article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
heart failure is responsible for a huge burden of disease in both developed and developing countries.1) among patients with heart failure, about 50% show normal or preserved left ventricular (lv) systolic function (hfpef).2) in the detection and evaluation of heart failure, echocardiography plays a crucial role in evaluation of ventricular systolic function, identification of other structural heart diseases, and hemodynamic assessment, including classification of diastolic dysfunction. although the diagnosis of hfpef is often considered a diagnosis of exclusion, recent european guidelines have focused on the evaluation of lv filling pressure.3) moreover, measurement of lv filling pressure also imparts valuable information for decision making and prediction of clinical outcomes. while invasive cardiac catheterization is the gold standard in gauging lv filling pressure, recent echocardiographic studies have identified no difference in outcome between the invasive measurement of filling pressure using the swan - ganz catheter and non - invasive echocardiography.4)5) a number of studies have identified the risks of invasive measurement of lv filling pressure, and it seems likely that the benefits obtained from this information are outweighed by the complications of invasive measurement. in contrast, the echocardiographic method is rapid and non - invasive, and it can be done at a patient 's bedside. understanding the cardiac cycle and the physiology of lv filling is the basis for interpretation in a comprehensive echocardiographic evaluation of diastolic function. normal diastolic function is necessary to adequately fill the heart without elevation of in diastolic filling pressure.6) ventricular systolic function can be readily measured as the ejection fraction (ef).7) however, evaluation of the diastolic function is more difficult.8) the diastolic phase is a well - organized process that enables optimal ventricular filling for a given clinical condition.9) the diastolic phase is composed of four phases ; isovolumic relaxation, early rapid ventricular filling, diastasis, and atrial contraction (fig. 1). lv filling is not a passive process.10) during lv contraction, myocardium is compressed and twisted.11) relaxation of the myocardial contraction and twist unloads this energy, and this process begins before the end of lv ejection. lv pressure falls rapidly during the isovolumic relaxation period and produces an early diastolic pressure gradient between the left atrial (la) and lv that sucks blood out of the la and fills the lv rapidly. thus, in the normal heart, myocardial relaxation (e ') and suction precede the onset of lv passive filling (e). in contrast, the failing ventricle shows reduction of passive ventricular filling and elevation of la pressure,12)13) so blood is pushed rather than sucked into the lv. in this setting, myocardial diastolic motion (e ') reflecting cardiac movement during diastole may be secondary to filling (e).14) the distinction in the mode of lv filling (and thereby e ') explains the different behaviour of e / e ' with impaired and preserved lv function. a number of echocardiographic techniques can be used to measure lv filling pressure. increased la size on 2-dimensional echocardiography is an indicator of increased lv filling pressure.15) the presence of enlarged la, while non - specific, provides evidence of long - standing elevation lv filling pressure elevation, and la volume is a more sensitive marker than la diameter.16)17) however, the process of reverse remodelling of the la may not be rapid, so that la enlargement may be a legacy of previously increased lv filling pressure. mitral inflow velocity (e) correlates well with lv filling pressure in heart failure, but in the broader community, abnormalities are non - linear because the measurement is affected by both myocardial relaxation and filling pressure. transmitral inflow is proportionate to the ratio between la pressure and the relaxation time constant, tau, whereas e ' is inversely proportionate to tau only, leading the ratio e / e ' to be proportionate to la pressure. the use of e / e ' is generally the most a feasible as well as among the most reproducible method for estimation of filling pressure. several prominent validation studies have confirmed the correlation of this ratio with filling pressure, and the prediction of normal and abnormal filling pressure is most reliable when the ratio is 15.18)19) however, the examiner should use these as a combination of other doppler variables and should check for the presence of other clinical conditions that can influence these variables.19)20) recently, e / e ' has been correlated with ambulatory measurement of la pressure in 60 simultaneous studies, with an area under the receiver operating curve > 0.9.21) the correlation of e / e ' with la pressure compares favorably with the low correlation of la pressure with type b natriuretic peptide. moreover, while the correlation of e / e ' with la pressure is best in the setting of impaired lv systolic function, it holds true with preserved systolic function, and despite changes of loading, for example in aortic stenosis and exercise.22) although high heart rates may present a challenge because of fusion of the e and a waves, the relationship appears to hold true in atrial fibrillation. finally, the measurement of e / e ' has been shown to correlate with outcome in patients following myocardial infarction, in aortic stenosis and post exercise.23)24) despite favorable correlations, some investigators have proposed that the method is an unreliable means of assessing filling pressure. in decompensated advanced systolic heart failure, e / e ' showed a poor correlation with intracardiac filling pressures, especially in large lv volumes, worse cardiac indices, and in the presence of cardiac resynchronization therapy.25) these results are likely driven by significant mitral regurgitation (present in 22% of the patients) as well as half of the patients with a broad qrs and consequent abnormal septal motion.21) the study should remind us of the pitfalls of measuring e / e '. the measurement of e velocity is derived from pulsed - wave (pw) doppler, usually in the apical 4-chamber view. using color flow imaging is helpful for the optimal location of sample volume of the doppler beam. a 1 - 3-mm sample volume is placed between the mitral leaflet tips during diastole. mitral inflow waveforms can be recorded clearly after optimization of spectral gain and wall filter setting. mitral inflow velocities should be measured at end - expiration with a higher sweep speed (100 mm / sec) (fig. 2). errors may arise from use of inappropriate location, sample volume or respiratory state. annular pulsed wave doppler tissue imaging is also obtained from the apical 4-chamber view, using a 1- to 2-mm size sample volume (fig. angulation between the ultrasound beam and the plane of cardiac motion should be minimized (50 cm / s is considered normal.34) vp can be used to predict lv filling pressure by combination with e velocity (e / vp)34) or ivrt { lv end - diastolic pressure = 4.5 [10/(2 ivrt + vp) - 9]}.35) in patients with depressed lvef, a e / vp ratio > 2.5 predicts lv end - diastolic pressure > 15 mm hg,36) and an e / vp ratio > 1.5 can be used as a prognostic marker in the prediction of in - hospital heart failure and survival after an acute myocardial infarction.37) however, this parameter can be influenced by many factors including elastic recoil of the la and lv, the diastolic properties of the lv, and la pressure, so patients with normal lv systolic function (normal lv volumes and ef) and elevated lv filling pressures can have normal vp. recently, global and regional diastolic function has been analyzed using strain and strain rate derived from speckle tracking and velocity vector imaging. these techniques do not have the limitation of angle dependency and have been validated with sonomicrometry,38) and applied clinically.39) global diastolic strain rate during ivr (srivr) by 2-dimensional speckle tracking imaging is a preload independent parameter. e / srivr can predict lv filling pressure in patients with normal lvef and regional dysfunction.40) because diastolic untwisting of the lv represents elastic recoil, a reduced rate of untwisting indicates the presence of diastolic dysfunction.41) decreased left atrial longitudinal strain during systole (< 30%) is associated with increased lv filling pressure.42) however, the evidence base for using deformation imaging techniques in the evaluation of diastolic dysfunction requires further study. in conclusion, the ratio between transmitral inflow and tissue velocity is a robust marker in the prediction of lv filling pressure. however, it is imperfect and should be interpreted with consideration of many situations that can affect this value. for this reason, this parameter should be supplemented by other echocardiographic and even invasive measurements under certain circumstances. | measurement of left ventricular (lv) filling pressure is useful in decision making and prediction of outcomes in various cardiovascular diseases. invasive cardiac catheterization has been the gold standard in lv filling pressure measurement, but carries the risk of complications and has a similar predictive value for clinical outcomes compared with non - invasive lv filling pressure estimation by echocardiography. a variety of echocardiographic measurement methods have been suggested to estimate lv filling pressure. the most frequently used method for this purpose is the ratio between early mitral inflow velocity and mitral annular early diastolic velocity (e / e '), which has become central in the guidelines for diastolic evaluation. this review will discuss the use the e / e ' ratio in prediction of lv filling pressure and its potential pitfalls. |
although lipomas are the most common mesenchymal tumor, incidence varies depending on the organ or tissue involved. lipomas of the greater omentum are rare and have only been documented as individual case reports. we present a rare case of a symptomatic omental lipoma in a 5-year - old girl which was successfully treated by laparoscopic resection. a 5-year - old japanese preschool girl presented with a 1-week history of right lower abdominal pain of increasing severity that was associated with nausea and anorexia. her temperature was 38.1c and her abdomen was tender in the right lower quadrant with signs of peritoneal irritation. laboratory investigation revealed a white blood cell count of 10 000/mm with 77% segmented neutrophils. a contrast - enhanced computed tomography (ct) scan of the abdomen revealed linear folds of omental tissue in a concentric pattern that extended from the level of the transverse colon to the right lower abdomen (fig. 1a). a pelvic mass of 6 cm in diameter with the same uniform radiodensity as that of fatty tissue figure 1:contrast - enhanced ct scan showed (a) torsion of the omentum, which was seen as linear folds of omental tissue in a concentric pattern that extended from the level of the transverse colon to the right lower abdomen ; and (b) a pelvic mass of 6 cm in diameter with the same uniform radiodensity as fatty tissue. contrast - enhanced ct scan showed (a) torsion of the omentum, which was seen as linear folds of omental tissue in a concentric pattern that extended from the level of the transverse colon to the right lower abdomen ; and (b) a pelvic mass of 6 cm in diameter with the same uniform radiodensity as fatty tissue. the patient was taken to the operating theater for abdominal laparoscopy because of torsion of the greater omentum. the procedure was performed using a 12-mm trocar placed in the umbilicus with accessory trocars in the left lower quadrant (12 mm) and below the umbilicus (5 mm). laparoscopy revealed a well - encapsulated, 6 5 cm, smooth, yellowish mass originating from the greater omentum that occupied the entire pelvis. the twisted omental pedicle was seen just below the transverse colon, and the lower part of the omentum distal to the torsion point appeared necrotic (fig. 2). laparoscopic resection of this necrotic omentum was performed using an ultrasonic coagulation device (harmonic, ethicon endo - surgery, inc. a small abdominal incision 4 cm in length was made below the umbilical trocar and the tumor was retrieved through this opening using an endocatch ii (tyco healthcare, tokyo, japan) without injury to the capsule. the total operation time was 62 min, and only a small amount of blood loss occurred. figure 2:laparoscopy revealed a tumor at the right lower border of the greater omentum with a smooth surface. laparoscopy revealed a tumor at the right lower border of the greater omentum with a smooth surface. macroscopically, the specimen was 80 60 25 mm in size and weighed 74.8 g. histopathological examination revealed that the tumor was composed of mature adipocytes indistinguishable from normal adipose tissue, confirming that it was a lipoma (fig. 3). figure 3:histopathological examination of the resected specimen showed that the tumor was composed of mature fat cells (hematoxylin and eosin, original object magnification 10). histopathological examination of the resected specimen showed that the tumor was composed of mature fat cells (hematoxylin and eosin, original object magnification 10). we described a rare case of omental torsion caused by a giant lipoma in a 5-year - old girl. to our knowledge, this is the first report of a giant lipoma of the greater omentum in a pediatric patient that was treated by laparoscopic surgery. the incidence of primary tumors of the greater omentum is low, but these tumors are diverse in their pathology. tumors of the greater omentum originate from its constituents of fat tissue and blood and lymphatic vessels, and present as leiomyoma, leiomyosarcoma, fibroma, fibrosarcoma, hemangiopericytoma, lipoma, liposarcoma, and mesothelioma. lipomas of the greater omentum are rare, particularly in children, and only a few case reports have been described in the literature. the eight cases of child (patients under 20 years old) omental lipoma reported to date are listed in table 1, including our present case [29 ]. the most common presenting symptoms were abdominal mass, nausea and fever also occurring occasionally. in our patient, the symptoms and signs of omental torsion seen at first physical examination mimicked those of acute appendicitis. ct scan was useful in determining the relationship between the lipoma and the omental torsion. similarly, beattie. also reported torsion of the greater omentum associated with a lipoma in a 77-year - old woman who presented with an emergency case of lower abdominal pain. table 1:cases of lipoma of the greater omentum in a child (patients under 20 years old)caseauthors (publication year)agesextreatmenttumor size (cm)tumor weight (g)symptoms1haller. (1998)3 ymexcision (open)13 9 6nrabdominal mass4barauskas. (2004)8 yfexcision (open)10 11 8720abdominal mass5luo. (2005)11 mmexcision (open)21 15 121820abdominal fullness6srinivasan. (2009)9 mnrexcision (open)nr1500abdominal mass7abubakar. (2009)13 yfexcision (open)34 26 2212 300abdominal mass8chaudhary. (2011)2 ymexcision (open)nrnrabdominal mass and pain9present case (2013)5 yfexcision (laparoscopic)8 6 375abdominal pain, fevernr, not reported ; y, years ; cases of lipoma of the greater omentum in a child (patients under 20 years old) nr, not reported ; y, years ; m, months. lipomas of the omentum are easily discovered by ultrasound examination and appear as a well - encapsulated, echogenic mass with good sound transmission. ct scan provides definitive identification of fat content within the lesion by providing radiodensity measurements. we decided to perform laparoscopic tumor excision and partial omentectomy because of torsion of the omentum. since the advent of laparoscopy patients treated using this approach have decreased need for narcotic analgesics, shorter hospitalization, quicker recovery and excellent cosmetic results. laparoscopy plays an important role in the diagnosis of tumors, particularly abdominal tumors in children, the diagnosis and management of which may be challenging. ct - guided needle biopsies may not yield sufficient tissue for all studies, whereas adequate tissue can be procured and tumor resectability assessed using laparoscopy. laparoscopy for pediatric abdominal tumors has been mostly used for neuroblastomas, most cases of which were identified by mass screening and were consequently small. in summary, we presented a pediatric case of torsion of the greater omentum caused by an omental lipoma that was treated by laparoscopic resection. | primary tumors of the greater omentum are rare. we report a case of a 5-year - old girl presenting with an acute abdomen who had omental torsion caused by a giant lipoma of the greater omentum, which was diagnosed by a computed tomography scan. laparoscopy revealed a yellow tumor of the greater omentum with a smooth surface. tumor excision and partial omentectomy was performed to treat the torsion, and the tumor was retrieved through a 4-cm - wide abdominal incision. macroscopically, the specimen was 80 60 25 mm in size and 74.8 g in weight, and histopathological findings were consistent with the diagnosis of lipoma. the present case highlights the possible use of laparoscopic surgery for removing large abdominal lipomas, thus avoiding the drawbacks of laparotomy in terms of postoperative pain and prolonged hospital stay. |
all reagents used were analytical - reagent grade and obtained from sigma - aldrich and used without any further purification unless otherwise specified. certified, premixed gas tanks, including ammonia, methylamine, dimethylamine, trimethylamine, hcl, so2, fluorine, chlorine, phosphine, arsine, phosgene, hydrogen sulfide, hydrogen cyanide, and diborane were obtained from matheson tri - gas corp. through s. j. smith, co. (urbana, il). final organically modified sol - gel (ormosil) formulations with the colorants were loaded into a 36-hole teflon ink well. sensor arrays were printed using an array of 36 floating slotted pins (which delivered approximately 130 nl each) by dipping into the ink well and transferring to the pet film. once printed, the arrays were aged under nitrogen for at least 3 days before any sensing experiment was performed. supplementary table s2) were prepared by mixing the prediluted analyte gas stream with dry and wet nitrogen gas with mks digital mass flow controllers to achieve the desired concentrations and relative humidity (rh) (cf. saturated vapors were generated from a diluted solution in a five gallon polyethylene carboy, which was further diluted to idlh concentration with nitrogen gas. importantly, gas stream concentrations and relative humidity were confirmed by in - line analysis by ftir using a mks multi - gas analyzer, model 2030. in our experience, independent in - line analysis of tank gases is absolutely essential, even with the manufacturer s certification ; premixed tanks of these reactive gases at the low concentrations used here (typically four times the idlh) do not necessarily retain their original certified concentrations. fluorine, chlorine, hydrazine, nitric acid and hf at their idlh concentrations were confirmed using drger detector tubes. for all sensing experiments, imaging of the arrays was done on an ordinary flatbed scanner (epson perfection v200) ; for good reproducibility, it is important to warm - up the scanner. difference maps were obtained by taking the difference of the red, green, and blue (rgb) values from the center of every colorant spot (~300 pixels) from the before and after images. to eliminate the possibility of subtraction artifacts caused by variations in color near the spot edge, only the spot center averaging of the centers of the spots avoids artifacts from non - uniformity of the printing of the spots, especially at their edges. subtraction of the two images yields a color difference vector of 3n dimensions where n = total number of spots ; for our six by six array, this difference vector is 108 dimensions (i.e., 36 changes in red, green, and blue color values), each dimension ranging from 255 to + 255 for 8-bit color imaging). measurements can be performed using adobe photoshopor with a customized software package, chemeye (chemsensing, inc., all experiments were run in septuplicate, and chemometric analysis was carried out on the difference vectors using the multi - variate statistical package (v. 3.1, kovach computing). relative humidity was controlled by mixing dry n2 with humidity saturated n2 (100% rh, generated from bubbling n2 through water). using 50% rh as a control, arrays were exposed to various humidity concentrations for two minutes. s4) ; no significant response to humidity was observed from 10 to 90% rh. so2 and chlorine gases at pel concentrations were prepared using the same method as idlh concentration. the colorimetric sensor array was exposed to n2 (50% rh) for 5 minutes, and then the gas stream switched from idlh to pel and back every 10 minutes. all reagents used were analytical - reagent grade and obtained from sigma - aldrich and used without any further purification unless otherwise specified. certified, premixed gas tanks, including ammonia, methylamine, dimethylamine, trimethylamine, hcl, so2, fluorine, chlorine, phosphine, arsine, phosgene, hydrogen sulfide, hydrogen cyanide, and diborane were obtained from matheson tri - gas corp. through s. j. smith, co. (urbana, il). final organically modified sol - gel (ormosil) formulations with the colorants were loaded into a 36-hole teflon ink well. sensor arrays were printed using an array of 36 floating slotted pins (which delivered approximately 130 nl each) by dipping into the ink well and transferring to the pet film. once printed, the arrays were aged under nitrogen for at least 3 days before any sensing experiment was performed. supplementary table s2) were prepared by mixing the prediluted analyte gas stream with dry and wet nitrogen gas with mks digital mass flow controllers to achieve the desired concentrations and relative humidity (rh) (cf. saturated vapors were generated from a diluted solution in a five gallon polyethylene carboy, which was further diluted to idlh concentration with nitrogen gas. importantly, gas stream concentrations and relative humidity were confirmed by in - line analysis by ftir using a mks multi - gas analyzer, model 2030. in our experience, independent in - line analysis of tank gases is absolutely essential, even with the manufacturer s certification ; premixed tanks of these reactive gases at the low concentrations used here (typically four times the idlh) do not necessarily retain their original certified concentrations. fluorine, chlorine, hydrazine, nitric acid and hf at their idlh concentrations were confirmed using drger detector tubes. for all sensing experiments, imaging of the arrays was done on an ordinary flatbed scanner (epson perfection v200) ; for good reproducibility, it is important to warm - up the scanner. difference maps were obtained by taking the difference of the red, green, and blue (rgb) values from the center of every colorant spot (~300 pixels) from the before and after images. to eliminate the possibility of subtraction artifacts caused by variations in color near the spot edge, only the spot center is included in the calculation. averaging of the centers of the spots avoids artifacts from non - uniformity of the printing of the spots, especially at their edges. subtraction of the two images yields a color difference vector of 3n dimensions where n = total number of spots ; for our six by six array, this difference vector is 108 dimensions (i.e., 36 changes in red, green, and blue color values), each dimension ranging from 255 to + 255 for 8-bit color imaging). measurements can be performed using adobe photoshopor with a customized software package, chemeye (chemsensing, inc., all experiments were run in septuplicate, and chemometric analysis was carried out on the difference vectors using the multi - variate statistical package (v. 3.1, kovach computing). relative humidity was controlled by mixing dry n2 with humidity saturated n2 (100% rh, generated from bubbling n2 through water). using 50% rh as a control, arrays were exposed to various humidity concentrations for two minutes. s4) ; no significant response to humidity was observed from 10 to 90% rh. so2 and chlorine gases at pel concentrations were prepared using the same method as idlh concentration. the colorimetric sensor array was exposed to n2 (50% rh) for 5 minutes, and then the gas stream switched from idlh to pel and back every 10 minutes. | we have developed a simple colorimetric sensor array (csa) for the detection of a wide range of volatile analytes and applied it to the detection of toxic gases. the sensor consists of a disposable array of cross - responsive nanoporous pigments whose colors are changed by diverse chemical interactions with analytes. although no single chemically responsive pigment is specific for any one analyte, the pattern of color change for the array is a unique molecular fingerprint. clear differentiation among 19 different toxic industrial chemicals (tics) within two minutes of exposure at idlh (immediately dangerous to life or health) concentration has been demonstrated. quantification of each analyte is easily accomplished based on the color change of the array, and excellent detection limits have been demonstrated, generally below the pels (permissible exposure limits). identification of the tics was readily achieved using a standard chemometric approach, i.e., hierarchical clustering analysis (hca), with no misclassifications over 140 trials. |
similar to other connectivity methods, such as seed - based functional connectivity and diffusion - tensor - imaging approaches, this method requires the definition of a set of regions of interest (rois) that act as network nodes. several techniques have been employed to functionally derive these nodes and their connections [3, 4 ]. the definition of such nodes often involves complicated functional connectivity estimation and border detection procedures. here, we suggest a relatively simple one - step border detection and roi estimation procedure. in particular, we propose to take advantage of one of the characteristics of the fuzzy c - mean clustering algorithm. this procedure allows a fixed percentage of voxels with a borderline pattern of connectivity to be nonunequivocally attributed. the further we move from the centre towards the border of a cluster, the more the characteristics of the pattern of connectivity are intermixed with those of the neighbouring clusters (e.g., nonunequivocally determined). as was recently shown by smith., the maximization of spatial independence could lead to suboptimal detection of networks that share significant spatial overlaps. our method maximizes the temporal independence because the criterion used in the clustering algorithm is the correlation between the time series of each voxel and the time series of the centre of each cluster. previous clustering studies [6, 810 ] performed the clustering procedure at subject level. given the relative deficiency of time points (about 120200 points in a six - minute run), this procedure has good reliability only for low - dimensional parcellation (e.g., with a limited number of clusters). in line with other investigations [2, 11, 12 ], we concatenated the time courses across all subjects to constitute a very big dataset that allowed us to obtain a higher clustering dimensionality. approach permits good estimation of a common set of clusters (and thereby of nodes) for a given group of subjects. subsequently, the between - subject variance was taken into consideration, so that each node 's functional connectivity pattern was evaluated at the subject level and summarized using a random - effect analysis. this method is very similar to the dual regression approach, according to which the independent component analysis (ica) was first applied to the concatenated dataset. to investigate how this node detection method performs with real data, we applied our procedure to the insular surface of 20 healthy subjects scanned in a resting state. we chose the insular surface because the insula is a complex and pivotal brain area in which different inputs from the body and the external world are highly integrated. this brain region has been parcellated by using different measures, such as resting - state functional connectivity [8, 10, 14 ], task - related functional connectivity [16, 17 ], and diffusion tensor imaging [18, 19 ], into two [8, 16, 2023 ], or three [9, 10 ], or more clusters [4, 5, 17, 24 ], each of which has a unique pattern of connectivity. a recent paper by kelly. demonstrated a convergence between resting state, task - based functional connectivity, and anatomical coactivations at several different parcellation levels (from two to 12 clusters per side ; with more than 12 clusters, reliability dropped by about 50%), thus supporting a common hierarchical structure within the insular cortex. given these premises, it would be of great interest to test this new node detection method in search of a resting - state functional parcellation of the insular surface. as an additional consideration, we suppose that high - dimensional clustering can make it possible to demonstrate the existence of a more complex pattern with echoes of several brain networks nested within the two main insular patterns previously reported. main group consists of twenty healthy right - handed volunteers (10 females, with a mean age of 32.6 11.2). replication group comprises eighteen healthy right - handed volunteers (nine females, with a mean age of 25.3 4.2). all subjects were free of neurological or psychiatric conditions, were not taking any medication known to alter brain activity, and had no history of drug or alcohol abuse. we obtained written informed consent from every subject, in accordance with the declaration of helsinki. the study was approved by the institutional committee on ethical use of human subjects at the university of turin. images were acquired during a resting - state scan on a 1.5 tesla intera scanner (philips medical systems). functional t2 weighted images were acquired using echoplanar (epi) sequences, with a repetition time (tr) of 2000 ms, an echo time (te) of 50 ms, and a 90 flip angle. the acquisition matrix was 64 64, with a 200 mm field of view (fov). a total of 200 volumes were acquired, with each volume consisting of 19 axial slices ; slice thickness was 4.5 mm with a 0.5 mm gap, while in - plane resolution was 3.1 mm. two scans were added at the beginning of functional scanning to achieve steady - state magnetization before acquiring the experimental data. a set of three - dimensional high - resolution t1-weighted structural images was acquired, using a fast field echo (ffe) sequence, with a 25 ms tr, an ultrashort te, and a 30 flip angle. datasets were preprocessed and analysed using brainvoyager qx software (brain innovation, maastricht, the netherlands). functional images were preprocessed to reduce artefacts as follows : (i) slice scan time correction was performed using a sinc interpolation algorithm ; (ii) 3d motion correction was applied using a trilinear interpolation algorithm according to which all volumes were spatially aligned to the first volume by rigid body transformations, and the roto - translation information was saved for subsequent elaborations ; (iii) spatial smoothing was performed using a gaussian kernel of 8 mm fwhm. several nuisance covariations were regressed out from the time courses to control for the effects of physiological processes, such as fluctuations related to cardiac and respiratory cycles and motion [2830 ]. specifically, we included nine additional covariations from white matter (wm), global signal (gs), and cerebrospinal fluid (csf), as well as six motion parameters. subsequently, time courses were temporally filtered in order to keep only frequencies between 0.008 and 0.08 hz and normalized. following the preprocessing, we implemented some steps to improve intersubject analysis of the anatomical location of brain activations. for each subject this coregistration was done using both the slice positioning as stored in the raw data 's headers and fine adjustments calculated comparing the intensity values of the data sets. this was obtained by translating and rotating the cerebrum on the plain passing through the anterior and the posterior commissure ; then, the borders of the cerebrum were identified. the coregistration matrix of anatomical and functional data consisted of the parameters of rotation and translation during the coregistration step and the parameters of talairach normalization. finally, by applying the anatomical - functional coregistration matrix we transformed into talairach space the functional time course of each subject and created the volume time course. we applied a fuzzy c - mean algorithm to the time courses of all the insular voxels and clustered these voxels on the basis of their temporal similarity. as is typical of fuzzy clustering techniques, a certain percentage of voxels can be nonunivocally attributed to the parcels. the percentage of nonunivocally attributed voxels (the fuzziness coefficient) is an arbitrary parameter. in line with other studies we subsequently confronted the voxel 's time courses x n (n = 1 n) with each other and derived a representative cluster of time courses (cluster centroids) v c (c = 1 c). on the basis of this unsupervised method, and starting from the original fmri time series, we got a predefined number of spatial modes, which were composed of a spatial map and an associated centroid time course. accordingly, a voxel is assigned to a cluster with reference to the similarity (e.g., by correlation) of its time course to the cluster centroid. this similarity is determined in a fuzzy way, which means that a voxel is not uniquely assigned to one cluster (hard clustering) because the similarity is expressed by the membership u cn of voxel n to cluster c. centroids v c and memberships u cn are both updated in an iterative procedure, which terminates when successive iterations do not further change memberships. cluster centres are determined via classical cluster - algorithm distance measures and are expressed as follows:(1) (2)where d is the distance between a voxel and a cluster centre and m is the coefficient that determines the fuzziness of the procedure ; m tunes out the noise in the data and lies between 1 (smallest fuzziness) and infinity. the most commonly used of the several distance measures of d are the euclidean distance, d e, and the mahalanobis distance, d m, which are defined as(3)dexn, vc = xnvc2,dmxn, vc = xnvctc1xnvc.c is the covariance matrix of cluster c. the mahalanobis distance takes in the elliptical shape of the cluster (i.e., it weights the differences by the range of variability, described by c, in the direction of the voxel instead of treating all voxels x n equally when calculating the distance d to the cluster centre v c). the euclidean distance assumes a spherical shape, without taking into account the shape of clustering, which corresponds to a covariance matrix c with 1 s on the main diagonal and 0 s elsewhere. calculation starts from an initial set of membership values for the data set in the following matrix form : (4)u0=122u+22vwith u = 1/c and v a matrix of randomly chosen cluster centres with initial c = 2. when further iterations do not cause significant change to memberships and centroids, the procedure stops. with this procedure this formula calculates the within - class variance over all clusters, w. in other words, a user - defined threshold for change in w is fixed when convergence is reached. the criterion of convergence is based on the first local optimum of (5). each time series is transformed into its z - score in order to avoid a classification of the voxels on signal amplitude rather than on signal shape. then, the principal component analysis (pca) is performed to reduce data dimensionality. optimal number of clusters : the a priori definition of the number of clusters and the fuzziness coefficient is often debated in the literature. usually, the optimal number of classes is unknown in fuzzy clustering. a number of cluster - validity indices have been proposed to estimate the optimal number of clusters in an unsupervised manner (for a review see)., we used the silhouette validation method, which consists in considering the silhouette coefficient of each element:(6)si = biaimaxbi, ai, where a i is the average dissimilarity of the i - point to all points in the same cluster and b i is the minimum of the average dissimilarity of the i - point to all points in the other cluster. unlike cauda., to perform the clustering procedure time courses were concatenated across all subjects ; this step, as has been pointed out by others, makes it possible to obtain a higher clustering dimensionality (i.e., more clusters). due to the fuzziness coefficient employed, we considered these voxels as border voxels, with a time course that showed transitional characteristics between contiguous clusters. the final step of this procedure was to place a spherical roi with a radius of 3 mm in the local maxima of each cluster (i.e., the area of maximal similarity between voxel time courses). see figure 1 for a graphical representation of the method. to investigate the specific pattern of connectivity of each cluster we employed a variant of the dual regression approach. in brief, we performed a generalized linear model (glm) including all the subject - specific time courses of all 12 right - insular spherical rois in a multiple regression analysis. this method resulted in a subject - specific time course relative to each roi, while controlling for the variance explained by all the other rois. subject - specific patterns of functional connectivity relative to each roi were then summarized at a group - level using a one - sample t - test. to confirm previous connectivity results, we also calculated the functional connectivity of the anterior and posterior insular clusters by grouping together the rois belonging to each cluster (see figure 2(a)). to validate our parcellation results we applied our method to a second dataset (replication group) and compared the results of the two datasets. all maps were thresholded at p < 0.05 and corrected for multiple comparisons using the false discovery rate (fdr). this number turned out to be the preferred number of clusters after the application of the silhouette validation method. the algorithm returned the borders of the functionally homogeneous areas ; for each cluster a spherical roi with a radius of 3 mm was placed in the area with the maximal homogeneity (see figure 2(a)). indeed, as shown in figure 2(c), all the rois were also found in the control group and the locations were almost overlapping in 17 out of 24 rois, while the other rois were displaced by only a few millimetres. our calculation of the functional connectivity of the rois belonging to anterior and posterior insular clusters confirmed the two patterns of connectivity described in a previous study. the anterior pattern, which occupies the most anterior ventral part of the insular cortex, is characterized by a cingulate - frontoparietal connectivity that has often been related to salience detection. in turn, the posterior pattern, which occupies the posterior dorsal insula, principally shows a sensorimotor connectivity pattern. however, by considering all the 12 rois and including the roi time courses in a multiple regression analysis, we discovered a much more intricate picture. with this method we demonstrated that these areas are connected to several other networks, such as the default mode network, the sensorimotor network, and parts of the dorsal attentional network by focusing on resting - state data, this study has demonstrated that the proposed fuzzy clustering node detection approach is able to perform simple yet reliable node detection and surface parcellation. by virtue of the fuzzy clustering procedure, we successfully generated nodes, and the data obtained with this method were replicable with other datasets. this method allows a very simple one - step border detection procedure, taking advantage of the fact that the borders between areas with homologous functional connectivity are characterized by a temporal profile (i.e., time course) with mixed characteristics of time courses of contiguous regions. the fuzzy clustering procedure has proven to be replicable using a replication dataset. by varying the fuzziness coefficient it is possible to change the number of voxels that are attributed to borders, and as a consequence the homogeneity of the voxels pertaining to the univocally defined parcels. furthermore, by applying a high - dimensional clustering