseases. although this pilot study has the weaknesses of limited sample size it showed the potential of oct - a for providing quantitative data for diagnosis and follow - up of different retinochoroidal diseases without the use of intravenous dyes. the first limit of this new technique was that the field of view (3 3 mm, 6 6 mm and 8 8 mm) was smaller than conventional fa. in the future the fov should increase as scan speeds increase. the second limit was that a precise fixation was required in order to obtain good images, so this technique was not reproducible in patients with low vision. | purpose. to assess the ability of optical coherence tomography - angiography (oct - a) to show and analyze retinal vascular patterns and the choroidal neovascularization (cnv) in retinal vascular diseases. methods. seven eyes of seven consecutive patients with retinal vascular diseases were examined. two healthy subjects served as controls. all eyes were scanned with the sd - oct xr avanti (optovue inc, fremont ca, usa). split spectrum amplitude decorrelation angiography algorithm was used to identify the blood flow within the tissue. fluorescein angiography (fa) and indocyanine green angiography (icga) with spectralis hra + oct (heidelberg engineering gmbh) were performed. results. in healthy subjects oct - a visualized major macular vessels and detailed capillary networks around the foveal avascular zone. patients were affected with myopic cnv (2 eyes), age - related macular degeneration related (2), branch retinal vein occlusion (brvo) (2), and branch retinal artery occlusion (brao) (1). oct - a images provided distinct vascular patterns, distinguishing perfused and nonperfused areas in brvo and brao and recognizing the presence, location, and size of cnv. conclusions. oct - a provides detailed images of retinal vascular plexuses and quantitative data of pathologic structures. further studies are warranted to define the role of oct - a in the assessment of retinovascular diseases, with respect to conventional fa and icg - a. |
viral hepatitis infections are a major health concern in many countries, affecting certain groups of people more than others. these diseases are economic, social and psychological burdens on those affected and lead to a high number of deaths (1). hepatitis b virus (hbv) is the most common type of these infections and while many individuals can be non - clinical carriers, it may be acute self - limiting, chronic or fatal in others. epidemiological studies show that over 2 billion people in the world are exposed to hbv, and about 400 million people carry it (2). almost 45% and 43% of the world s population live in hyper - endemic (over 7% prevalence) and meso - endemic areas (prevalence of 2% - 7%), respectively (3). although the prevalence of hbv has significantly decreased in iran and worldwide in recent years, reports show that iran is among the meso - endemic countries, similar to some of the other mediterranean countries (4, 5). a systematic review conducted by mohammadi. reported the prevalence of hbv in the iranian general population as 3% (6). hbv may be transferred from one person to another through contact with infected blood and semen. because of its unique viral membrane, hbv can survive outside the body for one week ; this increases the chance of individuals becoming infected, if they come in contact with the infected objects. this poses an especially high risk for certain occupational groups who routinely handle such objects, one of which are municipal solid waste workers (mswws) (7). generally, mswws are at a high risk of a variety of injuries and infections, such as hiv and hepatitis through exposure to infected needles / sharp objects in wastes, which may lead to disease transmission (8 - 10). a study performed in brazil reported the prevalence of hbv exposure in the mswws as 12.8% (11). two other studies on afghan and greek mswws reported the prevalence of hbv as 4% and 7%, respectively (12, 13). in a systematic review by corrao. based on a study, 35% of mswws and medical staff in the western parts of iran are at a lifelong risk of hbv in various ways (14). therefore, screening at risk occupational groups such as mswws is of great importance and is effective in preventing the spread of hbv among them as well as their families (3, 15). studies were previously conducted on other occupational groups such as hair dressers and mswws in different parts of iran (16) ; however, no comprehensive study was performed on msww in the southeastern areas of iran. the current study aimed to examine the prevalence of hbv and its risk factors in municipal solid waste workers compared to municipal employees not exposed to solid waste in zahedan, iran. the current cross - sectional study was carried out on a total of 654 male municipal staff in different areas of zahedan in 2013. about 3 ml of blood was taken from each participant, transferred to the laboratory under standard conditions, and tested for hbsag using the enzyme - linked immunosorbent assay (elisa). the data regarding the high risk behaviors and independent variables were collected through in - depth interviews and recorded in data sheets. the data sheets consisted of two parts, demographic characteristics and the history of exposure to possible risk factors of hbv. the participants were informed about the study objectives and the confidentiality of data in order to obtain valid answers, and all participants were included in the study with a signed informed consent. the participants were asked about any history of imprisonment, alcohol use, scarification, smoking and drug abuse, tattooing, jaundice, blood transfusions, surgical operations, endoscopy, hospitalization, wet cupping, needle stick injuries, battlefield experience, circumcision, immunization and dental treatments. of the participants, those with a history of tattooing, smoking or drug abuse, unsafe sexual intercourse with someone other than the spouse, alcohol use, scarification and imprisonment were considered to have high risk behaviors. chi - square test, fisher exact test and multiple logistic regression analysis were performed. modeling and determination of the variables in the final model were performed through the hosmer - lemeshow method. given the fact that coefficients in the multivariate and univariate logistic regression analyses were estimated on the basis of large - sample approximation, the number of model parameters should have been lower than 10% of the case numbers. due to the small number of cases in this study, the exact logistic regression was used for analysis. possible interactions of the studied variables were not included in the final multivariate model in order to avoid bias. the current study included 654 subjects : 178 (27.2%) mswws, 293 (44.8%) municipal employees not exposed to waste and 183 (28%) zahedan municipality drivers. the mean age of participants was 41.6 9.1 years, and all of them were male. table 1 illustrates the frequency of high risk behaviors among study participants. in general, 8.7% (95% ci : 7.6 - 9.8%) of participants reported a history of high risk behaviors. the frequency of risky behaviors was different among drivers (11.2%), mswws (8.1%) and staff not exposed to waste (7.5%). overall, 3.06% (95% ci : 1.70 - 4.40%) of the tested employees were positive for hbsag. nevertheless, seroprevalence of hbv significantly varied among the three study subgroups as follows : 6.20% (95% ci : 2.70 - 9.70) among mswws, 3.3% (95% ci : 0.08 - 5.80) in drivers and 1% in staff who were not exposed to waste (p < 0.01), there was a significant association (p < 0.05) between hbv positivity and all the following characteristics : low educational level, older age, longer duration of employment, lack of hbv immunization, a history of jaundice, endoscopy and battlefield experience, as well as occupational exposure to waste, to needle sticks and the other risky behaviors (tables 2 and 3). moreover, the prevalence of hbsag positivity among municipal staff experiencing at least one risky behavior was considerably higher (p < 0.01) than in those without any high risk behaviors. therefore, the abovementioned variables were included in a multiple logistic regression model. after adjusting for potential confounder variables, waste exposure, lack of immunization, a history of jaundice and endoscopy, and exposure to high risk behaviors remained as independent risk factors for hbv in the final model of multivariate analysis. mswws were more than nine times likely to have hbv compared to those not exposed to waste ; or = 9.36 (95% ci : 2.01 - 43.68). the risk of developing hbv was about four times higher in non - immunized subjects than the vaccinated ones ; or = 3.83 (95% ci : 1.09 - 4.16). a history of jaundice was also associated with an approximately 7-fold higher risk of hbv ; odds ratio = 6.91 : 95% ci ; 1.51 - 31.53). furthermore, exposures to risky procedures / behaviors were significantly associated with an increased risk of hbv (or = 4.80 ; 95% ci : 1.96 - 27.2). there was also a nearly 3-fold increase rate of hbv in individuals with a past history of endoscopy (or = 2.86 ; 95% ci : 1.08 - 7.62). the current study assessed the prevalence of hbv in the municipal staff of zahedan. although hbsag positivity varied significantly in the staff subgroups, it was the highest among municipal solid waste workers (6.20%). a recent study in the general population of zahedan showed that the prevalence of hbv was 2.5% (17). based on other studies also conducted in the general population, hbv ranged from < 2% to 2.5% in other parts of iran (18 - 21) with the exception of golestan, where the prevalence was reported at 8.9% (22). therefore, it is evident that the prevalence of hbv is higher in mswws than the general population. in addition, a study conducted on tehran afghan waste collectors estimated the prevalence of hbv at 4% (12), showing that even among mswws those in zahedan were at higher risk of hbv than those in tehran. an international review reported a prevalence of 11% for positive hbsag in municipal waste collectors. based on those results, hbv prevalence is lower in mswws of zahedan, compared to that of the global rates (8). another study performed in greece reported a prevalence of 7% which is similar to the results of the current study (13). the current study showed that despite the impact of age, duration of employment, educational level and type of occupation on occurrence of hepatitis b, the immunization record, jaundice, endoscopy, needle stick, and high risk behaviors might justify the high risk of positive hbsag among the studied participants through controlling the confounding factors. the risk of infection with hepatitis b increased with increasing age and longer duration of employment among municipal staff which might be due to the higher chance of exposure to risk factors and different sources of infection overtime. on the other hand, hepatitis b decreased with higher educational levels, which might be due to higher awareness of hbv transmission routes. studies in brazil and iran show a significant correlation between acupuncture and hbv (23, 24). in this study endoscopy given the fact that this procedure has increased over the recent years, it is necessary to have more strict disinfection policies in order to avoid possible spread of infection. immunization significantly prevents hbv (11, 23). despite the recommendations for immunization and the efforts made to fully vaccinate the target population, 19% of the current study participants, mostly mswws, did not have an hbv immunization record and over 22% of the participants had not completed the course of immunization. better education on the effectiveness of immunization, as well as the importance of completing the vaccination course should be prioritized by the health system and municipalities. it is noteworthy to say that since mswws are at a higher risk of contracting certain infectious diseases, they can receive the necessary vaccines free of charge in iran. however, it seemed that behaviors, such as smoking and drug abuse, a history of imprisonment, and scarification increased the exposure to the virus directly and also indirectly by weakening immune system which in turn increases the risk of infection (11). in the current study, 11.5% of the participants, all mswws, had been exposed to needles thrown on streets or had needle stick injuries. marinho. also reported a higher exposure to needles than that of the present study (11). although in the final model, there was no significant correlation between the exposure to needles and positive hbsag, this variable remained in the model and improved its fit. therefore, it is important to provide the municipal workers, especially mswws, with protective equipment and thorough instructions on their use. among the limitations of the current study, its cross - sectional design, the large number of confounding factors and unclear temporal transposition are noteworthy. another limitation of the study was that high risk behaviors were self - reported and may be inaccurate and underestimated. however, it was the first study performed with this sample size in south - east of iran. the current study demonstrated that the prevalence of hbv among mswws was higher than those of other occupational groups and the general population. risk factors showed a cumulative effect and the risk of infection increases with an increase in age and exposure to risk factors. immunization and lower engagement in high risk behaviors are important methods to prevent hbv in this population. thorough education of mswws as well as the general population about hbv and its routes of transmission are also highly needed. this is especially important because of the frequent contacts of mswws with one another and with their family members which may spread the infection. the current study demonstrated that the prevalence of hbv among mswws was higher than those of other occupational groups and the general population. risk factors showed a cumulative effect and the risk of infection increases with an increase in age and exposure to risk factors. immunization and lower engagement in high risk behaviors are important methods to prevent hbv in this population. thorough education of mswws as well as the general population about hbv and its routes of transmission are also highly needed. this is especially important because of the frequent contacts of mswws with one another and with their family members which may spread the infection. | backgroundhepatitis b virus (hbv) is likely to be more prevalent in certain populations and occupational groups, such as municipal solid waste workers (mswws).objectivesthe current study aimed to estimate the prevalence of hbv and its risk factors among mswws compared to other municipal employees not exposed to waste.patients and methodsthe current cross - sectional study included 654 municipal employees in zahedan (south - eastern iran). a sample of blood was taken from each participant and tested for hbsag through the enzyme - linked immunosorbent assay (elisa). demographic and other data on high risk behaviors were also collected through in - depth interviews. data were analyzed using chi - square test and multiple regression analysis by stata.resultsthe overall prevalence of hbv among municipal employees was 3.06% (95% ci : 1.70 - 4.30) ; however, it varied among the different employee subgroups as follows : 6.20% (95% ci : 2.70 - 9.70) in mswws, 3.3% (95% ci : 0.08 - 5.80) in drivers and 1% among staff who were not exposed to waste. multiple regression analysis showed that exposure to waste [or = 9.36 ; 95% ci = 2.01 - 43.7 ], lack of vaccination against hbv [or = 3.83 ; 95% ci = 1.86 - 25.2 ], jaundice [or = 6.91 ; 95% ci = 1.51 - 31.5 ], history of endoscopy [or = 2.86 ; 95% ci = 1.08 - 7.62 ], and high risk behaviors [or = 4.80 ; 95% ci = 1.96 - 27.2 ] were independently associated with hbv.conclusionsgreater encouragement for immunization against hbv as well as better education on hbv transmission routes and work safety precautions should be implemented to reduce the prevalence of hbv in mswws. |
nasolacrimal duct obstruction (nldo) is the most common cause of chronic dacryocystitis and in this case the only treatment option is surgery [1, 2 ]. although the external surgical approach still is the gold standard with the highest success rate, the most recent stage in the development of dacryocystorhinostomy (dcr) is the endocanalicular or transcanalicular approach. in this approach, a probe with a red light on the end laser - assisted dcr application began with massaro. in 1990 ; and, in addition to argon laser diode, potassium titanyl phosphate (ktp), holmium yag, co2, nd : yag, and erbium lasers have also been used until today [57 ]. flexible endoscopes (0.30.7 mm diameter) modified from gastroduodenal endoscopes were developed for transcanalicular surgery. by extending the diameter of the endoscopes and increasing the pixels of imaging, some authors have suggested the use of silicon tube intubation in nldo surgery [9, 10 ], while some prefer using silicon tubes only for definitive indications (canalicular damage, lacrimal sac inflammation, secondary surgery, small and contracted sacs, etc.) [11, 12 ]. the purpose of this retrospective study was to compare the surgical outcomes of transcanalicular diode laser dacryocystorhinostomy (tdl - dcr) surgery with and without bicanalicular silicon tube intubation in the treatment of a series of 113 patients with primary uncomplicated nasolacrimal duct obstruction. a series of 113 patients who had not previously undergone this surgery were operated on for nldo between 2010 and 2013. the study was carried out in accordance with the tenets of the declaration of helsinki. approval for the study was granted by the clinical research ethics committee of gata haydarpasa training hospital (1491 - 59 - 14/1539) and informed consent was obtained from all the patients. group 1 is comprised of 58 patients who underwent tdl - dcr surgery with bicanalicular silicon tube intubation, and group 2 is comprised of 55 patients who underwent tdl - dcr surgery without bicanalicular silicon tube intubation. after complete ophthalmic examination, nasolacrimal duct obstruction was confirmed with lacrimal irrigation and dacryocystography with lipiodol preoperatively in each case. the patients were selected according to the following criteria : (i) no history of nasolacrimal duct surgery ; (ii) no canalicular obstruction ; (iii) no history of traumatic injury to the ocular or nasal region ; (iv) no concomitant nasal pathology, such as septum deviation, concha bullosa, nasal polyposis, and atrophic rhinitis ; (v) absence of active infective dacryocystitis ; (vi) absence of dry eye and lower lid laxity. topical anesthetic drops (oxybuprocaine hydrochloride 0.4%) were put on the conjunctiva and cornea. then intranasal, infraorbital, and lateral nasal side anesthesia were applied with a solution mixture of epinephrine hydrochloride and lidocaine. after dilating the lacrimal puncta, the fiber was inserted through the canaliculus to the wall of the sac. the feeling of a hard stop is essential during the insertion process. with the endoscopic visualization of the nasal cavity, the red light reflex of the fiber is clearly seen on the nasal wall of the middle turbinate plane (figure 1). in this way diode laser (intermedic diode s30 oft 980 nm) parameters were settled at 10 w in 500 ms pulse mode potency, taking care not to prolong each impact to avoid overheating the structures. after reaching the nasal cavity, a crawford - type aspirator was used to displace the middle turbinate medially to protect the septum and middle turbinate and to maintain adequate exposure to the surgical site. laser application was continued until the width of the new ostium becomes greater than 5 mm diameter (figure 2). the laser shots were between 28 and 45 shots at 10 watts. at the end of surgery, in addition to the surgery in group 1 (n = 58), bicanalicular silicone intubation was performed. silicone extensions of the tube were tied to each other and then were left free in the nasal cavity (figure 3). postoperatively, antibiotic and steroid eye drops, nasal steroid spray, and also nasal saline were to be used four times a day for 2 weeks. additionally, oral antibiotic was to be used for 7 days. follow - up postoperative examinations were carried out on the first day, in the first week, in the first month, in the 3rd month, and then at 3-month intervals. resolution of symptomatic epiphora and lack of resistance in nasolacrimal saline irrigation were defined as success. data analyses were performed using spss 14.0 (statistical package for social sciences, spss inc., the normal distribution of the considered variables was first evaluated using the shapiro - wilk test. the data was presented as the mean standard deviation for the continuous variables, and the number of cases was used for the categorical ones. independent samples t - test was used to compare the means between group 1 and group 2. the study is comprised of 113 patients : group 1 was composed of 58 patients (28 males, 30 females) with a mean age of 33.6 11.57 (2165) years and group 2 was composed of 55 patients (21 males, 34 females) with a mean age of 37.4 10.01 (2165) years. final success rates were (49/58) 84.4% for group 1 and (35/55) 63.6% for group 2 (p = 0.011). the mean surgical time for groups 1 and 2 was 15.96 3.01 and 13.74 3.66 mins (range : 921 mins in both groups), respectively. the mean surgical time was longer due to silicon tube tying in group 1 and there was a statistically significant difference among the groups (p = 0.001). the mean total laser energy of groups 1 and 2 was 670.52 49.18 and 651.09 49.57 joules (range : from 420 to 720 joules in both groups), respectively. there was no statistically significant difference among the groups in terms of total laser energy (p = 0.951). in group 1, the result was evaluated as a failure, as there was mucosal scarring around the osteotomized area, and reobstruction occurred between 3 and 6 months postoperatively in 4 patients and between 6 and 12 months in 2 patients. in the 2nd month, 1 patient in group 1 developed an episode of infection, which was immediately treated with medical therapy. except for that patient, there were no other complications such as erosion of the punctum, fistulation to skin, and removal of the tubes. in group 2, endoscopic examinations showed scarring of the internal ostium requiring secondary surgery in 20 of the patients. reobstruction occurred between 1 and 3 months in 12 patients, between 3 and 6 months in 6 patients, and between 6 and 12 months in 2 patients postoperatively. the follow - up period was 18.4 2.8 months for group 1 and 18.8 2.1 months for group 2. transcanalicular diode laser dacryocystorhinostomy (tdl - dcr) is a minimally invasive surgical procedure, which has the great advantage of accessing the operating field through anatomic pathways. it minimizes trauma to surrounding tissue, avoids unnecessary surgical skin scars, and provides precise cutting and removal of tissue by ablation. silicon tube intubation with dcr surgery is used to prevent the blocking of the lacrimal passage and to provide epithelization. since silicon is an inert substance, it does not damage the conjunctiva and can be well - tolerated in the canaliculi. as mentioned above, the use of silicon tube intubation has been suggested for patients with coexisting canalicular diseases, contracted or scarred lacrimal sacs, and persistent congenital nasolacrimal duct obstructions. allen. evaluated 242 cases retrospectively and showed no statistically significant difference between failure and age but a statistically significant difference between failure and silicon tube intubation. in their study, it was reported that formation of granulomatous tissue at the site of osteotomy is one of the most important failure factors in surgery with silicon tube intubation. in literature, there are few studies about dcr surgery with and without silicon tubes. while some studies have reported no statistically significant advantage of using dcr with silicon stents over the dcr without stents [1517 ], in the other studies, intubation is recommended in dcr surgery. concluded that no benefit was found in silicon tube intubation in primary dcr based on a meta - analysis of primary dacryocystorhinostomy with and without silicon intubation that included 9 trials involving 514 cases. in the current study, the tdl - dcr surgery group with silicon tubes had a success rate of 84.4% (49/58), while the other group without tubes had a success rate of 63.6% (35/55), with a significant difference between these groups (p < 0.05). the success rates of both groups in the current study were similar to previous reports. success rates have been reported to vary between 80% and 99% in external dcr surgery and between 58% and 97% in endoscopic nasal procedures [1822 ]. the success of this combination with silicon tubes in tdl - dcr, possibly occurring ostium closure, is due to inhibition by the silicon tube during wound healing. there were a total of 29 failures in this study : 9 in group 1 and 20 in group 2. formation of granulomatous tissue occurred in 3 failed cases in group 1. in this group, in addition, endoscopic examinations showed scarring of the internal ostium in 6 patients in group 1 and in 20 patients in group 2. suggested 4 to 6 weeks for the duration of silicon tube intubation. to prevent the formation of granuloma, kong. suggested not removing the tubes before 8 weeks. husler and caversaccio reported that the tubes were well - tolerated by the patients and permit drainage of the nasolacrimal ducts for months and even years. in that study, the tubes remained in place for 9 months on average. in the current study, the bicanalicular tubes in the lacrimal ducts were well - tolerated by all patients without notable problems except in 1 patient who developed an infection. the great number of female participants compared to the males was consistent with previous findings [18, 20 ]. this study concluded that the success rate was different in the two tdl - dcr surgery groups with and without silicon tubes. silicon tube intubation was advantageous for patients who were undergoing their first dacryocystorhinostomy surgery for nasolacrimal duct obstruction. on the basis of these different outcomes, bicanalicular silicon tube intubation should be used in tdl - dcr surgery for patients with primary nasolacrimal duct obstruction. | aim. to compare the surgical outcomes of surgery with and without bicanalicular silicon tube intubation for the treatment of patients who have primary uncomplicated nasolacrimal duct obstruction. methods. this retrospective study is comprised of 113 patients with uncomplicated primary nasolacrimal duct obstruction. there were 2 groups in the study : group 1 (n = 58) patients underwent transcanalicular diode laser dacryocystorhinostomy surgery with bicanalicular silicon tube intubation and group 2 (n = 55) patients underwent transcanalicular diode laser dacryocystorhinostomy surgery without bicanalicular silicon tube intubation. the follow - up period was 18.42 2.8 months for group 1 and 18.8 2.1 months for group 2. results. success was defined by irrigation of the lacrimal system without regurgitation and by the absence of epiphora. success rates were 84.4% for group 1 and 63.6% for group 2 (p = 0.011). statistically a significant difference was found between the two groups. conclusion. the results of the study showed that transcanalicular diode laser dacryocystorhinostomy surgery with bicanalicular silicon tube intubation was more successful than the other method of surgery. consequently, the application of silicone tube intubation in transcanalicular diode laser dacryocystorhinostomy surgery is recommended. |
the serratus anterior (sa) has an important role in normal scapulohumeral rhythm during arm elevation1,2,3. in particular, the sa acts as the prime motive force of upward scapular rotation and protraction1, 2 and also contributes to the stability of the scapula by maintaining the medial border of the scapula against the rib cage2, 3. it has been reported that weakness of the sa leads to abnormal kinematics of the scapula and scapular muscle imbalance, which is associated with musculoskeletal problems such as neck and shoulder pain, scapular winging, and impingement4,5,6,7. in a clinical setting, therefore, it is important to evaluate muscle strength of the sa for diagnosis and treatment planning8. the manual muscle test (mmt) is frequently used to evaluate muscle strength of the sa7, 8. kendall.7 suggested that scapular protraction against manual resistance from an examiner at 90 of shoulder flexion is appropriate as an mmt for sa. however, it is difficult to detect subtle differences in muscle strength because such mmts generally classify muscle strength into only six grades, which are based on the subjective evaluation of the examiner9, 10. furthermore, previous findings showed only poor to fair intra - rater reliability (0.380.72) when using an mmt for shoulder muscles11. thus, other more quantitative and reliable methods for measuring the strength of scapular protraction are needed. isokinetic dynamometers12 and handheld dynamometers9 have been suggested as means to quantitatively assess muscle strength. however, although isokinetic dynamometers are useful in this respect, they are not favorable in the clinical setting due to high equipment costs and time requirements12. handheld dynamometers are advantageous in terms of providing quantitative data and being relatively inexpensive ; however, the reported intra - rater reliability of the measurement of scapular protraction strength using these devices varies from poor (0.26)13 to high (0.94)9. williams.14 suggested that the reliability of the handheld dynamometer may be influenced by the strength of the examiners. considering the disadvantages of previously used methods and equipment for evaluating sa strength, especially the strength of scapular protraction, a new method is required that provides its own resistance and thus limits the need for subjective assessment. the aim of the present study was to assess the intra - rater reliability of measures of scapular protraction in supine and seated postures using a novel method and apparatus. in total, 49 healthy subjects (29 men and 20 women) without neck or shoulder pain in the previous 3 months participated in this study. the exclusion criteria were a history of surgery of the neck or shoulder, impingement, and other shoulder injuries. the mean age of the subjects was 20.63 1.84 years, the mean height was 169.61 8.05 cm, and the mean body weight was 61.52 11.47 kg. prior to participation, informed consent was obtained by requiring all subjects to read and sign a consent form approved by the inje university ethics committee for human investigations. to measure the strength of scapular protraction, a new force - measurement device was used, which consisted of a 700 300 18-mm wooden plate for supporting the thorax, a load cell (rsba-50l, radian, seoul, south korea) that measured the strength of scapular protraction, a nonelastic resistance belt that provided resistance, and a digital indicator (ri-10w, radian, seoul, south korea) that indicated the real - time strength of scapular protraction. the wooden plate and resistance belt were connected by a load cell that measured tension caused by scapular protraction. the analog signal produced by the load cell was converted into a digital signal, which could be displayed on the digital indicator in either newtons or kilograms of force. in this study, the range of this force measurement device was 045 kg, with a resolution of 0.001 kg and precision of 0.003 kg. the frequency of measurement was 100 hz. the strength of left and right scapular protraction was measured in the supine and seated positions in randomized order. in the supine position, subjects were asked to lie on the wooden plate, with the axis of the shoulder joint parallel to the load cell. the shoulder and elbow were placed at 90 of flexion9, the resistance belt was attached at the proximal ulna and radius, and the length of the resistance belt was adjusted so that it fit along the humerus. subjects were asked to push on the resistance belt as hard as possible to perform maximal scapular protraction and then maintain maximal scapular protraction for 5 s (fig. measure of the scapular protraction strength using a new force measurement device). in the seated position, the wooden plate was hung from a wall, and subjects sat on a chair at 90 of hip and knee flexion with the axis of the shoulder joint parallel to the load cell. the thorax was held against the wooden plate, and the shoulder and elbow were held at 90 of flexion. the fitted resistance belt was placed on the olecranon, as in the prone position. they repeated maximal scapular protraction three times, with a rest period of 1 min between trials under each condition. measure of the scapular protraction strength using a new force measurement device descriptive statistics were used to calculate the mean strength of left and right scapular protraction in the prone and seated positions. the intra - class correlation coefficient (icc3,1) was used to determine intra - rater reliability of scapular protraction in the seated and supine positions. although icc values > 0.75 are generally considered to indicate good reliability10, we used more precise criteria, as follows : poor reliability, 0.9015. the mean (standard deviation, sd) strengths of scapular protraction on the left and right sides in the supine position were 12.21 6.28 kg and 12.80 6.59 kg, respectively. in the seated position, these values were 14.87 6.80 kg and 15.84 7.93 kg on the left and right sides, respectively. the icc3,1 and 95% confidence interval for these measures of strength of scapular protraction are shown in table 1table 1. the intra - class correlation coefficients and 95% confidence intervals for measures of scapular protraction strengthsidesupine positionseated positionicc95% ciicc95% cileft0.970.960.980.980.970.99right0.970.960.980.970.950.98icc, intra - class correlation coefficient ; ci, confidence interval. high intra - rater reliability was observed in the supine position (0.97) and in the seated position (0.970.98). this study examined the intra - rater reliability of measures of scapular protraction strength using a new method that eliminates the need for subjective assessment of force. this method showed high intra - rater reliability (0.970.98) in both the seated and supine positions when assessing the strength of scapular protraction. in previous work, the reliability of measures of strength of scapular protraction using a handheld dynamometer was good to high (0.830.94)9, 10. however, these findings were not consistent with the results reported by donatelli.13, who found poor intra - rater reliability (0.26) for measures of scapular protraction strength. this inconsistency in previous findings may be due to differences between the maximal strength of the subject and the resistance applied by the examiner when using a handheld dynamometer. in mmt methods, muscle strength is generally measured by maximal isometric contraction of the target muscle against resistance from the examiner. as a result, inaccurate data may result if the subject can apply greater force than the resistance provided by the examiner. therefore, the poor intra - rater reliability for measures of scapular protraction strength observed in the previous study by donatelli.13, who examined professional baseball pitchers, may be attributable to insufficient resistance from the examiner. in line with this, components such as resistance belts that provide constant resistance are required as part of a quantitative force - measurement device to obtain accurate and reliable measures of muscle strength. in our study, we attributed the high reliability scores obtained in both the supine and seated positions (0.970.98) to the use of a resistance belt rather than a human examiner. although wang.10 used a customized apparatus that included an adjustable chain for providing resistance, the intra - rater reliabilities of measures of scapular protraction strength (0.830.89) were lower than those reported here (0.970.98). this is likely because the subjects in that study performed scapular protraction with the elbow extended, and resistance was applied to the hand. in contrast, our subjects performed scapular protraction with 90 of elbow flexion, and resistance was applied at the olecranon. the elbow - flexed position decreases the number of joints across which the scapular protraction force is applied9, which may help to more accurately measure strength of scapular protraction. therefore, modifying the position in which scapular protraction strength is measured may also contribute to the improved intra - rater reliability observed in the present study compared with previous findings. regarding the potential limitations of this study, the intra - rater reliability of measures of scapular protraction strength was only assessed in healthy individuals. future studies should examine inter - rater reliability of measures of scapular protraction strength using our method. moreover, additional studies are required to determine whether there are differences in scapular protraction strength, as measured by this method, in individuals with and without neck or shoulder pain or scapular winging. in conclusion, our findings provide clinicians with a reliable and convenient method for more accurately assessing and comparing scapular protraction strength. moreover, assessing scapular protraction strength using this method may be useful for determining prognosis as well as in treatment planning. | [purpose ] the purpose of this study was to investigate the intra - rater reliability of measures of scapular protraction strength using a novel method. [subjects ] forty - nine healthy subjects participated in this study. [methods ] subjects performed maximal isometric scapular protraction on the left and right sides in the supine and seated positions. during scapular protraction, resistance was applied to the olecranon, and the strength of scapular protraction was measured using a load cell. intra - rater reliability was calculated as the intra - class correlation coefficient (icc3,1). [results ] high intra - rater reliability scores (0.970.98) for scapular protraction strength were observed in the supine and seated positions. [conclusion ] these findings demonstrate that the method described herein may provide a more reliable and convenient method to measure scapular protraction strength than common current practice does. |
one of the main impacts of patients submitted to maxillectomy is the impairment of speech intelligibility. the undesirable coupling between the oral and nasal cavities reduces intraoral air pressure during speech production causing articulatory imprecision, hypernasal speech, nasal air emission, and reduced vocal loudness8. one of the main problems faced by them is the impairment of speech intelligibility, which interferes with the quality of life. the defects created by maxillectomy can be repaired by prosthetic obturation or even reconstruction, using free and microsurgical transplants, grafts, and distant or regional flaps. however, an obturator is still considered to be one of the best rehabilitation tools in maxillary resections due to its rapid accomplishment, low cost, and the possibility of modification according to the patient needs. the aim of obturator prosthesis is to obliterate the undesired communication between the oral and nasal cavities created by the tumor resection surgery, and to improve speech intelligibility and swallowing. however, studies in the literature correlating maxillary obturator prosthesis with functional aspects and perceptual bases of speech are scarce1,10,11,13,14,16,17,18. many of these studies are case reports and/or shows heterogeneous groups with individuals who have involvement of soft palate, that may not be as successful as in those with resections limited only to the hard palate. yoshida,.17 (1990) observed improvement in speech intelligibility after prosthetic treatment in only four of eight maxillectomized patients studied. three patients of this group with soft defects achieved slight improvement in syllable intelligibility with obturator. sullivan,.13 (2002) reported speech intelligibility, speaking rate and communication effectiveness results for 32 patients who had undergone partial surgical resection of the maxilla with a wide range of defects involving the hard and soft palate. their results revealed that prosthodontic intervention resulted in a 33% increase in sentence intelligibility, a 26-word - per - minute increase in speaking rate, and a 4.2 scale point improvement (0 - 7 scale) in hypernasality across a wide range of maxillary and soft palate defects. the objective of the present study was to determine the efficacy of palatal obturator prosthesis in speech intelligibility and resonance in patients submitted to inframedial - structural maxillectomy. the records of patients submitted to treatment at the so paulo oncology center foundation between 1995 and 2001 were reviewed in order to select those who had undergone maxillectomy. thirty - three (33%) of them could not be located and/or did not respond to the invitation. of the remaining 67 (67%), 19 (19%) had died, 10 (10%) had recurrences and resections in other regions of the oral cavity and/or oropharynx, 4 (4%) had undergone maxillectomy restricted only to the alveolar margin, 3 (3%) had undergone chemotherapy and/or radiotherapy, 3 (3%) were living in long distance areas, 3 (3%) were not brazilians, and 2 (2%) presented difficulties in motor locomotion, therefore were not included in the sample. the remaining 23 patients (23%) who had undergone inframedial - structural maxillectomy with an oronasal fistula, and were wearing a stable maxillary obturator prosthesis for at least 3 months, were selected for the sample. thus, 23 patients participated in the study, 17 females and 6 males, with ages ranging from 18 to 83 years (mean = 49.5 years) who had been submitted to inframedial - structural resection along the maxilla. out of these, 10 had been submitted to radiotherapy and 6 to speech therapy. all patients were asked to answer a questionnaire with the following data : patient identification, history of the disease, type of surgery (extent and characteristics of palatal resection), complementary treatments (pre- or postoperative radiotherapy and/or chemotherapy), type of prosthesis, time of prosthesis wearing and speech therapy (table 1). l = lateral ; c= central ; ar = alveolar ridge ; cmd = complete maxillary denture ; rpd= removable partial maxillary denture. the patients who inclusion criteria had their speech tape recorded in a silent room with a digital tape recorder (md - rs37). during recordings, each patient remained standing with the microphone (lesson sm 58p4) positioned at 12 cm from his / her mouth. the patients were asked to count from 1 to 20, to repeat 21 words which included all phonemes of the brazilian portuguese language at initial, medial, and final positions, as well as to perform 15 sec of spontaneous conversation, with and without the obturator prosthesis. speech resonance and intelligibility from all patient recordings were assessed by five speech - language pathologists experienced in the care of patients with head and neck cancer. all speech recordings and perceptual judgments the speech samples from each patient, with and without the obturator, were presented in random order so that the listeners were unaware of whether the patient was wearing or not the obturator. speech intelligibility was assessed from a 15s sequence of spontaneous conversation, and from the 1 to 20 counting recordings for all patients with and without the obturator. speech intelligibility from spontaneous conversation and counting recordings were assessed using a 6-point scale according to pegoraro - krook9 (1995), where 1 represented normal speech intelligibility, and 6 represented severely impaired speech intelligibility. speech intelligibility was also judged as the percentage of the correct words that the listeners were able to correctly identify, immediately after hearing the speech stimulus. speech resonance was judged upon spontaneous speech and counting stimuli, using a 5-point scale, in which 1 represented normal resonance, and 5 represented very severe hyper or hyponasality. the values established for each patient were extracted by median of five speech - language pathologists. comparisons of the speech intelligibility and resonance results of all speech stimulus recordings, with and without the obturator were analyzed by the wilcoxon test. correlations between the spontaneous speech intelligibility and intelligibility upon word repetition, with and without the obturator, spontaneous speech intelligibility and resonance with and without the obturator, and intelligibility upon word repetition and resonance with and without the obturator were established using spearman 's correlation coefficient test (r). the concordance between the five speech - language pathologists was extracted using the kendall coefficient of concordance test (w). the concordance under the conditions without and with obturator among the five speech - language pathologists obtained using the kendall coefficient of concordance test (w) were 0.70 and 0.85 (p<0.001) for spontaneous speech intelligibility, respectively, 0.79 and 0.85 (p<0.001) for word intelligibility, respectively, and 0.80 and 0.62 (p<0.001) for speech resonance respectively. assessment of speech intelligibility by the listeners on the basis of the spontaneous speech recordings revealed a significant improvement in intelligibility with the obturator in place for 19 (82.6%) of the 23 patients, while no difference was found for the remaining 4 (17.4%). mean levels of spontaneous conversation with and without a prosthesis were 0.78 and 1.30 respectively. speech intelligibility judgments results based on repetition of the 21 words demonstrated that the listeners were able to identify 66.7% of correct words without the obturator and 90.4 % with the obturators for 23 patients. the speech resonance results demonstrated a significant reduction in hypernasality with the obturators in place for 16 (69.6%) of the 23 patients. of the 7 remaining patients, 5 (21.7%) did not show significant difference in hypernasality when wearing the obturator, and 2 (8.7%) presented a slight worsening. mean levels of speech resonance judgments with and without the obturator were 1.9 and 3.2 respectively (table 2). the results of speech intelligibility judgments upon spontaneous speech and counting recordings, and upon the difference in correct words were statistically significant (p<0,001) between the conditions with and without obturator. statistically significant results were found in speech resonance (p<0.001) between the two conditions. spearman 's correlation coefficient test (r) showed significant correlation between spontaneous speech intelligibility and resonance in the absence of the obturator (r = -0.78, p<0.001) ; between word intelligibility and speech resonance in the absence of the obturator (r = -0.83, p<0.001) ; between word intelligibility and speech resonance in the presence of the obturator (r = -0.87, p<0.001) ; and between word and spontaneous speech intelligibility in the absence of the obturator (r = -0.80, p<0.001). no significant correlation was observed between spontaneous speech intelligibility in the presence of the obturator and any of the variables analyzed. the standard measurement of communicative function is speech intelligibility since speech is a social instrument, with most significant measurements starting with the extent to which speech can be understood2. in the present study, all assessments of spontaneous speech intelligibility demonstrated improvement in intelligibility with the use of a prosthesis in most patients, in agreement with results reported in the literature1,10,11,13,17. according to rieger,.11 (2003) there are several important background patient characteristics that can not be ignored when looking at either clinical speech measurements or patient perceptions regarding obturator function. comparison of the two assessments of speech intelligibility has shown that under the condition without prosthesis 15 patients (65.2%) presented poor levels of speech intelligibility, while in the remaining 8 patients (34.8%) intelligibility ranged from mild to normal. out of 15 patients with lower speech intelligibility scores, 10 (66.7%) had undergone wider resections of the maxilla comprising the length of the alveolar border. in contrast, only 4 (50%) of the 8 patients with better speech intelligibility scores showed wider maxillectomies. kornblith,.3 (1996) reported that obturators were more functional during communication and swallowing in patients with smaller resections of the hard palate. moreover, bohle,.1 (2005) demonstrated for 55 patients who underwent ablative head and neck cancer therapy that as the percentage of resection of palate or tongue increased, the intelligibility of speech decreased. sullivan,.13 (2002) observed individuals with complete unilateral hard and complete unilateral soft palatal defects and found a mean intelligibility score of 46.5% with the prosthesis removed and 79.7% with it inserted. in addition, maxillectomies, particularly the larger ones, restrict the contact between the tongue and palate, impairing speech intelligibility5. out of 15 patients with low speech intelligibility scores, 8 (53.4%) had been submitted to this treatment. according to novaes7 (1999), doses ranging from 65 to 70 gy may lead to persistence of this alteration. treatment of xerostomia is palliative and artificial saliva can be used to relieve this discomfort but the outcome is poor. reduced saliva production and/or the presence of thicker saliva (an increased mucous component compared to the serous component) impair stability and retention of the dental prosthesis, mastication and swallowing, as well as causing difficulties in sound articulation15. rieger,.11 (2003) observed that a drier mouth was associated with poorer intelligibility for patients who had resection of maxilla with history of radiotherapy. most patients (approximately 75%) have not undergone this therapy probably because most of them lived in towns where this treatment was not available. lack of speech therapy did not interfere with the general results of speech intelligibility evaluations which, according to pegoraro - krook9 (1995), was probably due to the fact that the patients were normal speakers before cancer surgery, and anatomical repositioning alone in combination with palatal obturation was sufficient to recover speech without the need for speech therapy. however, we may infer that patients whose speech intelligibility continued to be poor with the prosthesis in place could have benefited from speech therapy since many of them showed imprecise articulation and increased speaking velocity, among others. hypernasality is a perceptive phenomenon which affects the quality of life due to its impact on speech intelligibility6. in the present study, the speech resonance results have demonstrated a reduction in hypernasality with the use of the prosthesis in most patients (69.6%), in agreement with some studies in the literature1,9,13 patients # 10, # 14, # 15, # 5 and # 19 did not have improved speech resonance when wearing the prosthesis. in the first three patients, speech resonance had already been considered to be normal or close to normal without prosthesis and therefore its use did not change this result. in addition to that, their prostheses have shown better stability and adaptation, which allowed a better articulatory pattern. in contrast, patients # 5 and # 19, who continued to have moderate to severe hypernasality and patients # 6 and # 11, who have shown worsening of hypernasality with the use of the prosthesis, presented stuck or imprecise articulation, reduced loudness and increased speech velocity despite good stability and retention of the prosthesis. none of these patients had undergone speech therapy. according to russo and behlau12 (1993), disorders of the articulatory pattern and speech velocity and rhythm frequently compromise speech. we therefore believe that the assessment of hypernasality by the listeners might be influenced by other parameters related to articulation, such as vocal quality, pitch, rhythm and inflection, with a consequent difficulty in differentiating speech resonance parameters from other communication variables1,8. a significant correlation (r = -0.78) was observed between the judgment of spontaneous speech intelligibility and the judgment of speech resonance without the prosthesis, suggesting that the greater the impairment in patient 's hypernasality, the higher will be the degree of impairment of speech intelligibility. thus, patients with higher levels of hypernasality presented significant difficulties in making themselves understood. according to yoshida,.18 (2000), mild hypernasality can generate only a discrete distortion in speech, while severe hypernasality leads to a drastic reduction in speech intelligibility, compromising the individual 's oral communication and social contact. bohle,.1 (2005) observed that perceptual ratings of resonance were associated with percent intelligibility of words and sentences, i.e. the data indicate that perceptual ratings of resonance indicative of increased hypernasality were associated with poorer intelligibility. another significant correlation was observed between the variables speech intelligibility upon word repetition and speech resonance both with and without the prosthesis (r = -0.87 and r = -0.83, respectively). these results demonstrate that, in both conditions, the larger the number of correctly repeated words, the lower the level of hypernasality. studies reported a significant increase in the percentage of correctly identified words, associated with a reduction in hypernasality, after prosthetic treatment of maxillectomized patients1,13,17. the correlation observed between the assessment of spontaneous speech intelligibility and intelligibility upon word repetition in the absence of a prosthesis was also statistically significant (r = -0.80), i.e. the larger the number of correctly repeated words, the more intelligible will be the spontaneous speech of these patients. no significant correlation was observed between spontaneous speech intelligibility in the presence of a prosthesis and any of the variables analyzed, probably due to the heterogeneity of the sample and the small number of patients participating in the study9,11. in addition, significant interclass agreement was observed for the assessment of spontaneous speech intelligibility (r = 0.70 and r = 0.85) and word intelligibility (r = 0.79 and r = 0.85) both with and without the use of the prosthesis, respectively. however, a low, although statistically significant, level of agreement was observed between the listeners of this study in speech resonance assessment without prosthesis (r = 0.62). yoshida,.18 (2000) confirmed that perceptive evaluation shows a poor intra and inter - judgment agreement and suggested the use of objective instruments for the study of speech resonance. in contrast, kreiman,.4 (1993) reported that total agreement among listeners is not expected, even in the case of experienced examiners, due to the difficulty in assessing minimal changes occurring after prosthetic treatment in a perceptive manner. the authors concluded that perfect agreement and reliability are not achieved, not even from a theoretical viewpoint. the present study has concluded that obturator prosthesis contributed to improved speech intelligibility in maxillectomized patients. however, the success of prosthetic treatment might be limited by factors such as radiotherapy, the extent of maxillary surgery and speech therapy. we therefore emphasize the integration of an interdisciplinary team in order to increase the efficacy of rehabilitation and the quality of life of these patients. | most patients who have undergone resection of the maxillae due to benign or malignant tumors in the palatomaxillary region present with speech and swallowing disorders. coupling of the oral and nasal cavities increases nasal resonance, resulting in hypernasality and unintelligible speech. prosthodontic rehabilitation of maxillary resections with effective separation of the oral and nasal cavities can improve speech and esthetics, and assist the psychosocial adjustment of the patient as well. the objective of this study was to evaluate the efficacy of the palatal obturator prosthesis on speech intelligibility and resonance of 23 patients with age ranging from 18 to 83 years (mean = 49.5 years), who had undergone inframedial - structural maxillectomy. the patients were requested to count from 1 to 20, to repeat 21 words and to spontaneously speak for 15 seconds, once with and again without the prosthesis, for tape recording purposes. the resonance and speech intelligibility were judged by 5 speech language pathologists from the tape recordings samples. the results have shown that the majority of patients (82.6%) significantly improved their speech intelligibility, and 16 patients (69.9%) exhibited a significant hypernasality reduction with the obturator in place. the results of this study indicated that maxillary obturator prosthesis was efficient to improve the speech intelligibility and resonance in patients who had undergone maxillectomy. |
a 60-year - old woman visited the cardiac outpatient - department (opd) of our institute due to persistent chest pain, dizziness and periodic cold sweats that had lasted for years but had recently worsened. an ecg showed sinus bradycardia and non - specific st - t changes, and a chest radiograph revealed an unusual enlarged cardiac shadow. to rule out congenital heart disease with an acute coronary syndrome episode, a cardiac ct was performed using a 64-slice mdct scanner (aquilion 64, toshiba, japan) with retrospective ecg gating within one single breath - hold. the acquisition protocol was as follows : 0.5 mm section width, 400 msec gantry rotation time, a tube voltage of 120 kvp, and a tube current of 500 ma. eighty milliliters of non - iodinated contrast medium was injected through an antecubital vein at 4.5 ml / sec and was followed by a 40 ml saline chaser. using the surescan and surestart technologies from toshiba, the helical scan automatically began when the contrast attenuation in the ascending aorta reached 160 hounsfield unit (hu). reconstructed images of the three - dimensional volume - rendered images and maximum - intensity - projection images at various phases of the cardiac cycle were performed on a workstation (vitrea 2, plymouth, mn). the mdct findings revealed a dilated right atrium and right ventricle with abnormal downward displaced insertion of the septal leaflet of the tricuspid valve, suggesting ebstein 's anomaly. a tiny patent foramen ovale (pfo) at the interatrial septum was also suspected. incidental findings of an engorged coronary sinus with atresia of the right atrial ostium and a coexisting abnormal tubular communication to the left atrium were also identified by mdct (fig. a transesophageal echocardiogram was performed and showed a dilated right atrium with lower portion outpouching, downward insertion of the tricuspid valve with moderate tricuspid regurgitation. in addition, a tiny pfo was noted, confirming the mdct findings as ebstein 's anomaly. a cardiac catheterization was performed and confirmed the insignificant coronary artery disease and adequate left ventricular global performance (ejection fraction = 81%). the patient was placed under medical treatment and scheduled for out - patient follow - up. a 64-year - old female suffered from vague palpitation and periodic dyspnea for years and sought help at our cardiovascular outpatient department. a coronary cta was performed using a 64 slice mdct scanner (aquilion 64, a unique 64-row quantum detector from toshiba, japan) with retrospective ecg gating. reconstructed images of the three - dimensional volume - rendered images and maximum - intensity - projection images at various phases of the cardiac cycle were also obtained. the mdct findings revealed an abnormal engorged coronary sinus with stenosis of the right atrial ostium and coexisting abnormal tubular communication to the left atrium (figs. medical treatment was suggested, and the patient was tracked by outpatient follow - up. a 60-year - old woman visited the cardiac outpatient - department (opd) of our institute due to persistent chest pain, dizziness and periodic cold sweats that had lasted for years but had recently worsened. an ecg showed sinus bradycardia and non - specific st - t changes, and a chest radiograph revealed an unusual enlarged cardiac shadow. to rule out congenital heart disease with an acute coronary syndrome episode, a cardiac ct was performed using a 64-slice mdct scanner (aquilion 64, toshiba, japan) with retrospective ecg gating within one single breath - hold. the acquisition protocol was as follows : 0.5 mm section width, 400 msec gantry rotation time, a tube voltage of 120 kvp, and a tube current of 500 ma. eighty milliliters of non - iodinated contrast medium was injected through an antecubital vein at 4.5 ml / sec and was followed by a 40 ml saline chaser. using the surescan and surestart technologies from toshiba, the helical scan automatically began when the contrast attenuation in the ascending aorta reached 160 hounsfield unit (hu). reconstructed images of the three - dimensional volume - rendered images and maximum - intensity - projection images at various phases of the cardiac cycle were performed on a workstation (vitrea 2, plymouth, mn). the mdct findings revealed a dilated right atrium and right ventricle with abnormal downward displaced insertion of the septal leaflet of the tricuspid valve, suggesting ebstein 's anomaly. a tiny patent foramen ovale (pfo) at the interatrial septum was also suspected. incidental findings of an engorged coronary sinus with atresia of the right atrial ostium and a coexisting abnormal tubular communication to the left atrium were also identified by mdct (fig. a transesophageal echocardiogram was performed and showed a dilated right atrium with lower portion outpouching, downward insertion of the tricuspid valve with moderate tricuspid regurgitation. in addition, a tiny pfo was noted, confirming the mdct findings as ebstein 's anomaly. a cardiac catheterization was performed and confirmed the insignificant coronary artery disease and adequate left ventricular global performance (ejection fraction = 81%). the patient was placed under medical treatment and scheduled for out - patient follow - up. a 64-year - old female suffered from vague palpitation and periodic dyspnea for years and sought help at our cardiovascular outpatient department. a coronary cta was performed using a 64 slice mdct scanner (aquilion 64, a unique 64-row quantum detector from toshiba, japan) with retrospective ecg gating. reconstructed images of the three - dimensional volume - rendered images and maximum - intensity - projection images at various phases of the cardiac cycle were also obtained. the mdct findings revealed an abnormal engorged coronary sinus with stenosis of the right atrial ostium and coexisting abnormal tubular communication to the left atrium (figs. medical treatment was suggested, and the patient was tracked by outpatient follow - up. normal venous development is a process of progression and regression of the three major paired venous systems. the right and left horns of the primitive sinus venosus receive blood from these major veins, namely the vitelline, umbilical, and common cardinal veins, respectively. during the fifth week of development, the left vitelline vein begins to regress. by the tenth week, the left common cardinal vein is occluded, and the left horn has regressed to form the coronary sinus and the oblique vein of ' marshall, ' and the right horn of the sinus venosus becomes incorporated into the right atrium (5). although an anomaly of the coronary sinus may occur as an isolated condition, it is often associated with other anomalies, either of the various systemic venous anomalies or the anomalous pulmonary venous connection (1). the coronary sinus normally opens into the right atrium and accounts for 75% of the cardiac venous circulation, returning blood from nearly all regions of the heart, including the septa (2). (1), in 1966 including (a) enlargement of the coronary sinus with / without a left - to - right shunt, (b) absent coronary sinus, (c) atresia of the right atrial coronary sinus ostium, and (d) hypoplasia of the coronary sinus (figs. - g) should raise a suspicion of the possibility of anomalous systemic venous return into the coronary sinus, or the possibility of an anomalous left - to - right shunt either from high - pressure shunting, such as a coronary artery - coronary sinus fistula, or low - pressure shunting from the pulmonary artery and left atrium. an unusually large communication between the left atrium and coronary sinus may occur, and may be misinterpreted as an atrial septal defect in the catheterization findings (1) that can cause confusion for corrective cardiac surgery. 2h) is always associated with a persistent left superior vena cava (plsvc) connection to the left atrium, an atrial septal defect and possibly other additional anomalies. it usually has a right - to - left shunt at the left atrial level as part of the complex functional abnormality. in another extremely rare type of hypoplasic coronary sinus (fig. 2i), some of the cardiac veins empty individually into the atrial chambers through dilated thebesian channels due to a failure in joining the coronary sinus. there is usually no major functional significance for such coronary sinus hypoplasia cases (1). atresia of the right atrial ostium of the coronary sinus may occur as an isolated anomaly or in association with other cardiac malformations (figs. if a functional plsvc exists, blood returns in a retrograde direction, passing upward to the left superior vena cava, the left innominate vein, the right superior vena cava, and eventually into the right atrium. therefore, special care should be taken in cases with a plsvc and a dilated coronary sinus as dividing or ligating the plsvc during surgical management of cardiac lesions may disrupt the coronary sinus venous return, leading to myocardial edema, ischemia, and necrosis with a poor patient outcome (3). in cases of atresia or stenosis of the right atrial ostium without coexistence of the left superior vena cava, the blood from the coronary sinus into the related atria may pass through alternative pathways such as a window to the left atrium, multiple enlarged thebesian veins, or through the levoatriocardinal veins that connect the coronary sinus and the left atrium (1, 2) (figs. the term ' levoatriocardinal vein ' was used by edwards and dushane to indicate an anomalous connection between the left atrium or a pulmonary vein to any derivative of the cardinal venous system (7). it was thought that this levoatriocardinal vessel persisted in response to a partially or totally obstructed ostium of the coronary sinus during early development, serving as a collateral outflow channel for the coronary sinus. it is important to be aware that in cases of right atrial ostial atresia / stenosis of the coronary sinus with coexistence of plsvc or the levoatriocardinal vein, the anomalous venous channels usually serve as the only way or the main collateral outflow for the coronary sinus. therefore, an alteration of these anomalous channels may lead to significant coronary venous obstruction (1, 3). in a board range of cardiac surgeries, retrograde coronary sinus cardioplegia perfusion (rcp) rcp is found to be especially beneficial in cases with severe coronary artery disease that can alter the distribution of antegrade cardioplegia, and is effective in cases involving aortic regurgitation or an open aortic root (2). however, it is difficult to perform rcp in patients with a right atrial ostial atresia / stenosis of the coronary sinus preoperatively, and in other types of coronary sinus anomalies, the efficiency and distribution of a rcp may be affected, which leads to partial or poor myocardial protection. in the presented two cases, the mdct findings revealed an abnormally enlarged coronary sinus ; the right atrial ostium was either stenostic or atresia. communication of an abnormal tubular structure, probably the levoatriocardinal vein, was found between the coronary sinus and the left atrium. however, no functional plsvc existed in both cases. according to the different contrast density within the left atrium, right atrium and the coronary sinus, a left - to - right flow through the levoatriocardinal vein was found in case 2 with right atrial ostial stenosis, and the increased flow resulted in an abnormally dilated and engorged coronary sinus. a bi - directional flow (both left - to - right and right - to - left shunt) was suspected in the patient of case 1 with right atrial ostial atresia, due to the small amount of high - density contrast within the coronary sinus and in the small levoatriocardinal channel. we speculated that there might be other coronary sinus outflow pathways in this case of ostial atresia, as the size of the levoatriocardinal vein with bi - directional flow was not as large as we expected. the other blood return may pass through the thebesian veins that were hidden within the myocardium and were grossly invisible. the association between the ebstein 's anomaly and coronary sinus ostial atresia in the case 1 patient is still to be determined due to the broad pathological - anatomical and clinical spectrum of ebstein 's anomaly that have been identified in the reported literature and the differences in presentation for different patients. although there is no significant functional disturbance in either of the two cases, left - to - right shunting into coronary sinus - related increased inflow combined with the right atrial ostial atresia / stenosis related obstructive outflow may raise the possibility of myocardium congestion. the clinical significance between the coronary sinus anomaly and the persistent chest discomfort of the two patients remains to be determined. in summary, the use of mdct provides a noninvasive alternative for pre - operative evaluation of congenital heart disease. a coronary sinus anomaly may occur as an isolated anomaly or more commonly as a component of congenital heart disease. recognizing and being familiar with the variations of congenital coronary sinus anomalies may avoid misinterpretation of cardiac catheterization findings in the preoperative evaluation of cardiac lesions, and may help in the pre - operative planning of retrograde cardioplegia, and may avoid troublesome hemodynamic disruption of coronary sinus blood return during cardiac surgery. | congenital coronary sinus anomalies are extremely rare, and they have received relatively little attention. this is probably due to the lack of both clinical symptoms and significant cardiac functional disturbance. we present two cases of a coronary sinus anomaly and briefly review the literature. recognizing and being familiar with the variations of a congenital coronary sinus anomaly in congenital heart disease may avoid a misinterpretation of cardiac catheterization findings and the troublesome disruption of coronary sinus blood return during the surgical management of cardiac lesions. |
the chs is a prospective, community - based cohort designed to study risk factors for the development and progression of cardiovascular disease in people aged 65 years (24). communities : forsyth county, north carolina ; sacramento county, california ; washington county, maryland ; and pittsburgh, pennsylvania. eligible participants were sampled using medicare eligibility lists, were not institutionalized, and were expected to remain in the area for at least 3 years. people who were wheelchair bound in the home or receiving hospice treatment, radiation therapy, or chemotherapy for cancer were excluded. the original chs cohort of 5,201 participants was enrolled in 19891990. for the current study, we excluded from this group 1,176 participants with prevalent diabetes (use of insulin or oral hypoglycemic agents, fasting blood glucose 126 mg / dl, or 2-h ogtt glucose 200 mg / dl) (25), 424 participants with missing measurements of insulin and/or glucose concentrations (fasting and/or 2-h ogtt), and 463 participants with missing covariate data (serum cystatin c, waist circumference, blood pressures, lipid concentrations, and c - reactive protein). another 687 predominantly african american participants enrolled in 19921993 were not included because 2-h ogtt insulin was not measured in this group. insulin resistance was evaluated primarily as the insulin sensitivity index (isi) derived from an ogtt (26). insulin and glucose were measured in the fasting state and 2 h after oral consumption of 75 g of glucose. glucose was measured using the kodak ektachem 700 analyzer (eastman kodak, rochester, ny), mean coefficient of variation 0.93%. isi was calculated using the formula isi = 10,000/sqrt(g0 i0 g120 i120). isi calculated using this method correlates well with insulin sensitivity measured using the hyperinsulinemic euglycemic clamp (r = 0.772, p 25% in the absence of clinical cardiovascular disease), or none (29). medication inventories were completed by chs staff using participants prescription and nonprescription medication bottles (24). total physical activity was quantified in kilocalories per week using validated questionnaires assessing a broad range of common activities (30). serum cystatin c was measured using a bnii nephelometer (n latex cystatin c ; dade behring, deerfield, il) and used to estimate gfr (egfr) using the equation : egfr = 76.7 [cystatin c ] (31). total cholesterol, hdl cholesterol, and triglyceride concentrations were measured using conventional enzymatic methods, with ldl cholesterol calculated using the friedewald formula (32). c - reactive protein was measured with an enzyme - linked immunosorbent assay developed in the chs laboratory (33). unadjusted mortality rates by quartiles of isi and fasting insulin were calculated using the person - years approach. we constructed a cubic spline model to describe the continuous association of isi with mortality risk, adjusting for age, sex, race, and study site. we tested associations of isi and fasting insulin with mortality using cox proportional hazards models. analysis of schoenfeld residuals and rescaled residuals plotted versus time demonstrated that the proportional hazards assumption was not violated. serial models were 1) adjusted for age, sex, race, and study site ; 2) additionally adjusted for potential confounders of the insulin resistance mortality relationship, including prevalent cardiovascular disease, smoking, lipid - lowering medication use, ldl cholesterol, physical activity, and waist circumference ; and 3) additionally adjusted for variables that may confound or mediate the insulin resistance mortality relationship, including systolic and diastolic blood pressures, antihypertensive medication use, hdl cholesterol, triglycerides, and c - reactive protein. the chs is a prospective, community - based cohort designed to study risk factors for the development and progression of cardiovascular disease in people aged 65 years (24). communities : forsyth county, north carolina ; sacramento county, california ; washington county, maryland ; and pittsburgh, pennsylvania. eligible participants were sampled using medicare eligibility lists, were not institutionalized, and were expected to remain in the area for at least 3 years. people who were wheelchair bound in the home or receiving hospice treatment, radiation therapy, or chemotherapy for cancer were excluded. the original chs cohort of 5,201 participants was enrolled in 19891990. for the current study, we excluded from this group 1,176 participants with prevalent diabetes (use of insulin or oral hypoglycemic agents, fasting blood glucose 126 mg / dl, or 2-h ogtt glucose 200 mg / dl) (25), 424 participants with missing measurements of insulin and/or glucose concentrations (fasting and/or 2-h ogtt), and 463 participants with missing covariate data (serum cystatin c, waist circumference, blood pressures, lipid concentrations, and c - reactive protein). another 687 predominantly african american participants enrolled in 19921993 were not included because 2-h ogtt insulin was not measured in this group. insulin resistance was evaluated primarily as the insulin sensitivity index (isi) derived from an ogtt (26). insulin and glucose were measured in the fasting state and 2 h after oral consumption of 75 g of glucose. insulin was measured by competitive radioimmunoassay (diagnostic products corp., malvern, pa), mean coefficient of variation 10.7%. glucose was measured using the kodak ektachem 700 analyzer (eastman kodak, rochester, ny), mean coefficient of variation 0.93%. isi was calculated using the formula isi = 10,000/sqrt(g0 i0 g120 i120). isi calculated using this method correlates well with insulin sensitivity measured using the hyperinsulinemic euglycemic clamp (r = 0.772, p 25% in the absence of clinical cardiovascular disease), or none (29). medication inventories were completed by chs staff using participants prescription and nonprescription medication bottles (24). total physical activity was quantified in kilocalories per week using validated questionnaires assessing a broad range of common activities (30). serum cystatin c was measured using a bnii nephelometer (n latex cystatin c ; dade behring, deerfield, il) and used to estimate gfr (egfr) using the equation : egfr = 76.7 [cystatin c ] (31). total cholesterol, hdl cholesterol, and triglyceride concentrations were measured using conventional enzymatic methods, with ldl cholesterol calculated using the friedewald formula (32). c - reactive protein was measured with an enzyme - linked immunosorbent assay developed in the chs laboratory (33). unadjusted mortality rates by quartiles of isi and fasting insulin were calculated using the person - years approach. we constructed a cubic spline model to describe the continuous association of isi with mortality risk, adjusting for age, sex, race, and study site. we tested associations of isi and fasting insulin with mortality using cox proportional hazards models. analysis of schoenfeld residuals and rescaled residuals plotted versus time demonstrated that the proportional hazards assumption was not violated. serial models were 1) adjusted for age, sex, race, and study site ; 2) additionally adjusted for potential confounders of the insulin resistance mortality relationship, including prevalent cardiovascular disease, smoking, lipid - lowering medication use, ldl cholesterol, physical activity, and waist circumference ; and 3) additionally adjusted for variables that may confound or mediate the insulin resistance mortality relationship, including systolic and diastolic blood pressures, antihypertensive medication use, hdl cholesterol, triglycerides, and c - reactive protein. mean (sd) age was 72 (5) years, and 1,920 participants were women (61%). distributions of isi and fasting insulin concentration were skewed, with median (interquartile range) values of 3.30 (2.214.91) units and 12 (916) iu / ml, respectively. isi correlated most strongly with 2-h ogtt insulin concentration (r = 0.927), followed by concentrations of fasting insulin (r = 0.734), 2-h ogtt glucose (r = 0.634), and fasting glucose (0.412). lower isi (i.e., greater insulin resistance) was associated with prevalent cardiovascular disease, more prevalent use of lipid - lowering medications, less prevalent smoking, lower physical activity, larger bmi and waist circumference, higher blood pressures, unfavorable lipid concentrations, and higher c - reactive protein concentration (table 1). baseline characteristics of 3,138 participants in the chs by quartiles of isi egfr was correlated with isi (r = 0.182, p < 0.001) and fasting insulin concentration (r = 0.236, p < 0.001). 1). compared with participants with egfr 60 ml / min/1.73 m, participants with egfr < 60 ml / min/1.73 m had lower isi (median [interquartile range ] 2.79 [1.774.28 ] vs. 3.41 [2.315.02 ]) and higher fasting insulin concentration (14 [1119 ] vs. 12 [915 ] iu / ml) but no substantial difference in fasting glucose (mean [sd ] 99.9 [9.1 ] vs. 98.7 [9.0 ] mg / dl). during the 14.7-year median follow - up, 1,810 participants died (58% of the study population), including 634 from adjudicated cardiovascular causes (35% of deaths). lower isi was associated with higher unadjusted mortality rates (table 2 and supplementary fig. 2). adjusting for age, sex, race, and study site, there was a monotonic relationship of isi with mortality risk below the 75th percentile of isi (4.91 units) (table 2 and fig. the magnitude of this association was modestly attenuated adjusting for potential confounders (table 2, model 2) or potential confounders and/or mediators (table 2, model 3). however, addition of egfr to either model substantially attenuated associations of isi with mortality (table 2, models 4 and 5). associations of isi with cardiovascular mortality displayed similar patterns as with all - cause mortality but were less robust, possibly as a result of smaller numbers of events or the competing risk of noncardiovascular mortality, while no strong, consistent, or statistically significant associations of isi with noncardiovascular mortality were observed (supplementary table 1). associations of isi, fasting insulin concentration, glucose concentration 2 h after glucose load, and fasting glucose concentration with all - cause mortality among 3,138 chs participants association of isi with all - cause mortality as modeled by cubic spline, adjusted for age, sex, race, and study site, among 3,138 participants in the chs. (a high - quality color representation of this figure is available in the online issue.) egfr did not modify associations of isi or fasting insulin concentration with mortality (interaction p values 0.304 and 0.835, respectively). adjustment for isi or fasting insulin concentration did not attenuate associations of lower egfr with increased mortality risk (data not shown). significant associations of impaired glucose tolerance with mortality were not substantially attenuated by adjustment for egfr (table 2). impaired fasting glucose was not associated with increased mortality risk in unadjusted or adjusted analyses (table 2). insulin resistance was associated with increased risk of all - cause mortality among community - based older adults, adjusting for conventional confounding clinical characteristics. associations were of similar magnitude, evaluating insulin resistance as isi derived from dynamic testing or as fasting insulin concentration. however, all associations were substantially attenuated and rendered statistically insignificant with additional adjustment for egfr, an effect that was most pronounced evaluating fasting insulin concentration as the exposure. in contrast, associations of impaired glucose tolerance with mortality were not attenuated by adjustment for egfr. without yet considering the role of kidney function, this study adds two new facets to the literature evaluating the health impact of insulin resistance. others have focused on cardiovascular disease events and cardiovascular disease mortality (110). in our study, results for all - cause mortality were stronger than results for cardiovascular disease mortality, possibly because the larger number of events led to increased statistical precision or because all - cause mortality accounted for the competing risk of noncardiovascular death. second, we focused on insulin resistance evaluated as isi during dynamic testing. because postprandial glucose is largely disposed of in peripheral tissues, such as muscle, isi may capture peripheral insulin resistance more completely than estimates of insulin resistance based on fasting insulin concentration, which in comparison more strongly reflect hepatic insulin resistance. it is interesting that while isi and fasting insulin concentration reflect different aspects of insulin resistance, they were similarly associated with mortality in conventionally adjusted analyses. similar results were observed in the framingham offspring study, in which 1) isi was calculated using a different formula that additionally incorporates body weight and 2) homa - ir scores were each associated with increased risk of incident cardiovascular disease (9). the current study is the first to our knowledge assessing isi as a risk factor for mortality, and it broadens the measures of insulin resistance evaluated in relation to health outcomes. the most novel finding in this study is the marked attenuation of the insulin resistance mortality association by adjustment for kidney function. specifically, even after adjustment for conventional confounders and mediators of the insulin resistance mortality relationship, further adjustment for cystatin c based egfr markedly attenuated observed magnitudes of association, and the degree of attenuation by egfr exceeded that for any other covariate. it is possible that impaired kidney function mediates, in part, the relationship of insulin resistance with mortality. systemic insulin resistance may directly contribute to kidney damage by creating an unfavorable renal microvascular environment, and the hyperinsulinemia that compensates for systemic insulin resistance may promote the intrarenal renin - angiotensin - aldosterone system, mesangial matrix production, and tubulointerstitial fibrosis (15,17,34). in turn, impaired kidney function, even within the normal range, may promote cardiovascular disease and mortality by leading to oxidative stress, anemia, disturbed mineral metabolism, and other unique metabolic abnormalities (35). alternatively, impaired kidney function may represent a sensitive marker of the adverse biologic pathways activated by insulin resistance without lying in the direct causal pathway. adjustment for egfr attenuated the association of insulin resistance with mortality even after adjustment for blood pressure, dyslipidemia, and inflammation, suggesting a role for other biologic pathways. diseased endothelial and epithelial kidney cells demonstrate resistance to insulin actions on cell proliferation and differentiation (16,18). resistance to nonglycemic actions of insulin at the level of the kidney may represent parallel processes occurring systemically. impaired kidney function independently promotes insulin resistance, at least at very low levels of gfr (14). in addition, the kidney clears 50% of peripheral insulin, such that higher insulin levels in the setting of lower gfr may reflect impaired kidney function instead of or in addition to insulin resistance (36). if impaired kidney function contributes substantially to both insulin resistance (true or apparent) and mortality, the independent contribution of insulin resistance to adverse outcomes may be overestimated in studies that do not accurately account for kidney function. in contrast to isi and fasting insulin concentration, associations of impaired glucose concentration with mortality risk were not attenuated by adjustment for egfr. this suggests that the adverse effects of glucose intolerance are mediated through nonrenal mechanisms or that the relationship of glucose intolerance with adverse health outcomes is less sensitive to confounding by impaired kidney function. strengths of this study include the broad, community - based population of older adults, the large numbers of participants and events, assessment of insulin resistance in both the fasting and dynamic states, evaluation of a hard outcome with complete follow - up, and availability of detailed covariate data, including a relatively sensitive marker of impaired kidney function. study limitations include the lack of direct measurements of insulin resistance and kidney function, lack of urine albumin measurements to ascertain whether accounting for kidney dysfunction more broadly might even further attenuate associations of insulin resistance with mortality, exclusion of a large number of african american participants because of missing ogtt data as a result of the chs design, lack of detailed data on socioeconomic status, and inability of epidemiologic analysis to specifically delineate causal pathways to differentiate confounding and mediation. in conclusion, the association of insulin resistance with mortality among community - based older adults appeared to be largely mediated or confounded by impaired kidney function. future studies assessing associations of insulin resistance with health outcomes should take kidney function into account. additional studies are needed to define the joint roles of insulin resistance and impaired kidney function in disease. | objectiveinsulin resistance is a risk factor for cardiovascular and noncardiovascular diseases. impaired kidney function is linked with insulin resistance and may affect relationships of insulin resistance with health outcomes.research design and methodswe performed a cohort study of 3,138 cardiovascular health study participants (age 65 years) without diabetes. insulin sensitivity index (isi) was calculated from fasting and 2-h postload insulin and glucose concentrations. associations of isi and fasting insulin concentration with all - cause mortality were tested using cox proportional hazards models, adjusting for demographic variables, prevalent cardiovascular disease, lifestyle variables, waist circumference, and ldl cholesterol. subsequent models were additionally adjusted for or stratified by glomerular filtration rate estimated using serum cystatin c (egfr).resultsa total of 1,810 participants died during the 14.7-year median follow - up. compared with the highest quartile of isi, the lowest quartile (most insulin resistant) was associated with 21% (95% ci 641) and 11% (3 to 29) higher risks of death without and with adjustment for egfr, respectively. compared with the lowest quartile of fasting insulin concentration, the highest quartile was associated with 22% (443) and 4% (12 to 22) higher risks of death without and with adjustment for egfr, respectively. similar attenuation by egfr was observed when blood pressure, triglycerides, hdl cholesterol, and c - reactive protein were included in models.conclusionsinsulin resistance measured as isi or fasting insulin concentration is associated with increased risk of death among older adults, adjusting for conventional confounding characteristics. impaired kidney function may mediate or confound this relationship. |
obesity and osteoporosis are important global health problems with high prevalence and impact on both mortality and morbidity [1, 2 ]. during the last decades both diseases have become a major health threat around the world, with age and female status increasing the risk of developing both obesity and osteoporosis [1, 2 ]. interestingly obesity has been considered a protection factor against the development of bone loss and osteoporosis, likely for increased androgen aromatization to estrogens in postmenopausal obese women [3, 4 ] and, also, for a potential role of mechanical loading in regulating bone remodelling. recently, however, the belief that obesity is protective against osteoporosis has been questioned. epidemiologic and clinical studies suggest that high level of fat mass might be a risk factor for osteoporosis and fragility fractures [68 ]. moreover, adipose tissue functions as an endocrine organ by releasing several adipokines, which appear to modulate glucose and lipid metabolism, inflammation, appetite, and insulin resistance [911 ]. a physiological relevance of adipose tissue for skeletal health likely could reside in the role that an excess of proinflammatory cytokines, such as il-6 and tnf-, might play by interfering with bone cells homeostasis [1215 ]. more recently, obesity has also been associated to sarcopenia, a condition characterized by progressive decline of muscle mass, quality, and strength [16, 17 ]. thus, the crosstalk between fat and bone might play an important role as homeostatic feedback system in which adipokines and molecules secreted by bone cells represent the link of an active and functional bone - adipose - muscle axis [1820 ], by mechanism(s) not fully clarified yet. in addition, obesity is associated with a chronic low - grade inflammation as depicted by increased plasma levels of c - reactive protein (crp), proinflammatory cytokines, and osteopontin [21, 22 ] as well as lower circulating levels of vitamin d (vit d). nevertheless, to date, few and conflicting data show a correlation among abdominal fat, vit d, osteocalcin, inflammatory markers, and bone mineral density alterations in morbid obese women. since our group has recently demonstrated skeletal alterations in adult obese subjects and also an association of obesity with sarcopenia, aim of the present study was to investigate whether serum factors in obese and obese osteoporotic patients and/or sarcopenic patients could differently affect osteoblastic cells homeostasis in vitro and, likely altering skeletal health. female subjects were selected in the department of experimental medicine, section of medical pathophysiology, endocrinology, and nutrition, of policlinico umberto i, sapienza university of rome. chronic medical conditions, use of medications affecting bone metabolism, hormonal and nutritional status, vitamin d supplementation, recent weight loss, and prior bariatric surgery interventions were assessed as exclusion criteria. patients were investigated for metabolic, inflammatory, and bone turnover markers and their sera used for culturing osteoblasts. subjects were characterized by dual energy x - ray absorptiometry (dexa) and divided into different groups upon bone mineral density (bmd) and muscle mass. they were divided into different groups : the first group included obese women (body mass index, bmi > 30) with normal bone mineral density and normal muscle mass (o) ; second group was formed by obese women with low bone mineral density for age (oo) ; another group included obese women affected by sarcopenia (os) ; the last group included women with both low bmd and sarcopenia (oos). a control group was also evaluated, which included healthy women with normal bmi and normal t score (ctl). the research protocol was in accordance with the ethical requirements of the helsinki declaration and was approved by ethical committee of policlinico umberto i, sapienza university of rome. the anthropometric measurements were taken following the procedures described in the anthropometric standardization reference manual. body weight was measured to an accuracy of 0.1 kg through a standard column body scale (seca, hamburg, germany). body height was determined using a rigid stadiometer (seca, hamburg, germany) to an accuracy of 0.1 cm. bmi was calculated as body weight in kg / body height in m. body composition (fat mass (fm) and fat - free mass (ffm)) was estimated by bioelectrical impedance analysis (bia). the bia measurement was performed on the right side of the body using 800-a and 50 khz alternating sinusoidal current and a standard tetrapolar technique (body impedance assessment, bia 101 impedance analyzer, akern, florence, italy). fat - free mass index (ffmi) was calculated as ffm in kg/(body height in m). sarcopenia was diagnosed according to the definition by the european working group on sarcopenia in older people (ewgsop), considering the reduction of muscle mass, the impairment of muscle strength, and physical performance. ffm was considered depleted if a patient 's fat - free mass (ffm) was 25 kg / m, considering that excess body weight includes not only body fat but also a certain amount of muscle mass. abdominal fat was evaluated and characterized by dexa as previously described elsewhere [27, 28 ]. human saos-2 osteoblastic cells were cultured in dulbecco 's modified eagle 's medium (dmem) supplemented with 2 mm l - glutamine, 100 u / ml penicillin / streptomycin, 10% fetal bovine serum (fbs), at 37c and 5% co2 in a humidified incubator. all buffers, media, and reagents were purchased from euroclone. for patients sera treatments, cells were grown up to 70% confluence, starved overnight in a medium serum - free, and then incubated 24 hrs with medium supplemented with 20% patient serum. for rna extraction and quantitative real - time evaluation, cells were treated with serum of single patients whereas for protein extraction and western blot analysis and for immunofluorescence experiments, growing media were supplemented with a pull of sera of the same group. for rna extraction, cells were washed twice with 1x phosphate buffer saline (pbs, euroclone) and total rna was immediately isolated with ambion rna mini kit (ambion, life technologies) according the manufacturer 's instructions. the purity and integrity of total rna were monitored by electrophoretic analysis on denaturating agarose gel ; ultraviolet spectrophotometry (biorad) was used for rna yield evaluation. quantitative real - time pcr was performed in abi prism 7500 light cycler (applied biosystem) using power sybr green pcr master mix (applied biosystem) as indicated by manufacturer. the relative level for each gene was calculated using the 2 method and reported as arbitrary units. in all experiments, twenty micrograms protein samples were separated in an sds - polyacrylamide gel and transferred to a nitrocellulose membrane. the membrane was blocked 60 min at room temperature with 5% nonfat dry milk (cell signaling) in t - tbs (tris - buffered saline plus tween 20, 0.01%). primary anti - lef-1, anti - tcf-1 anti - c - myc, anti -catenin, anti - gsk3 ser9-phosphorilated, anti - totalgsk3, and -actin antibodies, diluted as indicated by manufacturers, were added overnight at 4c. the membrane was washed three times with t - tbs and incubated for 60 at room temperature with hrp - labeled anti - rabbit or anti - mouse in 5% nonfat dry milk. the membrane was then washed three times and antibodies were visualized using ecl prime western blotting detection reagent (ge healthcare). quantitative analysis was performed using imagequant tl image analysis software (ge healthcare) ; sample value was normalized for housekeeping gene -actin and was reported as arbitrary units. if) analysis, cells were rinsed twice with cold pbs, fixed with 4% paraformaldehyde 15 at room temperature, rinsed three times with pbs, permeabilized by incubation in 0.2% triton in 3% bovine serum albumin (bsa), and rinsed accurately in pbs. cells were incubated in blocking solution (6 ng / ml igg from goat serum in pbs) for 30 at room temperature and further incubated with anti--catenin (cell signaling) 1 : 200 in pbs overnight at 4c. after three washes, cells were incubated with 1 : 500 anti - mouse alexa fluor (molecular probes) in the dark 45 at room temperature. cells were rinsed three times with pbs and slides were mounted with 70% glycerol in pbs. images were acquired by nikon eclipse 600 microscope and nikon ccd camera at 20x magnification. patients were characterized for anthropometric measurements, bmd, muscle mass as described in section 2. no differences were found in hormones levels, beside a significant decrease of vit d levels as previously published [23, 27 ]. to assess whether the sera of obese patients showed any altered balance of factors potentially affecting bone turnover, we collected sera of all subjects to culture cells and characterize modulation induced in osteoblasts activity in vitro. to determine potential effects of the sera from obese patients on osteoblast homeostasis, cells were incubated with the sera of obese subjects to assess effect on cell differentiation and activity. osteoblasts were cultured 24 hrs in presence of the sera obtained from individuals of the different experimental groups after which total rna was extracted and quantitative rt - pcr performed to evaluate specific genes. expression of runx2, an essential transcription factor expressed during bone formation and osteoblast differentiation, was decreased in all experimental group, except that in the os (p < 0.05, figure 1(a)) while bmp4 mrna expression was significantly decreased in cells grown in the sera of osteopenic patients (both oo and oos) (p < 0.05, figure 1(b)). the expression of balp mrna was significantly decreased in cells grown with the sera of all groups of obese patients compared to ctl (p < 0.05, figure 1(c)), demonstrating an impairment of osteoblast activity. interestingly, the expression of osteocalcin, the most important noncollagenic bone matrix protein, was significantly decreased only in cells exposed to sera of oo patients (p < 0.05, figure 1(d)), strongly suggesting that the presence of different amount of muscle and adipose tissues can differently interfere with osteoblast biology. finally, the expression of osteopontin (opn), a highly phosphorylated bone matrix sialoprotein [3135 ], was also significantly inhibited in osteoblasts incubated with sera of all groups of obese patients as compared to ctl (figure 1(e), p < 0.05). the following series of experiments were focused to further characterize the molecular mechanism(s) of action of the observed alteration of osteoblast homeostasis. the canonical wnt/-catenin pathway is essential for proliferation and survival of osteoblasts. when the canonical wnt ligands (i.e., wnt1, 3a, and 8) bind to the cell - surface receptors, the intracellular protein disheveled (dvl) is phosphorylated activating a cascade of intracellular events linked to the modulation of specific target genes expression [37, 38 ]. thus, to evaluate whether canonical wnt/-catenin pathway was involved in the osteoblastic gene expression modulation exerted by obese sera, expressions of some specific target genes were evaluated by quantitative rt - pcr and western blot analysis. osteoblasts were grown and exposed to the human sera for 24 hrs as described above. expression of cmyc and axin2 decreased in osteoblasts incubated in the presence of sera of o patients compared to ctl (p < 0.05) as shown in figure 2. likewise, the decrease of specific target gene expression was further confirmed by a reduction of protein expression of cmyc, lef, cd44, and tcf1, as shown in figures 3(a) and 3(b). in particular, wnt pathway inhibition was most significantly induced by exposure of cells to the sera of os patients (cd44 inhibition almost 50%) as compared to the other groups, strongly indicating complex mechanism(s) underlying skeleton homeostasis in obese and sarcopenic subjects. the expression of lef1 protein was not significantly affected in cells exposed to the patients sera, whereas lef1-n was strongly inhibited in cells exposed to all obese groups (figures 3(a) and 3(b)). to further investigate the potential mechanisms by which patient 's sera modulate the wnt/-catenin pathway, gsk3, a component of the -catenin destruction complex and negative regulator of the wnt pathway, was analyzed. in particular we checked both, by western blotting analysis, phosphorylation at ser-9 which inactivates gsk3 and, by immunofluorescence, -catenin nuclear translocation. a strong decrease of a ratio gsk3-ser9/total gsk3 was observed in osteoblasts upon exposure to the sera of all obese subjects (figures 4(a) and 4(b)), demonstrating that the canonical -catenin pathway is inactivated by the presence of nonphosphorylated (then active) gsk3, and normal regulation within cells disrupted by obese subjects sera. accordingly total -catenin amount is decreased showing that protein is tagged for proteasomal degradation. since nuclear localization of -catenin is used as a marker of enhanced wnt signaling, as expected, immunofluorescence analysis demonstrated a cytoplasmic localization of -catenin in osteoblasts exposed to the sera of all obese subjects (figure 5). taken together these in vitro data, showing the inhibition of canonical wnt/-catenin pathway, indicate that this signal transduction pathway is, likely, the intracellular signaling involved in the impairment of osteoblastic differentiation and activity exerted by obese sera. our results demonstrate for the first time that the sera of obese osteoporotic and/or obese sarcopenic subjects can induce significant alterations in osteoblast homeostasis due to disruption in the wnt/-catenin differentiation - linked molecular pathway. in particular, sera of obese subjects blunt the canonical wnt/-catenin pathway inducing a downregulation of specific target genes with a consequent altered osteoblast differentiation and activity pattern. despite being a risk factor for cardiovascular and metabolic disease, for a long time obesity has been thought to protect against osteoporosis [3, 4 ], due to stresses from mechanical loading and from metabolic effects of estrogenic hormones secreted by adipocytes for testosterone aromatization. however, recently, our group and others have demonstrated that increased visceral fat has negative effects on skeletal tissue health [7, 17, 27 ], indicating that further investigations were required to understand the complex interactions between bone and adipose tissue. further recent evidences, in healthy premenopausal women, demonstrated that higher trunk fat mass was associated with inferior bone quality, as evidenced by markedly lower trabecular bone volume fraction, fewer and thinner trabeculae, lower trabecular stiffness, and higher cortical porosity. moreover the same study indicated that higher trunk fat mass is associated with higher bone marrow fat, lower trabecular bone volume fraction, and decreased bone formation in vivo. our results support the role of an altered bone formation in the skeletal alterations observed in obese subjects and further emphasize that the mechanism(s) of action underlying the observed alterations is likely due to a damaged pattern of osteoblastic differentiation which impairs cell activity. in addition, muscle mass appears to play a role in the interplay between adipose and bone tissue, likely by mechanical stimuli and also by myokines and other factors secretion. indeed, muscle is also source of igf-1, known to be one of the factors which cooperate in the maintenance of skeletal health.in addition, lower levels of igf-1 [27, 41 ] have been found in obese individuals (unpublished observation) and igf-1 might play a pivotal role in the mechanism linking obesity to decreased bone density and bone quality, by mechanism due to altered osteoblast homeostasis. indeed, the recent in vivo results, showing a weak increase in osteoclastogenic factors, go against the hypothesis that production of adipokines and inflammatory cytokines by adipose tissue lead to an increased bone resorption inducing a decrease in bone volume [28, 44 ]. more interestingly, we demonstrated that obesity induces detrimental effect on osteoblasts differentiation activity, suggesting that both bone resorption and bone formation are disrupted in obese patients. in particular, runx2, which belongs to the runx family, is an essential transcription factor expressed during bone formation and osteoblast proliferation and differentiation and the blunted levels observed upon obese sera exposure further prove the osteoblast differentiation disruption. moreover, the decreased expression of all the osteoblastogenic differentiation and activity markers demonstrate the decreased osteoblast activity which further support the previously observed bone formation markers alteration in obese patients in vivo. wnt signaling pathway has emerged as a critical regulatory component of the control of bone formation and bone resorption. when the canonical wnt ligands (i.e., wnt1, 3a, and 8) bind to the cell - surface receptors, the intracellular protein disheveled (dvl) is phosphorylated inhibiting gsk3 from phosphorylating -catenin in the cytoplasm. as result, -catenin is stabilized and translocated into the nucleus where it establishes a transcriptional complex with t - cell factor (tcf)/lymphoid enhancer - binding factor (lef) to regulate expression of target genes [37, 38 ]. our data demonstrate that canonical wnt/-catenin pathway is one of the molecular intracellular pathways involved in the gene expression modulation disrupted in the osteoblasts exposed to obese sera. indeed, gsk3, a key modulator of -catenin activity, is repressed by phosphorylation at ser-9 and consequently -catenin is slightly detectable and only in the cytoplasm. as a consequence, the -catenin target genes are downmodulated and osteoblast differentiation and activity disrupted. in regards of the wnt molecular pathway, an interesting result is linked to the evaluation and characterization of lef1 modulation. lef1 contains two promoters that drive expression of a full - length protein (lef1) and an n - terminally truncated isoform (lef1-n). lef1 overexpression inhibits osteoblast maturation and runx2 activity on the osteocalcin promoter in vitro [47, 48 ], but lef1n had the opposite effect. lef1-n is present in mature osteoblasts and, despite the absence of the n - terminal high affinity -catenin binding domain, retains the ability to weakly interact with -catenin via second domain and to promote osteogenesis. interestingly, the sera of obese subjects can significantly blunt expression of lef1-n, strongly indicating an inhibition of osteoblast differentiation by an alteration of such molecular intracellular pathway. moreover, wnt interacts with other signaling pathways in the bone cellular environment. one of these signals, igf-1, enhances stabilization of -catenin, triggering the molecular mechanism(s) leading to an increase of osteoblast differentiation and activity. obesity is associated with decreased gh secretion and igf-1 deficiency is associated with increased abdominal adipose tissue accumulation, decreased bmd [27, 42 ], and increased fracture risk as demonstrated by ours and other groups. we understand that a limitation of our work is due to the fact that we have chosen a clonal osteoblastic cell line as our in vitro model system. however, it is well known that molecular or cellular mechanism(s) described in cellular model system is usually confirmed in primary cell lines, which we are evaluating as well. thus, our in vitro results further point out for a central role of igf-1 and osteoblasts disruption in the mechanisms linking obesity to decreased bone quality. indeed, these results lead to the suggestive hypothesis that lower levels of igf-1 in subjects affected by an increased abdominal adipose tissue accumulation could contribute to the blunted levels of -catenin signaling in the osteoblasts leading to a disruption of normal differentiation pathway. further investigations are needed to clarify and characterize the complex link between adipose - bone and muscle tissues and identify other potentially involved molecules, beside igf-1, linked to the observed altered wnt/-catenin pathway. | obesity and sarcopenia have been associated with mineral metabolism derangement and low bone mineral density (bmd). we investigated whether imbalance of serum factors in obese or obese sarcopenic patients could affect bone cell activity in vitro. to evaluate and characterize potential cellular and molecular changes of human osteoblasts, cells were exposed to sera of four groups of patients : (1) affected by obesity with normal bmd (o), (2) affected by obesity with low bmd (oo), (3) affected by obesity and sarcopenia (os), and (4) affected by obesity, sarcopenia, and low bmd (oos) as compared to subjects with normal body weight and normal bmd (ctl). patients were previously investigated and characterized for body composition, biochemical and bone turnover markers. then, sera of different groups of patients were used to incubate human osteoblasts and evaluate potential alterations in cell homeostasis. exposure to oo, os, and oos sera significantly reduced alkaline phosphatase, osteopontin, and bmp4 expression compared to cells exposed to o and ctl, indicating a detrimental effect on osteoblast differentiation. interestingly, sera of all groups of patients induced intracellular alteration in wnt/-catenin molecular pathway, as demonstrated by the significant alteration of specific target genes expression and by altered -catenin cellular compartmentalization and gsk3 phosphorylation. in conclusion our results show for the first time that sera of obese subjects with low bone mineral density and sarcopenia significantly alter osteoblasts homeostasis in vitro, indicating potential detrimental effects of trunk fat on bone formation and skeletal homeostasis. |
recent clinical trials of the intravitreal injection of bevacizumab (avastin, roche, reinach, switzerland) (ivb) have shown excellent results in the treatment of angiogenic pathologies including proliferative diabetic retinopathy (pdr). it has been reported that ivb significantly decreases bleeding from the vessels of the fibrovascular membrane during vitrectomy in pdr, and ivb has also been reported to be effective in the regression of new vessels in pdr.13 the f10 (nidek, gamagori, japan) is a new commercially available scanning laser confocal ophthalmoscope (slo) that can perform multiple functions including fluorescein angiography, indocyanine green angiography, fundus autofluorescence, retro - mode imaging, and dark - field mode imaging. in the dark - field mode with a central stop, in contrast, the retro - mode of the f10 slo uses an infrared laser and an aperture with a modified central stop that is displaced laterally from the confocal light path. this optical arrangement allows for a clearer and pseudo-3-dimensional image, and is a new method of detecting abnormalities in the retina, such as cystoid macular edema4 or myopic retinoschisis.5 however, to our knowledge, no previous report has examined the fibrovascular membrane in pdr with the retro - mode. accordingly, we used the new indirect viewing system of the retro - mode function of the f10 slo for noninvasive evaluation of pdr pathologies before and after ivb, and compared the images histologically with surgically excised fibrovascular membrane from two cases. a 52-year - old man with a history of pdr in the left eye was examined. fundus examination disclosed very severe fibrovascular proliferation throughout the posterior pole (figure 1a). interestingly, in the retro - mode imaging with the f10 slo, the neovascular vessels in the fibrovascular membrane were clearly observed, as in angiography. however, the outline of the fibrovascular membrane itself was not clear (figure 1b). three days after 1.25 mg of ivb, fundus examination disclosed regression of most of the new vessels in the significantly contracted fibrovascular membrane, consistent with previous reports6,7 (figure 1c). surprisingly, most neovascular vessel structures in the fibrovascular membrane were still clearly observed in the retro - mode image (figure 1d). a 39-year - old man with a history of pdr and vitreous hemorrhage in the right eye was examined. fundus examination disclosed severe fibrovascular proliferation around the optic nerve head (figure 2a). similarly to case 1, neovascular vessels were clearly observed in the fibrovascular membrane with the retro - mode imaging function of the f10 slo (figure 2b). two days after 1.25 mg of ivb, fundus examination disclosed regression of most of the new vessels. however, in the retro - mode image, neovascular vessels were still observed in the fibrovascular membrane (figure 2c). to determine the morphological changes in structure of the neovascular vessels after ivb, we prepared formalin - fixed paraffin embedded sections from surgically excised fibrovascular membrane 2 days after ivb in this case. staining of the neovascular tissue with hematoxylin - eosin disclosed that many neovascular capillaries were still present, but that only large vessels contained red blood cells (figure 2d). a 52-year - old man with a history of pdr in the left eye was examined. fundus examination disclosed very severe fibrovascular proliferation throughout the posterior pole (figure 1a). interestingly, in the retro - mode imaging with the f10 slo, the neovascular vessels in the fibrovascular membrane were clearly observed, as in angiography. however, the outline of the fibrovascular membrane itself was not clear (figure 1b). three days after 1.25 mg of ivb, fundus examination disclosed regression of most of the new vessels in the significantly contracted fibrovascular membrane, consistent with previous reports6,7 (figure 1c). surprisingly, most neovascular vessel structures in the fibrovascular membrane were still clearly observed in the retro - mode image (figure 1d). a 39-year - old man with a history of pdr and vitreous hemorrhage in the right eye was examined. fundus examination disclosed severe fibrovascular proliferation around the optic nerve head (figure 2a). similarly to case 1, neovascular vessels were clearly observed in the fibrovascular membrane with the retro - mode imaging function of the f10 slo (figure 2b). two days after 1.25 mg of ivb, fundus examination disclosed regression of most of the new vessels. however, in the retro - mode image, neovascular vessels were still observed in the fibrovascular membrane (figure 2c). to determine the morphological changes in structure of the neovascular vessels after ivb, we prepared formalin - fixed paraffin embedded sections from surgically excised fibrovascular membrane 2 days after ivb in this case. staining of the neovascular tissue with hematoxylin - eosin disclosed that many neovascular capillaries were still present, but that only large vessels contained red blood cells (figure 2d). using the retro - mode imaging function of the f10-slo, we observed regression of most new vessels in the significantly contracted fibrovascular membrane 2 or 3 days after ivb. recent reports have described the application of ivb in treating ocular neovascular disorders including pdr.810 ivb has also been reported to be effective in causing the regression of new vessels in pdr.13 adjunctive use of intravitreal bevacizumab for severe pdr before vitrectomy significantly decreased bleeding from the vessels of the fibrovascular membrane during the vitrectomy.6,7 in case 2 of our study, vitreous surgery was successfully performed and fibrovascular membrane was excised for formalin - fixed paraffin embedded sections 2 days after ivb. these observations suggest that our methods for ivb were appropriate and that 2 or 3 days might be long enough for neovascular vessels to regress, since arevalo reported that 5.2% of pdr cases with ivb developed tractional retinal detachment 3 to 30 days after ivb. we investigated noninvasive evaluation of pdr pathologies before and after ivb using the new indirect viewing system of the retro - mode function of the f10 slo, and compared the images histologically with surgically excised fibrovascular membrane from one case. in previous reports,4 distribution of the cystoid spaces was clearly shown on topographic imaging in diabetic macular edema with the retro - mode imaging function of the f10 slo. optical coherence tomography has been especially useful in evaluating the depth distribution of cystoid spaces. however, the horizontal distribution was more easily assessed by retro - mode imaging, suggesting that the two technologies may be complementary.4 in our cases of pdr, neovascular vessels in fibrovascular membrane were clearly seen with the retro - mode, even after ivb and without blood flow. accordingly, the f10 slo may be useful in evaluating neovascular vessels in fibrovascular membrane in pdr and for determining the precise retinal changes in diabetic retinopathy. in previous reports, neovascular vessels without blood flow1,3 and apoptotic cells on the regressing vascular walls2 were observed histologically after ivb. in our study, staining of the neovascular tissue with hematoxylin - eosin disclosed that many neovascular capillaries were still present, but that only large vessels contained red blood cells (shown in figure 2). our findings of neovascular vessel structures after ivb may be the same as these previously reported regressing neovascular vessels without blood flow. although our study suggests that the f10 slo is useful in evaluating regressing neovascular vessels, there are several limitations to this study. first, our small sample size was small : only two cases were examined, and only one underwent histological examination. second, the f10 slo could not detect vascular permeability such as the vascular leakage in retinal and neovascular vessels usually observed in active pdr when examined with fluorescein angiography. in pdr with dense media opacity such as that caused by vitreous hemorrhage, f10 slo could not be used for fundus examination.. these technical limitations of the f10 slo indicate that it may be most useful in conjunction with other imaging techniques. in conclusion, we determined the usefulness of the new indirect viewing system of the retro - mode function of the f10 slo for noninvasive evaluation of pdr pathologies before and after ivb. use of an slo, such as the f10, may provide a unique detailed observation of retinal diseases such as pdr. | the f10 is a new commercially available scanning laser confocal ophthalmoscope (slo) that can perform multiple functions. we determined the usefulness of noninvasive evaluation of proliferative diabetic retinopathy (pdr) pathologies before and after intravitreal injection of bevacizumab (ivb) using the new indirect viewing system of the retro - mode function of the f10 slo, and compared the images histologically with surgically excised fibrovascular membrane from two cases. in pdr, neovascular vessels in fibrovascular membrane were clearly seen with the retro - mode, even after ivb and without blood flow. the f10 slo may be useful in evaluating neovascular vessels in fibrovascular membrane in pdr and for determining the precise retinal changes in diabetic retinopathy. |
the health of the individual is known to vary in different countries, in the same country at different times, and in the same individuals at different ages, meaning that the condition of the individual must be related to or compared with reference data. by comparing data for the individual collected during the medical interview, clinical examination, and supplementary investigations with the reference data, the condition of individuals can be interpreted.1 investigation of an individual should depend on normal ranges established for the locality of that individual.2 the first study in neonatal hematology was published in 1924, when lippman reported the morphologic and quantitative characteristics of blood corpuscles during the newborn period.3 since then, many hematologic studies have examined babies at different gestational ages and of varying birth weights.4 furthermore, determination of a reference range for the healthy term neonate is clinically important in terms of a number of parameters in the complete blood count. for example, hemoglobin concentration is an important clinical measurement used in the clinical diagnosis, treatment, and public health interventions for anemia.5 hemoglobin and hematocrit have been used routinely in the diagnosis of neonatal anemia and polycythemia.6 white blood cell and platelet counts have been proven to be helpful in the assessment of neonatal sepsis and the hemostatic status of the infant, respectively.7 hematologic values are also frequently determined in the newborn for diagnostic purposes in cases of suspected infection and in those with bleeding disorders.8 the aim of this study was to establish a local reference range for full blood count parameters in neonatal cord plasma in hilla, babil, iraq. a total of 220 mothers and their neonates were enrolled in this cross - sectional study conducted at the babylon gynecology and children s teaching hospital from february 2011 to january 2012. inclusion criteria for mothers were age 1545 years, uneventful pregnancy, and hemoglobin 10 g / dl. inclusion criteria for neonates were birth at full term (3742 weeks) and normal birth weight (2.54.0 kg). exclusion criteria for the mother were multiple pregnancy, eclampsia, diabetes mellitus, heart, kidney, or lung disease, hematologic disease, and emergency cesarean section. exclusion criteria for neonates were perinatal blood loss, birth asphyxia, low apgar score (65%) is relatively common in preterm and small for gestational age neonates.16 no significant gender differences in blood cell parameters and white blood cell indices were found for neonatal cord plasma, which is in agreement with the research by mukiibi.17,18 the percentage of neutrophils was found to be significantly different between males and females (p = 0.01). comparison of red blood cell parameters in neonatal cord plasma for the current study with reference values cited by other studies shows that hemoglobin and red cell counts were significantly lower than those reported for malawi,2 karachi,10 al - nahrain,11 and abidjan.12 hematocrit values in the current study agree with those from abidjan12 but were significantly lower than those from malawi,2 karachi,10 and al- nahrain.11 this may be due to varying numbers of newborns, time interval between birth and clamping of the cord, ethnic differences, severity of anemia in the mothers, or the mother not having received routine hematinics during pregnancy.17 mean cell volume results were in agreement with those from malawi2 but were higher than those from karachi,10 al - nahrain,11 and abidjan.12 this may be related to race and geographic variations, especially altitude from sea level.19 mean corpuscular hemoglobin values in the current study agree with the results of the abidjan12 study but are higher than those for the malawi2 study and lower than for the karachi10 and al - nahrain11 studies. this may be due to varying numbers of newborns, race, stress during pregnancy, maternal factors, low socioeconomic status, and geographic distribution. mean corpuscular hemoglobin concentration results are significantly lower than those of other studies,2,1012 which may be due to varying numbers of newborns, time interval between birth and clamping of the cord, ethnic differences, and severity of anemia in the mothers. nucleated red blood cells are normally seen in the blood of neonates during the first week of life,19 indicating a degree of hypoxia during labor. however, nucleated red blood cell values in the current study were lower than in other studies,2,1012 which might be attributed to a difference in mean gestational age because there was a significant inverse relationship between numbers of nucleated red blood cells and gestational age,20 or might be due to the number of samples taken. red blood cell distribution width values in the current study were within the reference range ; however, other studies used for comparison did not include this parameter. the total white blood cell count in the current study was within the reference values but lower than in other studies.2,1012 these differences might be attributable to differences in timing of collection of blood samples and/ or the site of blood sampling.21 lymphocyte and neutrophil percentages in the current study agree with those from the karachi10 study, but lymphocyte levels were higher and neutrophil levels were lower than for the abidjan12 study, which may reflect the size of the sample and racial factors. the percentage of monocytes in the current study was higher than in the karachi10 study but lower than in the abidjan12 study, and the percentages of basophils and eosinophils in the current study were lower than those in the karachi10 and abidjan12 studies, which may be related to the size of the sample and racial factors. the platelet count in the current study is in agreement with that from the malawi2 and karachi10 studies, but is higher than that for the al - nahrain11 and abidjan12 studies, possibly because of environmental factors, such as the medicinal herbs widely used in africa (eg, feverfew and gingko biloba, which are antiplatelet agents), contamination with wharton jelly, poverty, and malnutrition.18 there was no significant difference between males and females regarding full blood counts in neonatal cord plasma apart from the percentage of neutrophils. there is both agreement and disagreement between the current study and other studies inside and outside of iraq. the hematologic reference values for iraqi newborns need to be confirmed by larger numbers of blood samples and collecting samples from different areas of iraq. | backgroundthe health of an individual is known to vary in different countries, in the same country at different times, and in the same individuals at different ages. this means that the condition of individuals must be related to or compared with reference data. determination of a reference range for the healthy term newborn is clinically important in terms of various complete blood count parameters. the purpose of this study was to establish a local reference range for full blood count parameters in neonatal cord plasma in hilla, babil, iraq.methodsa total of 220 mothers and their neonates were enrolled in this cross - sectional study from february 2011 to january 2012. maternal inclusion criteria were age 1545 years, an uneventful pregnancy, and hemoglobin 10 g. neonatal inclusion criteria were full term (3742 weeks) and normal birth weight. the umbilical cord was immediately clamped after delivery of the baby ; 3 ml of cord blood was then taken from the umbilical vein and collected in a tube containing ethylenediamine tetra - acetic acid, its plasma was analyzed for full blood count parameters by standard coulter gram, and the differential leukocyte count was done manually.resultsmean neonatal hemoglobin was 13.88 1.34 (range 1117.3) g / dl and mean white cell count was 10.12 2.8 (range 3.121.6) 109/l. mean platelet count was 267.63 60.62 (range 152472) 109/l. no significant differences in red cell, white cell, or platelet counts were found between males and females, except for neutrophil count. the current study shows lower levels of hemoglobin, white cells, and red cells compared with other studies, and there is agreement with some studies and disagreement with others concerning platelet count.conclusionmost results in the current study were within the reference range. the hematological reference values for iraqi neonatal cord plasma need to be confirmed by larger numbers of blood samples and by collecting samples from different areas in iraq. |