procedure to the analysis of the functional connectivity of the insula, we were able to detect the connectivity patterns, or, as defined by leech., the echoes of the other neural networks that we hypothesized might constitute the hierarchical subparcellation of the aforementioned anterior and posterior patterns of connectivity : the ventral anterior cingulo - fronto - parietal salience detection network and the dorsal posterior sensorimotor network, respectively. as has been previously reported [8, 16, 25, 33 ], there was some interhemispheric lateralization in the connectivity patterns of the insula. indeed, the localization of the clusters in the right and the left insula was slightly different, especially in the posterior insula. these results were confirmed when we subdivided the rois on the basis of their involvement within the two anterior and posterior clusters. a possible explanation for this hemispheric asymmetry could involve some aspects of emotional and sympathetic processing ; for example, the right insula is likely to respond more to sympathetic arousal, and the left insula to parasympathetic nervous functions [41, 42 ]. furthermore, the anatomical connections of the anterior insula (ai) with areas pertaining to the ventral attentional network, in particular the temporoparietal junction (tpj), have been shown to be lateralized on the right side. this is coherent with the fight or flight function of the sympathetic system, which requires an evaluation of the potential danger of incoming stimuli. the posterior part of the insula is characterized by smaller clusters and less homogeneity than the anterior part. accordingly, hemispheric asymmetry is also more evident in the posterior than in the ai. these findings support the idea that the posterior circuits have more heterogeneous connectivity patterns, in line with craig 's hypothesis suggesting that the posterior insula is a sort of data collector linked to many different networks [15, 44 ]. as reported in recent studies [9, 25 ], this group of posterior clusters mainly exhibits a sensorimotor pattern of connectivity. indeed, if we move from the more posterior part of the insular surface towards the middle and anterior parts, the connectivity changes from visuomotor to prefrontal pathways (ba9), then to sensorimotor, and back again to prefrontal pathways (ba8) within the middle insular cortex. in fact, not only action and perception - related patterns but also some prefrontal patterns of connectivity are present within the posterior insula. this is probably due to the involvement of this area in a variety of different activities, such as pain, language, interoception, and sexuality, as has been recently reported [17, 25 ]. overall, the posterior insula shows a more specific connectivity pattern than the ai, which, on the contrary, shows connections with networks related to the switch of attention between internal and external stimuli, such as the attentional and default mode networks. thus, rather than being specific, this pattern suggests a general function that can be exploited in a variety of everyday activities. this has been confirmed by several papers that have shown how the ai is more aspecifically and massively activated in a broad series of different behavioural domains [8, 9, 17, 25 ]. in line with our data, these studies linked the activity of the ai with cognitive and emotional responses, an involvement that, together with saliency detection and task switching, is almost ubiquitous. some authors [10, 14, 17, 4749 ] have suggested a differentiation or a gradient of connectivity between the dorsal and ventral ai, a variance that, however, we failed to demonstrate in our previous papers. different levels of parcellation determined by the various methods used to calculate the optimal number of clusters lead to a different picture of the insular cortex. this phenomenon is particularly evident in the results of the study by kelly., which compared insular parcellations with n = 2 and n = 3 clusters. in the parcellation with n = 3 clusters the higher number of clusters made it possible to reveal an anterior ventral cluster that was not present with n = 2. in the present paper of two dissociable frontoparietal patterns of functional connectivity, the dorsal and ventral ai, respectively (for a similar result see also). these two networks (the dorsal one here referred to as dfp and the ventral one as vfp) probably subserve only two partially different functions. the dorsal network is likely to be more involved in the integration of top - down and bottom - up salient information, whereas the ventral network is likely to be more involved in aspects of emotional salience detection as well as the integration of bodily feelings. these two large - scale networks exhibit a different pattern of connectivity : the dorsal network is more centred on dorsolateral and dorsomedial prefrontal cortices plus mid - dorsal cingulate cortices, whereas the ventral network is more linked to the anterior cingulate, ventral prefrontal cortices, and tpj. other authors have identified a network that is similar to the dorsal anterior cluster, or, rather, to a mix of the dorsal and ventral anterior insular clusters, for example, the frontoparietal control network, and the cingulo - opercular, ventral attentional [52, 53 ], and basal ganglia - fronto - insular control networks [14, 46 ]. the two anterior insular frontoparietal networks show areas of overlap and might have a shared variance that in some conditions makes these two components less easily separable. interestingly, a cluster placed in between and just anterior to these two areas shows connectivity with the default mode network. this cluster resides in a position that largely overlaps with the agranular area described by marsel mesulam and mufson in 1982. this result seems to validate the hypothesis according to which the ai is placed in a pivotal brain site so as to continuously reallocate cerebral resources between internal and external focused networks [55, 56 ] and modulate the switch between goal - oriented attentional and default mode networks. this supposition would also explain the frequent activation of this brain area in so many different tasks. the dfp and vfp patterns of connectivity, which further subdivide the anterior and posterior insular clusters, are probably overcome by the variance of two other main patterns, but when this variance is regressed out, a more complex picture emerges. this phenomenon can be explained by the hierarchical connectivity structure of the insular cortex, as has been suggested by some authors [16, 25 ]. the two clusters that were previously identified in our papers were here divided into a series of smaller parcels, a procedure in line with recent studies [18, 25, 57 ]. this is also in accordance with the suggested intrinsically hierarchical structure of this area [5, 24, 58 ], as hypothesized by craig and damasio [15, 41, 59 ]. in this study we were able to demonstrate that the detection of nodes using high - dimensional fuzzy c - mean parcellation is a simple, efficient, and reliable method. this indicates that the insula displays a potentially hierarchical structure, in which information coming from the environment and from the body is integrated and distributed to different areas of the brain. although our study confirmed the two (or three) major insular subdivisions, a more in - depth investigation also showed that these areas can be further subdivided into smaller clusters, each characterized by its own pattern of connectivity that can be detected with appropriate techniques. | several functional connectivity approaches require the definition of a set of regions of interest (rois) that act as network nodes. different methods have been developed to define these nodes and to derive their functional and effective connections, most of which are rather complex. here we aim to propose a relatively simple one - step border detection and roi estimation procedure employing the fuzzy c - mean clustering algorithm. to test this procedure and to explore insular connectivity beyond the two / three - region model currently proposed in the literature, we parcellated the insular cortex of 20 healthy right - handed volunteers scanned in a resting state. by employing a high - dimensional functional connectivity - based clustering process, we confirmed the two patterns of connectivity previously described. this method revealed a complex pattern of functional connectivity where the two previously detected insular clusters are subdivided into several other networks, some of which are not commonly associated with the insular cortex, such as the default mode network and parts of the dorsal attentional network. furthermore, the detection of nodes was reliable, as demonstrated by the confirmative analysis performed on a replication group of subjects. |
a 48-year - old woman (height : 155 cm, weight : 42 kg) was diagnosed with huntington 's disease 15 years ago. she had a history of recurrent aspiration pneumonia induced by huntington 's disease and pulmonary tuberculosis. we administered antibiotics and planned lobectomy of the right middle lobe to treat the abscess. chest radiography and computed tomography (ct) findings showed a cavitary lung abscess accompanied by pneumothorax and an empyema in the right middle lobe, along with consolidation in both lower lobes. after the patient arrived in the operating room, we conducted electrocardiography, pulse oximetry, non - invasive blood pressure monitoring, bispectral index monitoring, and preoxygenation for 3 min with the patient in a 15 head - up position. general anesthesia was induced with propofol and rocuronium (1 mg / kg), and it was maintained with total intravenous anesthesia (2% propofol and remifentanil). a mask was placed on the patient without ventilation after the drugs were administered, and intubation was performed after 30 s. we used a 35-french (fr) dlt (human broncho, bronchial cuff od 10.0 mm, insung medical co., seoul, korea), as the size of the patient 's left main bronchus was 10.5 mm on ct, and the tube was fixed at a depth of 28 cm considering her height. after fixing the dlt, we placed a bronchoscope (diameter = 3.1 mm ; olympus lf - dp, tokyo, japan) on the tracheal lumen to confirm the position of the dlt, and then performed one - lung ventilation. we inserted a 4-fr fogarty arterial embolectomy catheter (edwards lifesciences co., irvine, ca, usa) into the tracheal lumen and confirmed that it entered the right main bronchus via the bronchoscope and c - mac monitor (karl storz gmbh & co. kg, tuttlingen, germany). we removed the stylet and connected a 3-ml syringe filled with a contrast medium and normal saline to the 3-way stopcock. after passing through right upper lobe opening, we confirmed the right middle and lower lobes ; we confirmed with a bronchoscope that the distance from the origin of the right upper lobe to the right middle and lower lobe bifurcation point was 3 cm. after inserting the fogarty catheter 3 cm further based on the distance that we measured, we performed cuff ballooning using 0.7 ml of solution mixed with normal saline (fig. we confirmed that the cuff blocked the middle and lower lobe bifurcation on chest radiography (fig. 2). additionally, left radial artery cannulation and right internal jugular vein catheterization were performed. subsequently, we moved the patient to a lateral position while monitoring the movement of the fogarty catheter via the bronchoscope (fig. the cuff was maintained at a pressure less than 20 mmhg using a hi - lo hand pressure gauge (mallinckrodt medical, athlone, ireland). the fogarty catheter was removed after placing a surgical clamp on the bronchus of the right middle lobe. postoperatively, the patient 's tube was replaced with a 7.0-mm single lumen tube, and she was transferred to the intensive care unit (icu). her oxygen saturation was maintained at 99100% during the operation, and chest radiographic findings did not show signs of pneumonia in the right upper lobe. when lobectomy is performed to treat a lung abscess, it is important to prevent the spread of infection to the non - affected lung and then prevent the infection from spreading to the remaining parts of the ipsilateral lung. these steps are especially important in cases in which the patient 's general condition is weak due to recurrent pneumonia as well as impaired motor and cognitive function, which is typical in advanced stage huntington 's disease. selective lobar isolation prevents the endobronchial spread of infection, reduces postoperative complications, and improves the patient 's oxygenation via either o2 flow or continuous positive airway pressure when hypoxia occurs during surgery. this selective lobar isolation is performed by combining a bronchial blocker to the dlt or by using an uninvent tube. although an uninvent tube is easy to manipulate, if the cuff is moved or damaged during surgical manipulation, it increases the risk of spreading the lung abscess. in contrast, using a bronchial blocker with a dlt can protect the left lung even if the bronchial blocker is damaged during surgery. blockers that can be used in connection with dlt include arndt blockers and fogarty embolectomy catheters, which are used for removal of a thrombus. fogarty embolectomy catheters were preferred over arndt blockers as they are more economical and are always available at our hospital. however, these blockers also have the following limitations : 1) they can be displaced even after fixation because of the patient 's positioning and intraoperative movement ; 2) they restrain the deflation of the lung after isolation, because there is no lumen or the lumen is very small within the catheter ; and 3) they are not a viable option for patients with a latex allergy or stylet - induced damage of the bronchus. we intermittently monitored our patient via the monitor connected to the bronchoscope to minimize movement of the catheter when she was in the lateral position. the right middle and lower lobes were isolated, which prevented lung collapse, but this did not limit the view during surgery. we removed the stylet after the catheter was inserted into the right main bronchus to prevent stylet - induced damage. the maximal liquid and gas capacity of the balloon for 4-fr size fogarty embolectomy catheters are 0.7 ml and 1.5 ml, respectively, and the size of the inflated balloon is 9 mm. based on these specifications, we determined that it is adequate for blocking the 66.5 mm intermediate bronchus as measured with ct. we performed ballooning with 0.7 ml of contrast medium and confirmed that the intermediate bronchus was completely blocked. in addition, we verified on the chest radiograph that the balloon tip was placed at the bifurcation of the right middle and lower lobes. to prevent the cuff that was filled with contrast medium from rupturing and the lumen from being obstructed, we performed re - ballooning with 1 ml of air. we placed the patient in a 15 head - up position after the patient arrived in the operating room and performed a rapid sequence induction without ventilation to minimize the spread of the abscess. the patient 's oxygen saturation decreased to 95% during the process of confirming the final position of the dlt via the bronchoscope, but it improved after we commenced one - lung ventilation. intraoperative arterial blood gas analysis confirmed that the patient 's partial pressure of oxygen was maintained at 184 mmhg with a fractional inspired o2 level of 1.0, so we did not administer an additional supply of o2 to the right upper lobe. extubation was performed on postoperative day 2, as chest radiography in the icu did not show abnormal findings. the primary lesions in the present case were in the right middle lobe, which was suggestive of necrotizing pneumonia, and the right lower lobe, which was suggestive of aspiration pneumonia. therefore, the primary objective was to block the point of division of the middle and lower lobes with a fogarty catheter to prevent the abscess in the right middle lobe from contaminating the right lower and upper lobes (fig. however, one limitation is that an imperfect fit between the bronchus and the cuff can not completely isolate the right middle lobe ; thus, the abscess can still spread from the middle lobe to the lower lobe, which would not be observed via the bronchoscope during surgery. another limitation is that there is the possibility of the lung abscess spreading further during the process of removing the catheter and/or deflating the balloon. this risk can be reduced by adjusting the patient 's position to a supine position. selective isolation of the right middle lobe could have been an option ; however, we did not perform right middle lobar isolation as the abscess may have spread to the lower or upper lobe during the insertion of a fogarty catheter into the middle lobe. one of the typical symptoms of huntington 's disease is difficulty swallowing, and the resulting pneumonia is the most frequent cause of death. therefore, selective lobar isolation an attempt to preserve the functional lobes during surgery can be a good ventilation method during lobectomy for patients with huntington 's disease or an overall impairment of pulmonary function. | huntington 's disease is a neurodegenerative disorder with an autosomal dominant inheritance pattern. patients with huntington 's disease show an increased risk of aspiration pneumonia when the pharyngeal muscle is invaded. we report a case of advanced - stage huntington 's disease in which the patient received right middle lobectomy for a lung abscess caused by repeated aspiration. the best lung isolation technique has not yet been established in these patients. we successfully performed selective lobar isolation of the right lower and middle lobes using a double lumen tube and a fogarty embolectomy catheter. |
1-antitrypsin (aat) exhibits anti - inflammatory activity and its deficiency causes respiratory and inflammatory disorders (12345678). aat directly blocks serine proteinases activating interleukin (il)-1 cytokine family, il-8, il-32, and tumor necrosis factor (tnf)- (91011). il-32, originally discovered as a natural killer cell transcript 4 (nk4) and renamed as il-32 (also known as tnf-inducing factor (taif) in databank), induces various inflammatory cytokines via nf-b and p38mapk signaling (1012131415161718). il-32-ligand affinity chromatography lead to isolation of neutrophil proteinase 3 (pr3) from human urine (9). the suppression of il-32 expression by aat increased survival in an allogeneic bone marrow (bm) transplantation mouse model (19). unlike other cytokines possessing specific membrane receptors therefore, this study aimed to investigate the inhibitory activity of aat on il-32-induced inflammation in mouse bm cells. primary mouse bm cells were isolated from 6-week - old female c57bl/6 mice as described previously (20), seeded on a 96-well plate at a density of 110/0.2 ml, and then stimulated with 100 ng / ml lps (sigma - aldrich, st. louis, mo, usa), tnf, il-32, and il-1 (ybdybiotech, seoul korea) as indicated at the bottom. the animal experiments were approved by the institutional animal care and use committee (iacuc) of konkuk university. il-32-induced nf-b and p38mapk phosphorylation in bm cells isolated from 6-week - old c57bl/6 mice was examined using anti - phospho antibodies (cell signaling technology, beverly, ma, usa). recombinant pr3-fc was expressed as described previously (21), and then was used in il-32 binding assay. a 96-well plate was coated with pr3-fc (1 g / ml) overnight and blocked with 3% bsa for 2 h. il-32 was added at the concentration indicated at the bottom, and was detected by rabbit anti - il-32 antibody (22). aat - fc was pre - incubated with pr3-fc - coated 96-well plate at a concentration indicated at the bottom, and then its reaction with il-32 was detected by rabbit anti - il-32 antibody. primary mouse bm cells were stimulated with lps, tnf, il-32, and il-1 because they trigger common inflammatory pathways, such as nf-b and p38mapk, although they possess a specific receptor. il-1 induced il-6 at the highest level, whereas tnf induced il-6 at the lowest level, as compared to the induction level of other stimuli (fig. mouse bm cells were pre - incubated with recombinant aat - fc and then triggered with the same stimuli (fig. interestingly, aat - fc specifically suppressed il-32-induced il-6 expression, while aat - fc failed to inhibit il-6 expression induced by other stimuli (fig. this data is presented for the first time with direct evidence that aat - fc inhibits the inflammatory activity of il-32 in mouse bm cells. in addition, aat - fc experiments were performed by pretreating mice for 48 h prior to isolating bm cells. as shown in fig. 1e, il-32-induced il-6 expression was further decreased in aat - fc - pretreated mice, but il-6 expression induced by other stimuli was not inhibited (fig. next, nf-b and p38mapk signaling were assessed in the mouse bm cells after il-32 stimulation. 2a), while it was significantly suppressed in the bm cells from aat - fc - administered mice (fig. in addition, recombinant pr3-fc was expressed in chinese hamster ovary cells by using the open reading frame of pr3 fused to human fc as described previously (21). il-32 binds to pr3-fc in 1 nm range with a high affinity, since approximately 30 kda il-32 exhibits a specific binding at 30 ng / ml (fig. the specific il-32 binding to pr3-fc was abrogated by aat - fc in a dose - dependent manner (fig. these data suggest that aat - fc blocks il-32-induced inflammation in bm cells by competing with il-32 to bind on membrane pr3 and increases the survival of allogeneic bm transplantation mouse model (fig. unlike other cytokines with specific membrane receptors, il-32 utilizes membrane pr3 to induce inflammation. this may explain the specific inhibitory activity of aat on il-32-induced inflammation in patients with allogeneic bm transplantation. the present study illustrates the function of il-32 in bm inflammation that is specifically suppressed by aat - fc. further investigation on il-32-mediated inflammation in human bm transplantation will help understand the causative factor in gvhd. | the induction of interleukin (il)-32 in bone marrow (bm) inflammation is crucial in graft versus host disease (gvhd) that is a common side effect of allogeneic bm transplantation. clinical trials on -1 antitrypsin (aat) in patients with gvhd are based on the preliminary human and mouse studies on aat reducing the severity of gvhd. proteinase 3 (pr3) is an il-32-binding protein that was isolated from human urine. il-32 primarily induces inflammatory cytokines in myeloid cells, probably due to pr3 expression on the membrane of the myeloid lineage cells. the inhibitory activity of aat on serine proteinases may explain the anti - inflammatory effect of aat on gvhd. however, the anti - inflammatory activity of aat on bm cells remains unclear. mouse bm cells were treated with il-32 and different inflammatory stimuli to investigate the anti - inflammatory activity of aat. recombinant aat - fc fusion protein inhibited il-32-induced il-6 expression in bm cells, but failed to suppress that induced by other stimuli. in addition, the binding of il-32 to pr3 was abrogated by aat - fc. the data suggest that the specific anti - inflammatory effect of aat in mouse bm cells is due to the blocking of il-32 binding to membrane pr3. |
it extensively controls physical, psychological, and behavioral traits which are also influenced by genetic information. sex - related genetics may be categorized by how sex affects phenotypic traits, including sex itself as a trait (i.e., sex determination), sex - linked trait, sex - limited trait, and sex - influenced trait. sex determination depends on the existence of y chromosome, especially the sex - determining region y gene on the chromosome. sex defined as a binary trait has been proven to be more complex as accumulating research reveals its genetics. different molecular mechanisms operate in sexual development not only by the gene, but also by other autosomal genes that can control hormone balances. sex can be categorized as typical female, female with subtle variation, female with moderate variation, sex with xx and testicular disorder of sex development (dsd), sex with ovotesticular dsd, sex with xy and dsd, male with moderate variation, male with subtle variation, and typical male. sex - limited traits are determined by genes located on autosomes and express only in one sex. while these traits are responsible considerably for sexual dimorphism, sex - influenced traits do not show distinctive expression between women and men. however, dissection of genetic factors associated with sex has been limitedly explored to examine sex - influenced traits. this is because many of the traits are intricate that they can hardly be explained by a few genes or sex - specific genes (mitochondrial and sex - chromosomal genes). also, few appropriate analytical methods have been employed to explain sex - influenced traits. here, i would like to discuss assumption violations in identifying genetic factors for sex - influenced traits and propose appropriate methods to overcome problems. most analytical models for sex - influenced traits assume an additive sex effect by treating it as a covariate in models or adjusting it preliminarily (fig. this leads to inference on genetic and environmental effects associated with the term sex in the lump. sex has been interchangeably used with gender contrary to their original meanings of biological and social characteristics of women and men, either of which has connotations of biology and sociology. a problem is that the analytical models most likely ignore interactions of sex with genetic factors. thus, genetic effects related to hormones are likely to interact with other genetic effects. furthermore, different social environments by gender interact with genetic effects. this is the reason why gene - by - sex interaction might be explained as gene - by - gene interaction and/or gene - by - environment interaction in analytical models. the gene - by - sex interaction has been shown in hypertension, schizophrenia, rheumatoid arthritis, and recombination rate [5, 6 ]. from an evolutionary point of view, the gene - by - sex interaction can be produced by sex - specific or sexually antagonistic selection. nevertheless, the gene - by - sex interaction has been ignored mostly even in studies designed to identify other gene - by - gene or gene - by - environment interaction [8, 9 ]. however, the homogeneity problem can not be overcome by this approach for many sex - influenced traits. for example, heritability (a portion of phenotypic variance explained by genetic effects) of men was larger than that of women for body mass index and triglyceride level. this heterogeneous heritability must be attributed to difference in individual genetic effects between women and men. furthermore, genetic correlation between women and men was far from one for all quantitative traits analyzed using single nucleotide variants selected by significance threshold of 0.01 : 0.76 for body mass index, 0.80 for waist - to - hip ratio, 0.73 for pulse pressure, 0.78 for high - density lipoprotein cholesterol, 0.65 for triglyceride, 0.79 for low - density lipoprotein cholesterol, and 0.73 for glucose level. more seriously, this can produce false negative genetic associations when genetic effects exist only in one sex. the problem of ignoring gene - by - sex interaction can be solved by including interaction term in the analytical model (table 1b). the problem of heterogeneous variance can be solved by introducing a scaling factor to dispersion parameters. more efficiently, both problems can be simultaneously solved by analyzing data by sex (fig. heterogeneity of genetic variance by sex is assessed employing a hendersonian mixed model with genetic relationship matrix (table 1c). this matrix can be constructed by assessing genetic relationships among individuals using pedigree information or nucleotide variant information. especially, polygenic relationship matrix can be constructed using a large number of single nucleotide polymorphisms in genome - wide association studies (gwas) [11 - 13 ]. the mixed model methodology with polygenic covariance structure can control for population stratification which often produces spurious genetic associations in gwas. simultaneous analysis of both sexes might be also feasible by bivariate mixed model analysis (table 1d). this enables us to estimate genetic correlation between females and males. a careful analytical model is needed to deal with polygenic effects of sex chromosomes. polygenic effects of y chromosome should be independently included in analytical model only for phenotypes of men because of its absence in women and thus absent genetic correlation between women and men. polygenic effects of x chromosomes might be simultaneously assessed with autosomal polygenic effects or independently assessed, depending on the assumption about two alleles from homologous x chromosomes. the sex - stratified bivariate mixed model can be extended to analyses for multiple traits. for example, an analytical model for two diseases of schizophrenia and rheumatoid arthritis has been designed to treat schizophrenia - male, schizophrenia - female, rheumatoid arthritis - male, and rheumatoid arthritis - female as four different traits. a caution with the use of mixed model in estimating fixed and random effects should be attached on its underlying statistical property. many researchers believe that the best linear unbiased estimation (blue) and best linear unbiased prediction (blup) can be achieved respectively for fixed and random effects from mixed model analyses. the blue and blup are assumed to have known variance and covariance components of random effects and residuals. variance and covariance components should be estimated using the same data as used for blue and blup, typically employing restricted maximum likelihood (reml). that is, the reml estimates are utilized instead of known variance and covariance components. strictly speaking, fixed and random effects are not estimated as blue and blup anymore. a bayesian approach with gibbs sampling as a markov chain monte carlo could overcome the problem by estimating variance and covariance components and blue genetic effects simultaneously (table 1e). these merits help draw better inference on genetic parameters which often involve high - degree complexity. another issue is unrealistic assumption of homogeneous contributions to genetic variance, producing potential bias in genetic variance. heterogeneous effects can be introduced by a bayesian method with priors on numbers of major snps or by penalty based on functions of each snp effect. such reasonable approaches should be incorporated in the analysis to identify more accurate sets of genetic variants by sex and their heterogeneous effect sizes. genetic architecture of a complex trait can be constructed by sex and further extended by more stratified sex as shown in (fig. furthermore, the analysis would provide sex - dependent genetic potential of each individual for specific complex phenotype. this implies that genetic value inherited from an individual to daughter is different from that inherited from the same individual to son. criticism might be raised for reduced statistical power because sample size decreases in half from partitioning data by sex. furthermore, the burden of reduced power is dramatically improved as emerging technologies for sequencing dna are in rapid progress it is time to move towards estimating genetic architecture of each sex to understand genetics of sex itself and complex traits related to sex. genetic effects of each sex should also be estimated for transient traits such as rna and protein levels. for example, identification of expression quantitative trait loci can be conducted by sex to show sex - dependent gene regulation, which would help understand underlying biological mechanisms of sex - influenced traits. research efforts identifying sex - dependent genetic factors of diseases would provide insights on genetic dissection to explain different prevalence, course, and severity of complex diseases between women and men in the era of personalized medicine. this may make it possible to prescribe different health - seeking behavior between women and men. ultimately, heterogeneous genetic architecture between women and men will contribute healthier life in the future through in - depth understanding of underlying determinants on their health inequalities. | analytical models usually assume an additive sex effect by treating it as a covariate to identify genetic associations with sex - influenced traits. their underlying assumptions are violated by ignoring interactions of sex with genetic factors and heterogeneous genetic effects by sex. methods to deal with the problems are compared and discussed in this article. especially, heterogeneity of genetic variance by sex can be assessed employing a mixed model with genetic relationship matrix constructed from genome - wide nucleotide variant information. estimating genetic architecture of each sex would help understand different prevalence, course, and severity of complex diseases between women and men in the era of personalized medicine. |
submacular hemorrhages can be caused by several conditions such as trauma in all age groups and age - related macular degeneration (armd), polypoidal choroidal vasculopathy (pcv), and macroaneurysms in the elderly.1 unfortunately, any submacular hemorrhage will result in devastating visual loss if inappropriately managed. the important prognosis factors for vision recovery in traumatic submacular hemorrhage depend on the nature of the injury, length of time before treatment is sought, area of the retina involved, and pre - existing macular function. damage to the retina can occur within 24 hours and the opportunity for successful recovery is within 2 weeks of onset.2,3 the management of traumatic submacular hemorrhage has evolved tremendously from traditional submacular surgery with large retinotomy to a safer pneumatic displacement procedure with or without a tissue plasminogen activator (tpa).3 the success of anti - vascular endothelial growth factor (vegf) in treating submacular hemorrhage related to armd, proliferative retinopathy, and pcv is well established, but, as far as we are aware, there are no reported studies regarding its usage in traumatic submacular hemorrhage. submacular surgery and pneumatic displacement with the use of tpa injection are not without potential complications. retinal detachment, retinal toxicity, and recurrent hemorrhage do occur.4 the success of submacular surgery and pneumatic displacement with gas tamponade are directly related to the duration of the interval between trauma onset and time of seeking treatment because the surgical procedure is only applicable if the patient seeks treatment within 2 weeks of the trauma involving submacular liquefied blood.1,2 herein, we report a case of extensive traumatic submacular hemorrhage that was successfully treated with a single dose of intravitreal ranibizumab. a 23-year - old healthy malay man presented with reduced central vision in his left eye of 2 days duration following a history of blunt trauma. he alleged that his left eye had accidentally been hit by a racket while playing badminton. following the trauma, he developed a reduction in his left central vision that progressively worsened and was associated with mild eye pain. however, there were no floaters, fashes of light, or curtain field defects. ocular examination revealed visual acuity in the left eye was counting fingers at 1 meter and 6/6 in the fellow eye. the anterior segment of the left eye showed a presence of an infero - temporal subconjunctival hemorrhage and a mild anterior chamber reaction. left - eye fundus examination revealed an extensive submacular hemorrhage with suspicion of a choroidal rupture at the inferior margin of the submacular hemorrhage (figure 1). no retinal tear or retinal detachment was seen. optical coherence tomography of the left eye showed increased macular thickness with presence of submacular hemorrhage (figure 2a and b). he was diagnosed with traumatic subconjunctival hemorrhage, anterior uveitis, and extensive submacular hemorrhage of the left eye, most probably secondary to choroidal rupture following blunt trauma. he was treated with 4-hourly topical prednisolone acetate 1% in the left eye for the mild traumatic anterior uveitis and treated conservatively for the submacular hemorrhage. at follow - up at 1 week (day 12 post - trauma), there was no improvement in the vision in his left eye. the subconjunctival hemorrhage and anterior uveitis were resolved, but there was minimal resolution of the submacular hemorrhage (figure 2c and d). the prednisolone acetate 1% eye drop doses were tapered and then stopped within 2 weeks. in view of the lack of improvement in his vision and poor resolution of the submacular hemorrhage, we decided to trial intravitreal ranibizumab, which was a first for us in treating traumatic submacular hemorrhage. after discussing various treatment options with the patient and obtaining his informed consent, a single dose of 0.5 mg intravitreal ranibizumab was administered to his left eye using an aseptic technique in a surgical theatre on day 20 following trauma. four weeks post - intravitreal ranibizumab, his left visual acuity was found to have improved from counting fingers to 6/45. a choroidal rupture scar temporal to the fovea was observed, which had not been seen at presentation due to obscuration by blood (figure 3). repeat optical coherence tomography showed a reduction in macular thickness and resolution of the submacular hemorrhage with restoration of anatomical retinal architecture (figure 2e and f). by 3 months following the trauma, the patient s left visual acuity was found to have further improved to 6/18. several factors contribute to poor anatomical as well as functional visual recovery in traumatic submacular hemorrhage. these include mechanical damage to the photoreceptors by fibrin infiltration, shearing of photoreceptor cells, iron and hemosiderin toxicity, impaired nutrient supply to the photo - receptors, and fibrotic macular scarring.2,3 this indicates that the faster the blood clot resolves, the better anatomical and functional visual recovery is likely to be, since retinal degeneration over areas of dense fibrin occurs within 314 days.5 there is no formal consensus on the management of submacular hemorrhage. in our case, which involved a young man with a premorbidly healthy retina, several treatments could have been offered to him. submacular surgery was one of the options, but it has devastating complications related to its surgical technique, such as removing retinal pigment epithelium (rpe) and photoreceptor layers together with the blood clot.2 further, the anatomical uncertainty due to the obscuration caused by the hemorrhage can make the surgical procedure more difficult and unpredictable. the submacular surgery trial,6 which was undertaken in age - related macular hemorrhage patients, also reported that subretinal extraction of hemorrhage produced equivocal results in comparison to the observation group. pneumatic displacement with or without tpa may have been a better option, but this treatment also has certain limitations. improper pneumatic displacement can lead to shearing of the photoreceptor layers, which will worsen final vision outcome.7,8 in addition, the penetration of tpa into the sub - rpe space is poor compared with that of ranibizumab, which indirectly compromises the effect of tpa in deeper subretinal hemorrhage.7,8 conservative treatment involving just observation could have been an option with our patient. however, it would not have been suitable because of the presence of a wide area of submacular hemorrhage involving the fovea, which can predispose a higher risk of poor visual outcome due to the possibility of dense scarring by fibrin - mediated retinal damage. further, the age of the patient needed to be considered. when the patient is healthy and young, it is better to offer another treatment modality rather than just simple observation. in our case intravitreal ranibizumab has been successfully used to treat submacular hemorrhage related to retinal vascular diseases such as armd, pcv, and proliferative retinopathy. as far as we are aware, there have been no reported cases of traumatic submacular hemorrhage treated with ranibizumab. however, in our case, the ranibizumab rapidly resolved the submacular hemorrhage, restored the patient s retinal architecture, and achieved satisfactory visual recovery. the basis of its effectiveness in treating traumatic submacular hemorrhage as in our case is not clearly known. we postulate that the anti - vegf property as an anti - inflammatory agent played an important role. vascular tissue trauma is usually associated with an acute release of large amounts of vegf as part of the healing process.9 this large amount of vegf may be associated with extensive tissue inflammation due to the high amount of neutrophils released,9 which may lead to excessive tissue reaction, delayed healing, and dense scarring. besides its anti - angiogenesis effect, ranibizumab has also been proven to be a good anti - inflammatory agent, as it modulates inflammatory cells in particular, fibroblast - related activities.10,11 it has demonstrated good penetration into deeper retinal tissues, including the subretinal tissue and sub - rpe space. this may explain its effectiveness in treating conditions related to retinal trauma, including traumatic submacular hemorrhage.4 additionally, ranibizumab has also shown an excellent antiscarring effect in post - trabeculectomy patients by increasing bleb survival rate.10,11 however, our hypothesis on the significance of the anti - vegf property of ranibizumab is just an assumption based on a single case, so further investigation is needed to establish an association. although a favorable outcome was achieved in this case, a large population cohort study is needed to establish the safety and effectiveness of ranibizumab in treating extensive traumatic submacular hemorrhage. if the results of such a study were favorable, this would enable this treatment to become an alternative or adjuvant therapy to traditional surgery and conventional pneumatic displacement with tpa as a primary treatment in managing traumatic submacular hemorrhage. | herein, we report our experience in treating extensive traumatic submacular hemorrhage with a single dose of intravitreal ranibizumab. a 23-year - old healthy malay man presented with a progressive reduction of central vision in the left eye of 2 days duration following a history of blunt trauma. visual acuity was reduced to counting fingers. examination revealed infero - temporal subconjunctival hemorrhage, traumatic anterior uveitis, and an extensive sub - macular hemorrhage with suspicion of a choroidal rupture in the affected eye. he was initially treated conservatively with topical prednisolone acetate 1%. the subconjunctival hemorrhage and anterior uveitis resolved but his vision remained poor with minimal resolution of the submacular hemorrhage at 1 week follow - up (day 12 post - trauma). in view of the poor resolution of submacular hemorrhage, he was treated with a single dose of 0.5 mg intravitreal ranibizumab at day 20 post - trauma. at 4 weeks post - intravitreal ranibizumab, there was an improvement in visual acuity (from counting fingers to 6/45) and complete resolution of the submacular hemorrhage with presence of a choroidal rupture scar temporal to the fovea, which was not seen clearly at presentation due to obscuration by blood. his visual acuity further improved to 6/18 at 3 months post - trauma. although this single case had a favorable outcome, a large population cohort study is needed to establish the effectiveness of intravitreal ranibizumab in treating extensive traumatic submacular hemorrhage. |
delivery of high - quality and consistent services is a big challenge in the health care system nowadays. evidence based practice (ebp), a problem - solving approach to patient care based on the best available and valid evidence, leads to enhanced quality of care, reduced costs, and the individual and professional development of nurses and other health workers. ebp has been promoted as a way for clients to receive the best level of care. nurses are the largest group of health care providers and have a key role in ensuring the promotion of health care and delivering better services. ebp is important to the professional development, responsibility, and capabilities of nurses, and it has become an important subject in nursing and has integrated into daily practice. in addition, nurses who practice based on the scientific evidence have been able to make better decisions in services delivery. though nurses generally report positive attitudes and beliefs towards ebp [911 ], previous studies show that nurses were not familiar enough with its principals and they use ebp to a limited extent [9, 12, 13 ]. several studies have found that both human and organizational factors are associated with barriers to the use of ebp including lack of time to read literature, heavy workload, lack of staff experienced in ebp, and lack of resources [11, 14, 15 ]. a current systematic review showed that there are many barriers to the implementation and use of ebp and concluded that identifying barriers is the first step to removing them. little research has been conducted on ebp beliefs and its use among iranian nurses. moreover, the iranian nursing care system does not provide the incentive for nurses to engage in research and most nurses were not familiar with the concept of ebp. therefore, the aim of this study was to determine barriers to implementation of evidence based practice in zahedan teaching hospitals. the results of the study can help managers and policy makers in planning for better use of ebp in nurses and other staff in hospitals. this analytical cross - sectional study was conducted in zahedan city, south east of iran, in 2014. the sample was all nurses who were at work during data collection in the hospitals. the participants ' verbal informed consent was obtained and nurses participated voluntarily in the study. then, based on nurses personnel list (sampling frame) a proportional random sample from each hospital was taken by the stratum 's size. considering the proportion of barriers to implementation of ebp to be 78.6%, the sample size of 270 at 95% significant levels and error level of 0.05 was calculated and ten additional participants were added to the sample size and the overall sample size reached 280 subjects. we used the questionnaire of barriers to implementation of ebp that has been tested for reliability and validity in a previous study. in this study, cronbach 's coefficient alpha of 0.81 indicated sufficient reliability of all statements in the questionnaire. demographic information was collected such as age, sex, education, job experience, and employment status. the questionnaire of barriers to implementation of ebp consists of 27 statements with two aspects (organizational aspect : 18 statements, and individual aspect : 9 statements). in both organizational and individual aspects respondents were asked to score the level to which they agree (scored as 1), have no opinion (scored as 2), or disagree (scored as 3). descriptive statistics (frequency table, mean and standard deviation) were conducted to describe the background factors and barriers to implementation of ebp. the chi - square test was also used for data analysis at 0.05 significance levels using the statistical software stata 11 (statacorp, college station, tx, usa). the questionnaires were distributed to 280 nurses, with 263 nurses returning the questionnaires (response rate = 93.9%). the average age was 28.4 years (sd = 5.4) with a range of 2150 years. most of the participants were employed with education level of bachelor 's degree (94.7%). more than half of the participants agreed that 56% and 57% of barriers to implementation of evidence based practice are related to organizational and individual aspects, respectively. the list of five common barriers to implementation of evidence based practice (ebp) by organizational and individual aspects is presented in table 2. the lack of human resources (shortage of nurse) (78.3%), lack of internet access at work (72.2%), and heavy workload (70.0%) are the most important organizational barriers. the most important individual barriers to implementation of ebp are lack of time to read literature (83.7%), lack of ability to work with computer (68.8%), and insufficient proficiency in english language (62.0%). table 3 demonstrates the associations between background variables and barriers to implementation of evidence based practice by organizational and individual aspects. there was a statistical and significant correlation between age, educational level, job experience, employment status, and barriers to implementation of evidence based practice experienced by nurses associated with organizational aspects. with regard to barriers to implementation of evidence based practice experienced by nurses associated with individual aspects, only educational level was significant (p = 0.017). the present study has demonstrated the barriers to implementation of ebp among an iranian nurses population. the results showed that both organizational and individual aspects are barriers to implementation of ebp. we found that 57% of barriers to implementation of ebp are related to individual aspects. the three individual barriers most often encountered are lack of time to read literature, lack of ability to work with computer, and insufficient proficiency in english language. the most commonly reported personal barrier is lack of time in different parts of world [1921 ]. a qualitative study to explore nurses ' experiences and perceptions about ebp showed that over half of participants (52.6%) had not passed any courses on computers. previous studies [22, 23 ] revealed that the important factor to find the best evidence to clinical practice questions is having the ability to work with computers. in addition, an iranian study reported that 21.4% of barriers to implementation of ebp are related to individual aspects. the authors showed that lack of time is a common barrier to implementation of ebp. for example, a study to determine the barriers of ebp among iranian urologists found that being familiar with evidence is needed and lack of time is the important barrier to implementation of ebp. our study also found that language barriers were another important barrier ; insufficient familiarity with english language was a significant barrier to ebp implementation. this is supported by studies conducted in taiwan showing that nurses preferred evidence based resources to be available in chinese [20, 25 ]. another important finding of this study was that the 56% of barriers to the implementation of ebp were related to individual aspects. the most frequently reported organizational barriers to implementation of ebp were lack of human resources (shortage of nurse), lack of internet access at work, heavy workload, and lack of access to a rich library with nursing journals. reported that in the human resource category, shortage of nurses and heavy workload are the most common barriers to implementation of ebp. another study exploring the relationship between nurses ' personal and professional factors and ebp found that only 32% of nurses have a library rich in nursing journals at their workplace and 42% had no internet access. moreover, the results of a study showed that the most important facilitators to the utilization of research in practice are human resources. accordingly, organizational support can be a target of change in ebp implementation. in this regard, schoonover concluded that organizational strategies are needed to influence research awareness and utilization. another study revealed that several problems of clinical nurse performance appraisal system are related to organizational context. accordingly, changing of the appraisal system is necessary to support the achievement of high quality of patient care. the background variables such as age, educational level, job experience, and employment status were found to be significantly associated with barriers to implementation of ebp. according to the result, participants with job experience less than five and more than 16 years agree more that organizational aspects are associated with barriers to implementation of ebp. in other words, there was a u - shape association between job experience and organizational barriers of ebp implementation. it was identified that nurses with bachelor 's degree agree more that organizational aspects are associated with barriers to implementation of ebp than those with master 's degree. education level has been mentioned in some of the related studies as a main factor to implementation of ebp [13, 28 ].. also revealed that academic degree and educational training are important factors to implementation of ebp. since ebp is a critical and important issue in nursing, nurses should increase their knowledge and attitude about ebp and use it for better delivery services. beside, policy makers must provide a suitable workplace or opportunities for staff to increase their knowledge in hospitals. in this study older individuals may be more aware of the current trends or know that ebp is something that they should be doing. another reason is that they are more familiar with hospital system and factors associated with use of ebp. self - report questionnaire was used to obtain the data which can introduce information biases. for example, the construction of questionnaire, lack of time, and the individual interest may be derived from self - report questionnaire. another important limitation of our study was the limited sample size in subgroup of variables such as education level (94.7% versus 5.3%). despite these limitations, the high response rate (93.9%) in addition, knowledge of barriers will help health care system and policy makers to address these and to provide a culture of ebp. | this study aimed to determine the barriers to implementation of ebp among nurses. this cross - sectional study was conducted in zahedan city, south east of iran, in 2014. the questionnaire of barriers to implementation of ebp consists of 27 statements which was distributed among 280 nurses. more than half of the participants agreed that 56% and 57% of barriers to implementation of evidence based practice are related to organizational and individual aspects, respectively. participants identified barriers at organizational level included the lack of human resources (78.3%), lack of internet access at work (72.2%), and heavy workload (70.0%). barrier at individual level included lack of time to read literature (83.7%), lack of ability to work with computer (68.8%), and insufficient proficiency in english language (62.0%). age, educational level, job experience, and employment status were associated with organizational barriers to implementation of ebp. at the individual level only education was associated with barriers to implementation of ebp. barriers to implementation of ebp occur at both individual and organizational levels. the indicator of quality in nursing practice is ebp. hence, familiarity with ebp is recommended for iranian nurses. in addition, knowledge of barriers will help health care system and policy makers to provide a culture of ebp. |
in 1952, goldenhar described a syndrome that presents with a combination of several anomalies, such as, dermal epibulbar tumors, periauricular appendices, and malformation of the ears. later on, this condition also presented with heart diseases and hypoplasia of the zygomatic, mandibular, and maxillary bones. oculoauriculovertebral spectrum (oavs) presents with an estimated prevalence that ranges from 1 to 5,600 in 45,000 of live - births, and is considered the result of a blastogenesis defect that particularly involves the structures originating from the first branchial arches. in approximately 5 to 15% of the cases, the anomalies observed in oavs are hypoplasia of the thumb and hypoplasia and/or agenesis of the radio. to date, about 32 cases of oavs and radial defects have been reported. here an eight - year - old male child presented to the pediatric outpatient department with complaints of facial asymmetry and polydactyly with bilateral microtia since birth. the child was born by vaginal delivery at a government hospital, with a birth weight of 2.5 kg. the child showed undernourishment and weighed 15 kg (< fiftieth percentile) and a height of 110 cm (< fiftieth percentile). on physical examination, facial asymmetry, right side infranuclear facial palsy, bilateral microtia with bilateral ear tag [figure 1 ], short neck, high arched palate, and skin tags on the nape of the neck were present. there was lower motor neuron weakness of the facial nerve on the right side, manifested by an inability to close the right eye and loss of a nasolabial fold on the same side. asymmetric crying facies was noted with the right lower lip being pulled down while crying or chewing. left eye closure and nasolabial fold were normal. left preaxial polydactyly was present [figure 2 ], whereas, the other hand was normal. microtia with preauricular tag facial asymmetry with left preaxial polydactyly on ophthalmological examination, the only positive finding was presence of a right - sided iris coloboma. cardiac auscultation revealed that s1 and s2 were normal and a soft systolic murmur was present in the pulmonary area. x - ray examination of the skull and vertebral column did not show any vertebral abnormality. a computed tomography (ct) scan of the temporal bone revealed bony atresia of the external auditory canal, with absence of mastoid pneumatization of the right ear and left ear, showing auricular tags with bony atresia of the external auditory canal, with a deformed ossicular chain. oavs or goldenhar syndrome is characterized by a variable degree of uni - or bilateral involvement of the craniofacial structures involving the first and second branchial arches, ocular anomalies, and a vertebral defect. the oavs, with radial defects, characterizes a subset within the oavs, mainly involving the first uni - or bilateral branchial arches and limb primordium. the main signs include ear malformations, facial asymmetry, mandible hypoplasia, and a radial defect. the etiology is not known, but various theories suggest that exposure to viruses during pregnancy, abnormal vascular supply to the first arch, and abnormality of mesoblastic development are reponsible. some author reported that the disorder may be due to multifactorial inheritance. ear anomalies, including preauricular tags, microtia anotia, and aural fistulae are reported. wang,. reported a 46% incidence of conductive hearing loss in their study. in our case, bilateral microtia with bilateral preauricular tags craniofacial abnormalities may include malar hypoplasia, maxillary and mandibular hypoplasia, and temporal hypoplasia, incomplete development of the muscles of the face, macrostomia, cleft palate, cleft lip, and abnormalities of the teeth. wang. reported the incidence of facial nerve palsy in patients with craniofacial abnormalities to be 33.3%. in most cases, the etiological investigations of facial nerve palsy revealed an absence of physical or radiographic findings. the mri of the temporal bone revealed normal components of the facial nerve and facial canal in our case. ocular abnormalities included epibulbar dermoids or lipodermoids, unilateral microphthalmia, and upper eyelid coloboma. in our case vendramini,. reported that the most common anomalies observed in oavs were hypoplasia of the thumb and hypoplasia and/or agenesis of the radio. the radial defects observed with less frequency were thumb agenesis, preaxial polydactyly, and triphalangeal thumb. in our case left - side preaxial polydactyly congenital heart diseases are seen in 40 to 60% of the patients, but no cardiovascular abnormalities was found in our case. the renal malformation like renal agenesis, ectopic kidney, urethral duplication, and vesicoureteric reflex was ruled out by ultrasonography, in our case. vertebral anomalies like hemivertebrae and hypoplasia of the cervical vertebrae and cervical fusion were absent in this case. our patient had facial asymmetry, microsomia, microtia, congenital facial nerve palsy, skin tags iris coloboma, and preaxial polydactyly. orthodontic evaluations were important, to assess for missing teeth, dental crowding, jaw growth, and dental occlusion. all infants with oavs should have a diagnostic hearing evaluation brainstem auditory evoked response (baer) within the first six months of life. the use of hearing aids is needed early in life, in case of conductive deafness. in a patient with underdevelopment of the lower jaw, reconstruction could be done with rib bone graft, and an underdeveloped mandible could be is lengthened by a bone distraction device. reconstruction of the external ear could be performed at the age of six to eight years, whereas, the reconstructed asymmetry for cheek fullness could be done at eight to ten years of age. the surgical procedure involved temporarily wiring the jaws together during the operation. in conclusion, in very rare cases ovas is associated with a radial defect. | oculoauriculovertebral spectrum (oavs) or goldenhar syndrome is a wide spectrum of congenital anomalies that involves structures arising from the first and second branchial arches. it is characterized by a wide spectrum of symptoms and physical features. these abnormalities mainly involve the cheekbones, jaws, mouth, ears, eyes, or vertebrae. other conditions with ear and/or radial involvement, such as, the nager syndrome, holt - oram syndrome, radial renal syndrome, facioauriculoradial dysplasia, fanconi anemia, and vertebral, anal atresia, cardiac, trachea, esophageal, renal, and limb (vacterl) association should be considered for differential diagnosis. here we report a child who had facial asymmetry, microsomia, microtia, congenital facial nerve palsy, conductive hearing loss, skin tags, iris coloboma, and preaxial polydactyly. |
varus alignment has been shown to increase the risk of osteoarthritis (oa), especially in the medial condyle, and also accelerate disease progression in knees with existing oa. due to the varus alignment, the knee experiences higher loads through a larger adduction moment during gait, that increases loading through the medial condyle and reduces loads passing through the lateral condyle, thus causing or exacerbating the problems of oa on the medial condyle. the biomechanics of the knee is governed largely by the shape of the distal femur and proximal tibia, and the relationship that exists between their articulating surfaces. a normal knee, defined as having a neutral alignment, has a limb angle of 180 3, measured between the mechanical axis of the femur and the mechanical axis of the tibia. while the morphology and angulation of normal knees are well defined in the literature [13, 35, 36 ], varus knees have been primarily classified based on the alignment of the femur and tibia in just the coronal plane, with a mechanical tibiofemoral angle of 177 or lower. varus and valgus knees have been compared, but limited to a comparison of the flexion facets without incorporating the extension facets, which are most affected in medial oa. in addition, there are very few studies characterizing the variations in local morphology and alignment of varus knees and specifically comparing their differences with normal knees [18, 25 ]. condylar morphometry, which involves the study of the geometry and related axes and their associations, can be used to investigate features of the condyles and their relative movements [11, 12 ]. rotational alignment, which is critical to the kinematics and contact pressures of the implanted knee in total knee replacement (tkr), is often defined using axes and landmarks whose associations with each other are well understood. for example, the transepicondylar axis and the posterior condylar axis of the femur are often used to align the femoral component of knee prostheses [30, 36 ] and the posterior condylar axis of the tibia, the condylar centers axis and the tibial tubercle axis used to align tibial components. there is a risk that axes used to align components may change with the varus deformity, leading to implant misalignment and adverse biomechanics of the replaced joint. this is particularly timely given the recent heavy marketing of patient - specific instrumentation by manufacturers and the risk that such guides may align implants to the wrong place in varus knees if they are based on the wrong reference features. it was hypothesized that the axes and features used for alignment or patient - specific implant design are different between normal and varus knees, and recognizing and identifying these can help improve alignment of components, and patient - specific instrument and implant designs for a varus knee. to test this hypothesis, established geometrical features and axes of normal and varus knees were measured using a computed tomography (ct) protocol and any significant differences investigated. a total of 56 knees, 31 varus (173 2.4) and 25 normal (181.5 1), were ct scanned using a siemens sensation 4 four - slice ct scanner, following the imperial knee protocol for low - dosage tomography that also scans the femoral head / neck and ankle to allow mechanical axes to be resolved. of the 56 knees, for the measurements on the tibia, only 29 varus and 18 normal tibiae could be included due to insufficient ct slices to resolve some of the key axes. the varus knee group had oa, but this was limited to the anterior of the medial femoral / tibial condyle. to maintain consistency across the entire dataset, a protocol of landmark identification and measurements was developed and followed in each case. in - house ct software was used to threshold the grayscale values and allow visualization of the joint surfaces. the femur and tibia were analyzed separately as the relative alignment between femur and tibia was not considered a valid measure because of the supine unloaded body position during the ct scan. the femur was first orientated to a tri - spherical coordinate system formed by the centers of spheres fit to the femoral head and the medial and lateral flexion facets (ffs) of the knee. the mechanical axis of the femur (maf) was identified as the line connecting the center of the femoral head and the inter - condylar notch, defined in this study as the most distal center of the notch. landmarks were then identified to define the following axes anatomical transepicondylar axis (tea), femoral posterior condylar axis (pcaf), anterior condylar axis (aca) and whiteside s line (ap) (fig. 1). the extension facet (ef) of the medial condyle was defined as bounded anteriorly by the sulcus and posteriorly by projecting inferiorly the posterior edge of the depression associated with the origin of the medial gastrocnemius tendon. spheres were defined to represent the flexion facet (ff) surfaces of the medial and lateral condyles and their centers used to define the flexion facet axis (ffa, fig. 1). the extension facet was split into four equally spaced areas from posterior to anterior and spheres fit to each of these areas to investigate local changes in sphericity. the extension facet on the lateral condyle of both varus and normal knees was not measured owing to its flatter surface and unreliable sphere fitting as has been commented on previously.fig. 1 a regions used to define and place markers on the flexion facets (left) and extension facets (right) in the distal femur to fit spheres. boundaries of the facets were identified on ct scans ; the extension facet extended until the medial sulcus terminalis (dotted line) and was split into four sections for more detailed analysis. b visualization of the spheres fit to the flexion facets of the medial and lateral condyles, and transverse ct slice illustrating commonly defined axes for the distal femur (right) a regions used to define and place markers on the flexion facets (left) and extension facets (right) in the distal femur to fit spheres. boundaries of the facets were identified on ct scans ; the extension facet extended until the medial sulcus terminalis (dotted line) and was split into four sections for more detailed analysis. b visualization of the spheres fit to the flexion facets of the medial and lateral condyles, and transverse ct slice illustrating commonly defined axes for the distal femur (right) for fitting the sphere on to the condylar surfaces, over 50 points were used to fit spheres of best fit for the regions defined. the coordinates of all the landmarks, including sphere centers, were then projected in the coronal, sagittal and transverse planes relative to the tri - spherical axis defined previously, and measurements were carried out in each of the planes using a custom written code in matlab (mathworks, ma, usa). the diameters of the spheres, the angles formed between the various axes, point - to - point distances and point - to - axes distances were calculated in each of the anatomical reference planes. to eliminate problems related to the size variation in the groups, considering that the focus was on the distal femur, the tea was thought to be the most appropriate. the tibia was orientated to axes that were defined by the centers of the circles fit to the medial and lateral plateaus in the transverse plane and the center of the talus. to avoid erroneous measurement due to the presence of osteophytes, the circles were fit in a plane, 5 mm distal from the base of the medial inter - condylar spine. a circle was also fit to the tibial tubercle in the transverse plane and the center marked. the mechanical axis (mat) was defined as the line connecting the center of the tibia to the talus, with the proximal anatomical axis (aa) defined as the line bisecting the proximal medullary canal. : posterior condylar axis of the tibia (pcat), condylar centers axis (cca) and the tibial tubercle axis (tta) (fig. 2 a transverse view of circles and their centers fit to the medial and lateral plateaus, along with the tuberosity. c points used for measuring the coronal slope with the anatomical axis (superior : peaks and inferior : troughs) with the arrow indicating direction of increasing slope d the medial ap slope with the mechanical axis and e, the medial extension facet angle a transverse view of circles and their centers fit to the medial and lateral plateaus, along with the tuberosity. c points used for measuring the coronal slope with the anatomical axis (superior : peaks and inferior : troughs) with the arrow indicating direction of increasing slope d the medial ap slope with the mechanical axis and e, the medial extension facet angle the following landmarks were also identified : the peaks of the medial and lateral spines ; the most anterior point of the tibial tubercle ; the most superior (peaks) and inferior points of the tibial condyles in the coronal plane and sagittal planes to define the coronal and ap slopes ; and the points defining the extension facet angle in the sagittal plane (fig. the coronal slope was measured as the angle between the tibial plateau and the normal to the anatomical axis. these points were then projected onto the anatomical reference frames relative to the previously defined functional axis and measurements carried out as described for the femur. the sample size used in the study was in keeping with previous studies that have investigated morphometry [24, 25 ]. a complete set of measurements for each knee was completed and repeated by the lead author after a period of 3 weeks, and the intraclass correlation coefficient was used to determine the intraobserver reliability. for comparison between varus and normal groups, statistical analyses were carried out in spss (version 21, ibm, chicago, il, usa) using two - sample t tests or mann whitney tests depending on the normality of the data, determined using the shapiro the significance set at p < 0.05 with an additional bonferonni correction applied for groups of related measurements. the femur was first orientated to a tri - spherical coordinate system formed by the centers of spheres fit to the femoral head and the medial and lateral flexion facets (ffs) of the knee. the mechanical axis of the femur (maf) was identified as the line connecting the center of the femoral head and the inter - condylar notch, defined in this study as the most distal center of the notch. landmarks were then identified to define the following axes anatomical transepicondylar axis (tea), femoral posterior condylar axis (pcaf), anterior condylar axis (aca) and whiteside s line (ap) (fig. 1). the extension facet (ef) of the medial condyle was defined as bounded anteriorly by the sulcus and posteriorly by projecting inferiorly the posterior edge of the depression associated with the origin of the medial gastrocnemius tendon. spheres were defined to represent the flexion facet (ff) surfaces of the medial and lateral condyles and their centers used to define the flexion facet axis (ffa, fig. 1). the extension facet was split into four equally spaced areas from posterior to anterior and spheres fit to each of these areas to investigate local changes in sphericity. the extension facet on the lateral condyle of both varus and normal knees was not measured owing to its flatter surface and unreliable sphere fitting as has been commented on previously.fig. 1 a regions used to define and place markers on the flexion facets (left) and extension facets (right) in the distal femur to fit spheres. boundaries of the facets were identified on ct scans ; the extension facet extended until the medial sulcus terminalis (dotted line) and was split into four sections for more detailed analysis. b visualization of the spheres fit to the flexion facets of the medial and lateral condyles, and transverse ct slice illustrating commonly defined axes for the distal femur (right) a regions used to define and place markers on the flexion facets (left) and extension facets (right) in the distal femur to fit spheres. boundaries of the facets were identified on ct scans ; the extension facet extended until the medial sulcus terminalis (dotted line) and was split into four sections for more detailed analysis. b visualization of the spheres fit to the flexion facets of the medial and lateral condyles, and transverse ct slice illustrating commonly defined axes for the distal femur (right) for fitting the sphere on to the condylar surfaces, over 50 points were used to fit spheres of best fit for the regions defined. the coordinates of all the landmarks, including sphere centers, were then projected in the coronal, sagittal and transverse planes relative to the tri - spherical axis defined previously, and measurements were carried out in each of the planes using a custom written code in matlab (mathworks, ma, usa). the diameters of the spheres, the angles formed between the various axes, point - to - point distances and point - to - axes distances were calculated in each of the anatomical reference planes. to eliminate problems related to the size variation in the groups, considering that the focus was on the distal femur, the tea was thought to be the most appropriate. the tibia was orientated to axes that were defined by the centers of the circles fit to the medial and lateral plateaus in the transverse plane and the center of the talus. to avoid erroneous measurement due to the presence of osteophytes, the circles were fit in a plane, 5 mm distal from the base of the medial inter - condylar spine. a circle was also fit to the tibial tubercle in the transverse plane and the center marked. the mechanical axis (mat) was defined as the line connecting the center of the tibia to the talus, with the proximal anatomical axis (aa) defined as the line bisecting the proximal medullary canal. : posterior condylar axis of the tibia (pcat), condylar centers axis (cca) and the tibial tubercle axis (tta) (fig. 2 a transverse view of circles and their centers fit to the medial and lateral plateaus, along with the tuberosity. c points used for measuring the coronal slope with the anatomical axis (superior : peaks and inferior : troughs) with the arrow indicating direction of increasing slope d the medial ap slope with the mechanical axis and e, the medial extension facet angle a transverse view of circles and their centers fit to the medial and lateral plateaus, along with the tuberosity. c points used for measuring the coronal slope with the anatomical axis (superior : peaks and inferior : troughs) with the arrow indicating direction of increasing slope d the medial ap slope with the mechanical axis and e, the medial extension facet angle the following landmarks were also identified : the peaks of the medial and lateral spines ; the most anterior point of the tibial tubercle ; the most superior (peaks) and inferior points of the tibial condyles in the coronal plane and sagittal planes to define the coronal and ap slopes ; and the points defining the extension facet angle in the sagittal plane (fig. the coronal slope was measured as the angle between the tibial plateau and the normal to the anatomical axis. these points were then projected onto the anatomical reference frames relative to the previously defined functional axis and measurements carried out as described for the femur. the sample size used in the study was in keeping with previous studies that have investigated morphometry [24, 25 ]. a complete set of measurements for each knee was completed and repeated by the lead author after a period of 3 weeks, and the intraclass correlation coefficient was used to determine the intraobserver reliability. for comparison between varus and normal groups, statistical analyses were carried out in spss (version 21, ibm, chicago, il, usa) using two - sample t tests or mann whitney tests depending on the normality of the data, determined using the shapiro wilk test. the significance set at p < 0.05 with an additional bonferonni correction applied for groups of related measurements. the reliability of the measurements was found to be excellent on the femur for both varus and normal knees ; the intraclass correlation coefficient was found to be between 0.85 and 0.96 for all of the landmarks identified. in the tibia, there was very good agreement for the majority of the landmarks (0.870.93) except for landmarks used for the coronal slopes (0.72) due to the presence of osteophytes in eight of the varus tibiae. a significant difference was not found between the two groups for the diameters of the ff on the medial or lateral condyles. however, the ef on the medial condyles was found to be significantly larger in varus knees ; all of the individual sections analyzed were significantly larger (p < 0.05) than their counterparts in the normal group with mean differences ranging between 8 and 12 mm for individual sections. the diameters of the fit spheres for the flexion and extension facets are summarized in table 1. the center points of the spheres fitted to the medial extension facet sections translated anteriorly from sections 1 to 4 by about 5 mm in both groups.table 1 measurements made on the femur and tibia for varus and normal kneesgeometryvarus (mm)normal (mm)femoral medial ff radius20 221 2femoral lateral ff radius21 322 3femoral ef medial section 135 18 25 7femoral ef medial section 236 16 25 8femoral ef medial section 337 14 29 10femoral ef medial section 448 23 35 15tea length81 684 8pca length50 552 5aca length37 537 4ffa length51 554 4tibial medial plateau radius23 424 3tibial tubercle radius11 211 1cca length25 427 4tsa length11 212 3femoral axispcaa - pffaacavarusnormalvarusnormalvarusnormalvarusnormaltea7 27 22 53 67 38 39 3 11 3pca5 64 62 22 22 2 4 3a - p5 75 77 57 6ffa3 33 3tibial axisccatsattavarusnormalvarusnormalvarusnormalpca8 57 212 1413 9108 696 6cca11 126 8100 789 7tsa99 1584 10 p < 0.05, p < 0.001 measurements made on the femur and tibia for varus and normal knees p < 0.05, p < 0.001 the angles formed by the reference axes, tea, pca, ffa and ap did not differ significantly between the two groups. the results are also summarized in table 1. the aca was found to be significantly more in normal knees (~2, p < 0.05) measured against the pca and tea. significant differences were not found in the distances measured between the landmarks, or from landmarks to the defined axes. the femoral neck was significantly less anteverted for varus knees (9.4 5) compared with normal (15.7 5 ; p < 0.0001, fig. 3). a weak positive correlation was found between varus angle and femoral neck version in the varus group.fig. 3 box plot depicting the differences found between the varus and normal groups for femoral neck anteversion ; varus femurs had less anteversion when compared to normal femurs box plot depicting the differences found between the varus and normal groups for femoral neck anteversion ; varus femurs had less anteversion when compared to normal femurs the medial plateau was larger than the lateral plateau in both varus and normal tibiae, and no significant difference was found between the normal and varus groups for either medial or lateral plateau radii. the angle formed by the tibial pca and cca was not significantly different for varus and normal tibiae. the angles formed by the tta and the tibial pca were significantly larger (p < 0.0001) in varus tibiae, i.e., the tibial tubercle was rotated externally by 12 when compared to normal knees (fig. 4 box plot showing differences found between the two groups when the condylar centers axis and posterior condylar axis are measured against the tibial tubercle axis box plot showing differences found between the two groups when the condylar centers axis and posterior condylar axis are measured against the tibial tubercle axis there was a small (2) but significant increase in medial extension facet angle for the varus group (p = 0.002, fig. the coronal slope was found to be significantly more (p = 0.001) in varus knees (3.5) when compared to normal knees (0) (fig. measuring the coronal slope of the tibia is often difficult due to the presence of osteophytes ; therefore, it was investigated whether the coronal slope could be measured using the most inferior points (troughs) in the medial and lateral plateaus as opposed to the peaks (fig. a strong correlation was found between the two methods of measuring the slope in the coronal plane (r = 0.778 ; p < 0.0001 ; n = 47, see fig. 6).fig. 5 a box plot showing differences between varus and normal tibiae for the extension facet angle and b the coronal slopefig. 