fibroma of the tendon sheath is a rare tumor described as a benign lesion or a tumor - like reactive lesion arising from the synovium of tendon sheath. it has been reported mainly in finger and hand tendons as a benign, slowly growing nodule that arises from a synovial sheath [2, 6, 15, 16, 18 ]. involvement as a mass adjoining the synovial membrane of a joint capsule is extremely rare, and to our knowledge only seven cases have been described, mainly in the knee joint (four cases) [7, 8, 10, 1214, 18 ]. we wish to emphasize its unusual location in the case described here in the ankle a location for a fibroma of the tendon sheath that has never been described in the english literature before. this case concerns a 58-year - old man presenting a 24-month history of progressive localized swelling in the anteromedial aspect of his right ankle joint, with no recollection of associated trauma. the mass was slow - growing up to three months before coming to our attention, when it began to grow rapidly. physical examination revealed an approximately 5-cm - diameter ovoid mass over the anteromedial aspect of the right ankle joint ; the range of motion for dorsiflexion was progressively reduced to 10, and was slightly painful beyond this range. he had no diffuse joint effusion nor any other particular findings on other physical examinations. plain x - rays of the right ankle joint were normal, while an mri scan of the same region showed a soft tissue mass 5.5 3.4 2.6 cm in size arising from the anteromedial joint capsule. the mass had a nonuniform low intensity in t1- and t2-weighted scans, with focal septated areas exhibiting more intense signals (fig. an anteromedial ankle joint mass (arrow) with a nonuniform low intensity, along with focal septated areas exhibiting more intense signals. b sagittal stir mri scan. the mass (arrow) shows a more uniform high intensity a sagittal t1-weighted mri. an anteromedial ankle joint mass (arrow) with a nonuniform low intensity, along with focal septated areas exhibiting more intense signals. b sagittal stir mri scan. the mass (arrow) shows a more uniform high intensity the patient underwent an excision of the mass by anteromedial incision carried out under peripheral anesthesia (fig. 2a). on exploration, the mass was adherent to the lesser saphenous vein, which was isolated and medially mobilized. no clear capsule nor cleavage layer was found with the joint capsule, and no vascular peduncle was found either, so that part of the anteromedial ankle joint capsule had to be removed with the mass., the mass appeared to be a fibrous structure with a nonrubbery, hard consistency, and was gray - pearly white, multilobular and solid (fig. microscopic sections showed a variable cellularity : a central nodular area composed of dense fibrous connective tissue with focal areas of myxoid degeneration, and a peripheral dense fibrous connective tissue linked to the tendon sheath with some vascular structures (fig. c at section, the mass appears to be gray - pearly white, multilobular and solidfig. 3a h&e 10, the lesion appears to be circumscribed and surrounding tissues (right) are compressed by its growth. b h&e 25, tumor cells appear to be spindle - shaped and surrounded by abundant collagenic matrix. c h&e 40, tumor cells appear to be fibroblasts with no evidence of atypical patterns a anteromedial incision showing a distinct mass dislocating the lesser saphenous vein posteromedially. c at section, the mass appears to be gray - pearly white, multilobular and solid a h&e 10, the lesion appears to be circumscribed and surrounding tissues (right) are compressed by its growth. b h&e 25, tumor cells appear to be spindle - shaped and surrounded by abundant collagenic matrix. c h&e 40, tumor cells appear to be fibroblasts with no evidence of atypical patterns the patient was discharged the day after the operation with a physiotherapy program and an anterior splint to lock the joint in dorsal flexion, which was to be worn for two weeks. after one month he returned to his normal activities with full rom of his ankle., he regained full function of his ankle without pain or recurrence of his previous symptoms. fibroma of the tendon sheath, or tenosynovial fibroma, was first defined by geschickter and copeland in 1936. it has been described as a fibrotic neoplasm or a reactive fibrosis, but its precise origin is still unclear according to the current classification. however, histologically it is clear that it is a poorly recognized, slowly growing, benign proliferation of fibroblasts surrounded by collagen fibers, which appears as a fibrous nodule attached to tendon or tendon sheath ; a smooth, dense, multinodular mass with a diffuse pearly white appearance, ranging in size from 0.5 to 5.5 cm. a dense, matrix - rich collagenous stroma is arranged in nodules with slit - like vascular channels throughout it. occasionally myxoid and sclerotic hashimoto. found that many of the cells are represented by myofibroblasts. seventy - five to eighty - two percent of the tumors have been described in the extremities, most commonly the fingers, hands and wrists. the most important case report appears to be that of chung and enzinger in 1979, who reported on 138 patients : 98% of cases occurred in those locations. the tumor can occur at any age, with peak incidence occurring between 20 and 50 years. the male : female ratio has been described as 1.53:1 [2, 15 ]. the clinical presentation of tendon sheath fibroma often occurs years after its formation as a painless, slowly growing mass that may irritate the surrounding tissues by compression. nerve compression has been described in the distal forearm, presenting itself as a median nerve neuropathy. diagnosis must be based on the patient history and clinical examination, mri imaging and histology. plain x - rays are usually negative, except when large masses compress surrounding muscles or fat, or there are erosive bony changes, which are rarely described [2, 11 ].. reported on a fibroma of the tendon sheath in the distal forearm and described a low mri signal on t1-weighted images and a high signal on t2-wieghted images.. reported on an intraarticular mass of the knee with the same mri appearance.. found a low intensity in t1-weighted images and a mixed low and high intensity in t2-weighted images. described mri findings in six cases, including a low intensity in t1-weighted images in five cases, low intensity and isointensity in t2-weighted images in three cases, and a slightly high intensity in t2-weighted images in two cases. the current interpretation of this kind of behavior is that differences in the amounts of hyalinization, sclerosis and the number of proliferating fibroblasts may generate variations in t2-weighted mri findings : more hyalinized or sclerosed forms of fts (fibroma of tendon sheath) will tend to show lower intensities on t2-weighted images, while a more cellular variant will have a higher t2 signal. gadolinium dtpa - enhanced mri variations have also been described : pinar. and hitora. described a diffuse contrast enhancement on gd - dtpa - enhanced mri ; takakubo. described a peripheral enhancement which may be due to blood vessel proliferation at the periphery of the tumor. differential diagnosis must be made with giant cell tumor of the tendon sheath (gctts), representing a localized manifestation of pigmented villonodular synovitis that is less hyalinized and more cellular, and with histiocytes and monocytes as well as multinucleated giant cells, foam cells and hemosiderin - laden macrophages. due to similarities between some forms of the two tumors, some authors have hypothesized that they may be two phenotypic extremities of a single entity. fts must also be distinguished from nodular fasciitis, which resembles fts histologically but is a more rapidly growing mass [2, 6, 15, 16 ]. treatment is by local excision, with a reported recurrence of 24% ; all of the cases were described in hands and fingers, and this probably depends on the accuracy of the excision itself. to our knowledge, a malignant transformation has never been described. in conclusion, we can affirm that this case is of particular interest due to the localization, with no clear continuity with any tendon or tendon sheath. to our knowledge, only seven cases of localization within a joint capsule have been described : four in the knee (two in the posterior joint capsule [8, 18 ], one arising from a posterior cruciate ligament, and one in the suprapatellar pouch), one in the radioulnar joint, one in the temporomandibular joint, and one in the shoulder joint ; rather unusually, this last one presented as multiple intraarticular loose bodies. to our knowledge, ours is the first reported case of this tumor occurring in the ankle joint. this case is reported to highlight the diagnosis of a fts as a rare, but possible, cause of ankle joint mass. | we report a very rare case of fibroma of the tendon sheath arising from the anteromedial ankle joint capsule, with no apparent connection to any tendon in the area, found in a 58-year - old patient complaining of progressive local swelling. this uncommon tumor has its usual localization in tendon sheaths, is extremely rare in joint capsules, and has never been described in this location previously. mri showed nonuniform low signal intensity in t1- and t2-weighted images and high intensity in stir images. the mass was completely excised by open surgery. histopathological analysis later confirmed the diagnosis of a fibroma of the tendon sheath. |
oncogene amplification is found in a broad spectrum of tumors and is considered to play important roles not only in formation of cancer, but also in its later progression to states of metastasis and therapy resistance. the amplified copy or copies may appear on the same chromosome as the parental alleles, but may also be translocated to other chromosome(s) [figure 1a ] or even to extra - chromosomal acentric elements. illustration of the relationship between the parental alleles and the amplified ones of an oncogene. (a) in a cancer cell, a gene that locates at chromosome 8 (yellow dots) has two amplified copies located on one of the two 8 chromosomes, either the paternally or the maternally derived one. moreover, the gene also has an amplified copy on each of the two 10 chromosomes and two copies on one of the two 12 chromosomes (red dots). aneuploid chromosomes with amplified oncogenes often appear in cancer, but are not illustrated here. although the cell shows increased expression of this gene, relatively to the normal cells, it is difficult to pinpoint which one or ones of these eight (two normal and six amplified) alleles are responsible for the excess of the rna transcripts. (b) if both of the gene (red bar) and its promoter (short yellow bar) at chromosome 8 are amplified and the amplified copy is translocated to one of the 10 chromosomes, the co - amplified promoter may allow the amplified allele to be activated, and thus overexpressed, in a way similar to the activation of the parental allele(s) gene expression is known to be regulated not only by various epigenetic changes and regulatory rnas, but also by genetic mechanisms, including gene dose, i.e., copy number of the gene. there are many occasions in which overexpression of one oncogene is not associated with detectable amplification of the gene and thus is likely due to overactivation of the paternally or / and maternally derived alleles of the gene. for instance, in one study of glioblastomas, the met oncogene is amplified in only 5.1% of cases, but is overexpressed in 13.1% of the cases, indicating that in many cases, the increase in the expression is not due to amplification. similarly, in a study of esophageal carcinoma, mdm2 copy number is not correlated with its expression level. overexpression of epidermal growth factor receptor (egfr) in ependymoma is common and not correlated to gene copy number either. for some genes such as the human epidermal growth factor receptor 2 (her2), overexpression is more related to gene mutation, and mutation and amplification may occur in different patients. moreover, gene amplification shows topographic heterogeneity in a given tumor, just like the well - recognized heterogeneity of the expression level. there are even some occasions that seem to be counterintuitive, as in which gene amplification is actually associated with decreased expression. one of the possible explanations for this phenomenon is that not only the amplified allele(s) are inactive, but also one or both of the parental alleles are inactivated. in fact, some cancer cases show decreased expression and deletion of some oncogenes, such as decreased c - myc expression and deletion of the c - myc oncogene. in our musing, this is reasonable because most genes actually have dual functions, being an oncogene in some situations but being a tumor suppressor gene in the others and because rearrangement is a mechanism to inactivate tumor suppressor genes. egfr gene is amplified in about 50% of the newly diagnosed cases of glioblastoma, but the amplified allele(s) are often lost during primary culture, suggesting that the excessive copy or copies may no longer be needed for, or may even be detrimental to, the survival of glioblastoma cells in culture and thus are trimmed away. mechanistically, this occurs likely via dna recombination during cell division and presumably because the cells are no longer under the selective pressure in the culture, and such removal of the amplified copy or copies is more often seen, and can be much easily verified in bacteria. therefore, although it is still not quite clear why some cancer cases show decreases in the expression and the gene dose of some oncogenes, it may be related to growth advantage, which may mechanistically vary among cases. it is also possible that the paternally and maternally derived alleles are actually suppressed while the amplified alleles are activated and overexpressed, which may end up with a net result of little change in the expression level. relative to the above - described occasions, it is much more often that amplification of an oncogene is associated with increased gene expression, as has been shown by ample statistical analyses on the correlation between the copy number of the gene and its expression level. for instance, some studies show that egfr overexpression is correlated with its amplification in nonsmall - cell lung cancer, and a similar correlation is recently reported for the sqle gene in breast cancer. in fact, most studies conclude that the increase in the expression is ascribed to the gene amplification, i.e., the increase in the gene copy number, making this conclusion a longstanding and well - accepted concept in cancer genetics. for example, amplification of her2 gene is considered a major mechanism for its overexpression in breast cancer. however, an association shown in these studies does not need to be an actual cause result relationship. we have carefully scrutinized the literature but have not found convincing evidence, other than a positive statistical correlation, for this concept of amplification causes overexpression for many amplified oncogenes in cancers. in fact, different results and conclusions have been reported occasionally, such as a recent report showing that top2a overexpression in hepatocellular carcinoma was not secondary to gene amplification. the fact that one or both of the parental alleles of the oncogene are also activated and overexpressed in many cancer tissues or cell lines, as aforementioned, complicates the situation. for example, the c - myc oncogene is overexpressed in roughly 50% of the cases across all cancer types. amplification of the c - myc gene also occurs often, but the frequency is still much lower than the overexpression rate in the same cancer types, indicating that c - myc overexpression is not associated with amplification in most cases of almost all cancer types. in other words, overactivation of one or both of the normal c - myc alleles at the 8q24.21 of the paternally and maternally derived chromosome 8 is responsible for the overexpression in most cases. it is a very reasonable assumption that the amplified copies or alleles are activated, even when they are translocated to other chromosomes because the regulatory region of the gene, often referred to as promoter, is very likely to be co - amplified along with the oncogene to allow the excessive copies to be co - activated along with their parental ones [figure 1b ] however, this assumption may not always be real because an excessive copy at a new location of either the same chromosome or another chromosome is very likely to be under the sway of the local regulatory dna sequence as well. the result could be a suppression of the promoter, which may be one possible mechanism for the aforementioned suppression of the amplified allele(s). since in most cases, one or both of the parental alleles are also overexpressed, it is difficult to determine whether the excessive rna transcripts are derived solely from the parental allele(s), solely from the amplified allele(s), or from both [figure 1a ]. in other words, the observation that in most cases one or both of the parental alleles are activated and overexpressed muddles things up. in fact, to our knowledge, few attempts have hitherto been made to differentiate these three scenarios and differentiate the transcriptional activities between the excessive allele(s) and the parental ones. this is in part because such studies are technically difficult, unless the excessive allele(s) have mutations while the parental ones remain to be the wild type or the excessive alleles have different mutations from those in the parental alleles so that sequencing the complementary dna can result in information on whether there are any rnas transcribed from the amplified allele(s). if the amplified alleles have a deletion or insertion or have a mutation that changes the transcript splicing, resulting in a difference in the mrna size as frequently reported in cancers, the difference may be identified more easily by using reverse transcription and ensuing polymerase chain reactions to determine the sizes of the mrna variants. most studies of dna amplification have been focused on the expression of the protein - coding gene in the dna amplicon, without giving it enough attention that amplification of a genomic region is not the same thing as amplification of the gene in the amplicon. this is because only about 1.5% of the human genome encodes proteins and because not only protein - coding mrnas, but also different noncoding rnas as regulatory factors can be expressed from the dna amplicon. in fact, some genomic regions that harbor only noncoding rnas, such as the pvt-1, are also amplified in cancers. probably, in many cases, it is a noncoding transcript produced from the dna amplicon as a regulatory rna, but not an mrna and its protein product of the annotated gene that elicits a biological function to confer a survival or growth advantage on the cancer cell and thus, the cell does not require the mrna or its protein product to be overexpressed. this not only is one possible explanation for why on many occasions the expression level is not correlated with the gene copy number, but may also explain such occasions as that in which amplification of the mycn gene is a good prognostic marker for neuroblastoma, but the significance of mycn overexpression in prognosis is unclear. in a nutshell, noncoding regulatory rnas derived from the dna amplicon in particular are much underexplored and deserve many more studies, albeit noncoding rnas have been extensively studied in cancer in general. the widespread concept that gene amplification is a cause of increased expression still remains as a reasonable assumption, but has not yet been a convincingly proven fact for most, if not all, oncogenes in cancers. a caveat needs to be given that gene rearrangement is a different type of genetic alteration although it is often accompanied by gene amplification. rearrangement may cause formation of fusion gene(s) that produce fusion mrnas and fusion proteins, but their chimeric sequences can easily distinguish themselves from the transcripts from the parental alleles. yuping jia : shandong academy of pharmaceutical sciences, jinan, shandong 250101, china lichan chen : hormel institute, university of minnesota, austin, mn 55912, usa qingwen jia : shandong academy of pharmaceutical sciences, jinan, shandong 250101, china xixi dou : shandong academy of pharmaceutical sciences, jinan, shandong 250101, china ningzhi xu : laboratory of cell and molecular biology, cancer institute, chinese academy of medical science, beijing 100021, china dezhong joshua liao : clinical research center, guizhou medical university hospital, guizhou, guiyang 550004, p.r. | gene amplification causes overexpression is a longstanding and well - accepted concept in cancer genetics. however, raking the whole literature, we find only statistical analyses showing a positive correlation between gene copy number and expression level, but do not find convincing experimental corroboration for this notion, for most of the amplified oncogenes in cancers. since an association does not need to be an actual causal relation, in our opinion, this widespread notion still remains a reasonable but unproven assumption awaiting experimental verification. |
the most challenging aspect of acetabular revision is managing the bone stock loss and creating a stable reconstruction with long - term durability. reports show that restoring the normal biomechanical anatomy enhances survival and function [19, 42 ]. several techniques are described to reconstruct extensive acetabular defects, including structural grafts [20, 21, 26, 36, 46 ], reinforcement rings and cages [2, 28, 37, 38, 51, 52 ], placement of the acetabular component in a high hip center [12, 29, 45 ], jumbo cups [13, 24, 25, 35, 50 ], bilobed cups [1, 3, 8, 14, 30 ], use of trabecular metal acetabular augments [4, 32 ], and the triflange cup [9, 17 ]. results vary among these techniques (table 1).table 1results after acetabular revision surgery using different methodsstudyreconstruction methodnumber of patients (hips)followup (years)defectsurvivorship cup removal for any reason (95% ci)clinical outcomenumber of revisionsnumber of complicationsradiographic appearanceshhsothernumber of radiolucent linesotherberry. 79100)1 (2.6%)5 (13%)2 (5.2%) complete ; 24 (63%) incomplete2 (5.2%) migrationchen. bilobed cup38 (41)3.4 (25.5)paprosky types 2a3cpain less severe in 82%2 (5%)10 (26%)6 (16%) complete ; 35 (85%) incomplete6 (16%) migrationdeboer and christie bilobed cup18 (18)4.5 (3.46.9)aaos type iii91 (80100)01 (5.6%)6 (33%) incompleteabeyta. bilobed cup25 (25)11aaos type iii88% at 11 years76.5 (2591)3 (12%)3 (12%)4 (16%)moskal. bilobed cup11 (11)6 (56.8)aaos type iii85 (8190)000shinar and harris structural graft62 (70)16.5 (14.121.4)crowe types i iv dysplasia65% (55%75%) at 16.5 years75 (2997)25 (36%)18 (26%) radiographic loosepollock and whiteside structural graft20 (20)minimum 2noncontained superior weightbearing with anterior column defects7 (35%)6 (30%) radiographic loose ; 6 (30%) migrationjasty and harris structural graft36 (38)5.9 (49.1)large defect828 (32%)22 (50%)7 (16%) incomplete12 (32%) radiographic looseito. structural graft, jumbo cup, and/or high hip center74 (83)9.3 (513)aaos types i iii94.6% (87%100%) at 10 years81 (46100)4 (5%)12 (14%) dislocations ; 1 (1.2%) deep infection12 (15%) complete ; 19 (23%) incompletegarbuz. structural graft and some cases reinforcement ring116 (54 type 1 ; 29 type 2a ; 33 type 2b)7.1 (511)paprosky types 12b2a : 79.5 (1973) ; 2b : 71.2 (5288)success rate : 2a 90% ; 2b 76% 2a 4 (14%) 2b 15 (45%)2a 4 (14%) ; 2b 4 (12%)6 (21%) incomplete 2agarbuz. structural graft and some cases reinforcement ring32 (33)7 (511)aaos types iii iv71 (5288) group 1success rate : 55%15 (45%)4 (12%)kawanabe. reinforcement ring and morselized or bulk grafts38 (42)8.7 (4.312)aaos types ii ivmorselized : 53% (42.5%63.5%) ; bulk : 85% (72.4%91.6%) (radiographic failure) at 10 yearsjoa hip score : 77.3 (6595)2 (5%)6 (14%) complete4 (9.5%) radiographic looserosson and schatzker reinforcement ring and some cases bone grafts81 (81)5 (210)aaos types i ivmuller : 87 (61100) ; burch - schneider : 81 (5699)5 (6%)5 (6.2%) complete ; 15 (19%) incompletesaleh. reinforcement ring and structural graft19 (20)10.5 (516)gross type iv > 50% segmental bone loss anterior and posterior column77% at 10.5 yearswomac : function 62 (3193) ; pain 18 (8.127.9) ; stiffness 4.7 (3.65.8)3 (15%)3 (15%)01 (5%) ring migrationwinter. reinforcement ring and morselized bone graft38 (38)7.3 (4.29.4)aaos types iii iv82.6 (58.294.9)1 (2.6%)20 (53%)zehntner and ganz reinforcement ring and allograft27 (27)7.2 (5.510)aaos types i iii79.6% at 10 years9 (33%)12 (44%) migrationdearborn and harris high hip center44 (46)10.4 (8.512.7)stages i iv81 (56100)4 (8.7%)18 (39%)10 (22%) completewear 0.17 mm / year (0.030.47 mm / year)kelley high hip center22 (23)2.9 (25)substantial superior defects78 (4598)06 (27%)1 (4.3%) complete ; 7 (30%) incompleteschutzer and harris high hip center51 (56)3.3 (25.3)stages i iv86 (36100)05 (10%)4 (7.1%) complete ; 33 (59%) incompletedearborn and harris jumbo cup24 (24)7 (510.3)aaos types i iii86 (45100)3 (12.5%)5 (21%) recurrent dislocations ; 5 (21%) septic failure ; 4 (19%) trochanteric nonunion ; 4 (19%) remaining5 (21%) completewear 0.2 mm / year (0.030.36 mm / year)hendricks and harris jumbo cup24 (24)13.9 (12.316.2)aaos types i iii79 (4698)ucla activity scores : 5 (16)3 (12.5%)5 (21%) recurrent dislocations ; 5 (21%) septic failure ; 4 (19%) trochanteric nonunion ; 4 (19%) remaining5 (21%) completepatel. jumbo cup42 (43)10 (614)aaos types i iii ; paprosky types 2a3a83% (se 0.07) at 13 years81 (6399)5 (12%)2 (4.7%)4 (9.3%) incomplete 2 (4.7%)2 (4.7%) radiographic loosewhaley. jumbo cup89 (89)7.2 (511.3)aaos types i iii ; paprosky types 13b93% (85%100%) at 8 years834 (4.4%)18 (20%)5 (7%) complete2 (3%) radiographic failurechristie. triflange cup76 (78)4.4 (28.9)aaos types iii iv82.1 (59100)019 (24%)3 (12%) incompletedennis triflange cup24 (24)4 (26.5)paprosky type 3b79 (6889)3 (13%)3 (13%)3 (13%) radiographic loosenehme. trabecular metal14 (14)2.7 (0.53.8)aaos types i ivwomac : 33 (1852)03 (21%)4 (29%) incompletevan haaren. big, cemented cup68 (71)7.2 (1.69.7)aaos types i iv72% (54.4%80.5%) (aseptic loosening) at 7.2 years25 (35%)graft incorporation : success group 34 (66%) ; failed group 4 (20%)palm. big, uncemented cup79 (87)9 (711)gustilo and pasternak types ii, iii, iv90.5% (83.4%97.6%) at 9 years85 (34100)womac : 70 (22100)7 (8%)20 (23%)5 (5.7%) complete ; 16 (18%) incomplete5 (7.2%) radiographic loosebuttaro. big, mesh, cemented cup23 (23)3 (14.7)aaos type iii90.8% (68.1%97.6%) at 3 yearsmerle daubign and postel : 16.22 (8.7%)2 (8.7%)5 (22%)migration 5.1 mm (225)schreurs. big, cemented cup37 (42)12 (321)aaos types i iii80% (67%94%) at 20 years89 (60100)8 (19%)6 (14%)6 (14%) complete ; 14 (33%) incomplete7 (17%) radiographic looseschreurs. big, cemented cup56 (60)11.8 (1015)aaos types ii iii90% at 11.8 years85 (83100)5 (8.3%)9 (15%)15 (25%)4 (6.7%) radiographic looseschreurs. big, cemented cup28 (35)7.5 (314)aaos types ii iii85.1% (73%97.1%) at 8 years82 (5297)6 (17%)4 (11%)5 (14%)5 (14%) radiographic loosecurrent studybig, mesh, cemented cup25 (27)8.8 (314.1)aaos types iii, iv ; paprosky types 2b3b88% (74.2%100%) at 10 years71.6 (3395)ohqs : 24.9 (1249)3 (11%)13 (48%)2 (7.4%)5 (18.5%) radiographic loose ; wear 0.05 mm / year (00.15 mm / year) values are expressed as means, with ranges in parentheses ; modified harris hip score ; aaos = american academy of orthopaedic surgeons ; big = bone impaction grafting ; hhs = harris hip score ; joa = japanese orthopaedic association ; se = standard error ; ucla = university of california at los angeles ; womac = western ontario and mcmaster universities arthritis index. results after acetabular revision surgery using different methods values are expressed as means, with ranges in parentheses ; modified harris hip score ; aaos = american academy of orthopaedic surgeons ; big = bone impaction grafting ; hhs = harris hip score ; joa = japanese orthopaedic association ; se = standard error ; ucla = university of california at los angeles ; womac = western ontario and mcmaster universities arthritis index. we believe that restoring acetabular bone stock loss is essential for better survival rates, clinical function and pain, and radiographic appearances in revision hip arthroplasty. also, restoring bone stock loss provides a better starting point for any subsequent revision. for almost 30 years, we have used bone impaction grafting in combination with a cemented cup to reconstruct the acetabulum during primary and revision procedures in patients with acetabular defects [4044, 49 ]. survival rates of 90.8% have been reported at short - term followup (2456 months), 72% to 90% at midterm (7.27.5 years) [43, 48 ], and 80% to 94% at long term (11.820 years) [40, 41, 44, 49 ]. with more extensive defects, one study reported a survival rate of 72% ; 70% of the reconstructed cups had an american academy of orthopaedic surgery (aaos) type iii or iv bone defect. we studied a group of patients with acetabular reconstructions with bone impaction grafting for extensive bone deficiency. we determined the (1) survival rates with the end point revision for any reason, aseptic revision, and radiographic loosening ; (2) vas pain score, hhs, and the ohqs ; (3) number of repeat revisions ; (4) complications ; and (5) radiographic loosening, wear, and radiolucencies. between january 1993 and december 2003, we performed 27 acetabular revisions in 25 patients with large acetabular defects using impacted bone grafts and a cemented cup. during this period the indication for the revision was aseptic loosening of the acetabular component in 22 hips, septic loosening in four hips, and one with resection arthroplasty greater than 6 months. for this study, we included patients only with an x - change large - rim mesh (stryker - howmedica, newbury, uk). we had not classified the severity of the defects at the time of surgery and therefore included only patients who had 6 weeks of postoperative bed rest or 3 weeks of bed rest together with 3 weeks of nonweightbearing mobilization ; these were all patients who were judged to have the most severe defects. five men (five hips) and 20 women (22 hips) were included, with a mean age of 63 years (range, 4282 years) at the time of the index revision procedure. the minimum followup for all patients was 3 years (mean, 8.8 years ; range, 314.1 years)., two patients (two hips) died from causes not related to the revision procedure at 1 year and 7.5 years postoperatively. one patient died from hepatic failure ; however, she had aseptic loosening of her acetabular reconstruction but did not undergo reoperation because of her poor medical condition. the minimum followup of the surviving patients (not deceased, hips not revised) was 4 years (mean, 9.7 years ; range, 414.1 years). we retrospectively classified all defects using the aaos system : 25 had a type iii defect and two had a type iv defect. according to the classification of paprosky., four hips had type 2b, 14 hips had type 3a, and nine hips had type 3b defects. one metal mesh was used in nine hips, two meshes were used in 16 hips, and three meshes were used in two hips. the bone bed was rinsed with pulse lavage after removal of the cup, cement, and interface. segmental bone defects of the acetabulum were contained with one or more metal meshes fixated with screws. in all cases, the superolateral wall defect was reconstructed with a large - rim x - change metal mesh (fig. 1). next, sclerotic areas were perforated by multiple 2-mm drill holes, and impaction bone grafting was performed. bone chips with a diameter of 0.7 to 1.0 cm were made by morselizing femoral head allografts from the local bone bank with a rongeur or a bone mill (fig. the chips were impacted with metal impactors (x - change system ; stryker howmedica) and a mallet (fig. the original center of rotation of the hip was reconstructed with the transverse acetabular ligament as a reference mark. all cups were implanted with antibiotic - loaded bone cement (surgical simplex ; stryker howmedica) with third - generation cementing techniques and with a conventional full high molecular weight polyethylene (hmwpe) cup (fig. eleven muller 32-mm cups (sulzer, winterthur, switzerland), eight exeter / contemporary 28-mm cups (stryker howmedica), and eight charnley / elite 28-mm cups (depuy, leeds, uk) were used. the choice of the definitive cup size was made by the last trial cup and reamer used. the inner diameter was standard 28 mm, but occasionally a 32-mm cup was used to create a more stable situation or when there was a high risk of dislocation. we used only the planned operation technique ; no alteration of surgical plans was necessary [6, 42 ] (fig. 3).fig. (b) for acetabular reconstruction, 7- to 10-mm diameter fresh - frozen morselized bone chips are impacted using end metal impactors in several diameters. (c) with a hammer, the bone chips, layer by layer, are compressed tightly. (d) bone cement is introduced in a relatively viscous state and is pressurized to force bone cement into the graft. (reproduced with permission from busch vj, gardeniers jw, slooff tj, veth rp, schreurs bw. [favourable long - term results from cemented total hip arthroplasty combined with acetabular bone impaction grafting in patients under the age of 50 ] [in dutch ]. b(a) an ap radiograph shows the right acetabulum of a patient who had aseptic loosening of two cups in the pelvis with an aaos type iii and paprosky type 3b defect. (b) twelve years after revision, no radiolucent lines, no migration, and incorporation of the graft can be seen. (a) a flexible stainless steel mesh is used to close the segmental defects. (b) for acetabular reconstruction, 7- to 10-mm diameter fresh - frozen morselized bone chips are impacted using end metal impactors in several diameters. (c) with a hammer, the bone chips, layer by layer, are compressed tightly. (d) bone cement is introduced in a relatively viscous state and is pressurized to force bone cement into the graft. (reproduced with permission from busch vj, gardeniers jw, slooff tj, veth rp, schreurs bw. [favourable long - term results from cemented total hip arthroplasty combined with acetabular bone impaction grafting in patients under the age of 50 ] [in dutch ]. (a) an ap radiograph shows the right acetabulum of a patient who had aseptic loosening of two cups in the pelvis with an aaos type iii and paprosky type 3b defect. (b) twelve years after revision, no radiolucent lines, no migration, and incorporation of the graft can be seen. all patients received antibiotics (cefazolin) after results of intraoperative cultures were obtained. on indication and guided by these cultures, all patients received thrombosis prophylaxis with low - molecular - weight heparin for 6 weeks or, before 1999, with oral anticoagulation for 3 months. twenty patients (21 hips) had bed rest for 6 weeks. in five patients (six hips), an initial 6-week period of bed rest was planned, but nonweightbearing mobilization was used for the last 3 weeks. under the supervision of a physical therapist, mobilization with partial (10%) weightbearing was begun at 6 weeks and 50% weightbearing with crutches at 12 weeks. all patients were followed on a regular basis or until death ; data of the two patients who died were included. routine followups were scheduled at 6 weeks ; 3, 6, and 12 months ; and yearly or biannually thereafter. at our outpatient clinic, independent student researchers not participating in the treatment performed clinical analyses using the hhs, the ohqs (since 1998), and a vas for pain. the radiographic examination consisted of ap and lateral radiographs of the hip or pelvis. three patients (three hips) were unable to return for the clinical review owing to their advanced age and general health limitations. by telephone interview, none had complaints of the reconstructed hip and none have had additional surgery on the hip. the last radiographs for these three patients (4.0, 4.4, and 7.8 years postoperatively) were included in the radiographic review. the preoperative hhss were available for 15 patients and postoperative hhss were available for 20 patients. the preoperative ohqss were available for two patients and postoperative scores were available for 19. postoperative vas scores for pain (0 = best score, 100 = worst score) were available for 18 patients. three investigators (nve, dcjk, bws) independently evaluated the radiographs for signs of incorporation, radiolucent lines, cup position, heterotopic ossification, and polyethylene wear. whenever we differed regarding evaluation of a radiograph, we reviewed it again together without knowing our previous scores for that radiograph. we then reached agreement on the score, which, in all instances, was one of the scores from the previous evaluation ; we did not determine interobserver variability of any measures. radiographic evidence of incorporation was defined as equal radiodensity of the graft and host bone with a continuous trabecular pattern throughout, as described by slooff.. radiolucent lines greater than 2 mm in width were identified in the three zones of delee and charnley. position of the cup was defined as neutral in 45 (10), vertical in 56 or greater, and horizontal in 34 or less, according to salvati.. polyethylene wear was calculated using the dorr method as described by ebramzadeh.. failure was defined as the need for repeat revision of the acetabular component for any reason, and radiographic failure was defined as radiolucent lines in all three zones or tilting of the cup 8 or greater and migration of 5 mm or greater relative to the interteardrop line, in any direction on the ap radiographs of the pelvis. survivorship analysis was performed using the kaplan - meier method with the end points of revision for any reason, aseptic revision, and radiographic loosening. spss v 16.0 (spss benelux bv, ibm company nieuwegein, the netherlands) was used for statistical analysis. the probability of survival of the acetabular component at 10 years, with removal of the cup for any reason as the end point is 87.6% (95% confidence interval [ci ], 74.2%100%) (fig. 4). with revision for aseptic loosening as the end point, the survival rate is 95.2% (95% ci, 86.0%100%) at 10 years (fig. 5). the survival rate with radiographic loosening as the end point is 77.2% (95% ci, 59.0%95.4%) at 10 years (fig 4a kaplan - meier curve shows survival with an end point of revision of the cup for any reason. 5a kaplan - meier curve shows survival with an end point of revision of the cup for aseptic loosening. the survival rate was 95.2% (95% ci, 86.0%100%) at 10 years.fig. 6a kaplan - meier curve shows survival with an end point of radiographic loosening of the cup. the survival rate was 77.2% (95% ci, 59.0%95.4%) at 10 years. a kaplan - meier curve shows survival with an end point of revision of the cup for any reason. a kaplan - meier curve shows survival with an end point of revision of the cup for aseptic loosening. the survival rate was 95.2% (95% ci, 86.0%100%) at 10 years. a kaplan - meier curve shows survival with an end point of radiographic loosening of the cup. the survival rate was 77.2% (95% ci, 59.0%95.4%) at 10 years. the surviving patients had improved clinical scores after acetabular revision with bone impaction grafting and a cemented cup, even after a mean followup of 9.7 years (table 2).table 2clinical outcomesscorenumber of patients (hips) availablemedianmeanrangepreoperative hhs15 (15)5155.33095postoperative hhs18 (20)73.571.63395preoperative ohqs2 (2)26261735postoperative ohqs17 (19)2324.91249postoperative vas pain score at rest17 (18)011.7080postoperative vas pain score on movement17 (18)014.7070 surviving hips in living patients who did not have a repeat revision ; hhs = harris hip score ; ohqs = oxford hip questionnaire score ; vas = visual analog scale. surviving hips in living patients who did not have a repeat revision ; hhs = harris hip score ; ohqs = oxford hip questionnaire score ; vas = visual analog scale. three hips (11%) had failed results and underwent rerevision or removal of the implant.. against our protocol and advice, the patient started full weightbearing 4 weeks postoperatively. one hip failed 4.7 years after surgery owing to culture - proven septic loosening. the patient had one previous revision because of septic loosening and three revisions because of aseptic loosening. the third acetabular component was revised owing to aseptic loosening after the patient fell on the floor 5.8 years postoperatively and a cup revision was performed. there were 13 complications in total (table 3).table 3complicationscomplicationsnumbertreatmentoutcomecup failures unstable cup1resection arthroplastyresection arthroplasty septic loosening1resection arthroplastyresection arthroplasty aseptic loosening1cup rerevisionno additional problemsrevision femoral component recurrent dislocation1femoral stem rerevisionno additional problems perioperative unnoticed distal stem perforation of the femoral shaft1femoral stem rerevisionno additional problemsperioperative complication periprosthetic fracture3open reduction and internal fixationstable reconstructionpostoperative complication neurapraxia of peroneal nerve1observationpermanent partial motor paralysis dislocation hip2newport braceno additional problems delayed wound healing with effusion1observationno additional problems early septic loosening1observation (owing to patient s poor medical condition) five hips had radiographic signs of loosening based on migration ; three of these were described above and had repeat revision surgeries. the revised hips were considered radiographically loose after 1.0, 1.9, and 5.8 years. two hips in two patients, radiographically loose after 8.0 and 8.1 years postoperatively, were not revised. these two patients had complaints, but no repeat revision surgery was planned because of their old age and poor medical conditions. fourteen hips had polyethylene wear however, the wear was excessive (> 0.1 mm / year) in only three. the mean wear was 0.05 mm / year (range, 00.15 mm / year). five hips had class i ossifications, three had class ii, and one had class iii ossifications. various techniques have been described to manage these deficiencies, with varying results (table 1). bone impaction grafting is one of the few reconstruction techniques that restores the loss of bone stock and allows creation of an anatomic and biomechanical natural center of rotation. it has reported survival rates between 72% and 94% [40, 41, 43, 44, 48, 49 ]. in the more extensive defects of the 20 acetabular components revised in patients in that study, 70% had an aaos type iii or iv bone defect. in our current study, in a group of patients with acetabular revision with bone impaction grafting for extensive bone deficiency, we determined the (1) survivor rates, (2) pain relief and function, (3) number of rerevisions, (4) complications, and (5) radiographic appearances. however, no patients were lost to followup and the worst - case scenario survival rate was 88% at 8.8 years. also, we believe the group is representative because all ages and all revision and primary indications for the revision and primary arthroplasties are included. second, we retrospectively classified the severity of the defects and therefore the indications for surgery were not strictly based on a given level of severity. however, for this study, we included only patients who had 6 weeks of bed rest and the use of the x - change large - rim mesh, both of which we used only for patients needing more extensive reconstructions. bed rest was prescribed only for patients with severe defects in whom we believed, at the time, early mobilization would jeopardize the stability of the reconstruction. third, with a mean followup of 8.8 years our followup is midterm. for final proof long - term data fourth, we unfortunately had some missing clinical data, but available data show a trend that the clinical function and pain are improving after acetabular reconstruction with bone impaction grafting. we have used the ohqs only the past few years and therefore do not have previous data. the 10-year survival rates of the reconstructions in this study were 88% with removal of the cup for any reason as the end point, 95% with revision for aseptic loosening as the end point, and 77% with radiographic loosening as the end point at a mean followup of 8.8 years (range, 314.1 years). survival rates vary among the different techniques used in large acetabular defects (table 1). abeyta., who investigated the bilobed cup in large reconstructions, reported a survival rate of 88% for 25 patients with an aaos type iii defect after a followup of 11 years. the study was limited by a high number of lost and deceased patients. in the worst - case scenario, reconstruction with a structural graft has good short - term survival rates (zero revisions at a mean of 17.3 months), but middle and long - term (216.5 years) failure rates of 32% to 45% are reported for these grafts [21, 26, 36, 46 ]. trabecular metal acetabular augments are now commonly used in the united states for reconstruction of large acetabular defects. several studies show low failure rates of 0% to 6% [4, 32 ], but the followup is short (mean, 2.7 years) and the number of patients is small [4, 32 ]. among 71 revisions with aaos types i to iv defects using bone impaction grafting and a cemented cup, van haaren. found 25 hips (35%) needed repeat revision. the survival rate after 7.2 years with repeat revision with aseptic loosening as the end point was 72% (95% ci, 54.4%80.5%). however, greater than 50% of their aseptic revisions were based on cup loosening out of the cement mantle, which is an unusual failure mechanism. in line with the literature, patients had better postoperative clinical scores after acetabular reconstruction with bone impaction grafting and a cemented cup (table 1) [33, 40, 41, 43, 44, 49 ]. jasty and harris reported eight (32%) of their patients needed repeat revision by a mean followup of 5.9 years using structural femoral head allografts to reconstruct large acetabular bone defects. the repeat revision rate of abeyta. was 12%, similar to ours, using a bilobed cup in the reconstruction of acetabular deficiencies. different complication rates are described using bone impaction grafting techniques (table 1). described only two (8.7%) reoperations and two (8.7%) other complications (infection and dislocation). however, this report was based on bone impaction grafting with noncemented cups. also, high complications rates are reported using structural grafts (50%), jumbo cups (21%) [13, 24, 50 ], and the triflange cup (24%). in addition to the three hips needing repeat revision, another two cups were considered radiographically loose. in the other cases, this could be attributed to the unique cup, graft, cement, and bone interface. de kam. reported fewer radiolucent lines were seen in patients with impacted bone grafts in primary tha. in a study of revision arthroplasty we believe the proper function and the survival of an acetabular reconstruction in revision surgery depend on achieving adequate fixation of the new component, restoring the anatomic center of rotation of the hip, and restoring bone stock loss. we believe that for extensive reconstructions with bone impaction grafting, an after - treatment protocol of 6 weeks of bed rest, or 3 weeks of bed rest and 3 weeks nonweightbearing mobilization, is crucial for acceptable survival rates and improving clinical function and pain. in the study by buttaro. regarding the outcome of larger defects and bone impaction grafting, 6 weeks of unloading with crutches was used and at 3 years, the survival rate was 90.8%. however, one of their failed results involved a patient who decided to fully load the reconstruction and this resulted in failure, as occurred with one patient with failed results in our study. acetabular reconstruction using impaction bone grafting together with a cemented cup is a reliable technique with favorable midterm survival rates and clinical function in patients with massive acetabular defects. impacted bone grafting is an acetabular revision technique that restores bone stock loss and allows reconstruction of the normal anatomic biomechanics of the hip. | backgroundloosening of acetabular components often leads to bony defects. management of extensive acetabular bone loss in hip revision arthroplasty can be a tremendous challenge.questions/purposeswe asked whether a reconstruction with impacted bone grafts will provide a durable and pain - free function in extensive acetabular defects. we specifically determined the (1) survival rates with the end point of revision for any reason, aseptic revision, and radiographic loosening ; (2) visual analog scale (vas) pain score, harris hip score (hhs), and the oxford hip questionnaire score (ohqs) ; (3) number of repeat revisions ; (4) complications ; and (5) radiographic loosening, wear, and radiolucencies.patients and methodswe retrospectively followed 25 patients (27 hips) with extensive acetabular defects. no patient was lost to followup. two patients died during followup. minimum followup was 3 years (mean, 8.8 years ; range, 314.1 years).resultsthree patients (three hips) underwent repeat revision surgery and another two patients (two hips) had radiographically loose hips. the 10-year survival rate was 88% (95% confidence interval, 74.2%100%) with the end point acetabular revision for any reason and 95% (95% confidence interval, 86.0%100%) with the end point acetabular revision for aseptic loosening. the mean hhss were 55 points before surgery and 72 points postoperatively.conclusionsacetabular reconstruction with impaction bone grafting and a cemented cup is a reliable technique with a 10-year survival rate of 88% in patients with extensive acetabular deficiencies.level of evidencelevel iv, case series. see the guidelines for authors for a complete description of levels of evidence. |
currarino syndrome (cs) is a very rarely seen condition which is termed as currarino triad. it is a hereditary pathology which is characterized by a triad of sacrococcygeal bone defect, presacral mass, and anorectal malformation. when it is associated with all of these three anomalies, it is called complete form, while in the presence of one or two components, it is named incomplete form. i d : 4979) mutations have been reported in all cases with familial currarino triad. this triad which was firstly described by currarino is asymptomatic in more than 33% of the affected children. symptoms such as intractable constipation, urinary retention, incontinence, and bowel obstruction in infancy are frequently associated with this presentation. indeed, in more than 15% of the cases with currarino triad, concomitant mullerian duct anomalies are detected. cases with sacral agenesia should be investigated as for presacral masses and anorectal changes. for cases with suspect cs, multidisciplinary approach at an early stage is important. in the presence of anal atresia, prevention of potential complications a 2-year - old male infant was admitted to our hospital with inability to urinate and intractable constipation. from his medical history, it was learnt that 24 h after his birth, he had undergone colostomy operation with the indication of anal atresia and rectovestibular fistula. on physical examination, complete urinalysis revealed abundant leukocytes and erythrocytes in urine. the plain abdominal x - ray performed in the standing position demonstrated a defect at the right lower side of the sacrum, and a dysplasic image displayed deviation to the left (scimitar sacrum) (fig. a multilocular septated cystic lesion measuring 5.7 6 cm in the presacral area was detected (fig. hypoplasic appearance of the right sides of s3, and vertebras inferior to s3, leftward deviation of sacrum (scimitar sacrum), and a presacral cystic lesion were detected (fig. 3). on lumbosacral magnetic resonance imaging (mri), widening of the right s3-s4 and s4-s5 neural foramens, and a multilocular, septated anterior sacral meningocele (asm) which continued with sacral spinal canal anteriorly displaced bladder, and rectum were observed (fig. an abdominal radiograph : a defect at the right lower side of the sacrum, and a dysplasic image displaying deviation to the left (scimitar sacrum). an ultrasound examination revealed a multilocular septated cystic lesion measuring 5.7 6 cm in the presacral area. abdominal tomogram : hypoplasic appearance of the right sides of s3, and vertebras inferior to s3, leftward deviation of sacrum (scimitar sacrum), and a presacral cystic lesion. lumbosacral mri : widening of the right s3-s4 and s4-s5 neural foramens, and a multilocular, septated anterior sacral meningocele (asm) which continued with sacral spinal canal anteriorly displaced bladder, and rectum were observed. the patient was also operated in the clinics of neurosurgery with the indication of asm. this syndrome which was named after scientist guldo currarino who first discovered this triad is characterized by a sacral bone defect, a congenital hindgut anomaly, and a presacral tumor. this syndrome has been reported to stem from the hlxb9 gene mutations on the chromosome 7. therefore, presacral masses and sacral ageneses w / o anorectal anomalies are suggestive of possible familial cs. presacral mass which accompanies cs may consist of a teratoma, a hamartoma, a neuroenteric cyst, anterior meningocele or a combination of these four entities. it has been reported that presacral mass results in symptoms such as intractable constipation, urinary incontinence, sacral anesthesia, paraesthesia of the lower extremities, disturbance of anal sphincter control, etc. among them other symptoms are related to recurrent urinary tract infections, nausea, headache, and lumbar pain. in our case, clinical symptoms of urinary infection were associated with constipation. though rarely its association with hd has been reported. still, presence of cs was reported in an adult case with chronic anal fistula. in the diagnosis and follow - up of cs, radiological imaging modalities such as ultrasonography (us), computed tomography (ct), and mri kassir reported mri as a specific and sensitive non - invasive diagnostic tool in cases with anorectal malformation. mri can be used reliably in the diagnosis of this syndrome, associated mass lesions, and other pathologies, and also during post - treatment follow - up period of cases with cs. regardless of its anatomical characteristics, presacral mass should be completely removed during surgical resection. in our case, anterior meningocele was detected, and sacral laminectomy was applied through retroperitoneal approach. in these cases, in order to avoid serious neurological complications, the connection between spinal canal and tumor should not be overlooked. though rarely, since its malignant transformation into teratoma has been reported, multidisciplinary approach is very important in cases with cs which can result in morbidities and mortality. anal atresia can be one of the components of currarino triad. in a patient who was admitted because of the presence of anal atresia, in order to preclude potential complications, probable concomitancy of this syndrome should not be forgotten. anal atresia can be one of the components of currarino triad. in a patient who was admitted because of the presence of anal atresia, in order to preclude potential complications, probable concomitancy of this syndrome should not be forgotten. sevgi buyukbese sarsu, mehmet ergun parmaksiz, esra cabalar, ali karapur and cihat kaya have contributed to data collections. | currarino syndrome (triad) is an extremely rare condition characterized by presacral mass, anorectal malformation, and sacral bone deformation. the complete form of this syndrome displays all three irregularities. herein, we report a male case who was admitted to our hospital with symptoms of urinary system infection and persistent constipation 2 years after colostomy operation performed with the indication of rectovestibular fistula and anal atresia, diagnosed as currarino syndrome based on imaging modalities. in a patient who was admitted because of the presence of anal atresia, in order to preclude potential complications, probable concomitancy of this syndrome should not be forgotten. early diagnosis is important for the prevention of meningitis, urinary tract infections, and malignant change. |
severe proliferative vitreoretinopathy (pvr) is a common problem following complex retinal detachments and trauma. current instruments facilitate removal of epiretinal membranes during vitrectomy in order to achieve retinal reattachment. unfortunately, removal of subretinal pvr is often mandatory but not easily achieved ; this requires multiple posterior retinotomies and inability to completely remove these membranes may hinder retinal reattachment. removal of subretinal pvr often results in formation of new breaks, enlargement of retinotomies and traction on the vitreous base.1,2 perfluorocarbon liquids (pfcls) are employed to stabilize the retina during vitrectomy working as a second hand in epiretinal pvr dissection and also to drain subretinal fluid through peripheral retinal breaks. immiscibility with water, high specific weight and high surface tension have made pfcls an invaluable tool in vitreoretinal procedures.3,4 herein, we report the use of subretinal pfcls in conjunction with large peripheral retinotomies for thorough removal of subretinal pvr to achieve better reattachment rates. approval was obtained from the ethics committee of the asociacin para evitar la ceguera en mxico (hospital dr. all procedures followed the tenets of the declaration of helsinki ; written informed consent was obtained from all participants prior to the procedure. in complicated retinal detachment and extensive pvr cases, it is of utmost importance to perform a complete vitrectomy together with total posterior vitreous detachment, posterior hyaloid removal and thorough dissection of all epiretinal proliferative tissues. whenever the retina is not mobile enough to be easily reattached, the need for subretinal pvr dissection through retinotomies or retinectomies we propose that in the presence of extensive subretinal pvr, a peripheral retinotomy can be performed according to the location of pvr to be dissected. the retinotomy should be at least 180 degrees in extent, however larger dissection is sometimes required (fig. perfluorocarbon liquids are then placed through the retinotomy as a single bubble in the subretinal space using a fine cannula. this should be done while gently holding the retina attached to the ora serrata using the light probe or another instrument. care should be taken not to fold the retina over the fovea in order to avoid photoreceptor disruption. with this procedure, access is provided to the subretinal space enabling the surgeon to visualize bare rpe on one side, and the external neuroretinal surface on the other (fig. once pvr removal is completed, pfcls are removed by direct aspiration as a single bubble while still under balanced salt solution (bss) taking advantage of their high surface tension which prevents leaving bubbles behind. once the retina is folded back in place, pfcls may be used over the retina for reattachment. laser photocoagulation is applied at the border of the retinotomy followed by air - fluid exchange and finally silicone oil tamponade. the current report includes five eyes of five patients with retinal detachment secondary to trauma of more than 6 weeks duration who presented with pvr grade c. the retina remained attached in all eyes after surgery over a mean follow - up period of one year. one eye developed pfcl subretinal droplets at the equator. no signs of abnormal inflammation or proliferation of fibrous tissue were noted. despite chronicity, severity and poor visual prognosis of the detachments, all eyes maintained their preoperative vision or showed a modest increase (table 1). subretinal pvr has long been known to hinder retinal reattachment in spite of adequate epiretinal membrane dissection, nonetheless not all subretinal membranes require removal. surgical manipulation in the submacular space may lead to photoreceptor loss and could have been the cause of disappointing visual outcomes in previous studies on surgical removal of submacular neovascularization.5 several techniques have been described for patients requiring subretinal pvr excision for retinal reattachment. most techniques involve appropriately placed retinotomies together with dissection or removal by traction, of subretinal bands. however, these maneuvers may cause further damage to the retina. furthermore, multiple posterior retinotomies are usually necessary and retinal tears or retinotomies may become enlarged when traction is exerted on the membranes. these unwanted complications may be reduced by employing small retinotomies, however this advantage is offset by decreased maneuverability and limited access to subretinal membranes. the repair of complicated retinal detachments with anterior and subretinal pvr often requires large peripheral retinectomies in order to loosen the retina to a degree that allows its reattachment. unfortunately, the mobilized retina often gets in the way, obscuring visualization and making dissection difficult. the technique we propose herein permits adequate visualization as well as stabilization of the retina thereby allowing thorough dissection of subretinal membranes. it can be performed with the aid of a chandelier making bimanual dissection easier ; this might prevent iatrogenic retinal tears since it significantly diminishes retinal traction. moreover, pfcls provide more space to maneuver and may prevent damage to the rpe, bruch s membrane and choriocapillaris. alterations of these structures due to lack of adequate space have been reported as complications of submacular surgery.6 pfcls have become an indispensable tool in modern vitreoretinal surgery. the presence of these liquids in the subretinal space is usually considered a transoperative complication which occurs in eyes with persistent retinal traction and open retinal breaks.7 the use of pfcls in the subretinal space may raise questions regarding its toxicity. in vivo, subretinal pfcl droplets produce measurable scotomas and alter retinal function.8 in vitro, pfcls left for long periods in the vitreous cavity provoke photoreceptor disruption, external and internal plexiform layer thinning, decrease in the number of ganglion cells and damage to the inner nuclear layer, in addition to edema and macrophage infiltration into superficial layers.9 pfcls also affect rpe cell survival, to which they are in contact, for periods ranging from 3 to 7 days.10 nevertheless, scotomas and visual acuity improve after removal of retained subretinal pfcls.10,11 although long - term retinal toxicity has been documented, trans - operative use of pfcls in the subretinal space may be safe due to the short duration of contact. one may question the microscopic presence of pfcl in the subretinal space after its apparent removal. this issue might be hard to demonstrate since pfcls usually evaporate during preparation for histological evaluations. a new technique for staining pfcls has been described in which these compounds are mixed with stained semifluorinated alkanes. stained pfcls might prove useful for better visualization at the time of removal and may also be valuable in establishing the subretinal presence of pfcls on histopathologic sections. unfortunately, this combination is still not commercially available.12 despite this argument, the current technique of subretinal pfcl injection may still prove advantageous considering the consequences of retained fibrous proliferation and multiple retinotomies necessary for its removal. the use of pfcls in the subretinal space has been reported for harvesting and relocation of rpe grafts for treating age related macular degeneration.13 some of the advantages mentioned by the authors are increased subretinal space provided by pfcls, adequate flattening of the graft and better hemostasis during surgery. this technique was attempted in 4 patients and the authors reported adequate pfcl removal, complete retinal reattachment, graft revascularization, and improvement in central fixation and best corrected visual acuity (bcva). these findings suggest that the transoperative use of subretinal pfcls could be a feasible alternative. pfcl - air - silicone exchange was our preferred technique, although direct pfcl - silicone oil exchange is another option. we believe that due to their high surface tension, a water meniscus is created in contact between pfcls with water and silicone oil that may contribute to retinal slippage during exchange. pfcl - perfused vitrectomy has also been performed for treatment of diabetic and rhegmatogenous retinal detachments with promising results.14 electroretinography (erg) was not altered and showed a trend toward improvement. in one patient, pfcl entered the subretinal space and was removed under air ; this complication did not seem to alter the visual outcome. en bloc perfluorodissection is a novel technique for treatment of tractional retinal detachment.15 this procedure is accomplished by injecting pfcl between the retina and the posterior hyaloid in order to separate tissue from the subjacent retina. the technique provides similar advantages as pfcl - perfused vitrectomy using considerably smaller amounts of pfcl. the technique described herein was employed in five eyes with chronic retinal detachment and subretinal pvr, and we encountered no deleterious effects. postoperatively, small residual perfluorocarbon bubbles were present in one eye under the midperipheral retina (patient 3) but visual acuity stabilized at 20/400 six weeks postoperatively and remained unchanged. in order to prevent this complication, we believe that subretinal pfcls should be removed using slow active aspiration under bss to take advantage of the surface tension of the pfcl bubble. although retained pfcls in the subretinal space seem to be toxic, we consider our technique a viable alternative to extensive manipulations in eyes with subretinal pvr in which the abnormal tissue has to be removed in order to reattach the retina. we do not recommend this technique in eyes with good visual potential or in cases in which subretinal pvr is localized and can be removed by other techniques. | proliferative vitreoretinopathy (pvr) is a frequent condition following complex retinal detachments or trauma, and subretinal pvr is a common cause of retinal redetachment. subretinal pvr removal is challenging and may require creating multiple or large retinotomies, making manipulation of the retina difficult and sometimes hazardous. we propose a novel surgical technique that may facilitate subretinal removal of pvr. after peripheral retinotomy of 180 degrees or greater, perfluorocarbon liquid (pfcl) is carefully introduced into the subretinal space as a single bubble which provides space to perform the maneuvers. the pfcl serves as a second hand which folds the retina over, thereby allowing better visualization for safer and easier subretinal pvr removal. pfcl in then removed by direct aspiration as a single bubble while still under balanced salt solution, taking advantage of its high surface tension which prevents leaving bubbles behind. the described technique allows adequate exposure of the subretinal space for proper dissection of difficult - to - reach subretinal pvr. we applied this technique in five patients with chronic retinal detachment, extensive subretinal pvr and poor visual potential. the utilization of subretinal pfcl can assist dissection of subretinal pvr and may be useful in eyes with complicated retinal detachment and poor visual prognosis. |
the improvement in exposure conditions in the swedish vinyl chloride producing industry is reported. the article comments on the technology and control methods by which the vinyl chloride concentration has been lowered to less than 1 ppm vinyl chloride. two epidemiological retrospective cohort studies are presently under way on workers in pvc - utilizing industries and in the rubber industry.imagesfigure 1.figure 2.figure 3. |
|
intraosseous carcinomas of the jaw bones are rare occurrences and arise as a consequence of transformation of epithelial remnants of odontogenic or salivary origin. in addition, they can also occur as secondary deposits from primary tumors elsewhere in the body. the rarity and the varied clinical course of odontogenic carcinomas have resulted in considerable confusion as evidenced by several changes in terminologies and classification over the years. carcinomas derived from ameloblastomas have been designated by a variety of terms, including malignant ameloblastoma, ameloblastic carcinoma, metastatic ameloblastoma and primary intra - alveolar carcinoma. the term malignant ameloblastoma is used for ameloblastomas that metastasize without any histological features of malignancy in both the primary and the metastatic foci and the term ameloblastic carcinoma for tumors with ameloblastomatous differentiation showing cytological features of malignancy with or without metastasis. the world health organization (who) classifications of odontogenic tumors of 1972 and 1992 do not refer to the term ameloblastic carcinoma. it was recognized as a separate entity by elzay, slootweg and miller, eversole, reichart and philipsen, and by the who in 2005 in its classification of odontogenic carcinomas [table 1 ]. world health organization (who ; 2005) classification of odontogenic carcinomas ameloblastic carcinomas are locally aggressive lesions showing rapid growth with or without pain, paresthesia and anesthesia, trismus and dysphonia. ameloblastic carcinomas have been reported with local recurrences and metastasis to sites like the lungs, brain, liver and bones. a 24-year - old male patient reported to our oral and maxillofacial surgical unit with a chief complaint of swelling in the lower jaw since 5 years. the swelling was slow growing and was not associated with any other symptoms like pain, anesthesia, or paresthesia. the patient presented with no significant medical or surgical history. on extra - oral examination, the swelling was seen extending about 6 cm from the midline of the lower jaw bilaterally and about 5 cm superoinferiorly from the line joining the commissures to the lower border of the chin. the skin over the swelling appeared stretched, especially in the midline, with no other changes [figure 1 ]. there was no local rise of temperature and the swelling was non - tender and hard in consistency. lymph node examination revealed enlarged bilateral submandibular nodes which were non - tender, soft in consistency and unattached to the overlying skin or underlying structures. clinical photograph showing extraoral swelling intraoral examination revealed a cauliflower - like sessile exophytic growth involving the lower alveolus and floor of the mouth extending from 36 to 45 with significant bicortical expansion about 5 cm in the anterior region. on palpation, the swelling was non - tender, the base was hard in consistency and the superior exophytic growth was soft to firm. hard tissue examination revealed 41, 42, 31 and 33 to be displaced anteriorly, 34 was seen floating on the superior surface of the swelling. tooth 32 was clinically missing. clinical photograph showing intraoral swelling involving lower alveolar ridge and floor of mouth based on the above findings, a working diagnosis of ameloblastoma was considered. odontogenic myxoma, ameloblastic fibroma, ameloblastic carcinoma, primary intraosseous carcinoma and metastatic malignancy were considered. the orthopantomograph (opg) revealed a multilocular radiolucency with scalloped borders extending from the distal aspect of the root of 37 to mesial aspect of the root of 48. mandibular occlusal radiograph showed significant buccal and lingual cortical plate expansion with buccal cortex erosion in the left anterior region. orthopantomograph showing multilocular radiolucency extending to the third molar region bilaterally a tentative radiographic diagnosis of ameloblastoma was considered based on the large multilocular appearance, significant buccolingual expansion and the changes seen in the surrounding structures. the incisional biopsy was obtained from the intraoral verrucous surface revealed odontogenic epithelium in the form of interconnecting strands and islands with peripheral bilayered columnar cells. the central regions of the strands were hypercellular with prominent squamous metaplasia and keratin pearl formation. pleomorphism, hyperchromasia and mitosis, about 2 per high power field (hpf), were evident in few foci. towards the surface, the epithelium showed severe pleomorphism and increased mitosis. based on the histopathological features, a diagnosis of ameloblastic carcinoma surgical excision of the lesion by segmental resection of the mandible along with level i lymph node was planned. an incision was placed from right to left angle of mandible and lip was split with a midline incision. defect area was reconstructed using a double angled reconstruction plate and covered with pectoralis major myocutaneous flap. mandibular resection specimen with posterior extension upto the distal aspect of third molar bilaterally along with level i lymph nodes were received for histopathologic examination. gross examination of the specimen revealed brownish white swelling with whitish cauliflower like exophytic growth in the anterosuperior surface. cut surface revealed grayish - white solid lesion with three macrocystic spaces [figure 4 ]. tissues for histopathologic examination were taken from multiple areas including all the surfaces, area of perforation, solid and the cystic areas. level i lymph nodes including sub - mental and right and left submandibular lymph nodes numbering ten that were soft to firm in consistency were harvested. (a) photograph showing the resected specimen.(b) cut surface of the specimen showing macrocystic spaces the findings of the excisional biopsy from the tumor proper were similar to the incisional biopsy. in addition, tissues from the area of perforation and the exophytic superior surface showed irregular papillary surfaced parakeratinized stratified squamous epithelium continuous with underlying interconnecting strands of odontogenic epithelium. the cells within the strands in these regions showed prominent pleomorphism, hyperchromasia, mitosis about 5 - 6/hpf, individual cell keratinization and keratin pearl formation [figures 58 ]. (h&e 40) photomicrograph depicting pleomorphism and hyperchromasia in the ameloblastomatous foci (h&e 400) photomicrograph depicting pleomorphism and nuclear atypia and mitotic activity in the ameloblastomatous foci (h&e 400) photomicrograph showing increased and abnormal mitotic figures (h&e 1000) the surgical margins were negative for tumor infiltration and all the lymph nodes were negative for tumor metastasis and showed reactive hyperplasia. one of the earliest comprehensive reviews on ameloblastic carcinomas was performed by slootweg and muller in 1984, who reviewed 42 cases and reported two of their own. in a review of 319 odontogenic tumors in nigerian hospital by ladiende., malignant tumors constituted only 3.4%. in an analysis of 1,642 cases of odontogenic tumors in the chinese population, the incidence of ameloblastic carcinoma is highest in africa followed by china and with lesser number of cases in europe and the america 's. retrospective analysis of ameloblastic carcinoma in the english literature was performed on pubmed and a total of 138 cases including the present case were considered for review. only cases with adequate clinicopathological information were included. data were computed using a personal computer (pc) and statistical package for the social sciences (spss) 10.0 software program. a total of 91 cases occurred in the males and 47 in females with a male : female ratio of 1.9:1. age of presentation ranged from 4 to 91 years with most cases occurring in the 5 and 7 decades followed by the 3 decade. spindle cell variants occur in age range of 20 - 75 years with a male : female ratio of 5:3. the tumor occurred in the mandible with 90 cases followed by 45 cases in the maxilla with a ratio of 2:1. in both the maxilla and the mandible, data available from 100 cases regarding age of occurrence in the jaws revealed an average age of 42.9 for the mandible and a higher average age of 50 for the maxilla. cases have been reported to involve the anterior skull base, maxillary sinus, gingiva and the temporomandibular joint. swelling and pain are most commonly seen followed by ulceration, rapid growth and trismus. other features seen in ameloblastic carcinoma include teeth mobility asymmetry, cortical plate perforation and paresthesia. a total of 80 cases including the present case had a history of follow - up, of which the 27 cases that exhibited metastasis, 19 arose from the mandible and 8 from the maxilla. metastases were to the lungs (8 cases), lymph node (5 cases), bone (4 cases), brain (2 cases) and multiple bone involvement (8 cases). radiographically, it is similar to solid / multicystic ameloblastoma and appears usually as an ill - defined radiolucent lesion, either unilocular or multilocular. slight marginal scleroses without periosteal new bone formation, loss of lamina dura, resorption of the tooth apex and tooth displacement are also noted. advanced diagnostic imaging methods like the computed tomography (ct) and magnetic resonance imaging (mri) have been used and demonstrate extraosteal extension, perineural invasion and cortical and root resorption. pre and postoperative positron emission tomography (pet)-ct and fludeoxyglucose (fdg)-pet have been suggested for staging, diagnosis of metastasis and treatment surveillance. the central regions, unlike in ameloblastoma, is less orderly, being condensed and hypercellular with stellate reticulum - like structures being absent in most cases. a spindled cell variant has also been described wherein the central cells are spindle shaped simulating a low grade sarcoma. hallmarks of malignancy seen in ameloblastic carcinoma included nuclear pleomorphism, hyperchromatism, abnormal nuclear - cytoplasmic ratio, atypical mitosis and an increase in the number of mitosis. the number of mitosis can range from 2 - 8/high - power field (hpf). other features seen reflecting the malignant process are tumor necrosis, vascular and neural invasion. ghost cells, clear cells, calcifications, individual cell keratinisation, keratin pearl formation and melanin have also been reported in ameloblastic carcinomas. the stroma is usually fibrous, inflamed with areas of hemorrhage and hemosiderin. in our case, cellular and nuclear pleomorphisms were increased and atypical mitosis was evident. in the fine needle aspiration cytology (fnac), presence of stellate cells, palisaded basaloid cells, along with cellular and nuclear atypia are indicative ameloblastic carcinoma. malignancies of odontogenic origin arise from dental embryonic residues, either involving dental epithelium - odontogenic carcinomas or dental connective tissue - odontogenic sarcomas and occur in the jaws or gingiva. reported a case of peripheral ameloblastic carcinoma in a 71-year - old male and considered it to the product of proliferation and transformation basal cells of gingival epithelium. most ameloblastic carcinomas occur de novo as lesions with histologic features of ameloblastomas with less - differentiated areas, however they can also arise from pre - existing ameloblastomas with subsequent de - differentiation secondary to surgical and ionising therapies. such cases may be distinguished by presence of transitional areas of malignancy adjoining benign ameloblastomatous areas. malignant odontogenic tumors show up - regulation of genes coronin, myd 88 (myeloid differentiation primary response) and downregulation of stk19 (serine / threonine kinase), rfp (red fluorescent protein) and txk (tyrosine kinase). reported that the rate of allelic loss in a study involving chromosomes 1p, 3p, 9p, 10q and 17p in ameloblastic carcinomas are similar to those in benign tumors indicating that different genetic mechanisms may be responsible in malignant behavior. immunohistochemical studies have indicated differential expression of markers between ameloblastoma and ameloblastic carcinoma [table 2 ]. immunohistochemical profiles of ameloblastoma and ameloblastic carcinoma fewer apoptotic reactions have been found to occur in malignant ameloblastic tumors as compared to ameloblastomas. mitochondrial apoptosis signalling molecules aif (apotosis inducing factor), which has been implicated in lung carcinoma, has been considered to play a role in malignant transformation in ameloblastomas. changes in the bh3-only proteins, which are responsible for apoptosis in odontogenic tissues can lead to formation of tumors. malignant transformation in ameloblastic tumors may also be due to altered pd - ecgf tp (platelet - derived endothelial cell growth factor / thymidine phosphorylase) expression. abiko y. concluded that hyper methylation of p16 gene was involved in the malignant transformation of pre - existing benign ameloblastoma to an ameloblastic carcinoma. ameloblastic carcinomas also have revealed strong positivity for bcl-2, cytokeratin 's 5, 14, 18 and negativity for cytokeratin 7. strong expression of cam 5, 6, ae1 and ae3 and ki-67/mib-1 has also been seen in ameloblastic carcinoma. histopathological differential diagnosis includes primary intraosseous carcinoma, basaloid squamous cell carcinoma, mucoepidermoid carcinoma, acanthomatous ameloblastoma, keratoameloblastoma, calcifying epithelial odontogenic tumor, squamous odontogenic tumor and carcinomas and tumors metastasising to the jaws from sites such as the lung, breast or the gastrointestinal tract. with a common progenitor in the odontogenic remnants, primary intraosseous carcinoma (pioc) has been considered to be a closely related, less differentiated, usually non - keratinising form of ameloblastic carcinoma. giving credence to the squamous differentiation and lack of ameloblastomatous components, the who in 2005 separated pioc from ameloblastic carcinoma and renamed it primary intraosseous squamous cell carcinoma (pioscc) squamous cell carcinoma arising in odontogenic cysts can also pose diagnostic difficulties, but histologically resembles oral squamous cell carcinoma more than ameloblastic carcinoma. basaloid squamous cell carcinoma (bsc) histopathologically has features similar to ameloblastic carcinoma, including tumor cells with peripheral palisading, central lobular necrosis and microcystic spaces with deposition of basement membrane material. pas positivity in the microcystic spaces of bsc help differentiate it from ameloblastic carcinoma among other tumors. the low as well as high grade mucoepidermoid carcinomas have a destructive growth pattern and may exhibit metastasis. the squamous differentiation and mucicarmine positivity help to differentiate the mucoepidermoid carcinoma from the ameloblastic carcinoma. though the presence of ameloblastic structures and keratinisation in acanthomatous ameloblastoma and keratoameloblastomas is similar to ameloblastic carcinoma, these lesions however do not present with the cytologic features of malignancy that is characteristic of ameloblastic carcinoma. squamous odontogenic tumor must be considered in the differential diagnosis due to similarities with ameloblastic carcinoma. the features seen in both include tumor islands with lack of stellate reticulum and peripheral palisading, occasional presence of microcystic spaces and calcification a differential diagnosis for spindle cell ameloblastic carcinomas should include sarcomas, odontogenic sarcoma and ameloblastic carcinosarcoma. spindle cell areas, in the spindle cell variant are negative for vimentin, desmin, actin, factor viii and positive for cytokeratin. in view of the aggressive clinical behavior and local recurrences wide surgical resection with 2 - 3 cm of bony margins recurrence rates can be as high as 92.3% when conservative line of treatment is instituted. resection in cases occurring in the maxilla may be complicated due to rapid growth and extension into sinuses, orbit and other vital areas nearby. an exhaustive assessment of the resected specimen is indicated to rule out ameloblastic carcinoma arising in a prexisting ameloblastoma. clear cell ameloblastic carcinomas have higher recurrence rates (62.5%) than nonclear cell groups (33%) and therefore require aggressive treatment protocols. assessment of lymph node metastasis is mandatory and neck dissection indicated for both prophylactic and therapeutic considerations. while surgical resection remains the mainstay, radiotherapy and chemotherapy have been utilised in different treatment protocols, as an adjuvant, as a method for tumor size reduction prior to surgery and also for tumors that are too advanced and not conducive for surgery. the use of radiotherapy in a primary role may not be useful as reported by hall. in an assessment of 14 cases, which all went into recurrence. extensive lesions that require mutilating surgery, or in patient unfit or unwilling for surgery and in cases of relapse, carbon ion therapy may be considered. post - operative reconstruction may need to be delayed to account for the extreme rapid rates of recurrence, which in cases may be upto two years. maxillary ameloblastic carcinomas have poorer prognosis as do tumors in which both primary and metastatic foci are dedifferentiated. the present case has had a follow up for the past one year and no recurrences have been reported. periodic reassessment with a follow - up period of at least 10 years is mandatory. due to the paucity of cases of ameloblastic carcinoma, there is a need for reporting and long term evaluation of cases with detailed clinico - pathological correlation to differentiate it from other more commonly occurring tumors, especially ameloblastoma and to formulate treatment protocols. an exhaustive histopathologic examination of resected ameloblastomas is mandatory to rule out the presence any malignant transformation. | ameloblastic carcinoma is a rare malignant odontogenic neoplasm that can arise either as a de novo lesion or from pre - existing ameloblastoma. histopathologically, the tumor retains an ameloblastomatous differentiation pattern but shows cytological features of malignancy. owing to variable biologic behavior and paucity of long - term follow - up cases, there has been no clear consensus on treatment protocol. the present case of ameloblastic carcinoma arose in the mandible of a 24-year - old male. surgical treatment involved resection of the mandible along with regional lymph nodes. the patient has been on follow up for the past one year without any recurrence or metastases. an update on ameloblastic carcinoma encompassing the histogenesis, immunohistochemical features and treatment aspects are included. |
the 1990 clean air act mandated oxygenation of gasoline in regions where carbon monoxide standards were not met. to achieve this standard, methyl tertiary butyl ether (mtbe) was increased to 15% by volume during winter months in many locations. subsequent to the increase of mtbe in gasoline, commuters reported increases in symptoms such as headache, nausea, and eye, nose, and throat irritation. the present study compared 12 individuals selected based on self - report of symptoms (self - reported sensitives ; srss) associated with mtbe to 19 controls without self - reported sensitivities. in a double - blind, repeated measures, controlled exposure, subjects were exposed for 15 min to clean air, gasoline, gasoline with 11% mtbe, and gasoline with 15% mtbe. symptoms, odor ratings, neurobehavioral performance on a task of driving simulation, and psychophysiologic responses (heart and respiration rate, end - tidal co(2), finger pulse volume, electromyograph, finger temperature) were measured before, during, and immediately after exposure. relative to controls, srss reported significantly more total symptoms when exposed to gasoline with 15% mtbe than when exposed to gasoline with 11% mtbe or to clean air. however, these differences in symptoms were not accompanied by significant differences in neurobehavioral performance or psychophysiologic responses. no significant differences in symptoms or neurobehavioral or psychophysiologic responses were observed when exposure to gasoline with 11% mtbe was compared to clean air or to gasoline. thus, the present study, although showing increased total symptoms among srss when exposed to gasoline with 15% mtbe, did not support a dose - response relationship for mtbe exposure nor the symptom specificity associated with mtbe in epidemiologic studies.imagesfigure 1figure 2 |
|
many microorganisms express molecules that can bind immunoglobulins independently of the antigen specificity of the antibodies. a prominent example is the antibody - binding proteins found in the cell wall of the bacterium staphylococcus aureus (1, 2). these proteins have high affinities for the conserved elements in the fc and fab parts of various antibody classes, and they appear to serve an immunoevasive function, as binding of antibodies to these proteins interferes with phagocytosis of antibody - opsonized bacteria (3). some erythrocytes infected by the malaria parasite plasmodium falciparum bind igm, but not igg, independently of the specificity of the antibodies (4, 5). this fc - mediated binding of igm has been described for infected erythrocytes (ies) that bind to the sulfated glycosaminoglycan chondroitin sulfate a (csa) (5) and for ies capable of forming rosettes (several uninfected erythrocytes adhering to a central ie) (4). both ie phenotypes are related to expression of particular types of p. falciparum erythrocyte membrane protein 1 (pfemp1). thus, adhesion of ies to csa requires expression of the atypical pfemp1 type var2csa, which has nanomolar affinity for csa and is responsible for placental ie sequestration (69). rosetting can be mediated by several different pfemp1 proteins that have a semiconserved n - terminal head structure made up of certain subtypes of duffy binding - like (dbl)cysteine - rich interdomain region / (cidr/) domains (1013), and it appears to depend mainly on relatively low - affinity interactions with a range of host carbohydrates (1417). the function of fc - dependent binding of igm to p. falciparum ies is not fully understood (reviewed in reference 18). in the case of var2csa - type pfemp1, it appears to be mainly immunoevasive, as it can protect ies from specific igg recognition and immune destruction without compromising the csa - adhesive function of the antigen (19). however, such masking is ineffective in the case of rosette - mediating pfemp1 antigens (15), where binding of igm to pfemp1in combination with other serum factors seems to function to increase the low - affinity adhesive interactions involved in rosetting (15, 20). given the apparent clinical importance of igm binding (4, 21), it is of interest to know how many igm - binding pfemp1 variants exist within the pfemp1 repertoire of a single p. falciparum clone and how igm binding is related to the structural and functional characteristics of the involved pfemp1 proteins. we therefore set out to identify igm - binding pfemp1 proteins in p. falciparum nf54. we show that the genes for at least five igm - binding pfemp1 variants exist in the genome of this parasite. in addition to pfl0030c, which is the var2csa - type antigen in p. falciparum nf54, we found four others (pfl0020w, pf07_0139, mal6p1.4, and mal6p1.316). surprisingly, these did not mediate rosetting in functional assays and do not possess structural features indicative of being rosette mediating. our study shows that fc - mediated binding of igm to pfemp1 proteins is not limited to those that can adhere to csa or mediate formation of rosettes. recombinant proteins representing full - length pfl0030c and single- and triple - domain constructs of mal6p1.4, mal6p1.316, pfl0020w, and pfl0030c were produced in a baculovirus expression system, essentially as described previously (15, 22). the domain nomenclature proposed by rask. in 2010 antisera against mal6p1.4, mal6p1.316, and pfl0020w were raised in rats (24), and the human monoclonal antibody pam1.4, specific for several var2csa - type pfemp1 proteins, including pfl0030c, was generated as described elsewhere (25, 26). nonimmune igm binding to recombinant pfemp1 constructs was quantified by enzyme - linked immunosorbent assay (elisa) as described previously (15). p. falciparum nf54 parasites (27) were grown in vitro in o rh erythrocytes at 37c in a controlled atmosphere, using complete culture medium (rpmi 1640 supplemented with 0.5% albumax ii [life technologies bv, nrum, denmark ]), essentially as described previously (28). the p. falciparum nf54-derived and pvbh - transfected clone g6 was generated as described elsewhere (2931). it was maintained in the same way as the parental strain p. falciparum nf54, except that blasticidin (10 mg / ml ; life technologies) was added to shut down transcription of endogenous var genes and to erase the epigenetic memory. ies were selected for surface expression of defined pfemp1 proteins by immunomagnetic selection using (i) pfemp1-specific rat antisera followed by biotinylated anti - rat antibody (dako) and streptavidin - coupled dynabeads (fisher scientific) or (ii) pam1.4 followed by protein a - coupled dynabeads (fisher scientific), essentially as described previously (32). for selection of igm - binding ies, we used human igm (sigma) coupled to m-450 epoxy beads (life technologies) according to the manufacturers ' instructions. the genotypic identity of the parasites and the absence of mycoplasma contamination were verified regularly as described previously (33). for analysis of var gene transcription by quantitative real - time pcr, we used cdna generated from ring - stage parasite rna and p. falciparum 3d7 var gene - specific primers as described in detail elsewhere (6, 34, 35). transcription levels relative to those of the seryl - trna synthetase housekeeping gene were calculated by the 2 method. the binding of nonimmune igm and pfemp1-specific antibody to ies was quantified by flow cytometry, essentially as described previously (19). in brief, we used magnetically activated cell sorting (macs) to purify late - stage ies, labeled with ethidium bromide (10 mg / ml), serial dilutions of human igm, and secondary antibody. igm (100 nm) was preincubated (20 min, room temperature) with equimolar concentrations of mouse monoclonal antibodies specific for human fc2 (hb57), fc3 (5d7), or fc4 (1g6) (all described in reference 36) or mouse control igg (sigma). the purification of late - stage ies by macs was assessed by ethidium bromide staining as described above, and ie surface expression of the expected pfemp1 protein was verified by labeling with pfemp1-specific antisera or human monoclonal antibody. all list - mode data files were analyzed using winlist 6.0 (verity, topsham, me). p. falciparum g6 grown under blasticidin pressure to erase the epigenetic memory of var gene transcription was released from the selection pressure for 2 weeks to obtain a population with highly heterogeneous var gene transcription, as described previously (31). macs - purified late - stage ies were labeled with human igm (10 nm, 30 min, 4c), washed thrice in sterile phosphate - buffered saline (pbs) supplemented with fetal bovine serum (2%), stained with phycoerythrin - conjugated donkey anti - human igm (jackson immunoresearch, newmarket, united kingdom) (1:200, 30 min, 4c), and washed thrice as described above. an aria - ii fluorescence - activated cell sorter (bd biosciences, san jose, ca) was used to single - cell sort igm - positive ies into round - bottomed 96-well plates (thermo fisher scientific, roskilde, denmark) containing complete culture medium (200 l / well) and uninfected erythrocytes (2 l / well). the 96-well plates were incubated for 2 weeks (37c, 5% co2), with a change of medium thrice weekly and addition of uninfected erythrocytes (2 l / well) twice weekly. small aliquots of ies were stained with ethidium bromide (2 g / ml), igm (10 nm), and fluorescein isothiocyanate - conjugated anti - human igm (sigma ; 1:150) and used to assess parasite growth and igm binding by flow cytometry, using a beckman coulter fc500 instrument (beckman coulter, fullerton, ca). clones with igm - positive ies were transferred and expanded further in tissue culture flasks. adhesion of ies to csa - expressing bewo cells was determined essentially as described previously (37). in brief, ring - stage ies were labeled with [h]hypoxanthine for 24 h. bewo cells (lgc promochem, bors, sweden) were grown to confluence in flat - bottomed 96-well plates (thermo fisher scientific, denmark) and blocked with bovine serum albumin (5% in pbs, 1 h). macs - purified [h]hypoxanthine - labeled late - stage ies (2 10 ies / well) were added and incubated (37c, 1 h). unbound ies were washed off by use of a biomek 2000 automated plate washer (beckman coulter). after washing, macs - purified [h]hypoxanthine - labeled late - stage ies (2 10 ies / well) were added to three empty wells as a measure of maximal binding. the ies were harvested onto optiplate-96 filters (perkinelmer, waltham, ma), microscint40 scintillation liquid (perkinelmer ; 50 l / well) was added, and [h]hypoxanthine incorporation was determined on a topcount nxt scintillation counter (perkinelmer). ring - stage ies were incubated overnight (37c, 5% co2) in rpmi 1640 supplemented with either nonimmune human serum (10%) or albumax ii (0.5%). after labeling of parasites with ethidium bromide (25 g / ml), rosetting frequencies were assessed by counting 200 ethidium bromide - stained ies, using wet - slide preparations and fluorescence microscopy. phagocytosis of antibody - opsonized ies was measured as described previously (38). in brief, macs - purified late - stage ies were stained with ethidium bromide (100 g / ml, 10 min, room temperature), washed twice in rpmi supplemented with 2% fetal bovine serum, labeled with either human igm or human iga (50 nm), and opsonized with pooled plasma pools from nonexposed or p. falciparum - exposed adults (1:10, 30 min, room temperature). after washing as described above, the ies were incubated in 4-ml tubes (30 min, 37c, 5% co2) with cells of the human monocytic leukemia line thp-1 (tib-202 ; lgc standards, bors, sweden) at a 20:1 ratio. following lysis of remaining free ies (15 mm nh4cl, 10 mm nahco3,1 mm edta), the proportion of ethidium bromide - positive thp-1 cells was determined by flow cytometry using an fc500 instrument (beckman coulter). we used a biacore 2000 instrument (ge healthcare, hillerd, denmark) to measure the affinity of igm for recombinant pfemp1 constructs by surface plasmon resonance analysis as described previously (15). following gel filtration, the recombinant pfemp1 domain constructs (50 ml / min for 60 s), followed by buffer (120 s), were flowed over igm (750 relative units) immobilized on a cm4 biosensor chip (ge healthcare) by amine coupling. after each run, the chip was regenerated with 20 mm naoh. all experiments were performed in hepes buffer (0.01 m hepes, 0.15 m nacl, 3 mm edta, 0.005% [vol / vol ] surfactant p20, ph 7.4, 20c). the specific binding response to igm was calculated by subtracting the response to an uncoupled chip and to buffer injection. the kinetic sensorgrams were fitted to a global 1:1 interaction model to allow calculation of the ka, kd (dissociation constant), and kd (equilibrium dissociation constant) values, using biaevaluation software v. 4.1 (ge healthcare). one - way analysis of variance followed by holm - sidak multiple pairwise comparisons was used to evaluate the capacity of fc-specific antibodies to inhibit binding of igm to ies, and student 's t test was used to evaluate the ability of igm and iga to inhibit phagocytosis of igg - opsonized ies. we used the p. falciparum nf54-derived clone g6 to identify igm - binding pfemp1 proteins. this clone, which is transfected with a pvbh plasmid containing a blasticidin resistance gene controlled by a var promoter, initially transcribed the var gene pfd1015c (31). culturing this parasite under high blasticidin selection pressure results in a complete shutdown of endogenous var transcription and erasure of epigenetic memory, and removal of drug pressure we labeled ies with igm and single - cell sorted igm - positive ies into 96-well plates. after in vitro expansion for 3 weeks, we had 19 growing cultures originating from individual single - cell - sorted ies. var gene transcription was assessed in all lines containing igm - positive ies (eight from subclones and two from the 50-cell control sublines). each of the subclones transcribed multiple var genes as a result of shifts in var transcription during the period of in vitro expansion (fig. nevertheless, all but one subclone (g6.2.5) and one 50-cell subline (g6.1.13) showed dominant expression of a single var gene. one subclone (g6.3.16) and one 50-cell subline (g6.1.14) mainly transcribed pfl0030c. four clones (g6.1.57, g6.2.20, g6.2.56, and g6.2.79) mainly transcribed pfl0020w, two (g6.3.40 and g6.3.76) predominantly transcribed pf07_0139, and both the 50-cell sublines showed prominent transcription of mal6p1.316. the relative transcription levels of the identified candidate var genes were reflected in the proportions of erythrocytes infected by the subclones and sublines that bound igm (fig. (a) distributions of var transcripts in progenies of single - cell - sorted subclones and 50-cell - sorted sublines (g6.1.13 and g6.1.14) of igm - positive p. falciparum g6 following 3 weeks of expansion in vitro. the groups identified are group a (gray), group b / a (orange), group b (blue), group b / c (green), group c (red), and var2csa (white). the major transcripts are identified by name, and all candidate genes selected are shown as exploded pie slices. the percentage of corresponding ies binding igm is indicated in parentheses below the pie for each subclone. (b) domain structures of the pfemp1 proteins encoded by major var gene transcripts in these subclones and sublines. the orientation and domain numbers are indicated in italics along the top of the panel. the pfemp1 protein encoded by the pfl0030c var gene in p. falciparum nf54 is the csa - adhering var2csa - type protein pfl0030c (6, 7). this protein is known to bind igm via fc (19, 39), and several dbl domains have been implicated in this binding (39, 40). only the three c - terminal dbl domains in pfl0030c are of a type (dbl) that is also found in non - var2csa - type pfemp1 proteins. all the non - var2csa - type candidate igm - binding pfemp1 proteins we identified above contained c - terminal dbl domains (fig. however, we recently mapped the fc-binding domain in the rosetting pfemp1 protein hb3var06 to its c - terminal dbl_8 domain, and two of our candidate var transcripts (pfl0020w and mal6p1.316) additionally contain a dbl domain each (fig. together, these data point to c - terminal dbl and dbl domains as being relevant for fc - mediated igm binding. to verify the predicted igm - binding capacity of our candidate pfemp1 proteins, we next subjected previously unselected p. falciparum nf54 parasites to repeated selection with either the var2csa - specific monoclonal antibody pam1.4 or rat antisera to pfl0020w and mal6p1.316. in addition, we selected ies by using a rat antiserum to the pfemp1 protein mal6p1.4, because two of our subclones (g.6.256 and g6.2.79) showed prominent transcription of mal6p1.4 (fig. we did not have an antiserum specific for pf07_0139 and instead subjected subclone g6.3.40 to repeated rounds of selection for igm binding. as a negative control, we used p. falciparum nf54 selected by an antiserum specific for the intercellular adhesion molecule 1 (icam-1)-binding pfemp1 protein pfd1235w (33, 41). these selection protocols all resulted in parasites with dominant transcription of the expected var gene (fig. 2a), and all the selected ies bound igm to various degrees, except for the ies selected for expression of pfd1235w (fig. 2b and c). (a) distributions of var transcripts in p. falciparum nf54 following antibody selection for ie surface expression of mal6p1.4, pfl0030c, mal6p1.316, pfl0020w, and pf07_0139. the color coding and layout are as described in the legend to fig. 1. (b) titration of igm binding to erythrocytes infected by the corresponding subclones and sublines. means (symbols) and standard deviations (error bars) for triplicate measurements are shown. (c) histograms showing representative flow cytometry data on all selected parasite cultures, with (orange / white / blue) or without (gray) igm. we previously showed that the c3-c4 domains of igm bind to var2csa - type pfemp1 (19) and to the rosetting pfemp1 hb3var06 (15). we therefore measured the ability of monoclonal antibodies specifically recognizing the c2, c3, and c4 domains of human igm to interfere with igm binding to ies expressing each of the igm - binding pfemp1 proteins studied here. in each case, all three fc-specific antibodies significantly (p < 0.001 in all cases) reduced the binding of igm to the ies (fig. 3), although the c2-specific antibody was less effective than the other two antibodies at inhibiting igm binding to the var2csa - type pfl0030c protein, in accordance with previous findings (19). (a) involvement of fc domains in the binding of igm to pfemp1 as determined by the interference of monoclonal antibodies to various fc domains (c1, c2, and c3) with igm binding to selected pfemp1 proteins. overall means (histograms) and standard deviations (error bars) for three independent experiments are shown. statistically significant differences (p < 0.001) relative to the negative controls (mouse igg) are indicated by asterisks. each histogram shows an overlay of no igm (gray) and igm with anti - igm or control mouse antibodies (white). multiple domains have been implicated in fc - dependent binding of igm to pfemp1 (15, 39, 40, 42, 43). we recently used multiple recombinant single- and multi - dbl - domain constructs to map this type of igm binding to the penultimate c - terminal dbl (dbl_8) domain in the rosette - mediating pfemp1 hb3var06 (15). taking a similar approach here, we used elisa to identify the domains involved in igm binding, employing an array of recombinant proteins representing single and triple domains of pfl0030c, pfl0020w, mal6p1.4, and mal6p1.316, as well as a construct representing the full ectodomain of pfl0030c (see fig. 1b for an overview of the recombinant antigen constructs used). with this approach, we unequivocally identified dblpam5 as the igm - binding domain in the var2csa - type pfl0030c protein (fig. this is the penultimate c - terminal dbl domain in that protein and was the most prominent igm - binding domain in an earlier study of var2csa - type pfemp1 (39). similarly, we mapped the igm - binding capacity of pfl0020w and mal6p1.4 to their c - terminal domains (dbl4_6 and dbl3_9, respectively) (fig. we were unable to map the igm - binding domain of mal6p1.316 with our recombinant constructs. the graphs show the ability of domains in var2csa - type (a) and non - var2csa - type (b) pfemp1 proteins to bind igm (white) and iga (black). means (histograms) and standard deviations (error bars) for triplicate measurements from a representative experiment (of three) are shown. we used surface plasmon resonance analysis to show that the binding affinity of igm for each of the domains identified to bind igm by elisa was high, with kd values in the nanomolar range (table 1), which is the same range as that reported previously (15). triple - domain constructs had higher affinities (lower kd values) than single - domain constructs, which may be related to the construct conformation but likely also reflects the fact that two igm - binding domains (dbl2_7 and dbl4_9) were present in our mal6p1.4 triple - domain construct (fig. 4 and table 1). surface plasmon resonance analysis of igm binding to recombinant pfemp1 domains na, not available because the domain did not bind igm. the kd values were calculated based on a 1:1 binding model from 3 to 6 independent analyses, with 4 to 8 different concentrations tested in duplicates per analysis, and the values are shown with composite standard deviations. all constructs displayed rapid association kinetics, with ka values of 1 10 to 10 10 m s. the dissociation kinetics were more variable but were slower for the triple - domain constructs than the corresponding single - domain constructs, suggesting that the higher - order conformation of the pfemp1 proteins contributes to retention of igm once it is bound. fc - dependent igm binding to pfemp1 has previously been shown for parasites expressing csa - adherent var2csa - type or rosette - mediating pfemp1 variants (reviewed in reference 18). we therefore tested the abilities of erythrocytes infected by p. falciparum expressing either pfl0030c or each of the four new non - var2csa - type pfemp1 proteins to bind to csa and to form rosettes. we included parasites expressing the pfemp1 protein hb3var06 as a positive control in the rosetting assays, as this pfemp1 is known to mediate igm - dependent rosette formation (15). ies expressing the var2csa - type pfl0030c protein adhered strongly to csa - expressing bewo cells, in accordance with previous reports (6, 37), while none of the other pfemp1 proteins mediated significant adhesion to this receptor (fig. none of the five igm - binding pfemp1 proteins studied here was able to mediate formation of rosettes (fig. we previously reported that hb3var06-mediated rosetting requires soluble serum factors (15, 20), but serum did not lead to rosetting in ies expressing any of our new igm - binding pfemp1 proteins (fig. 5b). functional properties of erythrocytes infected by p. falciparum parasites expressing defined pfemp1. the graphs show the ability of ie surface - expressed pfemp1 proteins to mediate adhesion to csa on bewo cells (a) or to mediate rosetting (b) in the presence (white) or absence (black) of serum. means (bars) and standard deviations (error bars) for triplicate measurements from a representative experiment (of three) are shown. fc - dependent igm binding to var2csa - type pfemp1 markedly inhibits the binding of specific igg to the ie surface and subsequent phagocytosis of opsonized ies (19). however, this is not the case for parasites expressing the rosette - mediating hb3var06 protein, as igm binding has a limited effect on the phagocytosis of antibody - opsonized ies (15). to test whether igm could inhibit binding of pfemp1-specific igg to ies positive for each of the new igm - binding pfemp1 proteins identified here, we opsonized the ies with immune human plasma in the absence or presence of igm and subsequently measured phagocytosis by using a robust in vitro assay (38). phagocytosis of ies expressing the var2csa - type pfl0030c protein was markedly (about two - thirds) and significantly reduced in the presence of igm, in accordance with previous data (19) (fig.. a smaller or nonsignificant impact of igm on igg - dependent phagocytosis was seen for each of the other pfemp1 proteins (fig., they therefore resembled the rosette - mediating pfemp1 hb3var06 (15), although none of them appear to be involved in rosetting (fig. the graph shows the ability of igm (white) and iga (black) to interfere with igg - specific opsonization and phagocytosis of erythrocytes infected by p. falciparum parasites expressing defined pfemp1. overall means (bars) and standard deviations (error bars) for three independent experiments are shown., significant differences between the two bars. the particular virulence of p. falciparum parasites is related to their ability to express members of the clonally variant protein family pfemp1 on the surfaces of the erythrocytes they infect (reviewed in reference 44). the pfemp1 proteins mediate adhesion of ies to different host receptors in various tissues to avoid ie destruction in the spleen (45). each parasite genome contains about 60 pfemp1-encoding var genes that are transcribed in a mutually exclusive manner (4648). thus, normally only one pfemp1 is expressed on the ie surface at any given time, but the parasites can switch transcription among the different var genes from one asexual 48-h multiplication cycle to the next, thereby changing the adhesive and antigenic properties of the ies (46, 47). by now, it is clear that certain structurally defined and functionally related pfemp1 subfamilies are involved in particular types of severe malaria (reviewed in reference 49). the role of endothelial protein c receptor (epcr)-adhering pfemp1 proteins sharing domain cassette 8 (dc8) and dc13 motifs (50, 51) in the pathogenesis of cerebral malaria is a recent example. the similar role of dc4-containing pfemp1 proteins adhering to icam-1 is another (33). finally, var2csa - type pfemp1 proteins adhering to csa have a well - established key role in the pathogenesis of placental malaria (reviewed in reference 52). the tissue - specific adhesion mediated by these types of pfemp1 it is much less obvious why the ability of some pfemp1 proteins to bind igm via fc should be linked to malaria severity, as has repeatedly been shown (reviewed in reference 18). several pfemp1 domains have been implicated in igm binding (15, 36, 39, 40, 42, 43), but a unifying picture has not yet emerged. furthermore, it is unclear whether fc - specific binding of igm to ies is restricted to parasites expressing pfemp1 proteins that can adhere to csa or lead to the formation of rosettes. finally, it is not known how many pfemp1 proteins encoded by any single p. falciparum genome possess this phenotype. individual p. falciparum parasites transcribe only a single var gene at a time, and this mutually exclusive transcription ensures that normally only a single pfemp1 variant is present on the surface of any given ie (5355). even at the population level, the diversity of pfemp1 expression is often limited due to the presence of epigenetic memory (reviewed in references 56 and 57). to overcome this difficulty, we selected pvbh - transfected p. falciparum g6 clonal parasites for resistance to blasticidin, which effectively erases the epigenetic var gene transcription memory (2931). following induction of var switching, we single - cell sorted ies from this population based on their capacity to bind igm at the ie surface, and we obtained subclones and sublines with dominant transcription of four different var genes (fig. one was pfl0030c (6), which encodes the var2csa - type pfemp1 in the p. falciparum 3d7 clone (from which the g6 clone is derived) and was already known to bind igm via fc (19, 39, 40). the other three (mal6p1.316, pfl0020w, and pf070139) encode pfemp1 proteins not previously reported to bind igm. however, all contain at least one dbl-type domain, similar to the c - terminal domains previously implicated in the igm - binding capacity of var2csa - type pfemp1 (39, 40). finally, the var gene mal6p1.4, which encodes a pfemp1 with three c - terminal dbl domains in tandem, was also prominently transcribed in several subclones / sublines. two of the genes (pf0020w and mal6p1.316) additionally encode a c - terminal dbl domain. this further reinforced their candidature, as we recently mapped fc-specific binding of igm to a domain of that type (15). the fc - specific binding of igm to pfemp1 proteins has consistently been shown to involve the c3-c4 domains in the fc part of pentameric igm. thus far, at least three of the dbl domains in var2csa - type pfemp1 (dblpam2_2, dblpam5_6, and dblpam10_7) have been implicated (39, 40). we resolved this uncertainty by using recombinant constructs of each of the dbl domains in pfl0030c to map the igm - binding site to the penultimate n - terminal domain dblpam5_6 (fig. similar confusion has existed with respect to igm binding to non - var2csa - type pfemp1 proteins, in which n - terminal cysteine - rich interdomain region (cidr), central dbl, and c - terminal dbl domains have all been implicated (15, 42, 43). we found that dbl domains near the c terminus were responsible for mediating binding to igm in the pfemp1 proteins studied here. one of them (mal6p1.4) even contained two igm - binding domains (dbl2_7 and dbl3_9), something which has not been observed previously. overall, presently available evidence points to dbl and dbl domains near or at the c terminus as the key igm - binding elements in pfemp1 proteins. the functional significance of fc - mediated binding of igm to pfemp1 proteins remains unclear (18). in the case of var2csa - type pfemp1, it appears to serve an immunoevasive role that interferes with phagocytosis of igg - opsonized ies without compromising the adhesive function of pfemp1 (19). thus, pf0030c - expressing ies adhered strongly to csa, whether igm was present or not (fig. 5a), and igm markedly inhibited phagocytosis of igg - opsonized ies expressing this pfemp1 (fig. in contrast to these characteristics of var2csa - type pfemp1, we recently reported that fc - dependent binding of igm does not protect parasites expressing the rosette - mediating hb3var06 protein from phagocytosis of igg - opsonized ies but rather may serve to augment low - affinity adhesive interactions between the pfemp1 head structure and as yet undefined carbohydrate moieties (15). fc - specific binding of igm to the new pfemp1 proteins identified here did not markedly protect them from phagocytosis following opsonization by antigen - specific igg (fig., they resemble the rosette - mediating pfemp1 protein hb3var06, which suggests that they have an elongated conformation. only one of them (mal6p1.316) contains an n - terminal dbl domain of a type previously associated with rosetting (dbl1.5, dbl1.6, dbl1.8, or dbl2) (1013, 15), and none of them mediated rosetting (fig. these findings establish for the first time that the ability to bind igm via fc is not restricted to var2csa - type and rosette - mediating pfemp1 variants. they also indirectly support our hypothesis that an important function of igm binding is to augment low - affinity adhesive interactions between the pfemp1 head structures and host endothelial receptors (15). only when such receptors are also found on erythrocytes would this lead to rosetting. in conclusion, we have provided evidence that each p. falciparum genome encodes several pfemp1 proteins with the capacity to bind fc. we can not formally rule out that other parasite - encoded ie proteins, e.g., rosette - mediating rifins (58, 59), also have affinity for fc, but there is presently no evidence to support that possibility. we identified five pfemp1 proteins in p. falciparum 3d7/nf54 parasites, but this is almost certainly an underestimation considering the limited number of subclones we investigated. our findings confirm that fc - specific binding of igm to var2csa - type pfemp1 has an immunoevasive function. however, they also support recent data pointing to alternative roles for fc - mediated igm binding to other types of pfemp1 (15, 18, 20). in any case, the igm - binding phenotype is likely to be both common and important, as we showed that fc - dependent binding of igm is not restricted to pfemp1 proteins mediating either adhesion to csa or rosetting. although rosetting has been associated with expression of pfemp1 proteins causing severe malaria, the relationship is not absolute (reviewed in reference 60). indeed, several pfemp1 proteins that mediate adhesion to epcr and icam-1, phenotypes that have repeatedly been associated with severe malaria, do not mediate formation of rosettes (50). future analysis of the interrelationship among various pfemp1 phenotypes that have been individually associated with malaria severity may well produce important new insights. this prediction is supported by the fact that one of the pfemp1 proteins studied here (mal6p1.316), which bound fc but did not mediate formation of rosettes, contains a cidr of a type (cidr1.8) that is involved in adhesion to epcr (51). | the plasmodium falciparum erythrocyte membrane protein 1 (pfemp1) adhesive proteins expressed on the surfaces of infected erythrocytes (ies) are of key importance in the pathogenesis of p. falciparum malaria. several structurally and functionally defined pfemp1 types have been associated with severe clinical manifestations, such as cerebral malaria in children and placental malaria in pregnant women. pfemp1 that can bind the fc part of igm (fc) characterizes one such type, although the functional significance of this igm binding to pfemp1 remains unclear. in this study, we report the identification and functional analysis of five igm - binding pfemp1 proteins encoded by p. falciparum nf54. in addition to the var2csa - type pfl0030c protein, already known to bind fc and to mediate chondroitin sulfate a (csa)-specific adhesion of ies in the placenta, we found four pfemp1 proteins not previously known to bind igm this way. although they all contained duffy binding - like (dbl) domains similar to those in var2csa - type pfemp1, they did not mediate ie adhesion to csa, and igm binding did not shield ies from phagocytosis of igg - opsonized ies. in this way, these new igm - binding pfemp1 proteins resemble the rosette - mediating and igm - binding pfemp1 hb3var06, but none of them mediated formation of rosettes. we could map the capacity for fc - specific igm binding to dbl domains near the c terminus for three of the four pfemp1 proteins tested. our study provides new evidence regarding fc - dependent binding of igm to pfemp1, which appears to be a common and multifunctional phenotype. |