6scatterplots showing the strong positive correlation between coronal slope measured using the superior and inferior points a box plot showing differences between varus and normal tibiae for the extension facet angle and b the coronal slope scatterplots showing the strong positive correlation between coronal slope measured using the superior and inferior points a significant difference was not found between the two groups for the diameters of the ff on the medial or lateral condyles. however, the ef on the medial condyles was found to be significantly larger in varus knees ; all of the individual sections analyzed were significantly larger (p < 0.05) than their counterparts in the normal group with mean differences ranging between 8 and 12 mm for individual sections. the diameters of the fit spheres for the flexion and extension facets are summarized in table 1. the center points of the spheres fitted to the medial extension facet sections translated anteriorly from sections 1 to 4 by about 5 mm in both groups.table 1 measurements made on the femur and tibia for varus and normal kneesgeometryvarus (mm)normal (mm)femoral medial ff radius20 221 2femoral lateral ff radius21 322 3femoral ef medial section 135 18 25 7femoral ef medial section 236 16 25 8femoral ef medial section 337 14 29 10femoral ef medial section 448 23 35 15tea length81 684 8pca length50 552 5aca length37 537 4ffa length51 554 4tibial medial plateau radius28 424 3tibial tubercle radius11 211 1cca length25 427 4tsa length11 212 3femoral axispcaa - pffaacavarusnormalvarusnormalvarusnormalvarusnormaltea7 27 22 53 67 38 39 3 11 3pca5 64 62 22 22 2 4 3a - p5 75 77 57 6ffa3 33 3tibial axisccatsattavarusnormalvarusnormalvarusnormalpca8 57 212 1413 9108 696 6cca11 126 8100 789 7tsa99 1584 10 p < 0.05, p < 0.001 measurements made on the femur and tibia for varus and normal knees p < 0.05, p < 0.001 the angles formed by the reference axes, tea, pca, ffa and ap did not differ significantly between the two groups. the results are also summarized in table 1. the aca was found to be significantly more in normal knees (~2, p < 0.05) measured against the pca and tea. significant differences were not found in the distances measured between the landmarks, or from landmarks to the defined axes. the femoral neck was significantly less anteverted for varus knees (9.4 5) compared with normal (15.7 5 ; p < 0.0001, fig. 3). a weak positive correlation was found between varus angle and femoral neck version in the varus group.fig. 3 box plot depicting the differences found between the varus and normal groups for femoral neck anteversion ; varus femurs had less anteversion when compared to normal femurs box plot depicting the differences found between the varus and normal groups for femoral neck anteversion ; varus femurs had less anteversion when compared to normal femurs the medial plateau was larger than the lateral plateau in both varus and normal tibiae, and no significant difference was found between the normal and varus groups for either medial or lateral plateau radii. the angle formed by the tibial pca and cca was not significantly different for varus and normal tibiae. the angles formed by the tta and the tibial pca were significantly larger (p < 0.0001) in varus tibiae, i.e., the tibial tubercle was rotated externally by 12 when compared to normal knees (fig. 4).fig. 4 box plot showing differences found between the two groups when the condylar centers axis and posterior condylar axis are measured against the tibial tubercle axis box plot showing differences found between the two groups when the condylar centers axis and posterior condylar axis are measured against the tibial tubercle axis there was a small (2) but significant increase in medial extension facet angle for the varus group (p = 0.002, fig. the coronal slope was found to be significantly more (p = 0.001) in varus knees (3.5) when compared to normal knees (0) (fig. measuring the coronal slope of the tibia is often difficult due to the presence of osteophytes ; therefore, it was investigated whether the coronal slope could be measured using the most inferior points (troughs) in the medial and lateral plateaus as opposed to the peaks (fig. a strong correlation was found between the two methods of measuring the slope in the coronal plane (r = 0.778 ; p < 0.0001 ; n = 47, see fig. 6).fig. 5 a box plot showing differences between varus and normal tibiae for the extension facet angle and b the coronal slopefig. 6scatterplots showing the strong positive correlation between coronal slope measured using the superior and inferior points a box plot showing differences between varus and normal tibiae for the extension facet angle and b the coronal slope scatterplots showing the strong positive correlation between coronal slope measured using the superior and inferior points the major findings of this study were that, for varus knees, some reference axes and surface features are significantly different to normal knees. for the femur, the tubercle (and tibial tubercle axis) was externally rotated in varus knees and there was a medial tilt of the tibial plateau in the coronal plane. axes were also identified that were not significantly different in varus and normal knees. on the femur these were the anatomical transepicondylar axis, posterior condylar axis and whiteside s line and, on the tibia, the posterior condylar axis and condylar center axis. the presence of less femoral anteversion in varus knees when compared to normal knees is not surprising. normal femoral version has been reported to be varied between 10 and 20 with the clear evidence of increased anteversion causing internal rotation of the knee, which is closely associated with increasing valgus deformity of the knee. similarly, retroversion causes external rotation of the knee, is associated with varus deformity and has been shown to be closely related to the development of oa in adults. the varus knee group in the study all presented with oa of the medial side, and this has also been shown to be related to external rotation of the knee.. showed that the tibiofemoral joint center of force moves medially with external femoral malrotation, and this has been further confirmed by finite element studies by papaioannou. who showed increased compressive forces in the medial compartment of the knee joint with decreasing anteversion. thus, a statement on the predisposition of femurs with less femoral version angles and varus alignment leading to subsequent medial oa of the knee can be made. continuing with the femur, the study found the axes commonly used for femoral alignment did not differ between normal and varus knees. for both groups, the pca was internally rotated by 7 with respect to the anatomical tea, and whiteside s line had large standard deviations in its measurement which agrees with prior work [23, 26, 28 ]. for the tibia, the main finding was that the tibial tubercle, and consequently the tibial tubercle axis, was externally rotated in varus knees compared with normal knees. this is a common reference axis for axial alignment of the tibial tray in tkr, but it has been reported to be highly variable in different patients [29, 30 ], and, for this reason, concerns have been raised regarding its use for this purpose. for the tibia, a small increase in extension facet angle, which engages the femur during extension (from 0 to 30), was found. an increase in the extension facet angle has been attributed to the development of antero - medial oa of the knee [3, 21 ] which may be a causative factor in the increased risk of oa observed in varus knees in longitudinal studies [5, 33 ]. the coronal slope measured in varus knees demonstrated a slope toward the medial edge of the knee that may be a natural consequence of the varus deformity and excessive medial loading and erosion, which could be addressed by tibial osteotomy. it is well known that the posterior tibial slope plays an important role in the kinematics of the natural and implanted knee and also influences joint laxity and ligament function [15, 17 ], and the results of the study were in agreement with previous work. there was no significant difference found in the posterior tibial (ap) slope between normal and varus knees, but a relationship between decreasing medial tibial slopes for increasing varus angle was noted, which may be consequence of the larger loads that pass through the medial condyle in more varus knees. the high medial loads and the larger extension facet in the medial condyle articulating against the medial tibial plateau could result in a flattening of the surface, thus reducing the slope. in addition, in implanted knees, computational studies have also shown contact stresses concentrated in smaller regions along with an increase in ligament stresses with flatter slopes. this would imply that in severely varus knees, flatter slopes may lead to higher and more localized stresses. for varus tibiae, the posterior slope needs to be resolved carefully, as there is evidence in the literature of further varus alignment if the posterior slope is increased and is externally rotated. a limitation of the study is that the varus group had oa and the normal group was asymptomatic. however, the oa in the varus group was confined to the anterior of the medial tibio - femoral articulation only, and none of the patients were candidates for tkr. previous work comparing varus knees to normal has had the same limitation [8, 10, 24, 27, 30 ], but even asymptomatic varus patients might have cartilage wear in the anterior of the medial tibio - femoral articulation that could influence measurement of axes. another drawback is that the relative positioning of femoral and tibial axes could not be measured due to lack of information on the supine alignment (flexion angle) during the ct scanning of the patients. if included, the relative movement of the femur on the tibia could have also been studied and kinematic differences between the two groups investigated. complete patient demographics, bmi, height and age were also not available, and the results might not apply for ethnicity other than the caucasian population studied. the clinical implication of the study is related to implant alignment and the design of patient - specific instrumentation and implants in knee arthroplasty. reference axes were identified (based on the femoral neck and tibial tubercle) that are significantly different between normal and varus knees. caution should therefore be exercised using these axes for implant alignment in varus knees, whether manually performed during surgery or by preoperative planning for patient - specific guides. however, specific axes were also identified that are not different in normal and varus knees. in the design of patient - specific knee replacement, or even varus specific knee replacement, the data from the study can also help inform implant design by quantifying the larger medial extension facet and the anterior translation of a sphere used to characterize this surface from its posterior to anterior boundary. another, secondary, clinical implication of the study was that the coronal tibial slope could be measured using the deepest points of the troughs of the tibial plateaus which may be useful when osteophytes make the traditional method of measuring the slope difficult. the study found that a varus knee is significantly different to a normal knee in terms of femoral neck version, position of the tibial tubercle and morphology of the medial femoral and tibial condyle. these findings should be considered when selecting alignment axes, or designing implants or instrumentation for knees with a varus deformity. | purposethe aim of the study was to investigate varus and normal knee morphologies to identify differences that may affect knee replacement alignment or design for varus knees. methodscomputed tomography scans of varus and normal knees were analyzed, and geometric shapes, points and axes were fit to the femur and tibia independently. these points were then projected in the three anatomical planes to measure the variations between the two groups.resultsin the femur, varus knees had less femoral anteversion (p < 0.0001) and a larger medial extension facet (p < 0.05) compared with normal knees. in the tibia, the tubercle was found to be externally rotated in varus knees (12), with a significant increase in the coronal slope (p = 0.001) and the extension facet angle (p = 0.002).conclusionsthe study highlighted the differences and similarities found between the two groups, which raises awareness on changes required during surgical intervention and component placement or design for a varus knee. this is particularly relevant for the design of patient - specific instrumentation and implants.levels of evidencediagnostic study, level iii. |
standard techniques were used for the preparation of frozen sections ; hematoxylin and eosin (h&e), gomori trichrome, nadh - tetrazolium reductase (tr), and atpase staining ; and immunofluorescent and electron microscopic analysis. mouse monoclonal antibody against stim1 and rabbit polyclonal antibody against orai were obtained from bd biosciences (franklin lakes, nj) and merck (darmstadt, germany), respectively. exonic sequences were enriched using a sureselect v5+utrs kit (agilent, santa clara, ca) and subjected to nucleotide sequence analysis using a hiseq2500 platform (illumina, san diego, ca). burrows - wheeler aligner and samtools were used with default settings for the alignment of raw reads and variant detection. the protein - altering variants in stim1 and orai1 were filtered by excluding those present in 600 healthy japanese controls. direct nucleotide sequence analysis was performed using an abi 3100 genetic analyzer (thermo fisher scientific, waltham, ma). messenger rna (mrna) was extracted from muscle biopsy specimen using rneasy fibrous tissue mini kit (qiagen, hilden, germany) and amplified by reverse transcriptase (rt)-pcr with superscript (thermo fisher scientific). expression plasmid encoding human stim1 complementary dna was purchased from origene and the mutation c.1450_1451insga was introduced with a kod - plus mutagenesis kit (toyobo, osaka, japan). two days after transfection using effectene (qiagen), c2c12 myoblasts were labeled with anti - stim1, alexa fluor 594conjugated phalloidin (thermo fisher scientific) and 4,6-diamidino-2-phenylindole (dapi). the images were obtained using an fsx100 fluorescence microscope (olympus, tokyo, japan). transfection was carried out using x - tremegene hp transfection reagent (roche, basel, switzerland). transfected hek293 cells were trypsinized and seeded onto poly - l - lysine coated glass coverslips the next day. cells on coverslips were loaded with fura-2 by incubation in dulbecco 's modified eagle medium containing 5 m fura-2/am (dojindo, kumamoto, japan) at 37c for 40 minutes. the coverslips were then placed in a perfusion chamber mounted on the stage of a microscope (axio - observer z1 ; carl zeiss, oberkochen, germany). fura-2 fluorescence images recorded at 10-second intervals were analyzed using physiology software (carl zeiss). standard techniques were used for the preparation of frozen sections ; hematoxylin and eosin (h&e), gomori trichrome, nadh - tetrazolium reductase (tr), and atpase staining ; and immunofluorescent and electron microscopic analysis. mouse monoclonal antibody against stim1 and rabbit polyclonal antibody against orai were obtained from bd biosciences (franklin lakes, nj) and merck (darmstadt, germany), respectively. exonic sequences were enriched using a sureselect v5+utrs kit (agilent, santa clara, ca) and subjected to nucleotide sequence analysis using a hiseq2500 platform (illumina, san diego, ca). burrows - wheeler aligner and samtools were used with default settings for the alignment of raw reads and variant detection. the protein - altering variants in stim1 and orai1 were filtered by excluding those present in 600 healthy japanese controls. direct nucleotide sequence analysis was performed using an abi 3100 genetic analyzer (thermo fisher scientific, waltham, ma). messenger rna (mrna) was extracted from muscle biopsy specimen using rneasy fibrous tissue mini kit (qiagen, hilden, germany) and amplified by reverse transcriptase (rt)-pcr with superscript (thermo fisher scientific). expression plasmid encoding human stim1 complementary dna was purchased from origene and the mutation c.1450_1451insga was introduced with a kod - plus mutagenesis kit (toyobo, osaka, japan). two days after transfection using effectene (qiagen), c2c12 myoblasts were labeled with anti - stim1, alexa fluor 594conjugated phalloidin (thermo fisher scientific) and 4,6-diamidino-2-phenylindole (dapi). the images were obtained using an fsx100 fluorescence microscope (olympus, tokyo, japan). transfection was carried out using x - tremegene hp transfection reagent (roche, basel, switzerland). transfected hek293 cells were trypsinized and seeded onto poly - l - lysine coated glass coverslips the next day. cells on coverslips were loaded with fura-2 by incubation in dulbecco 's modified eagle medium containing 5 m fura-2/am (dojindo, kumamoto, japan) at 37c for 40 minutes. the coverslips were then placed in a perfusion chamber mounted on the stage of a microscope (axio - observer z1 ; carl zeiss, oberkochen, germany). fura-2 fluorescence images recorded at 10-second intervals were analyzed using physiology software (carl zeiss). he first noticed slight difficulty walking when he was 37 years old. at the age of 40, running and climbing stairs became difficult. his mother also had difficulty walking and was in a wheelchair when she was 40 years old. his parents were not consanguineous. on neurologic examination, pupils and ocular movement were normal. muscle atrophy and weakness was evident in all 4 limbs, and the bilateral triceps surae muscles were most prominently affected (figure 1a). the paraspinal muscles were also atrophic and he had winged scapulae (figure 1b). he did not exhibit myalgia, cramps, scoliosis, rigid spine, or symptoms suggesting stormorken syndrome, including miosis, thrombocytopenia, asplenia, or ichthyosis. blood cell counts and routine blood biochemistry were normal, except serum creatine kinase was elevated to 798 iu / l (normal range < 150). muscle mri revealed disseminated high - intensity areas on t1-weighted images in the quadriceps femoris, triceps surae, and paraspinal muscles, indicating fatty replacement in these muscles (figure 1c). (a) muscle atrophy is evident in all 4 limbs. among them, the triceps surae muscle (white arrowhead) is most prominently affected. (b) the patient exhibits winged scapulae due to atrophy of the paraspinal muscles. (c) muscle mri shows high - intensity areas on t1-weighted images in the quadriceps femoris, triceps surae, and paraspinal muscles, indicating fatty replacement in these muscles. (d) hematoxylin and eosin (h&e) staining reveals the increased variability of muscle fiber diameter and occasional centrally nucleated fibers. many fibers show tubular aggregates that are stained dark red by h&e (d), intense blue by nadh - tetrazolium reductase (e), and bright purple with gomori trichrome staining (f). (g) a serial section stained with atpase (ph 4.6) demonstrates that tubular aggregates are in type 2 fibers. (h) electron microscopy shows that some areas in the myofiber are replaced by numerous tubular structures. at higher magnification, each tubule is arranged in a honeycomb - like structure showing double - walled membranes (inset). bar = 1 m. ps = paraspinal muscles ; qf = quadriceps femoris ; ts = triceps surae. in addition, many fibers showed irregularly shaped dark red staining (figure 1d). these dark red accumulations were stained intense blue by nadh - tr (figure 1e) and bright purple with gomori trichrome staining (figure 1f), indicating that these are tubular aggregates. a serial section stained with atpase (ph 4.6) further demonstrated that the tubular aggregates were in type 2 fibers (figure 1 g). electron microscopic analysis revealed that some areas in the myofiber were replaced by numerous tubular structures (figure 1h) and that each tubule was arranged in a honeycomb - like structure that showed double - walled membranes at higher magnification (figure 1h, inset). exome sequence analysis and subsequent sanger sequencing of the proband revealed a novel heterozygous insertion mutation, c.1450_1451insga (p.ile484argfsx21), in exon 7 of stim1 (figure 2a). the same mutation was identified in his mother but not in healthy family members (figure 2b). the amino acid 484 resides in the ctid located in the cytoplasmic region of stim1 (figure 2c). to assess the localization of stim1 in the skeletal muscle of the patient the immunolabeling of stim1 and orai1, a calcium channel in plasma membrane, colocalized to the tubular aggregates visualized by gomori trichrome staining (figure 2d), which is consistent with previous reports. because premature termination codons often result in nonsense - mediated decay of mrna, we analyzed mrna transcript in the muscle biopsy specimen. sequencing of the rt - pcr product demonstrated that both wild - type and the c.1450_1451insga mutant transcripts are present (figure 2e). (a) sanger sequencing reveals a heterozygous insertion mutation, c.1450_1451insga, in stim1. (b) pedigree of the family indicates dominant inheritance and sequence analysis demonstrates the segregation of the heterozygous mutations with the disease. the mutation p.ile484argfsx21 resides in the c - terminal inhibitory domain (ctid), which is located in the cytoplasmic region of stim1 (red type). all missense mutations reported so far reside in the ef hand in the luminal region (blue type). (d) serial sections of gomori trichrome staining and immunofluorescent images indicate that both stim1 and orai1 colocalize to the tubular aggregates. (e) sanger sequencing of reverse transcriptase - pcr product amplified from muscle biopsy specimen demonstrates that both wild - type and mutant transcripts are present. cc1 = coiled - coil region 1 ; k = polylysine ; s = signal peptide ; sam = sterile motif ; sore = stim1 orai activating region ; sp = serine- and proline - rich domain ; tm = transmembrane domain. to investigate the functional significance of the c.1450_1451insga mutation typically, wild - type stim1 displayed diffuse distribution in c2c12 cells (figure 3a). in sharp contrast, mutant stim1 concentrated intensely around nuclei and exhibited an aggregation - like appearance in shrunk cytoplasm (figure 3a). counting cells with the diffuse vs aggregation - like localization of stim1 confirmed that the majority of cells expressing wild - type stim1 showed diffuse localization whereas most cells expressing mutant stim1 exhibited an aggregation - like pattern (figure 3b). (a) c2c12 myoblasts were transfected with wild - type (wt) and the c - terminal inhibitory domain mutant stim1 and labeled with anti - stim1 antibody, phalloidin, and 4',6-diamidino-2-phenylindole (dapi). wt stim1 displays diffuse distribution in c2c12 cells, whereas the signal of the mutant stim1 concentrates intensely around nuclei and exhibits an aggregation - like appearance in the shrunk cytoplasm. (b) seven stitching images (5 5) of the c2c12 myoblasts were captured using a fluorescence microscope, and the number of cells with diffuse vs aggregation - like localization of stim1 was counted. the majority of cells expressing wt stim1 show diffuse localization, whereas most cells expressing the mutant stim1 exhibit the aggregation - like pattern. (c) intracellular ca concentration was measured in hek293 cells expressing wt stim1 (gray square ; n = 40 cells), the mutant stim1 (black triangle ; n = 42 cells), or control (open circle ; n = 47 cells). the perfusion solution was changed from hepes - buffered saline (hbs) containing 2 mm ca to ca - free solution containing 0.5 mm ethylene glycol tetraacetic acid (egta). to evaluate ca influx across the plasma membrane, the duration of exposure to ca - containing hbs and ca - free hbs is indicated above the graph. (d) maximal intracellular ca rises after readdition of 2 mm ca to the cells. p = 0.0028, 0.0104, and 0.5299 for wt vs mutant, control vs wt, and control vs mutant, respectively. finally, we performed ca measurements to examine whether the stim1 mutation affects store - operated ca entry (soce). the wild - type or the mutant stim1 was expressed in hek293 cells, and changes in the intracellular ca concentration ([ca]i) were evaluated. as shown in figure 3c, overexpression of wild - type stim1 caused an increased [ca]i in the perfusion solution containing 2 mm ca, suggesting that wild - type stim1 enhanced ca influx through orai1 endogenously expressed in hek293 cells. this notion was further confirmed by the fact that removal of the external ca by ethylene glycol tetraacetic acid led to decreased [ca]i and that readdition of ca to the perfusion solution resumed the ca response. however, the mutant stim1-expressed cells did not show significant ca responses by the changes in the external ca concentration (figure 3, c and d). these results collectively suggest that the stim1 mutation we found in this study causes dysregulated ca homeostasis. he first noticed slight difficulty walking when he was 37 years old. at the age of 40, running and climbing stairs became difficult. his mother also had difficulty walking and was in a wheelchair when she was 40 years old. his parents were not consanguineous. on neurologic examination, pupils and ocular movement were normal. muscle atrophy and weakness was evident in all 4 limbs, and the bilateral triceps surae muscles were most prominently affected (figure 1a). the paraspinal muscles were also atrophic and he had winged scapulae (figure 1b). he did not exhibit myalgia, cramps, scoliosis, rigid spine, or symptoms suggesting stormorken syndrome, including miosis, thrombocytopenia, asplenia, or ichthyosis. blood cell counts and routine blood biochemistry were normal, except serum creatine kinase was elevated to 798 iu / l (normal range < 150). muscle mri revealed disseminated high - intensity areas on t1-weighted images in the quadriceps femoris, triceps surae, and paraspinal muscles, indicating fatty replacement in these muscles (figure 1c). (a) muscle atrophy is evident in all 4 limbs. among them, the triceps surae muscle (white arrowhead) is most prominently affected. (b) the patient exhibits winged scapulae due to atrophy of the paraspinal muscles. (c) muscle mri shows high - intensity areas on t1-weighted images in the quadriceps femoris, triceps surae, and paraspinal muscles, indicating fatty replacement in these muscles. (d) hematoxylin and eosin (h&e) staining reveals the increased variability of muscle fiber diameter and occasional centrally nucleated fibers. many fibers show tubular aggregates that are stained dark red by h&e (d), intense blue by nadh - tetrazolium reductase (e), and bright purple with gomori trichrome staining (f). (g) a serial section stained with atpase (ph 4.6) demonstrates that tubular aggregates are in type 2 fibers. (h) electron microscopy shows that some areas in the myofiber are replaced by numerous tubular structures. at higher magnification, each tubule is arranged in a honeycomb - like structure showing double - walled membranes (inset). bar = 1 m. ps = paraspinal muscles ; qf = quadriceps femoris ; ts = triceps surae. in addition, many fibers showed irregularly shaped dark red staining (figure 1d). these dark red accumulations were stained intense blue by nadh - tr (figure 1e) and bright purple with gomori trichrome staining (figure 1f), indicating that these are tubular aggregates. a serial section stained with atpase (ph 4.6) further demonstrated that the tubular aggregates were in type 2 fibers (figure 1 g). electron microscopic analysis revealed that some areas in the myofiber were replaced by numerous tubular structures (figure 1h) and that each tubule was arranged in a honeycomb - like structure that showed double - walled membranes at higher magnification (figure 1h, inset). exome sequence analysis and subsequent sanger sequencing of the proband revealed a novel heterozygous insertion mutation, c.1450_1451insga (p.ile484argfsx21), in exon 7 of stim1 (figure 2a). the same mutation was identified in his mother but not in healthy family members (figure 2b). the amino acid 484 resides in the ctid located in the cytoplasmic region of stim1 (figure 2c). to assess the localization of stim1 in the skeletal muscle of the patient the immunolabeling of stim1 and orai1, a calcium channel in plasma membrane, colocalized to the tubular aggregates visualized by gomori trichrome staining (figure 2d), which is consistent with previous reports. because premature termination codons often result in nonsense - mediated decay of mrna, we analyzed mrna transcript in the muscle biopsy specimen. sequencing of the rt - pcr product demonstrated that both wild - type and the c.1450_1451insga mutant transcripts are present (figure 2e). (a) sanger sequencing reveals a heterozygous insertion mutation, c.1450_1451insga, in stim1. (b) pedigree of the family indicates dominant inheritance and sequence analysis demonstrates the segregation of the heterozygous mutations with the disease. the mutation p.ile484argfsx21 resides in the c - terminal inhibitory domain (ctid), which is located in the cytoplasmic region of stim1 (red type). all missense mutations reported so far reside in the ef hand in the luminal region (blue type). (d) serial sections of gomori trichrome staining and immunofluorescent images indicate that both stim1 and orai1 colocalize to the tubular aggregates. (e) sanger sequencing of reverse transcriptase - pcr product amplified from muscle biopsy specimen demonstrates that both wild - type and mutant transcripts are present. cc1 = coiled - coil region 1 ; k = polylysine ; s = signal peptide ; sam = sterile motif ; sore = stim1 orai activating region ; sp = serine- and proline - rich domain ; tm = transmembrane domain. to investigate the functional significance of the c.1450_1451insga mutation, we transfected c2c12 myoblasts with wild - type and mutant stim1. typically, wild - type stim1 displayed diffuse distribution in c2c12 cells (figure 3a). in sharp contrast, mutant stim1 concentrated intensely around nuclei and exhibited an aggregation - like appearance in shrunk cytoplasm (figure 3a). counting cells with the diffuse vs aggregation - like localization of stim1 confirmed that the majority of cells expressing wild - type stim1 showed diffuse localization whereas most cells expressing mutant stim1 exhibited an aggregation - like pattern (figure 3b). (a) c2c12 myoblasts were transfected with wild - type (wt) and the c - terminal inhibitory domain mutant stim1 and labeled with anti - stim1 antibody, phalloidin, and 4',6-diamidino-2-phenylindole (dapi). wt stim1 displays diffuse distribution in c2c12 cells, whereas the signal of the mutant stim1 concentrates intensely around nuclei and exhibits an aggregation - like appearance in the shrunk cytoplasm. (b) seven stitching images (5 5) of the c2c12 myoblasts were captured using a fluorescence microscope, and the number of cells with diffuse vs aggregation - like localization of stim1 was counted. the majority of cells expressing wt stim1 show diffuse localization, whereas most cells expressing the mutant stim1 exhibit the aggregation - like pattern. (c) intracellular ca concentration was measured in hek293 cells expressing wt stim1 (gray square ; n = 40 cells), the mutant stim1 (black triangle ; n = 42 cells), or control (open circle ; n = 47 cells). the perfusion solution was changed from hepes - buffered saline (hbs) containing 2 mm ca to ca - free solution containing 0.5 mm ethylene glycol tetraacetic acid (egta). to evaluate ca influx across the plasma membrane, 2 mm ca was applied to the cells. the duration of exposure to ca - containing hbs and ca - free hbs is indicated above the graph. (d) maximal intracellular ca rises after readdition of 2 mm ca to the cells. p = 0.0028, 0.0104, and 0.5299 for wt vs mutant, control vs wt, and control vs mutant, respectively. finally, we performed ca measurements to examine whether the stim1 mutation affects store - operated ca entry (soce). the wild - type or the mutant stim1 was expressed in hek293 cells, and changes in the intracellular ca concentration ([ca]i) were evaluated. as shown in figure 3c, overexpression of wild - type stim1 caused an increased [ca]i in the perfusion solution containing 2 mm ca, suggesting that wild - type stim1 enhanced ca influx through orai1 endogenously expressed in hek293 cells. this notion was further confirmed by the fact that removal of the external ca by ethylene glycol tetraacetic acid led to decreased [ca]i and that readdition of ca to the perfusion solution resumed the ca response. however, the mutant stim1-expressed cells did not show significant ca responses by the changes in the external ca concentration (figure 3, c and d). these results collectively suggest that the stim1 mutation we found in this study causes dysregulated ca homeostasis. in the present study, we described a family with dominant tam with a novel frameshift mutation in the ctid of stim1. of note, this is in contrast to the previous reports of tam, in which the proximal muscles were predominantly affected. in skeletal muscle, ca homeostasis is regulated by soce. in soce, stim1 forms an oligomer upon the depletion of ca in sr and activates orai1 channels at sarcolemma, triggering extracellular ca entry. all stim1 mutations in tam reported so far are missense mutations residing in the ef hand (ef1 and ef2 in figure 2b), and this region is considered a hotspot. these mutations are presumed to induce the constitutive activation of orai1 and cause excessive ca influx into muscle cells. in contrast, a frameshift mutation, which creates a premature stop codon in the ctid located in the c - terminal cytoplasmic region of stim1, was identified in our family (figure 2b). the ctid is known to interact with soce - associated regulatory factor (saraf), a regulator of slow ca - dependent inactivation of orai1. following the transfection of c2c12 myoblasts with the ctid mutant stim1, aggregation - like signals of stim1 the aggregation - like appearance is distinct from that in c2c12 myoblasts transfected with stim1 harboring ef hand mutations, which exhibit numerous puncta - like small clusters in cytoplasm. furthermore, intracellular ca measurements revealed that the ca influx is significantly decreased in the cells transfected with the ctid mutant compared to the wild - type stim1-transfected cells. this result is in marked contrast to the previous reports, in which increased ca influx caused by constitutive activation of soce was observed. the transcript of ctid mutant was present in the affected skeletal muscle of our patient, suggesting that nonsense - mediated mrna decay is not induced. we speculate that the ctid mutant may inhibit the oligomer formation of stim1 necessary to activate the orai1 channels, leading to the decreased intracellular ca influx. alternatively, the stim1 oligomer including the ctid mutant may not translocate properly to the subsarcolemma where the oligomer interacts with orai1, because the ctid mutant lacks the polybasic motif (k in figure 2c) necessary for the stim1 targeting to plasma membrane. it is of particular interest to note that stim2, an alternatively spliced form of stim2, converts stim isoforms from an activator to an inhibitor of orai1. our findings provide further evidence that the dysregulation of ca homeostasis underlies the pathomechanism of tam. dr. okuma contributed to the evaluation of patients, data acquisition interpretation and analysis, and manuscript preparation. saito contributed to the study concept and design, data acquisition, interpretation and analysis, and manuscript preparation. sonoo contributed to the study concept and design, data acquisition, interpretation, and analysis. takeda pharmaceutical co. ltd., and daiichi sankyo co. ltd. ; and was supported by an intramural research grant (26 - 8) for neurological and psychiatric disorders of ncnp from the ministry of health, labour and welfare of japan and a grant - in - aid for scientific research c (26461281) from the ministry of education, culture, sports, science and technology of japan. mitsui has received research support from the ministry of education, culture, sports, science and technology of japan (grant - in - aid for scientific research (c) 15k09334). hara was supported by an intramural research grant (26 - 8) for neurological and psychiatric disorders of ncnp from the ministry of health, labour and welfare of japan, jsps kakenhi grant number 15h04846, and a grant - in - aid for challenging exploratory research (25670149, 15k13741) from the ministry of education, culture, sports, science and technology, japan ; and has received research support from the takeda science foundation, the life science foundation of japan, the kowa life science foundation, and the salt science research foundation. t. shimizu was supported by a grant - in - aid for scientific research c (15k09328) from the ministry of education, culture, sports, science and technology of japan. matsumura was supported by a grant - in - aid for scientific research c (25430075) from the ministry of education, culture, sports, science and technology of japan. j. shimizu was supported by a health and labour sciences research grant on intractable diseases (evidence - based early diagnosis and treatment strategies for neuroimmunological diseases) from the ministry of health, labour and welfare of japan, a grant - in - aid for scientific research c (24591289) from the ministry of education, culture, sports, science and technology of japan, and an intramural research grant (26 - 8) for neurological and psychiatric disorders of ncnp from the ministry of health, labour and welfare of japan. japan blood products organizations, mitsubishi tanabe pharma co., bayer japan, janssen pharmaceutical, genzyme japan, eisai co. ltd., fp - pharmaceutical co., dainippon sumitomo pharma co. ltd., otsuka pharmaceutical co. ltd., sony corporation, nikkei business publications inc., and leave a nest co. ltd. ; has served on the editorial board of neurology and clinical neuroscience ; has received research support from sanofi, japan blood products organization, mitsubishi tanabe pharma co., pfizer japan inc., ono pharmaceutical co. ltd., daiichi sankyo co. ltd., eisai co. ltd., kowa pharmaceutical co. ltd., and glaxosmithkline ; and was supported by kakenhi (grant - in - aid for scientific research on innovative areas [22129001 and 22129002 ]), the japan agency for medical research and development (grant - in - aid [h26-nanchiseishikkan jitsuyoka - ippan-080, 26310101, and ninchisho kenkyu 26340101 ]), and a grant - in - aid (h23-jitsuyoka [nanbyo]-ippan-004) of the research on measures for intractable diseases from the ministry of health, welfare and labour, japan. sonoo has served on the editorial boards of muscle and nerve, clinical neurology, and the japanese journal of clinical neurophysiology ; and was supported by grants - in - aid for scientific research from the ministry of education, science, sports and culture of japan (23591285), and a health and labour sciences research grant on rare and intractable diseases (evidence - based early diagnosis and treatment strategies for neuroimmunological diseases) from the ministry of health, labour and welfare of japan. | objective : to identify the gene mutation of tubular aggregate myopathy (tam) and gain mechanistic insight into the pathogenesis of the disorder.methods:we described a family affected by autosomal dominant tam and performed exome and sanger sequencing to identify mutations. we further analyzed the functional significance of the identified mutation by expression studies and intracellular ca2 + measurements.results:a 42-year - old man presented with slowly progressive muscle weakness and atrophy in all 4 limbs and the trunk. muscle biopsy and microscopic examination revealed tubular aggregates in his skeletal muscle. genetic analysis of this family identified a novel heterozygous mutation, c.1450_1451insga (p.ile484argfsx21), in stromal interaction molecule 1 (stim1), a ca2 + sensor in sarcoplasmic reticulum. we transfected cultured cells with stim1 and demonstrated that the mutant stim1 exhibited aggregation - like appearance in shrunk cytoplasm. furthermore, we revealed that the intracellular ca2 + influx is decreased by the mutant stim1.conclusions:the novel mutation p.ile484argfsx21 is located in the cytoplasmic c - terminal inhibitory domain (ctid) of stim1. however, all mutations reported so far in tam reside in the luminal n - terminal ef hand region. the aggregation - like appearance of stim1 and the decreased intracellular ca2 + influx in cells transfected with ctid mutant are in sharp contrast to these previous reports. taken together, these findings indicate that mutations of stim1 cause tam through the dysregulation of ca2 + homeostasis. |