gestational diabetes mellitus (gdm) is defined as glucose intolerance of variable degree with onset or first recognition during pregnancy. three to ten percent of all pregnancies are complicated with abnormal glycemic control, gdm accounts for 80% of them. in saudi arabia, abnormal glycemic control affects 8.9 - 12.5% of all pregnancies based on the region and the diagnostic criteria used. even with a well - developed antenatal care services, gdm carries a significant burden on individuals as well as health care services through its multiple complications affecting both the mother and her baby. these complications include obstetrical morbidities, perinatal mortality, increased rates of neonatal intensive care unit (nicu) admissions due to hypoglycemia, macrosomia, respiratory distress syndrome (rds), jaundice, polycythemia, electrolyte imbalance and birth trauma. other postnatal complications affecting newborns of diabetic mothers include transient myocardial hypertrophy, impaired left ventricular relaxation, congenital malformations with cardiovascular defects ranking on the top of the list followed by musculoskeletal and central nervous system (cns) anomalies. other long - term complications include a wide range of neuropsychological dysfunctions in the form of lower total developmental score, attention deficit disorder, and hyperactivity. the main objective of our study was to investigate, retrospectively, the rate of nicu admissions and the significant neonatal complications in pregnant women with gestational diabetes. a retrospective case - control study was conducted at king khalid university hospital (kkuh) -tertiary care center- during the period of january till december 2007. a number of randomly selected healthy pregnant women with their newly born infants were also identified. they were selected based on timing of delivery i.e., each healthy mother who gave birth after gdm mother in a 1:1 fashion. cases who were excluded from the cohort included women with chronic dm, out born infants, women delivering preterm (< 37 weeks ga) and those who were not followed up at kkuh during their pregnancy were excluded. the diagnosis of gdm was made by the obstetricians based on abnormal fasting blood sugar and oral glucose tolerance test (ogtt) diagnosed after 24 weeks of pregnancy. mothers were followed up regularly and blood sugar control was achieved with either diet or insulin. after delivery, infants were admitted to the newborn nursery unless they required intensive care. glucose monitoring was performed for all infants of gdm mother and high risk infants - like infants with intrauterine growth restriction (iugr). the monitoring was done by hemoglucocheck that started within the first 3 hours of birth at the newborn nursery, then before each feed until the blood glucose is stable for two subsequent readings. a single reading of glucose level below 2.6 mmol / l was treated with feeding if possible otherwise the baby was admitted and iv dextrose was initiated with close monitoring. maternal data included ; age, number of deliveries and abortions, mode of delivery, fasting blood glucose level, 2 hours ogtt level and other maternal comorbidites such as hypertension, hyperthyroidism, hypothyroidism and asthma. neonatal data included ; sex, birth weight, length, head circumference, apgar score at 1, 5, 10 minutes, details of nicu admission if the baby was admitted, length of nicu stay, neonatal complications with details of hypoglycemia, jaundice, respiratory distress, cns, cardiac anomalies, metabolic abnormalities and birth trauma. data were presented as mean (sd) for centrally distributed data and median (interquartile range) for skewed data. we chose a convenient sample of all gdm mothers and their matched control during the study period. data were presented as mean (sd) for centrally distributed data and median (interquartile range) for skewed data. we chose a convenient sample of all gdm mothers and their matched control during the study period. a total of 1532 chart were retrieved from the medical records, 419 gdm mothers and 347 controls with their term babies. the mean age for the mothers was 33.5 and 28.9 years for gdm and normal group, respectively. women with gestational diabetes were noticed to have a significant higher risk of abortions with lower parity order as compared to normal women ; this observation could indicate the presence of genetic or environmental association that needs further study. as expected the mean ogtt and the mean fasting glucose were significantly higher in gdm group (fasting blood glucose 5.10.8 versus 4.70.55 mmol gdm mothers were more likely to have higher blood pressure compared to normal mothers ; we believe this is mainly due to the observational nature of our study. there was no significant statistical difference in the means of birth weight, length and head circumference. the mean birth weight was 3.3 kg and 3.19 kg for newborns of gdm and normal mothers, respectively. the number of large for gestational age newborns was doubled in the gdm group as compared to normal group ; however this did not reach significant statistical difference mostly due to small sample size. the number of infants needed nicu admission was significantly higher for infants born to gdm mothers compared to infants born to normal mothers [or 2.7 (95% ci 1.5, 4.9), p<0.001 ]. of those admitted to nicu, infants born to gdm mothers had longer hospital stay compared to newborn infants born to normal mothers(6 days versus 3 days, p=0.03). these babies were more likely admitted to nicu for iv dextrose than newborns of normal mothers [or 3.19 (95% ci 1.05, 9.71) ], p value 0.04 ]. moreover, infants of gdm mothers were more likely to experience hypoglycemia at the newborn nursery than infants born to normal mothers (or 3.74, p<0.001). in a multivariate analysis, infants who developed hypoglycemia were larger for their gestational age, [or 16 (95% ci 2.4, 110) ]. although newborns of gdm mothers have double the risk of cardiovascular anomalies ; it did nt reach statistical significance. other neonatal outcomes namely respiratory complications, cns complications, jaundice requiring phototherapy, birth trauma and biochemical abnormalities were not significantly different between the two groups ; this lack of significance could be explained by the small sample size. in this retrospective case - control study, we have shown as previously reported that around 10% of infants born to gdm mothers are admitted to nicu for various reasons mainly hypoglycemia and perinatal distress, since we lack the differentiation of special care, high dependency, and intensive care unit in our institute, a comparison to international standards could nt be made to assess whether our infants born to gdm utilize more resources or not. nevertheless, the rate of 8 - 10% is comparable to most recent reports in the literature. this rate is double the admission rate and the length of hospital stay of newborns of unaffected mothers, which causes tremendous burden over health care system. a strong association has been observed in multivariate analysis ; infants who developed hypoglycemia were larger for their gestational age. this augments the published results of hyperglycemia and adverse pregnancy (hapo) study that showed strong continuous associations between cord c - peptide levels, neonatal hypoglycemia and excessive size at birth. despite having similar rates of nicu admission, hypoglycemia and utilizing similar definition for macrosomia, this observed difference can be explained by different genetic, demographic and maternal metabolic factors that are known to affect fetal growth. nonetheless ; this difference can be simply due to the natural limitation of our study design to identify with precision mothers with normal and abnormal blood glucose levels in their respective groups. other well - known fact is the effect of using different cut limits- the world health organization criteria or american diabetes association criteria- on the diagnosis of gdm ; thus we may have undiagnosed mothers with gdm who were assigned to the normal group. recently, two clinical trials subjected pregnant women with varying degrees of abnormal glucose tolerance test to either active management of their hyperglycemia or routine antenatal care ; both trials showed a significant reduction in the rate of macrosomia in the treatment group but no effect on the rate of hypoglycemia. moreover, good maternal glycemic control can reduce the risks of shoulder dystocia, cesarean delivery, and hypertensive disorders. the rate of rds was not increased in the offspring 's of gdm mothers included in our study. mmol / l) had babies with lung maturation similar to that of non - diabetic women. other important factor that could explain our observation is the exclusion of preterm deliveries that have been shown to be associated with gdm. firm conclusion could not be made with regard to biochemical abnormalities, birth trauma and multiple pregnancies mostly due to small numbers presented. our study is unique since it 's the first regional study that focuses on neonatal outcomes. the maternal nutritional status, availability of laboratory data, data reflecting treatment goal achievement such as fasting glucose level post initiation of therapy were unavailable. gestational diabetes poses a special mixture of metabolic factors ; key player essentially in terms of preventive strategies. respectable number of research papers emphasized the importance of maternal blood glucose control, yet other metabolic factors are awaiting more exploration. lately, two retrospective studies showed a significant higher fasting serum triglyceride levels in the second and third trimester in gdm mothers. gestational diabetes mellitus remains a significant morbidity to newborns resulting in increased intensive care admission, prolongation of hospital stay and higher rates of neonatal hypoglycemia. more efforts to assure early recognition and strict sugar control during pregnancy are still needed. | background : gestational diabetes mellitus (gdm) affects up to 10% of all pregnancies and results in significant maternal and neonatal morbidities.objectives:our main objective was to investigate retrospectively the rate of neonatal intensive care unit (nicu) admissions and significant neonatal complications in pregnant mothers with gestational diabetes.materials and methods : a retrospective cohort study was conducted. the medical records of king khalid university hospital (kkuh) were reviewed from january till december 2007. all pregnant women with gdm along with their offsprings were included and matched with healthy pregnant women. the primary outcome was the rate of nicu admission, hypoglycemia, birth weight and length of hospital stay.results:a total of 766 mothers (419 gdm mothers and 347 controls) with their term babies were included. infants born to gdm mothers had significantly higher risk of nicu admissions [or 2.7 (95% ci 1.5, 4.9), p value 0.0004 ], longer hospital stay and higher rates of hypoglycemia. newborns of gdm mothers had higher rates of perinatal distress and macrosomia ; however, the difference did not reach statistical significance.conclusion:gdm remains a significant morbidity to newborns resulting in increased intensive care admission, prolongation of hospital stay and higher rates of neonatal hypoglycemia. more efforts to assure early recognition and strict sugar control during pregnancy are still needed. |
thyroid hormones are critical for mammalian life, including cardiovascular, kidney, and other organs, especially the neurological system [15 ]. many changes occur in the thyroid gland, thyroid functions, iodine metabolism, and immune system during pregnancy [6, 7 ]. pregnant women are particularly susceptible to hypothyroidism, which has been associated with a wide range of adverse outcomes, including miscarriage, placental abruption, preterm birth, fetal growth retardation, and impaired neuropsychological development of the offspring [8, 9 ]. autoimmune thyroid disease is the most frequent cause of hypothyroidism in women of reproductive age. the prevalence of thyroid peroxidase antibody (tpoab) in the general population of reproductive age is 1020%. the existence of tpoab has been relevant to the possible development of thyroid dysfunction with the advancing gestation during pregnancy. conflicting results on the impact of tpoab on maternal and neonatal adverse outcomes have been published. a recent meta - analysis reported a significant association between thyroid autoantibodies and miscarriage. in a study by korevaar. however, another study did not observe the association between thyroid antibody positive and preterm birth. negro. reported a positive association between thyroid autoimmunity with preterm delivery and neonatal respiratory distress syndrome in euthyroid women, while no associations were found between preterm delivery and thyroid autoimmunity in the study by bliddal.. there still remains controversy regarding the screening strategies for thyroid functions and thyroid autoantibodies during prepregnancy, gestation, and postpartum [1517 ]. although guidelines recommended screening for thyroid diseases in the first trimester of pregnancy, there were still a large number of pregnant women with no screening for thyroid diseases in the first trimester in our country. a large proportion of women who were receiving prenatal care for the first time were already in the second trimester of pregnancy in most third - grade class - a hospital in our country such as our hospital, with thyroid function tests regarded as universal screening on the occasion. it is known that immune modulation that occurs during pregnancy would result in a decline of tpoab levels with progression of pregnancy and sometimes antibodies became negative in the later gestation [18, 19 ]. this study was to observe the effects of tpoab on adverse maternal and neonatal outcomes in pregnant women without earlier screening in an iodine - sufficient region in china, including the incidence of postpartum thyroiditis (ppt), placenta previa, placental abruption, premature rupture of fetal membrane (prom), polyhydramnios, oligohydramnios, postpartum haemorrhage (pph), preterm birth, fetal distress, low birth weight (lbw), and congenital hypothyroidism (ch). initially, 401 singleton pregnant women who underwent regular examination at jiangsu province hospital between january 2013 and july 2014 were enrolled in this study, with gestational age of 2428 weeks, with checking for thyroid functions at least 3 times antepartum, and following up until 12 months postpartum. pregnant women with a preexisting diagnosis of thyroid dysfunction, family history of thyroid diseases, assisted reproductive technology, and recognized system autoimmune diseases were excluded from this study. among the initially screened, 185 were excluded for history of thyroid dysfunction, 3 for family history of thyroid diseases, 3 for assisted reproductive technology, and 2 for recognized system autoimmune diseases. data about maternal age, parity, and history of spontaneous abortion were collected by interrogation. gestational age was calculated according to the first day of their last menstrual cycle (lmp) (for women with regular cycles), and/or ultrasonography for those with irregular cycles. physical exams for all participants included weight, height, and systolic and diastolic pressure. all participants had been tested for gestational diabetes mellitus at 2428 weeks through a 2-hour, 75 g oral glucose tolerance test. physical examination of neonate was done to determine apgar score, weight, and height. thyrotropin (tsh), free thyroxine (ft4), and urine iodine concentration (uic) were measured at baseline and checked at 4-week interval during gestation. levothyroxine (lt4) treatments were started in women with overt and subclinical hypothyroidism to maintain euthyroid antepartum and were withdrawn postpartum. thus, subjects were divided into two groups, according to the results of tpoab : tpoab - positive and tpoab - negative groups. measurements of tsh, ft4, and tpoab were carried out with the cobas 6000 centaur system (roche diagnostics, yzb / gem 18152010, mannheim, german), according to the instructions of the manufacturer (interassay cv 10 mu / l in heel blood) at birth subsequently confirmed as having a primary ch (tsh > 10 mu / l, ft4 neonatal diseases include neonatal haemorrhage, neonatal jaundice, neonatal thrombocytopenia, neonatal infections, and neonatal defects. serum tsh levels and uics failed the normality test, presented as median with interquartile. tpoab levels were presented as scatterplots with 25th, median, and 75th percentile values. the percentages of abnormal maternal and neonatal outcomes among different groups were carried by chi - squared test. the study was approved by the ethics committee of the first affiliated hospital of nanjing medical university. the purposes, the data collection procedures, and the benefits of the research were explained to them before obtaining their informed consent. the flow diagram of the study process was described in figure 1. finally, 26 women were in tpoab - positive group and 182 women were in tpoab - negative group. 208 pregnant women included 26 (12.50%) women in tpoab - positive group and 182 (87.50%) women in tpoab - negative group. there were no significant differences in age, bmi, gestational age, blood pressure, parity, history of spontaneous abortion, and blood glucose between two groups (p > 0.05). median urinary iodine concentration (muic) was 188 g / l in tpoab - positive group and 202 g / l in tpoab - negative group, indicating an iodine - sufficient population. in tpoab - positive group, 2 (7.69%) women were with overt hypothyroidism and 4 (15.38%) women with subclinical hypothyroidism. six (3.30%) women with overt hypothyroidism and 13 (7.14%) women with subclinical hypothyroidism were in tpoab - negative group. women with overt and subclinical hypothyroidism in both groups were treated with levothyroxine to maintain euthyroid. there has been no difference in the subjects treated with thyroxine in the two groups (p > 0.05). there was no difference of thyroid functions between two groups antepartum (p > 0.05) (table 2). as shown in figure 2, the titres of tpoab in tpoab - positive group postpartum were much higher than the levels during pregnancy (p 0.05). the rate of placenta previa, placental abruption, prom, oligohydramnios, and pph had no difference between the two groups (p > 0.05). neonatal outcomes in two groups were compared in table 5, and no significant difference in the incidence of preterm birth, fetal distress, lbw, neonatal diseases, and ch was observed between the two groups (p > 0.05). apgar score at 1 and 5 min, neonate weight, and height were comparable in the two groups (p > 0.05). in the current study, we investigated the effects of topab on maternal and neonatal outcomes in pregnant women in the second trimester. it was found that pregnant women who are tpoab - positive had increased risk of ppt, which predominantly happened at 6 weeks postpartum. prior research demonstrated a large variation in the prevalence of ppt, ranging from 1.1 to 16.7%, with higher prevalence in high risk groups such as women with type 1 diabetes mellitus, a family history of thyroid diseases, or other autoimmune diseases. in the present study, ppt occurred in 11.54% of women, including 42.31% of women in tpoab - postive group and 7.14% in tpoab - nagtive group. possible reasons for the different incidence between the studies could be related to the different assay methods, iodine intake, postpartum testing times, and environment factors. consistent with previous studies, tpoab - positive women had much higher prevalence of ppt compared to tpoab - negative women. although strong correlation between tpoab and ppt was observed, the underlying mechanism was not fully clear. the rebound action of the immune system in the postpartum period could be one of the reasons [22, 23 ]. the immune modulation that occurs during pregnancy would result in a decline of tpoab levels with progression of pregnancy. the levels of tpoab postpartum can restore to prepregnancy levels, leading to the increased destruction of thyroid gland. furthermore, it had reported that tpoab is related to thyroid injury and the igg1 subtype of tpoab may play a vital role in the damage of the thyroid in ppt. almost half of ppt happened at 6 weeks postpartum in both groups in our study, although it is known that the peak tpoab in the postpartum can occur up to 6 months postpartum. it is suggested that thyroid function tests should be performed at approximately 6 weeks postpartum especially in tpoab - positive women. the presenting forms of ppt included classical form, isolated thyrotoxicosis, and isolated hypothyroidism. in this study, 63.64% of ppt presented as classical form in tpoab - positive group and 61.54% presented as isolated thyrotoxicosis in tpoab - negative group. the titres of tpoab in tpoab - positive group postpartum were much higher than the levels during pregnancy in our study. with the higher levels of tpoab, much more injury of the thyroid gland would happen, with much more thyroid hormones released (the transient thyrotoxicosis) followed by hypothyroidism. eight women in the tpoab - negative group became tpoab - positive postpartum ; 5 in 8 presented with ppt. compared with tpoab - positive group, the levels of tpoab in these women were lower and the damage to thyroid gland might be slighter. the interim time from thyrotoxicosis to hypothyroidism the underlying clear mechanisms need further study. considering that ppt may become permanent in the postpartum or portend thyroid failure in later years, close follow - up is required especially in patients who are tpoab - positive in order to identify the cases developing permanent thyroid dysfunction. while some researches demonstrated that tpoab results in maternal and neonatal complications such as miscarriage, preterm birth, and lbw, this had not been reported by others. in the present study, tpoab was not found to be associated with placenta previa, placental abruption, prom, oligohydramnios, pph, premature delivery, fetal distress, lbw, neonatal diseases, and ch. chen. reported that tpoab was associated with prom and lbw ; no association was found with other outcomes, such as gestation diabetes, gestation hypertension, placenta previa, placental abruption, fetal distress, and preterm birth. the reasons for the negative results of the above outcomes in our study would be the later time of thyroid function tests. it is possible that some subjects of the tpoab - negative group may indeed have been tpoab - positive in the earlier pregnancy owing to the decline of tpoab levels with progression of pregnancy. interestingly, we found that women who are tpoab - positive had significantly higher rate of polyhydramnios compared to tpoab - negative group. common causes of polyhydramnios are gestational diabetes, fetal anomalies with disturbed fetal swallowing of amniotic fluid, fetal infections, and other, rarer causes. the observed significance had no relationship with the blood glucose due to the comparative levels of blood glucose in two groups. moreover, our results need to be validated with larger number of subjects from various medical centers. while american thyroid association (ata) commented on the lack of evidence needed to make any recommendations for the screening of thyroid autoantibodies in pregnancy. given the importance of the potential negative effects of tpoab on polyhydramnios, which is associated with increased adverse obstetric and neonatal outcomes [26, 27 ], we recommended that screening for tpoab in pregnancy should be performed so far. the adverse maternal and fetal effects linked with undiagnosed and untreated overt thyroid dysfunction in pregnant women have been clearly depicted in previous literature and guidelines [16, 28 ]. it is well accepted that overt and subclinical hypothyroidism have a deleterious impact on pregnancy. considering the ethics, women with overt and subclinical hypothyroidism in the both groups were treated with levothyroxine to maintain euthyroid in our study. there has been no difference in the subjects treated with thyroxine in the two groups. furthermore, maternal iodine deficiency may result in adverse maternal and neonatal outcomes, including miscarriage, preterm birth, and impaired neurodevelopment of offspring. therefore, we performed our study in an iodine - sufficient population to avoid the influence of iodine nutrition on the observed outcomes. various reports regarding the influence of tpoab on the impaired neuropsychological development of offspring have been published. li. reported that lower motor and intellectual development of children at 2530 months of age was associated with elevated tpoab of women at 1620-week gestation. a study from ghassabian. implied that the elevated titers of tpoab during pregnancy impact children 's risk of problem behavior, in particular attention deficit / hyperactivity. infant outcomes are of greater clinical significant concerns, such as cognitive and psychomotor development of offspring. therefore, with the extension of follow - up time, we would obtain much more data to clarify the impact of tpoab on the neuropsychological performance, including motor and intellectual development. in conclusion, we recommended that screening of thyroid function should be performed at earlier pregnancy and at approximately 6 weeks postpartum especially in tpoab - positive women. | purposes. to evaluate the effects of thyroid peroxidase antibodies (tpoab) on maternal and neonatal adverse outcomes in pregnant women. methods. 208 pregnant women at 2428 weeks were divided into two groups, tpoab - positive and tpoab - negative groups. thyroid function and tpoab were determined in all subjects until 12 months postpartum. levothyroxine was supplemented to maintain euthyroid with periodical checking of thyroid functions. the prevalence of postpartum thyroiditis (ppt), placenta previa, placental abruption, premature rupture of membrane, postpartum haemorrhage, polyhydramnios, oligohydramnios, preterm birth, low birth weight, congenital hypothyroidism, and neonatal diseases were observed in two groups. results. of all women, 11.54% had a ppt. the prevalence of ppt was significantly higher in tpoab - positive than tpoab - negative group (42.31% versus 7.14%, p < 0.001), with 45.46% and 53.85% of ppt happening at 6 weeks postpartum in tpoab - positive and tpoab - negative groups. the incidence of polyhydramnios was significantly higher in tpoab - positive than tpoab - negative group (15.38% versus 2.74%, p = 0.02). conclusion. pregnant women with tpoab - positive had increased risk of ppt, predominantly happening at 6 weeks postpartum. tpoab was associated with increased incidence of polyhydramnios and the underlying mechanisms required further investigation. earlier screening of thyroid function during pregnancy and postpartum was warranted in our region. |
intestinal epithelial cells (iecs) maintain a fundamental immunoregulatory function that influences the development and homeostasis of mucosal immune cells. interestingly, this single layer is home to an abundant population of intestinal intraepithelial lymphocytes (iels). though primarily comprised of cd8 t cells, the intestinal iels can be classified into two major subgroups. one group consists of cd4 or cd8tcr iels, which are known as type a iels. type b iels express tcrs or tcrs with a unique coreceptor, cd8. about 6575% of small intestinal iels are type b iels (cd8tcr and cd8tcr) in mice. most cd8 iel precursors go through a thymic stage of development and complete maturation in the intestine. we and others previously reported that intestinal gut - derived cytokines are particularly important for the homeostatic proliferation and survival of these iels. for example, specific intestinal il-7 overexpression (il-7 mice) significantly increased the number of type a iels but did not have much effect on type b cell numbers. mice lacking the il-15 system, including il-15, il-15r, and il-15r mice, showed a severe reduction in cd8tcr and tcr iels [4, 5 ], combined with previous evidence showing that cytokines of the common -chain (c) family (e.g., il-7, il-15) are critical for development of iels and depend on c for cellular signaling. toll - like receptors (tlrs) are the main pattern recognition receptors (prrs) that can recognize pathogen - associated molecular patterns derived from a diverse collection of microbes. tlrs are inducible or constitutively expressed in different combinations throughout the whole intestinal tract by a wide variety of cell types, including iecs, myofibroblasts, and immune cells [6, 7 ]. tlr signaling has been shown to be involved in epithelial cell proliferation, cytokine production, and antimicrobial peptide expression. of the tlrs, tlr2 is involved in recognizing a wide range of ligands, including peptidoglycan, lipoteichoic acid (lta), and lipoarabinomannan. a major signaling target of the tlr2 is activation of the transcription factor nf-b, which is shuttled from the cytosol to the nucleus where it initiates expression of pro- and anti - inflammatory cytokines. indeed, our recent study has shown that the higher level of infection burden in tlr2 mice was closely associated with a reduction in proinflammatory cytokines in the liver. furthermore, polymorphisms in genes encoding tlr2 and nf-b signaling proteins (nfkb1 and nfkbia) are associated with risk of inflammatory bowel disease (ibd). thus, it is hypothesized that tlr signaling for cytokine expression is involved in maintenance of iels and protection of intestinal mucosa. in this report, we found that the numbers of iels (especially type b iels) were reduced significantly in tlr2 mice and residual iels displayed reduced activation and proliferation, accompanied with impaired expression of il-15 in intestinal mucosa. our results also indicate that deficiency of tlr2 contributes to the high susceptibility of mice to dextran sulfate sodium- (dss-) induced colitis. tlr2 mice (c57bl/6j background) were kindly provided by wenyue xu (department of pathogenic biology, third military medical university, chongqing, china). specific pathogen - free wild - type (wt) c57bl/6j mice were purchased from the laboratory animal center of third military medical university. six- to eight - week - old, pathogen - free, male mice weighing 20 3 g were used. mice were maintained in temperature-, humidity-, and light - controlled conditions and all studies were performed under the guidelines of the institutional animal care and use committee of third military medical university. all experimental protocols were approved by this committee. for lipoteichoic acid (lta, invivogen, usa) injection, lta dissolved in pbs (5 g/200 l / mouse) was injected intravenously via the tail vein, and the intestinal samples were collected 24 h later. animals received either regular drinking water (control) or drinking water within 3% dss (molecular weight : 36,00050,000 ; mp biomedicals, cleveland, usa) for 7 days. the human colon adenocarcinoma cell line sw480 was purchased from china center for type culture collection (beijing, china). the cells were cultured in rpmi1640 supplemented with 10% fetal bovine serum (gibco, carlsbad, usa), 100 iu / ml penicillin, and 100 g / ml streptomycin (invitrogen, carlsbad, ca). the small intestine or colon was opened longitudinally, washed in an iel extraction buffer (1 mm edta, 1 mm dtt in pbs), and cut into 5 mm pieces. the tissue suspension was filtered rapidly through a glass wool column to remove debris and centrifuged at 1500 rpm at 4c for 5 min. pelleted cells were suspended in 20 ml 40% isotonic percoll (ge healthcare biosciences, piscataway, usa) and centrifuged at 2200 rpm at 4c for 22 min. the supernatant was carefully sucked off, leaving about 5 ml of solution (containing cells). and the pellet was resuspended in 2 ml tris - nh4cl (heated to 37c) for red blood cell lysis. the iels were fluorescence - labeled with the following antibodies : cd45-pe, cd45-percp - cy5.5, cd8-apc, cd8-fitc, cd4-pe, tcr-apc, tcr-fitc, and cd69-fitc. 2 10 cells were suspended in 50 l staining buffer (ebioscience, san diego, usa) with saturating amounts of antibodies and incubated for 30 min at 4c. for brdu pulse - chase experiments, brdu dissolved in sterile isotonic saline (10 mg / ml) was injected twice daily (0.1 mg brdu / g body wt. per d, i.p.), and iels were collected 24 h later. for detection of brdu, cells were stained with fitc - conjugated anti - brdu (brdu flow kit ; bd pharmingen, usa), according to the manufacturer 's instructions. the apoptotic ratios for the iels were measured using annexin - v - fitc / pi apoptosis detection kit (ebioscience, usa) according to the manufacturer 's protocol. data acquisition and analysis were performed with moflow (beckman coulter, us) and flowjo (three star, ashland, usa). specimens for histological examination were fixed in 4% paraformaldehyde for 48 h. representative sections of colon and jejunum were cut and embedded in paraffin. the primary antibodies, anti - cd3 (1 : 700 ; abcam, cambridge, ma), anti - il-15 (1 : 200 ; abcam, cambridge, ma), and purified rabbit igg (10 mg / ml, negative control) were incubated overnight at 4c. subsequently, the sections were incubated for 60 min with biotinylated goat anti - rabbit igg (1 : 100 ; wuhan boster, china) for 60 min, followed by incubation with streptavidin - enzyme conjugate (wuhan boster, china). briefly, twenty - four hours before transfection, 1 10 sw480 cells were seeded per well of a 24-well plate. each pbiix - luciferase reporter gene plasmid (100 ng, a gift from dr. sankar ghosh 's lab, yale university) was cotransfected with tk - rl (10 ng, promega, usa) for normalization and either 25 nmol / l of tlr2-sirna (sense : 5-gcccucucuacaaacuuuatt -3 ; antisense : 5-uaaaguuuguagagagggctt-3) or negative control oligonucleotide (sense : 5-uucuccgaacgugucacgutt-3 ; antisense : 5-acgugacacguucggagaatt-3). at 24 h after transfection, the cells were stimulated with tlr2 agonist, lta (500 ng / ml), for 6 h. then, cell extracts were obtained using the dual - luciferase assay kit according to the manufacturer 's protocol. total rna was extracted from isolated iels using trizol (invitrogen, carlsbad, ca). rna was reverse - transcribed into complementary dna (cdna) using a superscript first - strand synthesis system rt - pcr kit (invitrogen). this cdna was used as a template for the amplification of kgf, il-2, il-10, regiii, and -actin. quantitative pcr was performed by sybr premix ex taqtm ii (takara, japan) using an abi 7500 (applied biosystems, usa). the primers selected are as follows : kgf, f : cgcaaatggatactgacacg, r : gggctggaacagttcacact ; il-2, f : cctggagcagctgttgatgg, r : cagaacatgccgcagaggtc ; ifn-, f : tcaagtggcatagatgtggaagaa, r : tggctctgcaggattttcatg ; regiii, f : ttcctgtcctccatgatcaaaa, r : catccacctctgttgggttca ; il-7, f : tctgctgcctgtcacatcatct, r : aagtttggttcattattcggg ; il-15, f : atgttcatcaacacgtcctgact, r : gcagcaggtggaggtaccttaa ; -actin, f : cttctttgcagctccttcgtt, r : aggagtccttctgacccattc. differences were analyzed by student 's t - test (with 95% confidence interval). to investigate whether tlr2 signaling has an impact on the homeostasis of iels, we first examined the numbers of iels in tlr2 mice. the total number of iels in tlr2 mice was reduced significantly in the small intestine and colon, respectively (figures 1(a) and 1(b)). immunohistochemistry was used to detect and localize the iels, and most of these cells expressed cd3. in situ staining for cd3 confirmed that iels were tightly interdigitated with iecs at the basolateral face (figure 1(c)). consistent with flow cytometry, there was a striking loss of cd3-positive cells in the small intestine in the absence of tlr2 compared with wt mice (figure 1(c)). to better understand the changes occurring in the iels after tlr2 knockout, a phenotype analysis was performed using flow cytometry. typical results are presented in figures 2(a) and 2(b), and the absolute numbers of iel subsets are summarized in figures 2(c) and 2(d). analysis of small intestinal iels in tlr2 mice revealed that the unconventional cd8 (approximately 3.3-fold) and tcr (approximately 3.9-fold) iels were dramatically reduced and the cd8 iel subset was significantly reduced (approximately 1.1-fold). there was no significant difference in the number of cd4 iels in small intestine between tlr2 and wt mice, although their proportion relatively was increased in tlr2 mice. these data thus indicate a critical and selective role for tlr2 in the homeostasis of iels. to investigate the contribution of tlr2-dependent proliferative and cell survival signals in iels, we assessed their proliferative capacity by incorporation of brdu in vivo. cd8 iels showed poorer proliferation in tlr2 mice, whereas the cd8 iels were normal (figure 3(b)). iels are t cells that exist in some intermediate stage of activation, and cd69 expression might reflect the activated nature of iels. histogram showed a decrement in the expression of cd69 on the iels from tlr2 mice (figure 3(a)). a panel of cytokines was selected to represent the activities responsible for iel activation and intestine protection. the results suggest that il-2, ifn-, and regiii mrna expression in tlr2 iels significantly decreased. however, kgf showed no significant difference between wt group and tlr2 group (figure 3(d)). we and others have previously reported that il-7 and il-15 play critical roles in the development of iels. we next examined il-7 and il-15 mrna in the mucosa of jejunum by rt - pcr. interestingly, the basal or lta - induced expression of il-15 in mucosa was decreased when tlr2 was absent (figure 4(a)). however, the defect in il-7 mrna expression in tlr2 mice was limited (figure 4(a)). we also used immunohistochemistry to confirm the rt - pcr results suggesting that tlr2-driven signals regulated the expression of il-15 in intestinal mucosa (figure 4(b)). it is known that nf-b binding site is essential for transcriptional activation of the il-15 gene. to test whether tlr2 agonist could activate signaling pathway in intestinal epithelial cell line, nf-b reporter activity was assessed after the tlr2 sirna or mock sirna - transfected sw480 was stimulated with lta, respectively. as shown in figure 4(c), lta could induce high levels of nf-b reporter activity, whereas the response of tlr2 sirna group to lta was largely suppressed. thus, our data strongly suggest that tlr2 signaling might maintain the expression of il-15 in iec via nf-b activation. loss of type b iels in mice aggravated colitis in several animal models and resulted in impaired ability to repair damaged epithelia. in order to address the consequences of tlr2 deficiency for intestinal physiology, we employed dss - induced colitis. the severity of the tissue damage in tlr2-deficient colons was illustrated in histological sections, showing diffuse lamina propria and increased destruction of colonic epithelium but reduced immune cell infiltration (figure 5(a)). the overall mortality rate was 80% in dss - tlr2 mice versus 10% in dss - wt mice (figure 5(b)). compared with wt controls, tlr2 knockout animals lost weight more rapidly, to a greater extent, and failed to gain weight during the course of the 9-day experiment (figure 5(c)). these data suggest that tlr2 deficiency contributes to the impaired innate immune defense and high susceptibility to colitis in these mice. triggering of prrs in iecs leads to the expression of immune modulators, which have an impact on the regulation of the adjacent immune cells and are necessary to maintain intestinal mucosa barrier. as iecs have long been recognized as a source of il-15 in the intestines and are adjacent to iels, this study determined whether the tlrs on iecs are associated with the homoeostasis of iels through an il-15-dependent manner. we found that tlr2-dependent signaling in iecs played an important role in development of iels (especially cd8tcr and tcr iels), and the signaling was essential in transcriptional activation of il-15 via nk-b. furthermore, we have shown that loss of iels contributes to the high susceptibility of tlr2 mice to dss - induced colitis. although the study of tlr pathways in haematopoietic cells has mostly focused on their proinflammatory properties, their role in maintaining iels homeostasis and immune tolerance has emerged as a major component of their function in iecs. in the mouse small intestine, the expression of tlr2 is found in 3 iec lineages : enterocytes, paneth cells, and enteroendocrine cells [19, 20 ]. in addition to regional localization, tlr2 expression in the intestine is also thought to be regulated spatially. tlr2 expression is found on both apical and basolateral sides of the follicle - associated epithelium but only the apical side of the villous iecs. taken together, the localization and expression of tlr2 suggest that the molecular patterns that are actually recognized by tlr2 in the intestine are generally not from pathogens but from the commensal flora. thus, we focus on the role of tlr2 in shaping the repertoire of iels in the small intestine and colon. in this study, we showed that the total number of iels in tlr2 mice was reduced significantly in the small intestine and colon as compared with wt mice. moreover, tlr2 mice showed dramatically reduced numbers of cd8tcr and tcr, similar to the proportions found in il-15 mice. interestingly, shin and iwasaki found that cd8 tissue - resident memory t cells (belong to type a iel) expressed less il-15rb. based on these facts, we speculated that type b iels may express more il-15r compared to type a iels. moreover, yu. found that the cd8tcr and tcr iels were selectively decreased in myeloid differentiation factor 88- (myd88-) deficient mice. and we all know that the myd88-dependent pathway is utilized by all tlrs except tlr3. here, we identify previously unappreciated tlr2-mediated signaling necessary for development or maintenance of iel populations. consistent with an immune - modulator role of tlr, ~1.8% of all murine transcripts were affected significantly by tlr2 deletion, a number of which correlated with immune processes changes. however, our data showed that the cd8tcr and cd8tcr iel subsets did not completely disappear in tlr2 mice. this may be because the expression of il-15 in intestinal mucosa was reduced but not completely lost in tlr2 mice, which is consistent with our immunohistochemistry findings (figure 4(b)). alternatively, the iels may depend for their development and maintenance on factors other than il-15, such as il-2 and il-7 [24, 25 ]. lai. reported that il-15 did not affect iel development in the thymus but regulated homeostasis of iels in the intestine. it has been shown that intestinal il-15 supports cd8 iels survival through the activation of the pi3k - akt - erk pathway to upregulate bcl-2 and mcl-1. in the present study in addition to its effects on iel survival, il-15 is also known for the ability to enhance proliferation of isolated iels in vitro. to investigate the contribution of tlr2-dependent proliferative signals in iels the cd8 iels showed poorer proliferation in tlr2 mice, whereas the cd8 iels held the normal capacity. therefore, these results suggest that iec contributes to the maintenance of iels at least partly via tlr2-dependent il-15 production. unlike t cells in other peripheral immune compartments, iels express some markers of activated t cells, such as the ct antigen (in mice) and cd69, suggesting that they constitute a large population of partially activated effector cells. moreover, the majority of iels can secrete epithelial growth factors and produce th1 cytokines and antimicrobial peptides, such as regiii. in this study, additionally, the residual iels in tlr2 mice expressed a reduced level of ifn-, il-2, and regiii. consistent with our study, other researchers have found that commensal bacteria are required for dss - induced expression of proinflammatory cytokines and the antibacterial lectin regiii in iels. furthermore, tcr iels activation was found to be dependent on epithelial cell - intrinsic myd88. thus, the above lines of evidence indicate that iecs supply microbe - dependent cues to iels via tlrs. il-15 was found to be produced only by limited populations of cells, such as dendritic cells and epithelial cells, but not by activated t cells. and perhaps, more importantly, ma. demonstrated that transpresentation of il-15 by iecs alone is completely sufficient to direct the il-15-mediated development of cd8 iels. immunohistochemistry results showed that il-15 is mainly expressed in intestinal epithelium in the basal condition. as expected, the basal expression of il-15 in epithelium was decreased when tlr2 was absent. it is known that nf-b binding site is essential for transcriptional activation of the il-15 gene. in this regard, we observed that the tlr2 sirna decreased the nf-b gene reporter activity in response to lta (tlr2 agonist) in intestinal epithelial cell line sw480. therefore, as discussed above, it is now apparent that tlr2-myd88-dependent signaling is important for transcriptional activation of il-15 gene in iec and consequently for development and/or maintenance of iel populations. more researches need to be done for confirming this pathway in iec and defining the commensal bacterial species that elicit this effect. although the etiology of ibd is poorly understood, increasing evidence suggests that ibd is caused in genetically susceptible individuals by a dysregulated mucosal immune response to intestinal microorganisms. advances risen from genome - wide association studies (gwas) and immunological studies have recently moved the focus of ibd pathogenesis onto mucosal innate immune responses, such as epithelial barrier integrity, innate microbial sensing, autophagy, and unfolded protein response, as central pathogenic pathways in ibd. iecs from patients with ibd have higher expression of tlrs, especially tlr4, and similar or lower expression of tlr2, tlr3, tlr5, and tlr9 than iecs from control individuals. systemic administration of the tlr2 ligand tripalmitoyl - s - glyceryl cysteine - serine4-lysine (pam3csk4) protects against dss - induced colitis. in this study, the above results suggest that iels dysregulation caused by loss of tlr2 may favor the onset of colitis. indeed, data from our previous study suggest that loss of cd8tcr and tcr aggravates colitis in the mouse model. however, we also can not ignore the emerging role of tlr2 in protecting tj - associated integrity and enhancing transepithelial resistance of the enterocyte barrier. collectively, tlr2-dependent signaling is important in keeping the number of the iel populations in the basal condition. mice with tlr2 deletion lacked iels, especially the cd8 iels (type b iels), in the small intestine and colon. the residual iels displayed reduced proliferation and activation and increased apoptosis in tlr2 mice, accompanied with impaired il-15 expression by iec. moreover, our results also indicate that deficiency of tlr2 contributes to the high susceptibility of mice to dss - induced colitis. these results suggest that tlr2-dependent signaling for il-15 production from interaction between commensal bacteria and iec plays an important role in maintenance of homeostasis of iel. | tlr2 signaling is related to colitis and involved in regulation of innate immunity in the intestinal tract, but the mechanisms remain unclear. the aim of this study is to investigate how tlr2 affects differentiation of intraepithelial lymphocytes (iels) and regulates the susceptibility of colitis. iels were isolated from the small intestine and colon of mice, respectively. the iel phenotype, activation, and apoptosis were examined using flow cytometry and rt - pcr. il-15 expression and iel location were detected through immunohistochemistry. the experimental colitis was induced by administration of dextran sulfate sodium (dss). we found that the numbers of cd8+, cd8+, and tcr+ iels were significantly decreased in tlr2-deficient mice and the residual iels displayed reduced activation and proliferation and increased apoptosis, accompanied with impaired il-15 expression by intestinal epithelial cells (iecs). further study showed that tlr2 signaling maintained the expression of il-15 in iec via nf-b activation. moreover, tlr2-deficient mice were found to be more susceptible to dss - induced colitis as shown by the increased severity of colitis. our results demonstrate that iecs contribute to the maintenance of iels at least partly via tlr2-dependent il-15 production, which provides a clue that may link iecs to innate immune protection of the host via iels. |
choroidal osteoma is a rare benign intraocular tumor characterized by heterotopic bone of the choroid.1 it is often found in healthy young females and is unilateral in approximately 80% of cases.2 choroidal osteoma is usually located in the peripapillary region, which is yellow - gray or yellow - orange in appearance. the calcified region is clinically recognized as yellow - orange as a consequence of intact retinal pigment epithelium overlying the tumor. the decalcified region is recognized as a yellow - gray area, and occurs as a result of thinning and depigmentation of the overlying retinal pigment epithelium. the decalcified subfoveal tumor causes poor visual acuity because the decalcified choroidal osteoma leads to thinning of the outer retinal layers and loss of photoreceptor layers. reports suggest that choroidal osteoma leads to a poor visual acuity of 20/200 or worse after 10 years in 56%58% of individuals.2,3 shields examined 22 cases of choroidal osteoma, and reported that decalcified subfoveal choroidal osteoma was associated with poor visual acuity.4 thus, the finding of decalcification is important for the clinical prognosis. there have been some reports in recent years of the use of spectral - domain optical coherence tomography (sd - oct) in choroidal osteoma. however, no reports of high protrusion of choroidal osteoma into the retina were noted. in this study, we use sd - oct to report that decalcified choroidal osteoma can break through into the retina. a 27-year - old previously healthy woman visited another hospital presenting with visual loss, and was subsequently diagnosed with choroidal osteoma. her best - corrected visual acuity was 20/20 od and 20/50 os and her manifest refraction was 0.5 diopters od and 0.5 diopters os. ophthalmoscopy and fundus photograph examination revealed yellow - white lesions of approximately 4 disc diameters in size in os (figure 1a). there was a calcification region in the macula and a decalcified lesion in the lower macula area in os. spider vessels, on the tumor surface, which showed late - phase hyperfluorescence. the patient was diagnosed with choroidal osteoma with decalcification, and she was followed without further treatment. three years later, choroidal neovascularization appeared, and her best - corrected visual acuity was 20/100 os. in 2012, sd - oct (spectralis, heidelberg engineering, heidelberg, germany) revealed a layered hyper - reflective pattern, which was lamellar in appearance,5 and had a hyper - reflective mass pattern forming a mound - like area (figure 2).5 decalcified regions of the choroidal osteoma were raised and partially spread into the retina causing serous retinal detachment (figure 2). the maximal diameter and thickness of the tumor, as derived from sd - oct, was 7591 m and 1688 m, respectively. ophthalmoscopy and fundus photograph examination revealed yellow - white lesions of approximately three disc diameters in size in os, and this calcified region was more contractive than those found during the first examination (figure 1). some have reported raised choroidal osteoma by oct, but not severe protrusion.4,5 our case demonstrated that decalcified choroidal osteoma strongly projected and partially broke through the retina and could be observed with sd - oct. we found that sd - oct measured tumor thickness, and diameters were larger than previously reported by freton.6 they reported that the mean basal diameter of choroidal osteoma was 5.2 mm using fundus photographs and 6.4 mm using ultrasound images. the mean tumor thickness was 1.2 mm. in our report, tumor diameters and thickness were 7591 m and 1688 m, respectively. the tumor thickness observed in our studies was 1.4 times larger than previously reported.6 the choroidal osteoma was located between the choriocapillaris and outer choroidal tissue. the pathological tissue of the choroidal osteoma shows that the choroid was replaced by mature bone that contained bone marrow spaces with connective tissue and vessels, forming spongy bone structures. navajas used sd - oct to observe a calcified region, which histopathologically resembled a spongy bone structure.5 in our case, sd - oct revealed a lamellar appearance and mound - like area in the decalcified region. similar sd - oct findings of these conditions were also reported by navajas.5 they hypothesized that lamellar reflective patterns may correspond to sclera, and mound - like areas may correspond to tumor regions in which the spongy organization was lost, secondary to partial decalcification. we found similar results with our sd - oct measurements.5 in the current report, the calcified region narrowed over a period of 6 years as observed from color photographs. expansion of the decalcified region accompanied by coagulation of the calcium resulted from calcium migration. the calcium aggregates formed as a result of the migration of calcium from the decalcified osteoma. the agglomerated and decalcified region grew forward into the retina and partially broke through the retina. this tumor could, in the future, reach into the vitreous cavity. in conclusion, although choroidal osteoma is a benign tumor, it may strongly project upward from the choroid and disorganize the retina, with loss of inner and outer retinal layers once the tumor is decalcified. we report a rare case of decalcified choroidal osteoma breaking through into the retina during long - term patient follow - up. | choroidal osteoma is a benign tumor of the choroid. herein, we report a rare case of decalcified choroidal osteoma found in the retina. a 27-year - old woman presented with visual loss. her best - corrected visual acuity was 20/50 os. ophthalmoscopy of the left eye revealed a yellow - white calcified region accompanied by a decalcified region of four disc diameters in size. after 6 years, spectral - domain optical coherence tomography showed a tumor projected strongly upwards from the choroid and partially through the retina with serous retinal detachment, with both a lamellar appearance and mound - like area. the calcified region became more contractive than was observed on the first visit. conversely, the decalcified region was wider than was observed on the first visit. her best - corrected visual acuity was 20/400 os. choroidal osteoma was worsened by progression of decalcification. the decalcified choroidal osteoma resulted in poor visual acuity, and projected strongly upward from the choroid and into the retina. |
neuropathy in waldenstrm macroglobulinemia is very heterogeneous ; electrophysiological studies show not only demyelinating neuropathy, but also axonal neuropathy. demyelinating neuropathies in waldenstrm macroglobulinemia are classified into anti - myelin - associated glycoprotein (mag)/sulfated glucuronyl paragloboside (sgpg) neuropathy and chronic inflammatory demyelinating polyradiculoneuropathy (cidp), depending on whether an anti - mag antibody is present. the temporal dispersion of distal compound muscle action potential (cmap) in motor nerve conduction studies (ncs), which represents heterogeneous demyelination at the motor nerve terminal, is often observed in cidp [2, 3 ], but it has been rarely observed in anti - mag / sgpg neuropathy. however, the course of electrophysiological findings has been controversial [4, 5, 6, 7, 8, 9 ]. here, we report the case of a patient with anti - mag / sgpg neuropathy associated with waldenstrm macroglobulinemia who showed subclinical temporal dispersion of distal cmap and electrophysiological improvement after rituximab monotherapy. a 70-year - old man had a 2-year history of mild dysesthesia of the foot sole. neurological examination showed disturbed vibration sense in the feet, a positive romberg sign, and diminished deep tendon reflexes of the extremities. laboratory examinations showed no abnormal findings, except for an elevated serum immunoglobulin m (igm) level (673 mg / dl) and the detection of igm kappa monoclonal protein on serum immunofixation electrophoresis. anti - mag antibody was detected by western blot analysis, and the anti - sgpg antibody titer determined using an enzyme - linked immunoassay was 819,200 (normal value, 3,200). although the protein concentration was slightly elevated (67 mg / dl), no pleocytosis was observed in the cerebrospinal fluid. 1a), and the duration of cmap was slightly prolonged in the median nerve (fig. we diagnosed the patient with anti - mag / sgpg neuropathy associated with waldenstrm macroglobulinemia and initiated rituximab monotherapy, i.e., intravenous rituximab at a standard dosage of 375 mg / m weekly for 4 weeks. dysesthesia and vibration - sense disturbance in the feet were unchanged, but romberg sign disappeared 3 months after the initiation of therapy. on reexamination 1 year after therapy, motor function was normal and the serum igm concentration and anti - sgpg antibody titer had diminished (289 mg / dl and 25,600, respectively). serum anti - mag antibody and abnormal lymphocytes in the bone marrow had disappeared, but serum igm - kappa monoclonal protein was present. the parameters of the ncs before and 1 year after therapy are shown in table 1. distal latency (dl) and f - wave latency in the median and tibial nerves shortened, and motor nerve conduction velocity in the median nerve improved. 1c), but the cmap waveform in the median nerve was unchanged (fig. the clinical picture of our patient was consistent with anti - mag / sgpg neuropathy ; slowly progressive, symmetric, predominantly distal, and sensory neuropathy with relatively mild or negligible weakness. hence, we diagnosed the patient with anti - mag / sgpg neuropathy associated with waldenstrm macroglobulinemia. several electrophysiological studies have shown that anti - mag / sgpg neuropathy presents with disproportionate distal slowing of the motor nerve conduction, prolongation of dl, and a low terminal latency index without conduction block [12, 13, 14, 15 ]. however, the temporal dispersion of distal cmap in the tibial nerve was apparent before therapy. the temporal dispersion of distal cmap in anti - mag / sgpg neuropathy, defined as an interval of > 9 ms between the onset of the first negative peak and return to base line of the last negative peak of the cmap, has been detected in only 15 and 10.7% of the tibial and median nerves, respectively. it is known that the temporal dispersion of distal cmap is rarely seen in anti - mag / sgpg neuropathy because it typically presents with a uniform involvement of fibers. however, the lower limit of the temporal dispersion of distal cmap has recently been shortened to less than 9 ms (median 6.6 ms and tibial 8.8 ms) [3, 11 ]. according to these criteria, distal cmap in the median nerve of our patient was also slightly dispersed. the temporal dispersion of distal cmap in anti - mag / sgpg neuropathy may occur more frequently than has been reported in the past. responses to treatments with corticosteroids, intravenous immunoglobulin, plasma exchange and immunosuppressive agents are usually poor in anti - mag / sgpg neuropathy. rituximab, a chimeric anti - cd20 monoclonal antibody, has recently been administrated to patients with anti - mag / sgpg neuropathy and improved the laboratory findings [4, 5, 6, 7, 8, 9 ]. however, longitudinal investigations of electrophysiological studies of the patients treated with rituximab have been limited and controversial [4, 5, 6, 7, 8 ]. while some studies have shown the shortening of dl and the improvement of nerve conduction velocities [4, 5 ], others have shown a lack of electrophysiological improvement [6, 7, 8 ], and no studies have shown that rituximab improves the temporal dispersion of distal cmap. moreover, the relationship between the temporal dispersion of distal cmap and motor symptoms, including the degree and duration of weakness, has not yet been investigated. in the lower extremities of most reported patients treated with rituximab, distal cmap was already very small or had disappeared [4, 8 ], suggesting considerable progression of secondary axonal degeneration in the motor nerve. in contrast, our patient presented with only mild sensory symptoms before rituximab monotherapy based on mayo clinic consensus for management of newly diagnosed waldenstrm macroglobulinemia. we considered that active and heterogeneous demyelination at the motor nerve terminal in the tibial nerve, which has not yet induced prominent secondary axonal degeneration, would be seen during the first ncs. the temporal dispersion of distal cmap in anti - mag / sgpg neuropathy could occur at an early stage when the patients do not show significant motor symptoms. administration of rituximab before the progression of secondary axonal degeneration has a great potential to reverse the effects of demyelination including the temporal dispersion of distal cmap and to prevent the deterioration of neuropathy in anti - mag / sgpg neuropathy associated with waldenstrm macroglobulinemia. early treatment with rituximab may also be effective in patients with anti - mag / sgpg neuropathy associated with monoclonal gammopathy of undetermined significance. as for the sensory nerves, we suspected that secondary axonal degeneration had already taken place, based on sensory nerve action potential measurements before therapy and the observation that parameters of the sensory ncs had not substantially improved after therapy. | patients with anti - myelin - associated glycoprotein (mag)/sulfated glucuronyl paragloboside (sgpg) neuropathy associated with waldenstrm macroglobulinemia show demyelinating neuropathy, but the temporal dispersion of distal compound muscle action potential (cmap) in motor nerve conduction studies (ncs), which represents heterogeneous demyelination at the motor nerve terminal, is rare. we report on a 70-year - old man with anti - mag / sgpg neuropathy associated with waldenstrm macroglobulinemia ; he had a 2-year history of mild dysesthesia of the foot sole without any motor symptoms. he showed marked temporal dispersion of distal cmap in the tibial nerve with other demyelinating findings in the ncs. the temporal dispersion of distal cmap in the tibial nerve improved significantly, and motor function was again normal 1 year after rituximab monotherapy. the temporal dispersion of distal cmap in anti - mag / sgpg neuropathy is rare, but it could occur from an early stage when the patients show mild or no motor symptoms. rituximab therapy before secondary axonal degeneration has great potential to reverse the effects of the demyelination including the temporal dispersion of distal cmap, and to prevent the deterioration of neuropathy in anti - mag / sgpg neuropathy. |
chronic rhinosinusitis (crs) is an inflammation of the nose and paranasal sinuses lasting more than 12 weeks with a prevalence of about 10% in europe [1, 2 ]. it is diagnosed by typical symptoms and/or computed tomography (ct) scan and/or endoscopic changes. after failure of conservative therapy, endoscopic sinus surgery (ess) aims to restore mucociliary clearance and ventilation through the natural ostia. ess is based on the theory that the maxillary sinus ostium is the most important area in the pathogenesis of chronic and recurrent rhinosinusitis [3, 4 ]. obstruction of the ostium is believed to lead to chronic inflammation and eventually to pathologic alterations of the maxillary sinus mucosa. therefore, surgical opening of the ostium and thus improved drainage and ventilation of the sinus might restore the normal mucosa. it is considered that removal of the uncinate process alone would be enough to restore the ventilation of the maxillary sinus. ess with the minimally invasive technique aims to achieve normal sinus function and prevent sinus exposure to environmental irritants, by causing minimal opening of the sinonasal structures [6, 7 ]. the effect of minimally invasive ess has been shown to be comparable to invasive ess [6, 810 ]. only few controlled studies have compared small or no widening of bony or cartilaginous structures in the maxillary sinus ostium to antrostomy with relatively promising results [1115 ]. on the other hand, uncontrolled studies suggest that the presence of biofilms, osteomyelitis, and other factors favor invasive approaches towards the ostiomeatal unit [16, 17 ]. our aim was to compare endoscopically the mucosal recovery of the ostiomeatal complex area and maxillary sinus, after endoscopic sinus surgery with either the ostium preserving or ostium enlarging technique. this randomized, single - blinded study was carried out in the department of otorhinolaryngology, tampere university hospital, finland, and mikkeli central hospital, mikkeli, finland, between 2001 and 2003. inclusion criteria were moderate - to - severe sinus - related symptoms, according to patient interview, during at least 12 weeks despite maximal medical treatment and a lund - mackay (lm) sinus computed tomography (ct) score of at least 6/24 but no more than 18/24. exclusion criteria were age less than 18 years ; oral corticosteroid treatment during the last two months prior to surgery ; previous sinonasal surgery ; a history or physical examination suggestive of severe nasal septal deviation (that causes only unilateral nasal obstruction and/or requires septoplasty before ess can be performed), unilateral sinusitis, nasal polyposis > grade 1, aspirin sensitivity, chronic bronchitis, cystic fibrosis, a tumour or a disease with a severe impact on general immunity. dropouts from the study one patient died accidentally prior to the control at 9 months postoperatively. briefly, the uncinectomy was performed on both sides, in which the lower two - thirds of the uncinate process was removed. additional middle meatal antrostomy was randomized on either the right or the left side of each patient. it was performed by removing with cutting forceps, the posterior connective tissue of the natural ostium, to duplicate the diameter. if a large ethmoid bulla was disturbed doing uncinectomy and/or antrostomy, it was opened. nasal endoscopy was performed, and the operation field was cleaned 2 weeks after surgery (table 1). the endoscopic evaluation was performedpreoperatively, 177 days (mean sd, 26 23 days) before the operation, perioperatively, and during the debridement follow - up visit at 730 days (mean sd, 16 5 days) postoperatively, 3 and 9 months postoperatively. the maxillary sinus ostium obstruction was scored : 0 : no and 1 : yes. the maxillary mucosa was scored : 0 : normal (with or without cyst), 1 : edema, and 2 : polypous mucosa. the maxillary mucosal sinussecretions were scored : 0 : no, 1 : mucus, and 2 : pus. the endoscopicscore of the ostiomeatal complex area was semiquantitatively determined from the following changes : swollen / polypotic mucosa found in the middle turbinate / anterior ethmoid cells / uncinate process / maxillary sinus ostium / opening of the frontal recess ; middle meatal adhesions ; anatomical narrowness of the middle meatus. endoscopic score 0 was normal, 1 : mild, 2 : moderate, and 3 : severe changes of the middle meatus and ostiomeatal complex. the symptoms were recorded by a questionnaire preoperatively and at 16 days, 3 and 9 months postoperatively. the following symptoms were asked : facial pain / pressure, nasal obstruction, nasal discharge, postnasal drip, decreased sense of smell, and they were scored : no = 0, mild or moderate = 1, and severe = 2. in addition, lacrimation (none = 0, mild = 1, moderate = 2, and severe = 3) and postoperative bleeding (absent = 0, mild or moderate = 1, and severe = 2) were asked during the debridement follow - up visit at 730 days (mean sd, 16 5 days), and at nine months postoperatively. the study was approved by the institutional review boards of the tampere university hospital and mikkeli central hospital. statistics were performed with spss base 16.0 statistical software package (spss, chicago, il, usa). kruskal wallis and mann - whitney u tests were used for comparisons of groups. for correlations, a two - tailed p value of less than 0.05 was considered significant in all tests. we used the endoscopic score to evaluate semiquantitatively the mucosal status of the operated area. a high endoscopic score indicated swollen or polypous mucosa and/or anatomical narrowness of middle meatal and ostiomeatal complex area. preoperative observation of both sides of each crs patient revealed no significant differences statistically in the middle meatal endoscopic scores (p > 0.05, by wilcoxon test, figure 1). the endoscopic scores did not change significantly between the preoperative, and 16-day and 3-month postoperative periods (p > 0.05, by wilcoxon test, figure 1). nor did it change significantly between the 16-day and 9-month periods (p > 0.05, by wilcoxon test, figure 1). however, when comparing the preoperative endoscopy scores to 9-month postoperative endoscopic scores of each side separately, a significant and identical improvement on both the ostium preserving and enlarging sides was observed (p = 0.004, p = 0.001, resp. the endoscopic score was better on the antrostomy side compared to the uncinectomy - only side, but only at 16 days postoperatively (p = 0.039, by wilcoxon test, figure 1). interestingly, at 9 months postoperatively there was a correlation between the endoscopic score and the radiologic maxillary sinus lm score (the uncinectomy - only side p 0.05, by mann - whitney u and spearman rank correlation tests, data not shown). nor did the pre- or post - operative endoscopic scores correlate with any of the symptoms asked at the same time points on either ostium preserving or - enlarging sides (p > 0.05 by spearman rank correlation test, data not shown). there were no peri- or post - operative differences between the operation techniques in terms of accessory ostium, endoscopically evaluated (p > 0.05, by wilcoxon test, data not shown). at 16 days post - operatively, eight obstructed maxillary sinus ostia were found on the uncinectomy - only side in contrast to only one on the antrostomy side (p = 0.031, by wilcoxon test, table 2). of these, five remained obstructed at also 3 and/or 9 months postoperatively, four on the uncinectomy - only side and one on the antrostomy side (table 2). at 9 months postoperatively two new ostium obstructions were identified with each technique leading to identical numbers of obstructed ostia between the sides (p > 0.05 by wilcoxon test, table 2). in one case, the ostium was seen as being obstructed endoscopically but turned out to be widely open on ct - scans taken 9 months postoperatively (table 2). when dropping out this exceptional case, the ostium findings by ct - scans and by endoscopy were otherwise in line at 9 months postoperatively : the median of radiologic ostium area was higher in cases with endoscopically patent ostium contrasted to those with endoscopically obstructed ostium (the uncinectomy - only side p = 0.003, the antrostomy side p = 0.009, by mann - whitney u test, data not shown). sex, allergic rhinitis, asthma, smoking, nasal corticosteroids and/or antihistamine use did not associate with an obstructed maxillary sinus ostium (p > 0.05, by fisher test, data not shown) nor did maxillary sinus obstruction associate to any of the asked symptoms at 9 months postoperatively (p > 0.05, by mann - whitney u test, data not shown). there were no perioperative differences between the sides in terms of maxillary mucosal edema and secretions, endoscopically evaluated (p > 0.05, by wilcoxon test, data not shown).at 9 months postoperatively, there was an insignificant trend that maxillary sinus mucosal edema was more frequently found on the uncinectomy - only side compared to the antrostomy side (p = 0.083, by wilcoxon test, table 2). furthermore, at 9 months postoperatively four patients had mucous secretions in the maxillary sinus (table 2). although three of these were found on the uncinectomy - side, there were no statistically significant differences between the procedures (p > 0.05, by wilcoxon test, table 2). endoscopic findings ofmaxillary secretions did not associate with maxillary mucosal edema on either antrostomy or uncinectomy - only sides compared separately (p > 0.05, by fisher test, data not shown). however, there was a correlation between maxillary sinus secretions and endoscopic middle meatal score at 9 months postoperatively (the uncinectomy - only side p 0.05, by kruskal - wallis, mann - whitney u, and spearman rank correlation tests, data not shown). postoperatively, six patients out of 29 had endoscopic findings of adhesion formation ; three were on the uncinectomy side and four on the antrostomy side (table 2). there were no differences between sides in terms of adhesions (p > 0.05, by wilcoxon test, data not shown). adhesion formation did not associate to sex, allergic rhinitis, smoking, nasal corticosteroids, and/or antihistamine (p > 0.05, by fisher test, data partly shown in table 2). nor did the presence of adhesions associate to any of the asked symptoms at 9 months postoperatively (p > 0.05, by mann - whitney u test, data not shown). the important postoperative endoscopic signs are ostium patency, mucosal recovery, and adhesion formation. we found that the side with additional antrostomy showed significantly better early recovery of the middle meatal mucosa and maxillary sinus ostium patency. during nine - month followup, maxillary sinus ostium obstruction was insignificantly more frequently found with the ostium - preserving technique. long - term recovery of the middle meatal mucosa was statistically similarly achieved with both ostium - preserving and ostium - enlarging procedures. similarly to our findings, wadwongtham and aeumjaturapat. showed in a randomized study that antrostomy was better than uncinectomy early postoperatively, but that at one year postoperatively a 60% rate of patency was achieved with both procedures. one study comparing the antrostomy size, as well as other observational studies, showed good endoscopic recovery after ess [20, 21 ]. our finding that half of early postoperatively obstructed ostia remained obstructed later on with other signs of poor recovery seems to be in accordance with a recent study showing that findings of good recovery even at one month postoperatively seem to predict good long - term results of ess. on the other hand, previous observations have shown that postoperative mucosal healing takes more than one month [2326 ]. endoscopic parameters, such as middle turbinate position, adhesions, inflammation, and crusting, have shown to have acceptable interexaminer reproducibility and are suitable for evaluating ess outcomes in the postsurgical period [27, 28 ]. about two - thirds of patients with recalcitrant crs might have biofilms in the sinonasal mucosa, but their influence on disease or ess outcomes have yet to be elucidated [11, 16, 17 ]. zhang. have observed that bacterial biofilms might associate to asthma and also to adhesion formation and revision ess. in case of revision sinus surgery, kennedy has argued in favour of complete uncinate process removal, whilst preserving the mucosa. wang. showed a statistically significant correlation between more advanced bone remodelling and a higher postoperative endoscopic score, thus also reinforcing the putative importance of operating diseased bony / cartilage structures in order to achieve mucosal recovery. in our study, it seems that antrostomy as a more invasive procedure does not cause more frequently adhesion formation. patient history factors failed to provide an explanation for the development of adhesions, maxillary ostium obstruction, or mucosal findings. the only exception was allergic rhinitis, which associated with a higher endoscopic middle meatal score, which is not easy to explain as we did not observe increased inferior turbinate swelling in atopic patients pre- or post - operatively. in contrast to what has been found in patients with samter 's triad, allergic rhinitis would not seem to affect crs severity or outcomes of ess, as long as atopy is taken into account and treated [3337 ]. have shown that most patients with crs symptoms, and also about a third of those without crs symptoms, have a positive nasal endoscopy. endoscopic findings did not associate with symptoms in our study, which is in accordance with other observations [20, 39, 40 ]. the present and previous studies of ours and others show that nasal endoscopy findings correlate strongly with ct - scan scores, thus arguing in favour of radiation reduction by performing proper endoscopy [20, 38, 39 ]. still, both ct imaging and endoscopy might be needed, as was shown in a study where ct scans were superior in detecting anatomical variations in all bony or cartilaginous structures, while endoscopy remained superior only in polyp diagnostics. as a methodological shortcoming, with this study setup we were not able to observe the influence of comorbidities on procedure outcomes. on the other hand, the patient was his or her own control which decreases the effect of confounding factors, such as interpatient differences in use of pre - or post - operative medication and early postoperative care. overall, there was a good and similar long - term endoscopic recovery of the middle meatal and ostiomeatal complex area after maxillary sinus surgery with either the ostium - preserving or - enlarging technique. postoperatively, endoscopy and ct scans provide identical information about the ostiomeatal complex area and maxillary sinus. | background. endoscopic sinus surgery (ess) is considered for chronic rhinosinusitis (crs) after failure of conservative therapy. objective. the aim of this study was to evaluate endoscopically ostium patency and mucosal recovery after ess, with either maxillary sinus ostium - preserving or -enlarging techniques. materials and methods. thirty patients with non - polypous crs were enrolled. uncinectomy - only and additional middle meatal antrostomy were randomly and single - blindly performed for each side. pre- and postoperative endoscopic scores were semi - quantitatively determined according to findings in the ostiomeatal complex area. adhesions, maxillary sinus mucosal swelling, secretions, and ostium obstruction were also endoscopically evaluated. in addition, symptoms were asked and computed tomography scans were taken preoperatively and 9 months postoperatively. results. at 16 days postoperatively, a better endoscopic score and a less obstructed ostium were found with antrosomy. at 9 months postoperatively the endoscopic score improved significantly and identically with both procedures, however, obstructed ostia and sinus mucosal swelling / secretions were insignificantly more frequently found on the uncinectomy - only side. endoscopic and radiologic findings of the maxillary sinus mucosa and ostium correlated significantly 9 months postoperatively. conclusion. there was a good long - term mucosal recovery with both surgical procedures. in terms of early mucosal recovery and ostium patency, antrostomy might be slighly superior. |
gombocz and colleagues performed a prospective, randomized, double blind study in 40 patients undergoing cardiopulmonary bypass (cpb). they investigated the anti - inflammatory potential of dextran-70 to modulate systemic inflammatory response syndrome (sirs) and myocardial ischemia / reperfusion (i / r) injury following cardiac operations. interestingly, they could demonstrate that the infusion of dextran-70 before and after cpb reduces inflammation and cardiac troponin i release. the potential deleterious effects of coronary artery bypass grafting (cabg) are well investigated under various conditions including cpb and off - pump coronary artery bypass (opcab). this includes the systemic inflammation response induced by contact between immune competent cells and the extracorporal circuit, the ischemia - reperfusion injury of several organs, and the potential endotoxemia after splanchnic hypoperfusion and consecutive damage of the mucosal barrier. it is well known that in low - risk patients the inflammatory response after cpb is less pronounced. avoiding cpb might improve the outcome even in elderly patients with higher morbidity and might lead to good long - term results. nevertheless, the use of cpb is an essential requirement in certain cardiac surgery patients and routinely performed in cardiac surgery. the inflammatory response to cpb is accompanied by an increase in body temperature, leucocytosis and tissue oedema as well as an increased release of cytokines such as interleukin-6 (il-6) and il-10. this was the rationale for investigations of immune modulation by corticosteroids, cyclooxygenase inhibitors, complement directed therapies, and adhesion molecule blockade. the need for further studies was demonstrated by new insights regarding the therapy with aprotinin. recently, it was shown that this widely used drug in cardiac surgery is associated with an increased risk of death even in long - term follow up after five years. gene array analysis revealed that leukocytes overexpress adhesion and signalling proteins after cpb which may lead to succeeding tissue inflammation. previously, an anti - inflammatory effect of dextran could be demonstrated in experimental settings. steinbauer and colleagues showed in ischemia - reperfusion injury in striated muscle, using intravital microscopy, that dextran attenuates postischemic leukocyte rolling in a molecular weight dependent manner. in this context, the study by gombocz and colleagues yields interesting aspects on the immune modulation by dextran-70 in patients undergoing cabg. using dextran-70 infusion in the early post - cpb phase after 24 hours procalcitonin as well as cardiac troponin i and soluble adhesion molecules were found to be lower using dextran-70. thus, this study suggests that compared to gelatine, dextran-70 reduces the inflammatory response in patients after cpb. some limitations of the study by gombocz and colleagues need to be addressed : the single centre design including a small number of patients and a short observation period of approximately two days. nevertheless, the authors succeeded to further the exciting area of peri - operative inflammation in cardiac surgery. as so often, further investigations are warranted to evaluate the effects of dextran-70 treatment in cardiac surgery. these trials need to be limited to high - risk patients most likely to experience benefit by anti - inflammatory therapies. additionally, a combination of plasma inflammatory mediators and gene array analysis may lead to the identification of patients being more susceptible to harmful effects of cpb. cabg = coronary artery bypass grafting ; cpb = cardiopulmonary bypass ; il = interleukin ; i / r = ischemia / reperfusion ; opcab = off pump coronary artery bypass ; sirs = systemic inflammatory response syndrome. gm has done paid consultation and verbal presentations for b braun melsungen ag, germany. gm has performed research projects in collaboration with b braun melsungen ag and has thereby received other funding in the past. gm has also received fees for presentations and funds for performing research projects from serumwerke bernburg, germany. | potential deleterious effects of cardiopulmonary bypass (cpb) and cardioplegic cardiac arrest are known to influence outcome. the inflammatory response after cpb may have unfavourable effects especially in high - risk patients, for example, the very elderly. thus, to blunt the release of pro - inflammatory mediators seems to be a promising approach. so far, numerous attempts at immune modulation have been performed. however, the management of cardiac surgery patients needs further improvement. in this context, gombocz and colleagues investigated the potential anti - inflammatory effect of dextran-70. their results suggest that compared to gelatine, dextran-70 reduces the inflammatory response in patients after cpb. |
despite of extreme diversity in the deep sea environment, only a few kinds of microorganisms have been isolated and identified. most of them are reported to belong to phylum of bacteroidetes,,. there are only four recognized species of the genus sunxiuqinia, a member of the phylum bacteroidetes ; sunxiuqinia elliptica, sunxiuqinia rutila, sunxiuqinia faeciviva and sunxiuqinia dokdonensis. among them, s. elliptica and s. rutile were isolated from shallow sea sediment in a sea cucumber farm and at nagasuka fishery harbor, respectively. in contrast, s. dokdonensis and s. faeciviva were isolated from deep sub - seafloor sediment at a depth of 900 m below the seafloor off the west part of dokdo island and at a depth of 247.1 m below the seafloor off the shimokita peninsula, respectively,,,. based on difference of sampling depth this is the first report of the whole genome sequence of the genus, sunxiuqinia. this report would be helpful to extend our understanding about the genome and general characteristics of sunxiuqinia for future studies of marine environment. dna was extracted using bead - beating technique and sequenced on hiseq 2000 (illumina). de novo genome assembly was performed using clcbio clc genomics workbench v7.5 and annotation was conducted on rast. seed viewer was used for subsystem functional categorization of the predicted open reading frames (orfs) and for visualization. whole genome sequencing has generated and assembled into 225 contigs and the estimated genome size is 4,962,831 base pairs. the n50 of the genome is 43,403 bp and the g + c content of 45.4%. the genome was predicted to contain 4,550 coding sequence, 47 trnas and 3 rrnas. most of the annotated genes were involved in carbohydrate metabolism (378), amino acids and derivatives (336), protein metabolism (228), cofactors, vitamins, prosthetic groups and pigments formations (184), rna metabolism (129) (fig. 1), which is thought to be necessary to maintain the bacterial activity in the harsh environment like seafloor sediment. these genetic traits of marine isolate of sunxiuqinia will provide a clue to the subsequent study of bacteria in the unique ocean ecosystem. this whole genome shotgun project has been deposited at ddbj / embl / genbank under accession no. lgia00000000. | sunxiuqinia dokdonensis dh1 t was isolated from deep sub - seafloor sediment at a depth of 900 m below the seafloor off seo - do (the west part of dokdo island) in the east sea of the republic of korea and subjected to whole genome sequencing on hiseq platform and annotated on rast. the nucleotide sequence of this genome was deposited into ddbj / embl / genbank under the accession lgia00000000. |
weaning of piglets is associated with very severe stress. abrupt removal of the young piglets from the dam, mixing of different litters, dietary changes (from a milk to a cereal - based diet), and contact with unknown bacteria not only result in changes in the intestinal microbial community but also suppress the immune system and increase the prevalence to intestinal pathogens. in combination with other factors, such as changes in intestinal morphology and enzyme activity [13 ], this sets the scene for the development of postweaning diarrhoea with resultant performance losses. therefore, prophylactic in - feed antibiotics have been used for decades to ameliorate the postweaning reduction in productivity. since the beginning of 2006, in - feed antibiotics used in pig production have been banned in the european union. in order to sustain high productivity in pork production, researchers have searched for alternatives such as probiotics, prebiotics, and phytobiotics which might have growth promoting effects similar to in - feed antibiotics. essential oils (eo) are volatile, aromatic mixtures, consisting principally of terpenes and phenylpropane derivatives. they are present in many plant tissues, where their primary function is to protect the plant against bacteria and parasites. the composition of essential oils may vary depending on species, geographical origin, or vegetative stage. active components of essential oils are known to have antioxidative and anti - inflammatory effects [8, 9 ]. feeding diets supplemented with plant extracts can influence the microflora in the digestive tract of early weaned piglets by increasing the number of lactobacilli and the ratio of lactobacilli and enterobacteria in the jejunum and caecum [10, 11 ]. furthermore, positive effects on the nutrient digestibility [12, 13 ] and growth performance in piglets have been reported. in the present study, limonene, eugenol, and pinene they were selected because of known antioxidative and anti - inflammatory, but also for their immunomodulatory and relaxant and spasmolytic effects [18, 19 ]. all of these effects might be especially beneficial to piglets during the stressful weaning period. the effect of growth promoting feed additives may depend on hygienic conditions of the farm. only small effects might be obtained in situations with high hygienic status, while the potential for performance improvements may be more pronounced under less optimal (i.e., field) conditions. therefore, the aim of this study was to investigate the effects of essential oils in the starter diet on development of gut ecophysiology of piglets after weaning under different hygienic conditions. one experiment was carried out at the experimental pig farm (ef) of the research institute for the biology of farm animals dummerstorf, germany and the other at a commercial farm (cf). no antibiotics (for prophylactic or therapeutic reasons) were given to the animals at either facility. piglets of german landrace sows in 2nd to 6th parity were used for the experiment. to reduce the genetic difference between litters, the whole litter from one dam (811 piglets of both sexes) was allocated to a pen of 4.38 m at ef and 4.20 m at cf. the experiments were approved by the ethical committee of the ministry of nutrition, agriculture, forestry and fishery mecklenburg - vorpommern, germany. at each farm, four litters were fed a starter diet (c), and four other litters received the starter diet containing 0.04% of the (eo) mixture starting at weaning (28 days). the essential oil mixture contained 25 g limonene, 5 g eugenol, and 12 g pinene per kg product on organic and inorganic carriers (provided by delacon biotechnik gmbh ; austria). staffing restrictions at the commercial farm meant that it was impossible to regularly weigh the animals, and record feed intake accurately, there. therefore, body weight (bw) of the pigs from cf was recorded only just before euthanasia, and no feed conversion ratio (fcr) was calculated. at ef, all piglets were weighed at weaning, and the fi in each pen was recorded daily to calculate the fcr. four piglets per treatment group, one out of each pen, were taken at random 1, 2, 5, or 11 days after weaning (at 29, 30, 33, and 39 days of age, resp.) to provide samples. all piglets were sacrificed with an intracardial injection of t61 (intervet, unterschleiheim, germany) after collecting of blood samples. the si was divided into three equal parts, and contents from the distal part and from the colon were collected for chemical and bacteriological analyses and genomic dna extraction. intestinal contents were analysed for ph, dry matter (dm), lactate (la), ammonia, and short chain fatty acids (scfas). ph was measured with an inolab ph level 1 meter (wtw, weilheim, germany). dm was determined after drying for 24 hours at 60c followed by 3 hours at 105c. for other chemical analyses, each digesta sample was diluted with water (ratio 1 : 3), homogenized and centrifuged at 4500 rpm for 10 minutes at room temperature (rt). la concentration was determined calorimetrically after heat precipitation with concentrated sulphur acid in the presence of calcium hydroxide. the absorbance at 565 nm of the blue - violet colour complex produced following addition of p - hydroxiphenyl was measured on spectronic 20 genesys spectrophotometer (spectronic instruments, rochester, ny, usa) using lithium lactate solution as a standard. ammonia concentration was measured using the conway microdiffusion assay. for the measurement of scfa in the digesta scfas were then analysed using gas chromatography on gc-17a chromatograph (shimadzu deutschland gmbh, duisburg, germany) using 25 m long capillary column of 0.25 mm diameter. serum haptoglobin concentration was measured in order to obtain an objective, but indirect indication of contact with provocative antigens. a commercially available competitive enzyme immunoassay (r - biopharm, darmstadt, germany), specific for porcine haptoglobin, the limit of detection for this assay was 0.033 mg / ml, and the intra- and interassay coefficients of variation were 2.8% and 5.2%, respectively. fresh digesta samples were homogenised, serially diluted, and plated in duplicates onto selective agars (sifin, berlin, germany). plates for enumeration of enterobacteria (violet - red bile dextrose - agar) and enterococci (slanetz and bartley enterococcus selective agars) were incubated aerobically at 37c for 24 hours. lactobacilli (lab) were grown on mrs agar for 72 hours at 37c in anaerobic jars using anaerocult a (merck, germany). colony forming units (cfu) from the highest countable dilution rate of both parallels were counted, and mean results are given as log cfu / g digesta. total genomic dna was extracted from the digesta samples using dnaspinkit for soil (mpbiomedicals, heidelberg, germany) as described by janczyk.. polymerase chain reaction denaturing gradient gel electrophoresis (pcr - dgge) analysis was employed in order to investigate the changes in the bacterial composition of the intestinal contents. primer set s - d - bact-0968-a - s - gc (forward) and s - d - bact-1401-a - a-17 (reverse) was used [24, 25 ]. the amplicons of 16s rrna genes obtained by means of pcr were then separated using dgge as described by janczyk. with a denaturing gradient of 4065%. stained gels with sybr gold nucleic acid gel stain (molecular probes, eugene, oregon, usa) were exposed to uv light (alphadigidoc rt, alpha innotech corporation, san leandro, california, usa) for 2 seconds and photographed with a digital camera sp-500 uz (olympus, hamburg, germany) using alphaeasefc software. the dgge fingerprints were analysed using bionumerics software version 6.0 (applied maths, inc. data was analysed using multifactorial model i of anova (statistica, tulsa, usa). effects of age, diet, and farm and diet x farm interactions were calculated. the tukey hsd test was used to calculate which differences caused the significant effect of the factors. dgge fingerprints were analysed by calculating the richness (number of bands in a dgge profile), diversity (simpson diversity index), and evenness. similarity of the dgge profiles was calculated using the pearson correlation, and it was visualised in a cluster by means of the unweighted pair group method with averaging (upgma) applying the bionumerics. individual piglets consumed 240 149 g and 200 29 g daily on average in the c and eo groups, respectively. feed conversion ratio was similar in both groups (1.9 0.49 and 2.1 1.20 kg / kg in c and eo, resp.) weaned piglets at the experimental farm had better growth performance than piglets at the commercial farm (figure 1). there were no differences in body weight between the c and the eo - groups at time of sacrifice. scfa, la, and ammonia concentrations did not differ between c and eo at either farm but were affected by the age. the concentration of scfa in colon increased from 50.8 14.51 at 29 days to 86.8 18.73 at 30 days and further to 106.8 19.50 la concentration in distal si increased from 4.7 2.21 at 29 days to 24.6 15.24 at 30 days and 30.9 18.87 mmol / l at 39 days (p =.004). ammonia concentrations in distal si and in colon decreased from 7.4 5.36 and 22.6 6.90 at 29 days to 5.1 1.42 and 16.6 3.88 at 30 days and further to 3.5 1.45 and 15.7 3.80 mmol / l at 39 days, respectively (p =.003 and p.05, resp.). the calculated evenness for the dgge fingerprints was higher in the eo than in the c group (in the range of 0.71.0 in c and 0.60.7 in eo for the investigated time points at either farm, p <.001). single diet and age effects could be statistically proven only for the colon bacterial profiles and no difference was observed for ileum digesta samples. in this study, a mixture of limonene, eugenol, and pinene was fed to weaned piglets but resulted in no effect on piglet production parameters. performance data, however, were only recorded as descriptive parameters in order to ensure the animals were in overall good condition. therefore, no final conclusion on the effects of the tested essential oil mixture on piglet performance can be drawn. the choice of conditions (in this case, a farm), where experiments are conducted, can be of importance for observed results. no effects of diet containing in - feed antimicrobials on intestinal microbiota could be observed when an experiment was conducted at a farm with high and constant hygienic conditions. therefore, the present study was conducted in parallel at two farms, assuming a commercial farm would have lower hygienic conditions because of the lack of a high grade sanitary regime. the hygienic status of the farms was defined high (ef) or low (cf) according to observations of the farms before the experiment. in the modern ef, built in 2001, five technicians take care of 70 sows. pens have a plastic grid floor with a solid heated plate in the middle, and they are cleaned 3 times a week with a disinfectant when occupied. by contrast, the more than 45-years - old cf keeps 600 sows and employs 6 technical staff. pens are provided with concrete floor and when occupied, the faeces are removed from the pens, but cleaning with disinfection only happens when pens are empty. the hypothesis that cf had lower hygienic status was confirmed by measurement of pig serum haptoglobin concentrations. haptoglobin serum concentration increases in pigs as a result of sequential (although subclinical) infections. as there were no clinical signs of infections in the herd, a higher bacterial and/or viral load at cf could be the reason for the observed results. cereal - based starter diets usually contain high amounts of complex plant carbohydrates compared to sow milk. this requires adaptation of intestinal bacteria from fermentation of lactose towards a broad range of carbohydrates. lactobacilli adapt rapidly to such changes after abrupt decrease in their numbers directly after weaning. in the present study, as the main fermentation product of lactobacilli is lactic acid, this may be an explanation for the increase of lactic acid concentration in small intestine. an increase in lactobacilli and the ratio of lactobacilli and enterobacteria in the jejunum and caecum of early weaned pigs, respectively, has been reported at dietary application on carvacrol, cinnamaldehyde, and capsicum oleoresin [10, 11 ]. such an effect, however, could not be found in the present study. increased flow of indigestible carbohydrates to the colon results in higher production of scfa. ammonia concentration decreased as a result of the higher amounts of starch and other indigestible carbohydrates entering the large intestine, indicating less protein breakdown by indigenous microbiota. a molecular approach of 16s rrna pcr - dgge was applied in this study to investigate the changes in the microbial community. simpson diversity index (s1/d) and evenness (e1/d) were adapted and calculated for objective comparison of the dgge fingerprints ' richness (number of bands in a sample). simpson diversity index is one of the most meaningful and robust diversity measures, and it captures the variance of the species abundance distribution. evenness is a measure of how similar the species are in their abundances and it rises when species are more equally abundant in an assemblage. this parameter is independent from the species richness. at the end of the study, the richness and the diversity of the dgge profiles were lower in the eo than in c at either farm, but significant reduction was recorded only at ef. bacteria sensitive to active components might have disappeared or their abundance was reduced below the detection limit of the method (being 10 cells per g, assuming a total of 10 cells in one g of digesta) allowing the remaining bacterial groups a more equal development (giving higher evenness). the reduction in the diversity of the colonic microbial population may result in increased susceptibility to diarrhoea of different origin (pathogens, toxins, fatty acids imbalance, etc.) ; on the other hand, potentially pathogenic bacteria may have also disappeared from the community, as it was recorded for thymol. as we did not sequence the bands in this study, no conclusion can be drawn on which species were affected by the oils mixture and this could be a matter for further studies. interestingly, the microbiota in the intestine of the piglets from cf seemed to be more stable and less affected by the eo indicating the importance of the farm. indeed, the dgge fingerprints could be clustered individually for each farm, and differences in the intestinal microbial community at each farm could be confirmed. nevertheless, the general lack of effects of the essential oils on bacterial counts was observed at both farms. however, essential oils reduced the enterococci counts at the commercial farm which was probably depended on the different bacterial loads and on the different initial compositions of the bacterial populations. however, in vivo results often do not correspond to the findings in vitro [37, 38 ]. the reasons for this are unclear, possibly relating to factors such as adsorption time, transit time, or interactions with other digesta components. sads and bilkei and molnar and bilkei observed positive effects of feeding high levels of essential oils in pig diet (60180 mg carvacrol and 55165 mg thymol in kg diet), whereas others observed no effects of feeding low levels of phytogenic products [10, 41, 42 ]. in a previous study, it was shown that high dosage of thymol (10 g in kg diet) affected intestinal microbiota in vivo. the dosage applied in the present study was chosen based on concentrations of essential oils commonly used in feed industry and scientific studies, which would be economically feasible, and, therefore, the essential oil content (16.8 mg essential oils per kg diet) was much lower than in the study of janczyk.. it, therefore, can not be excluded that certain effects may have occurred at higher dosage of the tested essential oil mixture. the main aim of the study was to investigate if the tested essential oils provided in economically feasible concentrations had any effects on intestinal parameters in weaned piglets kept under different farm conditions. limonene, pinene, and eugenol had no overall effect on weaned piglets performance or the gut parameters. however, a late effect of the tested oils could be observed on colon bacterial population composition, and farm conditions seemed to play a role in the observed changes. | essential oils (eo) are being considered as possible alternatives to in - feed antibiotic growth promoters in pig nutrition. the effects of an eo mixture consisting of limonene, eugenol and pinene (10.0, 2.0, and 4.8 mg / kg diet, resp.) on gut physiology and ecology were studied in piglets. the experiment was conducted at low (commercial farm) and high hygienic conditions (experimental farm), to elucidate interactions between eo supplementation and husbandry methods. piglets were weaned at 28 days of age, when they were offered either a control diet (c) or c with eo. four piglets were sacrificed in each group on day 29, 30, 33 and 39. digesta from the third distal part of the small intestine and from the colon were sampled and analysed for ph, dry matter, lactic acid, short chain fatty acids and ammonia concentrations. enterobacteria, enterococci, lactobacilli and yeast counts were obtained by plating. genomic dna was extracted from digesta and polymerase chain reaction denaturing gradient gel electrophoresis was performed. individual microbial communities were identified at each farm. age affected the intestinal parameters. no effects of the eo with exception for a significant reduction in colon bacterial diversity at 39 days of age could be recorded at experimental farm. |
there has been large interest in speeding the acquisition of mri data by acquiring fewer samples in k - space and resolving the artifacts. recently, there have been significant advances in applying inverse problem techniques to reconstruct images from undersampled k - space mri data [16 ]. the methods use nonuniform undersampling and a nonlinear recovery scheme in which a constraint, such as a spatial total variation (tv) constraint, is applied on the estimated solution, while preserving fidelity to the acquired data in k - space. it has been shown that using an l1 norm or a tv norm as constraint exploits the implicit sparsity in the data, and can be used in both space and time dimensions. the method is best known to reconstruct piecewise constant or smoothly varying data from its undersampled fourier samples ; but the application of the method to mr imaging techniques like dynamic contrast enhanced myocardial perfusion imaging (with respiratory motion in the data) and diffusion tensor imaging (dti) can be limited as these images are often not piecewise constant. in this paper, we propose a technique to improve the reconstruction of general signals that may not fit the tv constraint well. the technique uses preprocessing of the measured undersampled data to determine an improved ordering of the pixel intensities of the image estimate. if an ordering that improves the match of the estimated images and the constraint being used within the reconstruction can be found, an improved reconstruction can result. the image estimates are reordered solely to be used with the constraint or regularization term in the iterative reconstruction. the reordering approach is general in its applicability and can be used in contexts which are based on regularization techniques and in which ordering of the image intensities can be determined a priori. in the next sections, we give a brief overview of the compressed sampling or constrained reconstruction method for mri from a regularization point of view and then present the theory and applications of the reordering method. the compressed sampling method is described rigorously from a mathematical standpoint recently in a series of papers [2, 810 ]. the method is used to reconstruct a signal from a set of random fourier samples below the nyquist rate by solving a convex optimization problem, in which fidelity to the measured data is preserved at sample locations, while applying an l1 or a tv constraint on the estimated solution. the method exploits the implicit sparsity in the estimated solution or a transform of the estimated solution. one useful transform for signals or images is finite differences as the signals that are not directly sparse can be sparse in terms of finite differences (especially piecewise constant or smoothly varying signals or images) and hence an l1 norm of finite differences (tv norm) is used. although the l1 norm of the signal or image estimate is not a direct measure of sparsity in the data, it has been shown that for a wide variety of data using an l1 norm is equivalent to using the l0 norm (the number of nonzero samples), which is a direct measure of sparsity. solving the optimization problem with an l1 norm is generally easier than solving the problem with an l0 norm. the compressed sampling method when applied to mr image reconstruction can be thought as a constrained reconstruction method in an inverse problem framework [3, 1114 ]. for the 1d case, the relation between fourier data and the signal space estimate can be represented as fm = d, where m is the signal of interest, d is the fully sampled k - space data, and f represents the fourier transform ; but it often takes a long time to acquire full k - space data and results in tradeoffs in image quality, resolution, and coverage of the organ. to accelerate the data acquisitions, when full data are not acquired in k - space, and only undersampled data are acquired, the relation between the artifact - free signal estimate m and acquired data is given by (1)wfm = d, where w implements a binary undersampling pattern with ones (where data are acquired) and zeros (where data are missing), and d is the undersampled fourier data. reconstructing the signal m directly using (1) is not feasible as w does not exist in general and hence the solution is not unique. the existence of the solution is imposed by considering least - square solutions which minimize the functional wfm d22, where ||||2 represents an l2 norm. uniqueness of the solution is imposed by using one or more constraints on the solution. a popular constraint used in the field of compressed sampling is the total variation constraint given by m2 + 1, where is the gradient of the estimated signal, is a small positive constant to avoid singularities in the derivative of the functional, and ||||1 represents an l1 norm. reconstruction is performed by minimizing a convex cost function (c) (2)c = wfm d22 + m2 + 1. hence, a solution which preserves fidelity to the acquired data and which has the minimum total variation is chosen as the final solution. in (2), is the regularization parameter which controls the tradeoff between the fidelity and the constraint terms. the total variation constraint helps to resolve the artifacts while not penalizing the edges heavily. the method can be extended to 2d and multi - image dimensions and it works very well when the k - space data are undersampled in an irregular fashion and the underlying complex images are smoothly varying or are piecewise constant. when the images are not piecewise constant (which is the case for most mr images), the performance of the method can be affected. we describe below a reordering method to improve the performance of the constrained reconstruction method when the data do not match the constraints well. the method preprocesses the signal to select a monotonic ordering of the estimated solution in space and/or time and incorporates the reordering in the constraints to obtain better reconstructions. for clarity, the reordering method is first described for the 1d case and then the method is extended to 2d and multidimension cases. applications of the reconstruction method with reordering for dynamic myocardial perfusion imaging with respiratory motion and for brain dti data are presented. when the signal of interest is varying rapidly and is not smooth or the data are not piecewise constant, the total variation of the signal is already high and hence reconstruction from undersampled fourier domain samples can be inaccurate. consider, for example, a smoothly varying 1d signal and a rapidly varying signal that are labeled original full data as shown in figures 1(a) and 1(b), respectively. when the corresponding fourier samples (k - space data) of the curves are undersampled by a factor of two in a pseudorandom fashion (using rand function in matlab (the mathworks, natick, mass, usa)) and reconstructed using the inverse fourier transform, the signals labeled undersampled data r = 2 in figures 1(a) and 1(b) are obtained. when these undersampled signals are reconstructed according to (2), the original curves are overlaid in figures 1(c) and 1(d) for reference. reconstruction using (2) is better for the smooth curve in figure 1 as compared to that for the rapidly varying curve. to improve the reconstruction in the latter case, we first reorder the estimated curve in the signal space according to an optimal order, and then apply the total variation constraint. the optimal ordering can be determined as the ordering that makes the signal intensities in the curve from the fully sampled dataset monotonic and smoothly varying. reordering the estimated solution helps by reducing sudden variations in the curves and gives a better match to the assumed constraint. in practice, the curve or images from fully sampled data will not be available to obtain the optimal ordering and some sort of approximate reconstruction must be used to determine the ordering. while this area needs more research, we show here that relatively simple methods for determining reorderings can improve reconstructions of some types of undersampled data. better reconstruction from the undersampled fourier samples is obtained when the reordered curve is used in the constraint term, as the a priori assumption that the curve has lower variation is better satisfied. so the new reconstruction from undersampled data is performed according to (3) in which the only difference is that the tv constraint is applied on the reordered data as opposed to applying the constraint directly on the given data. reordering the estimated signal can also be thought as multiplication of the signal with a reordering matrix p. this matrix can be a permutation matrix of ones and zeros (it could also be a diagonal matrix for a 1d signal and it can be generalized for multidimensional signals) as follows : (3)m^ = minmwfm d22 + (pm)2 + 1. note that the reordering in (3) is not directly based on the intensity values obtained from the aliased signal from undersampled data in k - space (or for other applications, whatever domain the measurement data is obtained). that is, p is determined once, and is fixed while minimizing (3). ordering the undersampled data according to the optimal order does not mean that the reordered undersampled image estimates are monotonic, but means that if this ordering is used, the original full data in the signal space will best match the tv constraint. consider figure 1(e) which shows the sorted curve of the original curve in figure 1(b). the curve is monotonic and smoothly varying and has lower total variation as compared to the original curve. the ordering in this case was chosen as the sorting order that made the original full curve monotonic and smoothly varying. although not shown here, the reconstruction with reordering was comparable to that without reordering for the case of the smooth curve in figure 1(a). from the compressed sampling point of view, reordering the data can lead to sparser representations of the data and hence higher acceleration factors. alternatively, better reconstructions for a given acceleration factor can be obtained. figure 2 illustrates the point for the original full curve shown in figure 1(b). the figure compares the sparsity of the original curve and the sorted curve in terms of finite differences. the finite difference curve for the sorted signal is sparser (has fewer nonzero values) as compared to that of the original signal and hence using an l1 norm of the finite differences with reordering leads to better reconstructions. choosing the optimal regularization parameter is important to obtain good reconstructions. the l - curve method is a popular technique for choosing the optimal value. the fidelity norm is plotted against the constraint norm of the reordered data and the optimal parameter is given by the corner of the l - curve. figures 3(a) and 3(b) show the l - curves obtained for reconstructions from undersampled data for the curve shown in figure 1(b) without and with reordering, respectively. the l - curve in figure 3(a) is also overlaid on figure 3(b) for direct comparison. the l - curves and the optimal parameters obtained are different for both cases. the optimal parameter without reordering is higher than that with reordering. as in the iterative methods, the number of iterations also plays the role of regularization parameter ; a fixed maximum number of iterations which gave minimum rms reconstruction error for various values was chosen in computing the l - curves. from the above, it is apparent that correct reordering can help in better reconstruction from undersampled fourier data when the signals are not smoothly varying. in the above experiment, we used full data to determine the optimal ordering. to be able to use the reordering method, we need to have an ordering that makes the original signal best match the constraint. in practice, it is likely not possible to get the exact ordering of the signal curves or images as that obtained using fully sampled fourier data due to various factors like blurring of the prior signal, noise in the prior signal, and so on. to simulate this case, we randomly perturbed the exact sorting order to see the effect of having inexact ordering on the performance of the algorithm. in figure 4, the x - axis represents the number of random perturbations, that is, the number of indices of the exact sorting - order vector that are randomly perturbed. consider s to be the sorting - order vector for the original signal. when there is one random perturbation, (i) a random number is generated between 1 and the length of s denoted by r_a, then (ii) a second distinct random number between 1 and the length of s denoted by r_b, and finally (iii) the value of the s at index r_a is exchanged with that at index r_b. a value of 10 on the x - axis means that the values of the exact sorting - order vector at 10 distinct randomly picked indices (out of 70) are exchanged with those at a different set of 10 distinct randomly picked indices. the y - axis represents the natural log of the total absolute difference between original full data and the reconstructed signal. we can see that as the number of random perturbations increases, the total absolute error using reordering gradually increases, but this number is still better or comparable to that without the reordering except for a few perturbations toward the end of the plot where the entire sorting - order vector was randomly perturbed. the reordering method described above for the 1d case can be extended to 2d and applied in the context of images. as in the 1d case, reordering in 2d for images helps in better reconstruction when the images of interest are nonsmooth or are not piecewise constant. for example, figure 5(a) shows a simulated piecewise constant heart image with blood pools and with an ischemic region in the myocardium. when full fourier data of the image are undersampled in a variable density (vd) cartesian fashion (so that 5 lines in the center of k - space are fully sampled and the remaining phase encodes are sampled in a pseudorandom fashion to give a net reduction factor of ~6.5), direct inverse fourier transform reconstruction gives the image shown in figure 5(b). when the constrained reconstruction approach with a tv spatial constraint (xm2 + ym2 + 1) without reordering is used, figure 5(c) is obtained. we can see that figure 5(c) matches well with figure 5(a) ; but when the image is not piecewise constant, the performance of the constrained reconstruction can be affected. figure 5(d) shows an actual mr heart image from a patient at a single time in a perfusion sequence. the image was reconstructed using a standard 2d inverse fourier transform of the fully acquired k - space data. figure 5(e) shows the standard 2d inverse fourier transform reconstruction of undersampled k - space data for the time frame, with zeros inserted for the missing k - space data points. the data were undersampled by a factor of three in vd cartesian fashion (10 phase encodes fully sampled around the center and the remaining ones in a pseudorandom fashion). figure 5(f) shows the constrained reconstruction from the undersampled data using a spatial tv constraint without any reordering which has a few residual artifacts. for improving the reconstruction in this case, the image is reordered independently in x and y directions before applying the 2d tv constraint, that is, reorderings are determined separately for each row and each column. in practice, since the data we deal with in mri are complex, the optimal ordering is determined independently for the real and imaginary components of the image and separately in x and y directions. a row - reordered real part of the image of the original complex mr image of the heart is shown in figure 5(g). the tv spatial constraint with reorderings for a complex image can be explicitly written as 1, where = x(prxmreal)2 + x(pixmimag)2 + y(prymreal)2 + y(piymimag)2 +, in which mreal is the real part of the image estimate and mimag is the imaginary part of the image estimate. prx and pix denote the reordering matrices for ordering the signal in x dimension for the real and imaginary parts, respectively, while pry and piy are the corresponding reordering matrices in y dimension. for simplicity and compactness, the above spatial constraint with reordering is referred to as x(pxm)2 + y(pym)2 + 1, where pxm gives the image reordered for each row in the x direction and pym is the image reordered for each column in the y direction. figure 5(h) shows the reconstruction from the undersampled data using a spatial tv constraint with reordering. the ordering of the data was obtained using the image reconstructed from fully sampled data. figure 6 shows a plot comparing the reconstruction error with increasing number of perturbations in the exact spatial ordering for the actual mr heart image in figure 5(d). the reconstruction error is calculated as the total absolute difference between the full data reconstruction and the data reconstructed using the tv spatial constraint. a value of 10 on the x - axis means that the sorting - order vectors for 10% of the total number of rows (rounded to nearest integer and randomly picked) and those for 10% of the total number of columns (rounded to nearest integer and randomly picked) are randomly perturbed for both the real and imaginary parts of the complex image data. perturbation for a given row or a column is done independently for the entire length of the sorting - order vector as described for the 1d case in section 2.4. a value of 100 on the x - axis means that the sorting - order vectors for all the rows and all the columns are completely perturbed (randomly and independently) for real and imaginary parts of the image. the error for the reconstruction with reordering is gradually increasing with increasing perturbations and when the exact sorting orders are severely modified, the error gets higher than that without reordering. the reordering method described above can be extended to multi - image mr acquisitions like dynamic myocardial perfusion imaging and brain dti. in perfusion imaging, a series of images of the heart are acquired to track the uptake and washout patterns of the contrast agent in the myocardium. dti requires the acquisition of multiple images with diffusion weightings in different directions. reordering can be done in the multi - image dimension in the time dimension for the case of myocardial perfusion imaging and in the diffusion encoding dimension for the case of dti. as in the 1d case, reordering in the multi - image dimension for the images can give a better reconstruction when the signal changes in the dimension are not smoothly varying which is the case for perfusion imaging with respiratory motion and for dti. the constraint for the reordering in the multi - image dimension is represented as t(ptm)2 + 1, where t represents the gradient operator in the multi - image dimension and ptm is the data reordered in the corresponding dimension. the subscript t is used because the multi - image dimension is analogous to the temporal dimension of dynamic perfusion datasets. for a given image frame in the multi - image dataset, reconstruction can then be performed by using tv constraints in both space and multi - image dimensions and with reordering in the corresponding dimensions as follows : (4)c = wfm d22 + 1t(ptm)2 + 1 + 2x(pxm)2 + y(pym)2 + 1. a similar framework to (4) was proposed in for reconstructing undersampled radial myocardial perfusion data but without reordering and with a different temporal constraint. as in, (4) the reordering method for multi - image acquisitions (4) was tested using a dynamic phantom. gd was slowly injected into a tube running through a water phantom and fully sampled cartesian k - space data were acquired over time using an echoplanar imaging sequence on a siemens 3 t trio scanner. raw k - space data was then undersampled offline in a variable density (vd) pseudorandom fashion, in which 12 central low - resolution k - space lines were sampled for all time frames, and the remaining phase encodes were sampled in a pseudorandom fashion to give a net reduction factor of three. the acquisition matrix for reconstruction from the undersampled data was then performed according to (4) in two steps. in the first step, the information about the reordering was obtained using images obtained using the central low - resolution data from vd undersampling. the image estimates were reordered first in the time dimension only and the reconstruction was performed. in this step, the real and imaginary parts of the complex low - resolution image space data for each pixel were sorted independently in the time dimension according to their intensity values. the corresponding sorting orders for the real and imaginary parts were used for reordering the real and imaginary parts of the complex undersampled image space data. after performing an initial reconstruction with only temporal reordering results of the final reconstruction with reordering were compared to full data reconstructions using the standard inverse fourier transform and to the reconstructions without any reordering. the reordering method was applied on dynamic myocardial perfusion imaging with respiratory motion and on brain dti data. full cartesian raw k - space perfusion data were obtained using a siemens 3 t trio scanner using a turboflash saturation recovery sequence. the parameters for the data acquisition were tr = 1.8 milliseconds, te = 1 millisecond, flip angle = 12, gd dose = 0.025 mmol / kg, slice thickness = 6 mm, and acquisition matrix = 192 96. the data were acquired with informed consent in accordance with the university of utah institutional review board. brain dti image data were acquired on a ge 3 t scanner and full k - space data were generated from the magnitude image data by applying 2d fourier transforms on each diffusion encoding direction. full k - space data for both perfusion and brain dti data were undersampled in a variable density pseudorandom fashion outside the center and with the central 18 k - space lines sampled for each time frame, and reconstruction was performed in two steps as described in section 3.1. the net r value for the perfusion data was 2.5 while that for the dti data was 3. the results of the reordering method on the multi - image phantom data are shown in figure 7. figure 7(a) shows the image of a slice that was reconstructed from full data using ift at single time point. figure 7(b) shows the corresponding image reconstructed from r~3 data using stcr without any reordering. figure 7(c) shows the image reconstructed from r~3 data using stcr with reordering in both temporal and spatial dimensions. figure 7(d) shows the absolute difference image between figures 7(a) and 7(b) and figure 7(e) shows the absolute difference image between figures 7(a) and 7(c). the images in figures 7(d) and 7(e) are scaled to the same window level to highlight the differences. the results of the reordering method for dynamic myocardial perfusion imaging are shown in figure 8. figure 8(a) (column) shows images at two different time points in a perfusion sequence reconstructed from full perfusion data using standard inverse fourier transforms. figure 8(b) (column) shows the corresponding stcr reconstructions from r~2.5 data without any reordering in time or space dimensions. figure 8(c) (column) shows the corresponding stcr reconstructions with reordering in both time and space dimensions. the reordering helps in reconstruction when there is a significant respiratory motion in the data. we previously reported higher acceleration factors (r~4 with interleaved undersampling and r~5 with variable density sampling) in for myocardial perfusion, when there was minimal or no respiratory motion in the data. in the presence of significant respiratory motion, the method in was not fully able to resolve the artifacts from undersampling. the current method was better able to reduce the artifacts even in the presence of large respiratory motion. the results obtained by applying the reordering method on brain dti data are shown in figure 9. figure 9(d) compares the line intensity profiles for full data reconstruction (figure 9(a)) and the reconstruction without reordering (figure 9(b)). figure 9(e) compares the intensity profiles for full data reconstruction (figure 9(a)) and the reconstruction with reordering (figure 9(c)). the signals in figure 9(e) match better than those in figure 9(d). this paper introduces a modified constraint term for compressed sampling and constrained image reconstruction approaches. in general, it is possible to choose a regularization or constraint term which is a good model for the image being reconstructed. the basic idea of the reordering method is that it is possible to tailor these regularization or constraint operators to improve the reconstruction by reordering the signal. from a compressed sampling point of view reordering can be thought as a new set of data - specific transforms that further improve the sparsity. recently, a new method using a prior image constraint was proposed to improve the constrained reconstruction of dynamic ct images. the additional prior image constraint minimizes the l1 distance between the estimated solution and the prior image. the reordering method proposed here is different in the sense that it does not directly use the intensities in the prior image. the method uses only the ordering information from a prior image or set of images, which can be preserved if the prior images are at a different and unknown intensity scale as compared to the estimated solution. reordering can be done in multiple dimensions to improve the sparsity when the signals are not smoothly varying. here, we used images from the central low - resolution data to determine orderings initially in the multi - image dimension and then used the resulting images to obtain the spatial reordering for each image separately. this is because the central low - resolution data are more faithful in the multi - image dimension than they are in the spatial dimension. reordering in the multi - image dimension offered more significant improvements as compared to reordering in the spatial dimensions. this is because the temporal constraint generally plays a more important role in resolving the artifacts as compared to the spatial constraint for dynamic imaging. to obtain significant improvements just using spatial reordering improved ways of obtaining reordering, like doing a separate training scan before the actual acquisition, may help to achieve higher accelerations. the reordering method incorporates the ordering information of the signal to better match the total variation constraint assumption and thus improves the reconstruction from undersampled data. methods like adaptive regularization [18, 19 ] were proposed to improve the performance of tv regularization - based denoising techniques by using a priori information about the signal. in these methods, the regularization parameter is varied based on the a priori knowledge of the locations of edges and smooth regions in a signal, so that less regularization is done where strong edges are present in the signal. while this type of approach may be extended to tv constrained reconstruction, choosing the optimal amount of variation of the regularization parameter can be complicated for rapidly varying signals. an alternative method that can use such a priori information was explored here with the reordering method that uses only a single regularization parameter. the reordering method may not be appropriate when the ordering is incorrect in such a way that the total variation of the reordered full image sets is increased as compared to that of the original full data. in practice in such cases, l - curves can be used to determine to some extent if reordering is appropriate. l - curves can be computed for reconstructions with and without reordering and the tv norms corresponding to the optimal regularization parameters can be compared. if the ordering is appropriate, then the tv norm corresponding to the optimal regularization parameter with reordering is lower than that for the corresponding optimal regularization parameter without reordering. consider figure 10(a) which shows the l - curve obtained for the 1d randomly varying curve shown in figure 1(b), with a large number of random perturbations (~65%) in the exact ordering. the tv norm corresponding to the optimal is 36.08. when the number of random perturbations is decreased (~21%), the l - curve in figure 10(b) is obtained and the tv norm corresponding to the optimal is 5.02. the l - curve in figure 10(a) is overlaid in figure 10(b) for reference. the tv norm corresponding to the l - curve obtained without reordering is 14.05. the reconstruction time with image reordering was higher than the standard l1 norm reconstruction, as in each iteration, the estimated signal is reordered before computing the constraint update. for the data reordering in 1d case, the reconstruction time was 1.04 times slower, while that for the dynamic case with reordering in both spatial and temporal dimensions was 2.8 times slower. it took ~35 seconds per iteration on a linux machine with an amd processor (2.5 ghz) and 6 gb ram for stcr with reordering in multiple dimensions. the implementation was done in matlab and a host of methods including the use of gpus are available to greatly speed up reconstruction methods. a method involving reordering in time and space dimensions of the image estimates to better match the chosen constraints of an inverse problem - type reconstruction was presented. the method uses non - reordered reconstructions to obtain information about the signal to be reconstructed to determine the orderings of the pixel intensities. the orderings can be estimated from the low - resolution images when a variable density undersampling scheme is used, and from non - reordered constrained reconstructions. the method can be forgiving to errors in the images used to choose the orderings as the method does not use the data directly but uses only its ordering information. the method was shown to have promise for cardiac perfusion imaging and offered some small improvements for dti data. future improvements in finding more optimal reorderings, perhaps as part of the estimation process, may make the approach useful in a wide array of applications. | recently, there has been a significant interest in applying reconstruction techniques, like constrained reconstruction or compressed sampling methods, to undersampled k - space data in mri. here, we propose a novel reordering technique to improve these types of reconstruction methods. in this technique, the intensities of the signal estimate are reordered according to a preprocessing step when applying the constraints on the estimated solution within the iterative reconstruction. the ordering of the intensities is such that it makes the original artifact - free signal monotonic and thus minimizes the finite differences norm if the correct image is estimated ; this ordering can be estimated based on the undersampled measured data. theory and example applications of the method for accelerating myocardial perfusion imaging with respiratory motion and brain diffusion tensor imaging are presented. |