the grass family poaceae is comprised of nearly 10,000 species, including annual species cultivated as major grain crops and perennial species cultivated as forage for livestock or turf grasses on home lawns, commercial landscapes, roadsides, parks, athletic fields, and golf courses. based on the ranges of temperature and precipitation that grasses adapt to cool - season and warm - season grasses have distinctive photosynthetic pathways, referred as c3 and c4 pathways, respectively. c3 or cool - season grass species grow most actively at temperatures ranging from 18c24c while c4 or warm - season grass species have an optimum growth temperature between 30c 35c. temperature rises beyond a threshold (5c 10c above ambient) may cause irreversible damages to plant function and development or alteration of metabolism, resulting in reduction in growth and yield production. it depends on the intensity, duration and rate of increase in temperature, as well as other environmental conditions, such as when the high temperature occurs (during the day or the night) and where it occurs (in the air or the soil) [3, 4 ]. since predicted global warming has become a serious threat for sustainable agriculture worldwide, an increasing challenge has been imposed to improve grass tolerance to high temperature. heat avoidance is the ability of plants to maintain internal temperatures below lethal stress levels, including transpirational cooling, changes in leaf orientation, reflection of solar radiation, leaf shading of tissues that are sensitive to sunburn, and extensive rooting [6, 7 ]. however, heat - avoiding cultivars thriving in the low humidity may lack heat resistance in humid areas due to reduced cooling effects of transpiration. plant tolerance to high temperature may be achieved through various mechanisms, including changes at the molecular, cellular, biochemical, physiological, and whole - plant levels [3, 9 ]. typically, heat - tolerant grass species and cultivars exhibit higher activity in the photosynthetic apparatus [1013 ] and higher carbon allocation and nitrogen uptake rates [14, 15 ] when exposed to supraoptimal temperature. heat stress was found to induce oxidative stress in grasses so that species and cultivars variations in the activities of antioxidant enzymes were associated with differences in heat tolerance [1619 ]. major hormones such as cytokinins and ethylene are also found to play regulatory roles in heat tolerance of grasses [2023 ]. heat stress has significant effects on protein metabolism, including degradation of proteins, inhibition of protein accumulation, and induction of certain protein synthesis, depending on the level and duration of heat stress [24, 25 ]. moderate heat response involves downregulation of proteins functioning in lipid biogenesis, cytoskeleton structure, sulfate assimilation, amino acid biosynthesis, nuclear transport and antioxidant response [26, 27 ]. while synthesis of most normal proteins and mrnas is inhibited in heat stress conditions, the transcription and translation of a small set of proteins, called heat shock proteins (hsps), may be induced or enhanced when plants are exposed to elevated temperatures [2830 ]. this paper summarizes the structure and function of major hsps, recent research progress on the association of hsps with heat tolerance in grasses, and how knowledge of hsps may facilitate heat - tolerant grass breeding. hsps are generally classified into five evolutionarily conserved groups : hsp100, hsp90, hsp70, hsp60, and small hsps (shsps). most, but not all, heat shock proteins are molecular chaperones, which bind and stabilize proteins at intermediate stages of folding, assembly, degradation, and translocation across membranes. the following paragraphs provide more details on the structure and function of each hsp group. hsp70 proteins compose a large family of highly conserved molecular chaperones widely found in almost all organisms. the sequence identity between bacterial and eukaryotic hsp70s is about 50%, suggesting its critical functions in various life forms [32, 33 ]. most eukaryotic organisms have multiple hsp70 homologs, located in diverse cell compartments including cytosol, mitochondrion, chloroplast and endoplasmic reticulum. in addition to their known function in preventing protein aggregation and assisting refolding of nonnative proteins in unfavorable environments, many hsp70 proteins also play essential roles in housekeeping activities under normal conditions. as a good example, in addition to the stress - inducible hsp70s, some hsp70 homologs, which are so called heat shock cognate 70 (hsc70), are constitutively expressed in the eukaryotic cytosol. hsc70 stabilizes nascent proteins being released from ribosomes, preventing possible misfolding and aggregation of partially synthesized polypeptide chains before the end of protein expression [3335 ]. a comprehensive expression profile analysis of the arabidopsis (arabidopsis thaliana) hsp70 gene family detected 2 - 20-fold induction of eleven hsp70 genes while the expression of another two hsp70 genes was not enhanced by heat shock treatment. despite the versatile functions, all hsp70 proteins in higher eukaryotes including plants share similar structures. as represented by a bovine hsc70, the typical structure of hsp70 homolog proteins is composed of an n - terminal atpase domain about 45 kda (blue, figure 1) and a c - terminal substrate - binding domain about 25 kda (green, figure 1), which are joined by an interdomain linker (magenta, figure 1). the atpase domain resembles the structure of actin and shares about 64% sequence identity among all eukaryotic hsp70s. the substrate - binding domain has relatively low - sequence conservation (~43% identity) but generally binds short stretches of hydrophobic peptides, which are normally buried inside the folded proteins. the affinity for substrate peptide binding is mediated by different nucleotide - binding states of the atpase domain. as the atp is hydrolyzed to adp, an allosteric conformational change occurs between the two domains of hsp70, resulting in a higher substrate binding affinity [37, 39, 40 ]. the switch of hsp70 nucleotide states is facilitated by j - domain cochaperones (hsp40). this process enables hsp70 to go through cycles of substrate binding and releasing in an atp - dependent manner, which stabilizes the exposed hydrophobic segments of nonnative proteins, prevents aggregation, and assists the correct folding [34, 41 ]. hsp60, known as chaperonin 60 (cpn60), is one of the first molecular chaperones identified. although the two hsp families share partially overlapping functions, their structures and mechanisms are distinct. groel - like hsp60 homologs have been found in mitochondrion and chloroplast of plant cells but not in cytosol. under heat - shock conditions, expression of mitochondrion hsp60 is induced and protects preexisting proteins in the organelle from denaturation or inactivation, whereas expression of chloroplast hsp60 (chhsp60) is constitutively produced with only modest increase. due to the high sequence similarity between plant hsp60 and groel, the structure of groel reported by xu. groel forms a huge homo - oligomer that is composed of two stacked rings, with each ring containing 7 monomers. each groel monomer is about 58 kda and can be divided into three separate domains : a nucleotide - binding equatorial domain (red in figure 2(a)), a flexible apical domain (blue in figure 2(a)), and a hinge - like intermediate domain (green in figure 2(a)). the unique structure of groel - like hsp60 homo - oligomeric complex creates a hydrophobic cavity about 50 in the center of each stacked ring (figure 2(b)), allowing the accommodation of unfolded polypeptides with size ranging from 10 to 60 kda [34, 49 ]. following the entry of substrates (nonnative proteins), groel binds atp and associates with a 10 kda cochaperone and groes (chaperonin 10) (orange in figure 2(a)). groes forms a heptametric ring and interacts with the apical domain of groel, acting like a dome - shaped lid that closes the central cavity in the chaperonin. the groel / groes association traps nonnative proteins in an enclosed hydrophobic environment that is amenable to proper folding. subsequently, the hydrolysis of atp leads to groel conformational change and dissociation of groes. this results in the release of encapsulated substrates and initiates the next cycle of substrate binding and folding. a primary mechanistic distinction between hsp60 and hsp70 is that hsp60 is capable of binding an entire domain or complete protein, unlike hsp70 that recognizes only short peptide segments. rubisco large subunit binding protein as it plays an essential role in the folding and assembly of rubisco large subunits. despite the overall sequence and structural similarity (40%~50% sequence identity) to groel, chhsp60 is a hetero - olgiomeric protein complex consisting of and subunits. it has been found that functional rubisco protein can only be expressed in e. coli in the presence of groel / groes system. this suggests that chhsp60 probably facilitates rubisco folding in a similar manner as its probacterial homolog. in accordance to hsp70 and hsp60 families, however, hsp90 features unique substrate specificity. instead of binding a wide spectrum of unfolded proteins, hsp90 only interacts with relatively well - folded proteins involved in transcription regulation and signal transduction pathways [53, 54 ]. furthermore, the function of hsp90 requires the formation of large protein complexes involving multiple cochaperones, including hsp70 and hsp40, which indicates close cooperation between different molecule chaperone families. although structural information about plant hsp90 is sparse, high - sequence conservations of the protein family across the phylogeny suggests a similar functional mechanism. typically, a hsp90 protein is composed of an n - terminal atpase domain, a middle substrate - protein - binding domain, and a c - terminal dimerization domain. it is proposed that the atp binding and hydrolysis regulate different conformational states of hsp90, which make the dimeric molecule chaperone to bind and release substrate proteins like a molecule clamp (reviewed in pearl and prodromou). however, dissection of hsp90 function is still restricted by the limited understanding of full - length hsp90 structure and its interaction with cochaperones. the unique feature of hsp100 family is their capacity to solubilize aggregated proteins and involvement in protein degradations [33, 55 ]. the best - characterized hsp100 proteins are clpa from e. coli and hsp104 from s. cerevisiae. both clpa and hsp104 assemble as a hexameric ring with a narrow central pore [35, 56 ]. hsp100 plays an essential role in plant survival of severe heat stress, but it is absent in some other organisms (ex. drosophila and vertebrates) that rely on hsp70 and other hsps to prevent aggregation and accommodate refolding under severe heat stress. small heat shock proteins (shsps) are the most ubiquitous hsp subgroup with molecular weights ranging from 12 to 42 kda. sequence analysis of shsps shows that members of this protein family includes an evolutionarily divergent n - terminal part, followed by a conserved -crystallin domain and a short c - terminal tail (figure 3). single - celled organisms such as bacteria have only one or two shsp, whereas multicellular organisms have many shsp in the genome. particularly, ten separate families of shsps have been recognized to be conserved in both monocot and dicot plants, indicating the potential for diversity in shsp mechanisms [61, 62 ]. shsps encoded by four of these families localize to the cytoplasm, and those encoded by the other six families localize to cellular organelles including nucleus, chloroplasts, mitochondria, endoplasmic reticulum, and peroxisomes. the current model for shsp chaperone activity was defined based on studies of a cytosolic shsp family named as class i shsps (shsp - ci), which represent the most abundant shsp in plants. the model suggests that shsp assembles into a large homo - oligomer, which binds denatured proteins in an atp - independent manner, keeping them in a folding - competent state. then, it cooperates with atp - dependent molecular chaperones, such as hsp70 and hsp90, to refold those proteins. notably, shsp has a much larger binding stoichiometry than other molecular chaperones, which has led to the speculation that shsp functions as a reservoir to stabilize the flood of denatured proteins in response to stress [65, 66 ]. it has been proposed that heat - induced oligomer dissociation is a major mechanism by which plant shsps can expose normally inaccessible, hydrophobic client - binding surfaces. nevertheless, the details about the interactions between shsp and nonnative proteins and how these nonnative proteins are subsequently refolded are still lacking. this is partially due to limited knowledge on the molecular structure of shsps. among the few solved crystallographic structures of shsps is a wheat tahsp16.9-ci (whsp16.9, pdb i d : 1gme). the basic building block of whsp16.9 is a dimer, which further assembles as a 12-mer consisting of two trimers of dimers (figure 3). in solution, whsp16.9 can dissociate into smaller oligomeric states in a temperature dependent manner. on the basis of this observation, it is likely that heat - induced dissociation of shsp oligomers may expose the hydrophobic patches buried in the oligomeric interface, resulting in binding and stabilization of denatured proteins [43, 60 ]. the presence and role of hsps in heat tolerance has been examined in various annual grasses cultivated as cereal crops, most of which belong to the genera of rice (oryza sp.), wheat (triticum sp.), maize (zea sp.), sorghum (sorghum sp.), rye (secale sp.), barley (hordeum sp.), and oat (avena sp.). the involvement of hsps in thermal tolerance has been studied in only a few perennial species such as creeping bentgrass (agrostis stolonifera), fescues (festuca sp.), and orchard grass (dactylis glomerata). table 1 summarizes the hsps reported in the grass family and their tissue specificity, which may play a crucial role in defending each type of tissues against heat stress. how these hsps are regulated in the defensive and adaptive mechanisms of cereal crops and forage or turf grasses under high temperature are reviewed below. expression of hsps in cereal species was first revealed in some early works in 1980s. in a study examining hsp metabolism in seedlings of five cereal species (common, drurm wheat, barley, rye, and triticale) responding to heat shock at 40c, inductions of 13 hsps (14 - 15, 3569, 8399 kda) were detected. it was also reported that distinct levels of acquired thermal tolerance between wheat varieties were associated with significant quantitative differences in the synthesis of multiple hsps (16, 17, 22, 26, 33, and 42 kda). more thorough characterization of heat - responsive proteins including hsps benefits from successful application of proteomic - based techniques, particularly two - dimensional gel electrophoresis coupled with mass spectrometry. identified 18 hsps in a study investigating rice leaf proteome in response to heat stress, including seven hsp70s, three hsp100s, one hsp60, and seven newly induced or highly upregulated shsps. detected upregulation of five shsps in a study analyzing the effect of heat stress on hexaploid wheat grain proteome. using a novel hybrid mass spectrometer (an electrospray ionization - quadrupole linear ion trap (q - trap) combined with nano - hplc), sle. were able to distinguish six isoforms of a 16.9 kda shsp in a proteomic study of barley heat response. since each hsp family generally shares high - sequence similarity across diverse cereal species, the anti - hsp antibodies could exhibit relatively broad cross - species activities. purified and raised highly specific polyclonal antisera against two rice hsps (104 and 90 kda), both of which accumulate in response to heat stress. using these reagents, they detected heat - induced accumulation of the immunological homologues of both hsps in seedlings of wheat, sorghum, and maize in western blotting experiments. first detected hsps (97, 83, 70, 40, 25, and 18 kda) in heat - tolerant and nontolerant variants of creeping bentgrass, a major cool - season turf species. they also found the heat - tolerant variants synthesized two to three additional shsp (25 kda). zhang. cloned four classes of hsps (hsp100, hsp90, hsp70, and shsps) that are differentially expressed under heat stress between the two genotypes of fescues, which are widely used as both forage and turf grasses. characterized an endoplasmic reticulum - resident hsp90 gene from orchard grass, whose expression increased during heat stress. this protein functions as a molecular chaperone by preventing thermal aggregation of malate dehydrogenase and citrate synthase. the following section will summarize some of our most recent research on hsp identification in association with heat tolerance in cool - season perennial grass species. heat acclimation has been found to induce hsps in various plant species. in a study examining the effects of heat acclimation (gradual temperature increase) and sudden heat stress (direct temperature increase) on protein synthesis and degradation in a heat - sensitive creeping bentgrass cultivar, it was found that both heat treatments led to the accumulation of several hsps (23, 36, and 66 kda) ; in addition, heat acclimation induced a few extra cytoplasmic hsps (57 and 54 kda), which were not present in the unacclimated plants under heat stress. these results suggest that upregulation of hsps, primarily shsp, hsp60 or hsp70 based on their molecular weights, is a typical response of perennial grasses to heat stress. especially, due to the fact that heat acclimation improved heat tolerance of the plants as manifested by lower electrolyte leakage in the leaves of heat - acclimated plants, induction of the two hsp60 proteins during heat acclimation could be related to enhanced thermotolerance in perennial grasses. it is known that there exists a positive correlation between cytokinin content and heat tolerance in creeping bentgrass, and exogenous application of cytokinins improves heat tolerance [88, 89 ]. veerasamy. further investigated the effects of exogenous applied zeatin riboside (zr), a synthetic cytokinin, on protein metabolism associated with heat tolerance in improved heat tolerance of zr - treated plants were manifested by less heat - induced degradation of ribulose-1,5-bisphosphate carboxylase proteins and lower protease activity than untreated plants. particularly, the expression levels of a few hsps (32 and 57 kda) were upregulated in zr - treated plants under heat stress. these results suggest that some shsp and hsp60 proteins are among the primary targets in cytokinin regulation of heat tolerance in cool - season perennial grass species. in order to better understand the roles of hsps in heat tolerance, a unique c3 perennial grass species, rough bentgrass (agrostis scabra) identified in yellowstone national park, has been investigated. the thermal a. scabra grows actively in the chronically hot soils, which may have adopted both heat avoidance and tolerance strategies. the physiological traits associated with superior thermotolerance of the species were described in a few recent publications from our lab. this species could maintain the canopy photosynthesis and respiration rates responding to short - term soil temperature elevation. its roots tolerate high soil temperature by holding high proportion of alternative respiration, low maintenance and ion uptake costs, as well as efficient expenditure and adjustment of carbon and nitrogen allocation patterns between growth and respiration. heat - induced changes in one - dimensional protein profiles of thermal a. scabra were compared to those of a. stolonifera. in the shoots, significant protein degradation was observed at 30c45c in penncross and a new heat - tolerant cultivar of creeping bentgrass l93, but not until 40c 45c in a. scabra. meanwhile, expression of hsps (23, 32, 36, and 66 kda) was induced or enhanced at 35c 45c in l-93 and a. scabra, but only at 40c 45c in penncross. moreover, l-93 than penncross at 3545c of 3 d was revealed by immunoblotting (figure 4). in the roots, heat - induced degradation of proteins including hsps was mitigated in the thermal species, especially at the extreme temperature (45c). immunoblotting detected induction of hsp60 and multiple shsp (class i) proteins at elevated temperatures in both species, but the induction in a. stolonifera was triggered later under heat stress and/or by higher temperature compared to the thermal species ; hsp70 was constitutively produced during heat - shock treatment (2 and 4 h) but prolonged heat stress increased its expression level (24 and 28 h) (huang, unpublished data). the results from both shoots and roots indicate a correlation between early induction of major hsps as well as maintenance of them under elevated temperature and better heat tolerance of cool - season perennial grasses. a more complete identification and comparison of heat - responsive proteins in the two agrostis grass species contrasting in heat tolerance were achieved through proteomic analysis. among the hundreds of proteins identified in the leaves is an hsc70, the abundance of which decreased under heat stress in both species. however, the degradation ceased at 2 d in a. scabra but continued to 10 d in a. stolonifera. it suggests that maintaining production of constitutively expressed hsps such as hsc70 is important for sustaining grass plant growth under heat stress. in the roots, proteomic analysis revealed the increase of an hsp sti (stress - inducible protein) in both species under heat stress, which contains two hsp binding motif, three tetratricopeptide repeat and two sti1 domains. sti proteins are involved in hsp90 signaling and interaction. as heat - induced accumulation of this protein was earlier and greater in the thermal species compared to heat - sensitive a. stolonifera, it indicated that upregulation of hsp90-related proteins such as sti may contribute to whole - plant thermotolerance in perennial grasses. a suppression subtractive hybridization (ssh) library was constructed by tian. to identify heat - responsive genes for thermal a. scabra. in this study expression of the hsp70 gene was constitutively expressed under optimum temperature but strongly upregulated under heat stress in both shoots and roots. the hsp20-like chaperone is highly homologous to an hsp20-like chaperone from clover (medicago truncatula) that contains the p23 domain. as p23 is one of the cochaperones of hsp90 and stabilizes the hsp90 heterocomplex [98, 99 ], enhanced expression of this chaperone gene under heat stress also indicated that upregulation of hsp90-related proteins are important for heat tolerance in perennial grasses, as discussed above in the proteomic study. in another study, using the sequence of the hsp70 gene isolated by ssh in a. scabra and the reported sequence of a shsp (hsp16) gene in a. stolonifera, the expression levels of the two genes were compared between heat - sensitive a. stolonifera and thermal a. scabra (huang, unpublished data). the expression of hsp16 was highly induced in both species at 45c after 24 h, but the induction was more substantial in the thermal species, whereas, hsp70 gene was constitutively expressed at optimum temperature but the expression was slightly upregulated at elevated temperatures in both species. the response of hsp gene expression to increasing temperature is in accordance with the response of hsp protein abundance to elevated temperature, confirming the direct association of hsps with heat tolerance in perennial grasses. overexpression of genes controlling cytokinins (cks) synthesis can also modify cks production in the plants in addition to application of products containing cks. penncross) with elevated endogenous cks level has been successfully generated in our lab and used to study the involvement of cks in grass tolerance to abiotic stresses including heat stress [79, 100 ], shade, drought and nutrient deficiency. in these plants, the agrobacterium ipt gene encoding adenine isopentenyltransferase that catalyzes the key step in de novo ck biosynthesis was ligated to either a senescence - activated promoter sag12 or a heat - shock promoter hsp18. delayed leaf senescence under heat stress was observed in both sag12-ipt and hsp18-ipt lines. a sag12-ipt line (s41) and an hsp18-ipt line (h31) was selected for a proteomic study to compare genome - wide protein changes associated with differential heat tolerance among sag12-ipt, hsp18-ipt, and the nontransformant (nt) lines. a plastid hsp90, a cytoplasmic hsp90, and a chloroplast hsp70 as well as a rubisco large subunit - binding protein subunit (chhsp60) were identified in the shoots, and two endoplasm hsp90 homologues were identified in the roots (figure 5). specifically, in the shoots, the abundance of the plastid hsp90 increased 2.8-fold only in s41 whereas the abundance of the cytoplasmic hsp90 decreased 70% only in nt under heat stress ; the chloroplast hsp70 was upregulated 1.5-fold and 2.0-fold in s41 and sh31, respectively, but not in nt (figure 5(a)). an increase in the abundance of the rubisco large subunit - binding protein subunit was detected only in nt but not in either ipt - transgenic line. upregulation of this chhsp60 protein indicates that proper folding of rubisco proteins may be disturbed by heat stress thus more chhsp60s are required as their primary function is to facilitate rubisco folding. in the roots, increased abundance of both endoplasmic hsp90 homologues was only observed in s41 under heat stress (figure 5(b)). the results confirmed the regulatory role of ck in hsp metabolism for heat tolerance by inhibition of its degradation or stimulation of its production. hsps belonging to the same group but assigned to different subcellular locations can be regulated distinctively, suggesting they may possess distinct functional mechanisms for heat tolerance. conventional breeding contributed substantially to the genetic improvement of grass germplasms in the last century. for instance, specific hsps are involved in breeding heat - tolerant maize. when crossing a heat - tolerant maize line (zpbl 1304) that synthesizes a 45 kda hsp and a heat - sensitive line (zpl 389) that does not synthesize this protein, synthesis of the 45 kda hsp was observed in f2 plants that displayed an increased ability to recover from heat stress. however, in most cases, germplasm screening for heat tolerance relies on field and whole - plant techniques, which are less efficient and sensitive due to environmental interactions. continuous efforts have been devoted to developing rapid and accurate procedures that allow simultaneous screening of large numbers of genotypes in order to breed heat - tolerant grass for use in hot and humid areas. recent progress in genetic manipulation of plants opens up opportunities for incorporating cellular and molecular techniques into grass improvement. the technology exists to make pinpoint genetic changes to grass using marker - assisted selection or direct gene transfer by biolistic transformation and agrobacterium - mediated transformation [110112 ]. a few successful cases on incorporation of hsp genes to improve heat tolerance were reported in rice. for example, enhanced thermotolerance was achieved in transgenic rice overexpressing an arabidopsis hsp101 gene. overexpression of a rice chloroplast shsp (oshsp26) gene conferred better tolerance not only to heat stress but also to oxidative stress in e. coli, and overexpression of shsp17.7 confers both heat tolerance and uv - b resistance to rice plants. the effectiveness of this strategy in breeding heat - tolerant perennial grasses needs to be further validated. in conclusion, heat tolerance of both annual and perennial grasses encompasses an orderly, dynamic and complex regulatory system of different groups of hsps. evidences are available on the association of early induction and persistent maintenance of hsps under elevated temperature with better heat tolerance in grasses. manipulating genes controlling hsp production may be beneficial for breeding heat - tolerant grass genotypes. | the grass family poaceae includes annual species cultivated as major grain crops and perennial species cultivated as forage or turf grasses. heat stress is a primary factor limiting growth and productivity of cool - season grass species and is becoming a more significant problem in the context of global warming. plants have developed various mechanisms in heat - stress adaptation, including changes in protein metabolism such as the induction of heat shock proteins (hsps). this paper summarizes the structure and function of major hsps, recent research progress on the association of hsps with grass tolerance to heat stress, and incorporation of hsps in heat - tolerant grass breeding. |
our patient is a 53-year - old african american female with no significant past medical, surgical, or family history who presented to our facility with a three - month complaint of right flank pain that was localized, gradually worsening, and graded as 7/10 by her. she is p3003, married, and had undergone a papaniclaou (pap) smear with an uneventful outcome (according to her) three years prior to presentation. a computerized tomography (ct) scan of the abdomen showed an 11.7108 cm right flank mass (figure 1) consistent with a large exophytic mass highly suspicious for a renal cell neoplasm. a subsequent ct scan of the head, chest, abdomen, and pelvis was negative for any obvious metastases. our patient underwent a right radical nephrectomy five days after admission with positive pathology for a 9 cm high - grade leiomyosarcoma (figure 2), showing extensive areas of necrosis and vascular invasion. our patient was discharged on postoperative day 4 in a stable condition, and she opted for a herbal remedy rather than chemoradiation therapy. on postoperative day 30, our patient presented to the emergency room (er) with persistent vaginal bleeding for 11 days ; on physical examination, a bulky cervical mass of 78 cm with bilateral parametrial infiltration extending to the pelvic wall was seen and biopsied. histopathology of the mass confirmed a diagnosis of poorly differentiated squamous cell carcinoma of the cervix, stage iiib. a repeat ct scan of the chest, abdomen, and pelvis with contrast revealed no obvious metastases and a 7.96.8 cm heterogeneous soft tissue mass within the lower uterine segment (figure 3), which a pelvic sonogram confirmed by showing a 6.46.97.7 cm cervical growth. figure 2histopathology of a high - grade leiomyosarcoma of the kidney (high - power ; hematoxylin and eosin stain). histopathology of a high - grade leiomyosarcoma of the kidney (high - power ; hematoxylin and eosin stain). our patient underwent definitive radiation therapy for the squamous cell carcinoma of the cervix, receiving a total of 74.1 gy in less than four months, and attempted brachytherapy. she re - presented to the er nine months later with marked anemia (hemoglobin : 5.1 mg / dl), generalized weakness, and poor functional status. a repeat ct scan and sonogram of the abdomen showed multiple metastases in the right flank with possible distant metastases in the liver. she also complained of severe back pain, and eventually passed away one week after re - admission. this is the first reported case of concomitant leiomyosarcoma of the kidney and squamous cell carcinoma of the cervix. the definitive diagnosis of both conditions requires surgical sampling and a high index of suspicion at inception. our patient had no known risk factors for cervical cancer such as cigarettes, promiscuity, human papilloma virus (hpv) infection, human immunodeficiency virus (hiv) disease, or prior abnormal pap smears. her rapidly progressive cervical carcinoma mass was, possibly, a result of a latent hpv infection that her immune compromised status (secondary to her first primary the leiomyosarcoma of the right kidney) exacerbated. leiomyosarcoma of the kidney is a very rare neoplasm with only about 190 cases published in the medical literature, and among renal sarcomas accounts for 5060% of cases. the united states national cancer institute (nci) surveillance, epidemiology and end result (seer) program documented 112 cases in the nci chronology between 1973 and 2006, while about 47 cases have so far been reported in japan. there was a preponderance of female cases in the seer study with a 58% majority and most of them occurred between the fourth and sixth decades of life. in comparison, the incidence of squamous cell carcinoma of the cervix has been declining steadily owing to the effect of widespread screening for premalignant cervical changes by cervical cytology (pap smear). in 2006, only 9710 women were diagnosed with cervical cancer (of which 8590% were of the squamous cell variety) in the united states with 3700 mortalities. initial presenting symptoms of leiomyosarcoma mimic renal cell carcinoma and include flank mass, pain, and hematuria with the right side twice as involved as the left side. this makes radiological diagnosis of leiomyosarcoma difficult, with postoperative pathological investigation the only way to make a definitive diagnosis. in like vein, only a histopathological specimen can definitively diagnose cervical cancer, and the fact that our patient had a negative pap smear three years before current diagnosis calls into question the new acog recommendation to screen asymptomatic healthy females once every three years. even though the guidelines make provision for more regular screening in immune - compromised patients, the clinical presentation by our patient, although typical of cervical cancer (which includes vaginal bleeding and pelvic pain), could be easily missed on the basis of a recent normal pap smear. treatment of renal leiomyosarcoma has been restricted to surgical, wide resection but recent reports of regression with adjuvant irradiation and chemotherapy may soon change this. the most effective chemotherapy regimens currently in use include doxorubicin, actinomycin d, cyclophosphamide, and vincristine. other interventions include adjunctive irradiation with 5000 rads and a synergy of gemcitabine and docetaxel in metastatic disease. iv) are treated by chemoradiation using cisplatin, 40 mg / m weekly, and external radiation treatment with brachytherapy. response rates to chemotherapy are approximately 50% (partial and complete), using multiple - agent regimens containing cisplatin, and 2070% for radiation therapy depending on the stage. surgery is often used for treating stage ib and early stage iia carcinomas of the cervix and include radical hysterectomy and pelvic exenteration with five - year survival rates of 50% or better. our patient with stage iiib cervical cancer had a prognosis of between 25% and 50%. the prognosis for renal leiomyosarcoma is related to its grade with intermediate- and high - grade lesions showing an aggressive course with significant mortality (< 25% survival at 5 years) and low - grade lesions less than 5 cm in size a better prognosis. our patient had a high - grade lesion greater than 5 cm with vascular invasion, and thus had an unfavorable prognosis. leiomyosarcomas are characterized by rapid growth rate, frequent metastases, and high local and systemic recurrence rates, while cervical cancer is rarely found in advanced stages in the united states because of the cervical screening tools that have been in place since the 1950s. cervical cancer is staged from stage i through iv and the prognosis is dependent on the size of the lesion and the stage at which the patient presents. our patient underwent nephrectomy for the right - sided leiomyosarcoma of the kidney and became immune - comprised, which led to the rapid progression of the squamous cell carcinoma of the cervix. she presented with vaginal bleeding even though she had normal prior pap smears and responded rapidly to irradiation of the cervix. in patients with leiomyosarcoma of the kidney, a concomitant squamous cell carcinoma of the cervix may occur and each primary malignancy must be treated individually, noting that a second primary may be secondary to the first primary with an immune - compromised status. | we report a case of right - sided leiomyosarcoma of the kidney with concomitant poorly differentiated squamous cell carcinoma of the cervix diagnosed one month after radical nephrectomy in a previously healthy female patient. this is the first reported case of concomitant leiomyosarcoma of the kidney and squamous cell carcinoma of the cervix, and the diagnosis, clinical presentation, prognosis, and treatment are discussed. |