the term combat sports describes a group of sports whose competitive essence consists of direct combat between two competing athletes2, 3. a sports injury is defined as damage to part of the body resulting in inability to practice or compete normally4. because combat sports frequently involve striking, throwing, or immobilizing an opponent, some researchers suggest that they are more dangerous for athletes than other sports5. almost all injuries involved in combat sports are caused by mechanical energy, and this manifests as musculoskeletal injuries. musculoskeletal injuries usually occur when the body experiences overload through accident or overuse5, 6. many sporting events in korea revolve around combat sports such as judo, wrestling, kendo, boxing, taekwondo, and ssireum. ssireum, also called korean wrestling, is a form of korean martial arts in which two athletes use strength and various skills to throw their opponent to the ground7. combat sports can be classified into two types : strike and non - strike (throwing or immobilizing an opponent). strike sports involve striking an opponent directly by kicking or punching or by using a weapon.. the rules of taekwondo, or rather gyorugi, state that a competitor can only score by striking his opponent in the chest using only his fists or by kicking his opponent s head and torso using only the part of the foot below the ankle8, 9. boxing is a contest that involves striking the body or head of an opponent by means of a punch10. the rules of kendo state that the head, wrist, waist, or throat of an opponent can be struck with a bamboo sword11,12,13. taekwondo athletes wear a guard on the head, torso, arms, legs, and groin, while kendo athletes are equipped with protective armor on the head, torso, and forearms. conversely, direct striking is not permitted in non - strike sports, so players do not generally wear protective equipment. different rules apply in judo, wrestling, and ssireum, and the common goal of these sports is to overpower an opponent through force and skill7, 14,15,16. every combat sports event has physical or injury characteristics based on the combat method, rules, and skills used. even within the same sport, combat sports are the focus of much attention worldwide, and for this reason, there is a wealth of research available regarding the injuries sustained by combat athletes in various competitions. these data are typically classified according to event, injured body part, and the epidemiology of the injury. however, little research has been carried out on the playing style of combat athletes, especially in strike and non - strike sports. our study aims to describe the characteristics of injuries sustained in strike and non - strike combat sports so that the data can be used in sports physiotherapy. the participants included elite college players of the following sports : judo (47), ssireum (19), wrestling (13), kendo (30), boxing (16), and taekwondo (34). of the participants, 133 were male and 26 were female. in the case of ssireum and boxing, the volunteers had no physical or psychological conditions, and all of them provided informed written consent to participation in this study. for the purposes of the study, we divided the participants into two groups according to playing style : strike sports and non - strike sports. kendo, boxing, and taekwondo are strike sports, while judo, ssireum, and wrestling are non - strike sports. the questionnaire was filled out directly by the athletes under the supervision of a researcher. injury questionnaire, which contained three queries based on the following information regarding the injury type : 1. type of injury (muscular system) 2. injured body part (cephalic, body, upper limb, lower limb) 3. where and when the injury occurred and the aftermath (when the injury occurred, when the athlete returned to exercise, recurrence of the injury, side effects, psychological reaction after the injury) in the case of queries 1 and 2, more than one response was permitted in order to cover all injuries experienced by the athletes. injury in this study was defined as any bodily damage that interfered with competition or training. statistical analyses were conducted using the pasw statistics software (version 18.0) to calculate averages and standard deviations. data relating to the general characteristics of the athletes were expressed as the mean standard error (se), and these data were assessed using the student s t - test. we also analyzed the frequency of injury in each sport, and crosstabs were created for each question using a test and fisher s exact test. in accordance with the terms of resolution 5 - 1 - 20, december 2006, the protocol for the study was approved by the committee of ethics in research of the university of yongin. furthermore, all volunteers provided informed consent for participation in the study7, 8, 10. the general characteristics of the participants are described in table 1table 1.general characteristics of the combat sports playersvariablejudossireumwrestlingkendoboxingtaekwondogender (m / f)male (%) 34 (72.3)19 (100.0)9 (69.2)27 (90.0)16 (100.0)28 (82.4)female (%) 13 (27.7)-4 (30.8)3 (10.0)-6 (17.6)total (%) 47 (100.0)19 (100.0)13 (100.0)30 (100.0)16 (100.0)34 (100.0)age (yrs)20.40.219.90.320.10.320.00.219.40.319.80.3height (cm)173.01.3178.11.1169.34.5174.51.1173.42.9178.31.0weight (kg)79.42.896.15.477.94.570.81.167.92.969.41.7bmi (kg / cm)26.20.630.21.526.91.023.20.322.50.721.70.3career (yrs)9.20.49.30.55.90.58.60.56.00.77.80.4training timerunning (h / day)1.70.11.30.11.30.20.60.11.00.31.10.1major (h / day)2.00.02.10.12.20.23.70.21.90.12.60.1wt (h / day)1.40.10.80.11.10.10.40.11.00.10.80.1total (h / day)5.2.0.84.30.24.60.44.70.24.10.24.60.2days / week (days)6.00.55.10.15.30.15.60.15.50.16.00.1all data are presented as the meanse. m : male player ; f : female player ; bmi : body mass index ; wt : weight training. # : p < 0.05.. all combat athletes had experienced musculoskeletal injuries except for one kendo athlete (table 2table 2.crosstabs of the type of injury and sports playersvariablemusculoskeletal injuriesskin injuriesnerve injuriestooth injuriesetc.non-strike sportsjudo (%) 47 (100.0)9 (19.1)8 (17.0)3 (6.4)0 (0.0)ssireum (%) 19 (100.0)6 (31.6)4 (21.1)1 (5.3)0 (0.0)wrestling (%) 13 (100.0)5 (38.5)4 (30.8)2 (15.4)0 (0.0)strike sportskendo (%) 25 (96.2)5 (19.2)4 (15.4)0 (0.0)0 (0.0)boxing (%) 16 (100.0)4 (25.0)2 (12.5)3 (18.8)0 (0.0)taekwondo (%) 34 (100.0)6 (17.6)3 (8.8)4 (11.8)0 (0.0)non - strike sports (%) 79 (100.0)20 (25.3)16 (20.3)6 (7.6)0 (0.0)strike sports (%) 75 (98.7)15 (19.5)9 (11.7)7 (9.1)0 (0.0)x(p) - (0.490)0.763 (0.382)2.126 (0.145)0.114 (0.735)-fisher s exact test. skin injuries were most frequent among wrestlers in the case of non - strike sports and among boxers in the case of strike sports. there was a high incidence of nerve injuries such as neuralgia among the non - strike athletes ; however, this was not statistically significant (table 2). the order of frequency with regard to injury types was musculoskeletal injuries followed by skin, nerve, and tooth injuries in both groups (table 2). in terms of musculoskeletal injuries, dislocation was the most frequent injury in non - strike athletes, and the difference between the groups was significant. fracture was most common in the taekwondo athletes, followed by the boxers and judo athletes (table 3table 3.crosstabs of the type of musculoskeletal injury and sports playersvariabledislocationfracturerupture of ligamentrupture of musclesprain or strainbruiseherniated discetc.nssjudo (%) 9 (19.6)23 (50.0)27 (58.7)10 (21.7)22 (47.8)23 (50.0)7 (15.2)0 (0.0)ssireum (%) 1 (5.6)2 (11.1)13 (72.2)6 (33.3)8 (44.4)12 (66.7)4 (22.2)1 (5.6)wrestling (%) 3 (25.0)4 (33.3)4 (33.3)4 (33.3)11 (91.7)8 (66.7)5 (41.7)1 (8.3)sskendo (%) 0 (0.0)2 (8.0)7 (28.0)3 (12.0)15 (60.0)10 (40.0)7 (28.0)4 (16.0)boxing (%) 1 (6.3)9 (56.3)6 (37.5)3 (18.8)11 (68.8)12 (75.0)4 (25.0)0 (0.0)taekwondo (%) 2 (5.9)23 (67.6)19 (55.9)18 (52.9)20 (58.8)24 (70.6)6 (17.6)0 (0.0)nss (%) 13 (16.9)29 (37.7)44 (57.1)20 (26.0)41 (53.2)43 (55.8)16 (20.8)2 (2.6)ss (%) 3 (4.0)34 (45.3)32 (43.7)24 (32.0)46 (61.3)46 (61.3)17 (22.7)4 (5.3)x(p)6.695 (0.010)0.921 (0.337)3.185 (0.074)0.671 (0.413)1.015 (0.314)0.472 (0.492)0.080 (0.778)- (0.439)fisher s exact test.. there was a higher incidence of ligament rupture among the ssireum athletes than among athletes of any other sport. although the non - strike sports showed a higher incidence of ligament rupture than the strike sports, the difference was not statistically significant (table 2). over half of all the athletes had experienced sprains, strains, and bruising, and most of the wrestlers had been injured in this way. the incidence of bruising was high in both the strike and the non - strike sports. the boxers and taekwondo athletes showed the most bruising injuries, followed by the ssireum and wrestling athletes. the incidence of herniated disc was similar in both groups, with wrestlers among the most affected (table 3). there were differences in terms of injuries to the cephalic body parts, and neck injuries in particular were more frequent in the non - strike sports than in the strike sports. however, the incidence of neck injuries was similar in the kendo athletes and non - strike sports athletes. boxers had experienced more injuries to the face and head than the other athletes (table 4table 4.crosstabs of region of cephalic injury and sports playersvariableneckfaceheadetc.non-strike sportsjudo (%) 8 (21.1)4 (10.5)2 (5.3)0 (0.0)ssireum (%) 7 (43.8)1 (6.3)1 (6.3)0 (0.0)wrestling (%) 4 (30.8)2 (15.4)7.1 (7.7)0 (0.0)strike sportskendo (%) 8 (29.6)0 (0.0)0 (0.0)0 (0.0)boxing (%) 3 (18.8)7 (43.8)3 (18.8)0 (0.0)taekwondo (%) 0 (0.0)4 (12.5)0 (0.0)0 (0.0)non - strike sports (%) 19 (28.4)7 (10.4)4 (6.0)0 (0.0)strike sports (%) 11 (14.7)11 (14.7)3 (4.0)0 (0.0)x(p)3.981 (0.046)0.569 (0.451)- (0.707)-fisher s exact test. body part injuries were less frequent than other injuries in all sports, with the exception of lower back injuries. the ssireum athletes showed the highest frequency of lower back injuries, followed by the kendo and wrestling athletes (table 5table 5.crosstabs of region of body injury and sports playersvariableabdomenchestlow backbacketc.non-strike sportsjudo (%) 1 (2.6)2 (5.3)11 (28.9)1 (2.6)1 (2.6)ssireum (%) 0 (0.0)1 (6.3)11 (68.8)2 (12.5)0 (0.0)wrestling (%) 0 (0.0)2 (15.4)7 (53.8)1 (7.7)1 (7.7)strike sportskendo (%) 1 (3.7)0 (0.0)15 (55.6)2 (7.4)0 (0.0)boxing (%) 0 (0.0)1 (6.3)6 (37.5)1 (6.3)0 (0.0)taekwondo (%) 0 (0.0)1 (3.1)9 (28.1)0 (0.0)1 (3.1)non - strike sports (%) 1 (1.5)5 (7.5)29 (43.3)4 (6.0)2 (3.0)strike sports (%) 1 (1.3)2 (2.7)30 (40.0)3 (4.0)1 (1.3)x(p)- (1.000)- (0.255)0.157 (0.692)- (0.707)- (0.602)fisher s exact test.. there were no significant differences between the two groups in terms of body part injuries. shoulder and elbow injuries were frequent in the non - strike sports group, and injuries to the right wrist and hands were less frequent in the strike sports group. there was a lower incidence of elbow injuries in the ssireum athletes than in the athletes pursuing other non - strike sports (left=12.5% ; right=6.3%). wrist injuries were more common in the kendo (left=55.6% ; right=48.1%) and boxing athletes (left=50.0% ; right=50.0%) than in the athletes pursuing other sports, while hand injuries were highest in the boxers. no major differences between the groups were identified in terms of finger injuries, which were most frequent in judo, followed by boxing, taekwondo, and wrestling (table 6table 6.crosstabs of region of upper limb injury and sports playersvariableleft shoulderright shoulderleft elbowright elbowleft wristright wristhandsfingersetc.nssjudo (%) 16 (42.1)17 (44.4)12 (31.6)17 (44.7)12 (31.6)8 (21.1)4 (10.5)25 (65.8)0 (0.0)ssireum (%) 5 (31.3)8 (50.0)2 (12.5)1 (6.3)7 (43.8)6 (37.5)0 (0.0)5 (31.3)0 (0.0)wrestling (%) 8 (61.5)7 (53.8)7 (53.8)7 (53.8)3 (25.0)3 (23.1)1 (7.7)6 (46.2)1 (7.7)sskendo (%) 2 (7.4)4 (14.8)5 (18.5)3 (11.1)15 (55.6)13 (48.1)3 (11.1)3 (11.1)0 (0.0)boxing (%) 5 (33.3)5 (31.3)4 (25.0)4 (25.0)8 (50.0)8 (50.0)7 (43.8)10 (62.5)0 (0.0)taekwondo (%) 2 (6.3)1 (3.1)2 (6.3)2 (6.3)10 (31.3)10 (31.3)9 (28.1)19 (59.4)1 (3.1)nss (%) 29 (43.3)32 (47.8)21 (31.3)25 (37.3)22 (33.3)17 (25.4)5 (7.5)36 (53.7)1 (1.5)ss (%) 9 (12.2)10 (13.3)11 (14.7)9 (12.0)33 (44.0)31 (41.3)19 (25.3)32 (42.7)1 (1.3)x(p)17.299 (0.000)20.137 (0.000)5.638 (0.018)12.452 (0.000)1.679 (0.195)4.028 (0.045)8.047 (0.005)1.736 (0.188)- (1.000)fisher s exact test. nss : non - strike sports ; ss : strike sports. p < 0.05). there was no significant difference between the groups in terms of lower limb injuries. lower limb injuries were the most common body part injury in both groups. furthermore, there were no significant differences in terms of injuries to left and right knees and toes, but the frequency was slightly higher in the non - strike sports group. injuries to the left and right ankles were the most common lower limb injuries in both groups. hip joint injuries, on the other hand, were the least common lower limb injuries in both groups. overall, there was a higher incidence of lower limb injuries in taekwondo athletes than in the other sports (table 7table 7.crosstabs of region of lower limb injury and sports playersvariableleft kneeright kneeleft ankleright ankleleft hipright hipleft toesright toesetc.nssjudo (%) 20 (52.6)19 (50.0)24 (63.2)20 (52.6)4 (10.5)4 (10.5)15 (39.5)15 (39.5)0 (0.0)ssireum (%) 7 (43.8)8 (50.0)12 (75.0)10 (62.5)1 (6.3)1 (6.3)4 (25.0)5 (31.3)0 (0.0)wrestling (%) 7 (53.8)9 (69.2)7 (53.8)6 (46.2)1 (7.7)1 (7.7)0 (0.0)1 (7.7)2 (15.4)sskendo (%) 10 (37.0)12 (44.4)17 (63.0)13 (48.1)1 (3.7)1 (3.7)4 (14.8)4 (14.8)0 (0.0)boxing (%) 5 (31.3)6 (37.5)6 (37.5)8 (50.0)0 (0.0)0 (0.0)0 (0.0)1 (6.3)1 (6.3)taekwondo (%) 14 (43.8)17 (53.1)25 (78.1)24 (75.0)6 (18.8)5 (15.6)8 (25.0)9 (28.1)4 (12.5)nss (%) 34 (50.7)36 (53.7)43 (64.2)36 (53.7)6 (9.0)6 (9.0)19 (28.4)21 (31.3)2 (3.0)ss (%) 29 (38.7)35 (46.7)48 (64.0)45 (60.0)7 (9.3)6 (8.1)12 (16.0)14 (18.7)5 (6.7)x(p)2.092 (0.148)0.706 (0.401)0.000 (0.982)0.567 (0.451)0.006 (0.938)0.32 (0.857)3.167 (0.075)3.062 (0.080)- (0.447)fisher s exact test. p < 0.05). in the responses regarding what the athletes were doing at the time the injuries occurred, training fights (75.19%) were cited first, followed by competition (12.40%), weight training (5.43%), running (3.10%), stretching (2.33%), and other (1.55%). in terms of the causes of injury, violent training was the most common (45.37%), followed by chronic fatigue (13.89%), lack of warm - up and cooldown exercises (13.89%), excessive desire (12.96%), too much stress (4.63%), other causes (3.70%), distraction (2.78%), excessive weight reduction (0.93%), foul by an opponent (0.93%), and unreasonable demands by a coach (0.93%). the responses regarding when the athletes returned to exercise after injury were as follows : after partial treatment (56.00%), after complete recovery (19.33%), after a few days of rest (14.67%), and immediately after receiving the injury (10.00%). the responses regarding why injured athletes returned early included greed (48.51%), walking on eggshells around colleagues (20.15%), coach pressure (16.42%), and other (14.93%). in response to whether they suffered side effects after injury, 85.81% of the athletes answered yes similarly, in response to whether they relapsed after injury, 84.62% of the athletes answered yes, while 15.38% answered no. with regard to the athletes psychological reactions after injury, their main concern was relapse, followed by difficulty engaging in exercise, loss of ability, other concerns, and concern that a coach would react negatively. m : male player ; f : female player ; bmi : body mass index ; wt : weight training. # : p < 0.05. fisher s exact test. p < 0.05 fisher s exact test. p < 0.05 fisher s exact test. p < 0.05 fisher s exact test. p < 0.05 fisher s exact test. nss : non - strike sports ; ss : strike sports. p < 0.05 fisher s exact test. in this study, we surveyed the characteristics of injuries in combat sports and found that the physical characteristics differed among the athletes in each sport. skin and nerve injuries were the next most common, while tooth injuries occurred least frequently in the combat athletes. we compared combat sports events according to playing styles, and the results showed that there were obvious differences between the two groups. non - strike sports showed a greater incidence of dislocation than strike sports, while sprains, strains, and bruises were common in both groups. in terms of body parts injured, there were major differences between the groups regarding upper limb injuries. in the case of most upper limb injuries, the differences were statistically significant. finger injuries in the judo athletes generally occurred when they tried to catch their opponents using skill. injuries to the left and right shoulders and elbows were more frequent in the non - strike sports, whereas the right wrist and hands were more frequently injured in the strike sports. these results can also be seen in other studies. according to research on sports injuries in pediatrics, children learning judo are more prone to upper limb injuries than other children, while children learning taekwondo are more prone to lower limb injuries than other children5, 17. some researchers suggest that judo and wrestling athletes are more likely to incur upper limb injuries than lower limb injuries21, 22. nevertheless, the same studies indicate that elbow injuries are less common in ssireum athletes than in athletes pursuing other sports because, unlike judo and wrestling, ssireum does not involve attempting to catch an opponent during a match. also, ssireum athletes grab hold of the satba (a cloth - sash tied around the waist and thigh) of their opponents before their matches begin7. hand and finger injuries are more frequent in boxing, judo, and taekwondo athletes than in those pursuing other sports. we believe that the fists of boxers sustain a direct impact when they strike their opponents. however, some studies suggest that the reason for hand injuries in taekwondo athletes may be attributable to their skill in protecting their heads and necks using their upper limbs23. in this study, finger injuries were particularly common in the judo athletes, which was in line with the results of other studies on judo injuries4, 21. finger injuries typically occur in judo athletes when they try to catch opponents using skill. for example, neck injuries were more frequent in the non - strike sports than in the strike sports, but there were no differences between the groups in terms of cephalic injuries. some studies on combat sports injuries indicate that judo and boxing athletes incur many severe head and neck injuries15, 24. however, we did not conduct a survey on severe injuries such as brain hemorrhage and spinal cord injury because the participants in our study were young athletes and currently participating in their sports. there was a relatively wide weight range among the participants of the non - strike group, and injuries to both knees were less frequent in this group, but the difference was not statistically significant. more than half of the judo and wrestling athletes had experienced knee injuries. in line with other studies, we found that the most frequent injury in athletes pursuing two events was injury to the medial collateral ligament25, 26. injuries in combat sports were most likely to occur during training fights, and the athletes who had incurred injuries felt that the most common cause was violent training. to prevent injury in combat sports, sports physical therapists need to pay particular attention to athletes during training. of the athletes who returned to training following injury almost all of the athletes who had been injured experienced side effects and relapse of their injuries. this is why many researchers emphasize the importance of injury prevention education for athletes18, 27. to summarize our study, the type and location of the injury differs according to playing style in combat sports. in this regard, dislocation and injuries to the neck, shoulders, and elbows were found to be more frequent in non - strike sports, while injuries to the wrists and hands were found to be more frequent in strike sports. sprains, strains, bruises, and injuries to the lower limbs were very common in both groups. our data is based on a small sample size and therefore does not include all the injuries that may be incurred in combat sports. however, we suggest that the characteristics of injuries in combat sports could be classified according to playing style. this would enable our study to provide physical therapists and researchers with information on prevention of injury. sports physical therapists need to study precautions and interventions regarding sports injuries according to the playing style of athletes. in addition, we recommend further systematic studies on the various playing styles in combat sports in order to assist sports physical therapists in devising interventions28, 29. | [purpose ] this study describes the characteristics of injuries in strike and non - strike combat sports, and the results are intended for use in the area of sports physiotherapy research. [subjects and methods ] the study was conducted on 159 athletes involved in a variety of combat sports. the participants included elite college players of the following sports : judo (47), ssireum (19), wrestling (13), kendo (30), boxing (16), and taekwondo (34). of the participants, 133 were male and 26 were female. in the case of ssireum and boxing, all of the athletes were male. [results ] in the case of the combat sports, the types of injury and injured regions differed according to playing style. dislocation and injuries to the neck, shoulders, and elbows were more frequent in the non - strike sports, while injuries to the wrists and hands were more frequent in the strike sports. there was a high incidence of sprains, strains, bruises, and injuries to the lower limbs in both groups. [conclusion ] we suggest that the characteristics of injuries in combat sports differ according to playing style, and our study will therefore provide physical therapists and researchers with information that can be used to prevent injury. |
the separation of styrene (st) and ethylbenzene (eb) mixtures is important in the chemical industry. here, we explore the st and eb adsorption selectivity of two pillar - shaped macrocyclic pillar[n]arenes (etp5 and etp6 ; n = 5 and 6). both crystalline and amorphous etp6 can capture st from a st - eb mixture with remarkably high selectivity. we show that etp6 can be used to separate st from a 50:50 v / v st : eb mixture, yielding in a single adsorption cycle st with a purity of > 99%. single - crystal structures, powder x - ray diffraction patterns, and molecular simulations all suggest that this selectivity is due to a guest - induced structural change in etp6 rather than a simple cavity / pore size effect. this restructuring means that the material self - heals upon each recrystallization, and st separation can be carried out over multiple cycles with no loss of performance. |
|
the close proximity between the orbit and the middle cranial fossa provides a direct pathway for intracranial extension of the disease ; the mortality rate can be over 50%. it can mimic many other orbital conditions and a high index of clinical suspicion is required for early diagnosis and appropriate treatment in these patients. management of orbital aspergillosis comprises systemic antifungal agents and surgical treatment that could range from limited debridement to orbital exenteration. we report a case of orbital aspergillosis in an immunocompetent patient with impending intracranial invasion. a 64-year - old man with a known history of well - controlled diabetes mellitus and hypertension presented to the accident and emergency department with a 2-day history of sudden decreased vision in the right eye. temporal arteritis was suspected with an elevated erythrocyte sedimentation rate (71 mm / h), and oral prednisolone 1 mg / kg was prescribed immediately. when the patient was seen by the ophthalmologist 4 days after the start of the oral steroid, right eye vision had deteriorated from 0.6 to 0.05. he had a concomitant grade-4 relative afferent pupillary defect and ophthalmoplegia, but there was no optic disc swelling. computed tomography showed a contrast - enhancing orbital apex mass in the right orbit abutting the medial and lateral portions of the optic nerve with extension to the posterior ethmoid and sphenoid sinuses ; the lamina papyracea was also eroded (fig. in view of the rapid deterioration of the patient 's ocular condition and the unknown nature of the orbital apex mass, an endoscopic ethmoidal examination was performed which excluded ethmoidal sinusitis. inflamed orbital apical tissue was sent for histopathology which showed septate hyphae branching at right angles that was highly suggestive of aspergillus. mri of the orbit showed the continued presence of the previously identified orbital apex mass but with suspicion of cavernous sinus thrombosis at 10 days following the endoscopic drainage and biopsy. to eradicate the orbital apex abscess, a combined lateral orbitotomy and transethmoidal orbital apex drainage and decompression the patient was prescribed systemic voriconazole and right eye vision remained at hand movement with improving ophthalmoplegia 1 month after surgery. systemic workup including blood tests for autoimmune markers, hiv, immunoglobulin and paraprotein, and thorax / abdominal ct and pet scans for the source of infection were all unremarkable. a follow - up mri scan 3 months after surgery showed improvement of the inflammation at the right orbital apex (fig. oral voriconazole was continued for a total of 22 weeks and was then stopped in view of his stable clinical condition. the latest mri scan, performed 8 months after surgery, showed similar residual inflammatory changes. at the latest follow - up, 14 months after surgery, the patient was clinically stable, but with a 6-mm right enophthalmos. despite the persistent poor visual acuity of his right eye with no light perception and a marked relative afferent pupillary defect, the extraocular movement continued to improve especially for elevation and depression. orbital aspergillosis is frequently related to immunocompromised conditions such as intravenous drug addiction, hiv infection, malignancy and the use of systemic immunosuppressive agents. the rare incidence in healthy patients can often lead to misdiagnosis and delayed treatment that could aggravate the infection or cause fatality. our patient was first treated for arteritic ischemic optic neuropathy by the emergency physician and was started on systemic steroids, which likely worsened the condition in this case. orbital aspergillosis can also mimic other conditions including bacterial orbital cellulitis, idiopathic orbital inflammatory syndrome and neoplasia. the patient may complain of persistent retrobulbar pain and headache that preceded the ophthalmic findings of decreased vision, proptosis and ophthalmoplegia. the disease is typically unilateral, but bilateral involvement has also been reported in the literature. our patient 's ct scan showed an enhancing mass surrounding the medial and lateral parts of the optic nerve at the orbital apex, with erosion of the adjacent medial orbital wall. low - density foci within the lesion representing areas of microabscesses can sometimes be seen. on t2-weighted images, the lesion could be hypointense or with heterogeneous intensity due to associated inflammation, as in our case. because mri can give a detailed picture of soft tissue structures, the extent of the lesion and the involvement of adjacent structures such as cavernous sinus can be better assessed by mri. biopsy of the lesion was imperative ; however, the nature of the lesion (infective, inflammatory or neoplastic) was unknown. reported cases that required more than 1 biopsy to make the tissue diagnosis are not uncommon due to the difficulty in surgical access [5, 6 ]. microscopic examination of the specimen may show the organism with characteristic branching septate hyphae at 45 degrees. special stains including gomori methenamine silver and periodic acid - schiff stain allow easier identification of the organism. fine needle aspiration cytology (fnac) is well documented as a diagnostic tool in fungal infection involving other body parts, but is not commonly performed to investigate orbital lesions. presented 2 cases of fungal infection of orbital and periorbital tissue diagnosed by fnac and suggested the role of fnac in making an early diagnosis of orbital aspergillosis, thereby allowing early therapy in these patients. surgical treatment including limited local debridement, evisceration and exenteration has been reported with variable outcomes. the extent of surgical debridement and excision would depend on the extent of the disease, the disease progress and response to medical therapy, whereas the surgical approach used would depend on the location of the disease. after the initial endoscopic drainage for the apical collection, the patient 's condition continued to deteriorate with a further decrease in visual acuity and increased ophthalmoplegia. mri performed 10 days after the first operation showed the persistent apical abscess, which surrounded both the lateral and medial parts of the orbital apex. in view of the fact that the abscess showed a progressive lateral extension to the optic nerve, we decided on a combined endoscopic and deep lateral orbitotomy to tackle the invasive orbital apex lesion. this allowed for maximal eradication of the abscess, as a sole endoscopic drainage would have left the abscess undrained at the lateral part of the optic nerve. residual abscess and further intracranial extension may lead to possible cavernous sinus thrombosis and fatality. in our case, an oscillating saw was used for the lateral orbitotomy 2 cm above the frontal zygomatic suture and 2 cm below the zygomaticomaxillary junction to create a wide exposure. dissection continued in the subperiosteal plane towards the orbital apex using a freer elevator. under an operating microscope, a rongeur was used to remove small portions of the greater wing of the sphenoid near the superior orbital fissure and the inferior orbital fissure in an attempt to decompress the optic canal. as no pus a small collection of white pus was noted upon removal of intraconal fat close to the orbital apex. the periorbita was closed and lateral bone was replaced and secured with a titanium plate. the lateral canthal tendon was sutured to the periosteum overlying whitnall 's tubercle. to our knowledge, this is the first case report which describes the use of a combined open and endoscopic approach for orbital decompression and drainage in a case of orbital aspergillosis. in most instances, an endoscopic approach would have been adequate for orbital apical drainage. however, in this case, where the actual collection of pus was located intraconally and lateral to the optic nerve, endoscopic drainage has its limitations. during endoscopic drainage, dissection over inflamed tissue and taking care to avoid damaging the medial rectus muscle may limit access to the infected foci. we believe a combined approach may be required to allow adequate exposure to the orbital apex, and it allows the abscess in this region to be adequately drained when the abscess can be seen to extend lateral to the optic nerve and intraconally on imaging. in our patient, a combined approach limited the risk of intracranial extension of the disease and avoided the need for further extensive surgical debridement or even exenteration. a high index of clinical suspicion for orbital apex aspergillosis is important for clinicians when approaching patients presenting with decreased vision and orbital signs. in the treatment of culture - proven orbital aspergillosis a combined endoscopic transethmoidal and lateral orbitotomy approach may be considered in cases where the infection encases the optic nerve medially and laterally or with impending intracranial extension. | a 64-year - old man with a known history of diabetes and hypertension presented to the accident and emergency department with a 2-day history of sudden decreased vision in the right eye. temporal arteritis was suspected with an elevated erythrocyte sedimentation rate (71 mm / h), and oral prednisolone was started immediately. four days later, the patient 's right eye vision deteriorated from 0.6 to 0.05, with a grade-4 relative afferent pupillary defect and ophthalmoplegia. computed tomography showed a contrast - enhancing orbital apex mass in the right orbit abutting the medial and lateral portions of the optic nerve with extension to the posterior ethmoid and sphenoid sinuses. a transethmoidal biopsy was performed which yielded septate hyphae suggestive of aspergillus infection. ten days later, the patient 's right eye vision further deteriorated to hand movement with total ophthalmoplegia. mri of the orbit showed suspicion of cavernous sinus thrombosis. a combined lateral orbitotomy and transethmoidal orbital apex drainage and decompression were performed to eradicate the orbital apex abscess. drained pus cultured aspergillus. the patient was prescribed systemic voriconazole for a total of 22 weeks. the latest mri scan, performed 8 months after surgery, showed residual inflammatory changes with no signs of recurrence of the disease. to our knowledge, this is the first case report which describes the use of a combined open and endoscopic approach for orbital decompression and drainage in a case of orbital aspergillosis. we believe the combined approach gives good exposure to the orbital apex, and allows the abscess in this region to be adequately drained. |
even though adhesive technology has made a significant progress, numerous questions still remain unanswered. clinicians generally use high - speed diamond and carbide rotary instruments to prepare cavity designs for adhesive restorations. dentin bond strength were noted earlier with the use of these instruments.[14 ] therefore, information on the effects of cutting tooth with different rotary instruments on resin dentin bond strengths is essential. on the other hand, the thickness and the density of the smear layer created with bur or diamond abrasive have been reported to affect the bond strengths when total - etch and self - etch strategies were used.[58 ] hence, it is still unclear whether the cutting instrument or bonding technique is the crucial factor in resin the flow of fluid from the pulp to the dentino - enamel junction is the result of a slight but constant pulpal pressure. although the flow along individual tubules is very small, this is sufficient to oppose and greatly reduce the inward diffusion of the resin. hence, fluid movement in dentinal tubules plays a major role in determining the bonding. we aimed to evaluate the shear bond strength of composite to tooth by using different adhesive strategies and rotary instruments with simulated pulpal pressure in this study. sixty freshly extracted, noncarious human maxillary and mandibular molar teeth with divergent roots were collected. teeth free from caries, occlusal wear, sclerotic dentin and calcifications in the pulp chamber were selected for this study with the help of radiographs. all the specimens were cleaned to remove the adhering soft tissue or calculus and stored in distilled water which was periodically replaced. all the teeth were kept under positive hydrostatic intra - pulpal fluid pressure via pulp chambers filled with distilled water during tooth preparation and bonding procedures to simulate the clinical conditions. to create this mechanism, a hole of 4 mm in diameter was made in the furcation area of the teeth, between the roots. the roots were covered externally by one end of the rubber tube while the other end was connected to a plastic tube. the other end of this plastic tube was connected to a water - filled 2-ml plastic syringe. the junctions of the rubber tube and tooth, rubber tube and plastic tube, tube and syringe were sealed using cyanoacrylate glue and epoxy putty to maintain an air - tight seal of the water column. the teeth and the syringes were fixed to two thermocol pieces, which were in turn held in position by four burette holder stands. the column height of water was adjusted to 34 cm to provide approximately 25 mm hg of pressure, which is the average tissue pressure in a healthy pulp. group ia : total - etch bonding technique + diamond abrasive group ib : total - etch bonding technique + carbide bur group iia : self - etch bonding technique + diamond abrasive group iib : self - etch bonding technique + carbide bur this study evaluated the bond strength of composite to enamel and dentin. class ii proximal box - only cavities of standard dimensions, 4 mm bucccolingual, 4 mm occlusogingival and 2 mm mesiodistal, with facial and lingual walls straight and parallel to each other, were prepared [figure 1 ]. in all the groups, the tooth surface was prepared under copious water spray with a high - speed air turbine (150,000 rpm ; nsk, nakanishi inc. teeth in group ia and group iia were prepared using diamond abrasives and teeth in group ib and group iib were prepared using carbide burs. schematic representation of the cavity preparation dimensions at proximal view the prepared enamel surface was etched with 36% phosphoric acid (detrey conditioner 36, dentsply, detrey, germany) for 20 seconds. two coats of adhesive resin, xp bond universal total - etch adhesive (dentsply, detrey, germany), were then applied with an applicator tip and then photopolymerized using a light intensity of 600 mw / cm for 10 seconds. the prepared surface was treated with two coats of the bonding agent, xeno v (dentsply, detrey, germany) and photopolymerized. in this study the proximal box was restored using a nanoceramic composite (ceram x mono dentsply, detrey, germany), placed in 2-mm thick horizontal increments. each layer was photocured for at least 40 seconds from the occlusal side. as tooth preparations are commonly performed on dentin and enamel simultaneously in clinical situation, it is important to determine the effect of rotary instruments over adhesive bond strengths of enamel as well as of dentin. hence, in the current study, total bond strength values obtained by composite to both enamel and dentin surfaces were evaluated. specimens were removed from the assembly apparatus and mounted in plastic cylinders for loading at an angle of 45. this angle is important because the load applied at 45 angle stimulates high shearing stresses. the mounted specimens in the rings were stored in distilled water until testing was performed. bond strength between the restorative materials and tooth surface was measured in the shear mode with the universal testing machine (lloyd- bangalore, india). the specimens were mounted in a jig, while a straight knife - edge rod (2-mm wide) was applied at the tooth the total bonded surface area of the proximal box cavity preparation was 40 mm, and it was calculated as the sum of the surface area of the gingival wall (8 mm), facial wall (8 mm), lingual wall (8 mm) and axial wall (16 mm). loads were converted to megapascals by dividing the loads in newtons by the total bonded surface area. n (newtons) = fracture load total bonded surface area = 8 + 8 + 8 + 16 = 40 mm results were subjected to statistical analysis using two - way analysis of variance (anova) and t - test at 95% level of confidence to know the effect of rotary instrument and adhesive technique (independent variables) on the bond strength (dependent variable). in this study, sixty freshly extracted, noncarious human maxillary and mandibular molar teeth with divergent roots were collected. teeth free from caries, occlusal wear, sclerotic dentin and calcifications in the pulp chamber were selected for this study with the help of radiographs. all the specimens were cleaned to remove the adhering soft tissue or calculus and stored in distilled water which was periodically replaced. all the teeth were kept under positive hydrostatic intra - pulpal fluid pressure via pulp chambers filled with distilled water during tooth preparation and bonding procedures to simulate the clinical conditions. to create this mechanism, a hole of 4 mm in diameter was made in the furcation area of the teeth, between the roots. the roots were covered externally by one end of the rubber tube while the other end was connected to a plastic tube. the other end of this plastic tube was connected to a water - filled 2-ml plastic syringe. the junctions of the rubber tube and tooth, rubber tube and plastic tube, tube and syringe were sealed using cyanoacrylate glue and epoxy putty to maintain an air - tight seal of the water column. the teeth and the syringes were fixed to two thermocol pieces, which were in turn held in position by four burette holder stands. the column height of water was adjusted to 34 cm to provide approximately 25 mm hg of pressure, which is the average tissue pressure in a healthy pulp. group ia : total - etch bonding technique + diamond abrasive group ib : total - etch bonding technique + carbide bur group iia : self - etch bonding technique + diamond abrasive group iib : self - etch bonding technique + carbide bur class ii proximal box - only cavities of standard dimensions, 4 mm bucccolingual, 4 mm occlusogingival and 2 mm mesiodistal, with facial and lingual walls straight and parallel to each other, were prepared [figure 1 ]. in all the groups, the tooth surface was prepared under copious water spray with a high - speed air turbine (150,000 rpm ; nsk, nakanishi inc. teeth in group ia and group iia were prepared using diamond abrasives and teeth in group ib and group iib were prepared using carbide burs. the prepared enamel surface was etched with 36% phosphoric acid (detrey conditioner 36, dentsply, detrey, germany) for 20 seconds. two coats of adhesive resin, xp bond universal total - etch adhesive (dentsply, detrey, germany), were then applied with an applicator tip and then photopolymerized using a light intensity of 600 mw / cm for 10 seconds. the prepared surface was treated with two coats of the bonding agent, xeno v (dentsply, detrey, germany) and photopolymerized. in this study the proximal box was restored using a nanoceramic composite (ceram x mono dentsply, detrey, germany), placed in 2-mm thick horizontal increments. the prepared enamel surface was etched with 36% phosphoric acid (detrey conditioner 36, dentsply, detrey, germany) for 20 seconds. two coats of adhesive resin, xp bond universal total - etch adhesive (dentsply, detrey, germany), were then applied with an applicator tip and then photopolymerized using a light intensity of 600 mw / cm for 10 seconds. the prepared surface was treated with two coats of the bonding agent, xeno v (dentsply, detrey, germany) and photopolymerized. in this study the proximal box was restored using a nanoceramic composite (ceram x mono dentsply, detrey, germany), placed in 2-mm thick horizontal increments. as tooth preparations are commonly performed on dentin and enamel simultaneously in clinical situation, it is important to determine the effect of rotary instruments over adhesive bond strengths of enamel as well as of dentin. hence, in the current study, total bond strength values obtained by composite to both enamel and dentin surfaces were evaluated. specimens were removed from the assembly apparatus and mounted in plastic cylinders for loading at an angle of 45. this angle is important because the load applied at 45 angle stimulates high shearing stresses. the mounted specimens in the rings were stored in distilled water until testing was performed. bond strength between the restorative materials and tooth surface was measured in the shear mode with the universal testing machine (lloyd- bangalore, india). the specimens were mounted in a jig, while a straight knife - edge rod (2-mm wide) was applied at the tooth the total bonded surface area of the proximal box cavity preparation was 40 mm, and it was calculated as the sum of the surface area of the gingival wall (8 mm), facial wall (8 mm), lingual wall (8 mm) and axial wall (16 mm). loads were converted to megapascals by dividing the loads in newtons by the total bonded surface area. n (newtons) = fracture load total bonded surface area = 8 + 8 + 8 + 16 = 40 mm results were subjected to statistical analysis using two - way analysis of variance (anova) and t - test at 95% level of confidence to know the effect of rotary instrument and adhesive technique (independent variables) on the bond strength (dependent variable). in this study, in the experiment, failure generally occurred as a combination of the following three modes : 1) fracture of the tooth structure, 2) fracture of restoration and 3) dislodgement of restoration. thus, failure was never purely adhesive or purely cohesive, but of mixed type. table 2 shows the statistical analysis (anova) of difference in shear bond strength in between groups. the mean shear bond strength and standard deviation values of different groups comparisons of the groups by two - way anova test table 1 shows that the mean shear bond strength values ranged from 4.30 to 6.24 mpa. diamond abrasive showed the greatest values of bond strength with the adhesive techniques and was statistically significant compared to carbide bur. total - etch group gave better bond strength over the self - etch group, but was not statistically significant. table 2 shows that adhesive technique is not a significant factor influencing the bond strength. there was no significant difference between total - etch and self - etch bonding agents (p > 0.05). statistically significant difference was observed between carbide and diamond rotary instruments (p 0.05). adhesives are routinely tested for bond strengths via in vitro tests, prior to the commercialization, as these methods provide immediate results. these laboratory studies are generally performed on flat tooth surfaces [have most favorable configuration factor (c - factor) ], prepared by using silicon carbide abrasive papers. unlike in clinical situations, another drawback of these bond strength studies was that they had been conducted without maintaining intra - pulpal pressure during bonding. hence, the experimental setup and methodology of the current study was designed to overcome these drawbacks and to mimic the clinical situation. in the current study, total shear bond strength values obtained by the composite to both enamel and dentin surfaces were evaluated simultaneously. the lower shear bond strength values recorded in this study can be explained by the following hypothesis : the c - factor is the ratio of bonded to unbonded walls of the preparation. c - factor for dental restorations typically ranges from 0.1 to 5.0, with higher values (> 1.5) indicating a greater likelihood of high interfacial stresses. box - like class i cavities would have a c - factor of 5, whereas a flat surface, as in veneering, would have a c - factor of 1. laboratory studies conducted at a c - factor of 1 tend to overestimate bonding performance compared with complex cavity preparations with high c - factors. the shrinkage forces in class ii cavities are high and result in debonding of one or more walls, when compared to flat surfaces with low c - factor. a study reported a 20% reduc - tion in bond strength of cavity bonding group as compared to flat surface bonding group.in vivo, dentin is penetrated by network of fluid - filled dentin tubules of 1.02.5 m diameter. the presence of fluid inside the dentinal tubules tends to dilute the dentin conditioner, decreases its potential for demineralization of the inter - tubular and peri - tubular dentin and eventually results in lower bond strength. moreover, water content and permeability of dentin is not identical for all regions because of variations in the number of tubules per millimeter. tubule density and peri - tubular dentinal area decrease and inter - tubular dentinal area increases, with distance from the pulp. for example, the permeability of occlusal dentin is higher over the pulp horns than at the center of the occlusal surface. similarly, proximal dentin is more permeable than occlusal dentin and coronal dentin is more permeable than root dentin. the problem of poor bonding to dentin near the pulp is due to the high content of water. hence, it is difficult to achieve uniform wetness simultaneously on the axial, pulpal and gingival walls, and between the superficial and deep dentin in class ii cavities lower values of bond strength have been reported in previous studies when the intra - pulpal fluid pressure was maintained.the bonded surface area is extremely important in determining the bond strength as fracture strength is measured per unit area. this may explain why the bond strength results in the present study were lower than the results obtained in studies where smaller dimension bonding surface had been used. the c - factor is the ratio of bonded to unbonded walls of the preparation. c - factor for dental restorations typically ranges from 0.1 to 5.0, with higher values (> 1.5) indicating a greater likelihood of high interfacial stresses. box - like class i cavities would have a c - factor of 5, whereas a flat surface, as in veneering, would have a c - factor of 1. laboratory studies conducted at a c - factor of 1 tend to overestimate bonding performance compared with complex cavity preparations with high c - factors. the shrinkage forces in class ii cavities are high and result in debonding of one or more walls, when compared to flat surfaces with low c - factor. a study reported a 20% reduc - tion in bond strength of cavity bonding group as compared to flat surface bonding group. in vivo, dentin is penetrated by network of fluid - filled dentin tubules of 1.02.5 m diameter. the presence of fluid inside the dentinal tubules tends to dilute the dentin conditioner, decreases its potential for demineralization of the inter - tubular and peri - tubular dentin and eventually results in lower bond strength. moreover, water content and permeability of dentin is not identical for all regions because of variations in the number of tubules per millimeter. tubule density and peri - tubular dentinal area decrease and inter - tubular dentinal area increases, with distance from the pulp. for example, the permeability of occlusal dentin is higher over the pulp horns than at the center of the occlusal surface. similarly, proximal dentin is more permeable than occlusal dentin and coronal dentin is more permeable than root dentin. the problem of poor bonding to dentin near the pulp is due to the high content of water. hence, it is difficult to achieve uniform wetness simultaneously on the axial, pulpal and gingival walls, and between the superficial and deep dentin in class ii cavities. lower values of bond strength have been reported in previous studies when the intra - pulpal fluid pressure was maintained. the bonded surface area is extremely important in determining the bond strength as fracture strength is measured per unit area. this may explain why the bond strength results in the present study were lower than the results obtained in studies where smaller dimension bonding surface had been used. the frictional stresses, along with plastic and elastic deformation of tooth, during mechanical tooth preparation result in formation of an amorphous layer of organic and inorganic debris called smear layer. this smear layer covers the dentin surface, adheres weakly to the underlying dentin and occludes the entrance of the dentinal tubules. as a part of restorative procedure in adhesive dentistry, the smear layer should be either removed with phosphoric acid (total - etch technique) or modified with acidic primers (self - etch technique). after statistical evaluation, results concluded that the diamond rotary instrument gave a higher bond strength compared to the carbide rotary instrument with both the adhesive techniques. diamond abrasive cuts the surface by abrasion, while carbide bur cuts the surface by the cutting action of blades. earlier studies have concluded that the diamond abrasive creates a thicker smear layer and a rougher dentin surface with deeper and uniform grooves, when compared to those created by the carbide bur. hence, the rougher surface created by the diamond abrasives would have increased the surface area and facilitates better infiltration of the adhesive resins, resulting in better bond strength than carbide. based on the current adhesive techniques, there are two major approaches to produce an effective bond between resin and dentin. etch and rinse systems employ phosphoric acid to remove the smear layer, followed by primer / adhesive applications. on the other hand, non - rinsed self - etch systems utilize acidic monomers to modify the smear layer. the subsequent bonding process incorporates this modified smear layer within the resin dentin bond. earlier studies have reported that when total etch technique was used, bond strength of dentin was influenced by the rotary cutting instrument. they conclude that topography of the dentin surface after removal of the smear layer and demineralization of the dentin would reflect the coarseness of the abrasive and the coarser abrasives would increase the surface area. hence, it would be reasonable to assume that in the current study, the roughness created by the diamond abrasive must have influenced the bond strength with total - etch technique, resulting in higher bond strength. on the other hand, some studies have concluded that the bond strengths of the self - etch system are influenced by the thickness of the smear layer. they concluded that the self - etching primers produce less etching because of their relatively high ph (> 2). this leads to compromised smear layer removal, demineralization of the underlying dentin and further penetration of the adhesive resin, resulting in poor bond strength. on the contrary, this study showed higher bond strength of composite with diamond rotary instrument (thicker smear layer) than carbide bur (thinner smear layer) when bonded with self etch technique. his study concluded that carbide bur creates a fibrous smear layer composed of well - arranged and undisturbed collagen fibrils. this smear layer might not be as easily dissolved by acidic monomer when compared to thick smear layers created by diamond abrasives. however, further micro - morphological and chemical studies of resin dentin interfaces, as related to different surface preparation methods, are required to clarify this issue. apart from the initial bond strengths achieved in this study, unimpregnated collagen and smear debris of hybrid layer could affect the long - term bond strength and raise concern regarding the longevity of restorations. further research is required, as this study did not confirm the reliability of results based on scanning electron microscope (sem) analysis, which could have greatly helped in studying the fracture modes, micro - morphology of both smear layer and hybrid layer and surface topography of the substrate after tooth preparation. it may be difficult to compare the results of the current study to those of previous studies, as these studies were not done under same experimental conditions. innumerable studies have evaluated the bond strengths of adhesive material till date. but correlation between these in vitro bond strength studies and the clinical performance of adhesive materials has not yet been established. without such data, little confidence in adhesive behavior can be obtained. more importantly, without a thorough understanding of the performance of adhesives clinically, knowledge will never be gained relative to the adhesive mechanisms that are necessary for further research in this area. though such clinical data are delayed, in vitro studies with an experimental setup mimicking the clinical conditions should be conducted in the future for relevant results. within the limitations of the study, we conclude that : diamond abrasives resulted in better shear bond strength than carbide bur, with both the adhesive techniques androtary instrument was found to be a significant factor influencing bond strength. diamond abrasives resulted in better shear bond strength than carbide bur, with both the adhesive techniques and rotary instrument was found to be a significant factor influencing bond strength. | aim : the aim of this study is to evaluate the shear bond strength of composite to tooth using different adhesive techniques and rotary instruments under simulated pulpal pressure.materials and methods : sixty extracted human molars were randomly divided into two groups of 30 samples each (group i and ii), according to the adhesive technique followed (i.e. total etch and self etch groups). each group was further divided into two sub - groups (sub - groups a and b) of 15 samples each according to the cutting instrument (diamond abrasive or carbide burs) used. class ii cavities were made with diamond abrasive or carbide burs, and restored with nano - composite under positive intra - pulpal pressure. shear bond strength of the specimens were recorded simultaneously.results:after statistical evaluation using two - way anova and t - test, the mean shear bond strength values of the groups are as follows : group ia- 4.69 mpa, group ib-6.15 mpa, group iia-4.3 mpa, and group iib-6.24 mpa. it was seen that group iib showed highest bond strength followed by group ib. group ii a showed the least bond strength.conclusions:within the limitations of the study, diamond abrasive gave better bond strength than carbide bur with both the adhesive techniques. |
the main challenge of obesity treatment is not weight loss, but long - term weight loss maintenance. this widely accepted view is supported by several studies indicating that a healthy weight loss of 5%10% can be achieved through both behavioral1 and pharmacological treatments,2 but weight is gradually regained in a large percentage of individuals. weight loss maintenance is hindered by a complex interaction of environmental, biological, behavioral, and cognitive factors, which are only partly known.3 their constellation is presented in figure 1 ; they variably interact in individual patients to an extent that is difficult to forecast. this explains why a high number of individuals, after a successful weight loss period, regain most of the weight lost. however, a proportion of individuals successfully maintain a long - term weight loss,4 and the study of this cohort, who achieve the goal despite the strong pressures to regain weight, may help identify the factors associated with this desired outcome. the most recent developments of comprehensive lifestyle modification programs combine dietary and physical activity recommendations with specific cognitive and behavior strategies to improve patients adherence to a long - term weight management. they confirm that a large subgroup of treated patients is able to maintain a healthy weight loss in the long term.5 these promising data have stimulated the development of multidisciplinary lifestyle modification teams aimed at providing patients with a comprehensive long - term management of obesity. the aims of this narrative review are : 1) to provide a definition of weight maintenance ; 2) to review the data on long - term weight loss maintenance ; 3) to describe the characteristics of individuals who successfully achieve long - term weight loss ; 4) to review the evidence - based strategies to promote weight loss maintenance ; 5) to describe a multidisciplinary approach, based on lifestyle modification aimed at providing patients with a comprehensive long - term management of obesity and its complications. in the past 20 years, several definitions have been proposed to define successful weight loss maintenance. individuals who have intentionally lost at least 10% of their body weight and kept it off at least 1 year. rossner7 proposed that a sustained weight loss of about 5%10% of baseline body weight represents a definite degree of success. the 2013 aha / acc / tos guideline for the management of overweight and obesity in adults.8 the aforementioned definitions share the notion that successful weight maintenance does not necessarily imply a large weight loss, but that a modest 5%10% amount is sufficient. from a clinical point of view, this amount of weight loss significantly reduces the risk of developing type 2 diabetes in susceptible people,9 and eliminates most of the other risks associated with obesity.8 moreover, this modest weight loss also improves psychological functioning, in particular, mood, body image, and binge eating.10,11 the wing and hill definition6 introduces two additional indicators of weight maintenance. this criterion is important because several studies reported that unintentional weight loss is common and may have causes and consequences totally different from intentional weight loss.12 second, weight loss should be maintained at least 1 year. this criterion was set as a reasonable target for research on the factors that enable individuals to maintain weight loss. however, it is obvious that the term successful would require a much longer period of weight maintenance, hopefully life - long. only a few studies have tracked successful weight losers over long - term follow - up or assessed the effect of lifestyle modification programs on long - term weight maintenance. the national weight control registry (nwcr) was established in 1994 as a prospective investigation of long - term successful weight loss maintenance. in 2014, thomas reported a 10-year observation of self - reported weight loss and behavior change in 2,886 participants, recruited primarily through newspaper and magazine articles, who had lost at least 30 pounds (13.6 kg) and kept it off for at least 1 year. the mean weight loss of participants was 31.3 kg at baseline, 23.8 kg at 5 years and 23.1 kg at 10 years. of note, 87% of participants were still maintaining at least a 10% weight loss after 5 and 10 years. these impressive data show that long - term weight loss maintenance is possible in self - selected weight losers. the 19992006 national health and nutrition examination survey examined the prevalence and the correlates of long - term weight loss maintenance, defined as weight loss maintained for at least 1 year, in 14,306 us adults.13 the study found that more than one out of every six us adults who have ever been overweight or obese has accomplished long - term weight loss maintenance of at least 10%. although the period of weight maintenance was much shorter than in the case of the nwcr, the study confirms that also in nonselected individuals in the community, long - term weight loss is possible. a recent systematic review on the outcome of weight loss lifestyle modification programs found that at 1 year, about 30% of participants had a weight loss 10%, 25% between 5% and 9.9%, and 40% 4.9%.1 weight loss reaches its peak within 6 months of the start of treatment, and in the absence of a weight maintenance program, the trend begins to reverse thereafter, with 50% of patients returning to their original weight after about 5 years.14 these data indicate that traditional lifestyle modification programs require a greater focus on long - term maintenance to be considered successful in real terms.15 hopefully, trials based on the latest generation of weight loss lifestyle modification programs, including the most innovative and powerful cognitive behavioral procedures, should produce even better long - term results. the most striking example is the look ahead (action for health in diabetes) study, which assessed the effects of intentional weight loss on cardiovascular morbidity and mortality in 5,145 overweight / obese adults with type 2 diabetes, randomly assigned to intensive lifestyle intervention (ili) or usual care (ie, diabetes support and education [dse]).16 at year 1, more ili than dse participants had lost 5% of their initial weight (68.0% vs 13.3%), with the ili group showing an average weight loss of 8.5%, significantly greater than the 0.6% seen in dse participants. at year 8, 88% of both groups completed an outcomes assessment, which revealed that ili and dse participants lost, on average, 4.7% and 2.1% of their initial weight, respectively. among the ili and dse participants, 50.3% and 35.7%, respectively, lost 5%, and 26.9% and 17.2% lost 10%.17 these impressive figures show that well - conducted lifestyle modification programs can produce clinically meaningful long - term weight loss, but also that the look ahead was not able to completely solve the problem of weight regain in a large percentage of its participants. the 10-year follow - up of the data of the randomized clinical trial diabetes prevention program (dpp) showed that the cumulative incidence of diabetes, among adults at high risk, remained lower in the lifestyle group, compared with the metformin and placebo arms. this outcome occurred even if the original lifestyle group partly regained weight.18 the results of dpp underline that the effect of lifestyle modification programs may produce significant health benefits even if the weight lost is partly regained. a few data are also available on the long - term weight loss maintenance with pharmacotherapy. the xendos (xenical in the prevention of diabetes in obese subjects) trial, for example, randomized 3,305 patients to lifestyle changes plus either orlistat 120 mg or placebo, three times daily in a double - blind, prospective study. after 4 years, the mean weight loss was significantly greater with orlistat than placebo (5.8 vs 3.0 kg), and the cumulative incidence of diabetes was only 6.2% with orlistat and 9.0% with placebo, corresponding to a risk reduction of 37.3%.19 therefore, adding weight loss drugs to the lifestyle modification programs not only improves long - term weight loss, but also reduces the incidence of diabetes. the study of the characteristics of individuals who successfully achieve long - term weight loss is a potential useful strategy to elucidate the factors implicated in the long - term maintenance of intentional weight loss. the pivotal studies and the most recent published reports are presented in table 1.4,13,15,16,1929 the nwcr, described in the data on long - term weight loss maintenance section, is the most important and longest study assessing the characteristics of individuals who successfully lost and maintained their weight loss, as well as the strategies they use to maintain their weight loss.30 in a large nwcr analysis, the members reported an average weight loss of 33 kg, which was maintained for more than 5 years. the main strategies adopted by members to keep a stable weight in the long term were:31 1) high levels of physical activity (about 1 hour per day) ; 2) eating a low - calorie, low - fat diet ; 3) eating breakfast regularly ; 4) self - monitoring weight ; and 5) maintaining a consistent eating pattern across weekdays and weekends. an encouraging result is that the chance of longer - term success increases in members who had managed to keep their weight off for 2 years or more. finally, low levels of depression and disinhibition, and medical triggers (ie, general practitioners or specialists promoting weight loss for medical reasons and/or having a family member with a heart attack) were also associated with weight maintenance. a random digit - dial telephone survey that used a representative sample of the us adult population compared the behavioral strategies adopted by successful individuals who maintained weight loss (ie, an average weight loss of 37 pounds maintained for over 7 years) with those of individuals who regained weight and weight - stable controls. this study confirmed that maintainers reported higher levels of strenuous physical activity, greater frequency of self - weighing, and continued use of more behavioral strategies to control their dietary fat intake.32 these reports, unfortunately, failed to answer the key question, namely, why some individuals persist in practicing weight - control behaviors, and therefore maintain long - term weight loss, while others abandon it. the fact that several individuals are able to maintain weight loss in the long term clearly demonstrates that the biological pressure on individuals to overeat in order to restore their original weight (the set - point theory)33 is not the only mechanism involved in weight regain. complex behaviors involved in maintenance of long - term weight loss are in part influenced by conscious cognitive processes. nevertheless, cognitive factors have largely been neglected in traditional weight - loss lifestyle modification interventions, which are based mainly on the principles of behaviorism. the lack of an intensive cognitive intervention has been suggested as one of the reasons for their limited effectiveness in promoting long - term weight loss.34 the quovadis (quality of life in obesity : evaluation and disease surveillance) study, an observational study on 1,944 treatment - seeking obese patients in 25 medical centers authorized to treat obesity by the italian national health service,35 investigated several cognitive factors involved in the long - term weight loss. the study confirmed that some cognitive factors are associated with the amount of weight lost (ie, increased dietary restraint and reduced disinhibition), while others are associated with long - term weight loss maintenance (ie, satisfaction with results achieved, confidence in being able to lose weight without professional help).15 according to these data, there is an urgent need to evaluate the effectiveness of specific procedures and strategies designed to address the cognitive variables associated with negative treatment outcomes. these strategies might help improve the long - term efficacy of weight - loss lifestyle modification programs. the individual beliefs in the control over personal life (expressed by the concept of locus of control) have long been implicated in weight loss and weight loss maintenance, with conflicting results. very recently, the large medweight study confirmed an association between an internal locus of control and weight loss maintenance ; individuals with an internal locus of control (ie, subjects perceiving they have control over the environment and feeling able to control stimuli) tend to have longer and more sustained weight loss maintenance compared with subjects with external locus of control (ie, subjects perceiving that their life is regulated by something outside their control).25 the internal orientation of locus of control is intimately connected with self - efficacy, another psychological domain of interest for weight maintenance.36 notably, individuals with internal locus of control are more likely to lose weight and maintain weight loss without any external support.25 personality traits are habitual patterns of behavior, thought, and emotion that are relatively stable over the years, differ across individuals, and may play a role in long - term weight loss by influencing behavior.37 personality traits, psychological well - being, body image, and eating behaviors have been measured in the quovadis ii, an observational study of patients with obesity seeking treatment at eight italian medical centers. among personality traits and after adjusting for general confounders and eating disorder scores, only novelty seeking was significantly associated with the 10% weight loss goal at 12-month follow - up.38 similar data were reported in a weight loss lifestyle modification program, in which low novelty seeking was the only personality trait discriminating between patients who were successful in losing 10% and those who were unsuccessful.39 these data support the observation that healthy dietary control and dietary restraint (ie, the cognitive control of food intake) are associated with low novelty seeking scores.40 the poor compliance with long - term weight loss programs may also be attributable to the attachment style of individuals. support for this hypothesis comes from a study showing that 12-month weight loss was significantly greater in patients with secure attachment than in those with insecure attachment, and that the patient therapist relationship was rated more positively by those with secure attachment.41 these data require replication in a different setting ; they indirectly confirm that securely attached adults are more cooperative in a patient teixeira have recently published a meta - analysis on the determinants of healthy behavioral changes influencing weight loss and weight loss maintenance of subjects entering treatment programs. thirty - five studies were included in the analysis ; 42 possible mediators were selected, and their effects on weight loss / weight loss maintenance were assessed by stringent criteria. overall, the analysis of medium-/long - term weight control (limited to 21 studies) identified higher levels of autonomous motivation, self - efficacy and barriers, self - regulation skills (including self - monitoring), flexible eating restraint, and positive body image as positive mediators for weight maintenance. a few of them were also determinants of physical activity, whereas no consistent mediators were identified for healthy dietary intake. overall, this analysis points to large differences in the psychological characteristics of the treatment - seeking obese population, which suggests it is necessary to move from a standardized to a tailored approach. some data showed that group sessions delivered twice a month for 1 year after the weight loss phase, keeping patients in active treatment, help patients maintain the weight loss.44,45 there is also evidence that some people maintain large long - term weight losses with a long - term self - help group pressure and support.46 it has been speculated that an extended care model of treatment provides patients with the support and motivation needed to continue to practice weight control behaviors.47 recent studies assessed the efficacy of different interventions designed to improve weight loss maintenance, randomizing patients, after a period of weight loss, to one of two active interventions or to a control group with 1230 months of follow - up. the stop regain trial found that a face - to - face intervention and an internet - based intervention, both emphasizing daily self - weighing and self - regulation, improved weight loss maintenance over a period of 18 months, in comparison with a control group, which received quarterly newsletters.21 this was mainly the case with the face - to - face program. the weight loss maintenance trial found that, after 30 months, the participants allocated to the personal - contact group regained 1.5 kg less weight than those in the self - directed group, whereas those in the interactive technology - based group regained only 0.3 kg less than those in the self - directed arm.22 the tours (treatment of obesity in underserved rural settings) trial found that obese women from rural communities allocated to 26 biweekly sessions via telephone or face - to - face regained less weight (mean 1.2 and 1.2 kg, respectively) than those in the education control group (mean 3.7 kg).23 given the importance of motivation and support, a very recent feasibility trial of motivational interviewing showed that face - to - face and phone interviews improved retention in the study, and increased weight maintenance (2.8 kg vs the control group).27 all these studies confirm that the extended care approach, with monthly or more frequent contacts, in person or via telephone or internet, can improve successful weight loss. they also reduce the risk of weight regain during the maintenance phase, with the exception of ehealth interventions, where evidence for effectiveness is limited28 and was not confirmed in a meta - analysis.48 however, extended care is not easily accepted by all patients. in a study outside the research setting, only about 15% of cases were still in continuous care after 3 years.20 future studies should be designed to identify the patients for whom extended care is more suitable, and those more likely to benefit from a shorter duration of treatment. data from the quovadis study indicate that older patients whose primary motivation for weight loss is improving health are more compliant in continuous care, while patients satisfied with the results they achieved with treatment, and those confident of self - managing additional weight loss may avoid weight gain without continuous professional assistance.20 finally, all the studies of extended (rather than continuous or indefinite) treatment did not report sufficient follow - up to exclude the occurrence of weight regain after the end of treatment. to maintain weight loss, individuals must adhere to behaviors that counteract physiological adaptations favoring weight regain.49 physical activity has modest impact during the weight loss period, but becomes essential to weight maintenance.26 unfortunately, the level of daily energy expenditure necessary to prevent weight regain is high compared with the modern - day lifestyle,50 and subjects with metabolic disorders do not perceive physical activity as a relevant component of healthy behavior.51 although total daily energy expenditure is a strong predictor of weight maintenance in obese individuals,52 adherence to a prescribed exercise intensity and/or dose is quite low, also considering the perceived fatigue in accomplishing the desired intensity goals.53 in order to increase motivation and adherence, individuals experiencing problems during weight loss maintenance may be addressed to pleasant programs of leisure - time physical activity.54 among leisure - time activities, dancing has a remarkable place;55 dance stimulates positive emotions, social interaction, and relationships in the community, while the acoustic stimulation and the music might strengthen the beneficial effects of aerobic exercise on cognitive functions.56 in a pilot nonrandomized trial, a 6-month dance course was associated with similar weight changes but with lower dropout rates compared with self - selected physical activity programs.57 this underlines the importance of social support and pleasant activities to increasing adherence to lifestyle intervention programs and to maintaining long - term weight loss in motivated patients. self - body perception, enhanced self - confidence, and social support may thus increase self - motivation, facilitating weight loss maintenance in the long term, and overall quality of life.58 another approach is to add long - term drug treatment to lifestyle change in patients who have been unsuccessful with diet and exercise alone.59 the potential effectiveness of this approach has been demonstrated by the xendos trial.19 however, this strategy also does not completely fulfill the needs of obese individuals requiring treatment, for at least three reasons:60 1) most patients do not want to be treated with drugs ; 2) the long - term use may be associated with adverse physical complications ; and 3) there are situations (eg, pregnancy) in which the treatment would be inappropriate. a final, scarcely tested strategy is the provision of portion - controlled meals or meal supplements in the long term. an old study with positive results, reporting an average weight loss of 8% at 4 years,61 received partial confirmation in a study in which continuing education and support (monthly meetings) were continued after an intensive weight loss phase. during this 12-month weight maintenance phase, all subjects were encouraged to consume a minimum of 14 portion - controlled meals they had received, free of charge, during the weight loss phase.62 it is, however, unknown whether and how long this strategy may be maintained. lifestyle modification programs include a weight loss phase, consisting of 1624 weekly sessions in 6 months, followed by a weight maintenance phase, which should last at least 1 year with monthly or more frequent contacts in person or by telephone.8 the strategies for weight maintenance differ from those used to achieve weight loss, and should include frequent self - weighing (at least weekly), the consumption of a reduced calorie diet, and high levels of physical activity (> 200 minutes / week).8 in research settings, lifestyle modification programs have been usually delivered by trained nonphysician health professionals, such as dietitians, or subjects having master s degree training in exercise physiology, behavioral psychology, or health education. participants are educated in individual sessions (as in the dpp),9 in groups of about 1020 participants44 or in a combination of group and individual sessions (as in the look ahead study).16 the american medical association house of delegates has recently declared obesity a disease requiring treatment,63 because of the multiple medical, psychological, and functional complications reducing life expectancy and impairing quality of life.64 in this context, these heterogeneous complications require a comprehensive assessment aimed at developing a multidimensional and individualized treatment,64 which is obviously better managed by a multidisciplinary team. as mentioned earlier, the promising results from long - term weight maintenance obtained by the new - generation, lifestyle modification programs should stimulate the physicians within the multidisciplinary teams to receive adequate training in cognitive behavioral therapy to engage patients in lifestyle modification.65 engaged patients should then be referred to trained lifestyle counselors (also called lifestyle trainers or healthy lifestyle practitioners)66 working closely with any other component of an ideal lifestyle modification unit (eg, dietitians, psychologists, physical activity supervisors), to implement both the weight loss phase and the long - term maintenance phase of the lifestyle modification. the physician supervising the team should also manage the medical and psychosocial complications associated with obesity, referring the patients to other physicians and health professionals according to specific comorbidities. finally, the supervising physicians should periodically monitor the effects of treatment, both on lifestyle and on weight outcomes, and consider the opportunity to intensify the lifestyle approach with obesity drugs, residential rehabilitative treatment, and, in selected patients with severe obesity, bariatric surgery. this multidisciplinary approach based on lifestyle modification has the potential to address several obstacles to reach the optimum long - term management of obesity. the difficulty in helping obese patients maintain a long - term weight loss has been challenged by recent studies showing that several individuals are able to maintain acceptable weight loss targets in the long term and by the promising results achieved by the new - generation lifestyle modification programs. these promising results should stimulate the adoption of multidisciplinary approaches based on lifestyle modification for the management of obesity. only comprehensive programs administered by noneclectic teams addressing any mediator of lifestyle modification, managing the several medical and psychological complications associated with obesity and, if indicated, coupling the lifestyle treatment with other interventions (eg, drugs, residential inpatient treatment, bariatric surgery) might be successful. the effectiveness and the cost - efficacy of a stepped - care approach should be evaluated by future longitudinal observational studies. | the long - term weight management of obesity remains a very difficult task, associated with a high risk of failure and weight regain. however, many people report that they have successfully managed weight loss maintenance in the long term. several factors have been associated with better weight loss maintenance in long - term observational and randomized studies. a few pertain to the behavioral area (eg, high levels of physical activity, eating a low - calorie, low - fat diet ; frequent self - monitoring of weight), a few to the cognitive component (eg, reduced disinhibition, satisfaction with results achieved, confidence in being able to lose weight without professional help), and a few to personality traits (eg, low novelty seeking) and patient therapist interaction. trials based on the most recent protocols of lifestyle modification, with a prolonged extended treatment after the weight loss phase, have also shown promising long - term weight loss results. these data should stimulate the adoption of a lifestyle modification - based approach for the management of obesity, featuring a nonphysician lifestyle counselor (also called lifestyle trainer or healthy lifestyle practitioner) as a pivotal component of the multidisciplinary team. the obesity physicians maintain a primary role in engaging patients, in team coordination and supervision, in managing the complications associated with obesity and, in selected cases, in the decision for drug treatment or bariatric surgery, as possible more intensive, add - on interventions to lifestyle treatment. |
work - related accidents with exposure to biological material among health professionals are a cause for concern in view of the harm they may cause to institutions and workers. although the risk of occupational contamination by infectious agents has been known since 1940, the adoption of preventive measures against this contamination only gained strength after 1980, due to the discovery of the existence of the hiv virus and the acquired immune deficiency syndrome epidemic. the restricted working space of the oral cavity, the possibility of unexpected movement of the patient, the routine use of sharp instruments, added to the direct manipulation of blood, saliva and secretions make the clinical dental care an unhealthy moment and propitious to the occurrence of percutaneous injuries, facilitating the transmission of pathogens by cross - infection such as hepatitis and hiv viruses. a study carried out in taiwan revealed that 23% of dentists reported more than one injury with sharp instruments per week, mainly during clinical procedures (31%) or with needles (28%). in brazil, the prevalence of accidents with needlestick and sharp instruments among dentistry students is 25.3%. thus, this high prevalence, together with the fact that 52.4% of dentists do not know the existence of occupational postexposure protocols, highlights the need to educate these professionals about the risks to which they are exposed, making occupational accidents less frequent. therefore, knowing the profile of work - related accidents with biological material can be the starting point for the elaboration and planning of measures to improve working conditions. in view of the above, the aim of this study was to describe the epidemiological profile of dentistry students of a public university, victims of accidents with needlestick and sharp instruments. data were collected at the university center for health biosafety (uchb), department of dentistry, state university of paraba. uchb is a referral service for victims of accidents with sharp instruments, providing rapid testing, psychological support, and referral for prophylactic treatment, if necessary. a total of 137 medical records from january 2012 to november 2016 were analyzed, and information on the year of the accident, sex and age of the victim, time and place of occurrence (clinic, laboratory, or purge), and the time interval between accident and search for care were collected. as inclusion criterion, the victim of accident should be undergraduate dentistry students and should have suffered an accident with sharp instruments during activities developed in the course. protocols of dentistry students who sought service for other types of accidents were excluded as were those involving students from other health - care courses, teachers, and other professionals. data were tabulated and descriptively analyzed (absolute and percentage frequencies) using the spss - statistical package for the social sciences - version 18.0, ibm corp., this study followed recommendations of resolution 466/12 of the national health council that regulates research with human beings in brazil and was approved by the university of paraba ethics research committee under protocol no. the occurrence of injuries with needlestick and sharp instruments involving students was 43.1% (n = 59), with half in 2016 (50.9%). the age of victims was ranged from 19 to 37 years, with a median of 23 years. there was a predominance of women (66.1%) and accidents were occurred mostly in the afternoon (54.4%) and in the internal environment of dental clinics (70.7%) [table 1 ]. distribution of accidents with needlestick and sharp instruments according to year, sex, age, shift, and location of the accident. campina grande, paraiba, 2016 for 75% of the victims, the time interval between the accident and the search for specialized care was up to 2 h [table 2 ]. in the presence of some blood pathogens, injuries with sharp instruments can cause life - threatening infections and are therefore an important issue regarding the occupational safety of health - care workers. dentists are a part of a group at high risk of exposure to this type of accident, which is even more pronounced among dentistry students due to their few work experiences. even using basic precautions, dentists can be exposed to pathogens in the course of their work activities. to avoid transmission of cross - infection, some safety precautions should be taken, in addition to the vaccination and adequate compliance with postexposure protocols. dentists need caution both in patient management and in the handling of work instruments, especially in dealing with sharp instruments since injuries with needles and sharp instruments represent the highest occupational risk for contamination by pathogens transmissible by blood. although the underreporting of accidents with biological risk is a universal phenomenon among health professionals, this study showed an increase in the number of reports, with peak observed in the year 2016 (50.9%). this fact can be explained by the adoption of a policy of awareness of risks during dental care and by educational and preventive actions developed by the specialized assistance service. therefore, this evolution in accident report may reflect a greater perception of future professionals regarding the need for basic and immediate care required after exposure, leading them to search for the service. the dentistry literature shows that the occurrence of accidents with needlestick and sharp instruments increases with advancing age. older (experienced) dentists are more easily injured, either due to the greater overload of activities or to the oversight with infection control procedures. in this study, educational institutions play a key role in student attitudes about the adoption of correct habits for the control of cross infection. therefore, there is a great need for more incisive biosafety awareness by students to acquire the perception of risk and build the capacity of protection, making them understand the need for care and caution in performing dental procedures, shaping them into safe clinical day - to - day behavior. a predominance of females (66.1%) among victims was observed, corroborating previous findings. however, there may have been underreporting of accidents by male students since as women are more cautious about their health and tend to have greater preventive self - care, they are possibly more attentive to the need to follow postexposure protocols and therefore cause a greater demand for the service. most of the accidents were reported to occur in the afternoon (54.4%). when analyzing the curricular structure of the dentistry course, it was found that the afternoon period concentrates the greatest number of clinical disciplines, especially those whose procedures are more invasive, such as the practical activities of surgery. in addition, since the activities of the dentistry course are developed in two shifts, fatigue may have been an aggravating factor for the occurrence of accidents. the analysis of the environment in which accidents with needlestick and sharp instruments occurred showed that most (70.7%) were recorded in dental clinics. the risk for the occurrence of accidents during dental practice changes according to the work process, the specific care characteristics, the infrastructure, and the available resources. it is assumed that little practical experience and reduced clinical skills of students, added to the psycho - emotional factors, nervousness, anxiety, and pressure for being constantly evaluated, may have influenced the high number of case in this population. in addition, most curricula in dentistry schools involve clinical activities increasing the likelihood of accidents in this environment. a relevant finding of the present study was the high number of accidents recorded in the purge environment, a place where students perform the cleaning of instruments (29.3%). it is assumed that the rush to complete this activity due to the high student demand associated with inattention or negligence in the use of appropriate personal protective equipment is responsible for the occurrence of accidents. therefore, this activity should be supervised by professionals, raising awareness, and training students. to achieve maximum efficacy, postexposure chemoprophylactic interventions need to be initiated as soon as possible after the accident, preferably within 2 h. when analyzing the time elapsed between the time of the accident and the demand for assistance, it was found that in most cases, the time ideally recommended was respected. nevertheless, the prevalence of individuals who delayed seeking postexposure care was still high. this condition is worrying since the results of preventive protocols become poorly effective as the time elapsed for its initiation extends. neglecting safety procedures by dentistry professionals and students are still common since over time they tend to forget and ignore protocols. dental professionals are unaware of the procedure that must be followed in the occurrence of a biohazard accident. studies with dentistry students in brazil have shown that a low number of students who reported of having suffered accidents with sharp instruments sought guidance from teachers or the accident department of the institution. thus, it was observed that the understanding of dentistry professionals about accidents with biological risk and their preventive measures is inadequate. the knowledge about the pathogenesis of microorganisms, personal experience with accidents in the workplace, and the level of knowledge about their prevention can lead to changes in attitudes and practices, with greater precaution and less risk, thus influencing the reduction of these events. accidents with needlestick and sharp instruments can be avoided by cautious manipulation of these instruments, protection of drills and needles, and proper disposal of needles, which should not be bent, broken, or handled without the use of gloves. when they occur, accidents should be treated as a medical emergency, and prophylactic interventions should be initiated within 2 h from the occurrence to obtain greater preventive success. prevention is the main and most effective measure to avoid the occupational transmission of diseases in dental practice. considering that the preventive practices of dentistry students need to be improved. periodic training and the presence of a permanent educational project with emphasis on prevention, awareness, and follow - up of occupational accident cases should be a part of the routine of dentistry schools. in addition, focusing on means to instigate positive preventive practices among dentistry students should be considered as one of the main goals to be achieved by educational institutions, which is a subject that needs to be approached with priority. accidents with needlestick and sharp instruments had a high frequency and occurred mainly with female students and in the afternoon in the clinical setting, and the time interval between exposure and the search for care complied with brazilian recommendations. | background : the occurrence of occupational accidents is common among students and dentists. the present study is aimed to evaluate the prevalence and characteristics of needlestick and sharp instrument injuries among dentistry students.materials and methods : a documentary research was carried out with data being obtained from the analysis of 137 medical records of injuries caused by needlestick and sharp instruments occurring in the period from 2012 to 2016 and were analyzed regarding the characteristics of the victim (gender and age) and the accident (year, time, environment, and time interval between exposure and search for care). data were organized in the statistical package for social sciences software version 18 and were presented through descriptive statistics.results:the occurrence of accidents was high (43.1%), with the predominance of female victims (66.1%) and aged up to 23 years (55.9%). the majority of events occurred in the afternoon (54.4%), in the clinical setting (70.7%), and in 75% of the cases, the search for care occurred within 2 h after exposure.conclusion:accidents with needlestick and sharp instruments have high frequency and involve mainly female students. they are more common in the afternoon and in the clinical setting and the time interval was between exposure and the search for care complied with recommendations of the brazilian legislation. |
case identification numbers were matched between the june 26, 2015, world health organization (who) line list (2) and daily text - based mers reports from the south korean mohw (1). matching between the 2 data sources was conducted by using age, sex, and date of reporting. the who line list included additional risk factor data, which were cross - validated against meta data from the mohw. the mohw daily mers reports provided real - time outcome information. as of july 15, outcomes and covariates were publicly available for 159 of 186 case - patients, all of whom became ill during weeks 27 of the outbreak. we used this subset to describe the patient population, evaluate risk factors for death by using logistic regression models, and assess predictors of time from onset to diagnosis and onset to discharge by using cox proportional hazards models. five potential covariates were analyzed : sex, age, concurrent health condition status, health care worker status, and time from onset to diagnosis. for time - to - event analyses, patients were categorized into outbreak weeks by date of onset. we tested the cox proportional hazards assumption by using schoenfeld residuals and included an interaction term for predictor and follow - up time. of the 159 case - patients analyzed, 94 (59%) were men. per who definitions, 25 (16%) had concurrent health conditions and 22 (14%) were health care workers. age was normally distributed (range 1687 years, mean [sd ] 55 [15.9 ] years). time from onset to diagnosis was positively skewed : median 4 days (interquartile range [iqr ] 27 days). median time from diagnosis to death and from diagnosis to discharge were 13 (iqr 1725.3) and 22 (iqr 916.5) days, respectively. as of july 15, a total of 35/159 cases analyzed were considered fatal, which yielded an estimated case - fatality rate (cfr) of 22%. univariate logistic regression models for each risk factor showed that older age and having a concurrent health condition were associated with death (both p<0.001) ; both variables remained significant after we adjusted for all 5 variables in a multivariate logistic regression model (table). the model estimated that odds of dying were 7 times higher for persons with concurrent health conditions than for persons without these conditions (odds ratio 7.14, 95% ci 2.2722.41). furthermore, for every 1-year increase in age, odds of dying increased by 12% (odds ratio 1.12, 95% ci 1.071.17). time from onset to diagnosis decreased from a median of 10 days during outbreak week 2 (iqr 8.012.0 days) to 2 days during week 7 (iqr 1.02.0 days). there was a 43.7% average increase in hazard of diagnosis per week by a univariate cox proportional hazards model (p<0.001). separate univariate cox models showed that no recorded risk factors were associated with this change. time from onset to discharge for patients who survived decreased from a median of 27 days during outbreak week 2 (iqr 22.032.0 days) to 19 days during week 7 (iqr 17.023.0). univariate cox proportional hazards analyses estimated a 34% average increase in the hazard of discharge per week (p<0.001), a 63% increase for health care workers (p = 0.046), and an 8% decrease for every 1-day increase in time - to - diagnosis. multivariate analysis controlling for all risk factors showed that the increase in hazard by week decreased to 26% (p = 0.032) ; no other covariates remained significant. we found that older age and preexisting concurrent health conditions were associated with an increase in odds of death from mers. although being a health care worker appears to be protective, the association is not significant, probably because only 1 health care worker had died of mers as of july 15, 2015. time from onset to diagnosis was not an indicator for death, which suggests that the rapidity with which a patient receives supportive care may be of marginal consequence. similarly, although being a male patient seems to increase odds of death, this relationship was not significant. on the basis of case - patients who had known outcomes through july 15, the ongoing mers outbreak in south korea had an estimated cfr (22%) that was half the cfr (44%) for all known case - patients with mers in saudi arabia (3), but a cfr similar to that calculated for patients with only nonsporadic illness (21%) (4). because 19 (10%) of 186 case - patients reported remain hospitalized, the final cfr of the outbreak might be higher than our current estimate. however, the proportion of patients who died (18%19%) has been fairly stable since june 27 (figure 2), which might indicate an asymptotic approach toward the final outbreak - specified cfr (57). if so, the final cfr associated with the mers outbreak in south korea during 2015 might be < 22%. if all remaining hospitalized case - patients died, the final outbreak cfr would be 29%, which provides an upper limit for our current estimate of 22% excluding additional cases. cumulative proportion of case - patients with middle east respiratory syndrome who were hospitalized, recovered, and died, south korea, as of july 15, 2015. cumulative recoveries and deaths over time were calculated by date of outcome ; when date of outcome was unavailable, date of reporting was used. although all 186 reported case - patients are included in this plot, only case - patients with known outcomes (e.g., recovered, died) and dates of onset were included in the analyses (n = 159). a total of 16 (64%) case - patients with mers in south korea who had concurrent health conditions died, compared with 19 (14%) case - patients without concurrent health conditions. this finding is comparable to that in a mers study in saudi arabia, which reported a 60% cfr for a study population in which 45 (96%) patients had concurrent health conditions (8). although only 25 (16%) case - patients had documented concurrent health conditions, the mers outbreak in south korean during 2015 has been largely nosocomial in nature. this finding suggests that observed differences between average cfrs in south korea and saudi arabia might be driven in part by differential rates of concurrent health conditions for susceptible persons. although such data enable preliminary epidemiologic research during an ongoing outbreak, case information is stringently restricted to protect patient privacy. because of this limitation, a follow - up analysis will be conducted pending availability of additional covariate data on potentially relevant biometrics (e.g., blood pressure) and behaviors (e.g., tobacco use), as well as outcomes for patients still hospitalized. despite these limitations, we found that risk factors for death among patients with mers in south korea who had known outcomes (age and concurrent health conditions) were similar to those identified for mers case - patients in saudi arabia (810). given these epidemiologic similarities and assuming that inherent virulence of mers coronavirus is not context specific, the cfr difference might be caused not only by differential prevalence of risk factors but also by treatment or surveillance disparities. time to diagnosis decreased during the first 7 outbreak weeks, which probably contributed to the reduced length of hospitalization for patients who recovered and indicates that supportive care in south korea might be highly adaptive. furthermore, as reported by cowling. (11), intensive case - finding activities might have produced more comprehensive diagnosis and reporting, thereby capturing less severe cases. in either event, given the frequency of importation events (12) and propensity for super - spreading (13), these findings provide information about mers and mers coronavirus in south korea that might be useful in improving early case detection and preventing death. | as of july 15, 2015, the south korean ministry of health and welfare had reported 186 case - patients with middle east respiratory syndrome in south korea. for 159 case - patients with known outcomes and complete case histories, we found that older age and preexisting concurrent health conditions were risk factors for death. |
silver nanoparticles have unique optophysical properties1 and have been used as catalysts and antimicrobial, antiseptic, and imaging agents.26 applications of nanostructures depend on their size and shape.6 development of new methods for synthesis of nanostructures that allow control of size and shape are necessary to generate new nanostructures that can be employed in various applications. hollow nanostructures were used to encapsulate and control release of drugs,7,8 cosmetics, and nucleic acids,9 and have enhanced catalytic properties owing to their large surface area.10,11 self - assembly of anisotropic silver nanostructures has been used for synthesis of biomaterials and semiconductor copolymers ; however, controlling shape and size of such structures is still a challenge.1214 there are several methods for fabrication of silver nanostructures with different shapes such as nanowires,15 nanorods,16,17 and nanotubes.15 however, these methods employ polymers (such as polyvinyl pyrrolidone or polyethylene glycol), toxic surfactants (such as cetyltrimethylammonium bromide, benzyldodecyldimethylammonium chloride), and reducing agents (such as sodium borohydride).1719 therefore, there is a need to develop new methods for safe and inexpensive synthesis of anisotropic silver nanostructures. the authors have developed a fast, inexpensive, and safe method for the synthesis of three - dimensional (3d) hollow flower - like silver nanostructures which may be useful in medical applications. the synthesized hollow structures with higher pore areas may have enhanced drug encapsulation capacity and can be used for sustained release of drugs. the method employs nontoxic degradable chemicals and allows control of size and shape of the synthesized structures. silver nitrate (agno3), trisodium citrate (tsc), dextrose, and sodium hydroxide (naoh) were purchased from sigma - aldrich chemie gmbh (munich, germany). hydrogen chloride and nitric acid were purchased from el - gomhouria co, (cairo, egypt). double deionized water (ddi) was prepared using a milli - q system (direct - q 3, model zrqs0p0ww, millipore corporation, billerica, ma) with a resistivity of 18 mcm. the hollow flower - like structures were synthesized by the chemical reduction of agno3 in aqueous solution. briefly, a round - bottom flask was cleaned thoroughly with aqua regia (3:1 hydrogen chloride : nitric acid) then rinsed with ddi water. agno3 (28 m) was added to 39 mm dextrose solution and dissolved in water at room temperature. naoh (0.01 mm) was added during stirring. the solution color changed from colorless to deep green, brown, yellow, or gray depending on the amount of agno3, dextrose, naoh, and tsc (16 mm). following color change, the solution was stirred for an additional 5 minutes, centrifuged, and washed three times with ddi water to remove excess dextrose. the size and morphology of the synthesized silver nanostructures were studied using scanning electron microscope (leo supra 55 ; carl zeiss ag, oberkochen, germany). the samples were mounted on a silicon slide and left 2 hours to dry before imaging without sputter coating ; particle size was reported as the mean diameter of randomly selected structures. the samples of the prepared silver nanostructures were diluted to 1/10 times in ddi water, and max measured using lambda 950 spectrophotometer (perkinelmer, waltham, ma). nitrogen isothermal adsorption was measured at 77 k on an asap 2010 porosimeter (micromeritics instrument corporation, norcross, ga). the pore size, volume, and area distribution were calculated using the barrett joyner halenda equation. the 3d morphology, surface area, and roughness of the prepared silver anisotropic nanostructures were studied using atomic force microscope (veeco dimension 3100 scanning probe microscope, veeco instruments, inc, plainview, ny). the samples were mounted on a silicon slide and left 2 hours to dry before imaging. silver nitrate (agno3), trisodium citrate (tsc), dextrose, and sodium hydroxide (naoh) were purchased from sigma - aldrich chemie gmbh (munich, germany). hydrogen chloride and nitric acid were purchased from el - gomhouria co, (cairo, egypt). double deionized water (ddi) was prepared using a milli - q system (direct - q 3, model zrqs0p0ww, millipore corporation, billerica, ma) with a resistivity of 18 mcm. the hollow flower - like structures were synthesized by the chemical reduction of agno3 in aqueous solution. briefly, a round - bottom flask was cleaned thoroughly with aqua regia (3:1 hydrogen chloride : nitric acid) then rinsed with ddi water. agno3 (28 m) was added to 39 mm dextrose solution and dissolved in water at room temperature. the solution color changed from colorless to deep green, brown, yellow, or gray depending on the amount of agno3, dextrose, naoh, and tsc (16 mm). following color change, the solution was stirred for an additional 5 minutes, centrifuged, and washed three times with ddi water to remove excess dextrose. the size and morphology of the synthesized silver nanostructures were studied using scanning electron microscope (leo supra 55 ; carl zeiss ag, oberkochen, germany). the samples were mounted on a silicon slide and left 2 hours to dry before imaging without sputter coating ; particle size was reported as the mean diameter of randomly selected structures. the samples of the prepared silver nanostructures were diluted to 1/10 times in ddi water, and max measured using lambda 950 spectrophotometer (perkinelmer, waltham, ma). nitrogen isothermal adsorption was measured at 77 k on an asap 2010 porosimeter (micromeritics instrument corporation, norcross, ga). the 3d morphology, surface area, and roughness of the prepared silver anisotropic nanostructures were studied using atomic force microscope (veeco dimension 3100 scanning probe microscope, veeco instruments, inc, plainview, ny). the samples were mounted on a silicon slide and left 2 hours to dry before imaging. the size and morphology of the synthesized silver nanostructures were studied using scanning electron microscope (leo supra 55 ; carl zeiss ag, oberkochen, germany). the samples were mounted on a silicon slide and left 2 hours to dry before imaging without sputter coating ; particle size was reported as the mean diameter of randomly selected structures. the samples of the prepared silver nanostructures were diluted to 1/10 times in ddi water, and max measured using lambda 950 spectrophotometer (perkinelmer, waltham, ma). nitrogen isothermal adsorption was measured at 77 k on an asap 2010 porosimeter (micromeritics instrument corporation, norcross, ga). the pore size, volume, and area distribution were calculated using the barrett joyner halenda equation. the 3d morphology, surface area, and roughness of the prepared silver anisotropic nanostructures were studied using atomic force microscope (veeco dimension 3100 scanning probe microscope, veeco instruments, inc, plainview, ny). the samples were mounted on a silicon slide and left 2 hours to dry before imaging. the size and shape of the synthesized silver nanostructures were studied using scanning electron microscopy and particle size was reported as mean diameter of randomly selected structures, as shown in figures 1 and 2. i) presents micrographs of samples prepared using varying concentrations of agno3, dextrose, and naoh. figure 1(a c) presents 3d hollow silver nanostructures synthesized using different concentrations of agno3 ranging between 28 m. the particles have a 3d hollow flower - like shape, with branched edges and highly rough surface and particle size ranging between 0.20.5 m with interconnected pores in the range of 50200 nm diameters (figure 3). pore interconnection, distribution, roughness, and branched edges increased with increasing agno3 concentration. figure 1(d f) presents samples prepared with varying concentrations of dextrose ranging between 39 mm. the particles have a 3d hollow flower - like shape with more branched edges, highly rough surface, and more multilayers and interconnected channels with ordered cross layers. particles had distributed internal pores in the range of 2080 nm. layer distribution, order, and interconnection increased with increasing dextrose concentration while branched edges decreased with increasing dextrose. particles have a 3d hollow flower shape with highly branched edges, highly rough surface, and elongated multilayers. particle size ranged between 0.21.6 m (figure 3) with distributed pores in the range of 50100 nm. the layers, pores, interconnection, and branched edges increased with increasing naoh concentration. figure 2(j m) presents samples prepared with varying concentrations of tsc ranging between 16 mm. particles have a flower - like shape with size between 0.452.3 m (figure 3). increasing tsc concentration above 6 mm resulted in large multiwall hollow scaffold - like structures that ranged in size between 3.05.0 m (figure 3). experiments were repeated several times and reproducible results were obtained indicating the ability to synthesize 3d hollow flower - like silver nanostructures with the ability to control their sizes and shapes by varying the concentrations of the four chemicals discussed above. it should be noted that carrying out the syntheses at different temperatures, between 25c and 70c, alone or in combination with varying concentrations of different chemicals had no effect on particle size or shape. the ultraviolet - visible spectra (figure 4a) of samples prepared with varying concentrations of agno3 (figure 1a c) showed absorption maxima between 410450 nm. samples prepared with varying dextrose concentration showed absorbance bands at 430 nm, 450 nm, and 450500 nm (figure 4b). figure 4c shows absorption spectra of samples prepared with varying naoh concentrations where absorption maxima were detected between 410600 nm. figure 4d shows spectra of samples prepared with varying concentrations of tsc where two absorption bands were detected at 280300 nm and 500525 nm. increasing concentrations of agno3, dextrose, naoh, or tsc resulted in increased size of silver nanostructures, silver nanostructures were investigated by atomic force microscopy where surface area, roughness, and surface area diffraction were 49.37 nm, 33.5 nm, and 14.6%, respectively (figure 5). figure 6(a d) shows the surface area, pore size, pore area, and pore area relative to varying concentrations of dextrose. porosimetry studies indicated that the surface area of 3d hollow flower - like nanostructures is high (25240 m / g) due to the presence of interconnected pores. the dextrose acted as a reducing agent of agno3 and as a preliminary capping material. tsc acted as a capping material and together with dextrose enhanced silver dispersion and directed growth of particles to highly anisotropic structures. growth of particles depended upon concentrations of dextrose and tsc adsorbed on the surface of silver particles. naoh augmented reduction and supported growth of nanoparticles to 3d hollow flower - like structures. the uniformity of size and shape of the 3d hollow flower - like silver nanostructures can be controlled by manipulating agno3, dextrose, naoh, and/or tsc concentrations. the smallest flower - like nanostructures (up to 200 nm) were prepared by using 2 m agno3, 3 mm dextrose, and 0.01 mm naoh. porosimetry analysis showed 3d hollow nanostructures with high surface area ranging between 25240 nm / g and pore area increased with increasing dextrose concentration. atomic force microscopy studies indicated that the prepared particles have 3d structures with surface roughness of 33.5 nm and surface area diffraction of 14.6%. because of their unique properties and ease of preparation, the prepared structures may serve as superior vehicles for long - term release of drugs and effective antimicrobial agents and also hold the promise as effective tools for catalysis. the use of nanoparticles as drug carriers is limited by the toxicity of used reagents, the limited control of pore size and area, and the cost of particle synthesis.20,21 the newly developed method allows effective control of structure porosity, employs environmental friendly reagents, and is fast and inexpensive. therefore, the synthesized anisotropic structures could open new frontiers as efficient and safe drug carriers. as compared to spherical or nonporous nanoparticles, porous drug carriers with pore size in the range of 5100 nm provide a larger surface area and improve drug dissolution and encapsulation efficacy.22,23 noteworthy is the fact that porous nanostructures have allowed the encapsulation of large amounts of biomolecules such as peptides and nucleic acids within a relatively small carrier material mass. the new silver flower - like silver nanostructures have interconnected pores and pore size of 50200 nm. their enhanced porosity is predicted to allow improved drug encapsulation and loading capacity and allow their use for sustained drug release. the antimicrobial effects of silver particles have been correlated to their large surface area which enhances their interaction with microorganisms as well as their stability in bacterial growth medium. additionally, silver nanoparticles with different shapes have been shown to have different effects on bacteria. for spherical nanoparticles, a total silver content of 12.5 g was needed to show bacterial inhibition, whereas rod - shaped particles needed a total of 50100 g of silver content to show a similar effect.24 the new silver nanostructures have very large surface areas and were stable in solution up to 1 month after synthesis, and thus are predicted to have enhanced antibacterial effect. these properties are dependent on particle shape and size and have been utilized for clinical diagnostics. zhou used triangular silver nanoparticle arrays for spectroscopic detection of p53, a marker of neck squamous cell carcinoma, in serum.25 also, shanmukh developed a spectroscopic assay, based on surface enhanced raman scattering, using silver nanorod arrays for detection and characterization of respiratory viruses.26 therefore, silver flower - like structures with their unique shape and controlled size warrant further investigation for potential utilization in clinical diagnostics. | backgroundthe synthesis of anisotropic silver nanoparticles is a time - consuming process and involves the use of expensive toxic chemicals and specialized laboratory equipment. the presence of toxic chemicals in the prepared anisotropic silver nanostructures hindered their medical application. the authors have developed a fast and inexpensive method for the synthesis of three - dimensional hollow flower - like silver nanostructures without the use of toxic chemicals.methodsin this method, silver nitrate was reduced using dextrose in presence of trisodium citrate as a capping agent. sodium hydroxide was added to enhance reduction efficacy of dextrose and reduce time of synthesis. the effects of all four agents on the shape and size of silver nanostructures were investigated.resultsrobust hollow flower - like silver nanostructures were successfully synthesized and ranged in size from 0.2 m to 5.0 m with surface area between 25240 m2/g. changing the concentration of silver nitrate, dextrose, sodium hydroxide, and trisodium citrate affected the size and shape of the synthesized structures, while changing temperature had no effect.conclusionthe proposed method is simple, safe, and allows controlled synthesis of anisotropic silver nanostructures, which may represent promising tools as effective antimicrobial agents and for in vitro diagnostics. the synthesized hollow nanostructures may be used for enhanced drug encapsulation and sustained release. |
advances in chemotherapy and cytostatic drug pharmacology have made it possible for cancer patients with severe end organ failure to be treated with adapted drugs. reports of patients with jaundice due to colon cancer,1 lymphoma,2 breast3 and other tumor types49 are becoming more frequent. this knowledge has been drawn from a deeper insight into the pharmacology of drug clearance in cancer patients with liver dysfunction.10 apart from case reports,11 however, there are no reports of series of patients presenting with severe jaundice, due to metastatic involvement of the liver, in which the treatment and outcome are summarized. we report here the first case series in this patient group, in which all patients were treated the same way with weekly cisplatin, until recovery of liver function, or death. our study aimed to demonstrate that even in these patients, a relatively well tolerated drug like cisplatin may reverse the jaundice and liver failure, permitting further more classical chemotherapies. this was a retrospective study conducted at sint - maria hospital of halle, belgium. all medical records provided by the hospital tumor registry were screened by one investigator to identify patients who met the study team s a priori selection criteria. these criteria included severe hyperbilirubinemia, due to unresectable metastatic cancer, and no prior cancer therapy (no prior surgery, or radiation, or chemotherapy). the medical records of the patients identified in this screening process were then reviewed in depth : namely, date of diagnosis, dates of cisplatin treatment, subsequent laboratory changes and further treatment or death. patients were considered eligible if they had imaging studies (ct and ultrasound) with evidence of liver metastases of different types of carcinoma and exclusion of biliary tract obstruction. patients were required to have : who performance score 1 to 3 ; neutrophil count > 1500 mm ; platelet count > 100,000 ; and normal serum creatinine at screening before starting chemotherapy. tumor responses were not assessed because of inconsistent patterns in radiographic testing from patient to patient and because of the greater value placed on survival. patients received 75 mg / m cisplatin on days 1, 8 and 15 on a 4-week cycle, repeated on days 8, 22, 29 and 36, as described by van den burg.12 patients with small cell lung carcinoma received subsequent therapy with etoposide, cisplatin and cyclophosphamide;6 those with unknown primary had subsequent therapy with carboplatin and taxol weekly.13 physical examination, vital signs assessment, body surface area calculation, biochemistry and hematology tests, and adverse - event assessment were performed prior to each dose of chemotherapy. myeloid colony - stimulatory factors were not used because of the limited myelosupression of cisplatin. liver tests at baseline and prior to each treatment cycle are shown in table 2. the remaining 4 patients completed treatment with 4 to 6 cycles of cisplatin and received subsequent therapy adapted to the tumor type (table 2). all patients initially showed a further rise of serum bilirubin with subsequent normalization of bilirubin after administration of second cycle of cisplatinum, as shown in table 2. two patients remain alive at time of writing, more than16 months and 4 months, respectively. this study assessed the efficacy of treatment with weekly cisplatin in liver failure due to liver metastasis of common solid tumors. weekly cisplatin was proven to be efficacious in diverse tumor types such as nsclc,14 head and neck cancer,15 and ovarian cancer.16 its unique renal elimination permits administration in patients with severe jaundice and subsequent poor liver function.17,18 the results of this retrospective analysis suggest that 4 to 6 courses of weekly cisplatin rapidly lead to normalization in serum bilirubin and other liver tests, which permits subsequent chemotherapy with cytotoxics with hepatic metabolism such as etoposide, cyclophosphamide and taxanes. four patients died after the first administration, mostly due to concomitant pulmonary disease and low who performance score at baseline. other side effects were related mainly to platinum - induced toxicities like anemia and ototoxicity. the most well known side effect of cisplatin, namely vomiting and nausea, was vigorously prevented by administration of granisetron, aprepitant and steroids. as noted in the initial publication,12 there were no cases of renal insufficiency due to the nephroprotective effect of hypertonic saline in which the cisplatin was dissolved. all 4 surviving patients had normal serum creatinine during cisplatin treatment and this did not change during later chemotherapies. unfortunately, it was not feasible to incorporate quality of life measures into this pilot study. larger studies of this regimen in this patient group should include such measures in an attempt to assess the risk / benefit ratio for this palliative treatment. prior publications and case series as well as the current series underline the growing interest of oncologists in treating these patients whose prognosis is dismal without chemotherapy in all series. our patient series is unique because it represents the first series of patients with fewer chemotherapy - sensitive tumor types than those mentioned above, who were all treated with the same cytostatic. the pharmacologically driven administration of a well known cytostatic, such as cisplatin, with its clinical efficacy even in severe jaundice, is paramount to success and prolonged survival in a substantial number of patients. this is the first reported series of 8 patients treated with weekly cisplatin for diffuse metastases of solid tumors causing severe jaundice (not metastases caused by colon or breast cancer). although there were a significant number of early deaths, in 4 of our 8 patients liver function recovered sufficiently to enable further standard chemotherapies. because of the rarity of the presentation and the poor general state of these patients, this series may serve as a basis for further treatments and observations | few data are available on patient management in jaundice caused by liver metastases of solid tumors (nonbreast and noncolon origin). we report the first patient series consecutively treated with cisplatin weekly in patients with severe jaundice and liver failure due to underlying metastatic neoplasms. in 4 out of 8 cases, liver function tests were reversed and jaundice disappeared, permitting subsequent standard chemotherapy. the other 4 patients died 3 to 5 weeks after admission, illustrating the extent and severity of the underlying neoplasm. |
the oral cavity is a natural habitat for a large number of microorganisms. in dentistry, these microorganisms may pose a risk for cross - contamination and infection. it is also important to consider that the pathways of contamination are bi - directional : both patients and dental health care personnel (dhcp) may be exposed to a number of pathogens through exposure to blood and saliva. in addition, the hands of dhcp may serve as a reservoir for pathogens, including multi - resistant strains. infection control forms an important part of practice for all health care professions and remains one of the most cost - beneficial medical interventions available,. professional dental associations and professional health agencies have advocated that universal precautions be applied to all patients, as their potential infectivity may not be known,,,. the aim of this study was to assess the compliance with infection control recommendations of dentists and dental assistants and evaluate the risk of cross - contamination of the workplace due to aerosol formation during invasive dental procedures. a prospective, observational study was carried out at the school of dentistry of the university hospital freiburg, germany. the study received an exemption from institutional review board, since only observational methods were applied. dental hospital staff was observed during clinical work for their compliance with infection control procedures as recommended by the german robert koch institute. in addition, a survey was conducted after the observation period to assess the individual knowledge of dental hospital staff about infection control procedures and official recommendations. all dentist and dental assistants working at the department of operative dentistry and periodontology, albert - ludwigs - university, freiburg, germany, were eligible for participation in the study and the survey. contamination of the workplace during 18 invasive dental procedures was tested by placing three columbia 5% sheep blood (cos) agar plates (heipha, germany) in different angles each at a distance of 0.75 meters from the dental - hand pieces ; the cos plates were then aerobically incubated for 48 h at 36c. statistical analysis was performed using statistical package for the social sciences (spss 19.0, chicago, usa). during the observational period, a total of 58 procedures were performed, 35 by female and 23 by male dentists. all dhcp (100%) wore gloves during dental work, but in some cases (female dentists : 14.3% ; dental assistants : 28.6%) gloves were neither changed nor hands were disinfected between aseptic activities (e.g. paperwork) or patients (female dentists : 68.6% ; male dentists : 60.9% ; dental assistants : 93%). only 31.4% of female and 39.1% of male dentists carried out adequate hygienic hand disinfection after removing gloves, while dental assistants carried out adequate hand disinfection significantly less frequently (7.0% ; p 1 ring worn, 4.6). transmission via aerosols, due to aerosol formation during invasive dental procedures, is a major concern in the dental setting. when working with hand - pieces bacterial aerosols including approximately 10 cfu our study confirmed the contamination of the workplace with bacteria in an area of diameter of 0.75. several infectious agents relevant to the dental setting can occur via direct or indirect airborne transmission, such as varicella - zoster virus or tuberculosis,. however, also hepatitis b virus (hbv) infection can, besides through percutaneous injuries, result from (in)direct blood or bloody fluid exposure through inoculation into cutaneous scratches, abrasions, burns or on mucosal surfaces,. hbv has demonstrated the ability to survive and remain infectious in dried blood on environmental surfaces for at least 1 week and probably longer,. therefore, dental procedures can introduce oral pathogens into the bloodstream or lymphatic system via direct hematogenous spread or aspiration, thereby causing various medical conditions including bacteremia, pneumonia, or infective endocarditis,. despite the knowledge of distinct hygiene procedures only a small percentage of dental staff performs hygiene practices according to the recommended guidelines. although compliance with other infection control practices was high, clearly improvements were desirable, as well. considerably lower compliance with infection control procedures due to insufficient knowledge was found in dental assistants compared to dentists. based on the results of this study a training program was initiated which was well accepted and appreciated by all dhcp, including dental assistants and dentists. extending continuing education and strict audit is needed in the dental setting to ensure compliance with infection control guidelines and to provide enduring knowledge. in addition, a high compliance with infection control procedures is the key to quality care and excellence in dentistry. our results provide insights for the development of a targeted education and training strategy to enhance compliance of dental staff, especially of dental assistants, with infection control procedures. parts of the sections material and methods and results have been presented in a poster on the 52 icaac in san francisco, september, 2012. all authors report no conflict of interest relevant to this article. parts of the sections material and methods and results have been presented in a poster on the 52 icaac in san francisco, september, 2012. | aim : compliance with infection control practices is the key to quality care and excellence in dentistry. infection control remains one of the most cost - beneficial interventions available. however, implementing control procedures requires full compliance of the whole dental team. the aim of our study was to measure the compliance in daily clinical practice.methods : the compliance with infection control practices in dentistry by dental health care personnel (dhcp) in a german university dental clinic was observed during clinical work. in addition, a survey was conducted to assess the individual knowledge about infection control procedures. contamination of the workplace during invasive dental procedures was tested, as well.results : a total of 58 invasive dental treatments implying close contacts between hcws and patients were scrutinized. all hcws (100%) wore gloves during dental work, but in some cases (female dentists : 14.3% ; dental assistants : 28.6%) gloves were neither changed nor hands were disinfected between different activities or patient contacts (female dentists : 68.6% ; male dentists : 60.9% ; dental assistants : 93%). only 31.4% of female and 39.1% of male dentists carried out adequate hygienic hand disinfection after removing gloves. male dentists wore significantly more often (100%) protective eyewear compared to 77.1% of female dentists (p<0.05). in addition, most of female dentists (62.9%) and dental assistants (80.7%) wore jewelry during dental procedures. conclusion : despite the knowledge of distinct hygiene procedures only a small percentage of dental staff performs hygiene practices according to recommended guidelines. strict audit is clearly needed in the dental setting to ensure compliance with infection control guidelines to prevent transmission of pathogens. our results provide insights for the development of a targeted education and training strategy to enhance compliance of dental staff especially of dental assistants with infection control procedures. |
nonalcoholic fatty liver disease (nafld) is one of the most common forms of chronic liver disease throughout the world. nafld is characterized by hepatic steatosis in the absence of significant alcohol use, hepatotoxic medication, or other known liver diseases. nafld represents a spectrum ranging from simple fatty liver to nonalcoholic steatohepatitis (nash), which is an aggressive form of nafld leading to cirrhosis and hepatocellular carcinoma [36 ]. recently, it has been established that nafld is commonly associated with metabolic syndrome, including type 2 diabetes, obesity, dyslipidemia, and hypertension and consequently is associated with cardiovascular mortality [610 ]. the potential need for treatment of nafld is recognized, in order to improve cardiovascular and liver - related outcomes, and several therapeutic interventions to treat various components of metabolic syndrome have been evaluated [1012 ]. angiotensin ii receptor blockers (arbs), which are highly selective for the angiotensin ii type 1 (at1) receptor and block diverse effects of angiotensin ii, are commonly used to treat hypertension. recently, arbs have been expected to be effective for treatment of nafld, due to targeting of the mechanisms of insulin resistance and hepatic injury via suppression of the renin - angiotensin system (ras), which has been suggested to be involved in the pathways of liver damage. it has been reported that an arb, losartan, showed significant improvement in aminotransferase levels and serum markers of fibrosis in hypertensive patients with nash. moreover, losartan has been reported to decrease the number of activated hepatic stellate cells, which play a pivotal role in the progression of hepatic fibrosis. telmisartan, another arb, has been reported to have a partial agonistic effect on peroxisome proliferator - activated receptor (ppar)- in addition to the effect of angiotensin ii blockade [16, 17 ]. so, telmisartan is expected to have more potent effects in nafld than those of losartan, via ppar activation, which promotes hepatic fatty acid oxidation, decreases hepatic lipogenesis, and increases peripheral and hepatic insulin sensitivity [18, 19 ]. in fact, it is reported that telmisartan attenuated steatohepatitis progression in an animal model. in addition, telmisartan has been reported to improve insulin resistance and liver injury, based on measurement of homeostasis model assessment - insulin resistance (homa - ir) and serum aminotransferase (alt) levels in humans. in the present study, we tested the hypothesis that telmisartan might have a more potent effect on nafld and biochemical markers of insulin resistance than does losartan. this study was conducted in accordance with the declaration of helsinki and was approved by the ethics review board of keio university. written informed consent was obtained from each subject before participation in the study. we screened patients with type 2 diabetes between 20 to 80 years of age with both nafld and hypertension. nafld was defined as fatty liver on ultrasonography, and aspartate aminotransferase (ast) level over 30 all patients consumed less than 20 g of pure alcohol per day, and were negative for hepatitis b serological tests, antibody to hepatitis c virus, and autoantibodies, including anti - mitochondrial antibody and anti - nuclear antibody. hypertension was defined as systolic blood pressure (sbp) over 140 mmhg and/or diastolic blood pressure (dbp) over 90 mmhg. exclusion criteria included the presence of ast > 100 iu / l and/or alt > 100 iu / l, severe hypertension (i.e., sbp > 200 mmhg, dbp > 120 mmhg), malignancy and recent major macrovascular disease (i.e., cardiovascular disease or stroke within past 3 months), insulin, biguanide or thiazolidinedione treatment for diabetes mellitus, and drug allergy to arbs. this was a randomized, open - label, parallel - group comparison of therapy with telmisartan or losartan. nineteen hypertensive nafld patients with type 2 diabetes were randomly assigned to the telmisartan (t) group (receiving a standard dose of 20 mg once daily, n = 12) or losartan (l) group (receiving a standard dose of 50 mg once daily, n = 7) medication was not masked, and treatment had to be taken daily at the same hour in the morning, with no concomitant medication or alcohol consumption allowed. all 19 subjects received dietary instructions using a meal - exchange plan from nutritionists. the ideal dietary caloric intake for each patient was calculated as the ideal body weight (kg) 25 kcal / kg. it was confirmed by questionnaire that the physical activity level was almost constant in each subject throughout the study period. the included patients were followed for 12 months, with two - monthly visits. anthropometric measurements, blood pressure (bp), heart rate (hr), and several clinical and biochemical parameters of glycemic control, lipid metabolism, and liver function were checked at every visit. body fat area as determined by computed tomographic (ct) scanning at the umbilical level, hepatic fat content based on the liver - to - spleen (l / s) ratio according to ct attenuation values, inflammatory markers, and serum bile acid level were determined before and after 12 months. blood samples were taken from each subject before breakfast in the early morning, after overnight bed rest. fasting plasma glucose (fpg) was determined by the glucose oxidase method. hemoglobin a1c (hba1c) was determined by high - performance liquid chromatography (toso, tokyo, japan) and presented as the equivalent value for the national glycohemoglobin standardization program (ngsp). serum immunoreactive insulin (iri) was measured by an enzyme immunoassay using a commercially available kit. homeostasis model assessment - insulin resistance (homa - ir) was calculated by the formula : fasting plasma insulin (u / ml) fasting plasma glucose (mg / dl)/405. homa- was calculated by the formula : fasting plasma insulin (u / ml) 360/(fasting plasma glucose (mg / dl) 63). total cholesterol (tc), high - density lipoprotein cholesterol (hdl - c), triglyceride (tg), and free fatty acids (ffas) were measured enzymatically by an autoanalyzer (hitachi, tokyo, japan). as biochemical parameters, ast, alt, gamma glutamyl transpeptidase (gt), alkaline phosphatase (alp), lactate dehydrogenase (ldh), blood urea nitrogen (bun), creatinine (cr), uric acid (ua), sodium (na), potassium (k), ferritin, and creatine phosphokinase (cpk) were measured. inflammatory markers such as hyaluronic acid (hyal), 7s domain of type iv collagen (4col7s), high - sensitivity c - reactive protein (hs - crp), procollagen iii peptide (p-3-p), zinc (zn), total adiponectin, and interleukin (il)-6 were analyzed at the special reference laboratory (srl, tokyo, japan). we also measured bile acid (ba) components by high - performance liquid chromatography, because bas might be related to lipid absorption and cholesterol catabolism. subcutaneous and visceral fat distribution was determined by measuring a 150 hounsfield unit (hu) to 50 hu area using the method of ct scanning at the umbilical level as described previously. v / s ratio was calculated as visceral fat area (vfa)/subcutaneous fat area (sfa). an index of fat deposition in the liver based on the liver - to - spleen (l / s) ratio according to ct attenuation values was also determined. the mean hu values of the liver and spleen were determined in the parenchyma of the right (ct - l1) and left lobe (ct - l2) of the liver and approximately the same size area of the spleen (ct - spleen), avoiding blood vessels, artifacts, and heterogeneous areas. l / s ratio was calculated as [((ct - l1) + (ct - l2))/2]/(ct - spleen). continuous variables were compared between the telmisartan group and losartan group using the mann - whitney u test for independent samples. differences in each parameter between the start and after 12 months in each group were analyzed using the wilcoxon 's matched - pair signed - rank test. a p value less than 0.05 statistical analyzes were carried out using statview 5.0 software (sas institute, cary, nc, usa). there were no significant differences in most parameters including duration of diabetes, anthropometric measurements, bp, biochemical measurements, and inflammatory markers between the t group and l group. in spite of randomization, there were significant differences in two parameters between the two groups at baseline ; serum ffa (0.87 0.26 meq / l in t group versus 0.50 0.26 meq / l in l group (p = 0.001)) and l / s ratio (0.82 0.25 in t group versus 1.01 0.23 in l group (p = 0.035)). both groups showed a significant decrease in sbp (139.4 11.1 versus 130.8 15.0 mmhg in t group (p = 0.045), 136.4 13.9 versus 127.4 10.6 mmhg in l group (p = 0.046)) after 12 months. concerning dbp, a statistically significant decrease was found in the t group (86.0 8.5 versus 75.4 12.7 mmhg (p = 0.032)), whereas the decrease in the l group did not reach statistical significance (81.6 13.0 versus 75.3 7.9 mmhg (p = 0.116)) (table 2). liver enzyme levels such as ast, alt, and gt did not show significant change in both groups after 12 months. while tc, hdl - c, and tg levels did not show significant change in both groups after 12 months, ffa level showed a significant decrease in the t group (0.87 0.26 versus 0.59 0.22 meq / l (p = 0.005)) whereas the change in the l group was not significant (0.50 0.26 versus 0.66 0.22 meq / l (p = 0.237)). regarding hba1c level, the l group showed a significant increase (6.7 1.0 versus 7.2 1.2% (p = 0.017)), while the change in the t group was not significant (6.4 0.6 versus 6.4 0.4% (p = 0.552)). ua level showed a significant decrease in the l group (5.7 1.5 versus 5.2 1.3 mg / dl (p = 0.046)), while it showed a significant increase in the t group (5.8 1.4 versus 6.3 1.2 mg / dl (p = 0.016)). levels of other inflammatory markers and bile acids did not show significant change in both groups after 12 months (tables 3 and 4). visceral and subcutaneous fat area did not change in both groups after 12 months. consequently, v / s ratio did not change in both groups. regarding l / s ratio, a significant increase was found in the t group (0.82 0.25 versus 0.97 0.22 (p = 0.049)), while it did not change in the l group (1.01 0.23 versus 1.01 0.21 (p > 0.999)) (table 5). in the present study, we evaluated the effects of arbs (telmisartan and losartan) on nafld in hypertensive patients with type 2 diabetes and compared their effect to improve liver function after 12 months of treatment. however, serum ffa level was significantly decreased in the telmisartan group, leading to a significant improvement in l / s ratio, which reflects the severity of fatty change in the liver, compared to that in the losartan group. this finding suggests that telmisartan might improve fat deposition in the liver. unlike other arbs, in fact, several reports have been published concerning the efficacy of the ppar agonist, pioglitazone, in the treatment of nash. it is known that pioglitazone improves liver histological features, including steatosis, hepatocellular ballooning degeneration, lobular inflammation, and fibrosis [2628 ]. in studies using several strains of animal models, telmisartan inhibited fat deposition, inflammation, and fibrosis in the liver [20, 2931 ]. also, these effects of telmisartan were greater than those of another arb, valsartan, with the expectation of its efficacy in the liver also in humans. in the present study, liver enzyme levels were not significantly improved in either the telmisartan or losartan group over 12 months. in a previous study, 48-week treatment with losartan significantly improved liver enzyme levels. however, liver enzyme levels before arb administration in the study were higher compared with those in our study, and after one year of administration of arb they were only reduced to around the same levels as found in our study. because the subjects had mild high levels of liver enzymes in the present study, it might have been difficult to observe marked improvement of liver enzyme levels. it is notable that there was a significant decrease in serum ffa level in the telmisartan group compared to that in the losartan group in the present study. reduction in serum ffa can improve insulin resistance and reduce fat deposition in the liver as ectopic fat [33, 34 ]. here, the l / s ratio, which indicates fat deposition in the liver, was significantly increased in the telmisartan group but not in the losartan group, suggesting that this might be associated with the ability of telmisartan to activate ppar [16, 17 ]. however, in the losartan group, a low serum ffa level and a l / s ratio were found at baseline compared to those in the telmisartan group, suggesting low insulin resistance and less fat deposition in the liver. thus, this suggests that it would not be possible to observe improvement of ffa and l / s ratio in the losartan group. it is reported that telmisartan, but not losartan, displayed insulin - sensitizing activity in a clinical study, which may be explained by its partial ppar activity. although a few clinical trials have examined the effects of arbs on nafld, they were mostly conducted in patients with nafld with markedly elevated liver enzyme levels. however, epidemiologic studies conducted in japan showed that liver enzyme levels remained only slightly elevated in many patients. the present study included patients with nafld, which is often seen in daily clinical practice, and thus was meaningful in regard to examining the effect of arbs in a more realistic setting. furthermore, the present study is thought to be meaningful since the effects of telmisartan and losartan in treating nafld have not been examined in a randomized controlled study. first, the small number of patients and the deviation between groups in spite of randomization made it difficult to detect differences in outcomes between groups. especially, differences in bmi and duration of diabetes between groups might affect the results. therefore, randomized controlled studies with larger numbers of patients might be needed in the future. secondly, in this study, dietary instruction and exercise therapy were left entirely to the discretion of the outpatient attending physicians rather than implementing specific patient education programs. for this reason, although it was uncertain whether dietary and exercise therapy were sufficient or not in either group, an increase in bmi was not observed at least in the telmisartan group, suggesting that dietary and exercise therapy were probably sufficient. lastly, we did not perform histological examination of fat deposition, inflammation, or fibrosis in the liver. it is thus unclear whether histological changes occurred in the liver tissue due to treatment with either drug. in this randomized controlled study that examined the effect of telmisartan and losartan in improving steatosis in hypertensive nafld patients with type 2 diabetes, significant improvement in liver function was not observed in either group. however, serum ffa level was significantly reduced in the telmisartan group compared to the losartan group. in addition, unlike losartan, telmisartan improved the l / s ratio. due to its potential to improve fat deposition in the liver, telmisartan could be a therapeutic option in the treatment of nafld. in the future, a large - scale clinical study is needed to determine the utility of telmisartan in the treatment of nafld. | aim. this study compared the effects of telmisartan and losartan on nonalcoholic fatty liver disease (nafld) and biochemical markers of insulin resistance in hypertensive nafld patients with type 2 diabetes mellitus. methods. this was a randomized, open - label, parallel - group comparison of therapy with telmisartan or losartan. nineteen hypertensive nafld patients with type 2 diabetes were randomly assigned to receive telmisartan at a dose of 20 mg once a day (n = 12) or losartan at a dose of 50 mg once a day (n = 7) for 12 months. body fat area as determined by ct scanning and hepatic fat content based on the liver - to - spleen (l / s) ratio, as well as several parameters of glycemic and lipid metabolism, were compared before and after 12 months. results. the telmisartan group showed a significant decline in serum free fatty acid (ffa) level (from 0.87 0.26 to 0.59 0.22 meq / l (mean sd), p = 0.005) and a significant increase in l / s ratio (p = 0.049) evaluated by ct scan, while these parameters were not changed in the losartan group. conclusion. although there was no significant difference in improvement in liver enzymes with telmisartan and losartan treatment in hypertensive nafld patients with type 2 diabetes after 12 months, it is suggested that telmisartan may exert beneficial effects by improving fatty liver. |
the definition of pain devised by the international association for the study of pain (iasp) is as follows : pain is an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage. chronic pain is any pain which persists beyond the normal healing period of 12 weeks. postherniorrhaphy groin pain is defined as pain lasting > 3 months after surgery, which is one of the most important complications occurring after inguinal hernia repair, and occurs with greater frequency than previously thought. a review of studies published between 1987 and 2000 showed an overall incidence of 25 percent with 10 percent of patients having pain fitting a definition of moderate or severe. incidence of long term (1 year) postoperative neuralgia reported for lichtenstein repair of inguinal hernia ranges from 6 to 29 percent. inguinodynia is the recommended generic term for chronic groin pain after hernia repair and should replace neuralgia or mesh inguinodynia to promote uniformity and avoid confusion in the literature. in cases that involve workman 's compensation issue, treating although most legal cases result in out - of - court settlement, worth noting is the fact that 57 percent of patients with postherniorrhaphy neuralgia will sue their surgeons. preemptive analgesia, type of anesthesia, preservation of nerves, and prevention of postoperative complications are related to development of chronic pain. the most important factor in development of chronic pain is immediate postoperative pain ; all measures must be taken to eliminate postoperative pain. we undertook a prospective study to analyze the factors associated with development of chronic pain following inguinal hernia repair. patients undergoing elective inguinal hernioplasty in victoria hospital from november 2011 to may 2013 were included in the study. data were collected by meticulous history taking and careful examination of all patients undergoing elective inguinal hernia surgery. since the study was performed in various surgical units of the hospital all patients underwent lichtenstein procedure with prolene mesh of dimension 8 cm 15 cm. the mesh was fixed with polydioxanone (pds) sutures and skin closed in layers. details regarding preoperative characteristics, type of anesthesia, intraoperative finding, and postoperative complication were recorded on a proforma. the pain was assessed by the visual analogue scale (vas) preoperatively and on days 1, 2, and 7 and at the end of 6 months by a questionnaire / telephonic conversation. pain score was classified as mild vas score 13, moderate vas score 47, and severe vas score > 7. patients complaining of severe pain will be called for followup for detailed examination and investigated for causes of chronic pain. the collected data was analyzed with respect to incidence and factors affecting the development of chronic pain and its management. the test and fisher 's exact test were used to evaluate differences between categorical variables. in the studies with two groups, student 's t - test was used to compare normally distributed continuous data and the mann - whitney u test was used to test between continuous variables that were not normally distributed. in the study with three groups, multivariate cox regression analyses were performed to estimate and compare unadjusted and adjusted relative risks. a total of 227 patients undergoing elective inguinal hernia repair satisfied the inclusion criteria and were available for followup at end of six months. majority of our patients were male 98.7% with mean age 49.1 years (range 1882 years). chronic pain at six - month followup was present in 89 patients constituting 39.4% of all patients undergoing hernia repair. when patients were divided into groups of mild (13), moderate (47), and severe pain (> 7) on basis of vas score, it was found that majority, 30.5% (n = 69), had mild pain, 7.9% had moderate pain, and less than 1% had severe pain (table 3). nineteen of 68 (27.9%) patients whose symptoms were of less than six - month duration developed chronic pain. patients with symptom duration greater than six months (44%) developed chronic pain. duration of symptoms greater than six months significantly affected development of chronic pain (p = 0.036) at 5% confidence interval. it was seen that 26.9% without preoperative pain developed chronic pain whereas 76.7% of patients with preoperative pain developed chronic pain. when patients with preoperative pain were divided into two groups mild pain (4 vas), it was seen that patients with significant preoperative pain had higher chances of developing chronic pain (p 4 vas), it was found that patients with significant preoperative pain had higher chances of developing chronic pain (p < 0.0001). in a study by wright. involving 300 patients, 88% of patients that developed chronic pain had pain at the preoperative assessment, compared to 59% of patients without chronic pain (p < 0.001). another study by poobalan. also found a significant predictive value (p < 0.005) between preoperative pain and chronic pain. in contrast, a large randomized study of 994 patients found no significant relation between the development of chronic and preoperative pain (p = 0.2). the mrc study found that 30% of patients reported no change in pain from before to after surgery but that 5% felt worse than before the herniorrhaphy. the available data suggest that preoperative pain may increase the risk of developing chronic pain but more studies are required with a detailed analysis of the history and type of pain complained of in other parts of the body than the inguinal area. only two of the 26 cases performed under local anesthesia developed chronic pain whereas 79 of 189 cases performed under spinal anesthesia developed chronic pain. present study results show that the use of local infiltration for inguinal hernia repair has substantial advantages over both regional and general anesthesia. similar results were observed by a study by nordin. ; it was also found that the longer time in theatre associated with local anesthesia was compensated for by the significantly shorter time for anesthesia, compared with regional and general anesthesia. postoperative side effects and prolonged hospital stay after groin hernia surgery were often related to the effects of anesthesia. local anesthesia had much better results than did its alternatives. in the regional anesthesia group patients had higher rate of micturition difficulties, some severe enough to necessitate urethral catheterization. overall cost benefit of local anesthesia over other types of anesthesia warrants its use in hernia surgery. only 32 cases had preemptive analgesia in this study ; it was found that preemptive analgesia did decrease incidence of chronic pain but due to limited number of cases it is difficult to recommend the same. various studies have shown that acute pain following injury can lead to central neuronal plasticity leading to chronic pain. whether techniques such as preemptive or preventive analgesia produce a clinically meaningful reduction in the intensity or duration of postsurgical pain remains unclear. multimodal analgesic approaches that use ketamine or other n - methyl - d - aspartate receptor antagonists gabapentin or pregabalin cox inhibitors, steroids, and afferent neural blockade in the perioperative period have the potential to prevent central neuroplasticity. good results have been obtained in the reduction of chronic pain after breast surgery with perioperative administration of venlafaxine, mexiletine with gabapentin, a eutectic mixture of local anesthetics (emla), and a combined treatment with emla and gabapentin. new studies are required to determine the value of preemptive analgesia in hernia repair and its timing and effect on development of chronic pain. much controversy exists regarding which treatment to reserve for the inguinal nerves during hernia repair. elective division of the ilioinguinal nerve has been proposed by some authors to reduce the risk of postoperative chronic pain. some studies recommend that nerve ends be ligated to reduce the risk of chronic pain, but there were no studies on the outcome of these recommendations [16, 17 ]. others have suggested that the nerves be divided or ligated only when their course in the operating field would lead to the risk of injury or if they interfere with positioning of the mesh. other studies have failed to show any relationship between the division or preservation of the ilioinguinal nerve and the risk of developing chronic pain. if division of the nerve is performed, it should be as close as possible to the site where it leaves the retroperitoneum. we found nerve injury in 22 of the cases and these patients had higher incidence of chronic pain. in a study by alfieri., chronic pain at 6 months after surgery was zero in those patients in whom all 3 nerves were identified and preserved, compared with the 40% incidence when these nerves were all divided or 4.7% when not all nerves were identified. these data would appear to suggest that if one or more nerves are not detected during surgery, it is possible that they could be inadvertently injured, entrapped, or secured, for example, if a continuous suture is introduced along the inguinal ligament or injured if the external spermatic vessels are divided to skeletonize the cord and thus generate severe pain at even some considerable time after the operation. the increased risk of developing chronic pain with the number of nerves divided can be explained by the fact that resection of the nerve has generally been performed distal to its origin, leaving the site of the injured nerve intact to continue to generate the pain signal and exposed to neuroma formation. results from studies in which operative management of an injured nerve is reported to be responsible for severe chronic pain suggest that if the nerve identified is inadvertently divided, it is important to resect it as proximally as possible so that it would not interfere or come into contact with the mesh, thus allowing retraction of the proximal segment into the ventral muscle or retroperitoneum. local infiltration was followed in 37 of the cases and it was found that chronic pain developed in only 4 cases. although studies have shown significant lower vas scores in infiltration group, the long term effects on pain are not documented. in the study of sinclair and colleagues, pain scores were reduced over the first 24 h period but not during 2448 h. in the study by tverskoy and colleagues, pain scores were reduced up to 48 h after operation. in the present study, it was found that early postoperative pain correlated with development of chronic pain. in a prospective study by lau. of 313 patients undergoing a laparoscopic repair, patients who had pain on coughing on the 6th postoperative day had a significant (p < 0.05) higher risk of developing chronic pain, but the method of early postoperative pain assessment was not described. in study by heikkinen. of 123 patients, four patients developed a chronic neuralgia type pain and had higher vas scores on day 14 (p = 0.03). this finding is in agreement with a large prospective study by callesen. involving 466 unselected patients 1 year after surgery, where the risk of chronic pain was significantly higher in patients with a high early postoperative pain score compared to those with a lower postoperative pain score (9 versus 3%, p < 0.05) after 1 week. the same correlation was found in patients with severe pain after 4 weeks (24 versus 3%, p < 0.001). there are no studies to assess the role of specific analgesic therapies in reducing the development of a chronic pain state after inguinal herniorrhaphy. the available data suggest that the severity of early postoperative pain correlates with the risk of developing a chronic pain state. in the present study, we found that chronic pain following inguinal hernia repair causes significant morbidity to patients and should not be ignored. intraoperative identification and preservation of all inguinal nerves are very important. all measures must be taken to suppress early postoperative pain and prevent complications as these lead to development of chronic pain. early diagnosis and management of chronic pain can remove suffering of the patient. however, the sample size and the followup period in the current study are relatively short. a larger study sample and longer followup may be needed before any further conclusion can be made. from our study, we recommend more operations be done under local anesthesia and routine identification and preserving all nerves. regular followup of patient and identification of chronic pain and appropriate treatment improve patient outcome following inguinal hernia surgery. | background. chronic postherniorrhaphy groin pain is defined as pain lasting > 6 months after surgery, which is one of the most important complications occurring after inguinal hernia repair, which occurs with greater frequency than previously thought. material and methods. patients undergoing elective inguinal hernioplasty in victoria hospital from november 2011 to may 2013 were included in the study. a total of 227 patients met the inclusion criteria and were available for followup at end of six months. detailed preoperative, intraoperative, and postoperative details of cases were recorded according to proforma. the postoperative pain and pain at days two and seven and at end of six months were recorded on a vas scale. results. chronic pain at six - month followup was present in 89 patients constituting 39.4% of all patients undergoing hernia repair. it was seen that 26.9% without preoperative pain developed chronic pain whereas 76.7% of patients with preoperative pain developed chronic pain. preemptive analgesia failed to show statistical significance in development of chronic pain (p = 0.079). nerve injury was present in 22 of cases ; it was found that nerve injury significantly affected development of chronic pain (p = 0.001). on multivariate analysis, it was found that development of chronic pain following hernia surgery was dependent upon factors like preoperative pain, type of anesthesia, nerve injury, postoperative local infiltration, postoperative complication, and most importantly the early postoperative pain. conclusions. in the present study, we found that chronic pain following inguinal hernia repair causes significant morbidity to patients and should not be ignored. preemptive analgesia and operation under local anesthesia significantly affect pain. intraoperative identification and preservation of all inguinal nerves are very important. early diagnosis and management of chronic pain can remove suffering of the patient. |
type 2 diabetes mellitus (dm2) is an independent risk factor of coronary artery disease (cad) and increases the risk of cad two to three times. moreover, the coexistence of dm2 and cad impairs cardiovascular prognosis and increases the risk of ischemic events [3, 4 ]. this observation can be explained by several mechanisms, including concomitant risk factors such as arterial hypertension, obesity, and metabolic abnormalities such as hyperglycemia, hyperinsulinemia, insulin resistance and dyslipidemia, which are responsible for endothelial dysfunction. it has been demonstrated that atherosclerotic plaques in dm2 patients are more prone to rupture. both dm2 as well as cad have been reported to unfavorably affect structural and functional characteristics of a fibrin clot relatively resistant to mechanical and enzymatic degradation [79 ]. fibrin clot structure and functions depend on several genetic and environmental factors present in both clinical entities, including enhanced inflammatory status and oxidative stress. altered fibrin clot architecture and function both in cad and dm2 are characterized by lower fibrin clot permeability resulting from a smaller pore size in the fiber network, along with impaired susceptibility to lysis [712 ]. specifically, the altered fibrin structure in dm2 is largely attributed to glycation of fibrinogen and fibrin, which may interfere with fibrin polymerization, cross - linking by fxiii, tissue plasminogen activator (tpa) and plasminogen binding and plasminogen to plasmin conversion. however, the data on this association are not consistent. moreover, fibrinogen is the main determinant of fibrin clot characteristics and increased fibrinogen levels are commonly observed in dm2. hyperfibrinogenemia has also been reported in several cohorts of cad patients free of dm2 and implicated in a higher risk of myocardial infarction (mi) [1416 ]. importantly, there is evidence that fibrin is a consistent component of atherosclerotic plaques, and that the presence of fibrin can promote their growth, being involved in the progression of atherosclerosis. it is unclear whether dm2 is a modulator of fibrin clot phenotype which is potent enough to alter the fibrin variables modified already by a number of prothrombotic mechanisms that operate in advanced cad. it has been demonstrated that acute hyperglycemia observed in up to 50 % of acute mi patients could significantly reduce the efficiency of fibrinolysis but had no effect on clot permeability. in advanced atherosclerosis, the effect of dm2 on fibrin clot properties appeared to be weaker and overruled by the impact of other factors, including hyperhomocysteinemia and elevated c - reactive protein. despite the fact that more tightly packed and less porous fibrin structure has been observed more often in cad patients who experienced stent thrombosis in the past, the effect of dm2 on clot properties in this population was negligible. on the other hand, treatment with insulin or biguanide has been shown to make fibrin more permeable [20, 21 ]. similarly, statin treatment can improve fibrin clot characteristics in subjects with increased cardiovascular risk [9, 22 ]. the aim of this study was to evaluate the fibrin clot permeability and susceptibility to lysis in cad patients with concomitant dm2 and determine factors that may account for alterations in fibrin clot properties in such high - risk population. in this case control study, we recruited 67 consecutive white patients (44 males and 23 females) with cad (angiographically documented 70 % stenosis in at least one epicardial coronary artery) and documented dm2, scheduled for elective coronary artery bypass grafting surgery (cabg). diabetes was defined as a history of diabetes regardless of disease duration, need for hypoglycemic agents, or fasting plasma glucose 126 mg / dl (7 mmol / l) on two separate occasions. exclusion criteria were : cancer, acute illness, atrial fibrillation, liver injury, acute coronary syndrome within the previous 6 weeks. a control group comprised 65 non - diabetic cad patients (49 males and 16 females), scheduled for cabg at the same time and matched for age, gender, and smoking habits. all subjects calculated an individual body mass index (bmi) using the standard formula : body mass in kilograms divided by the square of height in meters. blood samples were drawn from an antecubital vein with a minimal stasis prior to surgery. lipid profile and glucose high - sensitivity c - reactive protein (crp) was measured by nephelometry (dade behring). commercially available immunoenzymatic assays were used to determine fibrinolytic proteins, including plasma plasminogen activator inhibitor-1 antigen (pai-1 ; american diagnostica, stamford, ct, usa), tpa (diagnostica stago, asnieres, france), thrombin activatable fibrinolysis inhibitor antigen (tafi ; chromogenix, lexington, massachusetts, united states), von willebrand factor (vwf ; diagnostica stago, asnieres, france), and also platelet activation markers, soluble cd40 ligand (scd40l ; r&d systems, indianapolis, in, usa), and p - selectin (r&d systems). all the intra - assay and inter - assay coefficients of variation for the elisa measurements were below 7 %. fibrin clot permeability, expressed as a permeation coefficient (ks), which indicates the pore size, was determined as described. briefly, citrated plasma was diluted with the tris buffer, containing 20 mmol / l cacl2, 1 u / ml human thrombin (sigma) and 1 g / ml recombinant tpa (boerhinger ingelheim, ingelheim, germany). the time required for a 50 % decrease in clot turbidity (t50%) was determined. the study was powered to have a 80 % chance of detecting a 5 % difference in plasma clot permeability and lysis time using a p value of 0.05. in order to demonstrate such a difference or greater, 52 patients were required in each group. for a p value of 0.01, continuous variables are expressed as mean sd or median (interquartile range) and categorical variables as number (percentage). continuous variables were checked for normal distribution with shapiro wilk test and compared by student s t test or the mann the pearson or spearman rank correlation coefficients were calculated to test the association between two variables with a normal or non - normal distribution, respectively. the influence of different therapy of diabetes on fibrin clot properties was checked with kruskal all clinical and laboratory variables that showed the association with ks or t50% in univariate model (p 0.2) and did not show substantial correlations (r > 0.5) with another independent variable were then included in the multiple linear regression analysis to determine predictors of ks and t50% in the study population. the study was powered to have a 80 % chance of detecting a 5 % difference in plasma clot permeability and lysis time using a p value of 0.05. in order to demonstrate such a difference or greater, 52 patients were required in each group. for a p value of 0.01, continuous variables are expressed as mean sd or median (interquartile range) and categorical variables as number (percentage). continuous variables were checked for normal distribution with shapiro wilk test and compared by student s t test or the mann the pearson or spearman rank correlation coefficients were calculated to test the association between two variables with a normal or non - normal distribution, respectively. the influence of different therapy of diabetes on fibrin clot properties was checked with kruskal all clinical and laboratory variables that showed the association with ks or t50% in univariate model (p 0.2) and did not show substantial correlations (r > 0.5) with another independent variable were then included in the multiple linear regression analysis to determine predictors of ks and t50% in the study population. a p value < 0.05 was considered statistically significant. as shown in table 1, diabetic and non - diabetic groups were similar in terms of demographic variables and cardiovascular risk factors except bmi, which was 9 % higher in the former group (p < 0.001). a larger proportion of diabetic patients received angiotensin converting enzyme inhibitors (acei ; p = 0.001). twenty - six patients in the diabetic group received insulin alone, 27 were on oral hypoglycemic drugs only, 7 received both insulin and oral agents, while 7 patients were only on the diet.table 1patient characteristicsdiabetic subjectsn = 67controlsn = 65p valueage (years)65.6 7.865.3 9.60.86male gender, n (%) 44 (66)49 (75)0.22bmi (kg / m)29.6 4.027.1 3.80.002arterial hypertension, n (%) 61 (91)54 (83)0.17smoking, n (%) 17 (25)14 (22)0.60peripheral artery disease, n (%) 6 (9)13 (20)0.07previous mi, n (%) 53 (79)55 (87)0.41aspirin, n (%) 11 (16)10 (15)0.87statins, n (%) 58 (87)59 (91)0.33fibrates, n (%) 1 (1)00.32thienopyridine, n (%) 3 (4)1 (2)0.32acei, n (%) 65 (97)51 (78)0.001-blocker, n (%) 61 (91)58 (89)0.73data are shown as mean sd or median (iqr) unless otherwise indicatedbmi body mass index, mi myocardial infarction, acei angiotensin converting enzyme inhibitor patient characteristics data are shown as mean sd or median (iqr) unless otherwise indicated bmi body mass index, mi myocardial infarction, acei angiotensin converting enzyme inhibitor as expected, diabetic patients had higher fasting glucose (+ 24.3 %, p < 0.001) and fibrinogen levels (+ 9.0 %, p = 0.037). elevated pai-1 (+ 58.7, p < 0.001), tpa (+ 24.0 %, p < 0.001) antigens, but not tafi, were observed in the diabetic group. interestingly, p - selectin was increased (+ 12.2 %, p < 0.001) in the diabetic group. vwf and scd40l were similar in both groups (table 2).table 2laboratory investigationsdiabetic subjectsn = 67control subjectsn = 65p valueglucose (mmol / l)6.8 (5.68.0)5.3 (4.85.6)<0.001total cholesterol (mmol / l)4.91 (4.185.39)4.53 (3.895.41)0.40triglycerides (mmol / l)1.55 (1.211.96)1.48 (1.101.79)0.25hdl cholesterol (mmol / l)1.24 (1.091.48)1.31 (1.121.52)0.29ldl cholesterol(mmol / l)2.89 (2.423.64)2.75 (2.323.57)0.33platelets (10/mm)213 (177248)219 (179253)0.69creatinine (mol / l)77 (43172)84 (43154)0.42crp (mg / l)2.60 (1.654.41)2.34 (1.644.33)0.28fibrinogen (g / l)4.43 (3.454.96)3.87 (3.184.82)0.037pai-1 (ng / ml)65.4 (47.978.0)27.0 (21.435.0)<0.001tafi (%) 103 (93117)106 (99113)0.76tpa (ng / ml)10.4 (9.011.1)7.9 (6.59.9)<0.001vwf (iu / ml)108 (100129)108.0 (100119)0.31scd40l (ng / ml)1.04 0.240.97 0.270.10p - selectin (ng / ml)199.4 34.3175.1 39.8<0.001ks (10cm)7.70 1.348.20 0.920.02t50% (min)9.42 1.478.94 1.230.04data are shown as x sd or median (iqr)hdl high - density lipoprotein, ldl low - density lipoprotein, crp c - reactive protein, pai-1 plasminogen activator inhibitor-1, tafi thrombin activatable fibrinolysis inhibitor, tpa tissue plasminogen activator, vwf von willebrand factor, scd40l soluble cd40 ligand, ks permeation coefficient, t50% clot lysis time laboratory investigations data are shown as x sd or median (iqr) hdl high - density lipoprotein, ldl low - density lipoprotein, crp c - reactive protein, pai-1 plasminogen activator inhibitor-1, tafi thrombin activatable fibrinolysis inhibitor, tpa tissue plasminogen activator, vwf von willebrand factor, scd40l soluble cd40 ligand, ks permeation coefficient, t50% clot lysis time cad patients with dm2 had different fibrin clot parameters compared with the non - diabetic controls. ks was 6.1 % lower in the diabetic group (p = 0.02) while t50% was 5.1 % longer in patients with dm2 (p = 0.04). there were no significant differences in t50% between patients receiving various hypoglycemic therapy (p = 0.10) (fig. 1) however, patients treated with oral hypoglycemic drugs had 16.9 % lower ks than those treated with diet only (p < 0.02) and subjects receiving insulin had 14.6 % lower ks than those on dietary treatment only (p < 0.09) (fig. 1).fig. 1clot lysis time (t50%) and permeation coefficient (ks) in relation to different therapy of diabetes. abbreviations : box plot shows median and interquartile range (iqr) (q3 to q1). q1 and q3 are the first and third quartiles. whiskers are drawn at q3 + 1.5 iqr, q1 1.5 iqr. extreme values are omitted clot lysis time (t50%) and permeation coefficient (ks) in relation to different therapy of diabetes. abbreviations : box plot shows median and interquartile range (iqr) (q3 to q1). q1 and q3 are the first and third quartiles. whiskers are drawn at q3 + 1.5 iqr, q1 1.5 iqr. extreme values are omitted in diabetic group the inverse associations between ks and tafi (r = 0.36, p = 0.003), pai-1 (r = 0.38, p = 0.001), tpa (r = 0.27, p = 0.03) were observed (table 2). there were also negative correlations between ks and p - selectin (r = 0.40, p = 0.001 ; fig. 3) and vwf (r = 0.47, p < 0.001 ; fig. 2). moreover, scd40l and ks (r = 0.24, p = 0.06) tended to show inverse correlation in the diabetic group. similar correlations were not seen in the non - diabetic cad patients (data not shown).fig. 2correlation between permeation coefficient (ks) and von willebrand factor (vwf) and p - selectin in diabetic patients correlation between permeation coefficient (ks) and von willebrand factor (vwf) and p - selectin in diabetic patients in patients with dm2 but not in the non - diabetic group, there was a positive correlation between t50% and crp (r = 0.31, p = 0.01). the positive associations t50% with tafi (r = 0.53, p < 0.001) and tpa (r = 0.37, p = 0.002) were demonstrated. in addition, pai-1 had also positive associations with ks in diabetic (r = 0.57, p < 0.001) and non - diabetic patients (r = 0.62, p < 0.001). in the both groups, fibrinogen, p - selectin, vwf were positively correlated with t50% (diabetic group (fig. 3) : r = 0.41, p < 0.001 ; r = 0.51, p < 0.001 ; r = 0.71, p < 0.001, respectively ; non - diabetic group : r = 0.52, p < 0.001 ; r = 0.36, p = 0.003 ; r = 0.49, p < 0.001, respectively). only in the control group, scd40l was correlated with t50% (r = 0.26, p = 0.037).fig. 3correlation between clot lysis time (t50%) and von willebrand factor (vwf) and p - selectin in diabetic patients correlation between clot lysis time (t50%) and von willebrand factor (vwf) and p - selectin in diabetic patients a multiple linear regression analysis was performed to determine the independent effect of laboratory and clinical variables on ks and t50%. before the inclusion to the multiple model, significant correlations between independent variables have been found. ks was strongly correlated with t50% (r = 0.67 ; p < 0.001), vwf (r = 0.43 ; p < 0.001), pai-1 (r = 0.37 ; p < 0.001), and p - selectin (r = 0.29 ; p = 0.001). t50% was significantly correlated with vwf (r = 0.64 ; p < 0.001), pai-1 (r = 0.49 ; p < 0.001), p - selectin (r = 0.46 ; p < 0.001), fibrinogen (r = 0.46 ; p < 0.001), tafi (r = 0.39 ; p < 0.001), and crp before cabg (r = 0.30 ; p < 0.001). p - selectin was correlated with pai-1 (r = 0.47 ; p < 0.001), and fibrinogen (r = 0.29 ; p = 0.001) whereas pai-1 with t - pa (r = 0.38 ; p < 0.001), and vwf (r = 0.44 ; p < 0.001). fibrinogen was correlated with crp (r = 0.53 ; p < 0.001), platelet count (r = 0.37 ; p < 0.001), and vwf (r = 0.30 ; p < 0.001). finally, the multivariate model for the whole study population showed that vwf, pai-1, fibrinogen and diabetes mellitus were the independent predictors of t50% (r = 0.58, p < 0.001 ; table 3) whereas vwf was the only independent predictor of ks (r = 0.22, p < 0.001 ; table 3).table 3multiple linear regression with permeation coefficient or lysis time as the dependent variabledependent variableindependent variablecontribution of variance, % pksvwf10.5<0.00010.36diabetes mellitus2.10.070.15tafi1.20.100.13acei0.040.850.02crp0.010.950.01t50%vwf16.4<0.00010.43pai-116.3<0.00010.45fibrinogen5.50.00040.23diabetes mellitus9.10.0020.30acei0.360.330.06abbreviations : see tables 1 and 2 multiple linear regression with permeation coefficient or lysis time as the dependent variable abbreviations : see tables 1 and 2 the present study shows that dm2 is associated with decreased clot permeability and susceptibility to lysis in patients with severe cad. a strong modulatory effect of dm2 on plasma fibrin clot phenotype has been observed in the presence of several factors leading also to the formation of more dense and less lysable clots such as smoking, hypertension and elevated crp levels. dunn. have reported that the fibrin clots formed from fibrinogen obtained from patients with dm2 had denser, less porous structure than controls. the lack of associations between both fibrin variables and glycemia indicates that other factors may account for alterations in fibrin clot phenotype in cad patients. it has been shown that altered clot properties can be caused by a number of platelet - derived proteins mainly released at the sites of platelet aggregation. polyphosphates secreted from dense granules can alter the formation of fiber aggregates. in the presence of activated platelets, moreover, it has been demonstrated that the use of antiplatelet agents in patients with dm2 can overcome to some extent the potential effects of poor glycemic control on platelet reactivity. our study shows that p - selectin, which is expressed in alpha - granules of activated platelets, was increased in patients with dm2 and cad compared with non - diabetic subjects. another platelet marker, scd40l, which did not differentiate diabetic and non - diabetic cad patients, showed weaker or no associations with fibrin parameters in the current study. this provides evidence for a role of platelet activation in altering the fibrin clot structure in diabetic cad patients. an original finding is a strong association between vwf and clot properties, both permeability and lysis, observed in advanced cad. interestingly, in this patient group vwf was a predictor of ks, indicating novel associations linking endothelial dysfunction with fibrin clot properties measured ex vivo. endothelial dysfunction implies an alteration in endothelial integrity and, as such, may be assessed by flow - mediated dilatation or by changes in circulating markers, such as plasma vwf. it remains to be established whether vwf per se might actively alter plasma fibrin network properties. there have been previous studies showing increased [2931 ] or decreased tafi levels [32, 33 ] in cad patients. there have been, however, few reports evaluating the effect of tafi on clot lysis time in diabetic subjects that demonstrated no effect or hypofibrinolysis. in the present study, despite similar tafi levels in both groups, we found associations between permeability, lysis time and tafi only in the diabetic cad group. the impact of tafi on plasma fibrin clot phenotype in dm2 merits further investigation. given the fact that in both groups, a significant percentage of cad patients was taking statins, which have been reported to increase the clot permeability and lysis time [9, 22 ], it might be concluded that both drugs, though they can improve clot phenotype, were not able to abolish a complex effect of dm2 on fibrin variables [9, 11, 13 ]. of note, there were differences in clot permeability associated with the mode of treatment of dm2. taking into account the previous findings [20, 21 ], this probably resulted from disease severity and a specific effect of insulin or oral antidiabetic agents. in the present study, pai-1, fibrinogen and dm2 have been found to be the independent predictors of t50%, and vwf both t50% and ks. it appears that coexistence of atherosclerosis and dm2 might markedly enhance influence of the endothelial cell and the platelet activation on t50%. nevertheless, diabetic patients were matched with the non - diabetic group for most parameters. nevertheless, sample preparation including dehydratation hampers the extrapolation of microscopic findings to the in vivo conditions. in conclusion, our observations indicate that the dm2 is potent enough to unfavorably affect the plasma fibrin clot characteristics despite the altered clot phenotype as typically observed in advanced cad. in this clinical study platelet and endothelial markers further studies are needed to determine the mechanism of the altered fibrin clot structure formation in patients with dm2 and advanced cad. | altered fibrin clot structure has been reported both in patients with coronary artery disease (cad) and those with type 2 diabetes mellitus (dm2). the aim of the present study was to evaluate plasma fibrin clot permeability and susceptibility to lysis in patients with dm2 and cad. we studied 132 consecutive cad patients, including 67 subjects with dm2, scheduled for elective coronary artery bypass grafting surgery. ex vivo plasma fibrin clot permeability (ks) and lysis time (t50%) induced by 1 g / ml recombinant tissue plasminogen activator (tpa), along with plasma levels of plasminogen activator inhibitor-1 (pai-1), thrombin activatable fibrinolysis inhibitor (tafi), tpa, von willebrand factor (vwf), p - selectin, soluble cd40 ligand (scd40l), were measured. diabetic and non - diabetic patients did not differ in regard to demographics and remaining cardiovascular risk factors. concomitant dm2 was associated with higher glucose (+ 24.3 %, p < 0.001), fibrinogen (+ 9.0 %, p = 0.037), pai-1 (+ 58.7 %, p < 0.001), tpa (+ 24.0 %, p < 0.001) and p - selectin (+ 12.2 %, p < 0.001). compared with the non - diabetic group, the cad patients with dm2 had lower ks (-6.1 %, p = 0.02) and prolonged t50% (+ 5.1 %, p = 0.04). multiple regression analysis of the whole study group showed that vwf, pai-1, fibrinogen and dm2 were the independent predictors of t50% (r2 = 0.58, p < 0.001), while only vwf was an independent predictor of ks (r2 = 0.22, p < 0.001). this study indicates that dm2 is potent enough to unfavorably affect plasma fibrin clot characteristics despite abnormal clot phenotype typically observed in cad. of note, platelet and endothelial markers appear to contribute to fibrin clot properties in cad concomitant with dm2. |
the most common oxidation states in the environment are + 3 (as, also known as arsenite) and + 5 (as or arsenate), which exhibit different grades of toxicity. arsenic compounds can be found in organic (when linked with carbon and hydrogen) and inorganic (when combined with oxygen, chlorine, and sulfur, among other elements) forms. there are various sources of ingested arsenic, such as food (mainly in fish and seafood, algae, and cereals), air (coal - fired power generation and smelting), and water. of the various sources of arsenic in the environment, long - term exposure of arsenic in drinking water likely poses the greatest threat to human health. given its daily and widespread consumption, occurrence of arsenic in drinking water has been increasingly recognized as a major public health concern in several regions of the world over the past decades [57 ]. in fact, groundwater used for drinking contaminated with naturally occurring inorganic arsenic in bangladesh represents one of the largest mass poisoning of a population in history. worldwide, an estimated 160 million people live in regions with naturally elevated levels of arsenic in drinking water, due to the presence of arsenic - rich geological formations. arsenic is a natural component of rocks containing copper or lead, which can result in release of arsenic into water or air in zones of intensive mining activities. due to these geological conditions and/or anthropogenic activities, soil and this situation is compounded in extremely arid zones (such as in northern chile), where water sources are scarce and contaminated water serves as a drinking and irrigation supply. arsenic - contaminated drinking water represents an important public health issue, especially for developing countries. due to its physical characteristics (no odor, no color, and no flavor), arsenic exposure is often unnoticed, especially when ingested through drinking water. in this context, long - term effects are a major health concern in affected areas. the world health organization (who) and the u.s. environmental protection agency have recommended a threshold of 10 g / l for inorganic arsenic concentration in drinking water [11, 12 ]. unfortunately, millions of people are exposed to toxic levels and are at increased risk for the adverse health effects of arsenic [6, 13 ]. concentrations exceeding this threshold have been described in bangladesh, india, china, argentina, mexico, canada, usa, and chile, among other countries. there is a strong body of evidence linking arsenic with a variety of health problems, from acute toxicities to chronic diseases which can take years to develop. arsenic - related diseases include skin lesions, hypertension, ischemia, some endemic peripheral vascular disorders (e.g., black foot disease), diabetes, severe arteriosclerosis, neuropathies, and, significantly, many types of cancer [1518 ]. cancer - death risk associated with daily consumption of 1.6 liters of water with inorganic arsenic (50 g / l) has been estimated to be 21/1,000. arsenic has been classified as a class i human carcinogen by the international agency of research on cancer (iarc), meaning that there is sufficient evidence of carcinogenicity to humans. despite evidence in humans, animal models fail to replicate these observed effects, hampering elucidation of the exact mode(s) of action underlying arsenic related carcinogenicity. skin and several types of internal cancers, including bladder, kidney, liver, prostate, and lung have been associated with arsenic ingestion [10, 2125 ]. skin cancer is the most common form of neoplasm associated with arsenic ingestion, while lung cancer corresponds to the most deadly [13, 26 ]. interestingly, arsenic (specifically arsenic trioxide or as2o3) has been used as a chemotherapeutic agent for several types of cancer, with some studies showing high percentage of response in patients with acute promyelocytic leukemia (apl) [27, 28 ]. the relationship between arsenic and skin cancer has been well documented over the past several decades [29, 30 ]. the first inferences were made through observations of an increased frequency of skin cancer cases following treatment with fowler 's solution (1% potassium arsenite), formerly used for a variety of skin and hematological disorders. bowen 's disease (intraepithelial carcinoma or carcinoma in situ), basal cell carcinoma (bcc)- and squamous cell carcinoma (sqcc) are the most common malignancies found in patients with long - term exposure to arsenic. merkel cell carcinoma, an uncommon and highly aggressive cutaneous neoplasm, has been also documented at a lower frequency [3235 ]. arsenic - related skin sqcc can develop either de novo or progress from bowen 's disease, whereas arsenic - related bcc develops usually in multiple foci and areas of the body covered from sun exposure, in contrast to cases originating from other skin carcinogens, such as uv - light [3638 ]. arsenic - related bowen 's disease can appear 10 years after arsenic exposure, while other types of skin cancer can have a latency period of 20 or 30 years. a dose - response relationship and cell - type specificity have been described for arsenic - related skin cancer [40, 41 ]. additionally, normal human epidermal keratinocytes exposed to varying noncytotoxic / slightly cytotoxic concentrations of inorganic arsenic exhibit gene expression changes associated with molecular pathways relevant to arsenic - related skin carcinogenesis, such as oxidative stress, increased transcriptional levels of keratinocyte growth factors, and modulation of mapk and nf-b pathways. premalignant skin lesions are relatively early manifestations of arsenic toxicity and are often considered precursors to arsenic - induced skin bcc and sqcc tumors. pattern of pigmentation or depigmentation) and hyperkeratosis (skin thickening, mainly at palms and the feet). these lesions are commonly found in chronically exposed populations and are considered a diagnostic criterion of arsenicosis. moreover, some genetic susceptibilities to these arsenic - related skin lesions have been proposed, since they do not occur in every exposed individual. hyperkeratosis can appear with shorter periods of arsenic exposure, and it has been described that these lesions give rise to the majority of arsenic - induced skin cancer [46, 47 ]. additionally, it has been demonstrated that a significant proportion of fatal cases of skin cancer occurred in patients with prior signs of arsenicosis, such as keratosis and hyperpigmentation [31, 48 ]. in addition to directly affecting the carcinogenic process, it has been demonstrated that arsenic toxicity can also be potentiated by other environmental carcinogens. for example, arsenic - exposed individuals with a history of smoking and chronic exposure to environments with high fertilizer use may be more susceptible to cancer - prone skin lesions than those without these risk factors, even at the same level of arsenic exposure. arsenic can act as a cocarcinogen with uv light in a synergistic mode of action, leading to development of hyperkeratosis [49, 50 ]. additionally, the same mode of action was observed between high levels of arsenic (over 100 g / l) and tobacco smoking with respect to risk of skin lesions in men. there exists a significant dose - response relationship between arsenic concentration in water and incidence of lung cancer and other malignancies for both men and women. the association between lung cancer and ingested arsenic was discovered following therapeutic application of this metalloid in psoriasis patients treated with fowler 's solution [5355 ]. thereafter, an increased lung cancer risk following exposure to arsenic in drinking water was demonstrated by several case - control and cohort - type studies. consistent, positive, and statistically significant associations among individuals exposed to high concentrations of arsenic in drinking water and increased risk of lung cancer have been detected [56, 57 ]. based on large epidemiology studies in 1999, a report from the national research council (nrc, usa) concluded that there was sufficient evidence suggesting that the ingestion of arsenic in drinking water causes lung cancer, among other types of malignant neoplasias. after this publication, other major arsenic and lung cancer epidemiological studies were published [25, 59 ]. due to mounting evidence, the nrc study was reevaluated in 2001, concluding that the carcinogenic effects of arsenic in humans are significant, and that lung (and bladder) cancer should continue to be the focus of arsenic risk assessment for regulatory decision making. interestingly, the increase risk of lung cancer associated with arsenic seems to be cancer subtype specific. for example, where sqcc incidence had decreased worldwide and overwhelmingly associated with cigarette smoking ; in northern chile, a high proportion of sqcc frequently occurs in never smokers who have been chronically exposed to arsenic [25, 61 ]. as mentioned, bangladesh represents the largest mass poisoning of a population in history, as groundwater used for drinking is contaminated with naturally occurring inorganic arsenic. in rural areas in bangladesh, arsenic contamination in drinking water from tube wells is associated with lung cancer in males, with lung sqcc being the predominant histological subtype in areas with arsenic concentrations above 100 g / l. in these areas, the lifetime mortality risks of lung cancer are 159.1/100 000 for males and 23.1 for females (per 100 000 population). blackfoot disease (bfd) is an endemic, peripheral arterial disease characterized by severe systemic arteriosclerosis and spontaneous gangrene resulting in amputation, common to individuals exposed to arsenic in southwestern taiwan. in zones affected by bfd, increased incidence and subsequent mortality rates for lung cancer have been demonstrated, especially among those who used arsenic - contaminated well water for 40 years. smokers in this area have a 4.1-fold higher relative risk for lung cancer, suggesting a possible synergistic relationship between arsenic and tobacco exposures in terms of lung tumorigenesis. also, short - term exposure (5 years) of arsenic - contaminated drinking water (0.05 the andean zone in south america is another area where the relationship between chronic arsenic exposure and lung cancer has been demonstrated. a dose - response relationship between arsenic in drinking water and lung cancer was found in central regions of argentina, where arsenic concentrations in water supplies were > 100 g / l, even reaching as high as 2000 g / l. a correlation between increased arsenic concentration in drinking water and lung cancer incidence, lung cancer mortality increased ten years after the initiation of high - level exposure (arsenic concentration > 90 g / l in 1958). chronic exposures to water contaminated with low concentrations of arsenic do not, however, show the same strong associations with increased cancer incidence and mortality. for example, a study carried out in denmark did not find any significant association between exposure to low concentrations of arsenic in drinking water (0.0525.3 g / l) and risk of melanoma or lung cancer, among other types of neoplasias. similarly, another study conducted in belgium did not find a significant correlation between exposure to drinking water containing relatively low arsenic concentrations (2050 g carriers of cyp1a1 2a / gstm1 homozygous deletion genotype show increased odds ratios for lung cancer, especially among smokers [71, 72 ]. in addition, our group has recently proposed that genomic aberrations in arsenic induced lung cancers exhibit distinct molecular characteristics. using a whole genome tiling - path comparative genomic hybridization (cgh) array platform (described in), we analyzed dna copy - number alterations (cnas) among lung sqcc cases from a northern chilean population chronically exposed to inorganic arsenic in drinking water (figure 1). we identified unique patterns of chromosomal disruption and gene dosage related to sqcc from never smokers in northern chile, which did not correlate with normal dna copy - number variations (figure 1). this has led to the growing hypothesis that lung sqcc in arsenic - exposed individuals could represent a molecularly distinct form of this disease. pentavalent arsenical species are reduced to trivalent species, and oxidative methylation occurs to yield methylated tri- and pentavalent metabolites. however, more than a detoxification mechanism, it has been proposed that methylation can activate the toxic and carcinogenic potential of arsenic, since it has been demonstrated that mono / dimethylated arsenical species (both tri / pentavalent) can affect gene transcription, and are more potent enzyme inhibitors and cytotoxins than non - methylated species [76, 77 ]. moreover, since the arsenic biotransformation pathway uses s - adenosylmethionine (sam) as a methyl group donor, arsenic can also interfere with a number of cellular processes that require methyl groups, leading to the idea that alteration of epigenetic mechanisms can also participate in arsenic - induced carcinogenesis. a variety of these arsenic associated toxic events have been elucidated in cell line and animal models (table 1). after reduction of as to as by purine nucleoside phosphorylase, as is methylated via a as - methyltransferase, using sam as a methyl group donor, producing mono and dimethylated trivalent species, such as monomethylarsonous acid (mma), dimethylarsinous acid (dma), and equivalent pentavalent species (monomethylarsonic acid or mma, and dimethylarsinic acid or dma. interestingly, there is little evidence of methylated arsenic metabolites in skin, and in vitro studies have demonstrated that keratinocytes display very slow rates of arsenic methylation, and only mono - methylated species are produced [45, 80 ]. it has been proposed that as could be one of the responsible agents in arsenic related skin carcinogenicity, since it acts as a cocarcinogenic to mouse skin. additionally, individuals with arsenic - related skin lesions or skin cancer exhibit lower levels of dimethylated species in urine (in contrast to monomethylated species) [8285 ], indicating that a lower methylation activity could predispose individuals to arsenic - related skin malignancies. cellular induced damage derived from arsenic biotransformation leading to carcinogenic processes have usually been described to occur through oxidative stress by generation of toxic species, such as reactive oxygen species (ros) leading to genomic aberrations. generation of ros has been described as one of the earliest and most important mechanisms of arsenic - induced carcinogenicity [8691 ]. oxidative damage (measured as guanine oxidation) is significantly associated with skin tumors associated with arsenic exposure [92, 93 ]. it has also been shown that oxidative stress can modify gene transcription profiles of human hyperkeratosis, affecting several cancer - relevant pathways, such as the wnt/-catenin and calcium signaling pathways [94, 95 ]. both single- and double dna strand breaks are characteristic of most cancer types and have been shown to be induced by chronic arsenic exposure, even at low concentrations [96, 97 ]. arsenic, arsenic metabolites, and metabolism, directly and indirectly, affect normal epigenetic transcriptional regulation at both the level of dna methylation, histone maintenance, and mirna expression (reviewed in [98, 99 ]). as previously mentioned, biotransformation and reduction of arsenic leads to the formation of highly toxic methylated arsenic species which act as potent cytotoxics and enzyme inhibitors. since this process utilizes sam, the cell 's own methyl group donor, arsenic is thought to interfere with the cell 's ability to maintain normal epigenetic regulation via the disruption of normal dna methylation patterns, histone modification, and expression of micrornas (mirnas), possibly by the depletion of cellular pools of methyl groups (figure 2). epigenetic modifications do not alter the dna sequence itself but instead result in chemical modifications to dna or histone tail residues. cells and tissues exposed to arsenic display epigenetic aberrations that mimic early hallmarks of cancer, providing evidence for an epigenetic role in arsenic - mediated tumorigenesis. epigenetic regulation of gene expression is a highly dynamic process that can be modulated by existing therapeutics [100, 101 ] which may potentially apply to arsenic - related malignancies. in the human genome, dna methylation occurs at the 5-carbon position of cytosine in cpg dinucleotide sequences, resulting in 5-methylcytosine (5mc), often within short evolutionarily conserved regions enriched for cpg dinucleotides, called cpg islands [102, 103 ]. when located in promoter regions of genes, cpg islands are typically unmethylated (~90%) ; however, promoters without cpg islands are frequently methylated. therefore, the bulk of methylated dna in the human genome occurs in repetitive dna sequences, where it is thought to have an important role in silencing transposable elements and maintaining genomic stability. the transfer of the donor methyl group from sam to the cytosine in a cpg dinucleotides is catalyzed by dna methyl transferase (dnmt) enzymes, responsible for the de novo methylation throughout development (dnmt3a, dnmt3b, and dnmt3l) and maintenance of methylation patterns in somatic tissue (dnmt1). aberrant dna methylation is implicated in a vast spectrum of diseases and disorders and is one of the earliest and most frequent aberrations in cancer. dna hypomethylation is associated with genomic instability and the reexpression of parasitic dna, in addition to activation of genes normally silenced by methylation in a tissue - specific manner. conversely, aberrant dna promoter hypermethylation is strongly linked to transcriptional gene silencing, particularly for tumor suppressor genes (tsgs) and cancer. dna methylation patterns observed in human cancers resemble those of arsenic - related premalignant and malignant cells and tissues. for example, the dna methylation patterns of several well - known cancer genes have been studied in the context of, and found to correlate with, arsenic exposure in in vitro cell models and in populations exposed to arsenic. the activation of proliferative genes in rat liver epithelial cell lines which undergo malignant transformation following chronic, low - level arsenic exposure is associated with aberrant dna hypomethylation. exposure to as and as in the lung cancer cell line (a549), resulted in promoter hypermethylation and subsequent transcriptional silencing of p53. mice, chronically exposed to as through drinking water, acquire frequent promoter hypermethylation of the tumor suppressors p16 and rassf1a in lung tumor tissues. a study analyzing 351 cases of bladder cancer cases found that arsenic exposure was associated with promoter methylation of rassf1a and prss3. intriguingly, in one study, individuals with no cancer, but who were exposed to high arsenic concentrations (> 251 g / l), had a significant degree of dna hypermethylation in promoter regions of p53 and p16 compared to nonexposed controls, suggesting that arsenic related - hypermethylation events may be some of the earliest causal tumorigenic events. collectively, these and other findings (see [98, 99 ]) support the notion that arsenic - induced changes to dna methylation play a role in tumor formation. histones proteins enable condensation of double - stranded supercoiled eukaryotic dna into nucleosomes, which are made up of two copies each of h2a, h2b, h3, and h4 proteins. the n - terminal tails of histones are accessible to modifying enzymes, which function in catalyzing posttranslational modifications to the amino acid residues residing within the histone tail, including acetylation, methylation, ubiquitination, sumoylation, and phosphorylation amongst others [110, 111 ]. specific patterns of these modifications, commonly referred to as the histone code, correlate with transcriptional states of associated genes as well as to disease phenotypes. working in conjunction with transcriptional coactivators or repressors, histone modifying enzymes catalyze the addition or removal of these modifications to generally induce or maintain an (1) open euchromatic state, through the addition of acetyl groups (via histone acetyltransferases) or (2) a closed or heterchromatic state, through the addition of methyl groups (via histone methyltransferases) or removal of acetyl groups (via histone deacetylases) on specific histone residues. therefore, transcriptional activity of associated genes correlates with the formation of euchromatin or heterochromatin. arsenic metabolites have been shown to modulate normal histone patterns. as has also been shown to modify methylation patterns on h3k4, h3k9, and h3k27. a549 cells exposed to 2.55 m of as exhibited an increase in h3k9 dimethylation and a decrease in h3k27 trimethylation, both of which are associated with heterochromatin (gene silencing), and a decrease in h3k4 trimethylation which is associated with euchromatin formation (an activation mark). when the normal bronchial epithelial cell line (beas-2b) was exposed to 1 - 2 m of as, an increase in dimethylation of h3k9 arsenic compounds were also shown to induce malignant transformation of human nontumorigenic cell lines through changes to histone h3 acetylation, dna promoter methylation, and decreases expression of the dbc1, fam83a, zscan12, and c1qtnf6 genes. for each of these underexpressed genes, dna methylation inversely correlated with the histone acetylation levels for their respective promoter regions, leading authors to conclude that changes in histone h3 acetylation occur during arsenic - induced malignant transformation. mirnas are small, noncoding rna species that orchestrate the expression of genes involved in many key aspects of cell biology by degradation and translational inhibition of their target mrnas (reviewed in). in humans, more than 1400 mirnas have been identified to date (mirbase data base ; release 17, april 2011). mirnas inhibit gene expression by binding to the 3-untranslated region of mrnas through imperfect base pairing ; consequently, a single mirna can negatively regulate the expression of multiple and sometimes upwards of hundreds target genes. as a result, mirnas deregulations are implicated in diverse human pathologies, including cancer (reviewed in). an increasing number of studies show that arsenic exposure can alter mirna expression levels in vitro and in vivo. human lymphoblastoid cells exposed to sodium as over six days showed altered expression of five mirnas (hsa - mir-210, -22, -34a, -221, and -222). the authors hypothesized that these alterations could be a consequence of changes in methylation patterns, since the same alterations were observed when cells were grown under folate - deficient conditions, which can lead to reduced levels of sam. furthermore, overexpression of hsa - mir-222 was confirmed in human peripheral blood - derived cells from individuals with insufficient dietary folate. the induced changes in mirna expression could be reversed by the restoration of folate, suggesting that continuous exposure to agents like arsenic may be necessary to permanently alter the expression of mirnas. chronic exposure to as has also been shown to induce malignant transformation and epithelial - to - mesenchymal transition (emt), in concert with reduction in levels of mir-200 family members in immortalized p53-knocked downhuman bronchial epithelial cells (hbecs) but not in p53-intact hbecs. interestingly, stable expression of mir-200b alone was capable of entirely reversing and preventing as - induced emt and malignant transformation. arsenic exposure depleted the mir-200 s through the induction of emt - inducing transcription factors zinc - finger e - box - binding homeobox factor 1 (zeb1) and zeb2 and increased methylation of mir-200 promoters. a recent study examining the global expression of mirnas and mrnas of chick embryos after arsenic exposure revealed a dramatic decrease in expression of mirna-9, -181b, -124, and -125b. nrp1a transmembrane receptor involved in angiogenesis which is upregulated at the mrna level in arsenic - treated chick embryos was found to be a target gene of mir-9 and mir-181b. overexpression of mir-9 or mir-181b suppressed as - induced nrp1 expression, cell migration and tube formation, supporting involvement of these mirna species in as - induced angiogenesis via nrp1 gene activation. despite its carcinogenic potential, as has also been used as a treatment option for apl, which is frequently associated with a gene fusion involving the retinoic acid receptor alpha (rara) and the promyelocytic leukemia protein (pml) gene. have shown that pml - rara is able to transcriptionally repress several mirnas associated with critical pathways linked to leukemogenesis, such as hox proteins and cell adhesion molecules. expression of these mirnas was restored by retinoic acid and as, suggesting that, in apl, these agents may function to inhibit cell growth, at least in part by impacting mirna expression. arsenic contamination of drinking water remains a serious public health problem, affecting hundreds of millions individuals worldwide. the more severe effects, such as cancer, are evident up to several decades after exposure has ceased. although mitigation measures have been taken, the natural origin of this contamination keeps this problem an active preoccupation that requires strategies to monitor arsenic concentrations in drinking water and to define markers associated with early health effects. overall, reviewed literature indicates that arsenic exposure exerts deleterious health effects primarily through the induction of oxidative stress, alterations to dna methylation, histone modification, and mirna expression. understanding these events in the context of arsenic toxicity may provide powerful biomarkers for arsenic - induced carcinogenicity and elucidation of early steps in arsenic - induced malignancies that may be reversed by targeted therapies or preventative chemotherapeutics. larger, carefully designed epidemiologic studies will be required to more comprehensively examine the presence and consequence of these alterations in populations affected by arsenic contamination. since synergistic cocarcinogenicity, especially in skin and lung cancer, occurs in arsenic - exposed individuals, considerations of other environmental agents should be taken into account in these studies. elucidation of the mechanisms underlying the initiation and promotion of carcinogenesis related to arsenic 's biotransformation processes and metabolites is of foremost importance to the development of early detection and treatment regimes for affected individuals. | arsenic is a metalloid, that is, considered to be a human carcinogen. millions of individuals worldwide are chronically exposed through drinking water, with consequences ranging from acute toxicities to development of malignancies, such as skin and lung cancer. despite well - known arsenic - related health effects, the molecular mechanisms involved are not fully understood ; however, the arsenic biotransformation process, which includes methylation changes, is thought to play a key role. this paper explores the relationship of arsenic exposure with cancer development and summarizes current knowledge of the potential mechanisms that may contribute to the neoplastic processes observed in arsenic exposed human populations. |
cell - free dna (cfdna) is a newly available technology that allows highly accurate screening for the most common chromosome abnormalities without invasive testing. this testing identifies fetal dna in the maternal circulation and is considered to have a detection rate for trisomy 21 and trisomy 18 of greater than 97% and greater than 80% for trisomy 13 [18 ]. currently, consideration of cfdna testing is recommended for women at increased risk for chromosome abnormalities including women of advanced maternal age (ama), with abnormal serum screening results, ultrasonographic findings suggestive of aneuploidy, or history of a prior pregnancy affected by trisomy. however, the utilization of this new technology and the specifics of incorporating it into routine care are complex, as the information obtained from cfdna screening may overlap or contradict that from maternal serum screening, nuchal translucency ultrasound, or the genetic sonogram. we present our experience with implementing a new program for cfdna screening in a public hospital setting with attention to patient education and early genetic counseling to individualize care and eliminate redundant screening. the aim of this report is to assess implementation of this program in terms of diagnostic testing elected by participating patients in comparison to a cohort of ama patients seen prior to availability of cfdna in our practice. in addition, we sought to analyze concurrent trends in prenatal ultrasound practice, specifically whether nuchal translucency utilization and/or the relative importance of ultrasound soft markers at the detailed ultrasound changed after integration of cfdna. in response to the availability of cfdna, beginning in january 2013, we implemented a new patient care program entitled advanced maternal age options (ama options) to incorporate cfdna testing into the existing prenatal diagnosis services at santa clara valley medical center (scvmc) health and hospital system. scvmc is a tertiary care public health hospital with 6 free standing ambulatory health centers providing a full scope of maternal child health services. in addition, there are multiple community partner clinics that refer high - risk women for specialized pregnancy, delivery, and neonatal care. genetics and maternal fetal medicine ultrasound and consultation services are provided together at a single centralized ambulatory clinic location, which is also designated as a regional prenatal diagnosis center certified by the state of california department of health genetic disease screening program. genetic counseling is provided by licensed genetic counselors in the patient 's preferred language, either with the aid of native speaking counselors or professional translators. our system provides care to a predominantly hispanic population (74.0% in 2012 ; california maternal quality care collaborative maternal data center ; accessed 5 november 2013), as well as a significant number of women of asian / pacific islander decent (13.4% in 2012). the goal of the ama options program was to create a patient - directed plan of care for high - risk women that would allow the greatest access to a variety of testing options and avoid performing redundant screening. women who were identified as high risk (aged 35 or older at delivery or those with a prior family history of trisomy 13, 18, or 21) were referred for genetic counseling by their primary obstetricians during the late first trimester, ideally between 11 and 12 weeks of gestation. genetic counselors reviewed the available testing options including cfdna, first and second trimester serum screening, nuchal translucency (nt) ultrasound, detailed ultrasound, and amniocentesis. during that appointment, a patient - directed plan of care was created according to one of four care pathways : (1) cfdna ; (2) integrated screening (first trimester serum screening with nt ultrasound and second trimester quad screening) ; (3) direct - to - invasive testing (chorionic villus sampling (cvs) or amniocentesis) ; or (4) no screening. we assumed that this schema of stratifying choices would allow women to choose which testing they preferred while avoiding performance of multiple testing modalities on the same woman (i.e., women would not get first trimester serum screening and nt ultrasound if they were electing cfdna). women were by and large covered through the california medical program which recognized cfdna as a covered service for high - risk pregnancies. the harmony prenatal test (ariosa diagnostics, san jose, california) was available and, in most cases, was a covered benefit. all participating women were scheduled for detailed ultrasound between 16 and 22 weeks (ideally between 18 and 20 weeks). women were seen briefly for a second genetic counseling appointment in coordination with their detailed ultrasound to review the results of first trimester risk assessment and finalize their decision for amniocentesis. second trimester afp screening for neural tube defects was offered to all patients not having amniocentesis performed. all first and second trimester serum specimens were processed through the california genetics disease screening program. we compared high - risk women seen in the ama options program between january and september 2013 to advanced maternal age women seen in our clinic during the same period in 2012, prior to the initiation of the ama options program and prior to availability of cfdna in our practice. during 2012, high - risk women were generally offered standard first and second trimester screening by their primary obstetricians and referred and seen for genetic counseling in the second trimester (ideally at 18 weeks) on the same day and immediately prior to a detailed ultrasound, with amniocentesis, if desired. they were offered cvs (prior to 14 1/7 weeks) or amniocentesis (after 16 0/7 weeks) and detailed ultrasound. for nuchal translucency 3.5 mm, patients were also offered fetal echocardiography between 20 and 22 weeks. as all women with screen positive results were covered through california public insurance, their out - of - pocket expense was not a determining factor in test choices. choices in prenatal diagnostic testing and indications for invasive testing among all patients seen for genetic counseling prior to and following initiation of the ama options program were recorded by the genetic counselors in a prospective interdepartmental database. indication for invasive testing was classified as fetal anomaly (if any fetal anomalies other than soft markers were found at the time of the detailed ultrasound) ; ultrasound soft marker (see below) ; abnormal serum screening (screen positive on first and/or second trimester screening) ; family history (patient or 1st degree relative with congenital anomaly, mental retardation, genetic syndrome, or aneuploidy) ; or advanced maternal age only (if absence of any of the above indications). the presence of fetal anomalies or ultrasound soft markers was recorded by the perinatologist performing the detailed ultrasound. ultrasound protocols in use by our department during both 2012 and 2013 specified reporting of 6 soft markers in patients undergoing either standard or detailed sonograms between 16 and 22 weeks : echogenic intracardiac focus (unilateral or bilateral, isoechoic to bone) ; choroid plexus cyst (unilateral or bilateral, > 5 mm diameter) ; echogenic bowel (isoechoic to bone) ; pyelectasis (renal pelvis 4 mm) ; shortened humerus (less than 2.5% percentile for bpd) ; and nuchal thickness 6 mm (on angled axial view of upper cerebellum). management and patient counseling upon finding of one or more soft markers the santa clara valley medical center institutional review board granted exemption from review for this project. statistical analysis was performed using stata / ic 12 (statacorp, college station, tx) to test for differences in proportions. in the first 9 months of 2013, 181 women were seen in our unit for ama options counseling. for 163 (90%) of these, complete information about ultrasound findings and diagnostic testing choices at the 1622-week detailed ultrasound were available, and these women are the subject of the current report. of those who did not follow up for second trimester detailed ultrasound in our unit, there was no difference in patient demographics (age 38.0 versus 38.6 years ; gestational age 11.5 versus 12.1 weeks), proportion choosing early cfdna screening (66.7%) or invasive testing (16.7%), or proportion with abnormal screening (0.0%). figure 1 shows the number of women electing the various options presented at the ama options counseling session : cell - free fetal dna screening (112/163, 68.7%), integrated screening (1/163, 0.6%), direct - to - invasive testing (23/163, 14.1%), and no screening (27/163, 16.6%). of those who initially chose no screening, 5/27 (18.5%) women ultimately did desire and underwent cfdna ; and, of those who initially elected direct - to - invasive testing, 5/23 (21.7%) ultimately chose to undergo cfdna screening in lieu of amniocentesis in the second trimester. one woman (1/122, 0.8%) was screened positive for trisomy 21 on cfdna but did not elect invasive testing. she experienced a spontaneous abortion of dichorionic twins at 17 weeks ; genetic testing was not performed on the conceptus. four women (4/122, 4.1%) failed to obtain a result from cfdna, none of whom underwent invasive testing. the fourth experienced a fetal demise at 15 weeks ; karyotype and microarray were normal on the products of conception. table 1 shows the 1622-week ultrasound findings and diagnostic testing elected for women who had undergone ama options counseling and the reasons cited for invasive testing. a total of 21/161 (13.0%) women ultimately underwent invasive testing ; 16/23 had initially selected this as their preferred testing method. two women chose cvs, one of whom had an unsuccessful procedure and ultimately underwent amniocentesis ; a total of 20 amniocenteses were performed. two noteworthy trends in practice were observed in 2013 after initiation of the ama options program. we found a significant decrease in the proportion of women who had ultrasound soft markers reported during the detailed ultrasound (37/457, 8.1% versus 5/161, 3.1%, p = 0.03). we also noted that, when comparing our overall ama population between 2012 and 2013, a much lower proportion of ama women overall underwent nuchal translucency ultrasounds in 2013 after initiation of ama options (table 2). consequently, a higher proportion of available nt ultrasound appointments were allocated to patients aged less than 35. in 2012 and 2013, a similar small proportion of patients undergoing nuchal translucency ultrasound were screened positive for trisomy 21 or 18 (table 2), and a similar proportion was found to have nuchal measurement exceeding 3.5 mm. only one case of congenital heart disease occurred in the group with large nuchal translucency ; this case was associated with findings of multiple anomalies and confirmed 45x monosomy at 17 weeks ; the patient elected pregnancy termination. across both epochs, there was only 1 woman who had an infant with trisomy 21 without being prenatally detected. this patient was 32 years of age and had integrated serum screening with normal results. in the current report, we describe our experience with implementation of a novel program to incorporate cfdna screening with patient - specific genetic counseling in a public hospital setting. we believe our ama options program can serve as a model for use of a newly available high - level technology in a public health setting. we believe our ama options program serves as a model for implementation of cfdna in a public health setting hospital system. with implementation of this program of patient - directed aneuploidy assessment, we were able to provide first trimester genetic counseling to nearly 40% of our ama population while minimizing redundant testing strategies. when presented with options for aneuploidy screening, nearly 70% of these patients opted for cfdna screening and chose to forgo integrated first and second trimester screening. this is consistent with the anticipated 71.9%79% of women expressing a desire for cfdna testing [14, 15 ]. our experience has been very different from that of taylor., who offered cfdna to all women considering genetic testing with a 28% of women opting for cfdna over integrated screening. interestingly, 1 in 6 patients initially opted to have no screening or diagnostic testing, suggesting that a significant portion of our patients do not desire antenatal information about aneuploidy risk when provided with genetic counseling. integrated algorithms incorporating first and second trimester serum analytes, with and without first trimester nuchal translucency, have been developed. however, these algorithms do not currently incorporate cfdna, leaving providers and patients to face the question of whether to use cfdna in addition to or in place of integrated screening. when combining different independent screening tests, one must be cognizant of the additive effect on false positive rates. with our ama options program, we have minimized the problem of a compounded false positive rate by offering patients who present for care early in pregnancy the choice of one of several discrete screening pathways. this strategy avoids simply adding a new test on top of existing options in a haphazard manner. additionally, by providing pre- and posttest genetic counseling, in a manner consistent with acog guidelines, patients are provided with a clear understanding of rates of detection and false positive results, advantages and disadvantages of the different strategies, and the role of diagnostic procedures. we also examined how the ama options program affected health care delivery within our system. a decrease in utilization of amniocentesis interestingly, we found an apparent change in practice pattern with respect to the reporting of soft markers for chromosome abnormalities during second trimester ultrasonography. among women offered cfdna in the first trimester, likelihood ratios of soft markers noted on second trimester ultrasound and after first trimester, second trimester, and integrated screening have been calculated [19, 20 ]. the utility of these findings following cfdna screening is currently unknown ; however, given that the reported risk of selected chromosome abnormalities is 1 : 10,000 with a negative cfdna screen, it seems unlikely that the presence of isolated soft markers on genetic ultrasound would increase the risk to a significant level. we speculate that mfm providers performing the second trimester ultrasound on women who had already had negative cfdna testing were more reluctant to report soft markers to avoid patient confusion. current guidelines call for the use of cfdna in populations considered high risk for chromosome abnormalities. while cfdna does have appealing characteristics, such as its noninvasive nature, high detection rate for the most common aneuploidies, and low false positive rate, it should be integrated into clinical practice in conjunction with appropriate counseling, to ensure that patients understand the test and its limitations. currently, acog recommends pretest genetic counseling to inform patients of the abilities and limitations of cfdna. such counseling is important to guide patients through a very complex decision involving multiple tests that provide similar information. after initiation of our ama options program (during which most women declined first trimester screening in favor of cfdna), we noted increased access to nuchal translucency ultrasound appointments for non - ama (or low - risk) women. in our public health hospital system, nt appointments are a limited resource, and reallocation of these appointments has helped to further our goal to offer first trimester aneuploidy screening to all women in our system. presently, cfdna screening is not recommended for use in a low - risk population, as the performance of cfdna in these women has not been adequately evaluated. in contrast, integrated screening has been evaluated and is appropriate for use in women younger than 35 years old. existing data on the use of cfdna in non - high - risk women is promising, but further studies are needed to better understand testing performance in low - risk or unselected populations. the false positive rate of cfdna screening is an important consideration, as acting on a positive result without confirmatory testing may lead to undesired termination of nonaneuploid fetuses. as such, cfdna must be used as a screening test and confirmatory testing is recommended to inform decisions about pregnancy termination [9, 21 ]. one potential criticism of our approach is that patients electing cfdna no longer undergo formal first trimester assessment of nuchal translucency (nt). the nt ultrasound 's purpose is primarily for first trimester aneuploidy risk assessment as most women have a dating ultrasound with their primary obstetric provider to assure correct scheduling. it is uncommon to detect congenital heart disease by enlarged nt alone. while a large nt has been associated with congenital heart disease [2428 ], this sonographic finding is a poor screening tool for congenital heart disease. while there are multiple definitions for enlarged nt in the literature (e.g., 3.5 mm, > 95th percentile, 2.0 mom, 2.5 mom, 3.0 mom), all have a poor specificity (20%) for isolated congenital heart disease [2628 ]. while the first trimester nt may be useful for identifying those fetuses at high risk for congenital heart disease, the patients enrolled in the ama options program are all considered sufficiently high risk for congenital anomalies that they receive a detailed second trimester ultrasound, with thorough evaluation of fetal cardiac anatomy. while there may be value in earlier detection of congenital heart disease, given its overall low prevalence in this population, we do not see the nt as a test with sufficient performance as a screening test to be an obligatory part of prenatal care for the purposes of screening for congenital heart disease. noninvasive prenatal testing is an evolving technology. starting with assays of maternal serum afp to the current era of cfdna, integration of new technologies integrating cfdna into current practice must be done in a rational manner and in conjunction with appropriate counseling. patients need this counseling to help inform very difficult decision benefits, risks, and limitations of multiple alternatives for aneuploidy screening. in the context of a public health hospital system, while the actual impact of cfdna implementation on health care cost is still undetermined, recent cost - benefit analysis supports implementation in high - risk populations over other screening algorithms [23, 2932 ]. demonstrate a higher detection rate and net cost savings when screening for trisomy 21 is done with cfdna in comparison to traditional approaches. with the ama options program, in addition to a high acceptance and utilization of cfdna screening, we have further been able to provide efficient care through the minimization of redundancy in prenatal diagnosis. additionally, we have been able to improve availability of aneuploidy screening, in the form of first trimester nuchal translucency screening, to new segments of our patient population. in the era of accountable care organizations, this program furthers the goal of providing high quality care while eliminating redundancy in care provided. the initial experience with our ama options program demonstrates that a rational approach to integration of cfdna into obstetric practice is feasible and efficient. master 's level genetic counselors can provide patient education and assistance with decision making to create an individualized plan of care. utilizing this model, we have found that there may be unanticipated practice changes with adoption of cfdna, specifically with a decreased frequency of reporting isolated soft markers for aneuploidy ; however, the clinical impact of such change is unclear. moving forward, other systems are encouraged to be cognizant as to how cfdna is implemented in their systems. with ama options, | objective. cell - free dna (cfdna) offers highly accurate noninvasive screening for down syndrome. incorporating it into routine care is complicated. we present our experience implementing a novel program for cfdna screening, emphasizing patient education, genetic counseling, and resource management. study design. beginning in january 2013, we initiated a new patient care model in which high - risk patients for aneuploidy received genetic counseling at 12 weeks of gestation. patients were presented with four pathways for aneuploidy risk assessment and diagnosis : (1) cfdna ; (2) integrated screening ; (3) direct - to - invasive testing (chorionic villus sampling or amniocentesis) ; or (4) no first trimester diagnostic testing / screening. patients underwent follow - up genetic counseling and detailed ultrasound at 1820 weeks to review first trimester testing and finalize decision for amniocentesis. results. counseling and second trimester detailed ultrasound were provided to 163 women. most selected cfdna screening (69%) over integrated screening (0.6%), direct - to - invasive testing (14.1%), or no screening (16.6%). amniocentesis rates decreased following implementation of cfdna screening (19.0% versus 13.0%, p < 0.05). conclusion. when counseled about screening options, women often chose cfdna over integrated screening. this program is a model for patient - directed, efficient delivery of a newly available high - level technology in a public health setting. genetic counseling is an integral part of patient education and determination of plan of care. |
da-8159, a selective phosphodiesterase type 5 (pde5) inhibitor developed by donga pharmaceutical company (kyunggi, korea), is an oral agent for treating erectile dysfunction. it also induces smooth muscle relaxation and increases the endogenous cyclic guanosine monophosphate (cgmp) level in the rabbit corpus cavernosal smooth muscles (1). the data obtained from phase 1 clinical study showed da-8159 is safe and well tolerated after a single oral dose in healthy males up to 300 mg without severe adverse effects (unpublished data). however, as with other pde5 inhibitors, it may inhibit phosphodiesterase type 6 (pde6) at a higher concentration. the inhibitory concentration of da-8159 on the pde6 receptor is 10 times higher than that of the pde5 receptor. pde5 inhibition causes a vascular dilatation by blocking cgmp hydrolysis in the vascular smooth muscle. pde6 is present in retinal photoreceptor cells, and is essential for visual excitation, named phototransduction. the visual excitation begins with the absorption of a photon of light by the pigment rhodopsin. in this process, pde6 hydrolyzes cgmp to guanosine monophosphate (gmp), resulting in a decrease in the intracellular cgmp levels. this light - dependent decrease in cgmp leads to hyperpolarization of the photoreceptors through the closure of cation channels. the inhibition of pde6 increases the intracellular concentration of cgmp, which leads to opening of the sodium channels resulting in depolarization of the photoreceptor cells. the alteration of sodium channels causes exchange of ca, na and mg through the photoreceptor cells. as a result, ionic conductance generates an electrical response, which is transmitted to the visual cortex of the brain and produces a visual sensation. if da-8159 acts as a pde6 inhibitor in retinal photoreceptor cells and inhibits the phototransduction process, an electrical alternation should be recorded in an electroretinogram (erg)., new york, ny, u.s.a.) was initially developed as a drug to treat angina, but it was found to be highly specific to pde5. recently, it has been widely used to treat patients with erectile dysfunction. however, variable systemic and ocular side effects have been reported. the ocular side effects include visual halo (2), third nerve palsy (3), nonarteritic anterior ischemic optic neuritis (4, 5), etc. as observed with sildenafil, da-8159 may cause such ocular side effects. theoretically, pde inhibitor may change the retinal physiology in two ways ; an alteration of the phototransduction process by pde6 inhibition at the photoreceptor cells, and an alteration in vascular flow by pde5 inhibition at the vascular smooth muscle. we have previously been able to assess the alteration of phototransduction by erg or the subjective visual symptoms, and the alteration of the blood flow by doppler flowmetry (6 - 8). the objectives of this animal experiment were to investigate the effects of da-8159 on the ergs, and to examine the histological change after da-8159 administration in rabbits. twenty male rabbits (1.5 to 2.0 kg of body weight, bw) were used for the electroretinography and blood concentration measurements. the rabbits were divided into four groups ; the da-8159 5 mg / kg, 15 mg / kg, and 30 mg / kg bw treated groups and a control group. the test drug, da-8159, was dissolved in 5 ml of saline and fed through an l - tube., electroretinography was performed prior to administration, one hour after, and five hours after the drug administration. to analyze the relationship between the blood concentrations of da-8159 and the erg changes, 5 ml of blood was drawn from the ear vein prior to and immediately after the erg recording. the animal was anesthetized with an intramuscular injection of ketamine hydrochloride (65 mg / kg bw) and xylazine hydrochloride (15 mg / kg bw) mixture. the erg jet (universo sa, switzerland) was used as the recording electrode. the reference electrode was placed centrally on the shaven forehead. for the stability of the electrode, one end of a reference electrode the erg was recorded using a utas - e 2000 system (lkc technologies, inc, gaithersburg, maryland, u.s.a.). full - field electroretinography was performed according to the standard for clinical electroretinography recommended by the international society for clinical electrophysiology of vision (iscev) (9). as recommended by the iscev the significance of the erg changes after drug administration was analyzed using a bonferroni test. in brief, the time - dependent erg changes according to the drug concentrations were compared with that of the control group. the relationship between the blood concentration of da-8159 and the erg changes were analyzed using linear regression analysis. for histological examination, the eyeball was enucleated 1 or 5 hr after the drug administration. the eyeball was enucleated under general anesthesia with an intramuscular injection of ketamine hydrochloride and xylazine hydrochloride mixture. a total of twenty rabbits, two rabbits in each group, were used for the histological examination. immediately after enucleation, the eyeball was immersed in a fixative solution of 2% glutaraldehyde in 0.1 m phosphate buffers. one eye from each rabbit was used for optical microscopic examinations, and the other was used for electron microscopic examinations. for the optical microscopic examination, the eyeball was placed in 20 ml of 10% formaldehyde for 24 hr. for electron microscopic examination, the eyeball was bisected and a tissue block was cut into a 23 mm size using an dissecting microscope. the block was placed in 2% glutaraldehyde in 0.1 m phosphate buffer for 90 min in the cold, and post - fixed in 1% osmium tetraoxide for 90 min. after fixation, the block was dehydrated serially with ethanol, and embedded in epon. the ultrastructural study was performed by transmission electron microscopy (isi - lem 2000, akashi, japan). the five standard electroretinographic responses obtained from da-8159 administrated and the saline ingested group are shown in table 1. in the rod response, there was no remarkable erg change at any dose or at any time after da-8159 administration. in the maximal response, a statistically significant decrease in the b - wave amplitude (p0.05). the dose - dependent blood concentrations of da-8159 as a function of time are shown in table 2. no test drug was detected in the blood after 1 or 5 hr at dose of da-8159 5 mg / kg bw. at doses of 15 mg / kg and 30 mg / kg bw, there was a dose - dependent increase of the blood concentration after 1 hr of drug administration. however, no difference in the blood concentration was found after 5 hr. there was no correlation between the blood concentration and the erg change after 1 or 5 hr of test drug administration. no abnormal findings were observed either in the sensory retina, the photoreceptor rod and cone cells, the retinal pigment epithelial cells, the bruch 's membrane, or the choroidal vessels. an electron microscopic examination showed the vascular endothelial cells of the choroid exhibit well - preserved terminal bars connecting the adjacent endothelial cells. erg has established itself for many decades as a routine diagnostic method in clinical ophthalmology. it is a summation of the electrical responses generated by the neural and non - neuronal cells within the retina. however, it is necessary to standardize the recording and interpreting protocols in order to make it possible to compare the results elicited in different institutions. in 1989 the five basic erg responses are the rod response, the maximal rod and cone response, the oscillatory potentials, the cone response, and the 30-hz flicker response. however, the standardization is suitable for humans, but not for rabbits. the anatomical and functional similarities of the rabbit retina have made it a simulated model for an ophthalmic study, but the retinal anatomy of the rabbit is slightly different from that of humans. there are three types of cone cells in the human retina, but only two, green cones and blue cones (10, 11), are present in the rabbit retina. in addition, there is no standardized data for the rabbit erg, which makes it unadvisable to use human erg data in rabbits. compared to the baseline values, a statistically significant difference was observed between each group. therefore, it is advisable to compare the time - dependent erg change in the given group with that of the control group. in this study, the statistical significance of the time - dependent erg change was analyzed by comparing the data from the test drug administrated group with that of the control group. luu. (12) studied the effect of sildenafil on the full - field erg, color vision and the subjective visual symptoms on healthy volunteers. those who showed a depression in the erg cone function made more errors in the color vision test. in addition there was a correlation between the erg changes and the occurrence of the subjective visual symptoms. they made a conclusion that 200 mg sildenafil caused rather mild acute alterations in the cone and rod function. (13) reported an alteration of erg after a single dose of 100 mg sildenafil ingestion. there was statistically significant prolongation of the implicit time in the 30-hz flicker response at doses of 15 mg / kg bw and 30 mg / kg bw da-8159 with a concurrent decrease in amplitude, although this was statistically insignificant. similar erg changes were observed in the cone response at 30 mg / kg bw. because the 30-hz flicker response or cone response represents the photoreceptor cone function, its alteration may cause color vision changes. these erg changes are useful to explain the pathogenesis of color vision alterations after pde inhibitor administration. theoretically a higher concentration of a pde inhibitor may cause an alteration in the phototransduction process, resulting in the erg changes. behn. (14) investigated the effect of sildenafil on the retina in knockout mice, which were heterozygous for a mutation causing an absence of the subunit of rod pde6. they found that sildenafil significantly decreased the a-, and b - wave amplitudes in the heterozygous pde6 subunit lacking mice. further decrease in both the a-, and b - wave amplitude were observed with increasing sildenafil doses. the erg decrease was more pronounced in the heterozygous pde6 subunit lacking mice than in the wild mice containing normal pde6. this result shows that the sildenafil - induced erg change is not related to the pde6 inhibition caused by sildenafil. however, they asserted that the heterozygous pde6 subunit knockout mutation probably leads to a decrease in the amount of functional pde6, creating an enhanced susceptibility to the inhibitory effects of sildenafil. 15) reported significant reductions in the a-, and b - wave amplitudes 1 hr after administering sildenafil, and these effects recovered to normal levels after 6 hr. the amplitude reduction correlated well with the slidenafil plasma concentration, which showed a peak 1 hr after administering the drug. moreover, behn. (14) reported that sildenafil has a significant dose - dependent inhibitory action on the retinal function. the retinal inhibitory effect occurred with as little as twice the maximum equivalent dose recommended for humans. these results indicate a close correlation between the sildenafil blood concentration and the erg change. however, this study found no significant erg change at 5 mg / kg bw da-8159, which was 3.5 times higher - dose recommended for a 70 kg person. in this animal study, no correlation between the da-8159 blood concentration and erg changes could be found. the mean blood concentration at 1 hr after da-8159 15 mg / kg bw administration was as high as 2.2 times than that observed 5 hr after (0.031 g / ml vs. 0.014 g / ml, p<0.05), but the erg amplitude changes were the opposite. there was a statistically significant erg cone response change 5 hr after administering the test drug, not after 1 hr. as provided by manufacturer, if the erg changes are due to the pde6 inhibition effect of da-8159, the changes will peak around 1 hr after administration, not 5 hr after. (16) reported a change in the erg response related to the dose of the pde inhibitor in cats. the phosphodiesterase inhibitor increased the rod b - wave amplitude at low concentrations, but diminished the rod b - wave amplitude at high concentrations. in view of the results, it is possible that there is a correlation between blood concentration of pde inhibitor and the erg change at relatively high doses, positively or negatively. however, there is some uncertainty in the correlation between the blood da1859 concentration and the erg change. in conclusion, there were no significant erg changes after administering 5 mg / kg bw da-8159. however, at 15 mg or 30 mg / kg bw, a statistically significant prolongation of the 30-hz flicker implicit time was observed 5 hr after the test drug administration. furthermore, there was a b - wave amplitude decrease in the cone response at 15 mg or 30 mg / kg bw, although this was statistically insignificant. otherwise, no remarkable erg changes were observed in the rod, the maximal, and the oscillatory potentials. there was no correlation between the blood da-8159 concentration and the erg change. in light and electron microscopic examinations, there were no histological changes after da-8159 administration at any dose or at any time. these data suggest da-8159 has a minimal effect on erg changes in rabbits, but further evaluation of the effects of da-8159 on visual functions in human must be followed. | da-8159, a selective inhibitor of phosphodiesterase type 5, was developed as a new drug for erectile dysfunction. the effect of da-8159 on the electroretinogram (erg) and the retinal histopathology were evaluated in rabbits. the erg was performed prior to, and 1 and 5 hr after da-8159 (5 to 30 mg / kg) administration. the plasma concentration of da-8159 was determined at each time point, and retinal microscopic examination was also performed. there was no statistically significant erg change at any dose or at any time. though the 30 hz flicker showed a prolongation of the implicit time at 5 hr after the administration of either da-8159 15 mg or 30 mg / kg (p<0.05), but concurrent amplitude decreases were not statistically significant. at a dose of 5 mg / kg, no test drug was detected in the blood after either 1 or 5 hr. at either 15 mg / kg or 30 mg / kg, there was a dose - dependent increase in the blood concentration after 1 hr of drug administration, which decreased with time. in light and electron microscopic examinations of the retina, there was no remarkable change at any dose. these results suggest da-8159 has a low risk potential to the retina, but further evaluation on the visual functions in human is needed. |