in the central nervous system the extracellular matrix forms a compact and organized matrix called perineuronal nets (pnns) [1, 2 ]. the composition of this net is unique and different from of other tissues. cs proteoglycans (cspgs) are the main component of perineuronal nets [35 ] and consist of a large variety of core proteins covalently linked to chondroitin sulfate glycosaminoglycans (cs - gags). astrocytes, neurons, oligodendrocytes, and microglia seem to synthesize the cspgs participating in the formation of perineuronal nets. the role of pnns is not clear ; it is currently known that they are involved in synaptic stabilization and limitation of synaptic plasticity [8, 9 ]. due to the negative charge of cs - gags, they can bind to various cations, as sodium, potassium, and calcium, acting as a kind of buffering system [1012 ]. in alzheimer 's disease, it has been reported that cortical areas highly rich in perineuronal nets are less affected by degeneration. after cns injury, a glial scar is formed [1416 ] to reestablish the integrity of the cns [1719 ]. this enhances the cs - pgs within the glial scar which remain in the injured sites for a long period of time [20, 21 ] whereby they are considered to inhibit neural regeneration [22, 23 ]. the inhibitory activity of cs - pgs is mediated mainly by the cs - gags. the molecular mechanisms involved in the inhibitory effects of cs - gags are still not clear. they could be related to a direct interaction with a cs - gag receptor [25, 26 ] or through binding to specific growth inhibiting elements. alternatively, their effects can be mediated through the control of cs - gags and integrins activation, although a direct interaction between cs - gags and integrins has not been demonstrated. other studies have shown that the function of cspgs may be related to the specific sulfation sequence of cs chains [2932 ] that could act as both inhibitory molecules for axonal growth and neuritogenic molecules [18, 32 ]. in line with this is the observation that the treatment with chondroitinase following injury allows the formation of new synapses, increases synaptic plasticity, and leads to functional recovery [3336 ]. on the other hand, it has been reported that the removal of hyaluronic acid from hippocampal slices suppresses l - type ca currents and reduces ca transients. one of the primary events for the induction of long - term potentiation (ltp) at this synapse is the elevation of postsynaptic ca concentrations ; so, these molecules may modulate neuronal plasticity. thus, the study of the role of perineuronal net components on synaptic transmission is important to understand both neuronal excitability and plasticity. other studies have also reported that removal of hyaluronic acid facilitates lateral diffusion of membrane molecules, including ampa receptors, and reduces the level of paired - pulse depression [38, 41 ]. it is also known that digestion of cs - pgs with chondroitinase impairs early - ltp (e - ltp) and mice deficient in the cs - pgs brevican or neurocan show impaired e - ltp and late - ltp (l - ltp), respectively. we have recently reported that cs induces na inward current that causes cell depolarisation and a transient elevation of the cytosolic ca concentration ([ca]c) in cultured rat hippocampal neurons ; these effects were selectively mediated by ampa / kainate receptors. our present study provides evidence that, in addition to playing an important role in the structural integrity of mammalian extracellular matrix, cs can also modulate cellular excitability, synaptic transmission, and neuronal plasticity in rat hippocampal slices. thus, cs caused a reversible depression of synaptic transmission that was not prevented by an antagonist of kainate receptors. on the other hand, cs decreased the population spike mediated by synaptic transmission but enhanced the population spike evoked antidromically. additionally, cs exhibited a modulator role in neuronal plasticity by enhancing both paired - pulse facilitation and e - ltp. our data strongly suggest that not only cs has a structural function in the cns but also this gag has functional effects, for instance, the modulation of synaptic transmission. all experiments were performed on 400 m thick transverse hippocampal slices obtained with standard methods from male sprague - dawley rats (200250 g). the care and use of animals were carried out in accordance with the national council on animal care and the european communities council directive and were approved by the local animal care committee of universidad autnoma de madrid. animals were decapitated after anaesthesia with isoflurane, and the brain was quickly removed and dropped into ice - cold krebs - ringer bicarbonate (krb) solution containing (in mm) the following : 119 nacl, 26.2 nahco3, 2.5 kcl, 1 kh2po4, 1.3 mgso4, 2.5 cacl2, and 11 glucose. the hippocampi were sliced with a manual tissue chopper and placed in an interface holding chamber for at least 2 h at room temperature (2025c). a single slice was transferred to a submersion - type recording chamber where it was continuously superfused (2 ml / min) with standard krb solution. synaptic responses were evoked by stimulating the collateral - commissural fibbers of schaffer with electrical pulses (2050 a, 100 s, 0.0330.066 hz) applied through bipolar tungsten insulated microelectrodes placed on ca1 stratum radiatum. this stimulating pulse evoked a fepsp of about 1 mv amplitude that represents the 4050% of maximal response. electrical pulses were supplied by a stimulus isolation unit (cibertec, model isu200bip, madrid, spain). the field epsp and the presynaptic fibber volley (fv) from the stratum radiatum of the ca1 region were recorded with tungsten microelectrodes (1 m) connected through a home - made preamplifier to a grass amplifier (model 7p511h). evoked responses were low - pass - filtered at 3 khz and digitized at 25 khz using a digidata 1440a board (axon instruments) and stored on a computer using pclamp-10 software (axon instruments). the amplitude of the presynaptic fv was measured from the baseline to the negative peak of the fv. the synaptic strength was calculated using the initial slope phase (1 ms window) of the fepsp to avoid the possible contamination of the response by propagated population spikes. field epsp slope is considered a fine indicator of glutamatergic synaptic transmission. as baseline of field potentials we took the mean value of the signal (25 ms) preceding the stimulus artefact. data were normalized with respect to the mean values of the responses at baseline period in standard medium. chondroitin sulfate used in the present study was provided by bioibrica (barcelona, spain). cs is highly purified chondroitin sulfate of bovine origin in a concentration above 98% (measured by cpc titration assay, the official assay method of the usp cs monograph and european pharmacopeia to ensure a correct measure of cs purity and potency) ; however, an effect due to unknown components that constitute the remaining 2% can not be ruled out. this product from bioibrica consists of a mixture of cs sulfated in positions 4 (62%), 6 (32%) or unsulfated (6%) on the n - acetyl - d galactosamine group. the full range of its molecular weight is ~1316 kda with an intrinsic viscosity of ~0.020.06 m / kg. (rs)-1-(2-amino-2-carboxyethyl)-3-(2-carboxybenzyl)pyrimidine-2,4-dione (ubp-296) was supplied by tocris bioscience (bristol, united kingdom). number 27042), heparin (cat. number h3393), and other chemical components for solutions were obtained from sigma - aldrich (madrid, spain). number c3667, sigma - aldrich, madrid, spain) was prepared (50 mu / ml) in a modified krb (50 mm sodium acetate as reaction activator was added). the drugs were prepared as stock solutions stored frozen in the dark and diluted to the final concentration in the superfusion solution immediately before use. the osmolarity of the superfusion solutions was tested with a microosmometer (advanced instruments, model 3mo, norwood, ma, usa). data were expressed as means sem of the number of slices (n) studied, from at least 3 different animals. the level of statistical significance between two groups of data was established at p 0.05 when compared with the reduction caused by cs alone). a brief period of tetanization (100 hz, 1 s) applied to the schaffer collateral - commissural fibbers of the ca1 region produced a robust increase in the strength of synaptic transmission (ltp) that persisted for at least 60 min. as previously indicated, cs application (300 m) produced an average depression of fepsps of 23.72 3.8% ; this effect was reversible after washout of the drug. to determine if cs could affect the induction of ltp, cs was perfused after a stable baseline and high frequency stimulation (hfs ; 100 hz, 1 s) was applied in the presence of cs. in the slices where ltp was induced in the absence of cs, there was a sharp increase in fepsp slope (150.2 8.7% of baseline measured immediately after tetanic stimulation) that gradually decreased during the posttetanic potentiation and remained at 122.6 4.3% of baseline after 60 min of hfs. when the tetanic stimulation was applied in slices pretreated with cs, a sharp increase in fepsp slope was also produced (189.3 11.9% of baseline) ; this augmented signal remained at 148.8 11.1% of baseline after 60 min of tetanic pulse application (figure 6(a)). a comparison of the means of the fepsp slopes recorded 5 min after the tetanic stimulus showed a statistically significant increment of the potentiation showed a statistically significant increment of the potentiation conditions (p < 0.05, n = 8). however, comparing the fepsp slopes recorded at the end of the posttetanic period (60 min) showed no statistically increment in the final potentiation (122.6 4.3% and 148.8 11.1% induced in control and cs - pretreated slices). so, we can conclude that cs potentiates the induction of ltp but it does not modify its maintenance. when cs was applied after tetanisation, an enhancement of signal was observed after cs washout during approximately 1520 min ; after this time, as shown above, no statistical differences were observed when compared with control (data not shown). this potentiation after cs application was associated with the nonpermanent rebound observed after cs washout (increase over baseline). figure 6(c) shows a time - course of ltp recording normalized to the baseline after cs washout, so this rebound was not considered, and now it is easier to appreciate the fact that cs enhances the induction of ltp but not its maintenance. due to the complexity and heterogeneity of cs, the precise structure of cs with biological activity and their underlying molecular mechanisms of action are poorly understood. in the present work we have studied the effects exerted by synthetic cs on evoked synaptic transmission, neuronal excitability, and neuronal plasticity in slices of rat hippocampal neurons. cs caused the following : (i) a reversible depression of fepsps in a concentration - dependent manner ; (ii) a strong blockade of the population spike amplitude when it was mediated by synaptic transmission but not when it was antidromically evoked ; in this last case a potentiation was observed ; (iii) an enhancement of paired - pulse facilitation ratio ; and (iv) an increase in ltp magnitude. so, our results provide evidence that cs can modulate neuronal communication, synaptic transmission, and neuronal plasticity. in this study we have shown that cs produces a fast, pronounced, and reversible depression of fepsp in a concentration - dependent manner. they could be related to a direct interaction with a cs - gag receptor [25, 26 ]. this depression may be linked to the capability of cs to modulate the -1 integrin pathway. recently, some authors have reported that cspgs restrict spine dynamics and motility through this way. curiously, this integrin is linked to ampa receptors and so it is involved in mediating transmission. in addition, in primary culture of hippocampal neurons we have recently reported that cs induces na - dependent inward whole - cell current and that blockers of ampa receptors inhibited the cs effects ; in contrast, the blockade of nmda receptors did not modify those effects. with these considerations, we hypothesize that cs induces a partial inactivation of ampa receptors ; in this manner, the latter fepsp recorded in the stratum radiatum of ca1 evoked by the electrical stimulation of schaffer collateral is lower than the signal recorded before cs application. we noted that cs - induced fepsp depression was not due to an effect of cs on axon recruitment as inferred from the lack of significant changes observed in the fv amplitude. in spite of these considerations, we can not discard that the depression exerted by cs may also be due to a direct interaction with the component involved in synaptic transmission or mediated by inducing an increment in the excitability of hippocampal interneurons. additionally, we would like to point out that some possible discrepancies with other studies may be linked to the specific sulfation sequence chains used, because this feature determines the cspg functions [2932, 51 ]. here we have found that cs mediated the depression of cellular excitability when population spike was evoked by orthodromic stimulation of stratum radiatum fibbers, as expected from the depression of fepsp elicited by cs. however, our results also evidenced that cs produced a potentiation of neuronal excitability when population spikes were evoked by antidromic stimulation of alveus fibbers, in other words, when action potential was not mediated by synaptic transmission. we noticed that this potentiation of population spikes excitability did not develop epileptogenic - like behaviour. the molecular mechanism underlying the cs - modulation of neuronal excitability is also poorly understood. however, we think that the molecular mechanisms underlying these effects may be associated with the control of ions involved in the generation, propagation, and termination of action potential, as reported in neocortex and hippocampal slices were cs - gags removal shows an increase in the rate of ca diffusion. additionally, this idea is compatible with our previous paper where cs produced na - dependent inward whole - cell current ; such current causes cell depolarization and [ca]c transient in primary cultures of hippocampal neurons. in spite of cs - induced fepsp depression, associated with a possible inactivation of ampa receptors as indicated above, cs also modulates the glutamate release probability as inferred from the significant changes observed with the paired - pulse facilitation paradigm. this enhancement of facilitation may be associated with the property of cs to evoke an elevation of the [ca]c [44, 53 ]. as a result of this modulation of neuronal transmission, we have observed that cs also modifies ltp induction. one of the primary events for induction of ltp is the postsynaptic ca concentration that promotes the incorporation of additional ampa receptors into the postsynaptic sites. additionally, components of the extracellular matrix affect ligand binding, channel kinetics, and ca permeability of ampa receptors. it has been reported that cs actions are mediated by its interaction with ca - impermeable ampa receptors and that these receptors mediate excitatory synaptic transmission and play a key role in hippocampal ltp. thus, the neuronal transmission of the majority of synapses is influenced by extracellular matrix through interactions with their specific receptors. the application of hyaluronidase in hippocampal slices suppresses l - type calcium currents and reduces ca transients in postsynaptic dendrites or spines and abolishes an l - type - mediated component of ltp. after removal of hyaluronic acid, the ampa receptors diffusion is facilitated and the level of paired - pulse depression under conditions of elevated release probability is reduced [38, 41 ]. it has been reported that chondroitinase abc impairs e - ltp and mice deficient in brevican or neurocan show impaired e - ltp and l - ltp, respectively. cs - gag degradation opens up spaces for axonal growth and the formation of new neuronal contacts [57, 58 ]. in addition to this structural role, a more pharmacological profile of these degradation products has been suggested. this may be the case for cs that modulates synaptic transmission and processes such as ltp. the biological activity of cs is defined by the sulfation pattern of repeating disaccharide units. our cs from bioibrica consists of highly purified chondroitin sulfate of bovine origin in a concentration not less than 98% ; however, we can not discard that the effects here reported may be, at least in part, due to compounds included in the 2% remaining. our product consists of a mixture of cs sulfated in positions 4 (62%), 6 (32%) or unsulfated (6%) on the n - acetyl - d galactosamine group. other authors have reported that only cs with desulfation in the 4 and 6 position of n - acetyl - d galactosamine group is critical for its biological activity. however, other studies also point out that in spite of the sulfation in the 6 position of n - acetyl - d galactosamine group a 2 position sulfation of glucuronic acid for biological activity is also necessary [34, 62 ]. we have also tested a commercial form of chondroitin with sulfation in the 4 position that did not mimic the effect obtained by cs from bioibrica. in conclusion, we have found that in rat hippocampal slices cs depressed fepsps reduced the population spike amplitude evoked by orthodromic stimulation and augmented paired - pulse facilitation as well as ltp. these data support the hypothesis that degradation of extracellular matrix could release free cs that will then exhibit its effects on enhanced ca signaling and ca - dependent neuronal plasticity. this remodeling of perineuronal nets contributes to brain plasticity and hence to regulating cognition, tissue repair, cell migration, or axon regrowth. | it is currently known that in cns the extracellular matrix is involved in synaptic stabilization and limitation of synaptic plasticity. however, it has been reported that the treatment with chondroitinase following injury allows the formation of new synapses and increased plasticity and functional recovery. so, we hypothesize that some components of extracellular matrix may modulate synaptic transmission. to test this hypothesis we evaluated the effects of chondroitin sulphate (cs) on excitatory synaptic transmission, cellular excitability, and neuronal plasticity using extracellular recordings in the ca1 area of rat hippocampal slices. cs caused a reversible depression of evoked field excitatory postsynaptic potentials in a concentration - dependent manner. cs also reduced the population spike amplitude evoked after orthodromic stimulation but not when the population spikes were antidromically evoked ; in this last case a potentiation was observed. cs also enhanced paired - pulse facilitation and long - term potentiation. our study provides evidence that cs, a major component of the brain perineuronal net and extracellular matrix, has a function beyond the structural one, namely, the modulation of synaptic transmission and neuronal plasticity in the hippocampus. |
high mobility group box 1 (hmgb1) protein was first described almost 35 years ago as a nonhistone chromosomal protein with high electrophoretic mobility. as a dna binding protein,. found that hmgb1 activated an inflammatory response upon release into the extracellular milieu from necrotic cells and activated macrophages with accompanying organ failure [3, 4 ]. hmgb1 has been shown to be a dual - nature protein [5, 6 ]. in humans, serum levels of hmgb1 are increased in several inflammatory diseases such as infection, sepsis and septic shock [7, 8 ], acute coronary syndrome [9, 10 ], and disseminated intravascular coagulation. failure of circulatory dynamics transfer occurs in approximately 10% of neonates at birth, and these newborns require supportive interventions, such as suction and stimulation. furthermore, approximately 1% of such neonates require aggressive resuscitation, and if appropriate treatment is not given, they may die or suffer serious permanent impairments. according to the consensus 2010 of the international liaison committee on resuscitation (ilcor), children with moderate to severe hypoxic ischemic encephalopathy (hie) should receive brain hypothermic therapy (bht) after successful resuscitation. bht is performed as a brain protection strategy for neonates with hie, mainly to prevent secondary cell death after ischemia reperfusion. elevated high mobility group box 1 (hmgb-1) in the blood at the early stage of brain ischemia - reperfusion injury has been suggested to be involved in the release of various inflammatory cytokines. we report herein the results of our first study of hmgb1 dynamics in neonates receiving bht. in total, 21 neonates who were admitted to the neonatal intensive care unit (nicu) of nishisaitama - chuo national hospital during the 1-year period starting october 18, 2010, when the consensus 2010 recommendations were published, were enrolled in this study. these neonates included 8 with hie in whom bht was indicated, 5 controls diagnosed as having hie but who were not suitable candidates for bht, and 8 normal controls (hospitalized for management of mild respiratory insufficiency ; none had hie). serum which had been collected for the purpose of postbirth management by a primary care physician in charge of each subject was preserved and used. umbilical cord blood samples were subjected to plasma separation within 3 hours after birth and stored frozen at 30c. all day 5 plasma samples were obtained by drawing blood via the heel - cut method into capillary tubes followed by centrifugation at 12000 rpm and stored frozen at 30c. the plasma hmgb1 concentration was measured by commercial enzyme - linked immunosorbent assay (elisa) kit (shino - test, japan) according to the suppliers ' recommendations. the detection limit of hmgb1 was achieved at concentration above 0.2 ng / ml. serum samples with 5, 10, and 20 ng / ml hmgb1 protein concentrations were analyzed in 10 replicates for assessment of intra - assay precision. and so, interassay precision was determined by assaying serum samples of 5, 10, and 20 ng / ml over 5 separate assays. the intra - assay cvs ranged from 2.9% to 4.9%, and the interassay cvs ranged from 4.8% to 8.5%. recovery, calculated from data with (n = 10) several concentrations of 5, 10, and 20 ng / ml of purified human hmgb1 added to pooled serum as the ratio of the observed concentration to the expected concentration multiplied by 100%, ranged from 92% to 111% in the hmgb1 elisa assay. two - way anova and the mann - whitney test were performed using statmate iv. a p value < 0.05 was considered to indicate a statistically significant difference. table 1 shows a comparison of the clinical manifestations in cases with and without bht. gestational age was significantly greater, and 5-minute apgar scores were significantly lower in the bht (+) group. two - way anova showed significant differences in hmgb-1 levels among cases, but there were no significant differences in individual chronological changes (p = 0.6088), indicating that the hmgb1 level did not change significantly from birth through the early stages after birth in normal neonates (figure 1). the ua - hmgb1 level before undergoing bht significantly exceeded reference values. the concentration decreased significantly after bht, with no further changes through 5 days of age (p = 0.012) (figure 2). the ua - hmgb1 level in the bht () group did not differ significantly from reference values but was significantly increased 24 hours after birth, the time point at which bht was started in the bht (+) group, and then was significantly decreased by 5 days of age (p = 0.0102) (figure 2). when values measured at the time point just before the start of bht were compared, the ua - hmgb-1 level of the bht (+) group was found to be significantly greater than that of the bht () group. however, the level decreased more significantly in the bht (+) than in the bht () group 24 hours after the start of this therapy in the former, having no significant difference at 24 hours after birth (table 2). repeated measure anova showed a significant difference in chronological changes between the bht (+) and bht () groups (p = 0.0002). we previously established reference blood values for hmgb1 in full - term neonates soon after birth. there were no significant differences in hmgb1 level related to mode of delivery, but the concentration was significantly increased in cases delivered by emergency cesarean section or vacuum extraction for forced delivery. furthermore, okazaki. studies on the production, secretion, and site of action of hmgb-1 in the body have shown two distinct functions. local hmgb1 function occurring via stimulation due to infection of nuclei such as those of neutrophils and vascular endothelial cells. systemic hmgb1 function mediated by hmgb1 secreted by hmgb1 producing cells to induce remote organ failure in the lungs, liver, kidneys, and other organs during hemorrhagic states. the local hmgb1 and systemic hmgb1 functions require approximately 4 hours and 16 hours, respectively [2, 4, 5 ]. on the other hand, clinical experiments demonstrated hmgb1 to be released from cells within approximately 1 hour after the onset of brain ischemic lesions, which suggested hmgb1 in the central nervous system to possibly be involved in the early stage of an inflammatory reaction when cytokines such as tnf and icam-1 are produced [1518 ]. this study showed the hmgb1 level to already be remarkably increased in the umbilical arteries of infants with birth asphyxia. furthermore, neurons were damaged by the sudden onset of asphyxia, one of the ischemic disorders, possibly triggering the rapid release of hmgb1 into the bloodstream after the injury. bht or hypothermic therapy for hie in infants with birth asphyxia is recommended in the resuscitation guidelines 2010 japan. the modes of action of hypothermic therapy vary greatly and include inhibition of brain cellular energy metabolism, inhibition of glutamate release, inhibition of impaired reuptake of glutamate, inhibition of free radical production, reduction of the activities of cytotoxic substances including glutamate, free radicals, and cytokines, and prevention of the metabolic chain reactions characteristic of cellular dysfunction [79 ]. hmgb1 was considered to possibly trigger an inflammatory reaction and thereby promoted the production of cytokines (e.g., tnf) which regulate the early inflammatory reaction. furthermore, hmgb1 may be a useful index of the inhibition of early stage inflammation. | background. according to the consensus 2010 of the international liaison committee on resuscitation (ilcor), children with moderate to severe hypoxic - ischemic encephalopathy (hie) should receive brain hypothermic therapy (bht) after successful resuscitation. elevated high mobility group box 1 (hmgb1) in the blood at the early stage of brain ischemia - reperfusion injury has been suggested to be involved in the release of various inflammatory cytokines. methods. in total, 21 neonates plasma hmgb1 concentration was measured. these neonates included 8 with hie in whom bht was indicated, 5 controls diagnosed as having hie but who were not suitable candidates for bht, and 8 normal controls. results. the umbilical artery hmgb1 (ua - hmgb1) level before undergoing bht significantly exceeded reference values. the ua - hmgb1 level in the bht () group did not differ significantly from reference values, but was significantly increased 24 hours after birth. repeated measure anova showed a significant difference in time course changes between the bht (+) and bht () groups (p = 0.0002). conclusions. this study demonstrated hypothermic therapy to significantly decrease hmgb1. furthermore, hmgb1 is a useful index of the inhibition of early stage inflammation. |
good posture means a posture that can minimize the level of fatigue on the body resulting from gravity and external forces1, 2. it has been reported that korean middle school and college students spend 2/3 of the day in a sitting position while studying, using a computer, watching tv, etc1, 3. the relative position of the head and trunk, when maintaining good posture in a sitting position, works as an important factor in the onset of physical fatigue4. in the standing position, the body posture is maintained using the neck, spine and musculoskeletal system of the lower limbs ; however, in the sitting position while studying, the trapezius muscle is used to support the forward tilt of the head (78% of the overall body weight), and maintaining the posture for a long time causes a rapid increase in fatigue. when fatigue of the trapezius muscle increases, the neck and spine experience increased instability, which causes problems such as forward head posture and affects muscle pain and the spine in negative ways5, 6. therefore, various studies have been conducted to understand the correlation between long - term sitting postures and pain in the neck and shoulders7, 8. korean middle school, high school and college students mostly use horizontal tables and vertical - backed chairs for studying. the design conforms to korean industrial standards, but its effect on the prevention of forward tilt of the head during activities such as reading and writing is minimal. therefore, the necessity of implementing a design to prevent neck and trunk pain during studying has been recognized9, 10. furthermore, it has been reported that the neck and trunk pain of students due to studying is highly related to the sitting position while using school chairs7, 11. in extended study sessions using a desk and a chair, forward tilt of the neck and trunk occur if the gaze level is lower, which makes it the main factor in the onset of neck and spine pain12. chairs should be designed to endure the pressure of the body, and to support the body weight, while desks need to be able to handle the various studying functions such as reading and writing. through the provision of a design in which the gaze level does not change significantly, the pressure on the cervical spine and the lumbar spine could be reduced, which would be a useful way of preventing muscle fatigue10, 13. if the head is located relatively forward compared to the trunk, it changes the head, neck and physical alignment, causing pain in the head, neck and spine, while also negatively affecting the balanced growth of the body14, 15. this change in physical alignment in the sitting posture is a risk factor affecting body and trunk alignment. since korean students maintain the forward tilt position of the head even during rest after study, due to the increased use of smart phones and longer use of them, their levels of muscle and physical fatigue rises even more, since contraction - relaxation is decreased. it was reported that the electromyography (emg) activity level of the trapezius muscle, which covers wide areas of the neck, back and shoulders and is the muscle most affected maintaining a fixed posture of the head, and the change of physical fatigue level have a close relation16. in addition, it has been reported that the emg signals of the trapezius muscle measured using surface emg can be used as an indicator of muscle fatigue, especially the decrease of mean power frequency (mpf)17. previous research has indicated there is a very close relation between the trunk movement due to sitting on chairs, and the activity level of the erector muscles of the spine17, 18. upon reviewing the postures adopted while sitting in various chairs, which can cause changes in physical posture during work, differences in posture were found based on the methods used to adjust the level of gaze and monitor height13. desks and chairs should therefore be designed to reduce the pressure on the waist by dispersing the weight over a wider area, and to offer the height that is best for gaze level during study, since students use desks and chairs for many hours19. however, for typical korean students, if the height of the desk were unilaterally adjusted for the gaze level, it might have negative effects on other activities since the desks are also needed for other activities. therefore, this study compared assistant desks (which can reduce the fatigue level of the trapezius muscle through reducing the change in the gaze level during study and reducing the pressure on the neck while performing various tasks) and assistant chairs (that can prevent lumbar spinal tilt) with normal desks and chairs to verify the effects of the assistant chair - desk system (acds), which can minimize the forward tilt of the neck and trunk. the study subjects were 14 middle school students (14 years of age, 159.4 8.9 cm in height, weighing 50.3 9.2 kg, with skeletal muscle mass of 21.2 5.1 kg and 530 156 minutes study time / day) and 14 college students (24.2 2.4 years of age, 168.2 10.8 cm in height, weighing 63.8 16.8 kg, with skeletal muscle mass of 27.5 7.5 kg and 389 146 minutes study time / day) of mixed gender. it consists of an assistant desk which can be adjusted to facilitate the best gaze level of students and also has an adjustable backrest on the chair so that the students can study comfor (back solution, haan co., korea). the assessment of fatigue level was done using a fatigue testing device (ft-501, dongsan trading. korea), which measures the fatigue level using the flicker fusion frequency of the students during rest and after studying using a designated chair16. measurements were carried out after letting the students take a rest for 10 minutes while blindfolded. they were takes before and after 120 minutes of study by the students to measure their fatigue levels. emg signal analysis of the trapezius muscles was carried out with bipolar (20 mm center - to - center, 10 mm of diameter) ag - agcl surface electrodes (noraxon, usa). the electrodes were placed on the skin close to each other at a point midway between the spinous process of the 7th cervical vertebral and the outer edge of the acromion20. each electrode spot was marked with an oil pen and secured with surgical tape, after the skin had been shaved and cleaned with alcohol, to ensure that the electrode stayed on the same spot during the test measurement. the signals were amplified and bandpass filtered between 10 to 2,000 hz (noraxon telemyosystem 900, usa ; common mode rejection ratio : 100 db at 60 hz ; differential input impedance : 10 m ; gain : 2,000 ; base - line noise 0.05) was found between the mpfs of the left or right trapezius muscles and the fatigue level of the 28 participants after 2 hours of studying using either the ncds or acds. from the main effect verification based on the time interval, the right trapezius muscle mpfs (f=5.407, p=0.028) and fatigue level score (f=8.473, p=0.007) showed significant differences, and there was also a significant difference in the fatigue levels according to the main effect of the two chair systems (f=5.056, p=0.033). for ncds, there was a significant difference in the fatigue level after 2 hours of studying (t=3.578, p=0.001). in addition, a significant difference in the fatigue levels of the ncds and acds was also found after 2 hours of studying (table 1table 1.the mean power frequency slope of trapezius muscle between ncds and acds before and after 2 hours of studyconditioninitial timemean (sd)after 2 hours of studymean (sd)main effectinteraction effectncdsacdsncdsacdstime intervalchair systemleft trapezius muscle mean power frequency slope0.32 (1.24)0.02 (0.36)0.07 (0.40)0.03 (0.31)0.0930.3020.383right trapezius muscle mean power frequency slope0.11 (0.51)0.03 (0.35)0.22 (0.53)0.08 (0.61)0.0280.7800.415fatigue4.11 (3.41)4.09 (4.19)6.17 (3.85)4.82 (3.76)0.0070.0330.079p < 0.05 ; difference between time intervals : = initial value vs after 2 hours of study in ncds ; difference between groups : = ncds vs acds after 2 hours of study ; = main effect and interaction effect). among the changes in sitting posture found after 2 hours of studying utilizing the ncds or acds, an interaction effect was found only for the neck angle (p<0.05). according to verification of the main effects based on time intervals, a significant difference was present in the neck angle (f=390.27, p=0.001) and hip joint angle (f=43.10, p=0.001). based on the chair systems, there was a main effect only for the hip joint angle (f=9.01, p=0.006). p < 0.05 ; difference between time intervals : = initial value vs after 2 hours of study in ncds ; difference between groups : = ncds vs acds after 2 hours of study ; = main effect and interaction effect after 2 hours of studying, there were significant differences in the neck angles of both the ncds (t=4.848, p=0.001) and acds (t=2.707, p=0.012), but only the acds (t=2.438, p=0.022) showed a significant difference in the hip joint angle. between the ncds and acds, significant differences were found in the neck angle (t=8.385, p=0.001) and hip joint angle (t=6.325, p=0.001) measured before the study, and also in those measured after 2 hours of studying (neck angle, t=29.661, p=0.001 ; hip joint angle, t=4.205, p=0.001 ; table 2table 2.the neck and hip angles in the sitting position of the ncds and acds before and after 2 hours of studyconditioninitial time mean (sd)after 2 hours of study mean (sd)main effectinteraction effectncdsacdsncdsacdstime intervalchair systemneck angle26.8 (13.5)43.1 (1.0)18.4 (8.5)47.1 (5.7)0.0010.0920.001hip angle92.7 (12.9)105.6 (9.2)90.2 (13.0)101.2 (9.3)0.0010.0060.510p < 0.05 ; difference between time intervals : = initial value vs 2 hours after in ncds, = initial value vs 2 hours after in acds ; difference between groups : = ncds vs acds before studying, = ncds vs acds after 2 hours of study ; = main effect and interaction effect). p < 0.05 ; difference between time intervals : = initial value vs 2 hours after in ncds, = initial value vs 2 hours after in acds ; difference between groups : = ncds vs acds before studying, = ncds vs acds after 2 hours of study ; = main effect and interaction effect an interaction effect (p<0.05) was found between the length of the head to c7 (7th cervical vertebra) and the head to t12 (12th thoracic vertebra) in the sitting position, measured after 2 hours of studying with both the ncds and acds. according to the main effects based on time intervals, significant differences were also present in the length of the head to c7 (f=506.34, p=0.001) and the length of the head to t12 (f=353.08, p=0.001). in addition, significant differences in the length of the head to c7 (f=7.44, p=0.011) and the length of the head to t12 (f=7.02, p=0.013) present according to the main effects of the two on chair systems. after 2 hours of studying, there was a significant difference in the length of the head to c7 (t=4.804, p=0.001) and the length of the head to t12 (t=3.854, p=0.001) in ncds, but not in acds. there was also a statistically significant difference of the length of the head to c7 (t=12.182, p=0.001) and the length of the head to t12 (t=8.876, p=0.001) between ncds and acds, as measured before the experiment. finally, a significant difference was found in the length of the head to c7 (t=21.617, p=0.001) and the length of the head to t12 (t=33.552, p=0.001) between ncds and acds after 2 hours of studying (table 3table 3.length from the head to the 7th cervical vertebra and the head to the 12th thoracic vertebra in the sitting position of the ncds and acds before and after 2 hours of studyconditioninitial time mean (sd)after 2 hours of study mean (sd)main effectinteraction effectncdsacdsncdsacdstimechair systemlength from head to c725.5 (3.23)21.3 (2.73)27.4 (2.82)21.0 (1.88)0.0010.0110.001length from head to t1236.1 (6.14)24.3 (4.58)39.0 (4.30)26.9 (3.36)0.0010.0130.003p < 0.05 ; difference between time intervals : = initial value vs after 2 hours of study in ncds ; difference between groups : = ncds vs acds before studying, = ncds vs acds after 2 hours of study ; = main effect and interaction effect). p < 0.05 ; difference between time intervals : = initial value vs after 2 hours of study in ncds ; difference between groups : = ncds vs acds before studying, = ncds vs acds after 2 hours of study ; = main effect and interaction effect the sensation of fatigue consists of ocular symptoms, visual experience and physical fatigue factors, and the level of fatigue has been reported to have a close correlation with body coordination movements and the distance and angle of the gaze21. in addition, a significant change in the level of muscle activity was found in an analysis of the left and right trapezius muscles under different conditions of types of chair and work being done13. the characteristics of the trapezius muscle were observed while performing static contractions22, and the results indicate that the trapezius muscle plays a major role in fixing head movement during study or work performed using desks and chairs. the result can also be interpreted as showing that the trapezius muscle is used to maintain fixed posture because of movement of the head location, due to desk and chair design, which determine the direction of the gaze while in a sitting position. the trapezius muscle has increased activity when moving to lower the gaze than when a monitor and the corresponding gaze are in a horizontal line, despite the use of the arms in various tasks on the table23. the present study found a difference only in the mpf slope of the trapezius muscle after studying. this can be interpreted as a result of mostly using the right hand while studying, since the participants were all right - handed. long - term sitting while using a desk and chair increases the risk of pain in the cervical spine and the lumbar spine, and thus studies on the functions of various desks and chairs are ongoing24. the weight of the head segment is relatively heavy (about 8% of the body), but the muscles supporting that segment are not bigger than the other muscles. this situation can easily cause fatigue during maintenance of posture, and furthermore, can cause diseases such as spinal disk disease. therefore, the stability of the head segment is important, especially in a sitting posture which involves maintenance of posture for a long period, and the lower the level of the forward tilt of the head, the less the level of fatigue due to decreased fatigue of the muscles supporting the head25. in general, head movement is known to induce more instability than hip movement in terms of physical balance26. for students who spend many hours studying using a desk and a chair, the use of the acds, which can decrease the forward tilt of the head and trunk, would help to increase their studying capacity by reducing study - related fatigue. the authors also believe that it would also be effective at reducing the risk to the cervical spine of incurring spine distortions and diseases, while also decreasing head and physical pain. in a comparison of the head and neck postures and physical measurement characteristics of 985 australian youths, a group with head and neck pain had a forward head tilt that was 4.8 less than that of a group without pain, thus indicating a correlation between forward tilt of the head and pain of the head and neck11. it was also reported that a chair offering backward tilt was more comfortable a in a study of backrest angles for work comfort10, and a chair angle supporting a horizontal gaze showed13 was more vertical the angle of the lumbar spine, which determines the forward tilt of the trunk, this can be interpreted as facilitating decreased forward tilt of the trunk. having a horizontal gaze is more effective at maintaining relative comfort when studying for a long time using a desk and a chair. to obtain that goal although the forward tilt of the head of the ncds subjects increased in ncds after 120 minutes of studying in the present study, the acds subjects showed a relative decrease in the horizontal length change of the head to c7 and the head to t12 after 2 hour of study, and decreased forward tilt of the head and trunk was observed. korean students generally study for a long time while sitting on a chair with a horizontal desk. this posture eventually increases the forward tilt of the head, thus making the trapezius muscles continuously perform eccentric contractions to prevent forward tilt, causing increase in muscle fatigue and subsequent increase in the physical fatigue level. therefore, the acds used in this study appears to allow the maintenance of a more stable study posture by enabling a spinal curve through the use of an assistant chair to disperse the vertical pressure on the lumbar spine and by minimizing the head tilt to support a relatively horizontal gaze. this study revealed that when studying for a long time, the acds can reduce the level of fatigue compared to the conventional ncds, since it minimizes dislocation of the head from the central line of the body. | [purpose ] this study was designed to test the effects of the assistant chair - desk system (acds), which can reduce the forward tilt of the neck and trunk and the level of fatigue during long lasting study in the sitting position. [subjects ] fourteen middle school students and 14 college students of mixed gender participated in this study. [methods ] fatigue level, the trapezius muscle, and the forward tilt angle of the head and trunk as well as distance factors were assessed before after using a normal chair - desk system (ncds) and the acds for 120 minutes. [results ] there was an interaction effect in the angle and length of the neck from the sitting posture changes after 2 hours of studying using the ncds and acds. there were also significant differences in the fatigue levels, hip joint angles and the lengths from the head according to the main effects of the chair - systems. [conclusion ] the studying position while using the acds was determined to prevent significant fatigue levels of the muscle and body, provide support to the head, by limiting the forward movement of the neck, and prevent forward tilt of the neck and trunk, by enabling the target point and gaze to be closer to the horizontal direction. |