mitochondrial neurogastrointestinal encephalomyopathy (mngie) is a rare, devastating disease that usually manifests in childhood and leads to death at a mean age of 35 years. it is clinically characterized by progressive gastrointestinal dysfunction, cachexia, ptosis and ophthalmoparesis, peripheral neuropathy and diffuse leukoencephalopathy [1, 2 ]. however, patients with an atypical phenotype and variable onset, course and severity have also been described [3, 4, 5 ]. mngie is caused by mutations in the tymp gene encoding thymidine phosphorylase (tp). since tymp was discovered as the causative gene of mngie, more than 60 different mutations associated with fewer than 250 cases have been reported. loss of tp activity determines marked elevation in thymidine and deoxyuridine levels in body fluids, nucleotide pool imbalance, subsequent instability of mitochondrial dna (mtdna) and impairment of the mitochondrial respiratory chain [1, 8 ]. we report the case of a young caucasian patient with an incomplete mngie phenotype who harbored a novel disruptive tymp mutation. his disease was diagnosed late, thus making any therapeutic option useless. despite the current availability of effective treatment options such as allogeneic hematopoietic stem cell transplantation and carrier erythrocyte entrapped tp therapy as well as the promising future therapeutic approaches, e.g. gene therapy, it is essential to achieve early diagnosis to avoid the cumulative effects of imbalanced nucleosides on mtdna and to prevent as much mitochondrial damage as possible [1, 8, 12 ]. since he was 7, our 24-year - old patient had complained of intermittent postprandial vomiting and gastrointestinal dysmotility with alternating episodes of diarrhea and constipation that led to progressive weight loss over the years. he presented with severe cachexia (bmi 11.15) and numbness in the extremities of all 4 limbs. neurological examination showed absence of deep tendon reflexes, length - dependent decreased proprioception and vibratory sensation, mild generalized weakness and diffuse muscle atrophy. no cardiac, renal or hepatic involvement was reported. despite the lack of eye movement involvement, mngie was suspected and confirmed by measuring plasma thymidine and deoxyuridine [6 mol / l (normal values t (q67x) mutation in exon 2 (fig. 2a) and the previously reported c.866 a > c (e289a) mutation in exon 7 (fig. 2b) (genbank reference sequence nm_001113755.1), thus genetically proving the diagnosis of mngie. the novel mutation leads to a change from glutamine to stop codon and was not detected in 200 ethnically matched control chromosomes by direct gene sequencing. unfortunately, despite parenteral nutrition, the patient died of multiorgan failure due to severe malnutrition and cachexia a few weeks after diagnosis before any therapeutic option could be tried. mngie is a multisystem autosomal recessive disorder mainly characterized by gastrointestinal and central / peripheral nervous system involvement. gastrointestinal dysmotility, abdominal pain and distension, diarrhea, progressive weight loss and severe cachexia are the prominent features of the disease, associated with ptosis and ophthalmoparesis, peripheral neuropathy and diffuse leukoencephalopathy [1, 2 ]. patients usually die of complications resulting from their gastrointestinal disorders and inadequate nutritional status. diagnosis is achieved by demonstrating high plasma, urine thymidine and deoxyuridine concentrations, reduced tp enzyme activity and pathogenic mutations in tymp. disease - related tymp mutations determine loss of tp function, subsequent mitochondrial nucleotide pool imbalance, mtdna instability and impairment of the mitochondrial genome replication. a relationship between the clinical phenotype of mngie and tp activity is generally acknowledged : 30% activity does not cause overt disease [13, 14 ]. however, there are relevant exceptions to this rule. late - onset or less severe phenotypes in patients with greatly reduced or virtually absent tp activity have been reported [3, 5 ]. intrafamilial phenotypical variability, ranging from extremely severe to very mild clinical pictures, has also been described, thus adding further difficulties in predicting disease evolution and prognosis [5, 7 ]. the mutations reported herein, including the novel q67x nonsense mutation, cause a profound deficiency in tp activity (4 nmol / h / mg protein). interestingly, ophthalmoplegia, which is a fundamental element in suspecting the disease, was absent in this patient and may have contributed to the delay in diagnosis. although most patients present with the classical phenotype and report the first symptoms already in childhood, the correct diagnosis is usually established years later. a late diagnosis of the disease greatly reduces the chances of a positive outcome after therapy because patients start treatment when they are already in poor health and therefore have limited capacities to tolerate therapy and combat disease - related complications [5, 15 ]. the available therapeutic procedures aim to eliminate the toxic levels of thymidine and deoxyuridine by restoring at least partial tp activity. the earlier patients are treated, the less organ damage there is and the better the outcome will be [1, 9, 14 ]. in our patient, the correct diagnosis was achieved too late when multisystem involvement was so severe that it led to his death within a few weeks. despite the enormous efforts in optimizing therapies for mngie, one must not ignore the need to achieve a correct diagnosis as soon as possible. mngie should be suspected and tp activity and nucleoside levels measured in all patients who present with both gastrointestinal and nervous system involvement, even if the classical complete phenotype is lacking. | mitochondrial neurogastrointestinal encephalomyopathy (mngie) is a devastating autosomal recessive disorder due to mutations in tymp, which cause loss of function of thymidine phosphorylase (tp), nucleoside accumulation in plasma and tissues and mitochondrial dysfunction. the clinical picture includes progressive gastrointestinal dysmotility, cachexia, ptosis and ophthalmoparesis, peripheral neuropathy and diffuse leukoencephalopathy, which usually lead to death in early adulthood. therapeutic options are currently available in clinical practice (allogeneic hematopoietic stem cell transplantation and carrier erythrocyte entrapped tp therapy) and newer, promising therapies are expected in the near future. however, successful treatment is strictly related to early diagnosis. we report on an incomplete mngie phenotype in a young man harboring the novel heterozygote c.199 c > t (q67x) mutation in exon 2, and the previously reported c.866 a > c (e289a) mutation in exon 7 in tymp. the correct diagnosis was achieved many years after the onset of symptoms and unfortunately, the patient died soon after diagnosis because of multiorgan failure due to severe malnutrition and cachexia before any therapeutic option could be tried. to date, early diagnosis is essential to ensure that patients have the opportunity to be treated. mngie should be suspected in all patients who present with both gastrointestinal and nervous system involvement, even if the classical complete phenotype is lacking. |
human immunodeficiency virus (hiv) was first reported in 1981 in the united states of america among the homosexuals,[15 ] but not until 1986 the first episode was documented in nigeria among prostitutes as in the year 2008, the global estimate of people living with hiv / aids was 33.4 million with africa constituting about 60% of this figure. currently nigeria ranked third with 7.5 million people living with the dreaded virus next to india and south africa the frequency of hiv / aids by gender in port harcourt, nigeria, is at the ratio of 1:1 male to female while death resulting from the infection alone makes it one of the 10 leading causes of death in children and women of 1544 years of age world - wide. morbidity and mortality rates due to hiv / aids are probably the highest in the world. africa and indeed nigeria are no exceptions. richard reported that over 25 million deaths due to hiv / aids had already been recorded globally while not less than 10,000 youths are infected monthly in nigeria. in separate studies, abdulazeez. and fmoh / who reported that over 1.2 million people have already developed clinical manifestations of acquired immunodeficiency syndrome (aids) ] in nigeria as at 2005. people living with hiv may not develop any symptoms for over 10 years but can still transmit the infection to others during the asymptomatic period. most people infected with hiv are likely to develop aids if not treated or slowly develop aids due to their genetic difference that prevents the virus from damaging their immune system. terhost. defined cd4 lymphocytes as a subset of thymocyte - derived lymphocytes which are continuously expressed in the peripheral blood and lymphoid tissue. the definition of an aids patient nowadays is a person who is hiv seropositive and has cd4 less than 200 cells/ l even if the person appears apparently healthy. cd4 lymphocyte cells are a type of immune cells otherwise known as t - helper cells which are often used as prognostic markers for monitoring the progression of immunosupression such as hiv infection. a study carried out in tanzania reported that gender and geographical differences are some of the factors affecting the values of the cd4 level among immunosuppressed subjects. in a situation where permanent cure of the virus remains a mirage, prevention from the infection and proper management of those already living with the virus are ways to keep people alive. apart from physical examination of those on antiretroviral therapy, determination of the cd4 lymphocyte level of the patients is an important way of monitoring their responses to treatment. ordinarily every human being has the tendency to recover from any disease condition even without any treatment due to the ability of the body immune system to recognize and destroy foreign body as quickly as possible. cd4 lymphocyte cells are the key elements in body immune systems responsible for such body defense. ironically, with hiv infection, these cells are attacked and destroyed by the virus, thereby destroying the defense machinery of the body hence, making it more vulnerable to any disease condition without any resistance. the higher the viral load the greater the havoc on the cd4 lymphocytes and the lower the immunity of the host. this is why cd4 lymphocytes level determination is very crucial, as a barometer for measuring the immunity of hiv - infected people, especially those on therapy. in a study conducted by clark and shaw, it was reported that aids symptoms usually start to manifest when the cd4 lymphocyte level is below 300 cells/l, while in another study, it was reported that the destruction rate of cd4 lymphocyte cells in infected persons was 12 cells /l per fortnight. also, in untreated cases, the average survival time after the manifestation of clinical signs and symptoms of aids is about 1.5 years. this study therefore attempted to determine a cd4 lymphocyte reference range in this part of the globe so that it can serve as a guide for effective management of hiv - infected people on highly active antiretroviral therapy (haart). a total of 1520 subjects aged 1864 years, composed of 800 males and 720 females attending federal medical center, specialist hospital, general hospitals in ganye, mubi, garkida and numan were randomly selected for the study. other participants were subjects attending kowa hospital, peace hospital, adamawa hospital, yola biomedics laboratories and health centers in tola, pella, and fufore all in adamawa state of nigeria. the subjects were apparently healthy individuals seeking medical check - up for military recruitment, marriage, blood donation, and those seeking admission into secondary and tertiary institutions in the state. they also included some apparently healthy volunteers among the staff of the health institutions and some subjects attending hiv voluntary counseling and testing clinics. prior to the commencement of sample collection, approval from research and ethics committee of the state ministry of health was obtained in accordance with the helsinki declaration guidelines. also, consent of the participants was sought and obtained as only volunteers were enrolled in the study. five milliliters was put in plain test tubes held at room temperature for 20 minutes and then spun to remove the serum needed for hiv antibody typing. the remaining 5 ml was put in containers with ethylene diamine tetra acetic acid (edta), mixed properly and used for the cd4 lymphocyte count. a capilus hiv screening kit (trinity biotech, united kingdom) was used for the antibody detection while a standard diagnostic (bioline, korea) kit was employed for classifying all seropositive cases into hiv-1, hiv-2, and hiv-1 + 2. commercial dynal beads (dynal asa oslo norway) were employed to quantify the cd4 level in seropositive and seronegative samples following the manufacturer 's instructions. a capillus hiv screening device composed of slide and latex reagent one drop of latex reagent and a drop of each test serum were mixed in the well of the slide. appearance of visible agglutination on the slide channel was recorded as reactive while milky white appearance without agglutination was considered a system diagnostics reagent cassette was used to test the serotype of all hiv - reactive sera. a drop of the serum was put in the test window of the reagent cassette and allowed for 5 minutes for the serum to flow through control and test column of the cassette. appearance of two pinkish lines in the cassette within 5 minutes showed the presence of hiv serotype with the control. whenever the line appeared before the line of control band, it was an indication of the presence of hiv-1 and when the line appeared after the control band, it was an indication of the presence of hiv-2 in the serum. when there was appearance of three pinkish lines, it was an indication of the presence of both hiv-1 and hiv-2 serotypes. the dynal bead method was employed to determine the cd4 count as earlier described by idoko. data obtained from the tests were entered and analyzed using spss version 16 software of computer (spss inc. the test of significance was performed using the chi - square test for cd4 distribution with respect to hiv serotypes and student t - test for cd4 distribution by gender and by hiv serostatus. a total of 1520 subjects aged 1864 years, composed of 800 males and 720 females attending federal medical center, specialist hospital, general hospitals in ganye, mubi, garkida and numan were randomly selected for the study. other participants were subjects attending kowa hospital, peace hospital, adamawa hospital, yola biomedics laboratories and health centers in tola, pella, and fufore all in adamawa state of nigeria. the subjects were apparently healthy individuals seeking medical check - up for military recruitment, marriage, blood donation, and those seeking admission into secondary and tertiary institutions in the state. they also included some apparently healthy volunteers among the staff of the health institutions and some subjects attending hiv voluntary counseling and testing clinics. prior to the commencement of sample collection, approval from research and ethics committee of the state ministry of health was obtained in accordance with the helsinki declaration guidelines. also, consent of the participants was sought and obtained as only volunteers were enrolled in the study. five milliliters was put in plain test tubes held at room temperature for 20 minutes and then spun to remove the serum needed for hiv antibody typing. the remaining 5 ml was put in containers with ethylene diamine tetra acetic acid (edta), mixed properly and used for the cd4 lymphocyte count. a capilus hiv screening kit (trinity biotech, united kingdom) was used for the antibody detection while a standard diagnostic (bioline, korea) kit was employed for classifying all seropositive cases into hiv-1, hiv-2, and hiv-1 + 2. commercial dynal beads (dynal asa oslo norway) were employed to quantify the cd4 level in seropositive and seronegative samples following the manufacturer 's instructions. one drop of latex reagent and a drop of each test serum were mixed in the well of the slide. appearance of visible agglutination on the slide channel was recorded as reactive while milky white appearance without agglutination was considered a system diagnostics reagent cassette was used to test the serotype of all hiv - reactive sera. a drop of the serum was put in the test window of the reagent cassette and allowed for 5 minutes for the serum to flow through control and test column of the cassette. appearance of two pinkish lines in the cassette within 5 minutes showed the presence of hiv serotype with the control. whenever the line appeared before the line of control band, it was an indication of the presence of hiv-1 and when the line appeared after the control band, it was an indication of the presence of hiv-2 in the serum. when there was appearance of three pinkish lines, it was an indication of the presence of both hiv-1 and hiv-2 serotypes. the dynal bead method was employed to determine the cd4 count as earlier described by idoko. data obtained from the tests were entered and analyzed using spss version 16 software of computer (spss inc. the test of significance was performed using the chi - square test for cd4 distribution with respect to hiv serotypes and student t - test for cd4 distribution by gender and by hiv serostatus. table 1 depicts the distribution of mean cd4 lymphocytes by gender among the cohort seropositive and seronegative subjects. the mean cd4 lymphocyte count was lower in females compared to males across serostatus and also in seropositive compared to seronegative within gender. statistical analysis by the student t - test showed a significant difference in the mean cd4 lymphocyte distribution by sex (t=5.86). distribution of mean cd4 lymphocytes by gender the distribution of the mean cd4 lymphocyte level in hiv seropositive and seronegative populations is as shown in table 2 while the frequency of 191 seropositive cases by hiv types and cd4 lymphocyte levels is as shown in table 3. most of the seropositive 184 (96.3%) had type 1 hiv while most 175 (91.1%) had cd4 lymphocyte count within 200400 range. the result also showed a significantly higher mean cd4 lymphocyte count among adult male hiv seronegatives (=9.22) and seropositives (= 15.07) than their female counterparts. mean cd4 lymphocyte cell concentration in hiv seropositive and seronegative populations cd4 lymphocyte cell distribution by hiv serotypes (n=191) findings in this study showed a significantly higher mean cd4 lymphocyte count among adult male hiv seronegatives (=9.22) and seropositives (= 15.07) than their female counterparts. this result is in contrast with the findings of urassa and his associates conducted among adult tanzanians in which the mean cd4 lymphocytes level was higher among adult females than their male counterparts. the reason for the difference between the present study and the previous one could probably be due to geographical variation. while the dynal bead manual technique was employed in this study, automation was used in the previous one. the present result also showed that 47.0% of hiv seropositive subjects had mean cd4 count between 200 cells/l and 400 cells/l, 36.8% had cd4 lymphocytes less than 200 cells/l while 16.2% of the subjects had cd4 lymphocytes higher than 400 cells/l with all the subjects still appearing apparently healthy. these findings disagree with the results of reeves erhabor., which reported that with cd4 lymphocytes less than 300 cells/l aids symptoms are likely to start manifesting. the reason for the difference between this observation and the previous one could probably be due to variation in the geographical location and immune status of the subjects. meanwhile, this finding is in consonance with the result of idoko and his associates reporting similar views that subjects with cd4 lymphocytes lower than 300 cells/l could still be apparently healthy. cd4 lymphocyte count is a prognostic marker for monitoring the response of hiv - infected patients to antiretroviral therapy. in this study, going by clark and shaw results and findings of macdonnell and his co - workers, part of the values recorded within normal values in this study would have been considered abnormally low with such subjects probably incorrectly labeled aids patients. however, with this newly documented lymphocyte range, symptoms of aids may only start to manifest when the cd4 lymphocyte count is below 232 cells/l. urassa and co - workers had earlier reported that the cd4 lymphocyte level varies with geographical setting, race, and gender among immunosuppressed subjects. this range differs considerably from the reagent kit manufacturer 's recommended range which was put at 250500 cells/l. the scenario is not surprising because the manufacturer 's values were probably obtained from entirely different geographical setting and race since the test kit was imported from norway. the findings showed a significantly higher mean cd4 lymphocyte count among adult male hiv seronegatives (=9.22) and seropositives (= 15.07) than their female counterparts. also, the cd4 range of 232464 cells/l was recorded among apparently healthy seronegative subjects. further research work using the automation technique was suggested to confirm this new range before it could be recommended as a useful reference for monitoring hiv subjects on antiretroviral therapy. | background : cd4 lymphocyte cells are often used as prognostic markers for monitoring the progression of immunosupression such as hiv infection.aim:this study was conducted to assess the distribution of cd4 lymphocytes among apparently healthy human immunodeficiency virus (hiv) seronegative and seropositive populations in a nigerian state.materials and methods : a total of 1520 apparently healthy subjects aged 1864 years, composed of 800 males and 720 females attending some selected health institutions in the state, participated in the study. ten milliliters of blood was collected from each subject ; 5 ml of this was used for hiv antibodies sero - typing while the remaining 5 ml was anticoagulated and used for cd4 lymphocytes level determination. only samples tested positive both with capillus and determine hiv test kits were further differentiated into sero - types with a standard diagnostic hiv test kit. the cd4 lymphocyte levels of all the sample were determined ; mean cd4 levels of 205.10.09 and 287.40.3 cells/l were recorded among females seropositives and seronagatives respectively. statistical analysis by the student t - test showed a significant difference in the mean cd4 lymphocyte count by gender.results:findings showed a mean cd4 level of 311.71.2 cells/l among seropositive males while 399.30.6 cells/l was recorded among seronegatives (t=5.86). the study also recorded a cd4 lymphocyte range of 232464 cells/l among apparently healthy seronegative population in this locality.conclusion:the findings showed a significantly higher mean cd4 lymphocyte count among adult male hiv seronegatives (2=9.22) and seropositives (2=15.07) than their female counterparts. further research work using the automation technique is suggested to confirm this new range for monitoring hiv subjects on antiretroviral therapy. |
heart failure (hf) is a syndrome which is characterized by a diminished ability of the heart to pump optimum amount of blood to meet the body s demand. improvements in medical and device therapy in the last few decades among patients with coronary artery heart disease have resulted in a steep rise in hf hospitalizations and deaths attributable to hf and expanding costs. around 23 million people are affected by hf globally. in united states, the prevalence of hf is 4.7 million (1.5% - 2% of the total population) with approximately 550,000 incident cases of hf diagnosed annually. the scenario is not different in europe, with the prevalence ranging from 0.4% to 2%. the prevalence of hf continues to rise with age and affects 6 - 10% of people older than 65 years. according to national health services, total annual mortality ranges from 10 - 50% depending on severity. regrettably, till date, there is no accurate method to prognosticate patients with hf. the field of biomarkers has attracted intensive investigation in the last decade in the management and care of hf patients. circulating cardiac biomarkers, reflecting different aspects of the orchestral molecular interplay involved in hf have been sought after, with the prospect that these markers in combination would reveal the signature of the disease. the natriuretic peptides, which include b - type natriuretic peptide (bnp) and the n - terminal fragment of its prohormone (nt - probnp), are the approved biomarkers for hf. (gdf-15), pentraxin-3, galectin-3, osteopontin, are some of the novel biomarkers that have been investigated alone or in combination in the context of hf. growth - differentiation factor-15 is a distant member of the transforming growth factor- (tgf-) cytokine super family that is constantly expressed in the liver. it is also known as prostate derived factor (pdf), macrophage inhibitory cytokine-1(mic-1), nsaid - activated gene (nag-1) and placental tgf - beta (ptgfb).while the exact function of gdf-15 is still not completely understood, it has been shown to be weakly expressed in all tissue types under normal physiological states. the increased expression of gdf-15 has been observed during pulmonary, cardiac or renal diseases [8, 9 ]. experimental studies suggest that various forms of cardiac stress including pressure overload increase the concentration of gdf-15. animal studies indicate that gdf-15 is protective against cardiac injury by virtue of its anti - hypertrophic, anti - inflammatory and anti - apoptotic properties. however, clinical studies in humans indicate that higher concentration of gdf-15 is associated with increased mortality. observe gdf-15 to be a marker of increased mortality in chf [11, 12 ]. furthermore, lok. observe gdf-15 to be an even stronger predictor than ntprobnp. therefore, gdf-15 seems to display an array of different functions, rendering protection at some instances, while simultaneously being associated with poor outcomes. as there is a fair degree of uncertainty with respect to gdf-15 s role in hf we have thus collected the evidence from various clinical studies to understand the prognostic utility of gdf-15 as a novel biomarker in chf. we also looked at the value of gdf-15 in predicting hf in post mi patients and in the community setting. we performed an electronic search using databases such as medline, sciencedirect, cochrane library, scopus, google scholar and springer database. the search term used was gdf-15 and heart failure and we limited our search to human studies in the adult population. we excluded pediatric studies, studies looking at gdf-15 as a sole prognosticator in acs without incorporating hf as one of the outcomes, studies assessing gdf-15 assay methods, studies done in other populations such as non - st elevation myocardial infarction (nstemi), valvular heart disease, coronary atherosclerosis, stable coronary artery disease, congenital heart disease, acute pulmonary embolism, idiopathic pulmonary arterial hypertension, diabetic nephropathy, anemia, hypertrophic cardiomyopathy and hf with concomitant conditions such as renal dysfunction and obesity. furthermore, in - vitro studies, device therapy, cardiac resynchronization therapy, and studies looking at gdf-15 genetic polymorphisms were removed from the final list of selected articles. references of included studies were also examined in order to ensure that no potential eligible studies were missed. three investigators independently extracted information from the title and abstracts of the identified studies and relevant articles were selected for full - text review. we performed an electronic search using databases such as medline, sciencedirect, cochrane library, scopus, google scholar and springer database. the search term used was gdf-15 and heart failure and we limited our search to human studies in the adult population. we excluded pediatric studies, studies looking at gdf-15 as a sole prognosticator in acs without incorporating hf as one of the outcomes, studies assessing gdf-15 assay methods, studies done in other populations such as non - st elevation myocardial infarction (nstemi), valvular heart disease, coronary atherosclerosis, stable coronary artery disease, congenital heart disease, acute pulmonary embolism, idiopathic pulmonary arterial hypertension, diabetic nephropathy, anemia, hypertrophic cardiomyopathy and hf with concomitant conditions such as renal dysfunction and obesity. furthermore, in - vitro studies, device therapy, cardiac resynchronization therapy, and studies looking at gdf-15 genetic polymorphisms were removed from the final list of selected articles. references of included studies were also examined in order to ensure that no potential eligible studies were missed. three investigators independently extracted information from the title and abstracts of the identified studies and relevant articles were selected for full - text review. we retrieved 847 citations, of which 790 citations were excluded based on title or abstracts. out of 57 original articles, we identified 21 studies that fulfilled inclusion criteria (fig. 1). the studies comprised a total of 20,920 participants, and had 1863 cardiovascular events and 2052 cardiovascular deaths. there were 16 studies with a prospective cohort study design, three with a randomized controlled trial design and two with a cross sectional design. only 12 studies reported the follow - up duration ; the mean of which was 3.87 years. a total of nine studies reported the association between gdf-15 and all - cause mortality. it was found that in all the studies, higher gdf-15 levels independently predicted all - cause mortality (table 2). among the nine studies that assessed the power of gdf-15 to predict mortality, four were performed in hf populations, two in mi and two in community dwelling elderly population. all studies showed the association between elevated gdf-15 levels and increased risk for all - cause mortality even after adjustment with clinical risk factors such as age, sex, body mass index, diabetes mellitus, hypertension, smoking, left ventricular ejection fraction (lvef), egfr, bnp, hs - crp, nyha, -blocker, aspirin, & diuretic use. in addition to this, other established biomarkers used for comparison included tnt, tni and hscrp. a gamut of novel biomarkers such as galectin-3, st2, fractalkin, monocyte chemo attractant protein-1 (mcp-1) c - terminal pro - endothelin-1 (ct - pro - et-1), c - terminal telopeptide of type i collagen (ictp), c - terminal provasopressin (ct - pro - avp), to name a few were also used for comparison. the ability of gdf-15 to predict lv remodeling (supplementary table s1) was also investigated in 3 studies, with a strong correlation being observed in two of these studies, suggesting gdf-15 as an independent marker for lv remodeling. the diagnostic ability of gdf-15 was observed in two studies, with a combination of gdf-15 and ntprobnp being able to differentiate heart failure with preserved ejection fraction (hfpef) and heart failure with reduced ejection fraction (hfref) from controls better than either of the biomarkers alone. gdf-15, a cytokine belonging to the tgf- family has been investigated in various populations to determine its utility as a marker of adverse outcomes especially in the context of hf. in the hf, acute coronary syndrome (acs), and community based populations considered in this review, gdf-15 demonstrated its ability to predict mortality and cardiovascular events such as hf hospitalization [11, 13, 14 ]. gdf-15 was also found to be associated with deteriorating cardiovascular function, as measured by echocardiographic indices. these studies have also ascertained its incremental ability to traditional cardiovascular risk factors and established biomarkers to predict outcomes of mortality and hf. high levels of gdf-15 were predictive of all - cause mortality in hf, acs and healthy populations. the rancho - bernado study, a community based study observed that high gdf-15 levels were predictive of cardiovascular mortality, a decade after measurement in populations with no cv - risk. the authors deliberate whether elevated levels indicate the involvement of gdf-15 in the long pathobiological processes that eventually result in cardiovascular events. similar findings were observed in the womens health study, where elevated gdf-15 levels contributed a two - fold greater risk in the development of cv events [16 - 18 ]. serial measurements of gdf-15 have also shown to predict all - cause mortality, enhancing the predictive ability of the marker. this has been observed in both hf and community based studies [16, 19 ]. in a large community based study, it was found that > 40% change in gdf-15 levels was associated with a four - fold increased risk of mortality. while gdf-15 emerged as a predictor of all - cause mortality and cvd, it was also associated with non - cardiac conditions. there is abundant evidence to show that gdf-15 is highly expressed in several malignancies such as pancreatic, breast, ovarian, colorectal and gastric cancers, melanoma and glioblastoma [20 - 24 ]. therefore, one has to be wary while interpreting endpoints of all - cause mortality. as a consequence, gdf-15 is not considered to be a cardiac specific marker. in agreement with this, expression studies have shown that cardiac mrna and protein expression of gdf-15 are very low. while this may pose as an impediment to its application in the clinic, the argument lies in its utility in hf populations. hf being a systemic condition, a multi - marker panel including markers reflecting cardiac and systemic abnormalities might prove useful in prognosticating this patient population, providing information that is incremental to cardiac specific markers. in - vivo studies suggest that gdf-15 is cardioprotective, and that its expression reflects the onset of cardiac damage and its participation in the mitigation of damage [7, 10 ]. infusion of recombinant gdf-15 in gdf-15 gene targeted mice under the stress of ischemia or reperfusion injury prevent cardiomyocyte cell death. in addition, over - expression of heart - specific gdf-15 induced pressure overload induced hypertrophy in mice. counter intuitively, elevated gdf-15 levels are accurate predictors of mortality in humans, raising the question whether elevated gdf-15 levels mediate myocardial damage or do they reflect the body s protective but unsuccessful attempt at mitigating damage. gdf-15 acts via the smad dependent and smad independent pathways with smad dependent pathways being implicated in a number of pathological conditions of the heart. knockout of smad4 (transcriptional mediator of smad dependent pathways) in mice resulted in hypertrophy and hf suggestive of its cardio - protective role. however, owing to its affinity to type i and ii tgf- receptors and the smad receptors, gdf-15 s function may indeed depend on the presence of these receptors thereby contributing to the heterogeneity in gdf-15 s role [7, 26 ]. gdf-15 is expressed in a variety of cell types and tissues, and its expression is regulated by the p53 enzyme system. gdf-15 has been implicated in cardiovascular and cancer mortality and its expression has been shown to be reflective of oxidative stress, inflammation, and repair [8, 27, 28 ]. since the p53 enzyme system is a mediator in cardiovascular and cancer pathobiology, elevated levels of the biomarker may be indicative of the requirement of repair even before organ - specific damage has occurred, thereby providing the opportunity of early intervention in diseases with high mortality such as cvd and cancer. the natriuretic peptides, markers of myocardial strain, have surfaced as efficient prognostic and diagnostic biomarkers [30, 31 ]. however, their measurements have broad intra - individual variability, making it a significant hurdle in its utilization. moreover, natriuretic peptides are produced in response to wall stress, and their elevated levels do not give information about the etiology and intensity of myocardial distress [12, 32 ]. till date most scientific societies have not included natriuretic peptide measurement in clinical practice guidelines. in the context of hf, there is increasing consensus that a multi - marker panel, with each marker reflecting distinct patho - physiological processes that occur during hf will be incremental to one cardiac - specific marker. therefore, studies performed in cardiovascular disease populations and in the community have explored the additional prognostic value offered by gdf-15, incremental to conventional markers of cv risk, clinical signs and symptoms, ntprobnp, hscrp, troponins, and a gamut of other novel biomarkers. studies observed that the addition of gdf-15 improves the c - statistic of ntprobnp, thus offering additional value [12, 13, 19 ]. a combination of ntprobnp and gdf-15 surpassed the ability of either of the biomarkers alone in predicting all - cause mortality. addition of gdf-15 also improved the net reclassification index. in a community study, participants who had elevated levels of both gdf-15 and ntprobnp had a higher risk of mortality. participants with elevated levels of either of the biomarkers had an intermediate risk, while those with low levels of both biomarkers had significantly low risk of mortality indicating the utility of these two biomarkers in risk - stratification. the additional value provided by gdf-15 to other conventional biomarkers such as troponins and hscrp were also documented by these studies. exploratory factor analysis of a panel of 37 biomarkers to predict adverse events in the post mi population was conducted. gdf-15 along with midregionalpro - adrenomedullin (mr - proadm), soluble tumor necrosis factor receptor (stnfr), c - terminal pro - endothelin-1 (ct - pro - et-1), c - terminal telopeptide of type 1 collagen (ictp), c - terminal provasopressin (ct - proavp), uric acid, chromogranin a (cga), procollagen type iii n - terminal (piiinp) were clustered as one factor, indicating high collinearity between them. this group of biomarkers emerged to be strongest in predicting all - cause mortality and the combined end point of cv death and myocardial reinfarction. their incremental ability was observed even after adjustment with several clinical covariates in multivariate analysis mirroring the ability of this set of biomarkers to accurately reflect several pathophysiological processes following mi. a panel of biomarkers ntprobnp, hstnt, cystatin - c, gdf-15 and crp did not correlate with clinical signs and symptoms of nyha class, oedema, rales, jugular venous distention and orthopnoea showing that the information provided by biomarkers is distinct to that available from clinical signs and symptoms, and their measurement would positively influence clinical judgement. in addition to this, multi biomarker scores integrating biomarker information for efficient patient prognosis have been studied, demonstrating the practical applicability of the biomarker tests [34, 35 ]. unlike other markers of myonecrosis which follow a rise and fall pattern, gdf-15 is relatively stable, presenting few difficulties to bring the marker into clinical use. although, gdf-15 and ntprobnp together predict cv death/ all - cause mortality, gdf-15 has emerged as a significant predictor of non - cardiovascular death and cancer, independent of other biomarkers possibly because gdf-15 acts as a downstream mediator in pathways common to these conditions. pathobiological pathways of oxidative stress and inflammation, common to cardiac and non - cardiac diseases probably elicit gdf-15 expression via p53 pathways. due to the diverse information provided by the markers encompassing different aspects of hf, a multi - marker panel might prove to be clinically useful for the prognosis of hf. lv remodeling (lvr) refers to the process by which there is change in ventricular structure leading to altered chamber configuration and ventricular volume. a strong correlation was observed between gdf-15 and lvr using echocardiography suggesting gdf-15 could be involved in lv remodeling [15, 37 ]. while wang f. considered the elevation of left ventricular mass index as an indicator of lv remodeling in hf populations. -considered > 20% increase in the left ventricular end diastolic volume compared to baseline, to reflect lv remodeling in st elevated myocardial infarction population. gdf-15 was associated with lvr at 12 months follow - up in these patients, 22% of whom were successfully reperfused and/or were under secondary preventive measures. gdf-15 levels have also been shown to affect lv geometry, with high levels detected in patients with abnormal lv geometry. with increasing levels of gdf-15, greater remodeling and hypertrophy were detected. as mentioned before, gdf-15 was highly expressed in cardiomyocytes in conditions of mechanical stretch and ischemiain animal models. gdf-15 gene targeted mice showed enhanced hypertrophic response and a pronounced loss in ventricular performance when subjected to pressure overload suggesting its anti - hypertrophic and anti - remodeling action [7, 8 ]. however, in human studies, the responses observed is contrary to what is found in animals. if gdf-15 is indeed anti hypertrophic and anti - remodeling in function, increased levels of the biomarker must, intuitively, indicate improved ventricular performance and normal lv geometry. this raises the debate on whether gdf-15 is triggered post myocardial damage, and if this response is inadequate to prevent disease progression or whether gdf-15 itself is a mediator of lv damage. however it is noteworthy that the studies assessing the relationship between echocardiographic parameters and gdf-15 considered in this review have a similar limitation of a reduced sample size. as there is a dearth of data on gdf-15 and lv remodeling, it is imperative that more prospective studies are carried out to establish the suitability of gdf-15 as an independent predictor of lv remodeling. the diagnostic capability of gdf-15 to differentiate hfpef from hfref and controls was evaluated [39 - 41 ]. while the diagnostic power of gdf-15 and ntprobnp to differentiate hfpef from control populations was equal, the ratio of ntprobnp and gdf-15 provided a superior capacity to distinguish hfpef from hfref. gdf -15 was also seen to correlate with structural and functional indices of diastolic function such as left ventricular mass index (lvmi), left arterial volume index (lavi) and e / e. the capacity of gdf-15 to distinguish normal diastolic function from asymptomatic diastolic dysfunction (dd grade i) has also been studied, with increasing concentrations of gdf-15 observed with increasing severity of diastolic dysfunction. the concentration of gdf-15 was found to increase with the worsening stages of hf, with higher levels found in stage b than stage a. since stage b hf is asymptomatic, diagnoses is made only after the patient progresses to more advanced stages of hf. therefore, gdf-15 may be useful as a marker of hf for patients that do not show signs and symptoms of hf yet, but will eventually progress to advanced stages of hf. the etiology of hf also seemed to influence the predictive ability of gdf-15, with the biomarker being a stronger predictor of all - cause mortality in hf with non - ischemic etiology. further studies are warranted in these areas, to determine the ability of hf to diagnose stage b hf and, to document the influence of ischemic etiology on the prognostic ability of gdf-15. the heterogeneous nature of the studies did not offer us scope for performing meta - analysis. most of the studies available for our systematic review originally had a clinical trial design, and thus their inclusion - exclusion criteria could strongly influence the results. almost all studies were done in caucasian populations and their results may not be generalizable. some of the studies had a low sample size and thus the results have to be interpreted with caution. we did not include studies dealing with the effect of interventions on the gdf-15 concentration nor did we consider all end points used in the different studies but instead focused primarily on mortality, lv remodeling and comparison with other biomarkers. high levels of gdf-15 were predictive of all - cause mortality in hf, acs and healthy populations. the rancho - bernado study, a community based study observed that high gdf-15 levels were predictive of cardiovascular mortality, a decade after measurement in populations with no cv - risk. the authors deliberate whether elevated levels indicate the involvement of gdf-15 in the long pathobiological processes that eventually result in cardiovascular events. similar findings were observed in the womens health study, where elevated gdf-15 levels contributed a two - fold greater risk in the development of cv events [16 - 18 ]. serial measurements of gdf-15 have also shown to predict all - cause mortality, enhancing the predictive ability of the marker. this has been observed in both hf and community based studies [16, 19 ]. in a large community based study, it was found that > 40% change in gdf-15 levels was associated with a four - fold increased risk of mortality. while gdf-15 emerged as a predictor of all - cause mortality and cvd, it was also associated with non - cardiac conditions. there is abundant evidence to show that gdf-15 is highly expressed in several malignancies such as pancreatic, breast, ovarian, colorectal and gastric cancers, melanoma and glioblastoma [20 - 24 ]. therefore, one has to be wary while interpreting endpoints of all - cause mortality. as a consequence, gdf-15 is not considered to be a cardiac specific marker. in agreement with this, expression studies have shown that cardiac mrna and protein expression of gdf-15 are very low. while this may pose as an impediment to its application in the clinic, the argument lies in its utility in hf populations. hf being a systemic condition, a multi - marker panel including markers reflecting cardiac and systemic abnormalities might prove useful in prognosticating this patient population, providing information that is incremental to cardiac specific markers. in - vivo studies suggest that gdf-15 is cardioprotective, and that its expression reflects the onset of cardiac damage and its participation in the mitigation of damage [7, 10 ]. infusion of recombinant gdf-15 in gdf-15 gene targeted mice under the stress of ischemia or reperfusion injury prevent cardiomyocyte cell death. in addition, over - expression of heart - specific gdf-15 induced pressure overload induced hypertrophy in mice. counter intuitively, elevated gdf-15 levels are accurate predictors of mortality in humans, raising the question whether elevated gdf-15 levels mediate myocardial damage or do they reflect the body s protective but unsuccessful attempt at mitigating damage. gdf-15 acts via the smad dependent and smad independent pathways with smad dependent pathways being implicated in a number of pathological conditions of the heart. knockout of smad4 (transcriptional mediator of smad dependent pathways) in mice resulted in hypertrophy and hf suggestive of its cardio - protective role. however, owing to its affinity to type i and ii tgf- receptors and the smad receptors, gdf-15 s function may indeed depend on the presence of these receptors thereby contributing to the heterogeneity in gdf-15 s role [7, 26 ]. gdf-15 is expressed in a variety of cell types and tissues, and its expression is regulated by the p53 enzyme system. gdf-15 has been implicated in cardiovascular and cancer mortality and its expression has been shown to be reflective of oxidative stress, inflammation, and repair [8, 27, 28 ]. since the p53 enzyme system is a mediator in cardiovascular and cancer pathobiology, elevated levels of the biomarker may be indicative of the requirement of repair even before organ - specific damage has occurred, thereby providing the opportunity of early intervention in diseases with high mortality such as cvd and cancer. the natriuretic peptides, markers of myocardial strain, have surfaced as efficient prognostic and diagnostic biomarkers [30, 31 ]. however, their measurements have broad intra - individual variability, making it a significant hurdle in its utilization. moreover, natriuretic peptides are produced in response to wall stress, and their elevated levels do not give information about the etiology and intensity of myocardial distress [12, 32 ]. till date most scientific societies have not included natriuretic peptide measurement in clinical practice guidelines. in the context of hf, there is increasing consensus that a multi - marker panel, with each marker reflecting distinct patho - physiological processes that occur during hf will be incremental to one cardiac - specific marker. therefore, studies performed in cardiovascular disease populations and in the community have explored the additional prognostic value offered by gdf-15, incremental to conventional markers of cv risk, clinical signs and symptoms, ntprobnp, hscrp, troponins, and a gamut of other novel biomarkers. studies observed that the addition of gdf-15 improves the c - statistic of ntprobnp, thus offering additional value [12, 13, 19 ]. a combination of ntprobnp and gdf-15 surpassed the ability of either of the biomarkers alone in predicting all - cause mortality. addition of gdf-15 also improved the net reclassification index. in a community study, participants who had elevated levels of both gdf-15 and ntprobnp had a higher risk of mortality. participants with elevated levels of either of the biomarkers had an intermediate risk, while those with low levels of both biomarkers had significantly low risk of mortality indicating the utility of these two biomarkers in risk - stratification. the additional value provided by gdf-15 to other conventional biomarkers such as troponins and hscrp were also documented by these studies. exploratory factor analysis of a panel of 37 biomarkers to predict adverse events in the post mi population was conducted. gdf-15 along with midregionalpro - adrenomedullin (mr - proadm), soluble tumor necrosis factor receptor (stnfr), c - terminal pro - endothelin-1 (ct - pro - et-1), c - terminal telopeptide of type 1 collagen (ictp), c - terminal provasopressin (ct - proavp), uric acid, chromogranin a (cga), procollagen type iii n - terminal (piiinp) were clustered as one factor, indicating high collinearity between them. this group of biomarkers emerged to be strongest in predicting all - cause mortality and the combined end point of cv death and myocardial reinfarction. their incremental ability was observed even after adjustment with several clinical covariates in multivariate analysis mirroring the ability of this set of biomarkers to accurately reflect several pathophysiological processes following mi. a panel of biomarkers ntprobnp, hstnt, cystatin - c, gdf-15 and crp did not correlate with clinical signs and symptoms of nyha class, oedema, rales, jugular venous distention and orthopnoea showing that the information provided by biomarkers is distinct to that available from clinical signs and symptoms, and their measurement would positively influence clinical judgement. in addition to this, multi biomarker scores integrating biomarker information for efficient patient prognosis have been studied, demonstrating the practical applicability of the biomarker tests [34, 35 ]. unlike other markers of myonecrosis which follow a rise and fall pattern, gdf-15 is relatively stable, presenting few difficulties to bring the marker into clinical use. although, gdf-15 and ntprobnp together predict cv death/ all - cause mortality, gdf-15 has emerged as a significant predictor of non - cardiovascular death and cancer, independent of other biomarkers possibly because gdf-15 acts as a downstream mediator in pathways common to these conditions. pathobiological pathways of oxidative stress and inflammation, common to cardiac and non - cardiac diseases probably elicit gdf-15 expression via p53 pathways. due to the diverse information provided by the markers encompassing different aspects of hf, a multi - marker panel might prove to be clinically useful for the prognosis of hf. lv remodeling (lvr) refers to the process by which there is change in ventricular structure leading to altered chamber configuration and ventricular volume. a strong correlation was observed between gdf-15 and lvr using echocardiography suggesting gdf-15 could be involved in lv remodeling [15, 37 ]. while wang f. considered the elevation of left ventricular mass index as an indicator of lv remodeling in hf populations. -considered > 20% increase in the left ventricular end diastolic volume compared to baseline, to reflect lv remodeling in st elevated myocardial infarction population. gdf-15 was associated with lvr at 12 months follow - up in these patients, 22% of whom were successfully reperfused and/or were under secondary preventive measures. gdf-15 levels have also been shown to affect lv geometry, with high levels detected in patients with abnormal lv geometry. with increasing levels of gdf-15, greater remodeling and hypertrophy were detected. as mentioned before, gdf-15 was highly expressed in cardiomyocytes in conditions of mechanical stretch and ischemiain animal models. gdf-15 gene targeted mice showed enhanced hypertrophic response and a pronounced loss in ventricular performance when subjected to pressure overload suggesting its anti - hypertrophic and anti - remodeling action [7, 8 ]. however, in human studies, the responses observed is contrary to what is found in animals. if gdf-15 is indeed anti hypertrophic and anti - remodeling in function, increased levels of the biomarker must, intuitively, indicate improved ventricular performance and normal lv geometry. this raises the debate on whether gdf-15 is triggered post myocardial damage, and if this response is inadequate to prevent disease progression or whether gdf-15 itself is a mediator of lv damage. however it is noteworthy that the studies assessing the relationship between echocardiographic parameters and gdf-15 considered in this review have a similar limitation of a reduced sample size. as there is a dearth of data on gdf-15 and lv remodeling, it is imperative that more prospective studies are carried out to establish the suitability of gdf-15 as an independent predictor of lv remodeling. the diagnostic capability of gdf-15 to differentiate hfpef from hfref and controls was evaluated [39 - 41 ]. while the diagnostic power of gdf-15 and ntprobnp to differentiate hfpef from control populations was equal, the ratio of ntprobnp and gdf-15 provided a superior capacity to distinguish hfpef from hfref. gdf -15 was also seen to correlate with structural and functional indices of diastolic function such as left ventricular mass index (lvmi), left arterial volume index (lavi) and e / e. the capacity of gdf-15 to distinguish normal diastolic function from asymptomatic diastolic dysfunction (dd grade i) has also been studied, with increasing concentrations of gdf-15 observed with increasing severity of diastolic dysfunction. the concentration of gdf-15 was found to increase with the worsening stages of hf, with higher levels found in stage b than stage a. since stage b hf is asymptomatic, diagnoses is made only after the patient progresses to more advanced stages of hf. therefore, gdf-15 may be useful as a marker of hf for patients that do not show signs and symptoms of hf yet, but will eventually progress to advanced stages of hf. the etiology of hf also seemed to influence the predictive ability of gdf-15, with the biomarker being a stronger predictor of all - cause mortality in hf with non - ischemic etiology. further studies are warranted in these areas, to determine the ability of hf to diagnose stage b hf and, to document the influence of ischemic etiology on the prognostic ability of gdf-15. the heterogeneous nature of the studies did not offer us scope for performing meta - analysis. most of the studies available for our systematic review originally had a clinical trial design, and thus their inclusion - exclusion criteria could strongly influence the results. almost all studies were done in caucasian populations and their results may not be generalizable. some of the studies had a low sample size and thus the results have to be interpreted with caution. we did not include studies dealing with the effect of interventions on the gdf-15 concentration nor did we consider all end points used in the different studies but instead focused primarily on mortality, lv remodeling and comparison with other biomarkers. there is reasonable evidence to suggest that gdf-15 is an independent predictor of all - cause mortality in hf. gdf-15 may offer additional value in predicting the risk of hf and death in post mi patients. a multi - biomarker strategy with gdf-15 as one of the components may be superior to the conventional risk scores especially for systemic conditions such as hf. on a biological scale, it is also essential to carry out studies to see how information available about gdf-15 can be used in arriving at therapeutic decisions in hf management. we have not received any grants or funding from any agency for writing the manuscript. supplementary material is available on the publisher s web site along with the published article. | background : several diagnostic and prognostic biomarkers are being explored in heart failure. gdf-15 belongs to the transforming growth factor (tgf-) cytokine family that is highly up regulated in inflammatory conditions. we undertook this systematic review to summarize the current evidence on the utility of gdf-15 as a biomarker in heart failure.design and methods : multiple electronic databases for studies that reported the association between gdf- 15 and heart failure were searched using different electronic databases such as medline, science direct, springer link, scopus, cochrane reviews, and google scholar using pre - defined inclusion- exclusion criteria.results:twenty one original studies were identified that included data from 20,920 study participants. gdf 15 was found to be a strong prognosticator of all - cause mortality in heart failure patients. several studies found the benefit of using gdf-15 as a component of a multi - biomarker strategy in prognosticating patients with heart failure.conclusion:more studies are warranted to elucidate the molecular pathways involving gdf-15 and to see how knowledge about gdf-15 can be used to make therapeutic decisions in the clinic. |
autoimmune pancreatitis (aip) and pancreatic cancer have recently been reported.[15 ] in such cases, cytological examination can be difficult due to sclerosis, inflammation and reactive atypia in the corresponding tissue. in cytological examinations, some authors have reported that when a smear preparation exhibits a predominance of inflammatory cells (lymphocytes and plasma cells) with sparse epithelial cells lacking atypia, a cytological diagnosis of aip may be possible. here, we report, a case of invasive pancreatic ductal carcinoma with marked lymphoplasmacytic infiltration. although ductal cancer was suggested based on endoscopic ultrasound guided fine - needle aspiration (eus - fna) cytology findings, other medical examinations indicated chronic pancreatitis or aip. a 75-year - old man without a history of malignancy was referred to our institution because of weight loss and a mass lesion in the pancreas tail. the patient 's cea level was elevated (12.7 ng / ml ; normal, 0 - 6 ng / ml), but the ca 19 - 9 level was within the normal range (25.6 u / ml ; normal, 0 - 37.0 u / ml). no increase was noted in the serum amylase level (51 iu / l ; normal value, 25 - 120 iu / l) or the lipase level (22 u / l ; normal value, 13 - 49 u / l). dynamic - enhanced computed tomography (ct) imaging showed a mass measuring 20 mm in the tail of the pancreas with no dilation of the main pancreatic duct, anomalous arrangement of the pancreaticobiliary ducts, or obstructive jaundice. endoscopic retrograde cholangiopancreatography (ercp) revealed a narrowing of the main pancreatic duct at the tail. these results suggested that the mass lesion in the pancreas was caused by chronic pancreatitis or autoimmune pancreatitis, rather than a pancreatic carcinoma. further laboratory tests showed a normal igg level (1100 mg / ml ; normal, 800 - 1800 mg / ml), a normal igg4 level (67.0 mg / ml ; normal, 4 - 180 mg / ml) and the absence of antinuclear antibody. the eus - fna specimens showed a mixture of abnormal columnar epithelia and abundant lymphocytes. smear preparations of the eus - fna materials from the pancreas tumor were stained using diff - quik solution. cytoblocks were made by allowing the aspirated materials to clot in 10% buffered formalin, followed by treatment in alginic acid. the smear preparations showed numerous lymphocytes including plasma cells with necrotic material [figure 1a ] and small clusters of atypical epithelial cells [figure 1b ]. the atypical cells had a high nuclear to cytoplasmic ratio ; the cells were hyperchromatic and contained prominent nucleoli. the papanicolaou - stained smear preparations and the cytoblock preparations showed similar findings. in the cytoblock specimens, some plasma cells were immunoreactive to anti - igg4 antibody. (a) numerous lymphocytes and plasma cells with necrotic material and fibrosis are visible (diff - quik, 400) ; (b) atypical epithelial cells (diff - quik, 1000) ; (c) the cut surface of the resected specimen show an elastic, hard, white mass that was located in the pancreas tail ; (d) ductal adenocarcinoma with lymphoplasmacytic infiltration was visible (h and e, 100) ; (e) immunohistochemical findings showed abundant igg4-positive plasma cells around the pancreatic duct and cancer cells (ihc, 100) the cut surface of the resected pancreas showed an elastic, hard, white mass in the pancreas tail [figure 1c ]. in the histopathologic examination, intralobular and interlobular no granulocytic epithelial lesions were found, so these histological features were compatible with the characteristics of type 1 autoimmune pancreatitis - lymphoplasmacytic sclerosing pancreatitis (type 1 aip - lpsp). invasive ductal adenocarcinoma with lymphoplasmacytic infiltration was also observed in these lesions [figure 1d ]. immunohistochemical staining, revealed abundant igg4-positive plasma cells (> 50 cells per high - power field [hpf ]) around the pancreatic duct and tumor cells [figure 1e ]. the pathological diagnosis was moderately differentiated tubular adenocarcinoma with abundant lymphoplasmacytic infiltration and aip - lpsp features. smear preparations of the eus - fna materials from the pancreas tumor were stained using diff - quik solution. cytoblocks were made by allowing the aspirated materials to clot in 10% buffered formalin, followed by treatment in alginic acid. the smear preparations showed numerous lymphocytes including plasma cells with necrotic material [figure 1a ] and small clusters of atypical epithelial cells [figure 1b ]. the atypical cells had a high nuclear to cytoplasmic ratio ; the cells were hyperchromatic and contained prominent nucleoli. the papanicolaou - stained smear preparations and the cytoblock preparations showed similar findings. in the cytoblock specimens, some plasma cells were immunoreactive to anti - igg4 antibody. (a) numerous lymphocytes and plasma cells with necrotic material and fibrosis are visible (diff - quik, 400) ; (b) atypical epithelial cells (diff - quik, 1000) ; (c) the cut surface of the resected specimen show an elastic, hard, white mass that was located in the pancreas tail ; (d) ductal adenocarcinoma with lymphoplasmacytic infiltration was visible (h and e, 100) ; (e) immunohistochemical findings showed abundant igg4-positive plasma cells around the pancreatic duct and cancer cells (ihc, 100) the cut surface of the resected pancreas showed an elastic, hard, white mass in the pancreas tail [figure 1c ]. in the histopathologic examination, intralobular and interlobular fibrosis was observed, with numerous lymphocyte and plasma cell infiltrations. no granulocytic epithelial lesions were found, so these histological features were compatible with the characteristics of type 1 autoimmune pancreatitis - lymphoplasmacytic sclerosing pancreatitis (type 1 aip - lpsp). invasive ductal adenocarcinoma with lymphoplasmacytic infiltration was also observed in these lesions [figure 1d ]. immunohistochemical staining, revealed abundant igg4-positive plasma cells (> 50 cells per high - power field [hpf ]) around the pancreatic duct and tumor cells [figure 1e ]. the pathological diagnosis was moderately differentiated tubular adenocarcinoma with abundant lymphoplasmacytic infiltration and aip - lpsp features. in the current report, we were able to make a correct diagnosis of pancreatic carcinoma based on the presence of atypical epithelial cells in eus - fna specimens with concomitant aip - lpsp features. the differentiation of pancreatic ductal adenocarcinoma from focal chronic pancreatitis, such as autoimmune pancreatitis, is particularly difficult in some cases. indeed, although aip can be well controlled with corticosteroids, some patients undergo a pancreatic resection. this diagnostic and management dilemma has been discussed in detail. the proposed criteria for diagnosing aip include radiological studies, laboratory examinations, histopathological features, and response to steroid therapy.[79 ] because a definitive diagnosis of aip, based on its characteristic histopathology, can only be made using surgically resected tissues, establishing preoperative criteria for aip using biopsy specimens has not been practical. moreover, kamisawa., reported the possibility that pancreatic cancer may develop in aip patients. they proposed that k - ras mutations may be frequently detected in aip patients, and aip may be a risk factor for gastric and colonic cancer. eus - fna cytology improves the diagnosis of pancreatic masses, providing a sensitivity of 80%-90%, a specificity of 95%-100%, and an accuracy of 90%-95%. eus - fna cytology is often a helpful indicator for determining therapeutic strategies for patients with pancreatic masses, possibly leading to either resection or careful observation in patients in whom diagnosis, resectability, or operability are in question. in our case, the radiology findings suggested either aip or chronic pancreatitis, and only the eus - fna cytology findings indicated pancreatic adenocarcinoma. thus, eus - fna was a very useful tool for the preoperative differential diagnosis of pancreatic adenocarcinoma and aip. if patients partially meet the criteria for the diagnosis of aip and/or the mass lesion in the pancreas remains unchanged during steroid therapy, resection should be considered because of the possibility of pancreatic cancer. even if the cytological findings are negative for malignancy and the patient is diagnosed as having aip, a possible association with adenocarcinoma should be considered. indeed, our eus - fna findings showed numerous lymphocytes and plasma cells with associated necrosis. these findings seemed to indicate aip, but atypical epithelial cells were present ; thus, we were able to diagnose the patient as having pancreatic ductal adenocarcinoma accurately. eus - fna findings may be useful in guiding therapeutic management and may prevent the misdiagnosis of pancreatic tumors. eus - fna cytology should be further improved to enable pancreatic carcinomas to be distinguished from aip, thereby preventing opportunities for potentially curative resections from being lost while avoiding unnecessary surgical interventions for those with aip. | a 75-year - old man was diagnosed as having pancreatic ductal carcinoma containing remarkable lymphocytic and plasma cell infiltration, as revealed by the cytological examination of endoscopic ultrasound guided fine - needle aspiration (eus - fna) specimen. the eus - fna specimen showed small amounts of atypical epithelium with noticeable lymphocytes and plasma cells. a pancreatic resection was performed, and the histopathological features showed an invasive pancreatic ductal carcinoma with autoimmune pancreatitis (aip) lymphoplasmacytic sclerosing pancreatitis (lpsp)-like lesions. most of the plasma cells were immunoreactive to anti - igg4 antibody. eus - fna may be necessary for the differential diagnosis of aip and pancreatic cancer, and close attention should be given to the presence of marked lymphoplasmacytic cells in eus - fna specimens while making the diagnosis. |
manual therapy has, arguably, best been described by a polish medical manipulation practitioner, arkuszewski, as a mechanical therapy with reflex effects. the phrase mechanical therapy can be further characterized by noting that it is performed in the musculoskeletal (msk) system. the phrase reflex effects can be further qualified, at the very least, to indicate that these are health - beneficial. therefore, a revised version would read as follows:a manually - performed mechanical therapy to the msk system with health - beneficial reflex effects. a manually - performed mechanical therapy to the msk system with health - beneficial reflex effects. this formulation also provides a basis for describing the primary disorder posited by chiropractic theory : subluxation. recognizing that, for chiropractic, the subluxation has always been viewed as the thing for which adjustment (manual therapy) is done, a first - pass definition of subluxation, a la arkuszewski, would be a mechanical problem in the musculoskeletal system with health - deleterious reflex effects. since the founding of chiropractic and the other manual therapy professions, 2 fundamental issues have vexed us:1.what kind and location of mechanical problem in the msk system qualifies as a subluxation (or any of the other terms used as synonyms within and outside of chiropractic)?2.what kind of health - deleterious effects are specifically associated with subluxation ? what kind and location of mechanical problem in the msk system qualifies as a subluxation (or any of the other terms used as synonyms within and outside of chiropractic) ? the author recognizes that numerous others have attempted to review the subluxation concept, including recent excellent reviews by gatterman, peters, and ebrall. what follows is a nonsystematic overview of selected developments in the profession that have addressed these 2 questions. the archetypical and founding event in the history of the chiropractic profession is daniel david palmer 's first treatment of harvey lillard. from palmer 's original work, he describes his thinking leading up to this event as:displacement of any part of the skeletal frame may press against nerves, which are the channels of communication, intensifying or decreasing their carrying capacity, creating either too much or not enough functionating [sic ], as aberration known as disease.pressure on nerves causes irritation and tension with deranged functions as a result. why not a just cause instead of treating the effects ? why not?i claimed to be the first person to adjust a vertebra by hand, using the spinous and transverse processes as levers. i developed the art known as adjusting.the basic principle, and the principles of chiropractic which have been developed from it, are not new. i am not the first person to replace a subluxated vertebra, for this art has been practiced for thousands of years. displacement of any part of the skeletal frame may press against nerves, which are the channels of communication, intensifying or decreasing their carrying capacity, creating either too much or not enough functionating [sic ], as aberration known as disease. pressure on nerves causes irritation and tension with deranged functions as a result. why not release the pressure ? i claimed to be the first person to adjust a vertebra by hand, using the spinous and transverse processes as levers. the basic principle, and the principles of chiropractic which have been developed from it, are not new. i am not the first person to replace a subluxated vertebra, for this art has been practiced for thousands of years. palmer relates that he came upon this theory and applied it first to a man with deafness. keating records this version of events:harvey lillard gave him the cue which opened a new field for research. lillard was restored to hearing by two adjustments, a dorsal vertebrae was replaced in its normal position. harvey lillard gave him the cue which opened a new field for research. lillard was restored to hearing by two adjustments, a dorsal vertebrae was replaced in its normal position. here is harvey lillard 's rendition of these events according to palmer 's newsletter:i was deaf for 17 years and i expected to always remain so, for i had doctored a great deal without any benefit. i had long ago made up my mind to not take any more ear treatments, for it did me no good. this was new to me ; but it is a fact that my back was injured at the time i went deaf. palmer treated me on the spine ; in two treatments i could hear quite well. i was deaf for 17 years and i expected to always remain so, for i had doctored a great deal without any benefit. i had long ago made up my mind to not take any more ear treatments, for it did me no good. last january dr. this was new to me ; but it is a fact that my back was injured at the time i went deaf. palmer treated me on the spine ; in two treatments i could hear quite well. although palmer articulated several versions of his theory, the archetypal elements of palmer 's theory follow a logical pattern, as follows:1.subluxation, which is a misalignment of one of the vertebrae, causes2.pressure on nerves exiting around the vertebrae, causing3.disease. subluxation, which is a misalignment of one of the vertebrae, causes pressure on nerves exiting around the vertebrae, causing therefore,4.removal of subluxation (by manually adjusting it to its correct position) causes5.release of nerve pressure, causing6.the restoration of health. removal of subluxation (by manually adjusting it to its correct position) causes release of nerve pressure, causing the restoration of health. it also depicts the author 's view of the evolution of this model through the 20th century. an important early advancement was the transformation of the understanding of the activity of the nervous system from a vitalistic interpretation, as the flow of innate intelligence, to a mechanistic or physiologically - based understanding of function in the nervous system. it appears that this understanding was not fully mature, as it focused only on the efferent neural activity that could be compromised by nerve compression, that is, neural conduction and efferent innervation of end organs. this produced a formulation whereby nerve compression was understood to result in an interference or derangement of nerve function, as understood in purely physiologic terms, which then resulted in end - organ dysfunction or disease. one manifestation of this approach was the development of the meric system by bj palmer and james c wishart that organized this physiologic view of neural regulation according to the spinal segmental level of the peripheral nerves and their end - organ territories of innervation. this development allowed many chiropractors to leave their vitalistic heritage behind to its rightful place in the history of ideas and move into a solidly, if not fully, mature physiologic / pathophysiologic model (fig 1). another important advancement came with a change in the conception of the type of mechanical derangement that could constitute a subluxation. several chiropractic thinkers had begun to shift their focus from static misalignment to some kind of disturbance of function. however, this required a fundamental change in thinking from a primary and very limited focus on bone it changed our practice, by emphasizing different technical procedures for the assessment of joint function, well beyond the limits of determining static misalignment of a bone. as well, it prepared the way for the other major changes described below by grounding the theory of subluxation at the level of the joint, not the level of a single bone, and the pressure it could exert on nerves. this led the way to the next important shifts that characterize the major theoretical advancement of the late 1940s to the 1960s : maturation of the understanding of effects on and contribution of the nervous system (ie, reflexes) related to the subluxation. this work is associated with dr irwin korr and was echoed in chiropractic by many, including, but not limited to, dr ae homewood in the late 1950s as well as his students, drs r gitelman and a grice from the canadian memorial chiropractic college and dr s haldeman from the palmer college of chiropractic. this next step in the evolution of chiropractic thinking involved a shift from a focus solely on nerve compression to include the emerging understanding of the neural or reflex mechanisms that result directly from injury to the deep tissues of the vertebral motion segment. this shift incorporated the understanding of the effects of pain and inflammation from, for example, the facet joints of the spinal segments, on spinal cord mechanisms of sensory - motor integration and autonomic outflow. for korr, this was termed the facilitated segment and led to his theory of central excitatory state (ces). the notion of spinal irritability had been developed as early as 100 years prior and had been part of the work of head and others in the early 20th century. the work of korr, denslow, wright, and others revived this idea ; and it was then applied in osteopathic and chiropractic thinking. since that time, this model has come to be known as central sensitization (see below) ; and it has received enormous attention from pain researchers around the world. a corollary to this development was the shift from a focus, especially in early chiropractic, which was solely on efferent or downstream neural mechanisms (those affected by compression), to a more comprehensive understanding of sensory - motor interactions within the central nervous system. big idea was to consider the action of innate intelligence, as it flowed through the nervous system, as working from above - down, inside - out. in this theory, blockage of a nerve by a misaligned vertebra resulted only in a blockage of the outward flow of health - giving innate. once the shift of thinking beyond static misalignment of a vertebra to dynamic behavior of a spinal motion segment (joint) occurred, chiropractors could begin thinking about the sensory implications of their lesion. along with the shift away from spinal nerve compression mentioned above, this shift laid the groundwork for a much more sophisticated, fully scientifically grounded neural theory of subluxation. impulse- and non impulse - based mechanisms of the spinal lesion. it is actually better to consider these as nerve compression based and non nerve compression based mechanisms. it will be instructive to fill in some of the voluminous work that has ensued on these themes since that time. contemporaneous with this work on the neural side of the subluxation story was the work on the mechanical side undertaken by such notables as drs fred illi, joe janse, henri gillet and his colleague liekens, as well as their north american students, drs l john faye, ron gitelman, and adrian grice. notable developments in these mechanical approaches to the subluxation were : the development of motion palpation (although there is a history of interest in this going back to the 1930s with the work of grecco and others)the development of concepts such as joint play, end - feel, etc (the work of mennel is also important in this regard)the elucidation of complex segmental motions by end - motion radiographs leading to an understanding of reference ranges of segmental motion, coupled motion, and axes of motion the use of spinal - pelvic cineradiography the use of weight scales and posturometers to assess full body posture interest in gait mechanisms an expanded biomechanical model that grounded single spinal subluxations within the larger context of the vertebral column and the locomotor system and considered the assessment and treatment of patterns of findings (vs single separate findings) in these larger contexts.. the development of motion palpation (although there is a history of interest in this going back to the 1930s with the work of grecco and others) the development of concepts such as joint play, end - feel, etc (the work of mennel is also important in this regard) the elucidation of complex segmental motions by end - motion radiographs leading to an understanding of reference ranges of segmental motion, coupled motion, and axes of motion the use of spinal - pelvic cineradiography the use of weight scales and posturometers to assess full body posture interest in gait mechanisms an expanded biomechanical model that grounded single spinal subluxations within the larger context of the vertebral column and the locomotor system and considered the assessment and treatment of patterns of findings (vs single separate findings) in these larger contexts. i call this model structural wholism. aside from this work representing a shift toward the dynamic, functional aspects of the spine, it also represented a shift away from single vertebral analysis (subluxation listings etc) to a more sophisticated analysis of, and interest in, the entire locomotor system. in fact, the definition of chiropractic developed at the canadian memorial chiropractic college in the late 1960s was:a discipline of the scientific healing arts concerned with the pathogenesis, diagnostics, therapeutics, pain syndromes and neurological effects related to the statics and dynamics of the locomotor system, especially of the spine and pelvis. a discipline of the scientific healing arts concerned with the pathogenesis, diagnostics, therapeutics, pain syndromes and neurological effects related to the statics and dynamics of the locomotor system, especially of the spine and pelvis. the emphasis on the phrase locomotor system is mine, showing how that term predominated in the thinking of that time. notice that no mention of subluxation is found. in a countermovement to this development, it is the author 's opinion that this model may have created unwanted and unnecessary complexity in the numerous categories and aspects of tissue and physiologic functioning applied to the concept of subluxation, such as histopathology, myopathology, neuropathology, etc. somatic, neural, and visceral have these many dimensions or aspects (ie, all of these ologies). in the author 's opinion, this model did not contribute to the scientific advancement, especially the scientific elucidation, of the subluxation concept. in the author 's opinion, another similar unfortunate development was the american chiropractic association paradigm statement on subluxation in 1996:chiropractic focuses particular attention on the subluxation. a subluxation is a complex of functional and/or structural and/or pathological articular changes that compromise neural integrity and may influence organ system function and general health. a subluxation is a complex of functional and/or structural and/or pathological articular changes that compromise neural integrity and may influence organ system function and general health. (from gatterman) this definition is too ambiguous and tentative, with its many and / ors and conditional assertions ; and it has yet to be shown how this definition has contributed to the scientific development of the subluxation concept. in more recent times, a consensus appears to have been reached in the manual therapy academic literature around the nature of the mechanical problem in the spine amenable to manual therapy, namely, hypomobility associated with a disturbance of joint function, hence, the terms joint dysfunction or, for the spine, spinal or segmental dysfunction. the international association for the study of pain classification of chronic pain includes a definition of segmental dysfunction (in each of the spinal regions), as follows:(spinal) pain, ostensibly due to excessive strains sustained by the restraining elements of a single spinal motion segment. features (spinal) pain, with or without referred pain, that can be aggravated by selectively stressing the particular spinal segment.diagnostic criteria (all of the following should be satisfied):1.the affected segment must be specified.2.the patient 's pain is aggravated by clinical tests that selectively stress the affected segment.3.stressing adjacent segments does not reproduce the patient 's pain.pathology : unknown. presumably involves excessive strain incurred during activities of daily living by structures such as the ligaments, joints or intervertebral disc of the affected segment. (spinal) pain, ostensibly due to excessive strains sustained by the restraining elements of a single spinal motion segment. features (spinal) pain, with or without referred pain, that can be aggravated by selectively stressing the particular spinal segment. diagnostic criteria (all of the following should be satisfied):1.the affected segment must be specified.2.the patient 's pain is aggravated by clinical tests that selectively stress the affected segment.3.stressing adjacent segments does not reproduce the patient 's pain. the affected segment must be specified. the patient 's pain is aggravated by clinical tests that selectively stress the affected segment. pathology : unknown. presumably involves excessive strain incurred during activities of daily living by structures such as the ligaments, joints or intervertebral disc of the affected segment. the following recounts the development of ideas on the neurologic and mechanical issues relevant to subluxation from the 1960s onward and includes a short list of recent developments that are important to the development of the modern subluxation model. 1.chiropractors received considerable and protracted scorn for the idea of a pinched nerve. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model.2.however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. chiropractors received considerable and protracted scorn for the idea of a pinched nerve. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model. however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. several chiropractic researchers investigated the effects of nerve root compression in the ivf by using animal models (see reviews by vernon and henderson). disturbances of nerve conduction velocity and neural axoplasmic flow were demonstrated. however, these studies only provided an animal model of what might occur if actual compression of nerves by something that most would agree was a subluxation was not studied. the mechanical derangement of the subluxation is not easy to create in an animal model. most importantly, for our purposes of discussion in modern pain research circles, this type of research goes under the name of neuropathic pain. it is clear that compression / irritation of the peripheral nerves, either as nerve roots or as nerve trunks, results in profound changes in sensorimotor processing throughout the central nervous system, but especially in the spinal cord. this means that, all along, compression of nerves was not just an inside - out matter. there is a whole dimension of outside - in (centripetal) processes that involve highly complex and clinically important changes in central sensorimotor processing that then results in profound changes in sensory, motor, and autonomic functions. in other words, we now know that nerve compression / neuropathic pain is a much more complex matter than was originally conceived by the early chiropractors ; and if, as part of the modernization of our thinking on subluxation, we believe that a role for nerve compression should be preserved, we should do so only with great respect and full regard for the body of data now available on the matter.3.recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! 4.since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic muscle, joint, ligament sources. this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic muscle, joint, ligament sources. this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. deep pain mechanisms have been strongly associated with the development of central sensitization in the central pain transmission system : dorsal root ganglion cells, spinal cord dorsal horn, projection tracts to the brain, wide - ranging brain - based mechanisms in the medulla, midbrain, thalamus, and sensory cortex. as well, deep pain mechanisms are now known to evoke antinociceptive mechanisms local to the spinal cord as well as descending to the cord from midbrain nuclei.5.central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. these changes are also now regarded as the mechanisms responsible for the efferent manifestations of the subluxation, as they were conceived in the theory of the central excitatory state : reflex muscular hypertonicity, reflex autonomic changes (somatovisceral mechanisms), and the functional changes that result from these manifestations, such as reduced mobility of the joints, contractures of muscles, altered patterns of joint use and function, altered tissue health, etc. the fact that so much more is now known about the mechanisms of central sensitization and the particular mechanisms of deep somatic pain is owed to the advancement of animal models of joint and muscular pain. however, the vast majority of these studies, and therefore the vast majority of the data about these phenomena, comes from studies of the hind limbs of small animal models. subcutaneous pain mechanisms typically involve the tissues of the hind paw ; muscular mechanisms have involved mainly the gastrocnemius and soleus muscles ; joint mechanisms have mainly involved either polyarthritic models of all the tissues of the hind quarters or, in monoarthritic models, the knee and ankle joints. this led one of the leaders in the field of muscle pain mechanisms, siegfied mense, to title an article in 2003 as what 's different about muscle pain?6.there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. so i now ask the question, what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. so i now ask the question, what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? thankfully, there is a small but growing body of work on mechanisms of deep pain from paraspinal sources that is beginning to address this need. a full list of chiropractic neurophysiological research is available from the colloquium planners and is appended to this article. in addition, the works of solomonow, indahl, tachihara, and taguchi must be recognized. all of these studies are elucidating the mechanisms of deep somatic pain of axial (spinal) tissues and helping to address the question of whether there are any unique features of such pain, especially those that might underlie the distinctive clinical phenomenology of spinal pain. the early results provide encouragement for the notion that there may be distinctive features of spinal pain mechanisms and that these might explain the distinctive features of spinal pain complaints in our patients. with respect to subluxation models, the recent work on spinal loading and spinal motor control patterns deserves mention. multisegmental motor control patterns ligamentomuscular reflexes multisegmental motor control patterns with respect to integrating the concept of subluxation with more sophisticated motor control theories, an adage adapted from korr (personal communication) is instructive : under normal, healthy conditions, spinal segments function in a multi - segmental pattern ; no segment acts alone. under conditions of pain and injury, segments therefore, we can not expect to restore function by having injured segments move ; they must be moved to accomplish this. under normal, healthy conditions, spinal segments function in a multi - segmental pattern ; no segment acts alone. under conditions of pain and injury, segments therefore, we can not expect to restore function by having injured segments move ; they must be moved to accomplish this. the notion of segments acting alone means that focal pain initiates1.ligamentomuscular reflexes altering local segmental motor control, as well as2.somatosympathetic reflexes altering local vaso- and sudomotor control (as well as distant end - organ function ?). ligamentomuscular reflexes altering local segmental motor control, as well as somatosympathetic reflexes altering local vaso- and sudomotor control (as well as distant end - organ function ?). note that this is not a clinical model in the style of the vertebral subluxation complex ; rather, it is a predictive model that, although based upon current knowledge, identifies areas of important future laboratory and clinical work. in this final section, some of the very current challenges to the subluxation model are reviewed. for almost all of its history, chiropractic has posited that neurologic or reflex effects do result from subluxation and that it is these effects that underscore the importance of subluxation in the health of the patient. it is this proposal or this side of the arkuszewski - like formulation with which we began this article that received the greatest amount of criticism from opponents of the profession. throughout this time, the mechanical side of our original formula was not overly criticized, although the concept of misalignment has lost most of its favor. recent developments in manipulative sciences have created a unique challenge to the very concept of a specific mechanical problem toward which manipulation is directed.1.studies on the reliability of palpation of segmental motion have reported mixed results. this has led others to go further and become skeptical that a segmental mechanical problem with a disturbance of motion actually exists.2.a small number of studies on the validity of palpation for segmental motion or for segmental findings have reported questionable results. these studies have taken the form of randomized clinical trials of a single session of manual therapy manipulation, mobilization, and manual traction in which one group receives a single palpation - specific procedure and the other group receives the same procedure at sites distant from the target segment. the immediate clinical outcomes of these studies show no significant difference between groups, calling into question the need to identify a specific segment at all. the combination of 1 and 2 led some to suggest that the whole idea of a mechanical lesion is invalid and should be discarded.3.recently, classification - based approaches to treatment of spinal disorders based on apparently validated prediction rules (predicting positive outcome of treatment from symptom profiles) have been developed. some of these either exclude or downplay the results of palpatory examination for spinal hypomobility. on the other hand, some of them do the opposite and strongly emphasize the findings of motion palpation for spinal fixation. clinicians are now able to choose among these predictive models, with one option being to discard, or at least greatly downplay, the role of a mechanical lesion.4.a few recent studies on healthy subjects appear to indicate that cavitations occurring during spinal manipulations are not localized to the segment putatively identified as the lesion and as the target of the maneuver. this has been interpreted by some to mean that, even if a specific mechanical lesion does exist and even if it can be reliably identified in clinical assessment, such an exercise may be fruitless if the treatment can not match this level of specificity. this has led others to go further and become skeptical that a segmental mechanical problem with a disturbance of motion actually exists. a small number of studies on the validity of palpation for segmental motion or for segmental findings have reported questionable results. these studies have taken the form of randomized clinical trials of a single session of manual therapy manipulation, mobilization, and manual traction in which one group receives a single palpation - specific procedure and the other group receives the same procedure at sites distant from the target segment. the immediate clinical outcomes of these studies show no significant difference between groups, calling into question the need to identify a specific segment at all. the combination of 1 and 2 led some to suggest that the whole idea of a mechanical lesion is invalid and should be discarded. recently, classification - based approaches to treatment of spinal disorders based on apparently validated prediction rules (predicting positive outcome of treatment from symptom profiles) have been developed. some of these either exclude or downplay the results of palpatory examination for spinal hypomobility. on the other hand, some of them do the opposite and strongly emphasize the findings of motion palpation for spinal fixation. clinicians are now able to choose among these predictive models, with one option being to discard, or at least greatly downplay, the role of a mechanical lesion. a few recent studies on healthy subjects appear to indicate that cavitations occurring during spinal manipulations are not localized to the segment putatively identified as the lesion and as the target of the maneuver. this has been interpreted by some to mean that, even if a specific mechanical lesion does exist and even if it can be reliably identified in clinical assessment, such an exercise may be fruitless if the treatment can not match this level of specificity. the older challenge faced by the chiropractic profession was largely to the second half of our initial formulation of subluxation : the health - deleterious effects. our critics have persistently questioned the premise that chiropractic subluxations caused anything more important than local, benign pain. the entire historical chiropractic project of attaching health - significant effects to subluxation (such as the association of chiropractic college 's statement including the phrase that compromise neural integrity and may influence organ system function and general health) was challenged by these critics. the newer challenge is now to the first part of our statement : a subluxation is a mechanical problem in the musculoskeletal system. recent research appears to challenge this premise as well ; and some, within and outside of the profession, have adopted a completely skeptical view of the entire subluxation project. if it does n't exist in the first place, they say, how can it have any effects ? if we ca n't find it, why look for it and why include it in our clinical decision - making ? if we ca n't localize our treatment to one segment, why be concerned to do so ? the following recounts the development of ideas on the neurologic and mechanical issues relevant to subluxation from the 1960s onward and includes a short list of recent developments that are important to the development of the modern subluxation model. 1.chiropractors received considerable and protracted scorn for the idea of a pinched nerve. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model.2.however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model. however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. several chiropractic researchers investigated the effects of nerve root compression in the ivf by using animal models (see reviews by vernon and henderson). disturbances of nerve conduction velocity and neural axoplasmic flow were demonstrated. however, these studies only provided an animal model of what might occur if actual compression of nerves by something that most would agree was a subluxation was not studied. the mechanical derangement of the subluxation is not easy to create in an animal model. most importantly, for our purposes of discussion in modern pain research circles, this type of research goes under the name of neuropathic pain. it is clear that compression / irritation of the peripheral nerves, either as nerve roots or as nerve trunks, results in profound changes in sensorimotor processing throughout the central nervous system, but especially in the spinal cord. this means that, all along, compression of nerves was not just an inside - out matter. there is a whole dimension of outside - in (centripetal) processes that involve highly complex and clinically important changes in central sensorimotor processing that then results in profound changes in sensory, motor, and autonomic functions. in other words, we now know that nerve compression / neuropathic pain is a much more complex matter than was originally conceived by the early chiropractors ; and if, as part of the modernization of our thinking on subluxation, we believe that a role for nerve compression should be preserved, we should do so only with great respect and full regard for the body of data now available on the matter.3.recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! 4.since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic muscle, joint, ligament sources. this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic muscle, joint, ligament sources. this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. deep pain mechanisms have been strongly associated with the development of central sensitization in the central pain transmission system : dorsal root ganglion cells, spinal cord dorsal horn, projection tracts to the brain, wide - ranging brain - based mechanisms in the medulla, midbrain, thalamus, and sensory cortex. as well, deep pain mechanisms are now known to evoke antinociceptive mechanisms local to the spinal cord as well as descending to the cord from midbrain nuclei.5.central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. these changes are also now regarded as the mechanisms responsible for the efferent manifestations of the subluxation, as they were conceived in the theory of the central excitatory state : reflex muscular hypertonicity, reflex autonomic changes (somatovisceral mechanisms), and the functional changes that result from these manifestations, such as reduced mobility of the joints, contractures of muscles, altered patterns of joint use and function, altered tissue health, etc. the fact that so much more is now known about the mechanisms of central sensitization and the particular mechanisms of deep somatic pain is owed to the advancement of animal models of joint and muscular pain. however, the vast majority of these studies, and therefore the vast majority of the data about these phenomena, comes from studies of the hind limbs of small animal models. subcutaneous pain mechanisms typically involve the tissues of the hind paw ; muscular mechanisms have involved mainly the gastrocnemius and soleus muscles ; joint mechanisms have mainly involved either polyarthritic models of all the tissues of the hind quarters or, in monoarthritic models, the knee and ankle joints. this led one of the leaders in the field of muscle pain mechanisms, siegfied mense, to title an article in 2003 as what 's different about muscle pain?6.there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. so i now ask the question, what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? thankfully, there is a small but growing body of work on mechanisms of deep pain from paraspinal sources that is beginning to address this need. a full list of chiropractic neurophysiological research is available from the colloquium planners and is appended to this article. in addition, the works of solomonow, indahl, tachihara, and taguchi must be recognized. all of these studies are elucidating the mechanisms of deep somatic pain of axial (spinal) tissues and helping to address the question of whether there are any unique features of such pain, especially those that might underlie the distinctive clinical phenomenology of spinal pain. the early results provide encouragement for the notion that there may be distinctive features of spinal pain mechanisms and that these might explain the distinctive features of spinal pain complaints in our patients. with respect to subluxation models, the recent work on spinal loading and spinal motor control patterns deserves mention. multisegmental motor control patterns ligamentomuscular reflexes multisegmental motor control patterns with respect to integrating the concept of subluxation with more sophisticated motor control theories, an adage adapted from korr (personal communication) is instructive : under normal, healthy conditions, spinal segments function in a multi - segmental pattern ; no segment acts alone. under conditions of pain and injury, segments therefore, we can not expect to restore function by having injured segments move ; they must be moved to accomplish this. under normal, healthy conditions, spinal segments function in a multi - segmental pattern ; no segment acts alone. under conditions of pain and injury, segments therefore, we can not expect to restore function by having injured segments move ; they must be moved to accomplish this. the notion of segments acting alone means that focal pain initiates1.ligamentomuscular reflexes altering local segmental motor control, as well as2.somatosympathetic reflexes altering local vaso- and sudomotor control (as well as distant end - organ function ?). ligamentomuscular reflexes altering local segmental motor control, as well as somatosympathetic reflexes altering local vaso- and sudomotor control (as well as distant end - organ function ?). note that this is not a clinical model in the style of the vertebral subluxation complex ; rather, it is a predictive model that, although based upon current knowledge, identifies areas of important future laboratory and clinical work. in this final section, some of the very current challenges to the subluxation model are reviewed. for almost all of its history, chiropractic has posited that neurologic or reflex effects do result from subluxation and that it is these effects that underscore the importance of subluxation in the health of the patient. it is this proposal or this side of the arkuszewski - like formulation with which we began this article that received the greatest amount of criticism from opponents of the profession. throughout this time, the mechanical side of our original formula was not overly criticized, although the concept of misalignment has lost most of its favor. recent developments in manipulative sciences have created a unique challenge to the very concept of a specific mechanical problem toward which manipulation is directed.1.studies on the reliability of palpation of segmental motion have reported mixed results. this has led others to go further and become skeptical that a segmental mechanical problem with a disturbance of motion actually exists.2.a small number of studies on the validity of palpation for segmental motion or for segmental findings have reported questionable results. these studies have taken the form of randomized clinical trials of a single session of manual therapy manipulation, mobilization, and manual traction in which one group receives a single palpation - specific procedure and the other group receives the same procedure at sites distant from the target segment. the immediate clinical outcomes of these studies show no significant difference between groups, calling into question the need to identify a specific segment at all. the combination of 1 and 2 led some to suggest that the whole idea of a mechanical lesion is invalid and should be discarded.3.recently, classification - based approaches to treatment of spinal disorders based on apparently validated prediction rules (predicting positive outcome of treatment from symptom profiles) have been developed. some of these either exclude or downplay the results of palpatory examination for spinal hypomobility. on the other hand, some of them do the opposite and strongly emphasize the findings of motion palpation for spinal fixation. clinicians are now able to choose among these predictive models, with one option being to discard, or at least greatly downplay, the role of a mechanical lesion.4.a few recent studies on healthy subjects appear to indicate that cavitations occurring during spinal manipulations are not localized to the segment putatively identified as the lesion and as the target of the maneuver. this has been interpreted by some to mean that, even if a specific mechanical lesion does exist and even if it can be reliably identified in clinical assessment, such an exercise may be fruitless if the treatment can not match this level of specificity. this has led others to go further and become skeptical that a segmental mechanical problem with a disturbance of motion actually exists. a small number of studies on the validity of palpation for segmental motion or for segmental findings have reported questionable results. these studies have taken the form of randomized clinical trials of a single session of manual therapy manipulation, mobilization, and manual traction in which one group receives a single palpation - specific procedure and the other group receives the same procedure at sites distant from the target segment. the immediate clinical outcomes of these studies show no significant difference between groups, calling into question the need to identify a specific segment at all. the combination of 1 and 2 led some to suggest that the whole idea of a mechanical lesion is invalid and should be discarded. recently, classification - based approaches to treatment of spinal disorders based on apparently validated prediction rules (predicting positive outcome of treatment from symptom profiles) have been developed. some of these either exclude or downplay the results of palpatory examination for spinal hypomobility. on the other hand, some of them do the opposite and strongly emphasize the findings of motion palpation for spinal fixation. clinicians are now able to choose among these predictive models, with one option being to discard, or at least greatly downplay, the role of a mechanical lesion. a few recent studies on healthy subjects appear to indicate that cavitations occurring during spinal manipulations are not localized to the segment putatively identified as the lesion and as the target of the maneuver. this has been interpreted by some to mean that, even if a specific mechanical lesion does exist and even if it can be reliably identified in clinical assessment, such an exercise may be fruitless if the treatment can not match this level of specificity. the older challenge faced by the chiropractic profession was largely to the second half of our initial formulation of subluxation : the health - deleterious effects. our critics have persistently questioned the premise that chiropractic subluxations caused anything more important than local, benign pain. the entire historical chiropractic project of attaching health - significant effects to subluxation (such as the association of chiropractic college 's statement including the phrase that compromise neural integrity and may influence organ system function and general health) was challenged by these critics. the newer challenge is now to the first part of our statement : a subluxation is a mechanical problem in the musculoskeletal system. recent research appears to challenge this premise as well ; and some, within and outside of the profession, have adopted a completely skeptical view of the entire subluxation project. if it does n't exist in the first place, they say, how can it have any effects ? if we ca n't find it, why look for it and why include it in our clinical decision - making ? if we ca n't localize our treatment to one segment, why be concerned to do so ? 1.chiropractors received considerable and protracted scorn for the idea of a pinched nerve. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model.2.however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. chiropractors received considerable and protracted scorn for the idea of a pinched nerve. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model. however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. several chiropractic researchers investigated the effects of nerve root compression in the ivf by using animal models (see reviews by vernon and henderson). disturbances of nerve conduction velocity and neural axoplasmic flow were demonstrated. however, these studies only provided an animal model of what might occur if actual compression of nerves by something that most would agree was a subluxation was not studied. the mechanical derangement of the subluxation is not easy to create in an animal model. most importantly, for our purposes of discussion in modern pain research circles, this type of research goes under the name of neuropathic pain. it is clear that compression / irritation of the peripheral nerves, either as nerve roots or as nerve trunks, results in profound changes in sensorimotor processing throughout the central nervous system, but especially in the spinal cord. this means that, all along, compression of nerves was not just an inside - out matter. there is a whole dimension of outside - in (centripetal) processes that involve highly complex and clinically important changes in central sensorimotor processing that then results in profound changes in sensory, motor, and autonomic functions. in other words, we now know that nerve compression / neuropathic pain is a much more complex matter than was originally conceived by the early chiropractors ; and if, as part of the modernization of our thinking on subluxation, we believe that a role for nerve compression should be preserved, we should do so only with great respect and full regard for the body of data now available on the matter.3.recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! 4.since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic muscle, joint, ligament sources. this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. deep pain mechanisms have been strongly associated with the development of central sensitization in the central pain transmission system : dorsal root ganglion cells, spinal cord dorsal horn, projection tracts to the brain, wide - ranging brain - based mechanisms in the medulla, midbrain, thalamus, and sensory cortex. as well, deep pain mechanisms are now known to evoke antinociceptive mechanisms local to the spinal cord as well as descending to the cord from midbrain nuclei.5.central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. these changes are also now regarded as the mechanisms responsible for the efferent manifestations of the subluxation, as they were conceived in the theory of the central excitatory state : reflex muscular hypertonicity, reflex autonomic changes (somatovisceral mechanisms), and the functional changes that result from these manifestations, such as reduced mobility of the joints, contractures of muscles, altered patterns of joint use and function, altered tissue health, etc. the fact that so much more is now known about the mechanisms of central sensitization and the particular mechanisms of deep somatic pain is owed to the advancement of animal models of joint and muscular pain. however, the vast majority of these studies, and therefore the vast majority of the data about these phenomena, comes from studies of the hind limbs of small animal models. subcutaneous pain mechanisms typically involve the tissues of the hind paw ; muscular mechanisms have involved mainly the gastrocnemius and soleus muscles ; joint mechanisms have mainly involved either polyarthritic models of all the tissues of the hind quarters or, in monoarthritic models, the knee and ankle joints. this led one of the leaders in the field of muscle pain mechanisms, siegfied mense, to title an article in 2003 as what 's different about muscle pain?6.there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. so i now ask the question, what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? thankfully, there is a small but growing body of work on mechanisms of deep pain from paraspinal sources that is beginning to address this need. a full list of chiropractic neurophysiological research is available from the colloquium planners and is appended to this article. in addition, the works of solomonow, indahl, tachihara, and taguchi must be recognized. all of these studies are elucidating the mechanisms of deep somatic pain of axial (spinal) tissues and helping to address the question of whether there are any unique features of such pain, especially those that might underlie the distinctive clinical phenomenology of spinal pain. the early results provide encouragement for the notion that there may be distinctive features of spinal pain mechanisms and that these might explain the distinctive features of spinal pain complaints in our patients. 1.chiropractors received considerable and protracted scorn for the idea of a pinched nerve. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model.2.however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. chiropractors received considerable and protracted scorn for the idea of a pinched nerve. crelin 's effort to debunk chiropractic focused directly on this phenomenon by putatively showing that there was ample room in the intervertebral foramen (ivf) for the nerve to never undergo such compression. the phenomenon of nerve compression became very strongly associated with disk herniation after mixter and barr 's 1934 article. the role of minor intervertebral joint derangement in compression on nerves and in referred back pain became greatly diminished in the medical model. however, the link between herniated disks and nerve compression did eventually loosen so that, by the 1970s, the phenomenon of lateral entrapment of the spinal nerve root had become well accepted. the work of sharpless, sutherland, and luttges and gerren on nerve root compression susceptibility and the work of rydevik rehabilitated the concept of the compressed nerve in spinal diagnosis. several chiropractic researchers investigated the effects of nerve root compression in the ivf by using animal models (see reviews by vernon and henderson). disturbances of nerve conduction velocity and neural axoplasmic flow were demonstrated. however, these studies only provided an animal model of what might occur if actual compression of nerves by something that most would agree was a subluxation was not studied. the mechanical derangement of the subluxation is not easy to create in an animal model. most importantly, for our purposes of discussion in modern pain research circles, this type of research goes under the name of neuropathic pain. it is clear that compression / irritation of the peripheral nerves, either as nerve roots or as nerve trunks, results in profound changes in sensorimotor processing throughout the central nervous system, but especially in the spinal cord. this means that, all along, compression of nerves was not just an inside - out matter. there is a whole dimension of outside - in (centripetal) processes that involve highly complex and clinically important changes in central sensorimotor processing that then results in profound changes in sensory, motor, and autonomic functions. in other words, we now know that nerve compression / neuropathic pain is a much more complex matter than was originally conceived by the early chiropractors ; and if, as part of the modernization of our thinking on subluxation, we believe that a role for nerve compression should be preserved, we should do so only with great respect and full regard for the body of data now available on the matter.3.recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! recent work has shown that facet inflammation can induce compressive radiculopathy by spread of inflammatory exudate anteriorly into the ivf. therefore, spinal joint dysfunction / inflammation can lead to direct nerve compression (ie, neuropathic pain) and not just reflex effects from pain (see below). ironically, this work convincingly refutes crelin 's infamous report and finally provides confirmation of the oldest chiropractic theory : that relatively minor problems in the small joints of the spine can actually deleteriously compress or irritate the adjoining nerve ! 4.since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic muscle, joint, ligament sources. this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. since the 1970s, a great deal has been learned about deep somatic pain mechanisms, that is, pain from deep somatic muscle, joint, ligament sources. this is an advance on the situation whereby the great preponderance of knowledge of pain mechanisms before that time came from studies of cutaneous sources only. deep pain mechanisms have been strongly associated with the development of central sensitization in the central pain transmission system : dorsal root ganglion cells, spinal cord dorsal horn, projection tracts to the brain, wide - ranging brain - based mechanisms in the medulla, midbrain, thalamus, and sensory cortex. as well, deep pain mechanisms are now known to evoke antinociceptive mechanisms local to the spinal cord as well as descending to the cord from midbrain nuclei.5.central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. central sensitization involves such changes in dorsal horn neurons as lowered thresholds of excitation, prolonged after - discharges, spread of reactivity of dorsal horn neurons, increases in the peripheral receptive fields, and a host of molecular and cellular / synaptic changes that underlie these functional changes. all of these changes are thought to be responsible for the clinical phenomena of spread of pain from an initial source, referral of pain from the original source, the development of allodynia and other hypersensitivity states, the development of chronicity of pain by virtue of the persistence of these changes (long - term potentiation), and the development of recurrence by virtue of the creation of persisting neural engrams or pain memories. these changes are also now regarded as the mechanisms responsible for the efferent manifestations of the subluxation, as they were conceived in the theory of the central excitatory state : reflex muscular hypertonicity, reflex autonomic changes (somatovisceral mechanisms), and the functional changes that result from these manifestations, such as reduced mobility of the joints, contractures of muscles, altered patterns of joint use and function, altered tissue health, etc. the fact that so much more is now known about the mechanisms of central sensitization and the particular mechanisms of deep somatic pain is owed to the advancement of animal models of joint and muscular pain. however, the vast majority of these studies, and therefore the vast majority of the data about these phenomena, comes from studies of the hind limbs of small animal models. subcutaneous pain mechanisms typically involve the tissues of the hind paw ; muscular mechanisms have involved mainly the gastrocnemius and soleus muscles ; joint mechanisms have mainly involved either polyarthritic models of all the tissues of the hind quarters or, in monoarthritic models, the knee and ankle joints. this led one of the leaders in the field of muscle pain mechanisms, siegfied mense, to title an article in 2003 as what 's different about muscle pain?6.there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. so i now ask the question, what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? there has been a conspicuous absence of work on deep pain mechanisms from spinal (paraspinal) tissues. is what is now known about deep pain mechanism from the msk tissues of the peripheral limbs automatically to be applied to deep pain arising from spinal tissues ? are there no important differences ? if not, there is no compelling reason to hold on to theories that make the spine distinctive in any way ; and there is no reason to develop animal models of spinal deep pain. so i now ask the question, what 's (or : is there anything) different about spinal muscular (and ligamentous) pain ? thankfully, there is a small but growing body of work on mechanisms of deep pain from paraspinal sources that is beginning to address this need. a full list of chiropractic neurophysiological research is available from the colloquium planners and is appended to this article. in addition, the works of solomonow, indahl, tachihara, and taguchi must be recognized. all of these studies are elucidating the mechanisms of deep somatic pain of axial (spinal) tissues and helping to address the question of whether there are any unique features of such pain, especially those that might underlie the distinctive clinical phenomenology of spinal pain. the early results provide encouragement for the notion that there may be distinctive features of spinal pain mechanisms and that these might explain the distinctive features of spinal pain complaints in our patients. with respect to subluxation models, the recent work on spinal loading and spinal motor control patterns deserves mention. multisegmental motor control patterns ligamentomuscular reflexes multisegmental motor control patterns with respect to integrating the concept of subluxation with more sophisticated motor control theories, an adage adapted from korr (personal communication) is instructive : under normal, healthy conditions, spinal segments function in a multi - segmental pattern ; no segment acts alone. under conditions of pain and injury, segments can act alone. therefore, we can not expect to restore function by having injured segments move ; they must be moved to accomplish this. under normal, healthy conditions, spinal segments function in a multi - segmental pattern ; no segment acts alone. under conditions of pain and injury, segments therefore, we can not expect to restore function by having injured segments move ; they must be moved to accomplish this. the notion of segments acting alone means that focal pain initiates1.ligamentomuscular reflexes altering local segmental motor control, as well as2.somatosympathetic reflexes altering local vaso- and sudomotor control (as well as distant end - organ function ?). ligamentomuscular reflexes altering local segmental motor control, as well as somatosympathetic reflexes altering local vaso- and sudomotor control (as well as distant end - organ function ?). note that this is not a clinical model in the style of the vertebral subluxation complex ; rather, it is a predictive model that, although based upon current knowledge, identifies areas of important future laboratory and clinical work. in this final section, some of the very current challenges to the subluxation model are reviewed. for almost all of its history, chiropractic has posited that neurologic or reflex effects do result from subluxation and that it is these effects that underscore the importance of subluxation in the health of the patient. it is this proposal or this side of the arkuszewski - like formulation with which we began this article that received the greatest amount of criticism from opponents of the profession. throughout this time, the mechanical side of our original formula was not overly criticized, although the concept of misalignment has lost most of its favor. recent developments in manipulative sciences have created a unique challenge to the very concept of a specific mechanical problem toward which manipulation is directed.1.studies on the reliability of palpation of segmental motion have reported mixed results. this has led some to discard this procedure in their analysis of spinal pain. this has led others to go further and become skeptical that a segmental mechanical problem with a disturbance of motion actually exists.2.a small number of studies on the validity of palpation for segmental motion or for segmental findings have reported questionable results. these studies have taken the form of randomized clinical trials of a single session of manual therapy manipulation, mobilization, and manual traction in which one group receives a single palpation - specific procedure and the other group receives the same procedure at sites distant from the target segment. the immediate clinical outcomes of these studies show no significant difference between groups, calling into question the need to identify a specific segment at all. the combination of 1 and 2 led some to suggest that the whole idea of a mechanical lesion is invalid and should be discarded.3.recently, classification - based approaches to treatment of spinal disorders based on apparently validated prediction rules (predicting positive outcome of treatment from symptom profiles) have been developed. some of these either exclude or downplay the results of palpatory examination for spinal hypomobility. on the other hand, some of them do the opposite and strongly emphasize the findings of motion palpation for spinal fixation. clinicians are now able to choose among these predictive models, with one option being to discard, or at least greatly downplay, the role of a mechanical lesion.4.a few recent studies on healthy subjects appear to indicate that cavitations occurring during spinal manipulations are not localized to the segment putatively identified as the lesion and as the target of the maneuver. this has been interpreted by some to mean that, even if a specific mechanical lesion does exist and even if it can be reliably identified in clinical assessment, such an exercise may be fruitless if the treatment can not match this level of specificity. this has led others to go further and become skeptical that a segmental mechanical problem with a disturbance of motion actually exists. a small number of studies on the validity of palpation for segmental motion or for segmental findings have reported questionable results. these studies have taken the form of randomized clinical trials of a single session of manual therapy manipulation, mobilization, and manual traction in which one group receives a single palpation - specific procedure and the other group receives the same procedure at sites distant from the target segment. the immediate clinical outcomes of these studies show no significant difference between groups, calling into question the need to identify a specific segment at all. the combination of 1 and 2 led some to suggest that the whole idea of a mechanical lesion is invalid and should be discarded. recently, classification - based approaches to treatment of spinal disorders based on apparently validated prediction rules (predicting positive outcome of treatment from symptom profiles) have been developed. some of these either exclude or downplay the results of palpatory examination for spinal hypomobility. on the other hand, some of them do the opposite and strongly emphasize the findings of motion palpation for spinal fixation. clinicians are now able to choose among these predictive models, with one option being to discard, or at least greatly downplay, the role of a mechanical lesion. a few recent studies on healthy subjects appear to indicate that cavitations occurring during spinal manipulations are not localized to the segment putatively identified as the lesion and as the target of the maneuver. this has been interpreted by some to mean that, even if a specific mechanical lesion does exist and even if it can be reliably identified in clinical assessment, such an exercise may be fruitless if the treatment can not match this level of specificity. the older challenge faced by the chiropractic profession was largely to the second half of our initial formulation of subluxation : the health - deleterious effects. our critics have persistently questioned the premise that chiropractic subluxations caused anything more important than local, benign pain. the entire historical chiropractic project of attaching health - significant effects to subluxation (such as the association of chiropractic college 's statement including the phrase that compromise neural integrity and may influence organ system function and general health) was challenged by these critics. the newer challenge is now to the first part of our statement : a subluxation is a mechanical problem in the musculoskeletal system. recent research appears to challenge this premise as well ; and some, within and outside of the profession, have adopted a completely skeptical view of the entire subluxation project. if it does n't exist in the first place, they say, how can it have any effects ? if we ca n't find it, why look for it and why include it in our clinical decision - making ? if we ca n't localize our treatment to one segment, why be concerned to do so ? these challenges to the subluxation concept are in their early days and, in many instances, are based on only one or a few studies. in several instances, these studies have involved healthy subjects or those with relatively mild symptom severity. in several studies, the manual therapy intervention might be regarded as nonspecific and, therefore, would not qualify as an adjustment. on the other hand, critiques could be made of the quality of many of the studies that formed the basis for what might be called the standard model in chiropractic and the other manual therapy professions, including those which extend back several decades. indeed, some of the modern challenges, especially in the area of manual diagnostic procedures, appear to derive precisely from the poorer quality of prior studies. the only way forward is to strengthen our efforts to investigate the subluxation concept with high - quality scientific studies including animal models and human clinical studies. | objectivethis article presents a personal view of the historical evolution of theories of subluxation in the chiropractic profession.discussiontwo major themes emerge from this review : those related to the mechanical behavior of the spine and those related to the neurologic implications of these mechanical issues. chiropractic subluxation theory is one of the few health - related theories whereby these mechanical and neurologic theories have been unified into a comprehensive theory of disorder of spinal function. for this disorder, doctors of chiropractic have used the term subluxation. these theories, and their unification in the subluxation concept, have undergone evolution in the profession 's history.conclusionthe subluxation concept currently faces challenges, which are briefly reviewed in this article. the only way forward is to strengthen our efforts to investigate the subluxation concept with high - quality scientific studies including animal models and human clinical studies. |
condylar hyperplasia (ch) is a rare malformation of non - neoplastic origin involving size and morphology of one of the two mandibular condyles. this growth abnormality is usually unilateral and generally observed in patients between 10 and 30 years of age with no reported race and sex predilection. the enlargement of condyle results in unilateral elongation of face with deviation of the chin to the contra lateral side. ch of the mandible is a state of overdevelopment that can lead to facial asymmetry, mandibular deviation, malocclusion and articular dysfunction. the disorder is self - limiting, but as long as it remains active, the asymmetry progresses together with the associated occlusal changes. the etiology of the unilateral hyperplasia of the condyle is still under discussion. in the literature, local circulatory problems, endocrine disturbances, traumatic lesions and arthrosis are considered to be etiologic factors of this pathosis. the present case report is about a 17-year - old male patient who was reported with the complaint of gradually developing asymmetry of the right side of the face for past 1 year [figures 1 and 2 ]. his history revealed developing asymmetry of the entire right side of the face which he had noticed from a self - photograph. mandibular deviation toward the left side and overgrowth were noticed 1 year before and progressed slowly until it reached present proportion. he also developed pain in the right temporomandibular joint (tmj) region while opening the mouth for past 3 months. there was no history of trauma, any systemic diseases, infection, or surgery of the face and jaws. extra oral photograph showing facial asymmetry and deviation to the left photograph showing bowing of the mandibular body extra oral examination revealed facial asymmetry due to downward displacement of the entire right mandible and increase in the vertical height of the middle and lower facial thirds on the right side. there was a significant deviation of chin to the left side and slight downward tilt in lip line toward the right side [figure 1 ]. there was mild tenderness in his tmjs bilaterally and clicking was heard during movement of the right tmj. intraoral examination revealed slight shift of the mandibular midline toward the left side [figure 3 ]. intra oral photograph showing mild deviation of the mandibular midline to the contralateral side orthopantamograph revealed significant uniform enlargement of the mandibular condyle and elongation and thickening of condylar neck in the right side, comparatively normal condyle of the left side [figure 4 ]. the right gonial angle was characteristically rounded off and the mandibular canal was displaced to the lower border of the mandible right side. 3d - ct apparently showed differences in the size of both condylar heads as well as elongation of the neck of the mandibular condyle right side [figures 5 and 6 ]. clinical and radiographic findings were consistent with a diagnosis of unilateral ch of the right side. the panoramic radiograph view showing great discrepancy in size and morphology between the right and left condyles, along with a uniform enlargement of right condylar head and neck axial computed tomography picture showing enlarged right condylar head 3d - computed tomography picture showing uniform enlargement of the right condylar head and neck ch resulting in facial asymmetry is not only an esthetic problem for an individual, but also a functional disturbance to the tmjs and occlusion. ch of the tmj is a rare pathology that was first described by adam 's in 1836 as overgrowth of the mandibular condyle ; comparable pathology has not been described in any other joint. ch can be considered to be the end result of primary cartilage formation and secondary bone replacement. previous authors have debated whether intrinsic or extrinsic factors regulate the growth of the condyle. the traditional view was that the cartilage of the condyle mimics the epiphyseal cartilage of long bones ; therefore the condyle is the primary growth center of the mandible. an alternative view is that the condyle is just like other parts of the mandible in terms of growth capability ; with the only difference being chondrogenesis takes place in the periosteum that covers the head of the condyle. the degree of vascularity of the tissue and the presence of mechanical stress may initiate chondrogenesis or osteogenesis of the periosteum. based on these theories, local circulatory problems, previous trauma, hormonal disturbances, abnormal loading and cartilaginous exostosis have been suggested as possible etiologic factors. obwegeser and makak proposed three types of ch, based on radiographic and clinical characteristics : hemimandibular hyperplasia (hh), it includes enlargement of condyle, condylar neck, ramus and body with tilting of the occlusal plane ; hemimandibular elongation (he), it includes, condylar neck enlargement and variable displacement of the ramus and body without tilting the occlusal plane ; and ch, hyperplasia of condyle alone. in a study by chen. suggested that the term ch should not be used to refer to either hh or he. prominent features of ch include an enlarged mandibular condyle, elongated condylar neck, outward bowing and downward growth of the body and ramus of the mandible on the affected side, causing fullness of face on that side and flattening of face on the contralateral side. this deformity has been classified in to two groups by normann and painter, the first group includes patients who having an active hyperplastic growth, whereas the second is characterized by a stable situation in which the abnormal growth is completed. if the deformity has occurred before growth is complete the occusal plane is usually slanted because of dental compensation, whereas posterior open bite is usually apparent if the deformity occurs after completion of growth. most studies have found that ch occurs between ages 10 and 30 years and it has been suggested that the abnormal growth of the hyperplasia ceases with that general growth and that hh occurs at significantly younger age.. attention to the patient 's primary complaint is important for the early diagnosis of ch. almost one - third of the patients complained not about asymmetry, but rather about swelling on the contra lateral side, pain and dysfunction ; therefore attention must be paid to facial asymmetry even when it is not among the patient complaints. although clinical signs may suggest ch, a radiological examination showing elongation of the neck and head of the condyle is necessary for a definitive diagnosis. lateral cephalometric radiographs and the linear and angular measurements from the radiographs would provide information to determine whether maxilla or other facial and skull bone are involved. posteroanterior cephalometric projections are useful for detection of a horizontal shift of the mandibular midline. however, regular pantomograhs seem to add more value in the determination of patients with this condition. bone scanning is a non - invasive technique to evaluate whether the hyperplastic growth is still active ; commonly 99 technetium phosphate is used. histopathologically, widening of the fibrocartilage that covers the condyle, a wide richly vascularized proliferation zone enriched with large cells near its bony aspect and osteoclasts in the lacunae between new trabeculae formed by surrounding osteoclasts can be observed. when evaluating a patient with unilateral ch, numerous entities have to be considered in the differential diagnosis. in our case, hemifacial hypertrophy is distinguishable due to the absence of enlargement of soft - tissue structures of the right side of the face. osteochondroma and osteoma are distinguishable due to the presence of uniform enlargement of condylar head and neck in our case. hh and elongation are distinguishable due to the absence of ramus enlargement on the affected side. if the bone was deemed to be inactive the treatment was to have been bilateral sagittal split mandibular osteotomies, possibly combined with a maxillary le fort i osteotomy if it appeared that the maxilla had shifted to compensate for the shifted occusal plane of the mandible. if the growth was found to be active, the treatment would have been a high condylectomy to remove the growth site, combined with further mandibular osteotomies if there was still asymmetry. if a condylectomy is performed in an inactive case there is an undue and unnecessary disruption of the tmj and conversely if osteotomies are done on an active condyle there is a possibility of further deformity, resulting in failure of the realignment. knowledge about such unique unusual cases give information to clinician for early diagnosis and management. unilateral ch is an uncommon condition which can result into unesthetic look and various clinical problems. | condylar hyperplasia is (ch) an uncommon malformation of the mandible involving change in size and morphology of the condylar neck and head. ch is an anomaly that usually occurs unilaterally and equally affects in both men and women. hyperplasia of the condyle differentiated into hemimandibular hyperplasia, hemimandibular elongation and ch. here, we are presenting a case of 17-year - old male patient with unilateral ch and its review of the literature. |
we drew a diagram of the typical life course of subjects in an occupational cohort (fig. 1) and identified 10 occupational cohort time scales (table 1). knowing some of these 10 time scales was linked by equations of the form a = b + c, we compiled a complete list of these equations (table 1). we termed each of these 10 equations a relational triad. observing that each time scale is incorporated into three relational triads we termed this structure the time scale web. the time scale web : interrelationships between occupational cohort time scale relational triads plus their connection via tenure to the exposure variable relational triad. we explored how constraints on the ranges of date of hire and age at hire influenced the correlation between date of birth and age at hire by constructing a synthetic cohort with an arbitrary range of date of hire of 100 years, 1901 to 2000. in each of these years, we hired 70 subjects, one each with a hire age from 15 to 84 years, thus ensuring that in the overall data there was zero correlation between date of hire and age at hire. because subjects had been given year of hire and age at hire only in whole years, a random number between 0 and 1 was added to each to specify a date and age within that year. for example, a subject assigned date of hire 1990 and age at hire 43 years might be further specified as 1990.64921 and 43.22577 by the addition of the random numbers. we calculated date of birth as date of hire age at hire, and then calculated the correlation between date of birth and age at hire over several ranges of date of hire and three ranges of age at hire (fig. we also used an occupational cohort5 database supplied by the national institute for occupational safety and health (cincinnati, oh) under a data use agreement to ascertain the range of date of hire and age at hire for several beryllium materials manufacturing facilities and calculated for each the correlation between date of birth and age at hire. we applied the facility ranges of date of hire and age at hire as constraints on the synthetic cohort and calculated for each combination the correlation of date of birth with age at hire. we then compared the correlations derived from the synthetic cohort with the actual correlations (table 2) as a demonstration of how constraints on time scales in relational triads influence the correlation between the time scales. example of how constraints on time scale variables in relational triads affects correlations : correlation in a synthetic cohort of date of birth with age at hire for different ranges of date of hire and age at hire. we prepared a diagram to illustrate how tenure, average exposure, and cumulative exposure change with time, and how this process is reversed by progressive lagging of exposure (increasing lag time) (fig. 4). to illustrate how lagging exposure creates an association between time from hire and lagged exposure, we calculated in the controls in the sanderson study the correlation between lagged cumulative exposure and time from hire for lag 0, 10, and 20 years (table 3). to assist with the case example we constructed a causal diagram to represent the progression of thinking (fig. 5) and calculated the effect of adjustment with quartiles of several time scale variables on the odds ratios for quartiles of cumulative exposure lagged 10 years (table 4). how lagging affects exposure metrics this figure, from left to right, depicts in causal diagram format, the progression of thinking regarding possible confounders in the study of sanderson. the first two paths (solid lines) were contemplated by sanderson, the third starting with y (fine dotted lines) was added by schubauer - berigan, and the path on the right (coarse segmented lines) by this study. rank = rank order correlation (spearman = pearson r of the ranks) ; pm = product moment correlation (pearson r) ; ln = natural logarithm of data after 0.1 substituted for zero. from fig. 1 we identified 10 occupational cohort time scales (table 1). we were able to identify 10 relational triads with each time scale occurring in three relational triads (table 1). the connections between the relational triads by their common time scales form the time scale web, an arrangement of which is diagrammed in fig. as each time scale in a relational triad participates in two other relational triads, each relational triad can be connected via the corner timescales to six other triads. figure 2 also depicts the connection via tenure of the time scales to the multiplicative exposure relational triad, cumulative exposure = tenure average exposure. if one time scale in a relational triad is constrained to a narrow range, the other two become highly correlated. for example, in the relational triad date of hire = date of birth + age at hire, if the range of age at hire is narrow, as it might be in military recruits, the correlation between date of hire and date of birth would be high. to illustrate this we created a synthetic cohort and calculated the correlation between date of birth and age at hire for various combinations of range of date of hire and age at hire, demonstrating that the correlation increases with decreasing range of date of hire and with increasing range of age at hire (fig. that this is primarily influenced by constraint of the ranges of the time scales rather than by the detail of the respective distributions is illustrated by the agreement between correlations from real5 and synthetic cohorts (table 2). in analyses in which controls are selected by risk set sampling, it is usual practice to truncate the experience of controls as of the time scale value for the case.6 for example, if the time scale for risk set selection is age at censor of the case, information for controls matched to each case will be considered only up to the age at censor of the case. in the case example below, if the age at censor of the case were 65, with truncation the truncated age at censor for the case 's five controls would also be 65 years. therefore, in each case control set, age at censor is set equal for the case and all controls, so the correlation of the other time scales in each of the three relational triads containing age at censor becomes 1.0 or 1.0. thus, the correlation in each case control set between date of birth and date of censor is 1.0, between age at hire and time from hire is 1.0, and between age at termination and time from termination is 1.0 lagging exposure is a form of further truncation of exposure. lagging is performed under the assumption that exposure occurring during the period between the induction7 and the detection of disease does not contribute to the observed disease and that counting this exposure introduces error through misclassification of exposure. as lag time 4) no change in exposure occurs until lag time equals time from termination. at this point tenure decreases linearly with increasing lag time, cumulative exposure also decreases, although not necessarily linearly, and average exposure may or may not change. for a given lag time, exposure profiles with greater time from termination will have less truncation of tenure and cumulative exposure. profiles with time from hire greater than the lag time will avoid all exposure lagging to zero. the result is that, with lagging, the correlations between both time from termination and lagged exposure and time from hire and lagged exposure move in a positive direction. this phenomenon is illustrated by comparing the correlation between time from hire and exposure lagged 0, 10, or 20 years in the controls in the sanderson study (table 3). note that log transformation of the lagged exposure variable markedly influences the product moment correlation. the sanderson study of beryllium exposure and lung cancer was a case control study nested within an occupational cohort. the cohort consisted of subjects who had worked at least 2 days in a beryllium materials production factory between january 1, 1940, and december 31, 1969. this cohort was followed through 1992 for mortality with 142 deaths from lung cancer being identified. for each lung cancer death, five controls were randomly selected from the set of study subjects who had a date of hire less than the age at censor (death) of each case and an age at censor equal to or greater than the case 's age at censor. the controls for each case had their experience truncated at the case 's age at censor. exposure metrics (tenure, cumulative, average, and maximum) were created for lag times of 0, 10, and 20 years. one was to compare the geometric means of the exposure variables in cases and controls. the other was to use conditional linear logistic regression to identify odds ratios associated with exposure quartile categories. unmeasured factors (x) create an association between age at censor and lung cancer. age at censor was considered a potential confounder and was controlled via the age at censor risk set matching procedure for controls. second, exposure profiles were modified using lag time to create several lagged exposure variables as putative causes of lung cancer. schubauer - berigan added a second time scale to the causal diagram (fig. 5) on the basis that unspecified factors (y) created a demonstrable association between the date of birth and lung cancer. date of birth was considered to be a confounder of the lagged exposure lung cancer relationship and addition of date of birth to the analysis, using quartile categories, importantly changed the odds ratios for lagged exposure categories. for instance, for cumulative exposure lagged 20 years, the estimates for odds ratios for quartiles of cumulative exposure were 1.0, 2.18, 1.89, and 1.89 from lowest exposure to highest without control of date of birth and were 1.0, 1.46, 1.29, and 1.30 after adjustment with date of birth quartiles. age at hire quartile categories alone (without date of birth in the model) changed the cumulative exposure categories, lagged 20 years, slightly more, to 1.0, 1.37, 1.21, and 1.19, respectively. no separate rationale was developed for age at hire being a confounder other than the correlation between date of birth and age at hire of 0.906. no open association path was specified for either date of birth or age at hire that linked to both lung cancer and lagged exposure. first, we added time from hire as a third determinant of lagged exposure (fig. this variable was added as the result of the demonstration that lagging exposure creates an association between lagged exposure and time from hire (table 3). 2) to identify potential time scale association paths linking date of birth with time from hire. date of birth is in three relational triads, so there are six time scales, which could form a one - stop path from date of birth to time from hire. two, age at termination and date of termination, do not share a relational triad with time from hire. among the four that do share a relational triad with time from hire, age at censor al1 study, control subject 's date of hire is weakly correlated with both date of birth and time from hire, whereas both age at hire and date of censor are strongly correlated with both (table 4). adjustment of the odds ratios for quartiles of cumulative exposure lagged 10 years with quartiles of date of birth reduces the odds ratios. adjustment with quartiles of time from hire, age at hire, and date of censor reduces the cumulative exposure odds ratios further. consistent with its low correlation with date of birth and time from hire, adjustment with date of hire has no effect on the cumulative exposure lagged 10 years odds ratios. these findings support the hypotheses that two paths in the time scale web, lung cancer date of birth date of censor time from hire lagged exposure, function as important association paths (fig. from fig. 1 we identified 10 occupational cohort time scales (table 1). we were able to identify 10 relational triads with each time scale occurring in three relational triads (table 1). the connections between the relational triads by their common time scales form the time scale web, an arrangement of which is diagrammed in fig. as each time scale in a relational triad participates in two other relational triads, each relational triad can be connected via the corner timescales to six other triads. figure 2 also depicts the connection via tenure of the time scales to the multiplicative exposure relational triad, cumulative exposure = tenure average exposure. if one time scale in a relational triad is constrained to a narrow range, the other two become highly correlated. for example, in the relational triad date of hire = date of birth + age at hire, if the range of age at hire is narrow, as it might be in military recruits, the correlation between date of hire and date of birth would be high. to illustrate this we created a synthetic cohort and calculated the correlation between date of birth and age at hire for various combinations of range of date of hire and age at hire, demonstrating that the correlation increases with decreasing range of date of hire and with increasing range of age at hire (fig. 3). that this is primarily influenced by constraint of the ranges of the time scales rather than by the detail of the respective distributions is illustrated by the agreement between correlations from real5 and synthetic cohorts (table 2). in analyses in which controls are selected by risk set sampling, it is usual practice to truncate the experience of controls as of the time scale value for the case.6 for example, if the time scale for risk set selection is age at censor of the case, information for controls matched to each case will be considered only up to the age at censor of the case. in the case example below, if the age at censor of the case were 65, with truncation the truncated age at censor for the case 's five controls would also be 65 years. therefore, in each case control set, age at censor is set equal for the case and all controls, so the correlation of the other time scales in each of the three relational triads containing age at censor becomes 1.0 or 1.0. thus, the correlation in each case control set between date of birth and date of censor is 1.0, between age at hire and time from hire is 1.0, and between age at termination and time from termination is 1.0 lagging is performed under the assumption that exposure occurring during the period between the induction7 and the detection of disease does not contribute to the observed disease and that counting this exposure introduces error through misclassification of exposure. as lag time 4) no change in exposure occurs until lag time equals time from termination. at this point tenure decreases linearly with increasing lag time, cumulative exposure also decreases, although not necessarily linearly, and average exposure may or may not change. when lag time = time from hire, all exposure metrics become zero. for a given lag time, exposure profiles with greater time from termination will have less truncation of tenure and cumulative exposure. profiles with time from hire greater than the lag time will avoid all exposure lagging to zero. the result is that, with lagging, the correlations between both time from termination and lagged exposure and time from hire and lagged exposure move in a positive direction. this phenomenon is illustrated by comparing the correlation between time from hire and exposure lagged 0, 10, or 20 years in the controls in the sanderson study (table 3). note that log transformation of the lagged exposure variable markedly influences the product moment correlation. the sanderson study of beryllium exposure and lung cancer was a case control study nested within an occupational cohort. the cohort consisted of subjects who had worked at least 2 days in a beryllium materials production factory between january 1, 1940, and december 31, 1969. this cohort was followed through 1992 for mortality with 142 deaths from lung cancer being identified. for each lung cancer death, five controls were randomly selected from the set of study subjects who had a date of hire less than the age at censor (death) of each case and an age at censor equal to or greater than the case 's age at censor. the controls for each case had their experience truncated at the case 's age at censor. exposure metrics (tenure, cumulative, average, and maximum) were created for lag times of 0, 10, and 20 years. one was to compare the geometric means of the exposure variables in cases and controls. the other was to use conditional linear logistic regression to identify odds ratios associated with exposure quartile categories., unmeasured factors (x) create an association between age at censor and lung cancer. age at censor was considered a potential confounder and was controlled via the age at censor risk set matching procedure for controls. second, exposure profiles were modified using lag time to create several lagged exposure variables as putative causes of lung cancer. schubauer - berigan added a second time scale to the causal diagram (fig. 5) on the basis that unspecified factors (y) created a demonstrable association between the date of birth and lung cancer. date of birth was considered to be a confounder of the lagged exposure lung cancer relationship and addition of date of birth to the analysis, using quartile categories, importantly changed the odds ratios for lagged exposure categories. for instance, for cumulative exposure lagged 20 years, the estimates for odds ratios for quartiles of cumulative exposure were 1.0, 2.18, 1.89, and 1.89 from lowest exposure to highest without control of date of birth and were 1.0, 1.46, 1.29, and 1.30 after adjustment with date of birth quartiles. age at hire quartile categories alone (without date of birth in the model) changed the cumulative exposure categories, lagged 20 years, slightly more, to 1.0, 1.37, 1.21, and 1.19, respectively. no separate rationale was developed for age at hire being a confounder other than the correlation between date of birth and age at hire of 0.906. no open association path was specified for either date of birth or age at hire that linked to both lung cancer and lagged exposure. first, we added time from hire as a third determinant of lagged exposure (fig. this variable was added as the result of the demonstration that lagging exposure creates an association between lagged exposure and time from hire (table 3). 2) to identify potential time scale association paths linking date of birth with time from hire. date of birth is in three relational triads, so there are six time scales, which could form a one - stop path from date of birth to time from hire. two, age at termination and date of termination, do not share a relational triad with time from hire. among the four that do share a relational triad with time from hire, age at censor the sanderson study, control subject 's date of hire is weakly correlated with both date of birth and time from hire, whereas both age at hire and date of censor are strongly correlated with both (table 4). adjustment of the odds ratios for quartiles of cumulative exposure lagged 10 years with quartiles of date of birth reduces the odds ratios. adjustment with quartiles of time from hire, age at hire, and date of censor reduces the cumulative exposure odds ratios further. consistent with its low correlation with date of birth and time from hire, adjustment with date of hire has no effect on the cumulative exposure lagged 10 years odds ratios. these findings support the hypotheses that two paths in the time scale web, lung cancer date of birth date of censor time from hire lagged exposure, function as important association paths (fig. the lessons from the structure of occupational cohort time scales and the case example are several. first is that, in addition to developing a rationale for possible confounders through their association with disease, it is also worthwhile to look for possible confounders through association with exposure. lagging exposure modifies the association of time scales time from hire and time from termination with exposure. second is that a time scale web is created by the relational triads and their interconnections (fig. 2). the many paths connecting time scales in the web are always present in any occupational cohort study. the question in any study is can an open path connect exposure with disease, and if so, how long is the path and how large are the associations in each step of the path ? we found it useful to calculate a correlation matrix between all 10 time scales and the exposure variables. the usefulness of this increased greatly when we could place the correlations in the context of relational triads and their connections in the web. third is that both the relational triads and their web structure imply that with more than one time scale in an analysis or otherwise controlled, other time scales may be involved in the analysis. specific values for any two time scales in a relational triad will calculate a value for the third. thus, if two are in an analysis, for instance, date of birth and age at censor, so is the third, date of censor. extending this, if certain combinations of three time scales are in an analysis, two in one relational triad and one in a connected relational triad, a total of six time scale variables can be calculated and are therefore represented. for example, with date of birth and age at censor, which imply a value for date of censor, the addition of date of hire implies values for age at hire and time from hire, for a total of six time variables included. addition of any one of the remaining four time scale variables allows the calculation of all 10, implying that with certain combinations of four time scales in an analysis all 10 are included. it can be inferred from the property that certain combinations of four time scale variables will calculate values for all 10 that there are only four pieces of information among the 10. this conclusion seems obvious when the four time scales are, for example, date of birth, date of hire, date of termination, and date of censor, or date of birth, age at hire, age at termination, and age at censor, but seemingly odd combinations also suffice, for instance, tenure, time from termination, date of censor, and age at termination, the difference between the first two and the third is that in the first two all 10 time scales can be calculated directly from the four, whereas in the third intermediate calculations are required. besides obscure confounding, there is another mechanism through which relational triads and their connections may complicate epidemiologic analyses. in a second example, the approach to analysis of occupational cohort data was to stratify by age and date in 5-year intervals and assess risk per person year within these restricted categories.9 as one definition of age at censor and date of censor is the age and date used in an analysis, we will use these terms. constraint of age at censor and date of censor to 5-year intervals constrains possible date of birth to 10-year intervals. using fig. 2 to identify the six relational triads connected to age at censor, date of censor, and date of birth, three contain combinations of date of hire, age at hire, and time from hire, and three contain combinations of date of termination, age at termination, and time from termination. taking the former, it would be expected that date of hire, age at hire, and time from hire would be very highly correlated with each other. suppose then one performed analyses of disease risk with each and found a sharp rise in disease risk with increasing time from hire, a sharp fall in risk with increasing date of hire, and a sharp fall in risk with increasing age at hire. one could interpret the first as a latency effect, suggesting exposure - disease causality, the second as (assuming falling levels of exposure with time) an exposure - response causal effect, and the third as an age - susceptibility effect, also supporting an inference of a causal effect of the workplace exposure. the high correlation between the three time scale variables time from hire, date of hire, and age at hire ensures that the three analyses are not independent of one another and renders ambiguous any inference about which association was the driver of the effect. it is not generally recognized how lagging exposure and log transformation of exposure variables can modify associations of time from hire and time from termination with exposure variables. exploratory analysis with different lag times and with untransformed and log transformed exposure variables, where demonstration of an association between exposure and disease is the desired outcome, carries the risk that either or both combined can activate association paths in the time scale web and introduce obscure confounding. this is the lesson of the case example. in an analysis,1 in which geometric means of exposure variables were compared between cases and controls, the combination of lagging and the log transformation implicit in geometric means activated the time from hire age at hire / date of censor date of birth confounding paths also. very different results and interpretations would have been reached if means of un - log transformed exposure variables had been compared (data not shown). similarly, lagging alone creates strong rank correlation of time from hire with lagged exposure and thereby activated the time from hire age at hire / date of censor date of birth confounding paths for ordinal category analyses. because these paths were not obvious, when the desired outcome, demonstration of association between exposure and disease was observed it was accepted. time scales are often collapsed into ordinal categories, which would affect the precision of the relationships we have examined. we have not explored the behavior of relational triads when the time scales are categorical. for example, when date of birth and age at hire are in an analysis as categorical variables, to what extent is date of hire represented ? we also have not explored how the effects of constraint within strata of a variable translate to the overall effects. for example, in sanderson,1 within case control sets the correlation between time from hire and age at hire is 1.0, whereas across all the controls it is 0.73. we are unclear which value, 1.0 or 0.73, best characterizes the strength of the association for the purposes of understanding the strength of the association path. the property that inclusion of certain combinations of time scales implies the inclusion of others can be used to plan analyses to maximize efficiency and avoid redundancy. identification of hidden time scales can be accomplished by circling in the time scale web diagram the time scales desired to be included, determining which form a side on a relational triad, and identifying time scales, which occupy the third corner, and circling these, and so on. an example where this seems to have been done is an occupational cohort study of diesel exhaust carbon particle exposure and lung cancer,10 which clearly described the reason for including each time scale variable. in a proportional hazards model, date of hire, date of censor, age at censor, and tenure were included as adjustment variables. from the time scale web it can be deduced that these four allow the calculation of three more, and with these, all ten. furthermore, with tenure in the model, when either cumulative exposure or average exposure was examined, the multiplicative exposure relational triad included the other. thus, five variables visible in the model include all 12 in fig. 2, and there is no redundancy. the occupational cohort time scale relational triads and web can be used to identify potential cofounding. first, prepare a list of time scales likely associated with disease or exposure including when lagging exposure time from hire and time from termination. then, circling these on fig. 2 and identify connecting paths. these paths can be evaluated by calculating all 10 time scales for each subject and then constructing a correlation matrix containing all time scale variables and all exposure variables, including lagged variables. the next layer of inquiry is within the unit of analysis, for example, in the case example a case and its five controls, and in the second example sets of person years within sets bounded by 5-year by 5-year categories of age and date. the constraints inherent in the construction of the unit of analysis can be applied to the relational triads identified in the time scale web to infer partial correlations within the unit of analysis that may be stronger or weaker than those in the overall data. these inferred correlations can be used to evaluate potential association paths or ambiguity of interpretation. for the occupational physician wishing to critically evaluate a published paper with respect to time scales, a number of questions can be asked. the answers to these questions does the methods section describe which time scales are included in the analyses and why ? if this is not clear, it is quite possible the authors were unclear in their approach.if exposure was lagged, does the paper indicate whether time from hire and time from termination were considered as potential confounders?what is the unit of analysis and which time scales define that unit ? given these visible time scales, what hidden time scales can be deduced from the time scale web (fig. 2) to be included in the analysis?what are the constraints on the visible and hidden time scales in the analysis and what correlations can be inferred for the time scales forming the rest of the relational triads ? what time scales are possible sources of ambiguity of interpretation?what time scales not in the analysis (neither visible nor hidden) remain as potential confounders ? does the methods section describe which time scales are included in the analyses and why ? if this is not clear, it is quite possible the authors were unclear in their approach. if exposure was lagged, does the paper indicate whether time from hire and time from termination were considered as potential confounders ? what is the unit of analysis and which time scales define that unit ? given these visible time scales, what hidden time scales can be deduced from the time scale web (fig. 2) to be included in the analysis ? what are the constraints on the visible and hidden time scales in the analysis and what correlations can be inferred for the time scales forming the rest of the relational triads ? what time scales are possible sources of ambiguity of interpretation?what time scales not in the analysis (neither visible nor hidden) remain as potential confounders ? what time scales not in the analysis (neither visible nor hidden) remain as potential confounders ? the property that inclusion of certain combinations of time scales implies the inclusion of others can be used to plan analyses to maximize efficiency and avoid redundancy. identification of hidden time scales can be accomplished by circling in the time scale web diagram the time scales desired to be included, determining which form a side on a relational triad, and identifying time scales, which occupy the third corner, and circling these, and so on. an example where this seems to have been done is an occupational cohort study of diesel exhaust carbon particle exposure and lung cancer,10 which clearly described the reason for including each time scale variable. in a proportional hazards model, date of hire, date of censor, age at censor, and tenure were included as adjustment variables. from the time scale web it can be deduced that these four allow the calculation of three more, and with these, all ten. furthermore, with tenure in the model, when either cumulative exposure or average exposure was examined, the multiplicative exposure relational triad included the other. thus, five variables visible in the model include all 12 in fig. 2, and there is no redundancy. the occupational cohort time scale relational triads and web can be used to identify potential cofounding. first, prepare a list of time scales likely associated with disease or exposure including when lagging exposure time from hire and time from termination. these paths can be evaluated by calculating all 10 time scales for each subject and then constructing a correlation matrix containing all time scale variables and all exposure variables, including lagged variables. the next layer of inquiry is within the unit of analysis, for example, in the case example a case and its five controls, and in the second example sets of person years within sets bounded by 5-year by 5-year categories of age and date. the constraints inherent in the construction of the unit of analysis can be applied to the relational triads identified in the time scale web to infer partial correlations within the unit of analysis that may be stronger or weaker than those in the overall data. these inferred correlations can be used to evaluate potential association paths or ambiguity of interpretation. for the occupational physician wishing to critically evaluate a published paper with respect to time scales, a number of questions can be asked. the answers to these questions does the methods section describe which time scales are included in the analyses and why ? if this is not clear, it is quite possible the authors were unclear in their approach.if exposure was lagged, does the paper indicate whether time from hire and time from termination were considered as potential confounders?what is the unit of analysis and which time scales define that unit ? given these visible time scales, what hidden time scales can be deduced from the time scale web (fig. 2) to be included in the analysis?what are the constraints on the visible and hidden time scales in the analysis and what correlations can be inferred for the time scales forming the rest of the relational triads ? what time scales are possible sources of ambiguity of interpretation?what time scales not in the analysis (neither visible nor hidden) remain as potential confounders ? does the methods section describe which time scales are included in the analyses and why ? if this is not clear, it is quite possible the authors were unclear in their approach. if exposure was lagged, does the paper indicate whether time from hire and time from termination were considered as potential confounders ? what is the unit of analysis and which time scales define that unit ? given these visible time scales, what hidden time scales can be deduced from the time scale web (fig. 2) to be included in the analysis ? what are the constraints on the visible and hidden time scales in the analysis and what correlations can be inferred for the time scales forming the rest of the relational triads ? what time scales are possible sources of ambiguity of interpretation?what time scales not in the analysis (neither visible nor hidden) remain as potential confounders ? what time scales are possible sources of ambiguity of interpretation ? what time scales not in the analysis (neither visible nor hidden) remain as potential confounders ? occupational cohort time scales can be arranged as interconnected relational triads. understanding the properties of these relational triads and of the connecting time scale web is helpful in understanding the origins of otherwise obscure, but possibly strong, confounding bias, as well as ambiguities of interpretation. consideration of the interrelations between the occupational cohort time scales contributes to rational planning of use of time scales in analyses. recognition of the effect of lagging exposure and log transformation on the association of time scales time from hire and time from terminations with exposure aids identification of open association paths. | purpose : this study explores how highly correlated time variables (occupational cohort time scales) contribute to confounding and ambiguity of interpretation.methods:occupational cohort time scales were identified and organized through simple equations of three time scales (relational triads) and the connections between these triads (time scale web). the behavior of the time scales was examined when constraints were imposed on variable ranges and interrelationships.results:constraints on a time scale in a triad create high correlations between the other two time scales. these correlations combine with the connections between relational triads to produce association paths. high correlation between time scales leads to ambiguity of interpretation.conclusions:understanding the properties of occupational cohort time scales, their relational triads, and the time scale web is helpful in understanding the origins of otherwise obscure confounding bias and ambiguity of interpretation. |
gorlin syndrome is a rare genodermatosis with variable expressivity, associated with varied manifestations including multiple basal cell carcinomas and skeletal abnormalities. gorlin sign in ehler danlos syndrome, goltz gorlin syndrome for focal dermal hypoplasia and gorlin syndrome. gorlin syndrome also known as basal cell nevus syndrome (bcns) or nevoid basal cell carcinoma syndrome (nbccs) is an autosomal dominant genodermatosis characterized mainly by the presence of multiple basal cell carcinomas (bccs), jaw cysts, and palmoplantar pits.[13 ] it was first described by jarish and white in 1894 but its syndromic nature was not defined until 1960 ; defined by gorlin and goltz. a 60-year - old man, of low socioeconomic status presented with complaints of mole like skin lesions in his face, back, and scalp since childhood. there were multiple, discrete, pigmented, well defined, nontender mobile plaques and nodules of varying sizes present over the face, around eyelids, forehead, and scalp, and few on back [figure 1 ]. larger lesions were of size 3 - 4 cm over face having rolled out border and central ulceration covered with hemorrhagic crusts. multiple basal cell carcinomas over face on general examination the patient was of average built having kyphoscoliosis, macrocephaly, frontal bossing, broad depressed nasal bridge, high arched palate, [figure 2 ] and hypertelorism. skull x - ray and computed tomography (ct) scan brain showed calcification of falx cerebri but magnetic resonance imaging (mri) could not be done [figure 3 ]. ultrasonography of abdomen and pelvis were normal. in the next visit, after 6 months, patient had new similar lesions and older lesions over back had increased in size and causing discomfort. the larger lesions and few smaller lesions were excised, while rest lesions were treated with topical 5 fluorouracil (5-fu). retinoid in high dose and prolonged duration is a good agent for treatment and prevention of bcc, but could not be tried, looking at his economic status. bcns is an uncommon genodermatosis transmitted as an autosomal dominant trait exhibiting high penetrance and variable expressivity, mapped to chromosome 9q22.33.1. inherited or spontaneous mutations in the human homologue of drosophila patched gene underlie the disorder. due to variable expressivity this disorder is known to run in families with an equal frequency in both sexes. similar to the present case those who do not have any family members affected with bcns may comprise 60% of total bcns and 35 - 50% of these cases represent new mutations. the skin manifestations of multiple bccs in our case started in childhood and were around 8 to 10. this contrasts with classical presentation in which the tumors are innumerable and distributed in a bilaterally symmetrical manner. other cutaneous manifestations of the syndrome include milia, epidermal and sebaceous cysts, lipomas, and fibromas. multiple odontogenic keratocysts arising from the rests of dental lamina of the mandible and occasionally the maxillae are common in this disorder with a peak incidence in the second and third decade of life. these cysts may be complicated by the development of pathological fractures, amelobastomas, and squamous cell carcinomas and have a high rate of recurrence. small cysts may be asymptomatic and can be detected only by radiologically as in our case. they have their onset during the second decade and become more frequent with advancing age. it has been hypothesized that pits are a result of premature desquamation of most of the horny layer. in the skull there is early onset of calcification of falx cerebri, tentorium cerebri, dura, and choroids. bridging of sella turcica due to calcification of the diaphragm sellae is seen in 60 - 80% of patients. neurological abnormalities include agenesis of the corpus callosum, congenital hydrocephalus, mental retardation, medulloblastomas, and meningiomas. ophthalmological abnormalities seen are dystopia canthorum, internal strabismus, congenital blindness, and hypertelorism. other skeletal abnormalities include rib anomalies (splaying, synostosis, bifid, and cervical ribs), vertebral anomalies (block vertebra, hemivertebra, spina bifida occulta, and kyphoscoliosis), and shortening of the metacarpal and small flame lucency in phalanges. abnormalities of the reproductive system are ovarian and uterine fibromas in females and cryptorchidism and hypogonadism in males. other findings in bcns are mesenteric cysts, renal calculi, cardiac fibromas and a tendency to develop various other neoplastic lesions such as melanomas, neurofibromas, and rhabdomyosarcomas. the major diagnostic criteria include multiple bccs, odontogenic keratocysts, palmar and plantar pits, flare calcification, and a positive family history. the minor criteria are congenital skeletal anomalies (ribs, vertebra), macrocrania, cardiac or ovarian fibromas, medulloblastomas, lymphomesenteric cysts, and congenital malformations (i.e., cleft lip / palate, polydactyly, eye anomalies). the presence of 2 major or 1 major or 2 minor criteria is diagnostic of gorlin syndrome. our patient had four major (bccs, odontogenic cysts, palmoplantar pits, and falcine calcification) and one minor criteria (frontal bossing, kyphoscoliosis). the fact that its transmission is autosomal dominant with good penetrance and any child of an affected family is at 50% risk of carrying the affected gene implies the need of genetic counseling. we need to have a high index of suspicion to diagnose this rare syndrome as early diagnosis and genetic counseling could prevent consequences. we are presenting a rare classical case of gorlin syndrome with multiple numbers of major and minor features. | gorlin syndrome, a rare genodermatosis, otherwise known as nevoid basal cell carcinoma syndrome (nbccs) is a multisystem disease affecting skin, nervous system, eyes, endocrine glands, and bones. it is characterized by multiple basal cell carcinomas, palmoplantar pits, jaw cysts, and bony deformities like kyphoscoliosis and frontal bossing. we would like to report a case of gorlin syndrome with classical features, as this is a rare genodermatosis. |
botulinum neurotoxin a (bont a) is the first - line treatment for cervical dystonia (cd) and focal spasticity (simpson. the efficacy and safety of bont a has been demonstrated in numerous clinical studies leading to licensed use in many countries worldwide (costa. 2005 ; kamm and benecke 2011 ; simpson. 2008 ; ade - hall and moore 2000 ; truong and jost 2006 ; hallett. 2013 ; esquenazi. several studies (at least for upper and lower limbs) showed a low accuracy of muscle localization when using anatomical landmarks only (chin. 2005 ; molloy. 2002 ; schnitzler. 2012 ; yang. 2009 ; henzel. 2010). the accuracy of manual needle placement was not acceptable for the majority of target muscles. in consequence, it was concluded from these studies that ultrasound (us) could be considered as a valuable adjunct for muscle localization in patients with spasticity and that us can improve accuracy of bont a placement. however, to our knowledge, no studies have addressed the accuracy of needle placement in cervical muscles up to now. with us us is of special value as the injected muscles differ in size, and deep - seated muscles require a different approach compared to superficial muscles (fietzek. the us technique is already widely applied in neuropediatric care. for the treatment of spasticity injection control by us 2010). an improved clinical outcome could be demonstrated for us - guided bont a injections in children with cerebral palsy (kwon. 2010 ; py. 2009) and adults with spasticity after stroke compared to manual needle placement in two randomized controlled trials (picelli. 2012a, 2013). 2012a) showed a trend for superiority of us guidance compared to electrical stimulation. in another study, neither manual needle placement nor electrical stimulation showed complete accuracy when compared to us (picelli. in cervical dystonia, most clinical studies investigated the application of electromyography (emg). in these studies, nevertheless, a recent review did not show an overall better outcome compared to clinical muscle selection and anatomical needle placement (nijmeijer. for the application of us guidance in cervical dystonia, only very few publications of non - controlled studies or case reports in a low number of patients are available which refer mainly to deep, difficult accessible muscles, e.g., longus colli or obliquus capitis inferior (oci) (bhidayasiri 2011 ; fujimoto.. currently, there are no controlled comparative clinical studies of bont a injection according to anatomic landmarks versus sonography - guided injection in this indication. however, a recently published study although in a low number of patients with cervical dystonia provides evidence that us guidance of bont a injection in the sternocleidomastoid (scm) muscle could reduce the rate of dysphagia (hong. the authors concluded from their observations that recurrent dysphagia could reliably be eliminated by keeping the bont a solution within the scm. it is the aim of this review to discuss the application of us for injection control as well as the advantages and future perspectives of sonography - guided bont a injections in patients with cervical dystonia based on the available literature and our own experience. other techniques for injection control have been investigated in cervical dystonia, however several limitations have to be taken into account. although the use of computed tomography (ct) has been published in a small number of patients (bhidayasiri 2011 ; sung. 2007 ; lee. 2004), its use is limited to a clinical setting where ct is accessible. further on, ct is too expensive for frequent use in daily practice, it is not dynamic, and patients are exposed to radiation. despite comparable anatomic precision of ct and us, the latter displays the major drawback for its use in long - term treatment of patients with cervical dystonia. positron emission tomography (pet) has been used in two studies to identify hypermetabolic and presumably dystonic muscles, whereas injection was performed under ct or ultrasound guidance (sung. several studies have dealt with the use of emg for bont a injection in cervical dystonia. all these studies should be interpreted with caution as emg was simultaneously used for muscle selection. nevertheless, only one randomized controlled trial showed better results for combined emg selection and emg guidance compared to clinical muscle selection with anatomical needle placement (comella. a pooled analysis of 28 studies of which 17 used clinical evaluation to identify dystonic muscles and 11 used emg for selection, and guidance showed better results for the emg approach regarding pain reduction (40.3 vs.32.5 %). however, improvement was lower for emg compared to clinical evaluation for clinical rating scales like the tsui score (31.9 vs.43.7 %) (nijmeijer. it has to be taken into account that positioning of the emg needle in these approaches was performed according to anatomic landmarks. the placement of the emg needle tip into a specific muscle is thereby almost impossible to verify, as selective voluntary activation of neck muscles is not possible and might be additionally superimposed by dystonic activity from adjacent muscles. emg therefore serves more as a functional but not anatomical guidance as the assignment of emg activity to specific muscles is flawed by the same anatomic inaccuracy as needle placement according to anatomical landmarks. nevertheless, these shortcomings might be circumvented by combining emg with ultrasound guidance (see also below). finally searching for dystonic emg activity is associated with additional discomfort and pain for the patient and extra costs for the emg needle have to be taken into account. in cervical dystonia, electrical stimulation is not feasible because for neck muscles the response to the stimulus is not specific enough. although ct (but not emg) shows comparable anatomic precision as us, the latter is a non - invasive technique causing no additional discomfort for the patient nor exposing the patient to radiation or any further risks. us allows real - time visualization of muscles and the adjacent anatomical structures so that the entire injection procedure of bont a can be followed. availability of us in central europe neurological clinics is high as neurovascular ultrasound is part of clinical routine diagnostics and almost all clinicians are familiar with the us machine on - site. detailed recommendations on the technical requirements, procedure, and documentation of us - guided bont injection have been recently published (walter and dressler 2014). the obvious advantage of us is anatomic precision with accurate, safe, and optimal targeting of bont a injections in the affected muscles. with us figure 1 shows commonly injected muscles as the splenius capitis, sternocleidomastoideus, semispinalis capitis, and levator scapulae muscles (fig. 1a, b), as well as more difficult accessible, small, or deeper located muscles like the longus colli, longus capitis, scalene, and obliquus capitis inferior and superior muscles (fig. these neck muscles lie in close proximity to each other rendering false injections in adjacent muscles likely.. 1sonographic appearance of frequently injected muscles (mainly a, b) and more difficult accessible, small, or deeper located muscles (mainly c, d, e). muscles : ih infrahyoid, scm sternocleidomastoideus, sa scalenus anterior, smp scalenus medius posterior, lev levator scapulae, tra trapezius, sem semispinalis capitis, spl splenius capitis, oci obliquus capitis inferior, lc longissimus capitis, lco longus colli, lca longus capitis, rmi rectus capitis posterior minor, rma rectus capitis posterior major, and ocs obliquus capitis superior. others are ca carotid artery, bp brachial plexus, vc5 vertebra c5, rc5 root c5, and vn vagus nervetable 1relevance of ultrasonography (us) for injection of muscles in cervical dystoniamusclerelevance of us for muscle locationrelevance of us to avoid adverse reactions or injuriestypical injection errorsspecific adjacent anatomical structuresinfra-/suprahyoid muscles++++++severalsternocleidomastoideus+++ (dysphagia)carotid arterylongus colli / capitis++++++carotid artery, jugular vein, vagal nerve, phrenic nervescalene muscles++++++levator scapulaebrachial plexus, external jugular veinlevator scapulae+++scalenus posterior, splenius capitis (lower part), trapeziuslung apexsplenius capitis+ (injection often too deep)++ (weakness of neck extensors)semispinalis, longissimus, obliquus capitis inferiormight be frequently very thin during continuous treatmentlongissimus capitis / cervicis+++++splenius capitis, semispinalis, levator scapulaevertebral arterysemispinalis capitis / cervicis++splenius capitis, obliquus capitis inferior, trapeziusobliquus capitis inferior and small neck extensors++++++semispinalis capitis, other small neck musclesvertebral artery, n. occipitalis major, spinal canaltrapezius+levator scapulae ; splenius capitis, semispinalismight be frequently very thin, especially during continuous treatment sonographic appearance of frequently injected muscles (mainly a, b) and more difficult accessible, small, or deeper located muscles (mainly c, d, e). muscles : ih infrahyoid, scm sternocleidomastoideus, sa scalenus anterior, smp scalenus medius posterior, lev levator scapulae, tra trapezius, sem semispinalis capitis, spl splenius capitis, oci obliquus capitis inferior, lc longissimus capitis, lco longus colli, lca longus capitis, rmi rectus capitis posterior minor, rma rectus capitis posterior major, and ocs obliquus capitis superior. others are ca carotid artery, bp brachial plexus, vc5 vertebra c5, rc5 root c5, and vn vagus nerve relevance of ultrasonography (us) for injection of muscles in cervical dystonia the application of us as injection control avoids unintended muscle weakness due to diffusion of bont a into adjacent muscles and in consequence reduces the incidence of adverse reactions. this is especially important in cervical dystonia, as neck muscles might be small or thin and lie in close proximity to each other. 2012 report five cases of preselected patients who met criteria for cervical dystonia and subsequent dysphagia after emg - guided injections. the same might be especially true for avoidance of unintended weakness of neck extensor muscles. us is also indispensable when case - specific anatomic conditions are present such as obesity or very pronounced neck muscles. in addition, muscle atrophy can occur in consequence of previous treatments and even muscles like the splenius capitis or trapezius, which are usually injected without imaging guidance, can become very thin, thus putting the attending physician at risk to inject too deep. furthermore, the application of us helps to prevent injection errors in blood vessels and nerves as summarized in table 1. compared to injections in the extremities like in spasticity treatment, this might be of special importance in cd as injections in lateral cervical muscles bear a high risk for injuries of adjacent anatomical structures (e.g., carotid artery, thyroid truncus, internal and external jugular vein, vagal nerve, phrenic nerve, and brachial plexus). with injections in the dorsal neck region such as the obliquus capitis inferior muscle, the vertebral artery or the spinal canal can be erroneously injected. furthermore, sonography - guided injections may reduce the bleeding risk in patients receiving anticoagulant treatment. besides, anatomically precise injection of typically treated superficial muscles, us guidance enables injection of up to now not routinely treated deep cervical muscles, which contribute to a broad range of neck movements and are involved in complex forms of cervical dystonia (bhidayasiri 2011). these deep muscles include prevertebral muscles for primary neck flexion, lateral vertebral muscles for shoulder elevation, neck and head tilt, and a posterior group of muscles for neck extension (fig. some complex forms of cervical dystonia with involvement of deep cervical muscles are only poorly accessible by routine bont a therapy. table 1 provides an overview of the relevance of us for location of different muscles, which can be affected in patients with cervical dystonia. the implementation of more differentiated clinical concepts distinguishing between individual contributions of the distinct neck and head muscles (-collis/-caput concept, reichel 2011) gives rise to the need of a visualization method for precise differentiation and localization of the target muscle. the successful realization of this more realistic phenomenological approach is only feasible with highly controlled and precise us - guided injections. moreover, us guidance offers the potential for dose reduction and a decrease of the total number of injections / injected muscles factors that are potentially reducing the risk of producing neutralizing antibodies and therefore ensure long - term efficacy of bont a treatment in cervical dystonia. finally, us guidance ensures a highly standardized injection procedure resulting in a stable effect, better comparability between different injection sessions, and consistency in case of change of the treating physician. this circumstance is of special importance for cervical dystonia patients being treated for many years. a secondary but important effect of using us is the improvement of anatomical knowledge of the injecting physician. this is especially meaningful and indispensable for beginners who need to be trained in the specific and complex anatomy of neck muscles. however, consolidation of anatomical knowledge by applying us is also reasonable for experienced therapists. finally, even patients who are usually injected without us guidance may profit from improved anatomical understanding of the treating physician. currently, there are only a few practical drawbacks. the immediate availability of ultrasound equipment is not always and everywhere guaranteed, and there is a lack of reimbursement, especially in comparison to emg. the additional expenditure of time for application of us can be reduced by training programs. in general, efficacy of bont nevertheless, there is a potential for further improvements, and refined clinical and diagnostic concepts warrant prospective clinical studies. as an optimized bont a treatment is based on (a) accurate identification of involved muscles and (b) accurate injection of identified muscles, us guidance should be included in future studies to ensure standardized injection procedures as well as proper targeting of identified muscles. although diagnostic application of us for muscle identification is not within the scope of this review, us might be used for detection of muscle hypertrophy. furthermore, the combination of us and emg could overcome the shortcomings of emg regarding anatomic precision and would allow an accurate assignment of dystonic or tremulous activity to specific muscles (schramm. other techniques for injection control have been investigated in cervical dystonia, however several limitations have to be taken into account. although the use of computed tomography (ct) has been published in a small number of patients (bhidayasiri 2011 ; sung. 2007 ; lee. 2009 ; herting. 2004), its use is limited to a clinical setting where ct is accessible. further on, ct is too expensive for frequent use in daily practice, it is not dynamic, and patients are exposed to radiation. despite comparable anatomic precision of ct and us, the latter displays the major drawback for its use in long - term treatment of patients with cervical dystonia. positron emission tomography (pet) has been used in two studies to identify hypermetabolic and presumably dystonic muscles, whereas injection was performed under ct or ultrasound guidance (sung. several studies have dealt with the use of emg for bont a injection in cervical dystonia. all these studies should be interpreted with caution as emg was simultaneously used for muscle selection. nevertheless, only one randomized controlled trial showed better results for combined emg selection and emg guidance compared to clinical muscle selection with anatomical needle placement (comella. a pooled analysis of 28 studies of which 17 used clinical evaluation to identify dystonic muscles and 11 used emg for selection, and guidance showed better results for the emg approach regarding pain reduction (40.3 vs.32.5 %). however, improvement was lower for emg compared to clinical evaluation for clinical rating scales like the tsui score (31.9 vs.43.7 %) (nijmeijer. it has to be taken into account that positioning of the emg needle in these approaches was performed according to anatomic landmarks. the placement of the emg needle tip into a specific muscle is thereby almost impossible to verify, as selective voluntary activation of neck muscles is not possible and might be additionally superimposed by dystonic activity from adjacent muscles. emg therefore serves more as a functional but not anatomical guidance as the assignment of emg activity to specific muscles is flawed by the same anatomic inaccuracy as needle placement according to anatomical landmarks. nevertheless, these shortcomings might be circumvented by combining emg with ultrasound guidance (see also below). finally searching for dystonic emg activity is associated with additional discomfort and pain for the patient and extra costs for the emg needle have to be taken into account. in cervical dystonia, electrical stimulation is not feasible because for neck muscles the response to the stimulus is not specific enough. although ct (but not emg) shows comparable anatomic precision as us, the latter is a non - invasive technique causing no additional discomfort for the patient nor exposing the patient to radiation or any further risks. us allows real - time visualization of muscles and the adjacent anatomical structures so that the entire injection procedure of bont a can be followed. availability of us in central europe neurological clinics is high as neurovascular ultrasound is part of clinical routine diagnostics and almost all clinicians are familiar with the us machine on - site. detailed recommendations on the technical requirements, procedure, and documentation of us - guided bont injection have been recently published (walter and dressler 2014). the obvious advantage of us is anatomic precision with accurate, safe, and optimal targeting of bont a injections in the affected muscles. with us, figure 1 shows commonly injected muscles as the splenius capitis, sternocleidomastoideus, semispinalis capitis, and levator scapulae muscles (fig. 1a, b), as well as more difficult accessible, small, or deeper located muscles like the longus colli, longus capitis, scalene, and obliquus capitis inferior and superior muscles (fig. these neck muscles lie in close proximity to each other rendering false injections in adjacent muscles likely. table 1 displays typical injection errors and summarizes the clinical experiences from the authors.fig. 1sonographic appearance of frequently injected muscles (mainly a, b) and more difficult accessible, small, or deeper located muscles (mainly c, d, e). muscles : ih infrahyoid, scm sternocleidomastoideus, sa scalenus anterior, smp scalenus medius posterior, lev levator scapulae, tra trapezius, sem semispinalis capitis, spl splenius capitis, oci obliquus capitis inferior, lc longissimus capitis, lco longus colli, lca longus capitis, rmi rectus capitis posterior minor, rma rectus capitis posterior major, and ocs obliquus capitis superior. others are ca carotid artery, bp brachial plexus, vc5 vertebra c5, rc5 root c5, and vn vagus nervetable 1relevance of ultrasonography (us) for injection of muscles in cervical dystoniamusclerelevance of us for muscle locationrelevance of us to avoid adverse reactions or injuriestypical injection errorsspecific adjacent anatomical structuresinfra-/suprahyoid muscles++++++severalsternocleidomastoideus+++ (dysphagia)carotid arterylongus colli / capitis++++++carotid artery, jugular vein, vagal nerve, phrenic nervescalene muscles++++++levator scapulaebrachial plexus, external jugular veinlevator scapulae+++scalenus posterior, splenius capitis (lower part), trapeziuslung apexsplenius capitis+ (injection often too deep)++ (weakness of neck extensors)semispinalis, longissimus, obliquus capitis inferiormight be frequently very thin during continuous treatmentlongissimus capitis / cervicis+++++splenius capitis, semispinalis, levator scapulaevertebral arterysemispinalis capitis / cervicis++splenius capitis, obliquus capitis inferior, trapeziusobliquus capitis inferior and small neck extensors++++++semispinalis capitis, other small neck musclesvertebral artery, n. occipitalis major, spinal canaltrapezius+levator scapulae ; splenius capitis, semispinalismight be frequently very thin, especially during continuous treatment sonographic appearance of frequently injected muscles (mainly a, b) and more difficult accessible, small, or deeper located muscles (mainly c, d, e). muscles : ih infrahyoid, scm sternocleidomastoideus, sa scalenus anterior, smp scalenus medius posterior, lev levator scapulae, tra trapezius, sem semispinalis capitis, spl splenius capitis, oci obliquus capitis inferior, lc longissimus capitis, lco longus colli, lca longus capitis, rmi rectus capitis posterior minor, rma rectus capitis posterior major, and ocs obliquus capitis superior. others are ca carotid artery, bp brachial plexus, vc5 vertebra c5, rc5 root c5, and vn vagus nerve relevance of ultrasonography (us) for injection of muscles in cervical dystonia the application of us as injection control avoids unintended muscle weakness due to diffusion of bont a into adjacent muscles and in consequence reduces the incidence of adverse reactions. this is especially important in cervical dystonia, as neck muscles might be small or thin and lie in close proximity to each other. 2012 report five cases of preselected patients who met criteria for cervical dystonia and subsequent dysphagia after emg - guided injections.. the same might be especially true for avoidance of unintended weakness of neck extensor muscles. us is also indispensable when case - specific anatomic conditions are present such as obesity or very pronounced neck muscles. in addition, muscle atrophy can occur in consequence of previous treatments and even muscles like the splenius capitis or trapezius, which are usually injected without imaging guidance, can become very thin, thus putting the attending physician at risk to inject too deep. furthermore, the application of us helps to prevent injection errors in blood vessels and nerves as summarized in table 1. compared to injections in the extremities like in spasticity treatment, this might be of special importance in cd as injections in lateral cervical muscles bear a high risk for injuries of adjacent anatomical structures (e.g., carotid artery, thyroid truncus, internal and external jugular vein, vagal nerve, phrenic nerve, and brachial plexus). with injections in the dorsal neck region such as the obliquus capitis inferior muscle, the vertebral artery or the spinal canal can be erroneously injected. furthermore, sonography - guided injections may reduce the bleeding risk in patients receiving anticoagulant treatment. besides, anatomically precise injection of typically treated superficial muscles, us guidance enables injection of up to now not routinely treated deep cervical muscles, which contribute to a broad range of neck movements and are involved in complex forms of cervical dystonia (bhidayasiri 2011). these deep muscles include prevertebral muscles for primary neck flexion, lateral vertebral muscles for shoulder elevation, neck and head tilt, and a posterior group of muscles for neck extension (fig. some complex forms of cervical dystonia with involvement of deep cervical muscles are only poorly accessible by routine bont a therapy. table 1 provides an overview of the relevance of us for location of different muscles, which can be affected in patients with cervical dystonia. the implementation of more differentiated clinical concepts distinguishing between individual contributions of the distinct neck and head muscles (-collis/-caput concept, reichel 2011) gives rise to the need of a visualization method for precise differentiation and localization of the target muscle. the successful realization of this more realistic phenomenological approach is only feasible with highly controlled and precise us - guided injections. moreover, us guidance offers the potential for dose reduction and a decrease of the total number of injections / injected muscles factors that are potentially reducing the risk of producing neutralizing antibodies and therefore ensure long - term efficacy of bont a treatment in cervical dystonia. finally, us guidance ensures a highly standardized injection procedure resulting in a stable effect, better comparability between different injection sessions, and consistency in case of change of the treating physician. this circumstance is of special importance for cervical dystonia patients being treated for many years. a secondary but important effect of using us is the improvement of anatomical knowledge of the injecting physician. this is especially meaningful and indispensable for beginners who need to be trained in the specific and complex anatomy of neck muscles. however, consolidation of anatomical knowledge by applying us is also reasonable for experienced therapists. finally, even patients who are usually injected without us guidance may profit from improved anatomical understanding of the treating physician. the immediate availability of ultrasound equipment is not always and everywhere guaranteed, and there is a lack of reimbursement, especially in comparison to emg. the additional expenditure of time for application of us can be reduced by training programs. in general, efficacy of bont a treatment in cervical dystonia is high (e.g., costa. 2005 ; hallett. 2013). nevertheless, there is a potential for further improvements, and refined clinical and diagnostic concepts warrant prospective clinical studies. as an optimized bont a treatment is based on (a) accurate identification of involved muscles and (b) accurate injection of identified muscles, us guidance should be included in future studies to ensure standardized injection procedures as well as proper targeting of identified muscles. although diagnostic application of us for muscle identification is not within the scope of this review, us might be used for detection of muscle hypertrophy. furthermore, the combination of us and emg could overcome the shortcomings of emg regarding anatomic precision and would allow an accurate assignment of dystonic or tremulous activity to specific muscles (schramm. 2014). us is an increasingly available, non - invasive, and inexpensive method, which has clear advantages over other techniques for injection control in bont a treatment of cervical dystonia. it facilitates anatomically precise and reproducible injections in specific muscles, therefore carrying the potential of enhancing efficacy and safety of bont a treatment in cervical dystonia. it is a valuable method to improve anatomical knowledge and the quality of future clinical studies. the implementation of us guidance in clinical routine will also lead to an improvement of bont a injection schemes and our functional understanding in cervical dystonia, because only a precise injection in the target muscles allows judgement of the relevance of the respective muscles for the dystonic pattern. us therefore facilitates the correct identification of the functionality of muscles in relation to patient phenomenology. a valid concept of the role of different muscles in multidimensional movement disorders can only be developed if there is no doubt which muscles have really been injected or at least if the uncertainty can be reduced as far as possible. this has been pointed out by reichel (2011) in connection with the -caput/-collis concept using ct, but is applicable for sonography, as this method can be used repeatedly in patients without putting them at risk of radiation. therefore, from the perspective of the authors there is no convincing reason why us guidance for injection control should not become standard in bont a treatment of cervical dystonia. in conclusion, due to the advantages of us - guided bont a injections and the experience of the authors in clinical practice, the authors summarize their opinion as follows : beginners should learn the specific anatomy of neck muscles and exact targeting of bont a treatment by application of us.expertise in us guidance should be available at each bont a treatment center.in the opinion of the authors, the routine use of us injection guidance could be recommended in general.preferably, us guidance should be applied in the following cases : presence of individual anatomic conditions (pronounced neck muscles, atrophy, and obesity)occurrence of adverse events after bont a injections (especially dysphagia and unintended weakness)presence of complex dystonic patterns with a high probability of involvement of deeper located muscles which are more difficult to access (see tab. 1 ; relevance + + /+++).secondary non - responders without neutralizing antibodies against bont aus guidance should be included in future clinical studies. beginners should learn the specific anatomy of neck muscles and exact targeting of bont a treatment by application of us. expertise in us guidance should be available at each bont a treatment center. in the opinion of the authors, the routine use of us injection guidance could be recommended in general. preferably, us guidance should be applied in the following cases : presence of individual anatomic conditions (pronounced neck muscles, atrophy, and obesity)occurrence of adverse events after bont a injections (especially dysphagia and unintended weakness)presence of complex dystonic patterns with a high probability of involvement of deeper located muscles which are more difficult to access (see tab. 1 ; relevance + + /+++).secondary non - responders without neutralizing antibodies against bont a presence of individual anatomic conditions (pronounced neck muscles, atrophy, and obesity) occurrence of adverse events after bont a injections (especially dysphagia and unintended weakness) presence of complex dystonic patterns with a high probability of involvement of deeper located muscles which are more difficult to access (see tab. secondary non - responders without neutralizing antibodies against bont a us guidance should be included in future clinical studies. | botulinum neurotoxin a (bont a) is the first - line treatment for cervical dystonia. however, although bont a has a favorable safety profile and is effective in the majority of patients, in some cases the treatment outcome is disappointing or side effects occur when higher doses are used. it is likely that in such cases either the target muscles were not injected accurately or unintended weakness of non - target muscles occurred. it has been demonstrated in clinical trials for spastic movement disorders that sonography - guided bont a injections could improve treatment outcome. as the published evidence for a benefit of sonography - guided bont injection in patients with cervical dystonia is scarce, it is the aim of this review to discuss the relevance of sonography in this indication and provide a statement from clinical experts for its use. the clear advantage of sonography - guided injections is non - invasive, real - time visualization of the targeted muscle, thus improving the precision of injections and potentially the treatment outcomes as well as avoiding adverse effects. other imaging techniques are of limited value due to high costs, radiation exposure or non - availability in clinical routine. in the hands of a trained injector, sonography is a quick and non - invasive imaging technique. novel treatment concepts of cervical dystonia considering the differential contributions of distinct cranial and cervical muscles can reliably be implemented only by use of imaging - guided injection protocols. |
multiple synchronous lung carcinomas are not uncommon and the incidence of this malady ranges from 1% to 7%. because the prognosis has generally been poor for cases with lung metastases, it is critical to distinguish synchronous primary cancer from intrapulmonary metastases. martini and melamed indicated that synchronous lung cancer requires the following criteria for diagnosis : 1) the two tumors must be anatomically distinct and separate, 2) the tumors are historically different, and 3) if the tumors ' histology is of the same type, then each tumor should have its own original site, and there should be no cancer in the lymphatic vessels common to both, and no metastasis from another organ. however, it is often not so easy to differentiate multiple primary cancers from single primary cancer with metastasis, and especially in cases where two lesions have the same histology. we report here on a unique case that had two distinct lung masses with the same location, the same histology and a similar good response to initial chemotherapy with gemcitabine and carboplatin, but these tumors showed a different response to pemetrexed as a second - line treatment. two distinct 3 cm - sized lung masses in the left upper lobe were found on the chest pa (fig. squamous cell carcinoma was diagnosed by trans - thoracic needle biopsy of the lower mass. although the other mass could have been a double primary carcinoma, further diagnostic tests were not done because the patient did not want them at that time. there was also enlargement of multiple mediastinal lymph nodes, suggesting that any benefit from radical treatment would not be great. after four cycles of chemotherapy with gemcitabine (1,000 mg / m, days 1 and 8, every 3 weeks) and carboplatin (area under the curve : 6, day 1, every 3 weeks), the size of the two lung masses was decreased and so this was deemed a partial response. during the subsequent follow - up, the lung masses were again increased in size and she received second - line chemotherapy with two cycles of pemetrexed (500 mg / m, day 1, every 3 weeks). after completion of chemotherapy with pemetrexed, the lower mass was markedly resolved while the upper mass did not respond (fig. biopsy to the other mass was performed to determine whether it was a double primary carcinoma. however, the histology was almost same as the previously obtained specimen, and this made it difficult to differentiate the mass from metastasis (fig. 3). considering her age and performance, we decided not to administer further chemotherapy and so we recommended regular follow - up. the rate of detecting synchronous multiple lung tumors has recently increased due to the advances in diagnostic imaging modalities such as multi - slice spiral computed tomography and positron emission tomography scanning. most reported cases of synchronous tumors in the lung have been shown to have the same histologic type. among the possible tumor combinations reported in the medical literature, squamous cell carcinoma was by far the most common. thus, having the same cell type can not exclude the possibility of synchronous double primary carcinoma. various methods like dna flow cytometry and dna marker analysis can provide information about the loss of heterozygosity, and this might be useful to accurately identify genetic difference of two masses that have the same histology. in our case, we could not carry these procedures out because the amounts of the procured tissue samples were too small. the two lung masses of this patient could have originated from different clones or they could have progressed through different paths of molecular pathogenesis after metastasis, which would lead to different tumor characteristics, including their chemosensitivity. regardless of their pathogenetic mechanisms, it seems important to recognize that tumors with the same histology that develop in one patient can have different responses to drugs. we previously reported on another case of multiple primary lung cancers that had different responses to gefitinib. in that case, the sensitivity to gefitinib was related with mutations of epidermal growth factor receptor - tyrosine kinase. pemetrexed is a multi - targeted antifolate that inhibits several folate - dependent enzymes involved in both purine and pyrimidine synthesis. the overall response rate was 9.1% for pemetrexed in a randomized phase iii trial of pemetrexed versus docetaxel in patients with non - small cell lung cancer and who had been previously treated with chemotherapy. in 2007, there was a report of the in vitro chemosensitivity of freshly explanted tumor cells to pemetrexed. in that study, a low level of thymidylate synthase (ts) and the mrp4 gene expression significantly correlated with the chemosensitivity to pemetrexed, and the predictive value of ts and the mrp4 gene expression was independent of the tumor type. this might contribute to explaining the different responses to pemetrexed in our case, although this needs to be confirmed by further investigations. predicting the chemosensitivity of individual patients is important for improving the efficacy of cancer treatment and avoiding unwanted side effects and the economical expense of ineffective agents. however, this is quite challenging because drug responses reflect both the characteristics of the targeted cells, the mode of drug delivery and/or the host 's metabolism. although several genes have been reported to determine the response to drugs, this seems to be useful in only very limited situations. in addition, several attempts have been made to predict drug sensitivity with transcriptional profiling by using c - dna microarray, proteomic profiling, in vitro culture assay etc [9 - 11 ]. even though previous studies have shown some feasibility to achieve this prediction of response, the practical application to actual clinical cases still seems to have a long way to go. however, we believe this can be clarified in the near future via efforts to gain a better understanding about carcinogenesis and to find more molecular factors that can affect the sensitivity to drugs. gaining such knowledge may lead to a new era of individualized / tailored cancer therapy. | we described here a patient who had two lung masses. although the two masses had the same histology and a similar good response to initial chemotherapy with gemcitabine and carboplatin, the response to pemetrexed as a second - line treatment was different after re - growth of the tumors. these two lung masses could have originated from different clones or they could have progressed through different paths of molecular pathogenesis after metastasis, which would lead to different tumor characteristics, including their chemosensitivity. regardless of their pathogenetic mechanisms, it seems important to recognize that tumors with the same histology that develop in one patient can have different responses to drugs. |
water is the most abundant compound on earth 's surface, covering 70 percent of the planet. in nature it is in dynamic equilibrium between the liquid and gas states at standard temperature and pressure. at room temperature, it is a tasteless and odorless liquid, nearly colorless with a tint of blue. many substances dissolve in water and it is commonly referred to as the universal solvent. water is essential for all life on earth and makes up for more than 60% of our bodies. the therapeutic benefits of water were heralded in those of classical greece and late imperial china, even as its mechanism of therapeutic action remained to be determined. impact of water intake in the prevention of urinary system diseases such as uroli- thiasis, urinary tract infections, chronic kidney disease (ckd), autosomal dominant polycystic kidney diseases (adpkd) and bladder cancer were studied recently1). in this review, under normal conditions, the kidneys are the primary organ of water balance. the weight of the kidneys are less than 0.5% of the total body weight (about 150 g / kidney), but usual blood flow to the kidneys at rest is approximately 25% of cardiac output. although the kidneys filter more than 150 l body fluid on a daily basis depending on glomerular filtration rate (gfr), less than 1% of filtered fluid is actually passed into the urine. renal water excretion is primarily under the control of arginine vasopressin (avp ; an antidiuretic hormone) and the renin - angiotensin system. under normal circumstances, water ingestion in human is driven by thirst. when plasma osmolality increases or plasma volume decreases, perception of thirst rises2). thirst, as a homeostatic mechanism for the maintenance of fluid balance and, is controlled by plasma osmolality and plasma volume3). of those two signals, the former is the main regulator because just a 2 - 3% increase in plasma osmolality induces a strong perception of thirst4), whereas plasma volume must decrease by approximately 10% to stimulate thirst5). avp levels increase rapidly with small increases in plasma osmolality, and changes in plasma volume appear to modulate this osmotic stimulation6). the relatively short half - life of water excretion (about 100 minutes), which is dependent upon a high renal dilution capacity, prevents water intoxication effectively7). the kidneys adjust excretion according to the variable intakes of water and solute, as well as variable losses of water and solutes by the lungs, skin, and gastrointestinal tract. in addition to hormonally mediated water balance, the kidneys require water for solute excretion8). the kidneys can concentrate and dilute urinary solutes from a maximum concentrating capacity of 1,400mosm / kg h2o to a minimum diluting capacity of 40mosm / kg h2o in those with normal renal function9). the obligatory urine volume (v) can be determined for individuals by dividing the daily osmolar solute excretion (mosm / day) by the maximal urine osmolality (uosm max) : obligatory urine volume (ml)=daily osmolar solute excretion (mosm)/uosm max (mosm / kg h2o). thus, the requirements for urinary water loss are increased as the solute load is increased. in cases of ckd, the failing kidneys lose the capacity to concentrate the urine maximally, which means that they must excrete more water to eliminate the solutes acquired in the diet. as a consequence, patients are forced by thirst to drink more water to cover the loss linked to solute excretion. however, in cases where the volume of water ingested can not be excreted fully with urine output due to a defect in maximal urine dilutional capacity, an individual can enter a hyponatremic state. avp acts at the collecting duct of the kidney to decrease urine volume and promote water retention10). on the contrary, avp release is inhibited and the kidney increases hypotonic urinary output to maintain plasma osmolality and volume. avp is a nanopeptide hormone that is derived from a precursor form synthesized in the hypothalamus. after being synthesized in the hypothalamus, it is transported to the neurohypophysis where it is secreted in reaction to an increase in plasma osmolality and a decrease in effective blood volume31112). vasopressin can bind three receptor subtypes known as, the v1a, v1b and v2 receptors. in the kidneys, the v1a receptor is mainly localized in the interlobular arteries, the descending vasa recta, the macular densa and the collecting duct131415). the v2 receptor is predominantly localized in the collecting duct, the macular densa and the thick ascending limb of henle. stimulations of the v1a receptor and the v2 receptor result in an increase in blood pressure by vasoconstriction and in increase of water reabsorption by inserting aquaporin-2 of the collecting duct3101416171819). in the rats with ckd, v2 receptor mrna levels have been shown to be significantly decreased that indicated avp resistance in ckd1820). although vasopressin has a pivotal role in normal water metabolism, in certain situations, it may have deleterious effects on the kidney by causing increased glomerular pressure, renin release, hypertension and mesangial cell proliferation. bouby and fernandes21) in 2003 reported that low hydration with sustained high levels of vasopressin induces morphological and functional changes in the kidney. in this experiment, mild dehydration with sustained high levels of vasopressin impaired renal sodium excretion. bouby.22) in 1990 showed the effect of high water intake on the progression of chronic renal failure in the experimental model of a 5/6 nephrectomized rat. in this experiment, they studied renal function for 10 weeks and kidney morphology assessed thereafter. increased water intake in high water intake (hwi) rat reduced solute - free water reabsorption and urine osmolality. the progressive increases in urinary protein excretion and in systolic blood pressure observed in this model of ckd were significantly slowed in hwi rat compared with normal water intake (nwi) rat. inhibition of avp by high water intake may have slow the progression of chronic renal failure in this experimental rat model. in another study in rats with 5/6 nephrectomy, sugiura.23) showed that high water intake ameliorates tubulointerstitial injury in rats with subtotal nephrectomy. urinary volume increased and urinary osmolarity decreased after the nephrectomy, suggesting impaired renal urinary concentrating capacity. northern blot analysis demonstrated that transforming growth factor - beta (tgf - beta) mrna expression was significantly suppressed in hwi rats. in situ hybridization revealed that hwi suppressed tgf - beta mrna expression mainly in the outer medulla. when rats were into a high water intake, vasopressin levels decreased, and blood pressure, proteinuria and plasma creatinine were reduced. to show the importance of vasopressin inhibition in the progression of ckd rat model, bouby.24) made 5/6 nephrectomized rat in genetically vasopressin - deficient brattleboro rats and compared it to rats with normal vasopressin. in brattleboro rats, compensatory renal hypertrophy and ckd progression were attenuated when compared to rats with normal vasopressin. in an experimental siadh (syndrome of inappropriate antidiuretic hormone secretion) model induced by continuous administration of desmopressin to rats, naito.25) also observed the same renal histopathologic abnormalities, such as dilatation of tubules, and inflammatory cell infiltration, accompanied by significant increases in the relative weight of the kidney. whether increased water intake slows the progression of ckd or not, still remains a controversial topic among the nephrology community. hwi suppresses plasma levels of avp and suppression of avp is expected to be beneficial to kidney function. previous animal experiments suggest that water intake suppresses plasma levels of avp, high levels of which have been suggested to play deleterious roles in animal models of kidney disease2122232425). recent epidemics of ckd of unknown origin in central america, which is probably related to insufficient water intake and chronic volume depletion, were reported and named " mesoamerican nephropathy"26). two large studies recently reported that higher urine volumes27) and fluid intakes28) were associated with the preservation of renal function. clark.27) found in a prospective canadian cohort of 2,148 apparently normal participants followed up for 6 years that the rate of estimated glomerular filtration rate (egfr) decline was inversely related to increased 24-hour urine volume. for each liter increase in 24-h urine volume from 3l(stratified by quartile), the annual percentage decline in egfr decreased by 1.3, 1.0, 0.8, and 0.5 %, respectively. the adjusted odds ratio of developing rapid renal decline, defined as egfr loss > 5%/year, was 0.46 for individuals with urine volume > 3 l / day compared with the reference group (urine volume 1 - 1.9 l / day). they concluded that in this community - based cohort, the decline in kidney function was significantly slower in those with higher urine volume compared to lower urine volume. in another study, strippoli.28) in 2011 performed two australian crosssectional population based studies. the proportion of participants who completed the food frequency questionnaires (ffq) and had gfr measures was 2,744/3,654 (75.0%) for the first and 2,476/3,508 (70.6%) for the second survey. ckd was present in 12.4 - 23.5% men and 14.9 - 28.7% women (mean ages 66.4 - 65.4 years), respectively. participants who had the highest quintile of fluid intake (3.2 l / day) had a significantly lower risk of ckd (odds ratio 0.5 ; 95% ci 0.32 to 0.77, p for trend=0.003). there was a significant inverse linear association between self - reported daily fluid intake volume and ckd prevalence. ckd may be preventable at a population level with low - cost increased fluid intake. most recently, sontrop.29) conducted a cross - sectional analysis of the 2005 - 2006 u.s. they categorized total water intake from foods and beverages as low(4.3 l / day) and found higher ckd prevalence among those with the lowest fluid intake (4.3 l / day) (adjusted odds ratio 2.52 ; 95% ci 0.91 - 6.96). interestingly, when stratified by intake of (1) plain water and (2) other beverages, ckd was associated with low intake of plain water : adjusted or 2.36 (95% ci 1.10 - 5.06), but not other beverages : adjusted or 0.87 (95% ci 0.30 - 2.50). their results provide additional evidence suggesting a potentially protective effect of higher total water intake, particularly plain water, on the kidney. in 2013, clark.30) also conducted a six - week pilot study to examine the safety and feasibility of asking adults with ckd to increase their water intake. the hydration group was asked to increase water intake by 1 to 1.5 l / day relative to their weight, gender, and 24 h urine osmolality, in addition to usual consumed beverages. after six weeks, the change in urine volume was significantly different between groups (0.9 l / day ; p=0.002) with no change in serum sodium and no serious adverse effects. this study provided clear evidence of safety feasibility and the absence of a negative impact on the quality of life of the hydration intervention relative to the control ckd population. hebert.31) performed a retrospective analysis of 581 ckd patients with egfr 25 - 55ml / min in the modification of diet in renal disease cohort a. egfr was repeatedly determined in 442 adpkd patients and 139 patients with ckd from other causes over an average interval of 2.3 years. they tested the hypothesis that urine volume, urine osmolality (uosm), or both are significantly associated with gfr decline in patients with chronic renal insufficiency. contrary to the prevailing view that water is beneficial in ckd, the authors reported that individuals in the highest quartile of urine volume (> 2.85 l / day) showed a faster egfr decline than individuals in the lowest quartile of urine volume (< 2 l / day). the authors concluded that sustained high urine volume and low uosm are independent risk factors for faster gfr decline in patients with chronic renal insufficiency. thus, high fluid intake does not appear to slow renal disease progression in humans. they suggest that until better evidence becomes available, patients with chronic renal insufficiency should generally let their thirst guide fluid intake. in general, kidney transplant recipients are instructed to increase their daily fluid intake so as to preserve kidney function. they observed in renal transplant patients with baseline egfr of 46 ml / min that renal function decline was not different between patients who were prescribed a daily fluid intake of 4l compared with patients who were prescribed 2 l daily. the authors of this study concluded that recommendation of higher fluid intake does not seem to improve chronic kidney transplant failure. very recently, sontrop.33) performed a randomized controlled pilot trial with 28 patients with stage 3 ckd. hwi group drink approximately upto 1.5 l more per day than controls for 6 weeks and the control group was asked to maintain regular water intake. this increased water intake caused a significant decrease in plasma copeptin concentration among patients in the hydration group. whether the effect of increased water intake on plasma copeptin concentration is clinically significant, beneficial or sustainable over time is unknown at present. in conclusion, despite the encouraging association between hwi and preserved egfr in the two large observational studies2728), causal relationships between increased water intake and reduced gfr loss among individuals with ckd remain speculative. the intriguing effects of increased urine volume in preserving the glomerular filtration rate in humans with chronic renal disease need for large well - designed randomized prospective clinical trials. | impact of water intake on the courses of chronic kidney and urinary tract diseases, such as urolithiasis, urinary tract infections, chronic kidney diseases (ckd), autosomal dominant polycystic kidney diseases and bladder cancer, has recently been studied. it still remains controversial whether increased water intake slows the progression of ckd or not. however, high water intake suppresses plasma levels of arginine vasopressin (avp), which is expected to be beneficial for the preservation of the kidney function. previous studies suggest that water intake suppresses plasma levels of avp, and high levels of avp have been suggested to play deleterious roles in animal models of kidney disease. moreover, recent epidemic of ckd of unknown origin, which was supposed to be related to the insufficient water intake and chronic volume depletion, has been reported in central america, further suggesting that the suppression of avp by sustained water intake might be beneficial in this ckd population. indeed, the data from recent studies were consistent with the view that high water intake is associated with slower progression of ckd. however, contradictory findings also exist. the intriguing effects of increased urine volume in preserving the glomerular filtration rate in human patients with ckd require more large and well - designed randomized prospective clinical trials. |
intrastromal corneal ring segments (icrs), which were initially designed to correct mild and moderate myopia, are currently used to treat corneal ectatic disorders, including keratoconus [24 ]. icrs of the same or differing sizes have been used [2, 4 ]. the keratometric changes in icrs implantation are affected by the incision meridian and the size and diameter of the segments. previous studies were limited in that the spherical and cylindrical components were treated as independent variables. the analysis of surgically induced astigmatism (sia) requires conversion of the net astigmatism to orthonormal components in dioptric space. vector analysis research indicated that the maximum reduction in astigmatism was obtained when the incision and segments were placed along the flat topographic meridian [7, 8 ]. however, the nomogram for choosing the segment size and incision meridian in these previous studies differed from that recommended by the manufacturer. the present study was performed to determine the sia and average corneal power change of intacs icrs implantation when the pocket incision meridian and segment size were chosen in accordance with the manufacturer 's recommendations. we used the polar value method to analyze the sia for icrs implantation [6, 911 ]. this retrospective, nonrandomized study assessed 34 eyes in 34 patients diagnosed with keratoconus who underwent insertion of symmetric intacs sk icrs by the same surgeon (choun - ki joo) at our hospital. to prevent bias, this study was conducted in compliance with the regulations of the institutional review board of seoul st. all patients underwent a comprehensive examination preoperatively, including the uncorrected distance visual acuity (udva), corrected distance visual acuity (cdva), manifest refraction, slit - lamp biomicroscopy, goldmann tonometry, ultrasonic pachymetry, and simulated keratometry (k) using scanning - slit topography (orbscan ii ; bausch & lomb, rochester, ny). all surgeries were performed under topical anesthesia by the same experienced surgeon (choun - ki joo). in all cases, two symmetric intacs icrs (addition technology, sunnyvale, ca) with an inner diameter of 6 mm were used. the thickness of the intacs segments and incision location were selected based on the manufacturer 's recommended nomogram. the standard surgical protocol described in previous reports was followed [12, 13 ]. with the patient in the seated position, next, with the patient lying on the surgical table, the steep keratometric meridian was identified and marked using a mendez degree gauge (katena products, denville, nj) with the aid of preplaced reference points. a femtosecond laser was used for corneal tunneling (intralase fs60 ; abbott medical optics, santa ana, ca). the patient interface of the laser was docked in the eye and the incision meridian was adjusted to the previously marked steep meridian. the tunnel depth was set at 80% of the thinnest corneal pachymetry in the midperipheral cornea where it was planned to implant the icrs. a sinskey hook and dissector postoperative follow - up visits were scheduled at 1 week and 1 and 3 months and then at the clinician 's discretion. data collection was limited to 3 months postoperatively to isolate the effects of icrs implantation from the possibility of keratoconus progression [14, 15 ]. patients were excluded from the study if the data at 3 months were incomplete or if they received asymmetric segments. polar value analysis was used to analyze the sia [9, 11, 16 ]. the net astigmatism with the magnitude in diopters and direction in degrees was transformed into an orthonormal polar value expressed in diopters. to calculate the postoperative astigmatic polar values, for example, for the preoperative net cylinder a at a and the postoperative net cylinder b at b, the preoperative and postoperative astigmatic polar values were defined as follows : (1)akp+0preop = a, akp+45preop=0,akp+0postop = bsin2b+90acos2b+90a, akp+45postop = bsin2b+45acos2b+45a,akp+0=akp+0postopakp+0preop,akp+45=akp+45postopakp+45preop.it is possible to convert a pair of polar values into a conventional notation.(2)m=akp+02+akp+452=arctanmakpakp+45.for example, from the 27-year - old patient, we obtained the following preoperative topographic readings:(3)k1=63.5 d in the meridian 101k2=55.2 d in the meridian 11a=63.555.2=8.3 da=101preoperative net astigmatism=8.3 d at 101mean keratometry=59.4 d.the postoperative topographic test showed the following results at 3 months:(4)k1=54.9 d in the meridian 98k2=50.6 d in the meridian 8b=54.950.6=4.3 db=98.in the same way, we obtained the postoperative net astigmatism (4.3 d at 98) and mean keratometry (52.8 d). conversion to astigmatic polar values is as follows:(5)akp+0preop=8.3 dakp+45preop=0akp+0postop = bsin2b+90acos2b+90a=4.3 dakp+45postop = bsin2b+45acos2b+45a=0.4 dakp+0=akp+0postopakp+0preop=4.0 d,akp+45=akp+45postopakp+45preop=0.4 d.this pair of polar values was converted into the following conventional net cylinder notation:(6)m=4.0 d=93. the surgically induced polar value in the meridian + 0 [akp(+0) ] was the meridional power causing a decrease or increase in power along that plane. the surgically induced polar value in the meridian (+ 45) [akp(+45) ] was the torsional force twisting the astigmatism in a counterclockwise or clockwise direction. as the refractive components are correlated, multivariate statistical analysis using hotelling 's trace test was used to compare the intraindividual changes [10, 11 ]. in all analyses, univariate analysis was used to assess changes in the respective polar values [akp(+0) and akp(+45) ]. this study included 34 eyes in 34 patients (22 males, 12 females) with a mean age of 27.0 6.7 (range 1944) years. the thickness of intacs segment was selected based on the comprehensive nomogram and presurgical guide recommended by the manufacturer. intacs implantation significantly decreased the average corneal power by 7.1% less than the preoperative sim k (table 1). the average corneal power decreased by 1.46 2.80 d and 0.50 2.50 d for akp(+0) and akp(+45), respectively. the combined mean polar values for the sia changed significantly (hotelling 's t = 0.375 ; p = 0.006). univariate analysis revealed that akp(+0) decreased significantly and that the change in akp(+45), which is the torsional force twisting in the astigmatic direction, was not significant after 3 months. when the results were converted into conventional notation, the sia was 1.54 d at 99. the sia is shown as pairs of polar values in figure 1. a net decrease in akp(+0) occurred in 24 eyes (71%). subgroup analysis revealed that average corneal power decreased in each thickness subgroup (table 3). the percentage decreases compared to the preoperative sim k were 4.2, 4.4, and 8.2% in the 350, 400, and 450 m intacs subgroups, respectively. polar value analysis showed that akp(+0) decreased after 400 and 450 m intacs implantation. statistical analysis was not performed for the subgroups due to the small size of the individual groups. intacs are implanted to change the cornea by placing two symmetric or asymmetric segments in the midperiphery of the cornea. in general, symmetric intacs segments are used for central ectatic cones and asymmetric segments for eccentric ectatic cones. one of the main goals in managing the central cone is to decrease the average corneal power. however, a considerable amount of corneal astigmatism is also found in symmetric cones, and this should be decreased to improve visual quality. the present study was performed to examine the corneal power and astigmatic effects of 6 mm intacs sk. in this study, all incisions were located on the preoperative steep meridian and the segment thickness was selected using the nomogram recommended by the manufacturer. the results showed that the average corneal power decreased significantly by 3.8 d after 6 mm intacs implantation. the keratometric changes observed in this study corresponded with previous reports. in studies of 7 mm intacs icrs, the mean change in k varied from 1.94 to 4.3 d depending on the author and surgical procedure involved in tunnel creation [12, 14, 1820 ]. with regard to the keratometric results for 6 mm intacs (intacs sk), haddad. demonstrated that flat and steep keratometry decreased by 1.51 and 2.24 d, respectively. in another study, the mean keratometry (k) reading decreased from 52.07 to 46.15 d for k1 and from 57.9 to 51.2 d for k2. in a third study of advanced keratoconus intacs sk, which is closer to the visual axis, had a greater flattening effect on the central cornea. segments 6 mm in diameter decreased the corneal astigmatism by 1.54 d at 99 from the preoperative steep meridian. vectorial analysis of icrs implantation was performed in a few studies [7, 8 ]. our results agreed with an earlier study in that the corneal astigmatism decreased after vector analysis. [7, 8 ] indicated that the maximum reduction in astigmatism (2.67 d) occurred when the incision was placed in the flat meridian (perpendicular group) and the least effect (0.65 d) was when the incision was placed in the steep meridian (meridional group). the differences in study design and analysis make it difficult to directly compare these previous results with those of the present study. [7, 8 ] implanted two symmetric 7 mm intacs icrs 0.3 mm thick irrespective of the preoperative keratometric power. in contrast, 6 mm intacs sk and the manufacturer 's nomogram were used in our study. although decreasing the variables (segment size and diameter) could give a more reliable result, we followed the manufacturer 's recommendations for respective patients. second, the mean keratometric power decreased more in the meridional group (3.93 d) than in the perpendicular group (1.79 d) in the previous study. symmetric intacs segments are usually used for keratoconus patients with a relatively central cone. in this situation, decreasing the keratometric power would be the preferred goal of the surgery, rather than decreasing the corneal astigmatism. the meridional group had a better result with regard to decreasing the keratometric power, although the astigmatic effect was less than that in the perpendicular group in tu. third, the preoperative keratometric astigmatism itself was greater in the perpendicular group (4.65 d) than in the meridional group (2.40 d), although no statistical preoperative comparison was available. third, we encountered the same problem mentioned in a previous report ; that is, the keratometric results were highly variable. the percentage coefficient of variation (sd / mean) was 192% for akp(+0). this exceeded the value reported by tu., which was 133% for the keratometric surgical effect. we speculate that other variables, including the thickness of the segments, increased the percentage coefficient of variation. our study showed that 6 mm intacs significantly decreased the corneal power and corneal astigmatism compared to the preoperative values when the segments were implanted according to the recommended nomogram. we demonstrated that locating the incision site on the preoperative steep meridian flattened the steep meridian, expressed as a decrease in akp(+0). the torsional effect was not significant, as verified by univariate analysis of akp(+45), which illustrated the accuracy of the incision location. however, the results of our study are readily understood, and the net sia was clearly shown by the changes in akp(+0) and akp(+45). we conclude based on our average corneal power and astigmatic results that the current nomogram recommended by the manufacturer for selection of intacs thickness and incision location is efficacious. | purpose. to evaluate surgically induced astigmatism (sia) and the average corneal power change in symmetric intrastromal corneal ring segment (icrs) implantation. methods. the study included 34 eyes of 34 keratoconus patients who underwent symmetric intacs sk icrs implantation. the corneal pocket incision meridian was the preoperative steep meridian. corneal power data were obtained before and 3 months after intacs sk icrs implantation using scanning - slit topography. polar value analysis was used to evaluate the sia. hotelling 's trace test was used to compare intraindividual changes. results. three months postoperatively, the combined mean polar value for sia changed significantly (hotelling 's t2 = 0.375 ; p = 0.006). the sia was 1.54 d at 99 and the average corneal power decreased significantly by 3.8 d. conclusion. intacs sk icrs placement decreased the average corneal power and corneal astigmatism compared to the preoperative corneal power and astigmatism when the corneal pocket incision was made at the preoperative steep meridian. |