peroneus brevis tendinitis with its attritional longitudinal split rupture without any subluxation from peroneal groove and associated enlarged peroneal tubercle is un common presentation. a 40 year old female presented with moderate swelling and tenderness over the lateral and dorso - lateral aspect of left ankle with history of old trauma to ankle with swelling, persistant pain and difficulty in walking. on physical examination during passive eversion and inversion the excursion of the peroneal tendons was painful. most tender point was just posterior to the tip of the fibula. during surgery we found the intact superior peroneal ligament with both peroneal tendons placed at normal site without subluxation, tendon sheath was inflamed and swollen, on further dissection we could see the attrition of inner surface of the peroneus brevis and a 2 cm longitudinal split tear of the same. although rare but peroneus brevis tendon attrition and tear can occur without subluxation from peronal groove. refractory ankle pain on lateral aspect presenting with on and off swelling should arise suspicion of peroneal tendon tear. there are only a few reports of peroneal tendon tears with hypertrophied peroneal tubercle, which are thought to be uncommon 1. a longitudinal tear of the peroneal tendon is thought to be the result of repetitive peroneal subluxation. however, this report documents a case of longitudinal split of the peroneus brevis tendon that had no peroneal tendon subluxation. bassett reported peroneal tendon tears that did not result in instability of the ankle and there was no subluxation of the tendon when examined clinically. we report here one such uncommon case & technique of treatment for peroneus brevis tendon tear without subluxation of the tendons. a 40 year old female patient presented with pain and moderate amount of swelling over lateral aspect of ankle since 2 months. she had a past history of twisting injury to the ankle couple of months back. she took conservative treatment as taping and steroid injections for last 2 months to alleviate pain and swelling but they were ineffective. on physical examination diagnosis : histologically, specimen of hypertrophied soft tissue which surrounded the peroneal tendon & extra slip of peroneal tendon fibers examined microscopically reveal degeneration of the tendon fibers. t1 weighted mri image showing coronal section through ankle joint, marked edema and fluid collection is clearly evident surrounding peroneal tendons mri showed significant fluid collection along the peroneal tendon sheath, however split could not be appreciated over the mri. a classification of peroneus brevis tendon splits has been proposed by sobel, (table 1). grading scale for peroneus brevis splits : surgical technique : surgical treatment of peroneal tendinopathy is indicated after failure of conservative measures. a surgical exploration of the peroneal tendon was performed through the posterior longitudinal incision given behind the fibula. the superior peroneal retinaculum was noted to be uninjured, and there was no subluxation of the tendon. anatomical abnormalities such as peroneus quartus, low lying peroneus muscle belly, and abnormal shaped fibular groove were not noted. inflamed tendon sheath was excised, with excision of the longitudinal tear and attrited portion of tendon, remaining more than 50% thickness of the tendon was repaired in form of suture - tubulization of tendon with non - absorbable 4 - 0 nylon sutures. in this 4 - 0 nylon sutures were applied as inverted sutures so that there smallest size knot remains facing at outer surface of tendon instead of remaining towards the peroneal groove. this will help in gliding the tendon, well in groove as well knot of tendon will not interfere in any function of tendon. the excessive prominence of peroneal tubercle shaped to normal by undermining the base of tubercle, in this way anatomy near the tendon kept normal. post - operative protocol : short leg non - walking cast was given for 2 weeks. at the end of 2 weeks removable short leg walking boot for 4 weeks given and the dorsiflexion and planter flexion exercises were begun. at the end of 6 weeks inversion exercises and progressive weight bearing was started. at 8 weeks eversion exercises started and walking boot was removed. at 4 months patient resumed normal activities with no pain. t1 weighted mri image of sagittal section through ankle joint showing fluid collection in peroneal sheath at retrofibular region intra - operative picture of the inflamed peroneal sheath showing hypervascularity and marked synovial fluid collection, also both peronei tendons are normally situated in peroneal groove i.e. no subluxation found peroneus brevis tendon tears are not restricted to the elderly but can also occur in young population in conjunction with lateral ankle sprains. there are several causes of tendon attrition such as : incompetence of the superior peroneal retinaculum, subluxation of the peroneal tendon, and compression from the peroneus longus tendon lying posteriorly to the sharp posterior ridge of the fibula. however, bassett reported peroneal tendon tears in young athletes that occurred after their initial ankle sprains, and all these patients had stable ankles. uninjured superior peroneal retinaculum with no subluxation of the peroneal tendon was confirmed surgically in all cases. our technique of repairing the tendon is also one of the unique one as this did not interfere in healing of tendon. intra - operative picture of peroneus brevis tendon reverted to show inner surface which was found to be attrited and torn - out. peroneal tendon tears without tendon subluxation are uncommon, especially in young people and may be left undiagnosed. although rare but peroneus brevis tendon attrition and tear can occur without subluxation from peronal groove. lateral aspect refractory ankle pain presenting with on and off swelling should arise suspicion of peroneal tendon tear. correct diagnosis and proper surgical repair especially with inverted sutures which does interfere with healing of tendon in groove can produce excellent results. refractory pain at lateral aspect of ankle associated with on & off pain and swelling may be due to peroneal tendon tear. early diagnosis & surgical repair with grooving of back of fibula can lead to complete recovery. | introduction : peroneus brevis tendinitis with its attritional longitudinal split rupture without any subluxation from peroneal groove and associated enlarged peroneal tubercle is un common presentation.case report : a 40 year old female presented with moderate swelling and tenderness over the lateral and dorso - lateral aspect of left ankle with history of old trauma to ankle with swelling, persistant pain and difficulty in walking. on physical examination during passive eversion and inversion the excursion of the peroneal tendons was painful. most tender point was just posterior to the tip of the fibula. during surgery we found the intact superior peroneal ligament with both peroneal tendons placed at normal site without subluxation, tendon sheath was inflamed and swollen, on further dissection we could see the attrition of inner surface of the peroneus brevis and a 2 cm longitudinal split tear of the same.conclusion:although rare but peroneus brevis tendon attrition and tear can occur without subluxation from peronal groove. refractory ankle pain on lateral aspect presenting with on and off swelling should arise suspicion of peroneal tendon tear. correct diagnosis and proper surgical repair can produce excellent results. |
alzheimer 's disease (ad) and behavioral variant frontotemporal dementia (bvftd) are the leading causes of young onset dementia (ratnavalli., 2002 ; harvey., 2003) bvftd has a very heterogeneous presentation, but is mostly characterized by a marked, progressive decline in personality and/or behavior. symptoms such as loss of manners or decorum, impulsive actions, apathy and changing of eating behavior are common (rascovsky., 2011). furthermore, patients often show deficits in cognitive domains of executive functioning, attention and working memory (rabinovici., 2010 ; hornberger., 2008, 2012) ad is mainly characterized by episodic memory impairment in the initial phase but deficits in visuospatial abilities, executive functioning, language and attention are also common (nestor., 2004 ; smits., 2011). clinical diagnostic criteria for bvftd and ad have been proposed (rascovsky., 2011 ; mckhann., 2011), but the frequent overlap of clinical symptoms associated with ad and bvftd and heterogeneity within one syndrome pose serious problems in the differential diagnosis (greicius., 2002 ; miller., 2003 ; walker although the definite diagnosis of both types of dementia is only possible at autopsy, magnetic resonance imaging (mri), providing measurements of gray matter (gm) atrophy and white matter (wm) integrity, have been shown to detect brain changes in an early disease stage. studies on gm atrophy have shown precuneus, lateral parietal and occipital cortices to be more atrophic in ad than in bvftd, whereas atrophy of anterior cingulate, anterior insula, subcallosal gyrus, and caudate nucleus was more severe in bvftd compared to ad (rabinovici., 2007 ; du., 2007 ; looi., however, many scans differ from the predicted patterns of atrophy and overlap between ad and bvftd is common : gm loss in dorsolateral prefrontal cortex, medial temporal lobes, hippocampus and amygdala is found in both ad and bvftd and does not help to discriminate between the two disorders (rabinovici., 2007 ; munoz - ruiz., 2012 ; van de pol., 2006 ; barnes., 2006). moreover, especially in the beginning of the disease, cortical atrophy may not be visible by eyeballing. in addition to local gm damage, a decrease of fractional anisotropy (fa) in wm, suggesting wm tract damage has been shown, especially in bvftd. previous studies showed that compared to ad, wm integrity was lost in bvftd especially in the frontal and bilateral temporal regions (zhang. taking into account wm abnormalities holds promise to improve the distinction between ad and bvftd but only a few studies have been conducted so far (zhang., 2009 ; mahoney., 2014). moreover, it is conceivable that the combination of information from gm and wm may help in the discrimination between ad and bvftd. most former studies focused on either gm or wm damage however, while only a few investigated the extent to which the loss of wm integrity and gm atrophy are related and how they jointly contribute to the clinical classification of patients (mcmillan., 2012 ; mahoney., 2014 ; zhang., 2011). generalizability of these findings is limited as in one study patients from the whole ftld spectrum were compare to ad patients (mcmillan., 2012) and in other studies the different imaging modalities were only linked to each other but not used for diagnostic discrimination (mahoney., 2014 ; zhang., 2011). in this multi - center study we compared patterns of cortical and subcortical gm atrophy and of wm integrity between patients with bvftd, ad and controls with the ultimate goal to facilitate clinical diagnosis. in addition, we investigated the joint discriminative ability of gm atrophy and wm integrity measurement to distinguish both patient groups from controls and from each other. in this two center study, we included 39 patients with probable ad and 30 patients with bvftd, who visited either the alzheimer center of the vu university medical center (vumc) (probable ad : n = 23 ; probable bvftd : n = 16 ; possible bvftd : n = 4) or the alzheimer center of the erasmus university medical center rotterdam (probable ad : n = 16 ; probable bvftd : n = 9 ; possible bvftd : n = 1). all patients underwent a standardized 1-day assessment including medical history, medical history (dementia, psychiatry, cardiovascular) of first - degree relatives, informant - based history, physical and neurological examination, blood tests, neuropsychological assessment, and mri of the brain. diagnoses were made in a multidisciplinary consensus meeting according to the core clinical criteria of the national institute on aging and the alzheimer 's association work group for probable ad (mckhann. 2011) and according to the clinical diagnostic criteria of ftd for bvftd (rascovsky., 2011). to minimize center effects, in addition, we included 41 cognitively normal controls (vumc : n = 23 ; rotterdam : n = 18), who were recruited by advertisement in local newspapers. before inclusion in the present study, controls were screened for memory complaints, family history of dementia, drugs- or alcohol abuse, major psychiatric disorder, and neurological or cerebrovascular diseases. they underwent an assessment including medical history, physical examination, neuropsychological assessment, and mri of the brain comparable to the work - up of patients. inclusion criteria for both cohorts were : (1) availability of a t1-weighted 3-dimensional mri (3dt1) scan and a set of diffusion weighted imaging (dwi) images designed to allow calculation of the diffusion tensor at 3 t, and (2) age between 50 and 80 years. exclusion criteria were : (1) large image artifacts (n = 12) ; (2) failure of imaging analyzing software to process mr scans (n = 6) ; and (3) gross brain pathology other than atrophy, including severe white matter hyperintensities and/or lacunar infarction in deep gray matter structures. level of education was rated on a seven - point scale (verhage, 1964). the study was conducted in accordance with regional research regulations and conformed to the declaration of helsinki. all patients gave written informed consent for their clinical and biological data to be used for research purposes. to assess dementia severity we used the mini - mental state examination (mmse). cognitive functioning was assessed using a standardized neuropsychological test battery covering five major domains : memory (immediate recall, recognition and delayed recall of dutch version of the rey auditory verbal learning test and total score of visual association test a), language (visual association test picture naming and category fluency (animals : 1 min)), visuospatial functioning (subtest of visual object and space perception (vosp) battery : number location), attention (trail making test part a (tmt a), digit span forward, and letter digit substitution test (ldst)), and executive functioning (digit span backwards, trail making test part b (tmt b), letter fluency, and stroop color word test, card iii). for a detailed description of neuropsychological tests z - scores were calculated from the raw test scores by the formula z = (x) /, where is the mean and is the standard deviation of the subjective complaints group. the value z = 0 therefore reflects the average test performance of the subjective complaints group in a given domain. scores of tmt a, tmt b, and stroop were inverted by computing 1 next, composite z - scores were calculated for each cognitive domain by averaging z - scores. composite z - scores were calculated when at least one neuropsychological task was available in each cognitive domain. imaging at the vumc was carried out on a 3 t scanner (signa hdxt, ge healthcare, milwaukee, wi, usa), using an 8-channel head coil with foam padding to restrict head motion. patients and controls from the erasmus university medical center rotterdam were all scanned at the leiden university medical center (lumc). imaging at lumc was performed on a 3 t scanner (achieva, philips medical systems, best, the netherlands) using an 8-channel sense head coil. the scan protocol included a whole - brain near - isotropic 3dt1-weighted sequence for cortical and subcortical segmentation. at vumc this was a fast spoiled gradient echo sequence (fspgr ; repetition time tr 7.8 ms, echo time te 3 ms, inversion time ti 450 ms, flip angle 12, 180 sagittal slices, voxel size 0.98 0.98 1 mm, total scan time 4.57 min). at lumc this was a turbo field echo sequence (t1tfe ; tr 9.8 ms, te 4.6 ms, flip angle 8, 140 transversal slices, voxel size 0.88 0.88 1.2 mm, total scan time 4.57 min). dwi consisted of five volumes without directional weighting (i.e. b = 0 s / mm) and 30 volumes with noncollinear diffusion gradients (i.e. 30 directions, b = 1000 s / mm) and tr 13,000 ms, te 87.8 ms, 45 contiguous axial slices of 2.4 mm, voxel size = 22 2.4 mm, parallel imaging with factor 2, total scan time 7.8 min. at the lumc dwi consisted of 1 vol without directional weighting (i.e. b = 0 s / mm) and 60 volumes with noncollinear diffusion gradients (i.e. 60 directions, b = 1000 s / mm) and tr 8250 ms, te 80 ms, 70 axial slices, voxel size = 22 2 mm, parallel imaging with factor 2, total scan time 9 min. in addition, the mri protocol included a 3d fluid attenuated inversion recovery (flair) sequence, dual - echo t2-weighted sequence, and susceptibility weighted imaging (swi) which were reviewed for brain pathology other than atrophy by an experienced radiologist. dicom images of the 3dt1-weighted sequence were corrected for gradient nonlinearity distortions and converted to nifti format, after which the image origin was automatically placed approximately on the anterior commissure using a linear registration procedure. the structural 3dt1 images were then analyzed using the voxel - based morphometry toolbox (vbm8 ; version 435 ; university of jena, department of psychiatry) in statistical parametric mapping (spm8 ; functional imaging laboratory, university college london, london, uk) implemented in matlab 7.12 (mathworks, natick, ma). in the first module of the vbm8 toolbox (estimate and write) the 3dt1 images are normalized to mni space and segmented into gm, wm and cerebrospinal fluid (csf). we used the default settings, except for the clean - up, where we used the light clean - up option to remove any remaining non - brain tissue, as advised in the vbm8 tutorial. tissue classes were normalized in alignment with the template with the non - linear only option which allows comparing the absolute amount of tissue corrected for individual brain size. the correction is applied directly to the data, which makes a head - size correction to the statistical model redundant. subsequently, all segmentations were checked with the second and third module of the vbm8 toolbox (display one slice for all images and check sample homogeneity using covariance) and by a one - by - one visual check. in the fourth module, images were smoothed using an 8 mm full width at half maximum (fwhm) isotropic gaussian kernel. voxelwise statistical comparisons between groups were made to localize gm differences by means of a full factorial design with diagnosis (ad, bvftd, controls) as factor with independent levels with unequal variance, using absolute threshold masking with a threshold of 0.1 and implicit masking. post hoc, we compared ad with controls, bvftd with controls, and ad with bvftd. the threshold for significance in all vbm analyses was set to p controls, l23 roi ad > controls, l23 roi bvftd > controls, l23 roi bvftd > ad ; as well as sex, age, and center. in general, a discriminant analysis creates k-1 linear combinations (discriminant functions) of the entered predictor variables which provides the best discrimination between the groups (k). to identify the most optimal combination of variables for best discrimination, stepwise forward analysis was used with a decision scheme based on the f - value of wilk 's lambda (entry : 3.84 ; removal : 2.71). demographic and cognitive data for all patients (ad : n = 32 ; bvftd : n = 24) and controls (n = 37) fulfilling inclusion criteria are summarized in table 1. ad patients were older than controls (p controls ; (4) l1 roi bvftd > controls ; and (5) l1 roi bvftd > ad. the two resulting discriminant functions had a wilk 's lambda of 0.134 (p 0.001) and 0.437 (p 0.001). 5b shows the projection plot of the two canonical discriminant functions for discrimination of the three groups. gm roi ad controls, gm roi ad controls. cross - validation successfully classified 86% of all cases correctly, with correct classification of 97.3% of controls, 81.3% of ad patients, and 75% of bvftd patients. the main finding of this study is that there are gm and clear wm differences between ad and bvftd which both independently contributed to the classification of both types of dementia. despite a comparable disease stage, bvftd patients had more atrophy in orbitofrontal and inferior frontal areas, caudate nucleus and nucleus accumbens than ad patients. furthermore, they had more severe loss of fa, higher md, l1 and l23 values, especially in the frontal areas. combination of modalities led to 8691.4% correct classification of patients. gm contributed most to distinguishing ad patients from controls and bvftd patients, while wm integrity measurements, especially l1, contributed to distinguish bvftd from controls and ad. a large number of studies investigated the differences between controls and ad or bvftd patients with regard to either gm or wm pathology. their results are in line with the current study showing gm atrophy of medial temporal lobe structures and temporoparietal lobes in ad (whitwell. 2002) and atrophy of orbitofrontal, anterior cingulate, insula, lateral temporal cortices, and caudate nucleus in bvftd (rabinovici and miller, 2010 ; hornberger., 2011 ; couto., 2013 ; looi., dti studies on ad reported a rather consistent pattern of fa reductions in widely distributed wm tracts exceeding mtl regions (scola. 2010). in patients with bvftd significant fa reductions in the superior and inferior longitudinal fasciculus, as well as additional fa decreases in the uncinate fasciculus and the genu of the corpus callosum have been reported (borroni., 2007 ; matsuo., 2008). to determine whether gm atrophy or wm integrity have potential diagnostic use, a direct comparison between ad and bvftd is more important than the comparison with a control group. with respect to gm atrophy, precuneus, lateral parietal and occipital cortices have been shown to be more atrophic in ad than in bvftd, whereas atrophy of anterior cingulate, anterior insula, subcallosal gyrus, and caudate nucleus are more atrophic in bvftd compared to ad (rabinovici., 2007 ; du., we did not find any areas which are more atrophic in ad compared to bvftd. this could be explained by the strict fwe - corrected vbm approach, as we found less gm in posterior brain regions in ad patients when not applying the multiple comparisons correction. these results are in line with another study not applying multiple comparisons correction (rabinovici., 2007). another explanation that we did not find any gm reductions in ad could be that our patients are included in an early disease stage, with relatively higher mmse scores compared to another study (du., 2007). nevertheless, patterns of gm atrophy often overlap, as there are numerous regions of gm loss which are found in both ad and bvftd (rabinovici., 2007 ; munoz - ruiz., 2012 ; van de pol., 2006 ; barnes., 2006). the few existing dti studies demonstrated wm alterations in ftd compared to ad, including more widespread fa reductions in the frontal, anterior temporal, anterior corpus callosum, inferior fronto - occipital fasciculus and bilateral anterior cingulum (zhang., 2009, 2011 ; hornberger., 2011 ; avants., 2010 ; mcmillan., 2012). one of these studies also investigated the md, l1 and l23 differences between ftd and ad and found increased l1 and l23 values in ftd compared to ad (zhang., 2009). our study is in line with these previous studies, failing to observe reduced fa and increased md, l1 and/or l23 in ad relative to bvftd. the same is seen in the dgm structures, where bvftd patients have more subcortical brain damage compared to ad patients but not the other way around (looi., 2008, 2009 ; halabi., the combination of different imaging analysis methods suggests that the non - cortical parts of the brain play an important role in bvftd. networks in bvftd, consisting of white matter and deep gray matter structures, may be different compared to the cortical networks in ad. indeed, studies of functional connectivity show more functional network connectivity in ftd compared to controls and ad (filippi., 2013 ; zhou., 2010). we attempted to combine gm and wm measures to increase the discrimination of patient groups and showed that next to gm atrophy, wm integrity measures helped in distinguishing ad from bvftd. a few earlier studies have combined wm and gm information with the objective to better discriminate between ad and bvftd. they found that ftd patients exhibited more wm damage than ad patients in an early stage of the disease suggesting that measuring of wm damage add up in the discrimination between these two dementias (zhang. another study only linked the two imaging modalities and support the idea of a network disease in ftd but did not examine diagnostic value of gm and wm (avants., 2010). only two studies actually used a multimodal combination of wm and gm. in one study they achieved a classification with 87% sensitivity and 83% specificity between ad and bvftd (mcmillan., 2012). in another study they developed a new metric which gives a measure of the amount of wm connectivity disruption for a gm region and showed classification rates were 813% higher when adding wm measurements to gm measurements (kuceyeski., 2012). the novelty of the study lies in the combination of three measures to separate ad from bvftd. we combined vbm based measures of cortical atrophy, first based measures of atrophy of dgm structures and dti based measures of wm integrity to yield an optimal classifier. both discriminant analyses revealed that cortical gm contributed to the separation of ad from the other two groups and wm integrity measurements contributed to the discrimination of bvftd from the other groups. this could be explained by the notion that, despite some involvement of dgm and wm, ad is assumed to be a cortical dementia with specific gm regions being affected whereas bvftd predominantly affect areas (frontal - insula - anterior cingulate) which are part of structurally and functionally connected neural networks. these networks are connected by specific wm tracts located within damaged gm areas as the frontal lobes and are preferentially affected, contributing to network failure in bvftd. the finding of more severe damage of dgm structures add up to the hypotheses of bvftd being a network disorder as dgm structures can be seen as relay stations in the fronto - striatal brain networks. these findings are further supported by the fact that bvftd had the same disease stage (comparable mmse, cdr, duration of symptoms) as ad patients but have more wm and dgm structure damage. a possible limitation of this study is that we did not have post - mortem data available, so the possibility of misdiagnosis can not be excluded. nevertheless, we used an extensive standardized work - up and all ad patients fulfilled clinical criteria of probable ad, 19 patients fulfilled the criteria for probable bvftd and 5 patients for possible bvftd. all diagnoses were re - evaluated in a panel including clinicians from both centers to minimize sample effects. because this is a multicenter study, the differences in data acquisition parameters between the two centers might introduce some noise in the dti analysis. however, we adjusted for center in all models and moreover, a recent study showed that when considering scanner effects in the statistical model, no relevant differences between scanners were found (teipel., 2012). to be confident that the different scanners did not essentially influence the results, we repeated the tbss analyses for a subtest of all subjects of vumc only and results remained essentially unchanged. we corrected for age in all analyses and repeated the vbm, first and tbss analyses in an age matched subgroup which did not change the results essentially. among the strengths of this study is the sample size and its multi - center nature. we had enough power to detect differences using fwe and fwe - tfce correction to adjust for multiple comparisons. another strength is the unique combination of three imaging parameters in this study to achieve optimal discrimination between ad and bvftd. accurate diagnosis of patients in life is increasingly important, both on clinical and scientific grounds. therefore, there is an urgent need to improve diagnostic accuracy in a quantitative manner. this study has shown that dti measures add complementary information to measures of cortical and subcortical atrophy, thereby allowing a more precise diagnosis between ad and bvftd. if acquisition, preprocessing and analyses methods are easier to implement in the daily clinical routine, dti could be incorporated in the standard dementia mri protocol in the future. | we investigated the ability of cortical and subcortical gray matter (gm) atrophy in combination with white matter (wm) integrity to distinguish behavioral variant frontotemporal dementia (bvftd) from alzheimer 's disease (ad) and from controls using voxel - based morphometry, subcortical structure segmentation, and tract - based spatial statistics. to determine which combination of mr markers differentiated the three groups with the highest accuracy, we conducted discriminant function analyses. adjusted for age, sex and center, both types of dementia had more gm atrophy, lower fractional anisotropy (fa) and higher mean (md), axial (l1) and radial diffusivity (l23) values than controls. bvftd patients had more gm atrophy in orbitofrontal and inferior frontal areas than ad patients. in addition, caudate nucleus and nucleus accumbens were smaller in bvftd than in ad. fa values were lower ; md, l1 and l23 values were higher, especially in frontal areas of the brain for bvftd compared to ad patients. the combination of cortical gm, hippocampal volume and wm integrity measurements, classified 97100% of controls, 81100% of ad and 6775% of bvftd patients correctly. our results suggest that wm integrity measures add complementary information to measures of gm atrophy, thereby improving the classification between ad and bvftd. |
celiac disease is a chronic autoimmune disorder of the small intestine with a morbidity that has increased rapidly over the past 30 to 40 years. according to a recent study, the prevalence of this disease is ~1% in europe and usa, but it has not yet been reported in korea. in the disease process, genetically susceptible individuals are exposed to prolamins following the ingestion of certain grains, such as wheat, barley, and rye. this triggers autoimmune responses in the intestinal mucosa, resulting in chronic inflammation and villous atrophy in the small intestine. the main genetic factors include the hla - dq2 and dq8 gene loci of human leukocyte antigen (hla) class ii genes. indeed, ~90% of patients with celiac disease carry hla - dq2 heterodimers (" dq2.5 "), encoded by the hla - dqa105 and hla - dqb102 alleles. the remaining patients (~5% to 10%), who are dq2.5-negative, nearly all carry hla - dq8 heterodimers (" dq8 "), encoded by the hla - dqb103:02 allele, generally in combination with the hla - dqa103 variant. a 47-year - old woman complained of persistent chronic diarrhea and weight loss over the previous 9 months. the patient was diagnosed with celiac disease and was found to be genetically predisposed, due to hla - dq2.5, and had coexisting graves ' disease. to our knowledge, this is only the second reported case of celiac disease coexisting with graves ' disease diagnosed in asia and the first case in korea. here, a 47-year - old woman was referred to our hospital due to watery diarrhea with weight loss. the patient had up to 20 episodes of watery diarrhea daily and a 15-kg weight loss over the previous 9 months. thyroid function tests showed increased levels of triiodothyronine (221 ng / dl ; normal range, 80 to 200 ng / dl) and free thyroxine (ft4 ; 3.51 ng / dl ; normal range, 0.77 to 1.94 ng / dl) and decreased levels of thyroid stimulating hormone (tsh ; 0.05 iu / ml ; normal range, 0.30 to 4.00 iu / ml). additionally, a thyroid autoantibody test showed increased levels of anti - thyroid peroxidase antibody (2,162 iu / ml ; normal range, 0 to 8 iu / ml), anti - thyroglobulin antibody (166.4 iu / ml ; normal range, 0 to 60 iu / ml), and tsh - binding inhibitory immunoglobulin (27.7% ; normal range, 0% to 10%). after 6 months of treatment, thyroid function tests showed normal levels of ft4 (1.3 ng / dl) and tsh (0.37 iu / ml), but the patient still complained of persistent watery diarrhea and abdominal distension. a weight gain of 6 kg had been achieved in the 2 weeks following the initiation of treatment, but no further weight recovery was achieved. physical examination showed the patient had a height of 161 cm, weight of 60 kg, blood pressure of 124/67 mm hg, pulse of 87 beats per minute, respiratory rate of 18 breaths per minute, and body temperature of 36.3. the patient had no abdominal pain, tenderness, or edema. white blood cells (wbcs ; 8,250/l ; normal range, 4,000 to 10,000/l), hemoglobin (13.3 g / dl ; normal range, 12 to 16 g / dl), platelet count (279,000/l ; normal range, 150,000 to 350,000/l), sodium (139 mmol / l ; normal range, 135 to 145 mmol / l), potassium (3.6 mmol / l ; normal range, 3.5 to 5.0 mmol / l), total protein (6.6 g / dl ; normal range, 5.8 to 8.0 g / dl), albumin (4.1 g / dl ; normal range, 3.1 to 5.2 g / dl), cholesterol (126 mg / dl ; normal range, < 200 mg / dl), alkaline phosphatase (62 iu / l), and alanine transaminase (22 iu / l ; normal range, < 40 no wbcs were observed in the stool examination, and no bacterial growth was identified in the stool culture. in addition, the patient showed negative results for detection of the antihuman immunodeficiency virus antibody and antinuclear antibody testing. abdominal computed tomography scan showed no ascites or enlarged lymph nodes, and no edema or masses were observed in the small intestine (fig. a duodenal bulb biopsy showed no significant villous atrophy, but a slight increase in intraepithelial lymphocytes was seen (fig. 3). based on the medical history of graves ' disease, persistent chronic diarrhea with weight loss, and increased intraepithelial lymphocytes of the patient, she was suspected to have celiac disease. accordingly, the patient was placed on a gluten - free diet and subjected to serological and genetic tests. as a result of hla typing, hla - dqa103 and 05 and hla - dqb102:01 and thus, the patient had an hla - dq2 heterodimer (" dq2.5 ") comprising hla - dqb102:01 and hla dqa105. megiorni and pizzuti reported that dq2.5 is a high - risk factor for celiac disease. serological analysis showed that the patient did not have immunoglobulin a (iga) anti - tissue transglutaminase (anti - ttg) or iga endomysial antibodies. diarrhea was reduced from 20 times to 0 to 1 time per day starting from the second day of the gluten - free diet. at 4 weeks after initiating the gluten - free diet, the patient 's weight had increased by 8 kg, reaching 68 kg, and her clinical symptoms had also improved. during a 6-month follow - up, diarrhea recurred only twice after consuming noodles containing gluten. the patient is currently maintaining a gluten - free diet. although serologic testing was negative, the patient was finally diagnosed with celiac disease after identifying the hla - dq2.5 genotype and the diagnosis of graves ' disease. indications considered in the diagnosis of celiac disease occur in three tiers : first, typical symptoms, such as chronic diarrhea, malabsorption, weight loss, and abdominal distension ; second, unexplained iron deficiency anemia, folate, or vitamin b12 deficiency, elevation of serum aminotransferase, delayed puberty, decreased reproductive function, aphthous ulcers, peripheral neuropathy, recurrent migraine, and cerebellar ataxia ; and third, membership of a patient group with a high risk of celiac disease. such high - risk groups include those with type 1 diabetes, other autoimmune diseases, familial history of celiac disease, turner syndrome, down syndrome, or williams syndrome. in this case, celiac disease was suspected because the patient showed typical symptoms and had a previously diagnosed autoimmune disease. all examinations to diagnose celiac disease should be conducted while patients are following a gluten - containing diet. furthermore, celiac disease can not be diagnosed via a single examination. for the diagnosis of celiac disease, symptoms such as diarrhea and malabsorption, serological findings of anti - ttg and iga endomysial antibodies, villous atrophy of the small intestine on duodenal biopsy, elevation of intraepithelial lymphocytes, hla typing, and clinical improvement after beginning a gluten - free diet classified the risk gradient of celiac disease according to hla - dq typing, in that patients with dq2.5 or dq8 were considered to be a very high - risk group. in this case, a middle - aged female patient with previous complaints of chronic diarrhea was diagnosed initially with graves ' disease. finally, she was diagnosed with celiac disease and the hla - dq2.5 genetic predisposition in addition to graves ' disease. the diagnosis of celiac disease was based on increased intraepithelial lymphocytes, dq2.5 positivity, and the response to a gluten - free diet. based on recent studies and reviews, even though celiac disease originally was considered a rare malabsorption syndrome of childhood, affecting mainly caucasians, it is now recognized as a more common condition that may affect many races and ethnic groups at almost any stage of life. green and cellier reported the mean age at diagnosis was 46.41.0 years (range, 16 to 82). also, its clinical presentation varies widely, ranging from classical gastrointestinal manifestations to only atypical signs. many cases remain undiagnosed or are not diagnosed until later because of the wide variability in symptoms. in our case, the severe gastrointestinal symptoms of celiac disease presented in late adulthood and were accompanied by graves ' disease, even if there might have been a prior latent period. the diagnosis of celiac disease was delayed for 14 months because of the coexistence with graves ' disease and a lack of suspicion due to the low incidence of celiac disease in koreans. a case of celiac disease coexisting with graves ' disease is rare in asia. to our knowledge, this is only the second reported case in asia and the first in korea. a case of combined primary hyperparathyroidism, graves ' disease, and celiac disease was reported previously in lebanon. there was only one previous domestic case report of celiac disease, but with no coexisting autoimmune diseases. a few cases in europe and canada include adult patients with graves ' disease diagnosed with celiac disease due to chronic diarrhea, malabsorption, or bone deformities. the case presented here differed from these other cases in that two autoimmune diseases were diagnosed in a patient who had no previous disease history and who was positive for dq2.5 by hla typing. although the patient belonged to a very high - risk group for celiac disease, due to typical symptoms and dq2.5 positivity, serological tests were negative, despite their high sensitivity and specificity. the reason for the negative serological tests is likely attributable to the timing of the serological tests, which were conducted after the gluten - free diet was initiated ; however, all examinations should be conducted while a patient is eating a gluten - containing diet. in such a case if the result of a duodenal biopsy is positive after consuming 3 g gluten daily for 2 weeks, or if the result of a serological test is positive after a 6 week gluten - containing diet, the patient is diagnosed with celiac disease. in this case, however, a gluten tolerance test was not conducted because of the pain caused by the symptoms and economic reasons. according to a recent study, hla genotyping is a useful diagnostic method for celiac disease in patients treated with a gluten - free diet without a confirmatory diagnosis. in conclusion, celiac disease was diagnosed clinically in a patient with hla - dq2.5 and graves ' disease. this is the first case of celiac disease coexisting with graves ' disease reported in korea. further, this case is meaningful in that hla genotyping showed dq2.5 positivity, a high - risk factor for celiac disease. however, due to changes in dietary patterns and the development of better diagnostic methods, the prevalence of celiac disease is expected to increase in asian patients with prior autoimmune diseases. | celiac disease is an intestinal autoimmune disorder, triggered by ingestion of a gluten - containing diet in genetically susceptible individuals. the genetic predisposition is related to human leukocyte antigen (hla) class ii genes, especially hla - dq2-positive patients. the prevalence of celiac disease has been estimated to be ~1% in europe and the usa, but it is rarer and/or underdiagnosed in asia. we report a case of celiac disease in a predisposed patient, with a hla - dq2 heterodimer, and graves ' disease that was treated successfully with a gluten - free diet. a 47-year - old woman complained of persistent chronic diarrhea and weight loss over a 9 month period. results of all serological tests and stool exams were negative. however, the patient was found to carry the hla dq2 heterodimer. symptoms improved after a gluten - free diet was initiated. the patient has been followed and has suffered no recurrence of symptoms while on the gluten - free diet. an overall diagnosis of celiac disease was made in a genetically predisposed patient (hla - dq2 heterodimer) with graves ' disease. |