lung cancer incidence was 73,6/100,000 in 2004 in the united states (1), and spontaneous pneumothorax are more rare. between 1991 and 1995, the rate of admissions to uk hospitals for both primary and secondary spontaneous pneumothorax was 16.7 per 100,000 men per year and 5.8 per 10,.000 women per year (2). one diagnostic and therapeutic alternative to thoracotomy is video - assisted thoracoscopic surgery (vats), allowing wedge bullectomy and lung wedge biopsy while reducing pain by smaller incisions and leading to shorter hospital stay. controversy exists as to which approach is superior (3,4). at our institution, three surgeons use either two - port or three - port procedure vats but otherwise the same technic. we have reviewed our experience with two - port vats over the last 6 years to determine wether this approach can be regarded as safe. the charts of all patients who underwent a thoracoscopic procedure by two - port incisions from july 2001 to july 2007 by two thoracic surgeons were reviewed. we included in the study all patients who underwent wedge resections for spontaneous pneumothorax and wedge biopsies for pulmonary infiltrates and small nodules (0.5), large nodules (greater than 1.5 cm diameter), diffuse severe emphysema, giant bulla, and those who were converted to open surgery for any reason. retrospective data collection includes comorbidities, surgical treatment received, duration of surgery, duration of chest tubes, hospital length of stay (los), post - operative complications and analgesia. all patients were operated using the same technique. under general anesthesia with double lumen intubation, the patient was placed on the lateral decubitus position to expose the left or right chest. a small 2 cm transverse skin incision was performed on the lateral and lower aspect of the chest. a second thoracoscopic port incision was performed more superiorly and anteriorly or posteriorly. following that, a 10-mm, 0 thoracoscope (karl storz) with a working channel was introduced into the pleural cavity through the first incision. careful inspection of the pleural space was performed. for bullectomy and pleurectomy or pleurodesis, the apex of the upper lobe, having blebs, was grasped through the working port of the scope and an endo gia-45 stapler (3.5 mm green cartridge ethicon) was used through the second port. the upper segment of the lower lobe was carefully inspected and blebs were resected using the same technic. regarding lung wedge biopsy for nodules or infiltrates, limited small wedge resections were performed using an endograsper and an endogia-45 4.8 mm stapler. the wedge resections for biopsy were performed in different areas of the lung to obtain a good sampling. combined apical pleurectomy and mechanical pleural abrasion was performed for pleurodesis, on the anterior, lateral, and posterior aspects of the chest wall. for some elderly patients with chronic obstructive pulmonary disease, following the mechanical abrasion, talc poudrage was used to achieve optimal pleurodesis. following irrigation and suction with normal saline, a 32 french chest tube was placed posteriorly to the lung up into the apex through the camera port. all the incisions were closed using 0 vicryl sutures stitched on the subcutaneous tissue and monocryl 4 - 0 subcuticular on the skin. intercostal block with bupivacaine 0.25 with epinephrine was done in the intercostal space where the trocar and the chest tube have been placed. the charts of all patients who underwent a thoracoscopic procedure by two - port incisions from july 2001 to july 2007 by two thoracic surgeons were reviewed. we included in the study all patients who underwent wedge resections for spontaneous pneumothorax and wedge biopsies for pulmonary infiltrates and small nodules (0.5), large nodules (greater than 1.5 cm diameter), diffuse severe emphysema, giant bulla, and those who were converted to open surgery for any reason. retrospective data collection includes comorbidities, surgical treatment received, duration of surgery, duration of chest tubes, hospital length of stay (los), post - operative complications and analgesia. all patients were operated using the same technique. under general anesthesia with double lumen intubation, the patient was placed on the lateral decubitus position to expose the left or right chest. a small 2 cm transverse skin incision was performed on the lateral and lower aspect of the chest. a second thoracoscopic port incision was performed more superiorly and anteriorly or posteriorly. following that, a 10-mm, 0 thoracoscope (karl storz) with a working channel was introduced into the pleural cavity through the first incision., the apex of the upper lobe, having blebs, was grasped through the working port of the scope and an endo gia-45 stapler (3.5 mm green cartridge ethicon) was used through the second port. the upper segment of the lower lobe was carefully inspected and blebs were resected using the same technic. regarding lung wedge biopsy for nodules or infiltrates, limited small wedge resections were performed using an endograsper and an endogia-45 4.8 mm stapler. the wedge resections for biopsy were performed in different areas of the lung to obtain a good sampling. combined apical pleurectomy and mechanical pleural abrasion was performed for pleurodesis, on the anterior, lateral, and posterior aspects of the chest wall. for some elderly patients with chronic obstructive pulmonary disease, following the mechanical abrasion, talc poudrage was used to achieve optimal pleurodesis. following irrigation and suction with normal saline, a 32 french chest tube was placed posteriorly to the lung up into the apex through the camera port. all the incisions were closed using 0 vicryl sutures stitched on the subcutaneous tissue and monocryl 4 - 0 subcuticular on the skin. intercostal block with bupivacaine 0.25 with epinephrine was done in the intercostal space where the trocar and the chest tube have been placed. we reviewed the charts of 319 patients and a total of 217 patients had undergone two - ports incisions and fit in the inclusion criteria ; all remaining cases corresponded to any of the exclusion criteria. there were 136 (65.7%) males and 81 (37.3%) females with a mean age of 47 years (range 1484). the operative time, los, chest tube requirement time duration are summarized in table 2. we noticed that 16% of primary spontaneous pneumothorax (psp) cases showed postoperative complications, 19% for secondary spontaneous pneumothorax (ssp), 14% for pulmonary nodules and 12% for pulmonary infiltrate. the most common postoperative complications were 11 (5%) cases of persistent air leak, 11 (5%) cases of transient fever peak of unknown origin, 3 (1.4%) cases of pneumonia, 3 cases (1.4%) of postoperative bleeding, and 1 (0.46%) case of c. difficile colitis which has resolved. there were no cases of wound / cellulitis, empyema, arrhythmia or cardio - vascular event. only three cases of primary spontaneous pneumothorax needed a reoperation for bleeding, persistant air leak and a recurrency. within the 98 patients operated for pneumothorax, 82 (83.7%) underwent pleurodesis by mechanical abrasion, 6 (6.1%) by talc poudrage, and 10 (10.2%) received no pleurodesis. within the 69 patients operated for infiltrates, 1 (1.4%) underwent pleurodesis by mechanical abrasion, 3 (4.3%) by talc poudrage and 65 (94%) received no pleurodesis (figures 1 and 2). vats is known for being both an effective diagnosis and therapeutic tool employing minimally invasive techniques. it became involved in the diagnosis of idiopathic interstitial lung disease (5), and the staging of lung nodules (6) while allowing a simultaneous assessment of the pleura. it also facilitates the treatment of pneumothorax by wedge bullectomy and pleurodesis. for primary spontaneous pneumothorax, it has even been demonstrated effective and safe for the first episode (7). our cohort data suggests that the average operative time is proportional to the number of postoperative days to remove chest tubes and discharge home if no postoperative adverse event occurs. this constatation excludes the cases involving pulmonary infiltrates for which the longer length of stay is due to the preoperative disease. compared to other vats studies for spontaneous pneumothorax and indeterminate interstitial lung disease, our data shows good results regarding operative time, chest - tube drainage, and postoperative hospital stay. for mean operative time, studies state values as 5719 minutes (8), 67.916.7 minutes (5), and 129 minutes (9). for pleural drainage, studies show mean duration as 1.4 days (range 1 - 7) (10), 4.1 days (9), 5.81.2 days (2), and 6.04.7 days (5). for postoperative hospitalization, values were published for 2.4 days (10), 4 days (9,11), 5 days (12), 7.71.6 days (8), 7.94.7 days (5), and 9.5 days (9). compared with previous studies in terms of postoperative mortality and morbidity, our sample of patients who underwent two - ports surgery for vats had very good results. regarding 30-day mortality, studies often depicts no cases (5,79,1214) or rates as low as 0.5% (15), 0.8% (16), 1.3% (17) and 3.6% (18). this last increased rate was seen for secondary spontaneous pneumothorax, due to diagnosed pulmonary pathologies as emphysema. higher rates are present for postoperative complications, for which increasing factors include extreme age range and preoperative comorbidities. studies depict morbidity of 9.6% for nodules (15), 1.7% (13), 25.4% (17), and 27.4% (8) for primary spontaneous pneumothorax, and 25% (13) and 76.9% (17) for secondary spontaneous pneumothorax. in previous reviews, persistant air leak was seen for 10% to 11.5% of procedures (9,17), pneumonia in up to 6.7% (17), bleeding in 1.6% (19). moreover, others describe arrythmia (17), empyema (17), and wound infection (13) that did nt occur in our cohort. to minimize these complications, authors recommend a close monitoring in the post - operative care unit and on the ward. vital signs, chest tubes drainage and incision wounds should be checked by the surgical team in morning rounds, and twice a day by nurses. moreover, chest radiographs and complete blood count may be of particular interest if patients are symptomatic. prevention of c. difficile infection is also important with a judicious use of antibiotics and isolation when necessary. interestingly, during the post - operative days, patients operated for lung infiltrates consumed more morphine (65.3 mg) than patients who underwent the surgery for lung nodules and pneumothorax (48.4 mg and 42.1 mg, respectively). we noticed that the practice of pleurodesis did not significantly increase the use of narcotics, despite the earlier notion that pleurodesis increase pain in an important way. post - operative morphine administration levels in pneumothorax cases whom surgery included mechanical abrasion illustrate an average difference of less than 10 mg in post - operative day 1 and 2 (figure 1). a study also suggested that additionnal mechanical pleurodesis has no disadvantages versus bullectomy alone in terms of worsening post - operative chest pain or pulmonary function (20). chemical talc pleurodesis appears to decrease the need for post - operative morphine. in our cohort, postoperative morphine administration levels in cases of pulmonary infiltrates were much greater for patients receiving no pleurodesis than for those receiving chemical talc pleurodesis. however, this included only 3 patients and is therefore highly suseptible to hazard (figures 1 and 2). we conclude that thoracoscopy (vats) via two - port incisions is a safe and efficient procedure for patients presenting a pneumothorax or requiring a lung biopsy. our complication rate is similar or lower to the rates of three - port thoracoscopy. this technique is arguably superior to three - port incisions based on the finding that it may decrease the postoperative pain and neuralgia risks, and presents obvious cosmetic benefits particularly for young patients. | background : video - assisted thoracoscopic surgery (vats) involving wedge resection of bulla and lung biopsy can be done by two or three - port incisions. controversy exists as to which approach is superior. we communicate our experience with two - port vats for these procedures.methods:we retrospectively analyzed the charts of all patients who underwent a vats procedure by two - port incisions from july 2001 to july 2007 by two thoracic surgeons (s.c., s.c.) we included in the study all patients who underwent wedge resections for primary or secondary spontaneous pneumothorax and biopsies for pulmonary infiltrates and small nodules.results:a total of 319 patients charts were examined, and 217 of whom had undergone two - port incisions fitted in the inclusion criteria. there were 136 (65.7%) males and 81 (37.3%) females with a mean age of 47 years. pneumothorax was the main diagnosis for 98 (45%) patients, followed by pulmonary infiltrates for 69 (32%) patients and lung nodules for 50 (23%) patients. the mean operative time and the number of post - op days for chest tube removal and to discharge home in each group have also been recorded. there were few post - operative complications, such as 11 (5%) cases of persistent air leak, 11 (5%) cases of transient fever of unknown origin, 3 (1.4%) cases of pneumonia, 3 (1.4%) cases of bleeding within, one reoperated, and 1 (0.46%) case of c. difficile colitis. the 30-day mortality was 0%.conclusion : the thoracoscopic (vats) wedge biopsy via two - port incisions is a safe operation for patients presenting with pneumothorax or requiring a lung biopsy. a two - port approach seems to be a reasonable alternative to three - port incision procedures for these types of diagnosis, regarding post - operative pain and cosmetic benefits particularly for young patients. |
angiotensin (ang)-(1 - 7) is a new family member of the renin - angiotensin system and its appearance has challenged the traditional renin - angiotensin axis, angiotensin converting enzyme / angiotensin ii / angiotensin ii receptor type 1 (ace / ang - ii / at1) axis. in 1988, santos,. first found that ang-(1 - 7), which was regarded as an inactive fragment, was the major product generated from ang - i in the regions of the dog brainstem. campagnole - santos,. then found that ang-(1 - 7) was a bioactive peptide, which could cause hypotensive response accompanied with bradycardia after injection into the dorsal motor nucleus of the vagus. furthermore, benter,. observed that ang-(1 - 7) could counteract the effect of ang - ii on blood pressure. recent studies have shown that ang-(1 - 7) is a counter - regulatory mediator of ang - ii, which exerts protection against cardiovascular disease through the improvement of endothelial function, inhibition of vascular smooth muscle cell proliferation and migration, vasodilation and modulation of ventricular remodeling., atherosclerosis is characterized by endothelial dysfunction, smooth muscle cell proliferation and migration and disorder of lipid metabolism. recent studies have proved that ang-(1 - 7) plays an important role in protecting against the development of atherosclerosis. in this review, we will discuss the recent findings concerning the biological role of ang-(1 - 7) and related mechanism during atherosclerosis development, as illustrated in figure 1. in the traditional ace / ang - ii / at1 axis, ang - i is cleaved by angiotensin converting enzyme (ace) into ang - ii, which contains eight amino acids. most of pathological effects of the renin - angiotensin system (ras) are attributed to the overproduction of ang - ii. activation of the ang - ii at1 receptor results in vasoconstriction, elevation of blood pressure, cell proliferation and sodium retention. recently, the appearance of new ace2/ang-(1 - 7)/mas (g - coupled protein receptor of ang-(1 - 7)) axis has challenged the existence of traditional ace / ang - ii / at1 axis. as shown in figure 2, ace2 cleaves one amino acid from ang - i, generating ang-(1 - 9). in addition, ang-(1 - 7) can be also directly generated from ang - ii through cleavage of ace2. ace2 is distributed in various tissues, including kidney, heart, vessel and testis. reduced concentrations of ang-(1 - 7) have been observed in renal cortical homogenates of ace2 knockout mice. other enzymes can also generate ang-(1 - 7) directly from ang - i, including prolylendopeptidase (pep), prolylcarboxypeptidase (pcp), neprilysin and matrix metalloproteinase 8 (mmp8). ang-(17) effectively suppresses expression of endothelial cell adhesion molecules, such as vcam-1 and icam-1, resulting in reduction of monocyte adhesion into endothelial layer and subsequent decreased macrophage recruitment in atherosclerotic plaque. in addition, ang-(17) stimulates proliferation of endothelial progenitor cell, regenerating the injured endothelial layer. finally, ang-(17) suppresses the formation of atherosclerotic lesion, and improves plaque stability by reducing proinflammatory cytokines levels, matrix metalloproteinases activities, macrophage contents and necrotic core in the plaque. ang-(1 - 7) : angiotensin-(1 - 7) ; enos : endothelial nitric oxide synthase ; icam-1 : intercellular cell adhesion molecule 1 ; il-6 : interleukin 6 ; mcp-1 : monocyte chemotactic protein ; smc : smooth muscle cells ; tnf- : tumor necrosis factor ; vcam-1 : vascular cell adhesion molecule 1 ; vsmc : vascular smooth muscle cell. in contrast, ang - i is cleaved by ace2 and further cleaved by ace, generating ang-(17). ang-(17) can counteract the effects of ang - ii, mediating vasodilation, blood pressure reduction, anti - proliferation and sodium secretion. ace : angiotensin converting enzyme ; ang - ii : angiotensin ii ; ang - i : angiotensin i ; ang-(1 - 7) : angiotensin-(1 - 7) ; at1 : angiotensin ii receptor type 1 ; pep : prolylendopeptidase ; pcp : prolylcarboxypeptidase ; mas : g - coupled protein receptor of ang-(1 - 7) ; mmp8 : matrix metalloproteinase 8. the ang-(1 - 7) receptor was not elucidated until santos,. found that ang-(1 - 7) acted through mas receptors, which was a g protein - coupled, seven transmembrane protein. mas deficient mice completely lacked the antidiuretic action of ang-(1 - 7) after an acute water load, and also lost ang-(1 - 7)-induced aortic vasodilation. interestingly, ang-(1 - 7) could also regulate the mas receptor by inducing redistribution of mas receptor from cell membrane to intracellular vesicles and subsequent endocytosis. ang-(1 - 7) has been demonstrated to protect against endothelial cell dysfunction, which is regarded as an early step in atherosclerotic plaque formation. firstly, ang-(1 - 7) negatively regulated ang - ii - induced intercellular adhesion molecule 1 (icam-1) and vascular cell adhesion molecule 1 (vcam-1) by suppressing p38 mitogen - activated protein kinase (mapk) phosphorylation and attenuating nuclear translocation of nf - kappab, suggesting that ang-(1 - 7) could effectively modulate endothelial cell adhesion molecules. secondly, ang-(1 - 7) has endothelium - dependent vasodilator properties. ang-(1 - 7) treated mice showed reduced reactive oxygen species (ros) production, decreased nadph oxidase expression and increased endothelial nitric oxide synthase expression, resulting in renal endothelium - dependent vasorelaxation. similarly, ang-(1 - 7) restored endothelium - dependent vasodilation in cerebral resistance arteries in rats fed with a high - salt diet. administration of ang-(1 - 7) also restored vasodilation through reducing vascular oxidant stress in mesenteric arteries of salt - fed rats. in addition, one study tested ang-(1 - 7)-eluting stents, and found that ang-(1 - 7) effectively improved aortic dilator function. thirdly, ang-(1 - 7) stimulated proliferation of endothelial progenitor cells, regenerating the injured endothelial layer in the atherosclerotic vessel. seva,. found that cyclic ang-(1 - 7), a metabolically stable ang-(1 - 7) analogue, increased circulating hematopoietic progenitor cell in mice with myocardial infarction. fourthly, thrombus formation was associated with injury of vascular endothelial cells, and intravenous infusion of ang-(1 - 7) into rats which developed venous thrombosis caused a great reduction of thrombus formation. interestingly, antithrombotic effects of captopril and losartan could be attenuated by ang-(1 - 7) antagonist, indicating that ang-(1 - 7) was involved in the antithrombotic process of angiotensin converting enzyme inhibitor and angiotensin receptor blocker (arb) drugs. treatment of orally active formulation of ang-(1 - 7) also promoted an antithrombotic effect in the abdominal vena cava of spontaneous hypertensive rats. moreover, ang-(1 - 7) caused a decrease in endothelial cell tube formation and neovascularization. the effect of ang-(1 - 7) on the inhibition of angiogenesis was possible due to reduction in vegf - a (vascular endothelial grow factor - a), a primary proangiogenic protein. vascular smooth muscle cell (smc) proliferation and migration are important processes in the development of atherosclerosis. however, zhang,. showed that ang-(1 - 7) alone had no effect on mouse smc growth, whereas ang-(1 - 7) inhibited ang - ii induced mouse smc proliferation. the reasons for these divergent effects of ang-(1 - 7) might be due to differences in the repertoires of receptors, signaling molecules and cell cycling regulators in the different types of cells. ang-(1 - 7) was also able to abrogate ang - ii induced smc migration. ang-(1 - 7) treatment attenuated neo - intimal formation in abdominal aorta after stent implantation and in balloon - injured carotid arteries in rats., ang-(1 - 7) treatment also resulted in a reduction of neo - intimal formation and collagen synthesis after angioplasty in rabbits. firstly, ang-(1 - 7) negatively modulated ang - ii - induced erk1/2 activity in smcs, which has been well established as a signaling pathway for smc proliferation and migration. secondly, ang-(1 - 7) was able to antagonize ang - ii - stimulated up - regulation of matrix metalloproteinases-9, which is an extracellular matrix protein - degrading enzyme known to facilitate cell migration., thirdly, ang-(1 - 7) could down - regulate the ang - ii at1 receptor in smcs, resulting in reduced ang - ii binding to the receptor and subsequent decreased smc migration. recent studies have demonstrated that ang-(1 - 7) can effectively regulate lipid metabolism. ang-(1 - 7) transgenic rats presented decreased cholesterol and triglycerides levels, as well as a reduction in abdominal fat mass. in the aspect of glucose metabolism, ang-(1 - 7) transgenic rats showed enhanced glucose tolerance, insulin sensitivity and insulin - stimulated glucose uptake. furthermore, the study found that the improvement of lipid and glucose metabolism in ang-(1 - 7) transgenic rats was possibly due to increase of adiponectin production in adipose tissue. oral formulation of ang-(1 - 7) could effectively prevent high - fat diet - induced hepatic steatosis and decrease plasma total cholesterol with a reduction of inflammatory markers in the livers of mice. in contrast, mas deficient mice showed an increase of total cholesterol and triglycerides, as well as reduced glucose intolerance, insulin sensitivity and insulin - stimulated glucose uptake, resulting in 50% increase in abdominal fat mass. another study also showed that besides an increase of cholesterol and triglyceride, mas / apolipoprotein e (apoe) double knockout mice were associated with increased hepatic lipid content and alanine aminotransferase with a change in hepatic protein content of mediators related to atherosclerotic inflammation, such as peroxisome proliferator - activated receptor- and liver x receptor. moreover, recent studies have shown that statins, the most widely used lipid - lowering drugs, can exert additional pleiotropic actions partly through modulating ang-(1 - 7) levels. atorvastatin treatment attenuated the inhibitory effect of tnf- on ace2 and ang-(1 - 7) production in smc culture. another study showed that administration of rosuvastatin lead to increased ang-(1 - 7) level and subsequent decreased vascular smc proliferation and intimal thickening after vascular balloon injury in rats. the effect of statins on ang-(1 - 7) production is also demonstrated in clinical trials. ang-(1 - 7) levels increased significantly after 30-day atorvastatin treatment in twelve hypercholesterolemic patients. however, another clinical trial found no differences in ang-(1 - 7) levels before and after atorvastatin treatment in healthy subjects, possibly because of the different study population and drug dosage. ang-(1 - 7) has been shown to inhibit the development of atherosclerotic plaque in many previous studies. four - week ang-(1 - 7) treatment suppressed the formation of atherosclerotic lesion in apoe mice, and increased the endothelium - dependent vaso - relaxation with decreased superoxide production and increased endothelial nitric oxide synthase. furthermore, yang,. showed that ang-(1 - 7) enhanced plaque stability with high contents of collagen, and low contents of macrophages and lipids. in addition, ang-(1 - 7) lowered the expression levels of pro - inflammatory cytokines and activities of matrix metalloproteinases in atherosclerotic lesions, stabilizing the plaques. another study also showed that treatment of ang-(1 - 7) lead to decreased shear stress - induced carotid plaques, and reduced neutrophil and macrophage infiltration. interestingly, a study found that treatment of ang-(1 - 7) and losartan were equivalent in the reduction of atherosclerotic plaque formation in apoe mice. moreover, combination of ang-(1 - 7) and losartan together enhanced the anti - atherosclerotic effects. recently, the use of genetic modified animals has further demonstrated the role of ang-(1 - 7) in atherosclerosis. ace2 knockout mice showed an increase of atherosclerotic plaque formation. in the ace2 knockout mice, the study observed more ang - ii and other inflammatory cytokines produced by macrophages, and adherence of more macrophages onto the layer of vascular endothelial cells, resulting in the development of atherosclerosis. apoe mice that received ace2 gene transfer showed a significant reduction of atherosclerotic plaque with decreased level of vcam-1, monocyte chemotactic protein 1 (mcp-1) and interleukin 6 (il-6). another study also showed that ace2 over - expression in rabbits lead to stability of atherosclerotic plaquefewer macrophages, less lipid deposition and more collagen contents with decreased ang - ii levels and increased ang-(1 - 7) levels. further study showed that mas knockout mice had an increased ratio of intima to media in the aorta in organ culture media after five weeks, suggesting the involvement of the mas receptor in the suppression of intima proliferation. furthermore, the utility of ang-(1 - 7) agonist and antagonist also indicated the protective role of ang-(1 - 7) in atherosclerosis. apoe mice that treated with ang-(1 - 7) receptor agonist ave0991 showed only half areas of atherosclerotic lesion compared to the control group. further study showed that nadph oxidase expression, as well as macrophages and activated cd4 t cells, were decreased in ave0991 treated mice. in addition, inflammatory indicators such as mcp-1, il-6 and il-12 were diminished by ave0991 in apoe mice. ave0991 also effectively attenuated ang - ii production, well known inducer of atherosclerosis, in the aortas of apoe mice compared to wild type animals. blocking of endogenous ang-(1 - 7) with ang-(1 - 7) antagonist, a779, decreased the plaque stability by increasing the lipid contents and reducing collagens in apoe mice, indicating that endogenous activated ang-(1 - 7) was also involved in the protection against atherosclerosis. although most research concerning the role of ang-(1 - 7) in atherosclerosis remains at an animal experimental stage, more and more studies focused on human studies. recent studies have found that ang-(1 - 7) is involved in the neovascularization and inflammation in human. ace2 and mas receptor expressions reduced by 69% and 58% respectively in patients with aortic valve stenosis compared those with normal control valves. interestingly, ace2 was expressed in the macrophages and fibroblasts around neovessels in stenotic aortic valves. another study found that ang-(1 - 7) may be associated with the protective effect of arb drug. serum levels of ang-(1 - 7) were significantly increased, and ang - ii - induced vasoconstriction was reduced from 50% to 15% in the patients that had taken irbesartan for 30 days, suggesting the possible role of ang-(1 - 7) in the protective mechanism of arb drug. although ang-(1 - 7) has the ability to protect against atherosclerosis, the characteristics of metabolism of ang-(1 - 7) have limited its oral pharmaceutical formulation in clinical utility. ang-(1 - 7) can be rapidly cleaved by peptidase with half - life for just 10 s. in addition, ang-(1 - 7) is easily degraded in gastrointestinal tract when orally administrated. therefore, the clinical pharmacotherapy of ang-(1 - 7) has encountered some problems. however, the recent research has found several possible ways to implement the clinical application of ang-(1 - 7). firstly, inclusion of ang-(1 - 7) into the oligosaccharide hydroxypropyl--cyclodextrin (hpcd) cavity can enhance stability, protect against digestive enzyme, and increase absorption of ang-(1 - 7) across biological barriers. one study has found that oral intake of -cyclodextrin / ang-(1 - 7) effectively increased serum concentration of ang-(1 - 7), and inhibited thrombosis formation in spontaneous hypertensive rats. marques,, found that administration of -cyclodextrin / ang-(1 - 7) suppressed isoproterenol induced myocardial damage, remodeling and infarction in rats. another study also showed that chronic treatment of -cyclodextrin / ang-(1 - 7) decreased blood pressure and heart rate, improved heart function, attenuated sympathetic modulation on heart and vessels, and enhanced parasympathetic modulation in spontaneously hypertensive rats, which were also observed in exercise - trained rats. secondly, ang-(1 - 7) could be stabilized by introducing thioether bridges in plasmid - encoded prenisin - modification enzymes, which enhanced resistance to breakdown by protease and increased bioavailability of ang-(1 - 7). a recent study has shown that the thioether - bridged ang-(1 - 7) increased relaxing activity on pre - contracted rat aorta rings by two times compared to natural counterpart of ang-(1 - 7). thioether - bridged ang-(1 - 7) also restored increased heart weight and myocyte size caused by myocardial infarction to sham levels. endothelial function was also improved after treatment of thioether - bridged ang-(1 - 7) in rats with myocardial infarction. thirdly, ang-(1 - 7), which is contained in liposome, has the ability to protect against degradation and maintain a sustained release. the treatment of liposome - entrapped ang-(1 - 7) resulted in attenuation of circadian variation of blood pressure and heart rate that lasted for several days. there is growing evidence that ang-(1 - 7) plays an important role in protecting against atherosclerosis through regulating the function of smooth muscle cells and endothelial cells, and modulating lipid metabolism. the appearance of oral pharmaceutical formulation of ang-(1 - 7) has brought great potential for atherosclerosis treatment. ang-(1 - 7), the new member of ras, is a new therapy option that merits further development and exploration. | angiotensin (ang)-(1 - 7) is recognized as a new bioactive peptide in renin - angiotensin system (ras). ang-(1 - 7) is a counter - regulatory mediator of ang - ii which appears to be protective against cardiovascular disease. recent studies have found that ang-(1 - 7) played an important role in reducing smooth muscle cell proliferation and migration, improving endothelial function and regulating lipid metabolism, leading to inhibition of atherosclerotic lesions and increase of plaque stability. although clinical application of ang-(1 - 7) is restricted due to its pharmacokinetic properties, identification of stabilized compounds, including more stable analogues and specific delivery compounds, has enabled clinical application of ang-(1 - 7). in this review, we discussed recent findings concerning the biological role of ang-(1 - 7) and related mechanism during atherosclerosis development. in addition, we highlighted the perspective to develop therapeutic strategies using ang-(1 - 7) to treat atherosclerosis. |
epidemiological and experimental studies provided clear evidence that unresolved pathogen infections and chronic inflammation promote tumor development and led to the inclusion of inflammation among the hallmarks of cancer [1, 2 ]. on the other hand, invisible to the immune system, but also favor the formation of an immunosuppressive microenvironment unable to eliminate cancer cells. as a result, the reduced secretion of molecules acting as tumor - promoting factors and the normalization of the tumor microenvironment are main goals to develop appropriate antitumor strategies. the tumor microenvironment is composed of stromal and inflammatory cells that are recruited and/or locally induced to proliferate or differentiate by tumor cells or by normal cells educated by tumor cells. these signals are predominantly constituted by cytokines and chemokines (chemotactic cytokines), key orchestrators of leukocytes trafficking under homeostatic conditions as well as during inflammation and cancer and part of the molecular pathways driving cancer cell survival, motility, and invasiveness. chemokines, identified on the basis of their ability to induce chemotaxis, have a fundamental role not only in inflammation and immune surveillance but also in cancer progression. chemokines, secreted by the tumor cells from primary tumors or metastatic sites or by the normal cells recruited and/or locally activated, can behave as growth factors, increase metastasis formation and angiogenesis, or induce the formation of an immunosuppressive microenvironment. this last complex capacity is obtained by recruiting activating tumor - associated macrophages (tam), myeloid - derived suppressor cells (mdsc), t - regulatory cells (t - reg), or mesenchymal stem cells (mscs) and by inhibiting the antitumor activity of th1 cells and cytotoxic t lymphocytes (ctl). in response to chemokines present in remote organs, tumor cells that express the corresponding receptor furthermore, tumor cells acquire higher adhesive, migratory, and invasive properties in response to chemokines that are expressed at preferential metastatic sites. as a consequence, the presence of inflammatory cells such as reactive leukocytes and the expression of a large number of inflammatory mediators (e.g., cytokines, chemokines, and enzymes) in the primary tumor are mostly associated with poor prognosis and metastasis formation. a variety of chemokines and chemokine receptors have been detected in neoplastic tissues [1, 4 ]. we will focus our attention primarily on the c - c chemokine ligand 5 (ccl5), also known as regulated upon activation, normal t - cell expressed, and secreted (rantes), and its receptors c - c chemokine receptor type 5 (ccr5). ccr5 is a seven - transmembrane g - protein - coupled receptor, mediating diverse signaling cascades in response to its ligands. ccr5, a promiscuous receptor, binds with high - affinity ccl5, ccl3 (mip-1a), and ccl4 (mip-1b) and is the major coreceptor for hiv. ccl5 belongs to the c - c chemokine family whose members also include ccl3 and ccl4. ccl5, a target gene of nf-b activity, is expressed by t lymphocytes, macrophages, platelets, synovial fibroblasts, tubular epithelium, and certain types of tumor cells. nf-b activation by different stimuli such as cd40l or il-15 induces ccl5 production. ccl5 plays an active role in recruiting a variety of leukocytes into inflammatory sites including t cells, macrophages, eosinophils, and basophils. in collaboration with certain cytokines that are released by t cells such as il-2 and ifn-, ccl5 also induces the activation and proliferation of particular natural killer cells to generate c - c chemokine - activated killer cells. ccl5 produced by cd8 t cells and other immune cells has been shown to inhibit hiv entry into target cells. ccl5 activity is mediated through its binding to ccr1, ccr3, and mainly ccr5. ccr4 [21, 22 ] and cd44 are auxiliary receptors for ccl5 [21, 23 ]. ccl5 production is relevant to inducing proper immune responses against tumors, but, on the other hand, ccl5 is associated with cancer progression and metastasis. ccl5/ccr5 interactions may favor tumor development in multiple ways : acting as growth factors, stimulating angiogenesis, modulating the extracellular matrix, inducing the recruitment of additional stromal and inflammatory cells, and taking part in immune evasion mechanisms. a schematic view of the consequences of the ccl5/ccr5 interactions in cancer is shown in figure 1. this review summarizes updated information on the role of the ccl5/ccr5 axis in tumor development and/or progression, focusing primarily on multiple myeloma (mm), classical hodgkin lymphoma (chl), prostate, breast, gastric, colon, and ovarian cancer, and melanoma. based on the findings obtained so far, we propose that inflammatory chemokines and their receptors are attractive therapeutic targets in malignancy. the binding of chemokine to their g - protein - coupled receptors (gpcrs) activates a series of downstream effectors that facilitate internalization of the receptor and signal transduction leading to integrin activation (adhesion) and polarization of the actin cytoskeleton. the consequences are directional sensing, cell polarization, accumulation of small gtpases, rac, cdc42, and pi3k at the leading edge, actin polymerization, and f - actin formation. more specifically, ccl5 contributes to the activation of the v3 integrin and to cell migration through pi3k / akt, which in turn activates ikkalpha / beta and nf-b. nf-b activation also can elevate the secretion of mmp-9 or promote invasion by increasing the secretion of both mmp-2 and -9 and by activating the erk and rac signaling. in other instances ccl5/ccr5 acts via mek, erk, and then nf-b, resulting in the activations of v3 integrin and contributing to cell migration. chemokines, by activating the tyrosine kinase receptors, the jak - stat, or the mapk / erk signaling pathway, also promote tumor cell proliferation. exogenous ccl5 stimulates cell proliferation by inducing the mtor pathway, leading to a rapid upregulation of cyclin d1, c - myc, and dad-1 expression. an additional mechanism based on the ccl5-ccr5 interaction can lead to increased cell proliferation : increased glucose uptake, increased atp production, and enhanced glycolysis, associated with extracellular acidification. many studies were published during the last several years on the expression of ccl5 and ccr5 in hematological malignancies, but, only for multiple myeloma (mm) and at least in part for chl, we have a comprehensive view of the role played by the ccl3-ccl5/ccr5 pair. the mm cell localization in the bone marrow and the cross - talk with the bone niche trigger dramatic alterations in the bone marrow (bm) microenvironment, critical for tumor progression, resistance to therapies, and osteolytic bone destruction. the interaction between osteoclasts (ocs) and mm cells plays a key role in the pathogenesis of mm - related osteolytic bone disease. mm cells promote ocs formation and, in turn, ocs enhance tumor cell proliferation via cell - cell contact. the ccr5-ligand ccl3 is detected in mm cell line and freshly isolated mm cells [34, 35 ] and is one of the most important oc - activating factors produced by mm cells and a contributor of mm - associated osteolytic bone disease. mm cells from patients with multiple bone lesions secrete higher amounts of ccl3 (and ccl4) than those with less - advanced bone involvement. consistently, ccl3 serum levels are elevated in newly diagnosed mm patients and correlate with the extent of bone disease, bone resorption, and disease prognosis. increased expression of ccl3 in bone biopsies correlates with extensive bone disease, increased angiogenesis, and advanced stage in newly diagnosed patients with mm. ccl3, secreted by mm cells, stimulates oc activity and also inhibits osteoblast formation, further contributing to the imbalance between bone resorption and bone formation. mm cells also secrete ccl5, suggesting a possible role of this chemokine in the pathogenesis of mm since, like ccl3, it is a potent activator of both ccr1 and ccr5 receptors expressed by stromal cells and oc precursors. several studies have evaluated the expression of ccr5 and ccr1 by mm cell lines and by cells derived from patients [34, 35, 4245 ] and demonstrated that their engagement determines mm cell survival, migration, and homing to the bm. in fact, mm cells migrate in the presence of ccl5 and the extent of migration depends on the ccr5 expression levels [35, 43, 45 ]. inhibition of ccr1 and ccr5 receptors by antagonists or neutralizing antibodies partially reduce osteoclastogenesis, osteolytic lesions, and mm - induced angiogenesis [34, 35, 42 ]. recently, dairaghi. demonstrated that ccr1 blockade by the selective antagonist ccx721 reduces tumor burden and osteolysis in vivo in a mouse model of myeloma bone disease, likely by inhibiting the cross - talk of mm cells with ocs and oc precursors. thus the development of ccr1 antagonists for the treatment of mm and associated osteolytic bone disease is a further therapeutic possibility. overall, the current observations propose two major mechanisms by which ccl3 and/or ccl5 released by tumor cells and their receptors support mm progression : the first is the ability to disrupt bone homeostasis and induce bone destruction, and the second is the bone marrow homing of mm cells due to the expression of ccr5 and ccr1. therefore, counteracting the consequences of these chemokine / chemokine receptors interactions may represent a new therapeutic option in mm. the microenvironment is essential for growth and survival of classical hodgkin lymphoma (hl) tumor cells and chemokines play a primary role in its formation. they may exert a direct action on tumor cells by increasing cell survival and proliferation, recruit cells capable of sustaining the growth of tumor cells by providing a suppressive environment that suppresses cytotoxic immune responses, or redirect hl cells to advantageous microenvironmental sites within the lymphoid tissues. chl cells secrete cytokines / chemokines and express a variety of cytokine / chemokine receptors [8, 47 ] and it is now widely assumed that the clinical and histological features of chl are primarily due to the effects of a plethora of cytokines and chemokines secreted by chl cells such as ccl5 [48, 49 ], ccl17, ccl22, ccl28, and ccl20 [39, 52 ] or by the surrounding cellular infiltrate. the recruitment and proliferation of nontumor cells for example : chl cells (i) do not express eotaxin but produce il-13 and tnf- which are capable of inducing eotaxin expression in cocultured dermal fibroblasts in a concentration leading to a specific chemotactic response of th2 cells ; (ii) produce molecules capable of inducing ccl5 secretion in hl - derived fibroblasts ; (iii) express cd40 and its engagement by cd40l rosetting t - cells increase ccl5 secretion. together these lines of evidence suggest that the cross - talk between tumor cells and fibroblasts or the activation by surrounding cd40l+ t - cells may be involved in the influx and further proliferation of inflammatory cells typical of the hl microenvironment. accordingly, when compared with control lymph nodes or tissues diagnosed with reactive lymphoid hyperplasia, chl tissues display higher levels of chemokines such as ccl5 and ccl3 [47, 48 ]. both chemokines are significantly higher in ebv - positive than in ebv - negative hl tissues, consistent with the fact that the ebv gene lmp1 is necessary to induce the expression of ccl5 in ebv - negative cell lines. both ccr5 and ccl5 [48, 49 ] are also constitutively expressed by chl - derived cell lines (l-428, km - h2, l-1236, and l-540), by tumor cells from chl lymph node tissues, and by bystander cells including lymphocytes and macrophages. ccr5 receptor is functional since human recombinant ccl5 increases the clonogenic growth of chl tumor cells. as a consequence, ccl5 secreted by the microenvironment consistent with the fact that chl cell lines expressed the ccr5 receptor and its ligand, neutralizing anti - ccl5 mabs decrease the spontaneous clonogenic growth, suggesting that ccl5 may represent an autocrine growth factor for chl cells. cd40 engagement and cocultivation with fibroblasts from hl - involved lymph nodes (hlf) increase ccl5. on the other hand, the silencing of irf4, a transcription factor iperexpressed by chl cells and whose expression is linked to proliferation and survival, decreases ccl5 secretion. ccl5 secreted by chl cells increases the migration of mast cells, eosinophils, cd4 + t cells, and likely t - reg cells, highlighting its involvement in the formation of the microenvironment. as a consequence ccl5 and the ccr5 ligands secreted by tumor cells or by the surrounding t - cells, macrophages, or fibroblasts may support chl progression by increasing proliferation and by recruiting cells involved in the microenvironment formation. a schematic view of the possible mechanisms (paracrine and autocrine) leading to chl cells proliferation and microenvironment formation by ccl5 is shown in figure 2. a number of solid tumor types express ccl5 and/or ccr5, but only some malignancies were widely studied, thus providing evidence of the involvement of this pair in cancer progression and development. we briefly summarize the role of ccl5/ccr5 in melanoma and gastric, ovarian, cervical, colorectal, and prostate cancer. however, since the most extensive results were obtained in breast cancer, major emphasis is given to this malignancy. ccl5, while being minimally expressed by normal breast epithelial duct cells, is highly expressed by breast tumor cells at primary tumor sites, regional lymph nodes, and metastatic sites, indicating that ccl5 expression is acquired in the course of malignant transformation and that ccl5 plays a role in breast cancer development and/or progression. increased positivity and expression levels of ccl5 by breast tumor cells are significantly associated with disease progression, relapse, and/or metastasis, compared to patients in remission [58, 59 ]. in this tumor the major source of ccl5 is the tumor cells ; however, ccl5 is also expressed by infiltrating leukocytes and mesenchymal stem cells (mscs) of the tumor microenvironment [15, 57, 60 ]. ccl5 is also present in interstitial fluids perfusing the tumor, in pleural effusions, and in serum. a functional ccr5 receptor is expressed by a subpopulation of human breast cancer cell lines and displays a functional response to ccl5. in addition, oncogene transformation induces ccr5 expression, and the subpopulation of cells that express a functional ccr5 also displays increased cell migration and invasiveness. a microarray analysis on 2,254 human breast cancer specimens found increased expression of ccl5 and its receptor ccr5, but not ccr3, in the basal and her-2 genetic subtypes. in contrast, when a similar analysis was performed in nonneoplastic breast samples, no correlation between ccl5 and ccr5 expression levels was found, indicating that ccl5/ccr5 signaling may be preferentially activated during the development of specific breast cancer subtypes. ccl5 expression is strongly associated with the progression of breast cancer, particularly the triple - negative breast cancer (tnbc), and may represent an immunotherapeutic target in the tnbc. hypoxia is a major selective factor that promotes the growth of tumors with a diminished susceptibility to radiation and chemotherapy and is associated with cancer progression, cancer metastasis, and thus poor prognosis. hypoxia induces a strong increase of both ccl5 and ccr5 expressions by breast cancer cells. under this experimental condition ccl5 stimulates cell migration rather than cell proliferation and neutralization of ccl5 inhibits the hypoxia - induced migration of cancer cells. similarly, overexpression of ccr5 increases cell migration, and knockdown of ccr5 attenuates hypoxia - mediated cell migration. hypoxia - inducible factor-1 (hif-1) is involved in ccr5 and ccl5 regulation under hypoxia and hif-1 mrna levels are highly correlated with ccr5 mrna and ccl5 mrna levels in clinical samples. ccl5 also concurs with the cross - talk between breast cancer cells and mscs : cancer cells stimulate ccl5 secretion by mscs and osteoblasts of the tumor microenvironment and ccl5 in turn induces tumor cell migration and promotes invasion and metastasis [15, 60 ]. mscs - derived ccl5 promotes mammary tumor cell invasion and the activation of matrix metalloproteinases (mmps), consistent with the fact that ccl5 is capable of upregulating the release of mmp-9. tumor infiltrating cells seem bona fide prognostic and even predictive biomarkers and could be incorporated into diagnostic and therapeutic algorithms of breast cancer. ccl5 supports breast malignancy by changing the equilibrium between leukocyte infiltrates in tumors, leading to dominance of cells with tumor - promoting rather than tumor - killing activities. in fact, ccl5 shifts the balance between different leukocyte cell types by increasing the presence of deleterious tams that secrete proangiogenic factors, suppress the antitumor response, and inhibit the antitumor t - cell activities. ccl5, together with tumor - derived colony - stimulating factors, promotes mammary tumor progression generating mdscs in the bone marrow, helping to maintain the immunosuppressive capacity of human mdscs. ccl5 neutralization could decrease the immunosuppression activity of mdscs, improve the efficacy against poorly immunogenic tumors, and reduce progression and metastasis. ccl5 expression by breast tumor cells represents a valuable prognostic factor for detection of stage ii breast cancer patients who are at risk for disease progression. its expression is associated with the absence of estrogen receptor, thus increasing the prognostic value of each of these two markers in patients (in the order iii > ii > i) at risk for progression. ccl5 serum levels are elevated in breast cancer patients compared to healthy individuals and tend to be higher in lymph - node - positive patients, larger tumor size, the presence of lymphovascular invasion and multifocal tumors. tamoxifen resistance is a major therapeutic problem in breast cancer and a significant correlation between stat3-rantes autocrine signaling and acquisition of tamoxifen resistance has been reported : stat3 and rantes in tamoxifen - resistant mcf-7 cells regulate each other via autocrine signaling, leading to the induction of an antiapoptotic signal. this latter facilitates the maintenance of drug resistance, thus suggesting a novel strategy for the management of patients with tamoxifen - resistant tumors. to conclude, based on several studies done in patients, animal model systems, and in vitro systems, the ccl5/ccr5 axis seems to have a crucial role in cancer progression and may represent an important breast cancer therapeutic target with minimal adverse impact. melanoma cell lines and melanoma tissues express a number of chemokines that support their growth and are implicated in tumor progression. furthermore, organ - specific patterns of melanoma metastasis correlate with the expression of specific chemokine receptors. ccl5 and ccr5 are expressed by melanoma cells, primary melanomas, and cutaneous metastasis. ccl5 is higher in melanoma cells than in normal melanocytes and is associated with a higher malignancy state and increased tumor formation [73, 74 ]. recently, to better evaluate the significance of ccr5 expression in melanoma development, tumor growth in ccr5 knockout (ccr5) and wild type (ccr5) mice was investigated. ccr5 deficiency caused apoptotic melanoma cell death through inhibition of nf-b and upregulation of il-1r, thus suggesting a tumor - promoting role of ccr5. already a previous study by mellado. had shown that ccr5 plays a key role in inducing apoptotic death in tumor infiltrated lymphocytes (til) in a ccl5-dependent manner : cxcl12 released by melanoma cells induced the expression of ccl5 by til, which in turn activated their death program. this activity is upregulated also by ccl3 and ccl4 : they act via ccr5 to induce cytochrome - c release into the cytosol, leading to activation of caspase-9 and -3. recently, using a mouse model of melanoma, schlecker. demonstrated that tumor - infiltrating monocyte - mdscs directly attract high numbers of t - regs via ccr5 and that intratumoral injection of ccl4 or ccl5 increases tumor - infiltrating t - regs, but ccr5 deficiency led to their profound decrease. moreover, melanoma growth is delayed in ccr5-deficient mice, likely because of a profound decrease of t - regs, emphasizing the importance of ccr5 in the control of antitumor immune responses. the conclusion is that the ccl5/ccr5 axis seems associated with melanoma progression due to increased levels of immunosuppressive cells. increased ccl5 levels are expressed by human gastric cancer cell lines characterized by a high metastatic potential suggesting a tumor - promoting role of ccl5 in gastric cancer. this possibility is supported by the effects of supernatants derived from low- and high - metastatic gastric cancer cell lines on the activities of peripheral blood mononuclear cells (pbmc). supernatants from high - metastatic gastric cancer cell lines increase ccl5 expression in pbmc, as compared to pbmc stimulated by supernatants of low - metastatic cells. in turn, tumor cells cocultured with pbmc have higher invasion properties than noncocultured cells, and this process is highly inhibited by antibodies to ccl5, suggesting that the cross - talk with pbmc, likely through ccl5, increases the invasion potential of tumor cells. several authors have then analyzed ccl5 expression in gastric cancer and found a possible correlation with the formation of metastasis. the possibility that ccl5 could serve as a predictor of metastasis was based on a study analyzing ccl5 circulating levels prior to anticancer treatment : ccl5 levels are higher in patients than in healthy controls ; furthermore, the expression is higher in stage iv patients than in stages i or ii - iii and in metastatic sites. in fact, ccl5 and ccr5 are highly expressed in gastric cancer with lymph node metastasis, and ccl5 levels in the lymph nodes with cancer invasion are substantially increased, confirming the role of ccl5/ccr5 axis in metastasis formation. following infection with helicobacter pylori in a gastric cancer model system ccl5 is elevated and its levels are reduced by treatment with anti - inflammatory drugs. this is in accordance with the finding that il-2 and ifn- (th1 cells) are lower and il-10 (th2 cells) is higher in lymph node metastasis than in cancer without metastasis, suggesting a shift toward an immunosuppressive microenvironment. gastric cancer cells exploit ccl5, not only for their own growth, but also to assist in evasion of the host immune system. ccl5 serum levels correlate with the clinical stage and treatment with ccl5 promotes tumor growth. gastric cancer cells stimulate cd4 + t lymphocytes to secrete ccl5 and they may also induce fas - fasl - mediated apoptosis of cd8 + t lymphocytes using ccl5. the conclusion is that the ccl5/ccr5 axis seems associated with gastric cancer progression due to increased growth and metastasis formation. the ccl5/ccr5 axis plays also a role in colon cancer since ccl5 and its receptors are overexpressed within primary as well as liver and pulmonary metastases compared to healthy tissues. ccl5 increases the in vitro growth and the migratory responses of colon cancer cells from both human and mouse origins. in addition, systemic treatment of mice with neutralizing anti - ccl5 antibodies reduced the extent of subcutaneous tumors, liver metastases, and peritoneal carcinosis. more recently, a novel mechanism of immune escape mediated by ccl5 was defined by chang.. knockdown of ccl5 from ct26 mouse colon tumor cells decreases apoptosis of tumor - infiltrating cd8 + t cells and reduces tumor growth in mice. here, ccl5 not only promotes migration of t - reg cells to tumors but also enhances the killing ability on cd8 + t cells. this augmented function is associated with the increased release of tgf- by t - reg cells. while a treatment with tak-779, a ccr5 antagonist, only partially compromises colon progression, ccl5 neutralization renders the tumors more sensitive to a pdgfr-directed strategy in mice. it is of note that this combination regimen offers the greatest protection against liver metastases and fully suppresses macroscopic peritoneal carcinosis. the conclusion is that ccl5/ccr5 signaling recruits t - regs which in turn eliminate cd8 + t cells, thereby defining a novel mechanism of immune escape in colorectal cancer and pointing to the potential value of ccl5 as a therapeutic target. the ccl5/ccr5 axis is involved also in prostate cancer (pca) progression : both are expressed in human prostate cancer (pca) cell lines, primary cultures of prostatic adenocarcinoma cells, and pca tissues. ccl5 stimulates pca cell proliferation and invasion and both are inhibited by the ccr5 antagonist tak-779. ccl5 increases pca proliferation in synergy with il-6 and it is also induced by the antibody - mediated aggregation of the prostate specific membrane antigen (psma). psma is a type - ii integral membrane protein capable of activating the nf-b transcription factor, predominantly localized to the epithelial cells of the prostate gland and whose expression increases several fold in high - grade prostate cancers and in metastatic and in androgen - insensitive prostate carcinoma. serum ccl5 levels do not differ among prostate cancer patients with or without paclitaxel resistance but the expression of the ccr1 receptor increases in paclitaxel - resistant pc3 prostate cancer cells. interaction between ccr1 and ccl5 promotes the invasion of taxane - resistant pc3 prostate cancer cells by increasing the secretion of mmp-2 and -9 via erk and rac activation suggesting that ccr1 could be a novel therapeutic target for taxane - resistant prostate cancer. ccl5 expression is detected not only in malignant ovarian biopsies, but also in normal biopsies, with minimal expression in ovarian cancer cell lines. the cell types expressing ccl5 in the biopsies are not yet determined, but it is likely that infiltrating leukocytes constitute the major origin of this chemokine in ovarian tumors. however, recently long. demonstrated that ccl5 is expressed in ovarian cancer stem cells (cslcs) characterized by the expression of cd133 antigen that identifies a specific subpopulation of human ovarian cancer cell line and ovarian cancer tissue in which migration and invasion are particularly enhanced. in comparison to cd133-negative non - cslcs, ccl5 and its receptors, ccr1, ccr3, and ccr5, are consistently upregulated in cd133-positive cells, and blocking of ccl5, ccr1, or ccr3 effectively inhibits the invasive capacity of cslcs. the enhanced invasiveness is mediated through nf-b activation along with elevated mmp-9 secretion, suggesting that the autocrine activation of ccr1 and ccr3 by ccl5 represents one of the major mechanisms underlying the metastatic property of ovarian cancer cells. evidence supporting an association between ccl5 and ovarian carcinoma progression was also provided by a study analyzing chemokine levels in plasma of patients at different stages of disease. ccl5 levels are higher in ovarian cancer patients than in patients diagnosed with benign ovarian cysts and elevated in stages iii - iv of ovarian cancer compared to stages i - ii. ccl5, along with ccl3 and ccl4, is present in ascitic fluids of ovarian carcinoma patients, and their levels positively correlate with the extent of t lymphocytes infiltration. ccr5 and ccr1 are mainly detected in t lymphocytes and monocytes but only low expression of ccr5 is detected in the tumor cells [26, 91 ]. cancer - associated fibroblasts (cafs) are fibroblasts altered by the continuous exposure to cancer cells residing within the tumor microenvironment. cafs promote cancer cell invasion, proliferation, and metastasis by secreting cytokines and chemokines, which stimulate receptor tyrosine kinase signaling and epithelial - mesenchymal transition (emt) programs. the cultivation of ovarian cancer cells with normal fibroblasts generates cafs possibly through the secretion of molecules that regulate the expression of mirnas, noncoding rna molecules that regulate gene expression at a posttranscriptional level. the cross - talk between ovarian cancer cells and fibroblasts decreases mir-31 and mir-214 and increases mir-155 expression, reprogramming normal fibroblasts into tumor - promoting cancer - associated fibroblasts. ccl5 is a key target of mir-214 and the downregulation of mir-214 increases ccl5 production, leading to increased tumor growth. anti - ccl5 antibodies block the effect of cafs on tumor growth and cell migration and ccl5-transfected normal fibroblasts increase the invasion of ovarian cancer cells, suggesting that ccl5 is a candidate effector molecule in cafs, contributing to tumor cell recruitment and growth. the conclusion is that ccl5 is a protumorigenic chemokine and a key target of mir-214, thus showing that microrna perturbation in the stromal microenvironment can affect tumor growth by increasing the secretion of ccl5 by cafs and suggesting that ccl5 is a possible therapeutic target in ovarian cancer. however, at present several outstanding questions remain and the roles played by ccl5 and its receptors in ovarian cancer are far from being resolved. many additional aspects should be studied in this disease since they may provide important considerations and new strategies for therapeutic intervention. a fundamental objective in cancer therapy is to disrupt the interactions leading to tumor growth or to the formation of a protumorigenic and immunosuppressive microenvironment. accordingly, our knowledge on the role of chemokine receptors in proliferation and invasion of malignant cells and the role of chemokines in the recruitment of tumor - promoting myeloid cells or lymphocytes could be exploited in new approaches to treatment. ccr5 is an essential coreceptor for hiv virus entry to host cells and has therefore become an attractive target for anti - hiv therapeutics development. a number of specific small molecule ccr5 antagonists that are being used as antiviral therapies, but are also effective in blocking ccr5 signal transduction, were identified by high - throughput screening efforts. maraviroc and vicriviroc are ccr5 antagonists that exert potent blocking activities for chemokine function and hiv entry. there are several lines of evidence suggesting possible clinical applications of ccr5 antagonists in cancer treatment. maraviroc or vicriviroc reduces in vitro invasion of basal breast cancer cells without affecting cell proliferation or viability [95, 96 ]. maraviroc, that has already been licensed by fda for the use in humans, prevents the development of hepatocellular carcinoma in a mouse model and decreases pulmonary metastasis in a preclinical mouse model of breast cancer [62, 96 ], suggesting that ccr5 antagonists could be used as an adjuvant therapy to reduce the risk of metastasis in patients with the basal breast cancer subtype. the nonpeptide ccr5 antagonist tak-779 is a small molecular weight quaternary ammonium derivative, that binds exclusively to ccr5. it inhibits hiv infection but also the ccl5-induced proliferation and invasion of pca cells ; this suggests that this antagonist may potentially be an effective inhibitor 9 of tumor growth and progression. anibamine [98, 99 ] is the first natural product reported as a ccr5 antagonist and thus provides a novel structural skeleton distinct from other lead compounds that have generally been identified from high - throughput screening efforts. anibamine produces significant inhibition of pca and ovarian cancer cell line ovcar-3 proliferation without any significant cytotoxicity in nih 3t3 fibroblastic cells [99, 100 ], suppresses adhesion and invasion of the highly metastatic m12 pca cell line, and decreases pca growth in mice [98, 99 ]. based on these results, anibamine and also one of its synthetic analogues are potential leads to develop novel agents against prostate and ovarian cancer. anibamine is currently undergoing further preclinical characterization [99, 100 ]. inhibition of ccl5 secretion by cancer cell or by the tumor microenvironment may represent an additional system to affect cancer progression. mscs are recruited by developing breast tumors where they can enhance the metastatic potential of weakly tumorigenic breast cancer cells through the secretion of ccl5. zoledronic acid significantly affects the secretion of ccl5 and interleukin 6 in mscs suggesting that the drug could contribute to antitumor activity by affecting the ability of mscs to interact with breast cancer cells. alternatively, chemotherapy drugs could affect both proliferation and the formation of an immunosuppressive microenvironment by decreasing the secretion of ccl5 by cancer cells, as reported for the pi3k-specific inhibitor gs-1101 in chl cells. another therapeutical modality that deserves some consideration deals with the potential utilization of the cross - talk between cancer cells and cellular constituent of the microenvironment. along this line we recently found that the egfr - tyrosine kinase inhibitor gefitinib negatively affects egfr activation by pc3-cm leading to decreased secretion of ccl5 by mscs. overall, anti - ccl5 drugs could affect both tumor cell proliferation and/or the formation of an immunosuppressive microenvironment by decreasing the secretion of ccl5 by cancer cells the investigation of the roles played by ccl5/ccr5 in tumor development and metastasis is only in its infancy. while promalignancy effects are strongly implicated in mm and breast cancer, their contribution to other malignancies such as chl, melanoma, gastric, prostate, and ovarian and colon cancer deserves further studies. furthermore, one has to take into account the fact that the ccl5/ccr5 axis acts in conjunction with other chemokines to affect the malignant phenotype (e.g., the cxcl12/cxcr4 pair), exemplifying the multifactorial nature of malignancies and the need to target several mediators simultaneously. also, in considering ccl5/ccr5 as therapeutic targets, we should evaluate the effects of anti - ccl5/ccr5 treatments on the immune integrity of the host. the optimal therapeutic modalities would have to accommodate two opposing demands : the need to inhibit the detrimental involvement of ccl5 and ccr5 in specific malignant diseases protecting their potentially beneficial activities in immunity, including the anticancer immune responses. overall, our current knowledge leads us to suggest the ccl5/ccr5 axis as a potential therapeutic target in several cancer diseases. however, bringing this proposal into practical application requires further research to more clearly elucidate the effects of ccl5 on cancer progression and the formation of an immunosuppressive microenvironment to insure that such treatments are supported by the appropriate rationale. finally, as postulated by schall and proudfoot, the right target selection, time of intervention, and, in particular, functional dose may be the key to developing successful chemokine - targeted drugs not only for inflammatory diseases but also for cancer. | until recently, inflammatory chemokines were viewed mainly as indispensable gate keepers of immunity and inflammation. however, updated research indicates that cancer cells subvert the normal chemokine system and these molecules and their receptors become important constituents of the tumor microenvironment with very different ways to exert tumor - promoting roles. the ccr5 and the ccl5 ligand have been detected in some hematological malignancies, lymphomas, and a great number of solid tumors, but extensive studies on the role of the ccl5/ccr axis were performed only in a limited number of cancers. this review summarizes updated information on the role of ccl5 and its receptor ccr5 in cancer cell proliferation, metastasis, and the formation of an immunosuppressive microenvironment and highlights the development of newer therapeutic strategies aimed to inhibit the binding of ccl5 to ccr5, to inhibit ccl5 secretion, or to inhibit the interactions among tumor cells and the microenvironment leading to ccl5 secretion. |
left ventricular outflow tract obstructions (lvotos) encompass a series of stenotic lesions starting in the anatomic lvot and may involve parts of the aorta. obstruction may be subvalvar, valvar, or supravalvar and are usually with associated congenital anomalies. these lesions impose increased afterload on the left ventricle and can result in hypertrophy and eventual dilatation and failure of the left ventricle. supravalvar aortic stenosis (svas) is the rarest of all forms of lvoto, which has been reported to be associated with william 's syndrome. a 27-year - old filipino male began to experience easy fatigability accompanied by dyspnea on exertion, orthopnea, paroxysmal nocturnal dyspnea 1-year prior to consultation. there was a progression of symptoms and patient eventually sought consult and was said to have valvular heart disease. past medical history and family history were unremarkable. physical examination showed he had intact mentation and was coherent. cardiac findings showed a dynamic precordium, a displaced apex beat at the 6 intercostal space left midclavicular line, with lv heave. a harsh 3/6 systolic murmur is heard at the 2 right intercostal space which also radiates to the carotid area. a diagnostic evaluation showed left ventricular hypertrophy by voltage criteria as well as an enlarged heart with left ventricular prominence on chest x - ray. there was also concentric left ventricular hypertrophy with severe hypokinesia and depressed global systolic function (29% by simpson 's) and doppler evidence of grade iii diastolic dysfunction. preoperative transesophageal echo (tee) showed a linear echogenic density just above the aortic valve confirming the finding of svas. the aortic valve cusps are also thickened and fused indicating the presence of a concomitant valvar aortic stenosis [figure 2 ]. the patient eventually underwent aortic valve replacement, excision of the supravalvar membrane and aortic root dilatation with aortotomy and pericardial patch augmentation. there was a note of severe aortic stenosis with a fusion of the aortic valve cusps and calcification of the aortic annulus intraoperatively. postoperative tee revealed an effective orifice area of effective orifice area of 1.59 cm by continuity equation, the mean gradient of 5.4 mmhg ; peak instantaneous gradient of 10 mmhg. follow - up echocardiogram showed a normally functioning prosthetic valve with improvement of wall motion compared to previous study as well as improvement of ejection fraction from 29% to 50% with grade ii diastolic dysfunction. transthoracic echocardiogram showing supravalvar aortic stenosis. note the discrete membrane above the aortic valve (yellow encircled). the sinotubular junction and continuous waveform doppler showed a peak systolic pressure gradient of 135 mmhg transesophageal echocardiogram showed a linear echogenic density above the aortic valve with + 1 aortic regurgitation (blue arrow, left). the aortic valve cusps are thickened with restriction of motion of the noncoronary cusp and right coronary cusp creating an echo - free space, indicating a concomitant valvular aortic stenosis (right) svas is by far the rarest form of lvoto, reportedly accounting for 0.6 up to 6% of cases although the true incidence is unknown. it usually occurs as a feature of william 's syndrome, which is characterized by elfin facies, mental retardation, and hypercalcemia. a familial form without features of william 's syndrome inherited in an autosomal dominant pattern and rarely in sporadic patients without a family history. genetic studies have demonstrated that the forms of supravalvar as are caused either by mutations or deletion of the elastin gene located on chromosome 7q11.23. histologic studies have shown diseased media with an increased collagen content and reduced elastic tissue in the form of broken and disorganized elastin (elastin arteriopathy). the reported incidence of william 's syndrome is 1/20000 to 1/50000 and can occur either in an autosomal dominant or sporadic form. our patient did not have features of this disorder and family history was unremarkable, so he probably had the sporadic form. there are three recognized morphologic varieties, the most common type being the hourglass (segmental) variety which occurs in some 66% of cases, and in which there is gross thickening of the media often associated with intimal fibrous hyperplasia. the most unusual variety is the membranous type (13% of cases) consisting of a simple fibrous membrane with a single perforation allowing for blood flow. clinical manifestations related to supravalvar disease are due to the left ventricular outflow obstruction. coronary perfusion is impaired not only by the systolic stress brought about by the hypertrophy but also with diastole being impeded by the supravalvar membrane, which may lead to further subendocardial ischemia, afterload mismatch, and eventually left ventricular dysfunction. the congenital form of svas (without william 's syndrome) has been reported to be associated with other abnormalities such as coarctation of the aorta, patent ductus arteriosus, atrial septal defect, ventricular septal defect, atrial septal defect, and mitral valve abnormalities (barlow syndrome). the incidence of isolated svas is unknown, but it is believed that this form is rarer than the one associated with william 's syndrome. a multicenter retrospective study analyzed the outcomes of 113 patients with svas, 45% did not have william 's syndrome. nyha class ii or greater, mitral valve involvement and a gradient of > 50 mmhg were predictors of operative and postoperative events. another interesting aspect of our case is the presence of a concomitant valvar aortic stenosis. in the study by greutmann., 22 of the 51 patients without william 's syndrome had other concomitant lesions including aortic valve stenosis in 14 of the 22 patients. the supravalvar portion of the disease has profound effects on the architecture and function of the aortic valve itself. this emphasizes the advantage of tee for superior visualization of the aortic valve and provide further detail which can be missed on transthoracic echo that may have implications in surgical management. the postoperative outcomes of patients without any other concomitant genetic or congenital abnormalitis are good. svas is the rarest form of lvoto that is frequently associated with william 's syndrome and rarely in an isolated, sporadic form. | supravalvular aortic stenosis, characterized by narrowing of the ascending aorta above the valve, is the least common form of left ventricular outflow tract obstruction and is usually associated with william 's syndrome. we present a case of a 27-year - old male with isolated supravalvar aortic stenosis (svas) presenting with heart failure. this case underscores the fact that in rare cases sporadic svas can occur in isolation without the classic findings of william 's syndrome and highlighting the importance of integration of clinical and echocardiographic recognition for definitive management. |
history of medicine is an extensive and a very complex science, with many interesting and even fascinating aspects, which should be studied carefully and with no partisan bias. this paper is a plea for studying history of medicine in the higher medical education. as 2017 marks 125 years since valeriu lucian bologa (18921971) the first romanian professor of history of medicine was born, we bring thus a homage to his memory. we publish this paper in clujul medical journal, because bologa was professor and head of department of the history of medicine at the cluj faculty of medicine for more than three decades (19301962) and also a member of the editorial board of this publication. the evolution of medicine has interested many historians of medicine in the past and new arguments continue to be brought about the need of its study. it is necessary to show that the formative role of the history of medicine has been discussed since the second half of the nineteenth century. after a century, emphasizing the significance of the history of medicine in the training of the future doctors, v. l. bologa evidenced several objectives : to give to physician the possibility to refresh and enlarge his general culture ; to focus his attention on one of the most beautiful chapters from the history of civilization and to promote respect for the past of medicine for its outstanding protagonists. however, it is strange to observe that the interest of some students is not sufficiently developed for learning the history of medicine. one reason is the fact that the present time has its focus on what is the immediate present and what is to be the future. in this context, farokh erach udwadia put the question it is therefore worthwhile to give the reader a glimpse of the recent past ? i do believe so, for the past in any field of endeavour permeates the present and lies buried within the future. referring to history of medicine, he added : to gain a proper perspective, the never - ending canvas of medicine is best viewed in its entirety the past, the present, the changing unfinished future. the misunderstanding regarding the formative role of history of medicine for students can be explained in another way. the period of accelerated progress involves the appearance of many professional notions, new conceptions etc. their consequence is the need to introduce new topics or types of lectures in the academic curricula. implicitly, they lead to a compression of classical subjects of study, although they could be important for the professional training of students or for their general culture. referring directly to the history of medicine, the study of the past of medicine permits a better understanding of its present and gives the possibility to do develop strategies for its future. studying history of medicine, students learn how to understand and to think different medical events from various perspectives : how to correlate various medical profiles apparently without connection with each other, or how the same discovery may occur several times at intervals of centuries and without continuity in time. for example, students can understand how the important anatomist giovanni battista morgagni (16821771) can be regarded as the father of modern pathology. another significant example is that students learn that the cataract surgery which is considered an operation specific for modern times was practiced in antiquity and mentioned by aulus cornelius celsus (c. 25 bc c. 50 ad) and later, in the middle ages, by abulcasis (9361013). learning the history of medicine, students reach a certain level of understanding, like how it was possible that galen s influence on european medicine lasted nearly fifteen centuries after his death. the correct analysis of the past of medical science allows us to understand not only the progressive phases of medicine, but also the periods of stagnation or regression. this is a significant advantage, because knowing the negative experiences of the past, future errors can be avoided. an interesting point of view was discussed by jacalyn duffin (b. 1950) : the history of medicine offers a conceptual tool for learning about medicine. even if they last studied humanities in high school, they soon grasp the thrill and an adventure of a debate over questions and context. in reaching for this modest goal, students learn something about the past ; however, they can select the events that seem more relevant for their own personal lives and career goal. the effort to memorize is useful, because it will help students to learn easier some diseases and syndromes having proper names. it is more useful to remember the century or the historical period in which different personalities lived, rather than their years of birth and death. also, not all titles of books they wrote are important to be kept in mind, but only those that marked the progress of medicine. for example, is very useful to memorize the title de humani corporis fabrica of andreas vesalius (sixteen century), because it marked a turning point in the evolution of anatomy. although very few, there are students who consider history as a boring and unimportant subject. this is due to the fact that they are not convinced by what means history. this is a consequence that during school years, history is presented in a thematic approach. thus, it is difficult for future students to understand that the correct study of the history is the past of mankind since ancient times till today, according to the specifics of geographic areas and of communities. ioan - aurel pop (b. 1955) shows that : the facts of the past, removed from space and time have no historical relevance. being dispersed, they serve the political discourse, the writer, the musician, filmmaker, essayist, philosopher, etc., but these are not history. to teach the history of medicine is a great responsibility, being necessary to analyze every medico - historical aspect in various ethical, socio - economic, cultural etc. perspectives. as giorgio zanchin (b. 1945) puts into evidence : if history is understood as a succession of events determined by specific causes, with specific consequences that vary according to social, economic, and political conditions, a historical analysis is essential for a dynamic interpretation of scientific theories in a social - cultural context of reference. in a book exploring the continuities and discontinuities in medical thought and practice, keir waddington shows that this approach encouraged readers to think about how medicine has been used to fashion and refashion views of the body and disease ; how it informed access to healthcare and welfare policies ; and how this was related to different political, cultural, intellectual and socioeconomic contexts. about his volume entitled an introduction to the social history of medicine he noted that it focuses not on individuals, institutions or discoveries, but on a comparative examination of key theme in the social history in europe. there is also the approach of history of medicine in terms of the conditions in which the discoveries were made. michael t. kennedy (b. 1938) noted in the introduction of his book entitled a brief history of disease, science and medicine that much of what medical students learned from the past has now been shown to be in error. for that reason, his concept of history of medicine includes other subjects than those in a thus, he gave explanations about his interest in how infectious diseases evolved and [i ] think it important to understand this aspect of science to make sense of the story of smallpox in the new world and syphilis in the old. regarding the history of medicine presented in essays we consider that it can be correctly understood only by those who have a solid knowledge of history. for example, this type of approach can be used with certain intentions, as olivier faure (b. 1953) did, gathering his articles previously published in various journals. however, this approach is limited only for shorter periods of time and is focused on some social aspects of medicine. an absence of mastery of academic codes or contempt for them, this propensity to direct language is the sign of the enthusiasm and passion with which i have always approached the subjects i have dealt with. a book of history of medicine that aims to include more subjects, such as the evolution of different medical discoveries, the evolution of techniques and medical innovations, controversies in medicine etc. this gives the authors the responsibility, but also the opportunity to approach the problems in their own way. this multiple approach can have, as result, a book which is it not unitarily written.. furthermore it could give rise to heated debates on issues related to these thematic problems. discussing the importance of the scientific research in history of medicine, john l. thorthon reveals that the history of medicine has been studied for centuries, but remains a fluid subject. fresh facts can reveal new fields of research, and even result in a re - evaluation of the subject. a misinterpretation may have led to false assumptions which in turn have misled later writers, resulting in errors which have been perpetuated for centuries. only comparatively recently have professional medical historians, armed with an appreciation of both medical knowledge and a background of social history, attempted to unravel the intricacies of the development of medical progress. at the end of our paper, we consider adequate to remember some ideas of nicolae vtmanu (18971977) and gheorghe brtescu (b. 1923) : knowing the past of this exciting science [history of medicine ] is meant to attract alike the young man who strives to embrace the medical profession, and the one that deepens it with passion : it [history of medicine ] is useful for the physician who needs a [... ] quick and safe orientation, as for the inexperienced scholar, sensitive to all what is noble, profound and useful in human activity. the study of the past of medicine permits a better understanding of its present and gives the possibility to develop adequate strategies for its future. the study of the history of medicine offers the students the possibility to correlate various medical profiles seemingly without connection with each other. to teach history of medicine is a great responsibility, being necessary to analyze medico - historical aspects in various ethical, socio - economic and cultural perspectives. there are different ways of understanding the roles of the history of medicine regarded from the traditional perspective to the contemporary point of view. fresh medico - historical facts can reveal new fields of research, and even a re - evaluation of the same subject. | history of medicine is an extensive and very complex science. in a simple and classical understanding, it has an informative and associative role. although it is not easy for students to understand the multiple implications of the history of medicine, its importance becomes more evident during their academic formation. the students must be persuaded particularly about the ethical and cultural values that history of medicine has in their training. furthermore, history of medicine participates in creating the necessary perspective for shaping the future of medicine in the next decades. this is, perhaps, the most interesting role that the history of medicine should play from the modern point of view of students and young physicians. this paper presents different ways of understanding the roles of the history of medicine regarded from the traditional perspective to the contemporary point of view. |
prolonged obstructed labor is one of the major direct causes of maternal mortality in nigeria, preceded only by obstetric hemorrhage, sepsis (abortion), and toxemia of pregnancy, in that order [1, 2 ]. indirect causes of maternal deaths are conditions which complicate preexisting maternal illnesses or disease conditions. they emerge in the course of the pregnancy, like malaria, viral hepatitis, and human immunodeficiency virus infection / acquired immunodeficiency syndrome (hiv / aids). it has been reported that about 1 - 2% of obstructed labor are mechanically caused in the second stage of labor. in 2005, the world health organization (who) estimated maternal mortality rate (mmr) for nigeria to be 1,100 deaths per 100,000 live births. however, a more recent facility estimate (2010) of mmr for calabar metropolis stood at 1,500 per 100,000 live births. the latter figure is astronomically wide from the who recent global mmr estimate (2011) of 840 deaths per 100,000 live births, with the obvious implications that coping mechanisms for obstetric patients in labor, possibly in terms of availability of trained man - power, befitting healthcare facilities, government funding to maternity services, and other indirect contending issues like economic circumstances of the people and means of transportation, have all depreciated remarkably in calabar. maternal mortality occasioned by obstructed labor is preventable and there are convincing reports that the acquisition of the knowledge and utilization of the partograph, would result in an impressive fall in its incidence, which contributes about 810% of maternal deaths [79 ]. the partogram was introduced through the pioneering work of philpott and castle in 1972, used convincingly by studd in 1973, and later modified and adapted for global usage in all settings by the who in 1988, hence its conceived applicability in this study. it is a graphic representation of the events of labor, depicting maternal and fetal circumstances, plotted against time in hours [79 ]. correct utilization of the partograph will stem prolonged and/or obstructed labor in all settings, thus reducing significantly the sequelae of maternal and fetal wastages [3, 9 ]. maternal mortality has been extensively studied in calabar with very poor maternal mortality rates in both situations [5, 11 ]. there is as yet no study that compares knowledge and utilization of the partograph among the different user groups in this environment, to underscore the proper applicability of this basic labor monitoring instrument or the lack of it. the current study was therefore carried out to determine and compare the factors that influence the utilization of the partograph a simple labor monitoring tool among nonphysician obstetric care workers in the primary, secondary, and tertiary healthcare delivery levels in calabar, nigeria. the range of obstetric care workers (ocws) in tertiary and secondary healthcare delivery levels in the urban settings in nigeria is wide. it includes obstetricians, family physicians, general duty doctors, nurses and midwives, auxiliary nurses, community health officers, and community health extension workers (chews). on the contrary, at the primary care level, the physician compliment of this list is often lacking while the inclusion of nurse aids, junior community health extension workers (jchews), and traditional birth attendants (tbas) becomes evident. studying the activities of ocws with regard to their knowledge and utilization of the partograph at the primary care level side by side with the secondary and tertiary levels in calabar, therefore, would readily unveil some of the reasons for maternal wastages which have continued to be an unsurmountable problem in our environment till date. the results of this study should provide scientific data that would enable the formulation of policies aimed at improving mmr in our environment, through continuing medical and nursing professional development on obstetric care giving, in order to meet the united nations millennium goal 5, slated for 2015. furthermore, this study opens a lacunar of challenge for the family physician in that he is the medical expert whose services can be seen in the three tiers of healthcare delivery in the obstetric care environment in our setting : as a resident doctor in the tertiary healthcare system, as the officer - in - charge of the system in some secondary healthcare delivery facilities, and as the one to receive referrals from primary care centers in such secondary settings in obstetric care giving. this study was conducted in the department of family medicine, university of calabar teaching hospital (ucth), calabar, nigeria. it involved the maternity unit of the obstetrics and gynecology department of the ucth as a tertiary healthcare center ; the general hospital (gh), calabar, as a secondary healthcare center ; and three primary healthcare (phc) centers, in calabar. the ucth is the only tertiary healthcare delivery center in calabar with one hundred and ten obstetric beds and over 2000 deliveries are taken here annually. the general hospital in calabar is the only government owned secondary healthcare facility in the metropolis and the maternity unit has twenty - four of the total of its one hundred bed capacity. the three phc centers used in this study, which were determined by random selection, are among the twelve in the metropolis. their bed capacities are five, seven, and eight, and they take an average of eighty - four, one hundred and eight, and one hundred and twenty deliveries annually, respectively. it lies along latitude 458 north of the equator and longitude 820 east of the greenwich meridian, within the south - south geopolitical zone of the country. it has a population of 372,848 by the nigerian national population and housing census of 2006. this study was a descriptive study using self - administered semistructured questionnaire designed to determine the knowledge and utilization of the partograph in the three levels of healthcare in calabar, nigeria. two hundred and ninety (290) consenting nonphysician obstetric care workers (ocws) were recruited for the study in all three tiers of the healthcare delivery system : primary, secondary, and tertiary in the calabar metropolis. all nonphysician obstetric care workers in the department of obstetrics and gynecology of the university of calabar teaching hospital who consented were purposively recruited to participate in the study. informed consent was obtained from the 137 respondents from the ucth before they were served with the questionnaire. the same procedure was followed at the general hospital, calabar, and out of 133 consenting respondents who were served with the questionnaire, 130 responded. of the 12 phcs in calabar metropolis, three were randomly selected and 30 consenting nonphysician ocws were served with the questionnaire, out of which 28 responded. the return rate of questionnaires from the three levels of care was 96.7% (290). descriptive statistics (frequencies, proportions, means, percentages, tables, and standard deviation) were used to summarize variables, while inferential statistics (chi square test) was used to test the significance of association between categorical variables with the level of significance set at 5%. the test - retest reliability of the questionnaire had been carried out in a previous study. consequently, a score of > 12 was rated as good knowledge and a score < 12 was rated as poor knowledge of the partograph (table 9). ethical issues on this study were addressed by the university of calabar teaching hospital health research ethics committee and the health research ethics committee of the cross river state ministry of health, calabar. two hundred and ninety (290) consenting nonphysician obstetric care workers (ocws) participated in this study. forty - five point five percent (45.5%) of this number was drawn from the university teaching hospital (tertiary center), 44.8% from the general hospital (secondary center), and 9.7% from three primary healthcare centers in calabar metropolis. there was a female preponderance at a ratio of 12 : 1 with 77.5% of the total female subjects being nurse / midwife. three of the subjects were less than one year in the service while ten were getting near their retirement duration in service (35 years). about two - thirds of the respondents in the three levels of care were unable to identify the correct definition of the partograph as a simple graphic recording of labor and salient conditions of the mother and fetus against time in hours. in table 3, which assessed the use of the partograph as a preventive tool, the results show that 62.4% of the participants indicated that it can reduce maternal morbidity, 73.8% indicated that it can reduce maternal mortality, 53.4% indicated that it can reduce child morbidity and 69.3% indicated it can reduce newborn mortality. however, a larger percentage of the respondents, majority of them, nurses / midwives who did not know about these preventive functions, were working at the tertiary level of care. a detailed assessment of the graphic representation of normal labor on the partograph was also done (table 4). for example, only 29% knew that the graph should fall to the left of the alert line and 49% did not know. the category of assessment made with the partograph was also studied (table 5). most of the respondents indicated that the partograph can be used in detecting prolonged labor (71.0%), poor progress of labor (71.0%), insufficient uterine contractions (62.1%), satisfactory progress of labor (62.8%), suspected fetal distress (60.7%), need for labor augmentation (60.3%), abnormal fetal heart rate (58.6%), need for caesarean delivery (57.2%), obstructed labor (56.6%), and dehydration in the mother (41.0%). the knowledge base of the respondents (mainly nurses and midwives) was consistently greater among the workers in the general hospital (a secondary health facility) than the university teaching hospital, a tertiary health facility. factors militating against the use of the partograph in labor monitoring at all levels of healthcare (table 6) were as follows : little or no knowledge (79.0%), nonavailability of the partograph (58.6%), shortage of staff (46.9%), and time consuming (24.1%). the relationship between knowledge, years of experience with the utilization of the partograph within the practice level, and partograph availability is represented in table 7. knowledge of the partograph had a significant relationship with its utilization among workers in ucth (= 38.96, p 0.0001) and general hospital (= 12.05, p 0.0001). partograph availability also had a statistically significant relationship with its utilization in the three levels of health facility, ucth (= 52.5, p 0.0001), general hospital (= 56.5, p 0.0001), and phc facilities (p 0.0001). table 8 shows that nurse / midwife working at all levels were more knowledgeable on the use of the partograph compared to other ocws : ucth (= 26.5, p 0.0001), general hospital (= 7.44, p 0.006), and phc (fisher 's exact test ; p = 0.004). also, there was a statistically significant relationship between previous partograph training among ucth (=.4.31, p 0.04) and gh (= 9.43, p 0.002) obstetric care workers. the phc workers ' previous training (fisher 's exact test : p = 0.43) did not have any significant relationship with their knowledge. in this study, knowledge of the partograph and its availability had a significant relationship with its utilization. this finding is similar to studies conducted in ogun state, in south west nigeria, bayelsa in south - south nigeria, and enugu in south east nigeria. also, previous training on the partograph in school and being a trained nurse / midwife show significant association with a better overall knowledge of the partograph. this has been identified in other studies where nurses at the tertiary levels had better knowledge due to periodic seminars and in - service training compared to their colleagues at the private health facilities and phc centers [1417 ]. this study identified the following as factors militating against the use of the partograph : little or no knowledge on the partograph (79%), nonavailability of the instrument in labor wards (58.6%), and shortage of staff (46.9%). interestingly, 75.9% indicated that it was not time consuming, which seems a contradiction because with staff shortages, an additional task of using the partograph would normally be seen as time consuming especially if the benefits of the instrument are not well appreciated. this finding is significant and calls for hospital and ministry of health officials to make sure the instrument, a cost effective tool in labor monitoring, is made available in all maternity centers. this study used nonphysician obstetric care workers from the three levels of healthcare in calabar metropolis. the reason is because these categories of workers, especially nurses and midwives form the bulk of skilled birth attendants in nigeria and their knowledge and utilization of this simple preventive tool will go a long way in reducing maternal and neonatal morbidity and mortality. nigeria is one of the six countries in the world contributing about 10% to global maternal mortality statistics and also one of the countries that appears not to be on the road map of achieving the mdg 5 in 2015. many of the respondents (70.3%) were not able to correctly define the partograph even when the questions made available to them were quite simple. also, the detailed knowledge of the component parts of the partograph with regard to normal labor tracing, its relationship to the alert and action lines, and number of uterine contractions and duration of strong contractions was very poor indeed. several studies in nigeria also indicate the general overall poor knowledge of the partograph [1417 ]. interestingly, the workers at the general hospital (the secondary healthcare facility) had a better overall knowledge than those at the university teaching hospital, a tertiary health facility. this finding is not in agreement with some studies in south west nigeria [15, 17 ] where the knowledge was higher among tertiary health workers. however, a study in ethiopia did show that workers in the health centers had good knowledge and better utilization than workers in the hospital. since the partograph has been recommended by who as a preventive tool in labor monitoring in all public institutions [9, 20 ], especially in low resources countries, it is important that these health workers be adequately knowledgeable on which aspect of prevention the partograph is most useful. in this regard, this study also showed that workers at the secondary health facility had overall higher knowledge on the benefit of this instrument with respect to assessment for prolonged labor, obstructed labor, poor progress of labor, insufficient uterine contractions, suspecting fetal distress, abnormal fetal heart rate, the need for labor augmentation, and caesarean deliveries than those working at the university teaching hospital. the likely explanation for this is that health workers at this level use the instrument more regularly to identify abnormal labor patterns early so they could arrange for timely referral to the doctor since nurses and midwives are the primary birth attendants in all maternities at the primary and secondary health facilities in nigeria. the smallness of the sample size, especially from the phc, would make the estimates and the dependent and independent variables unstable and therefore undetected. however, a larger size from the phc in the entire state (geopolitical zone / local government areas) will be a good study among phc workers ; many of them are nurse aids, chews, jchews, and ward orderlies, who form the bulk of the unskilled birth attendants in nigeria. secondly, the study does not include obstetric care workers in private hospitals, so, the findings can not be generalized for calabar metropolis. thirdly, distortions can occur with the use of self - administered questionnaires ; the social desirability bias where the respondents will tend to give answers they feel is socially desirable to the researchers, in case this information will get to the authorities at the health ministry. this study implicates lack of detailed knowledge of the partograph, nonavailability, and poor staff strength as factors militating against optimal utilization of this very important preventive labor monitoring tool in calabar metropolis. the importance of training and experience is highlighted in this study since an association between good knowledge and utilization was established. working in the secondary healthcare level and the phc was related to having overall higher knowledge of the partograph in this study. this means that ocws at these two levels utilized the partograph more than their counterparts in the teaching hospital, possibly because they needed it to guide them in early referral which is not necessarily a problem in the teaching hospital. the findings of this study underline the fact that the knowledge and inclination to use this instrument should be reinforced through periodic regular professional education by way of unit presentations, seminars, and workshops. the partograph charts should be made available by the hospital management for use at all times in the labor rooms in line with who recommendation and safe motherhood programs. the authors recommend periodic in - service training for all ocws, the provision of partographs in labor rooms in all maternities in the study environment, and regular supervision and mandatory health facility policies from the hospital administration regarding the use of the partograph (tertiary healthcare), state ministry of health (secondary healthcare), and local government health departments (phc clinics) for the safety of mothers in calabar metropolis as also expected for all other parts of nigeria. | the challenge to maternal well - being with associated maternal wastages especially in labor has remained unsurmountable across the three tiers of health care delivery in nigeria. this study aimed to determine and compare the factors that influence utilization of the partograph in primary, secondary, and tertiary health care delivery levels in calabar, nigeria. this was a descriptive study, using a self - administered semistructured questionnaire on 290 consenting nonphysician obstetric care workers, purposively recruited. the mean age of the respondents was 40.25 8.68 with a preponderance of females (92.4%). knowledge of the partograph and previous partograph training had statistically significant relationship with its utilization among respondents from the tertiary and general hospitals. the level of knowledge was higher among workers in the general hospital than those working in the university teaching hospital. nurses / midwives in the three levels of care were significantly more knowledgeable in partograph use than other nonphysician obstetric care workers. lack of detailed knowledge of the partograph, its nonavailability and poor staff strength in the study centers were factors militating against its ease of utilization. the authors recommend periodic in - service training and provision of partograph in labor rooms in all maternity wards in our environment. |
listeria, campylobacter, and salmonella species and escherichia coli o157:h7 have been isolated from majority of food - borne outbreaks (chemburu., 2005). they are ubiquitous bacteria widely distributed in the natural environment and in vegetal foods (low and donachie, 1997). the genus of listeria comprises seven species that are l. monocytogenes, l. grayi, l. innocua, l. ivanovii, l. welshimeri, l. murrayi and l. seeligeri. the hemolytic species of listeria such as l. monocytogenes, l. seeligeri and l. ivanovii cause infection in human (lovett and twedt, 1988). l. monocytogenes is considered one of the major foodborne pathogen in human and animals, though l. ivanovii and l. seeligeri are occasionally isolated from human diseases (lovett and twedt, 1988). listeriosis may cause meningitis, encephalitis, septicemia, abortion or gastroenteritis in children, pregnant women, the immunecompromised and the elderly (lorber, 1990). outbreaks and sporadic cases of listeriosis have been associated with various contaminated foods such as milk, raw meat, cheese, meat products, seafood products, and vegetables (gomez., 2014). listeria species are generally susceptible to a wide range of antimicrobials, but the first multiresistant l. monocytogenes strain has been isolated in 1988 (zhang., 2007). since this year, antibiotic - resistant l. monocytogenes isolates have been recovered from food, environment, and human listeriosis cases (zhang., 2007). currently, a -lactam antibiotic (e.g., ampicillin or penicillin) combined with an aminoglycoside (e.g., gentamicin) is the reference therapy for human listeriosis, while the second choice of treatment is vancomycin, erythromycin and trimethoprim - sulfamethoxazole combination for pregnant women or patients allergic to -lactams (hof, 2004). thus, investigation and monitoring of the antibiotic susceptibility of listeria species from different regions of the world is very important for public health (wang., 2013). turkey meat has an important place in poultry meat industry ; however, there is little information on the prevalence and antimicrobial susceptibility of listeria species in turkey meats. the aims of this study were to investigate the occurrence of listeria species in turkey meats and to check the antimicrobial susceptibility of the isolated strains. a total of 115 fresh turkey meat samples were randomly collected from the supermarkets, butchers and restaurants between january and september 2014 in aksaray province, turkey. all meat samples were immediately placed in sterile plastic bags, cooled on ice during transport to the laboratory, and analyzed on the same day for the detection of listeria species. strain isolation and identification a 25 g of each meat sample was transferred to sterile plastic bags containing 225 ml of half - fraser (hf) broth (oxoid, uk) without supplements and homogenized using a stomacher (stomacher 400, france) for 1 min. subsequently, it was incubated 20 for 1 h. then, selective supplement sr-166 (oxoid, uk) was added to hf broth and it was incubated 30 for 23 h. after this step, 0.1 ml of the hf broth was transferred into 10 ml tubes containing fraser broth (oxoid, uk) supplemented by fraser selective supplement (sr156, oxoid, uk) and were incubated at 37 for 48 h. after enrichment, 0.1 ml of the enriched samples were cultured onto duplicate plates of oxford agar (oxoid, uk) supplemented with sr 140e (oxoid, uk) and palcam agar (oxoid, uk) containing supplement sr 150e (oxoid, uk) and incubated at 37 for 48 h. the suspected colonies were identified by gram staining, characteristic colony morphology, hemolytic activity, camp test, and biochemical tests. after identification, listeria isolates were stored at 80 in brain heart infusion broth (oxoid, uk) containing 15% of glycerol. bacterial strains were grown in brain heart infusion broth (oxoid, uk) at 37 for 24 h. after that dna was extracted using the protocol provided in promega wizard genomic dna purification kit (promega, usa). the listeria specific primer pairs were used in pcr for amplification of the prs gene of listeria spp. the sequence of forward primer was 5'-gctgaagagattgcgaaagaag- 3 ' and reverse primer was 5'-caaagaaaccttggatttgcgg-3 '. the pcr mixture was prepared in a total volume of 50 l containing 5 l of 10 x pcr buffer, 1.5 mm mgcl2, 250 m each of the four dntps (fermentas, lithuania), 1.25 u of taq dna polymerase (fermentas, lithuania), 0.5 m of each primer (idt, usa), and 5 l of template dna. the amplifications were performed in a thermalcycler (ependorf, mastercycler gradient, germany) using the protocol reported by doumith. susceptibility to the following antibiotics was determined for all the isolates of listeria by the standard disc diffusion method (national committee for clinical laboratory standards, 1988). briefly, bacterial cultures were grown at 37 for 48 h in tryptic soy broth (tsb, oxoid, uk) and transferred to mueller - hinton agar (oxoid, uk). then, antimicrobial susceptibility test discs were applied and plates incubated at 37 for 24 h. discs containing the following antibiotics were spotted with a 3 cm interval : ampicillin (10 g), cephalothin (30 g), ciprofloxacin (5 g), clindamycin (2 g), chloramphenicol (30 g), gentamicin (10 g), levofloxacin (5 g), moxifloxacin (5 g), meticillin (5 g), oxacillin (1 g), penicillin g (10 g), rifampicin (30 g), trimethoprime - sulfamethoxazole (1.5 - 23.5 g), tetracycline (30 g) and vancomycin (30 g). a total of 115 fresh turkey meat samples were randomly collected from the supermarkets, butchers and restaurants between january and september 2014 in aksaray province, turkey. all meat samples were immediately placed in sterile plastic bags, cooled on ice during transport to the laboratory, and analyzed on the same day for the detection of listeria species. strain isolation and identification were made according to the iso11290 - 1 method (1996). a 25 g of each meat sample was transferred to sterile plastic bags containing 225 ml of half - fraser (hf) broth (oxoid, uk) without supplements and homogenized using a stomacher (stomacher 400, france) for 1 min. subsequently, it was incubated 20 for 1 h. then, selective supplement sr-166 (oxoid, uk) was added to hf broth and it was incubated 30 for 23 h. after this step, 0.1 ml of the hf broth was transferred into 10 ml tubes containing fraser broth (oxoid, uk) supplemented by fraser selective supplement (sr156, oxoid, uk) and were incubated at 37 for 48 h. after enrichment, 0.1 ml of the enriched samples were cultured onto duplicate plates of oxford agar (oxoid, uk) supplemented with sr 140e (oxoid, uk) and palcam agar (oxoid, uk) containing supplement sr 150e (oxoid, uk) and incubated at 37 for 48 h. the suspected colonies were identified by gram staining, characteristic colony morphology, hemolytic activity, camp test, and biochemical tests. after identification, listeria isolates were stored at 80 in brain heart infusion broth (oxoid, uk) containing 15% of glycerol. bacterial strains were grown in brain heart infusion broth (oxoid, uk) at 37 for 24 h. after that dna was extracted using the protocol provided in promega wizard genomic dna purification kit (promega, usa). the listeria specific primer pairs were used in pcr for amplification of the prs gene of listeria spp. the sequence of forward primer was 5'-gctgaagagattgcgaaagaag- 3 ' and reverse primer was 5'-caaagaaaccttggatttgcgg-3 '. the pcr mixture was prepared in a total volume of 50 l containing 5 l of 10 x pcr buffer, 1.5 mm mgcl2, 250 m each of the four dntps (fermentas, lithuania), 1.25 u of taq dna polymerase (fermentas, lithuania), 0.5 m of each primer (idt, usa), and 5 l of template dna. the amplifications were performed in a thermalcycler (ependorf, mastercycler gradient, germany) using the protocol reported by doumith. susceptibility to the following antibiotics was determined for all the isolates of listeria by the standard disc diffusion method (national committee for clinical laboratory standards, 1988). briefly, bacterial cultures were grown at 37 for 48 h in tryptic soy broth (tsb, oxoid, uk) and transferred to mueller - hinton agar (oxoid, uk). then, antimicrobial susceptibility test discs were applied and plates incubated at 37 for 24 h. discs containing the following antibiotics were spotted with a 3 cm interval : ampicillin (10 g), cephalothin (30 g), ciprofloxacin (5 g), clindamycin (2 g), chloramphenicol (30 g), gentamicin (10 g), levofloxacin (5 g), moxifloxacin (5 g), meticillin (5 g), oxacillin (1 g), penicillin g (10 g), rifampicin (30 g), trimethoprime - sulfamethoxazole (1.5 - 23.5 g), tetracycline (30 g) and vancomycin (30 g). a total of 47 listeria spp. were isolated from 47 of 115 (40.9%) raw turkey meat samples. the isolates were distributed between l. monocytogenes (12 isolates), l. innocua (16 isolates), l. grayi (15 isolates) and l. welshimeri (4 isolates). in this study, approximately 41% of meat samples were contaminated with listeria spp. the percentage of listeria contamination in various poultry meat samples ranged from 8% to 99% in previous studies (chen., 2009 ; fallah., 2012 ; (2010) isolated listeria spp. in 21.6% of poultry meat samples in italy. additionally, listeria spp. was identified in 134 of 401 poultry product in iran by fallah. (2012) and in 76 of 160 fresh broiler chicken samples in jordan by osaili. the presence of listeria in raw meats could be the result of environmental contamination by food handlers or fecal contamination during evisceration (fenlon., the incidence of l. monocytogenes was found to be 10.43% in turkey meat samples. this contamination rate is similar to the rates of 12.5% and 12.7% from two previous studies (bilir ormanc., 2008 ; fallah., high incidences of l. monocytogenes were detected in raw turkey meat samples (ojeniyi., 2000 ; wesley., 2002 ; wong., 1990). in usa, wesley. (2002) reported that approximately 38% of turkey meat samples were contaminated with l. monocytogenes. in another study, the prevalence of l. monocytogenes in raw turkey product was found as 17.4% in denmark (ojeniyi., 2000). in taiwan, wong. (1990) isolated l. monocytogenes in 38% of turkey parts. on the other hand, the prevalence of l. monocytogenes in other works ranged from 9.4% to 38% in chicken meat samples (fallah., 2012 ; this difference in the prevalence rates could be because of the sizes and varieties of samples, the used methods, and the sampling times (hansen., 2006). additionally, the presence of l. monocytogenes in raw meats threats the public health and it may cause severe disease in children, pregnant women, the immune - compromised and the elderly (lorber, 1990). other studies indicated that l. innocua was the most common species in poultry meats (fallah., 2012 ; osaili., 2011 ; pasavento., 2010 ; l. innocua and l. monocytogenes are closely related species and they are genetically very similar. it has been suggested that l. innocua is nonpathogenic bacterium, but it become a transferable reservoir of antibiotic resistance for l. monocytogenes (bertrand., 2005). it is interesting to note that 13% of isolates were identified as l. grayi in our work and it was the second common species in raw turkey meats. the resistance to one or more antibiotics has been detected in l. monocytogenes isolates from foods, environment and human cases since the first strain with antimicrobial resistance was isolated in 1988 (gomez., 2014). in the last years, increasing number of antimicrobial - resistant l. monocytogenes isolates has been detected around the world. this indicates that l. monocytogenes rapidly obtains a wide range of antibiotic resistance genes (lungu., 2011). it is known that antimicrobial resistance in l. monocytogenes is mainly caused by mobile genetic elements which are self - transferable plasmids, conjugative transposons, and mobilizable plasmids of other bacterial species such as staphylococcus spp. and enterococcus spp. the level of multi - resistance was higher in l. monocytogenes strains (66.7%) than in l. innocua (62.5%) and l. grayi (53.3%). particularly l. monocytogenes strains are slowly occurring resistant to antibiotics (conter., 2009). in the present study, a high resistance of l. monocytogenes, l. innocua, l. grayi, and l. welshimeri to ampicillin and penicillin that are used to treatment of listeriosis was showed. similarly, ampicillin and penicillin resistant strains were reported in various turkey and chicken meats (ayaz and erol, 2010 ; bilir ormanc., 2008 ; fallah., 2012 ; ycel., 2005). on the other hand, the some researchers have announced a high susceptible of l. monocytogenes isolates to these antibiotics (gomez., 2014 ; kovacevic., 2013 ;, 2011 ; wang., 2013). in our work, 44.7% and 85.1% of the isolates was resistant to meticillin and oxacillin, respectively. in italy, pesavento. besides, meticillin is routinely used in treatment of infections of enterococcus (pesavento., 2010). in this study, all l. monocytogenes isolates were sensitive to fluoroquinolones (ciprofloxacin, levofloxacin, and moxifloxacin) and tetracycline, but l. innocua strains were highly resistant to these antibiotics. the tetracycline and ciprofloxacin sensitive l. monocytogenes isolates were reported in chicken meat samples by some authors (bilir ormanc., 2008 ; gomez., 2014 ; osaili., 2011 ; wang. however, high antimicrobial resistance rate to fluoroquinolones and tetracycline was detected in meat samples in iran by fallah. the sensitivity of l. monocytogenes isolates to some antibiotics which mostly used to treat of listeriosis (rifampicin, gentamicin, and clindamycin) was in agreement with the papers of pesavento. strains were vancomycin susceptible and this drug is used as the last therapeutic options for treatment of human listeriosis. the percentage of chloramphenicol resistant strains of l. monocytogenes and l. innocua were 8.3% and 18.8%, respectively. the resistance for this antibiotic could be due to the illegal use of it in some poultry farms (fallah., 2012). have been announced to be naturally resistant to cehalosporins (troxler., 2000). the number of papers about antibiotic resistances of listeria species has been increased in the last years. in 2005 ycel., in 2008 bilir ormanc., and in 2010 ayaz and erol reported that all l. monocytogenes strains from turkey or chicken meats in turkey were susceptible to gentamicin and chloramphenicol, but in this study we found resistance of 8.3% to gentamicin and 8.3% to chloramphenicol. besides, same authors (ayaz and erol, 2010 ; bilir ormanc., 2008 ; ycel., 2005) announced that the percentage of ampicillin resistant l. monocytogenes was 66%, 73.9%, and 67.9%. however, in our work, 75% of the l. monocytogenes isolates was resistant to ampicillin. results of our study comparing to the findings of others works in turkey (ayaz and erol, 2010 ; bilir ormanc., 2008 ; ycel., 2005) indicate that there is an increasing percentage of multiresistance in listeria isolates in the last decade. in conclusion, our results represent information about the high contamination status of raw turkey meats with listeria spp. in turkey. the isolates particularly l. monocytogenes are increasingly resistant to one or more antibiotics and may represent a potential risk for public health because these antibiotics are common used in treatment of listeriosis. the correct and controlled use of antibiotics in veterinary medicine is important in order to the emergence of resistant strains. | the aims of this study were to investigate the occurrence of listeria species in turkey meats and to check the antimicrobial susceptibility of the isolated strains. hundred and fifteen raw turkey meat samples were randomly collected from the supermarkets, butchers and restaurants. strain isolation and identification were made according to the iso11290 - 1 method. antimicrobial susceptibility was determined by the standard disc diffusion method. a total of 47 listeria spp. were isolated from 115 (40.9%) raw turkey meat samples. the isolates were distributed between l. monocytogenes (25.53%), l. innocua (34.04%), l. grayi (31.91%) and l. welshimeri (8.51%). a total of 55.3 % of listeria spp. isolates were multi - resistant to at least 3 of the antimicrobial agent tested. the level of multi - resistance was higher in l. monocytogenes strains (66.7%) than in l. innocua (62.5%) and l. grayi (53.3%). listeria spp. isolates were highly resistant to ampicillin, cephalothin, penicillin, meticillin, oxacillin, and trimethoprime - sulfamethoxazole. the isolates particularly l. monocytogenes are increasingly resistant to one or more antibiotics and may represent a potential risk for public health because these antibiotics are common used in treatment of listeriosis. the correct and controlled use of antibiotics in veterinary medicine is important to the emergence of resistant strains. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.