posterior reversible encephalopathy syndrome (pres) is a neurological syndrome defined by clinical and radiological features. the typical pattern includes headache, confusion, visual symptoms, and seizures, with magnetic resonance (mr) findings consistent with vasogenic edema predominantly localized to the posterior cerebral hemispheres. patients in all age groups appear susceptible, but the real incidence of this condition is not known. pres most often occurs in the setting of hypertensive crisis, preeclampsia, or with cytotoxic immunosuppressive therapy, however many other clinical settings are reported (table 1). in pediatric population it is mostly described in association with hematological or renal disorders. the pathophysiology is not completely understood but it appears to be related to disordered cerebral autoregulation and endothelial dysfunction. pres is usually benign, being fully reversible in many cases within 2 weeks after removal of the inciting factor and control of the blood pressure. however, a small number of patients could experiment refractory intracranial hypertension, leading to residual neurological deficits or even decease. a 15 years - old egyptian boy was admitted to the emergency department of our hospital because of accidental abdominal trauma while playing. he arrived at the hospital complaining of abdominal pain ; he was fully awake, without cardiovascular nor respiratory impairment. contrast enhanced computerized tomography (ct) scan of the abdomen demonstrated pancreatic injury with edema of the pancreatic head and uncinate process. because of the high suspicion of perforation, he underwent an exploratory laparotomy that was negative for visceral lesions. after the surgery, the patient was extubated and admitted to our intensive care unit. during the following week he was hyperthermic (figure 1, panel b) and developed severe abdominal pain, partially controlled with epidural infusion of ropivacaine and sufentanil, and intravenous (iv) administration of paracetamol, nonsteroidal antiinflammatory drugs and opiates. he was agitated despite the amount of analgesia : so an iv infusion with propofol was started. his blood pressure was basically high (figure 1, panel a), with peak values around 150/80 mm hg. on day 9 after admission he underwent a second exploratory laparotomy, demonstrating extended bowel ischemia. he was treated with a small bowel resection and the placement of a vacuum assisted closure system that was removed after 12 days and multiple surgical revisions. time - line of mean arterial pressure (panel a), body temperature (panel b), and white cells count and procalcitonin (panel c) during the stay in intensive care unit. the dotted gray line highlights day 29, when the brain ct was performed and the diagnosis of pres was made. wc, white cells count ; pct, procalcitonin. after the surgical intervention he was mostly hyperthermic (figure 1, panel b). procalcitonin increased, reaching a peak of 19 ng / ml on day 11 (figure 1, panel c). after the isolation of extended - spectrum beta - lactamase producing e. coli in the abdominal fluid, the antimicrobial therapy was shifted to meropenem and amikacin. the ct scan of the abdomen performed on day 13 showed a diffuse peritonitis and the evolution of the pancreatitis with formation of a pancreatic pseudocyst. sedation and analgesia were difficult to manage, due to a persistent status of agitation and pain, unresponsive to epidural analgesia. he was kept intubated under iv infusion of propofol, midazolam, morphine and ketamine, and inhalatory anesthesia with sevorane was also used for 5 days. despite the significant amount of sedative drugs his blood pressure was normal tending to hypertension (figure 1, panel a). after the surgical closure of the abdominal wall on day 21, his clinical conditions seemed to improve : procalcitonin dropped to values less than 1 ng / ml, and the amount of antipyretic drugs required to control his body temperature was progressively lowering. on day 25, sedation was reduced and he was extubated. he was awake for a few days but his blood pressure rose to value of 160/90 mm hg. his body temperature rose as well, without any new microbiological isolation or procalcitonin increase. few days later, on day 29, his neurological status dramatically worsened with stupor and neck rigidity ; he was therefore intubated. head ct scan showed bilateral cortical and subcortical hypodense lesions in both occipital and parietal lobes and bilateral frontal lobe white matter hypodense lesions. a lumbar puncture was performed, demonstrating no signs of infection of the central nervous system. the radiological findings, together with the absence of signs of meningoencephalitis, raised the suspicion of pres. brain mr confirmed the diagnosis, while excluded the presence of venous thrombosis (figure 2). furthermore he underwent a ct scan of the abdomen that showed an enlargement of the pancreatic pseudocyst, compressing the stomach and the duodenum. panels a d : at the time of diagnosis, axial flair images demonstrated multiple, bilateral areas of hyperintensity and edema in cerebellar hemispheres and temporo - parieto - occipital lobes with cortico - subcortical distribution and predominant white matter involvement. panels e h : 50 days later, axial flair images demonstrated complete regression of edema and signal alteration in both cerebellar and cerebral hemispheric white matter. mr showed marked improvement with only small foci of cortical hyperintensity and thinning in parietal parasagittal regions (panel h, black arrow). sedative drugs were continued for 5 days with good control of the arterial pressure values. his neurological status improved and on day 35 he was extubated. he was alert and calm, and his blood pressure was corrected with transdermal clonidine. fifty days later he was discharged at home in good general conditions, after a brain mr demonstrating complete resolution of the lesions (figure 2). pres is a clinical syndrome consisting of acute neurological symptoms usually including seizures, headache, visual disturbance, mental status alterations, and paralysis. at ct / mr imaging, the brain typically demonstrates focal regions of symmetric hemispheric edema. in a recent study of 96 pres patients by liman, edematous lesions, although detectable within the entire brain, involved the occipital and parietal lobes in the majority of cases. frontal and temporal lobes were affected in about 50% of cases, the basal ganglia in about one - fourth of cases, the thalamus in about one - fifth of cases. in more than half of cases this has been classically attributed to severe rise in blood pressure, but it is now evident that direct endothelial damage, seen in immunosuppressant drugs use, autoimmune diseases, or eclampsia, can be the leading cause of this condition. the role of hypertension in the onset of this syndrome is supported by the evidence that acute hypertension frequently accompanies pres. abrupt blood pressure rise, exceeding the threshold of cerebral blood flow autoregulation, can lead to hyperperfusion and blood brain barrier disruption, inducing leakage of plasma and macromolecules in the interstitium. however, pres is commonly seen even without hypertension or with only minor increase of blood pressure. this observation promotes the hypothesis that hypertension would be a consequence and not the trigger in pres pathogenesis. endothelial activation and dysfunction would play a crucial role, representing the common pathway shared by all clinical conditions associated with pres onset. the cytotoxic effects of immunosuppressive therapy on the vascular endothelium could explain the relationship between immunosuppressive drugs and pres. endothelial activation and injury is a crucial step in the progression of the septic response secondary to an infective event, and could explain the association of pres with infection and sepsis. in our case, the clinical onset of pres was characterized by a deterioration of the neurological status without the presence of seizures, a symptom described in 60% to 75% of patients with pres and in 9 of 10 cases from a pediatric intensive care unit. furthermore, in the pediatric population, pres is mostly described in association with hematological diseases, neoplasms, or renal diseases, making our case an unusual clinical scenario. the neuroimaging has been the pivotal element for the diagnosis, showing bilateral hypodense lesions in both occipital and parietal lobes, consistent with literature findings. other rare diseases have a similar radiological pattern, in particular acute disseminated encephalomyelitis (adem). however, the lack of a viral infection preceding the neurologic deterioration and the absence of pathological findings in the liquor make the diagnosis of adem unlikely. before the onset of pres, our patient was mostly hypertensive although without exceeding the values typically associated with loss of cerebral autoregulation. however, his blood pressure values were similar to those reported in a pediatric population of patient with pres and are consistent with the endothelial pathophysiological hypothesis. moreover the patient presented a status of sepsis with hyperthermia, high pct levels and leukocytosis and isolation of e. coli in the abdominal fluid and this could represent a trigger for the onset of pres. interestingly a few cases of pres in the setting of acute pancreatitis with or without other possible triggers for pres (alcohol withdrawal, systemic lupus erythematosus, acute intermittent porphyria) have been reported. in acute pancreatitis there is a local and systemic activation of inflammatory pathways that could play a major role in the development of extra pancreatic complications. experimental models of pancreatitis have suggested that the proinflammatory cytokines, produced during pancreatitis, may have a pivotal role in vasogenic brain edema formation, a pathogenic mechanism similar to pres. the development of brain edema has also been implicated in the pathogenesis of pancreatic encephalopathy, an uncommon complication of acute pancreatitis. there is no specific treatment for pres, but the disorder is usually reversible once the precipitating cause is eliminated or treated. general consensus among clinicians suggests that treatment of hypertension is important, although no studies have been done to measure the effect of hypertension control on the resolution of pres. patients with pres have been treated with dexamethasone, but, because of its associated risk of hypertension, fluid overload, and electrolyte disturbance, this is not a recommended therapy. in our case given the unusual association between pres and pancreatitis and the lack of the most typical symptoms seen in this case, we would like to stress the importance of considering pres in the differential diagnosis of neurological deterioration in children with mild hypertension and/or other potential triggering factors like sepsis. we reported a case of pres in a 15 years old boy admitted to our intensive care unit for abdominal trauma with acute pancreatitis. the clinical presentation was a sudden deterioration of the neurological status and the brain ct and mr showed the presence of typical pres lesions. hypertension, the septic state of the patient and the intense proinflammatory response triggered by the pancreatitis could represent the culprits of pres developing. even if there is no specific treatment for this condition, a diagnosis is mandatory to start antihypertensive and supportive treatment. we are therefore suggesting to consider pres in the differential diagnosis of a neurological deterioration preceded by hypertension and/or septic state, even without other | abstractwe are reporting a case of posterior reversible encephalopathy syndrome (pres) developed in an unusual clinical scenario without the presence of the most described symptoms. pres is a neurological and radiological syndrome described in many different clinical conditions. in children it has been mostly reported in association with hematological and renal disorders.our patient was a 15 years old boy, admitted to our intensive care unit for pancreatitis after blunt abdominal trauma.during the stay in the intensive care unit, he underwent multiple abdominal surgical interventions for pancreatitis complications. he had a difficult management of analgesia and sedation, being often agitated with high arterial pressure, and he developed a bacterial peritonitis. after 29 days his neurological conditions abruptly worsened with neuroimaging findings consistent with pres. his clinical conditions progressively improved after sedation and arterial pressure control.he was discharged at home with complete resolution of the neurological and imaging signs 2 months later.the pathophysiology of pres is controversial and involves disordered autoregulation ascribable to hypertension and endothelial dysfunction. in this case both hypertension and endothelial activation, triggered by sepsis and pancreatitis, could represent the culprits of pres onset. even if there is no specific treatment for this condition, a diagnosis is mandatory to start antihypertensive and supportive treatment. we are therefore suggesting to consider pres in the differential diagnosis of a neurological deterioration preceded by hypertension and/or septic state, even without other typical clinical features. |
a 61 year old man presented to our institution with a diagnosis of stage t3a prostate cancer. his serum prostate - specific antigen level was 5.3 ng / ml, and a transrectal biopsy demonstrated a gleason score of 3 + 4=7 in 20% to 80% of the cores from both lobes. a combination of suture ligation, bipolar cautery, harmonic scalpel, and holc were successfully used at various stages of the procedure to help achieve hemostasis and for ligation of the vas deferens. holc were used specifically for control of the lateral pedicle of the prostate during ralrp. we did not use holc at the bladder neck or the site of vesicourethral anastomosis. the vesicourethral anastomosis was achieved by using a single intracorporeal knot running 2 - 0 monocryl suture. also, the patient did not undergo wide dissection of the bladder neck during ralrp. pathology showed a gleason score of 3 + 4=7 with extracapsular extension, but negative lymph nodes, negative margins, no seminal vesicle invasion, and no angiolymphatic invasion. three months after surgery, he complained of dysuria and decreased force of the urine stream. he underwent retrograde cystourethrography in the office, which revealed a bladder neck contracture on the urethra (fig. the cystourethroscopy demonstrated a normal - looking urinary sphincter but a very tight bladder neck. the bladder neck was successfully dilated, and visualization of the bladder revealed the presence of four holc. the four holc were floating in the bladder without stone formation and had migrated from the previous ralrp (fig., an indwelling urethral catheter was left for 7 days. at the 3 month follow - up after this dilatation, the patient was satisfied with his voiding habits and reported having a good urinary stream. with the recent surge in minimally invasive surgery (robotic and laparoscopic assisted surgery), interest in hemostatic alternatives to suturing has increased. several automated suturing devices including endostitch (autosuture, ussc, norwalk, ct, usa), lapraty clips (ethicon, endosurgery inc, piscataway, nj, usa), and holc have been used during laparoscopic procedures. among them, holc are a commonly used device and have been shown to be safe and reliable for vascular control in laparoscopic procedures. during ralrp, holc have been used for ligation of the vasa deferentia, seminal vesicle arteries, and prostatic pedicles to prevent excessive electrocautery and possible injury to the neurovascular bundles. however, several limitations, in addition to the concern for clip migration, have become apparent. blumenthal. reported the first case of migration of holc into the vesicourethral anastomosis after ralrp. there have been some reports of intravesical migration of these clips causing urethral erosion, bladder neck contractures, and subsequent calculus formation [2 - 6 ]. in all those cases, however, holc lodged in the bladder neck area with stone formation. in our case, the holc were floating in the bladder without stone formation. of a case in which a metal clip had migrated into the urinary bladder after retropubic radical prostatectomy. it was hypothesized that inflammation had arisen around the urinary bladder or vesicourethral anastomosis and that this also involved the metal clip, which then eroded the bladder wall and eventually migrated into the bladder. also, in our case, the mechanism of migration of holc in the bladder is unclear. according to the hypothesis described above, we can suspect that the holc migrated into the bladder during the serial course. on the basis of these findings, we recommend minimizing the use of holc on tissue immediately adjacent to the anastomosis during ralrp, specifically, the vasa and seminal vesicles, and every effort should be made to retrieve any loose clips after the procedure. these clips are prone to migration and may cause, or significantly contribute to, bladder neck contracture formation after ralrp. migration of holc into the vesicourethral anastomosis should be considered in patients with symptoms consistent with bladder neck contracture after ralrp. in addition, in these cases, noncontrast computed tomography scan might be helpful to detect clips. | hem - o - lok clips (weck surgical instruments, teleflex medical, durham, nc, usa) are widely used in robot - assisted laparoscopic radical prostatectomy because of their easy application and secure clamping. to date, there have been some reports of intravesical migration of these clips causing urethral erosion, bladder neck contractures, and subsequent calculus formation. we report the first case of bladder migration of hem - o - lok clips without stone formation after robot - assisted laparoscopic radical prostatectomy. the hem - o - lok clips were found during urethral dilation with a guide wire for bladder neck contracture under cystourethroscopy. the hem - o - lok clips were floating in the bladder without stone formation and were removed by a cystoscopic procedure. |
the study was approved by the local ethics committee and the reported investigations were carried out in accordance with the principles of the declaration of helsinki as revised in 2000. a total of 41 unrelated, first - degree relatives (fdrs) of type 2 diabetic patients were enrolled at the hospital policlinico tor vergata. inclusion criteria were the eldest offspring in each family with only one parent affected by type 2 diabetes, absence of diabetes (fasting plasma glucose < 7.0 mmol / l and/or 2-h post oral glucose tolerance test < 11.1 mmol / l), and absence of diseases able to modify glucose metabolism. on the first day, after 12 h of fasting, fdrs underwent anthropometrical evaluation, including bmi and waist circumference, measurements of clinic blood pressure after 5 min of quiet rest, a 75-g oral glucose tolerance test, measurements of the intima - media thickness (imt) of the common carotid artery, and evaluation of the endothelial function as previously described (8,9). on the second day, after a 12-h overnight fast, subjects underwent a euglycemic hyperinsulinemic clamp study as previously described (9). serum samples were analyzed by a sandwich enzyme - linked immunosorbent assay (elisa) method using anti - mouse antibodies for human soluble tumor necrosis factor (tnf) receptor 1, soluble interleukin 6 (il-6) receptor, soluble vascular cell adhesion molecule 1 (svcam-1), soluble intercellular cell adhesion molecule 1 (sicam-1), soluble chemokine (c - x - c motif) ligand 16, and scxc3l1 (all from r&d systems, minneapolis, mn) according to manufacturer s instructions. peripheral blood mononuclear cells (pbmcs) were isolated from 40 ml of peripheral blood of fdrs using ficoll - plaque plus (ge healthcare, piscataway, nj) as indicated by the manufacturer. untouched monocytes were isolated from pbmcs by using an indirect magnetic labeling system (monocyte isolation kit ii ; miltenyi biotec, auburn, ca). about 2.59.7 total rna was extracted from monocytes with the rneasy micro kit (qiagen, valencia, ca) according to the manufacturer s instructions. single - strand cdna was synthesized, according to the applied biosystems (foster city, ca) standard protocol, from 1 g of total rna sample using high - capacity cdna archive kit. fifty nanograms of cdna was amplified by real - time pcr rna expression of tnf- converting enzyme / adam17, adam10, tnf-, timp3, lectin - like oxidized low - density lipoprotein receptor-1 (lox1), chemokine (c - c motif) receptor 2 (ccr2), matrix metalloproteinase 9 (mmp9), insr, irs1, irs2, or sirtuin 1 (sirt1) (primers available upon request) using an abi prism 7900ht system (applied biosystems) and normalized to 18s rrna as an endogenous control. each reaction was carried out in duplicate and analysis was performed by 2 method. for protein extraction cells (2.5 10) were plated in dulbecco s modified eagle s medium with 0.2% bsa in the absence of serum for 6 h and then stimulated with insulin (10 mol / l) for 10 min. at the end of the treatment, in order to assay insulin signaling components, proteins were extracted and analyzed by pathscan sandwich elisa kits (cell signaling, beverly, ma) according to the manufacturer s instructions. the following pathscan sandwich elisa kits were used : phospho - insr (pantyr) and total insr ; phospho - irs1 (pantyr) and total irs1 ; phospho - irs2 (pantyr) and total irs2 ; and phospho - v - akt murine thymoma viral oncogene homolog 1 (akt1) (ser473) and total akt1. protein extracts were used to determine the adam17 activity by the sensolyte 520 adam17 activity assay kit (fluorimetric ; anaspec, san jose, ca) according to the manufacturer s instructions. the kolmogorov - smirnov test was used to test the normality of distribution, and nonnormally distributed variables, including all mrna values, were naturally log transformed. group differences of continuous variables were compared using student t test or univariate anova test with bonferroni post - hoc test. serum samples were analyzed by a sandwich enzyme - linked immunosorbent assay (elisa) method using anti - mouse antibodies for human soluble tumor necrosis factor (tnf) receptor 1, soluble interleukin 6 (il-6) receptor, soluble vascular cell adhesion molecule 1 (svcam-1), soluble intercellular cell adhesion molecule 1 (sicam-1), soluble chemokine (c - x - c motif) ligand 16, and scxc3l1 (all from r&d systems, minneapolis, mn) according to manufacturer s instructions. peripheral blood mononuclear cells (pbmcs) were isolated from 40 ml of peripheral blood of fdrs using ficoll - plaque plus (ge healthcare, piscataway, nj) as indicated by the manufacturer. untouched monocytes were isolated from pbmcs by using an indirect magnetic labeling system (monocyte isolation kit ii ; miltenyi biotec, auburn, ca). about 2.59.7 total rna was extracted from monocytes with the rneasy micro kit (qiagen, valencia, ca) according to the manufacturer s instructions. single - strand cdna was synthesized, according to the applied biosystems (foster city, ca) standard protocol, from 1 g of total rna sample using high - capacity cdna archive kit. fifty nanograms of cdna was amplified by real - time pcr rna expression of tnf- converting enzyme / adam17, adam10, tnf-, timp3, lectin - like oxidized low - density lipoprotein receptor-1 (lox1), chemokine (c - c motif) receptor 2 (ccr2), matrix metalloproteinase 9 (mmp9), insr, irs1, irs2, or sirtuin 1 (sirt1) (primers available upon request) using an abi prism 7900ht system (applied biosystems) and normalized to 18s rrna as an endogenous control. cells (2.5 10) were plated in dulbecco s modified eagle s medium with 0.2% bsa in the absence of serum for 6 h and then stimulated with insulin (10 mol / l) for 10 min. at the end of the treatment, in order to assay insulin signaling components, proteins were extracted and analyzed by pathscan sandwich elisa kits (cell signaling, beverly, ma) according to the manufacturer s instructions. the following pathscan sandwich elisa kits were used : phospho - insr (pantyr) and total insr ; phospho - irs1 (pantyr) and total irs1 ; phospho - irs2 (pantyr) and total irs2 ; and phospho - v - akt murine thymoma viral oncogene homolog 1 (akt1) (ser473) and total akt1. protein extracts were used to determine the adam17 activity by the sensolyte 520 adam17 activity assay kit (fluorimetric ; anaspec, san jose, ca) according to the manufacturer s instructions. the kolmogorov - smirnov test was used to test the normality of distribution, and nonnormally distributed variables, including all mrna values, were naturally log transformed. group differences of continuous variables were compared using student t test or univariate anova test with bonferroni post - hoc test. by analyzing clinical characteristics and metabolic parameters of fdrs of type 2 diabetes (anthropometric, biochemical, and clinical parameters are shown in table 1), we found that insulin resistance, evaluated as glucose disposal rate (m) during a euglycemic hyperinsulinemic clamp, negatively correlates with imt (r = 0.575 ; p < 0.0001), and dividing our population into tertiles of insulin resistance assessed by m clamp, we also confirmed that the insulin - resistant tertile has higher imt values, confirming the validity of this model to study biomarkers linking insulin resistance to atherosclerosis (9,10) (supplementary fig. 1a and b). we analyzed the mrna expression levels of insr, irs1, irs2, and sirt1. no correlation was found between levels of insr, irs1, and sirt1 expression with clinical and biochemical parameters (data not shown). however, we found in this group of subjects that irs2 expression correlated with fasting plasma glucose (r = 0.34 ; p < 0.05), insulin resistance assessed by m (r = 0.406 ; p < 0.01), glycated hemoglobin (r = 0.36 ; p < 0.05), hdl cholesterol (r = 0.28 ; p < 0.05), and imt (r = 0.49 ; p < 0.001) (data not shown). we observed that subjects in the lowest tertiles of expression of irs2 in monocytes were significantly more insulin resistant and had the highest imt level (fig. 1a and b and supplementary table 2) ; accordingly those with low irs2 had increased fasting plasma glucose and hba1c and reduced levels of hdl cholesterol (fig. next we analyzed the expression of genes relevant for inflammation, such as tnf-, ccr2, lox1. similarly, we did not find correlation between levels of gene expression and clinical and biochemical parameters in this group of subjects. because mrna expression could not reflect protein regulation at the membrane and cytoplasmic level, we analyzed the levels of insr, irs1, and irs2 in the lowest versus the highest tertiles of insulin resistance. our analysis confirmed that in cultured monocytes of insulin - resistant subjects, irs2 protein and tyrosine phosporylation levels were significantly decreased (fig. 2b), whereas no differences were observed for insr and irs1 in both protein expression and phopsphorylation (fig. interestingly, whereas akt1 protein levels were similar in the two groups, akt serine 473 phosphorylation reflected the reduced irs2 activation (fig. 2c). analysis of the subjects with lowest irs2 protein levels in monocytes confirmed that these were significantly more insulin resistant and had the highest imt level (fig. 2d distribution of anthropometric and biochemical parameters and monocyte gene expression data according to tertiles of insulin resistance data are percentage or means sd, unless otherwise indicated. p value is reported for significant differences among groups tested with anova with bonferroni post - hoc test. ngt, normal glucose tolerance ; igt, impaired glucose tolerance ; 2 h p - l, 2 h postglucose load ; homa - ir, homeostasis model assessment of insulin resistance ; fmd, flow - mediated dilation ; sil6 r, soluble il-6 receptor ; stnf r1, soluble tnf receptor 1. mrna expression of irs2 in monocytes from fdrs of type 2 diabetic subjects is correlated with in vivo insulin resistance and subclinical atherosclerosis. high log irs2 mrna levels are associated with increased levels of m (a), decreased imt (b), decreased fasting plasma glucose levels (c), decreased glycated hemoglobin (d), and increased hdl cholesterol (e). p < 0.05 for low irs2 (n = 14) compared with high irs2 (n = 14) by anova with bonferroni post - hoc test. insr and irs protein levels and phosphorylation status in monocytes from lowest vs. highest insulin resistance tertiles. c : insr and irs1 protein levels and pan - tyrosine are not different in monocytes from insulin - sensitive (n = 13) vs. insulin - resistant (n = 14) subjects (a). irs2 protein levels and pan - tyrosine phosphorylation are higher in monocytes from insulin - sensitive (n = 13) vs. insulin - resistant (n = 14) subjects (p < 0.05, by student t test) (b). akt protein levels and serine 473 phosphorylation are higher in monocytes from insulin - sensitive (n = 13) vs. insulin - resistant (n = 14) subjects (p < 0.05, by student t test) (c). d h : fdr subjects characterized by lowest irs2 protein levels in monocytes exhibit significantly increased imt (d), decreased m (e), fasting plasma glucose (f), hba1c (g), and increased hdl (h) (n = 14 and n = 14 for low irs2 and high irs2, respectively ; p < 0.05, by student t test). recent studies using human specimens and animal models suggested that the regulation of the inflammatory behavior of monocytes is controlled by timp3, which restrains the release of the soluble fraction of transmembrane proteins through their ectodomain shedding. this process is regulated by sheddases belonging to the adam family of metalloproteases, which generate soluble forms of cytokines, growth factors, and receptors, such as tnf-, il-6 receptor, vcam-1, icam-1 and selectins, all involved in the chronic inflammatory process. timp3 is the physiological inhibitor of the adams involved in the ectodomain shedding process, such as adam17 and adam10 (11). we analyzed the expression of several genes involved in the membrane ectodomain shedding in monocytes extracted from pbmcs of fdrs, such as adam17, adam10, mmp9, and timp3. no correlation was found between gene expression levels and clinical and biochemical parameters. dividing our population into tertiles of insulin resistance assessed by m clamp, we found that timp3 mrna levels were significantly reduced in insulin - resistant fdrs (table 1 and fig. insulin - resistant fdrs carrying lower timp3 expression were characterized by significantly increased adam17 activity (fig. 3b). timp3 mrna levels were negatively correlated with imt (r = 0.43 ; p < 0.05) (fig. further analysis revealed that in monocytes, there is a correlation between irs2 and timp3 expression (fig. 3d), with subjects in the lowest tertile of irs2 expression having reduced timp3 levels (fig. 3e) and increased ectodomain shedding activity, as suggested by increased circulating soluble il-6 receptor and svcam-1 (fig. a : timp3 expression is higher in insulin - sensitive compared with insulin - resistant fdr subjects (p < 0.05 for low m [n = 14 ] compared with high m [n = 13 ] by anova with bonferroni multiple comparison tests). b : adam17 activity is significantly higher in monocyte extracts from insulin - resistant (black bar ; n = 14) compared with insulin - sensitive (white bar ; n = 13) fdr subjects (p < 0.05 by student t test). c : mrna expression of timp3 in monocytes from fdrs of type 2 diabetic subjects is negatively correlated with subclinical atherosclerosis. d : expression of timp3 in monocytes from fdrs of type 2 diabetic subjects is positively correlated with irs2 mrna levels. e : expression of timp3 in monocytes from fdrs of type 2 diabetic subjects is reduced according to irs2 mrna expressed in tertiles. f : soluble il-6 receptor (rec), a marker of increased ectodomain shedding, is significantly higher in subjects with lowest irs2 mrna expression levels. p < 0.05 for low irs2 (n = 14) compared with high irs2 (n = 14) by student t test. a.u., arbitrary unit. by analyzing clinical characteristics and metabolic parameters of fdrs of type 2 diabetes (anthropometric, biochemical, and clinical parameters are shown in table 1), we found that insulin resistance, evaluated as glucose disposal rate (m) during a euglycemic hyperinsulinemic clamp, negatively correlates with imt (r = 0.575 ; p < 0.0001), and dividing our population into tertiles of insulin resistance assessed by m clamp, we also confirmed that the insulin - resistant tertile has higher imt values, confirming the validity of this model to study biomarkers linking insulin resistance to atherosclerosis (9,10) (supplementary fig. 1a and b). we analyzed the mrna expression levels of insr, irs1, irs2, and sirt1. no correlation was found between levels of insr, irs1, and sirt1 expression with clinical and biochemical parameters (data not shown). however, we found in this group of subjects that irs2 expression correlated with fasting plasma glucose (r = 0.34 ; p < 0.05), insulin resistance assessed by m (r = 0.406 ; p < 0.01), glycated hemoglobin (r = 0.36 ; p < 0.05), hdl cholesterol (r = 0.28 ; p < 0.05), and imt (r = 0.49 ; p < 0.001) (data not shown). we observed that subjects in the lowest tertiles of expression of irs2 in monocytes were significantly more insulin resistant and had the highest imt level (fig. 1a and b and supplementary table 2) ; accordingly those with low irs2 had increased fasting plasma glucose and hba1c and reduced levels of hdl cholesterol (fig. next we analyzed the expression of genes relevant for inflammation, such as tnf-, ccr2, lox1. similarly, we did not find correlation between levels of gene expression and clinical and biochemical parameters in this group of subjects. because mrna expression could not reflect protein regulation at the membrane and cytoplasmic level, we analyzed the levels of insr, irs1, and irs2 in the lowest versus the highest tertiles of insulin resistance. our analysis confirmed that in cultured monocytes of insulin - resistant subjects, irs2 protein and tyrosine phosporylation levels were significantly decreased (fig. 2b), whereas no differences were observed for insr and irs1 in both protein expression and phopsphorylation (fig. interestingly, whereas akt1 protein levels were similar in the two groups, akt serine 473 phosphorylation reflected the reduced irs2 activation (fig. 2c). analysis of the subjects with lowest irs2 protein levels in monocytes confirmed that these were significantly more insulin resistant and had the highest imt level (fig. 2d distribution of anthropometric and biochemical parameters and monocyte gene expression data according to tertiles of insulin resistance data are percentage or means sd, unless otherwise indicated. p value is reported for significant differences among groups tested with anova with bonferroni post - hoc test. ngt, normal glucose tolerance ; igt, impaired glucose tolerance ; 2 h p - l, 2 h postglucose load ; homa - ir, homeostasis model assessment of insulin resistance ; fmd, flow - mediated dilation ; sil6 r, soluble il-6 receptor ; stnf r1, soluble tnf receptor 1. mrna expression of irs2 in monocytes from fdrs of type 2 diabetic subjects is correlated with in vivo insulin resistance and subclinical atherosclerosis. high log irs2 mrna levels are associated with increased levels of m (a), decreased imt (b), decreased fasting plasma glucose levels (c), decreased glycated hemoglobin (d), and increased hdl cholesterol (e). p < 0.05 for low irs2 (n = 14) compared with high irs2 (n = 14) by anova with bonferroni post - hoc test. insr and irs protein levels and phosphorylation status in monocytes from lowest vs. highest insulin resistance tertiles. c : insr and irs1 protein levels and pan - tyrosine are not different in monocytes from insulin - sensitive (n = 13) vs. insulin - resistant (n = 14) subjects (a). irs2 protein levels and pan - tyrosine phosphorylation are higher in monocytes from insulin - sensitive (n = 13) vs. insulin - resistant (n = 14) subjects (p < 0.05, by student t test) (b). akt protein levels and serine 473 phosphorylation are higher in monocytes from insulin - sensitive (n = 13) vs. insulin - resistant (n = 14) subjects (p < 0.05, by student t test) (c). d h : fdr subjects characterized by lowest irs2 protein levels in monocytes exhibit significantly increased imt (d), decreased m (e), fasting plasma glucose (f), hba1c (g), and increased hdl (h) (n = 14 and n = 14 for low irs2 and high irs2, respectively ; p < 0.05, by student t test). recent studies using human specimens and animal models suggested that the regulation of the inflammatory behavior of monocytes is controlled by timp3, which restrains the release of the soluble fraction of transmembrane proteins through their ectodomain shedding. this process is regulated by sheddases belonging to the adam family of metalloproteases, which generate soluble forms of cytokines, growth factors, and receptors, such as tnf-, il-6 receptor, vcam-1, icam-1 and selectins, all involved in the chronic inflammatory process. timp3 is the physiological inhibitor of the adams involved in the ectodomain shedding process, such as adam17 and adam10 (11). we analyzed the expression of several genes involved in the membrane ectodomain shedding in monocytes extracted from pbmcs of fdrs, such as adam17, adam10, mmp9, and timp3. no correlation was found between gene expression levels and clinical and biochemical parameters. dividing our population into tertiles of insulin resistance assessed by m clamp, we found that timp3 mrna levels were significantly reduced in insulin - resistant fdrs (table 1 and fig. insulin - resistant fdrs carrying lower timp3 expression were characterized by significantly increased adam17 activity (fig. 3b). timp3 mrna levels were negatively correlated with imt (r = 0.43 ; p < 0.05) (fig. further analysis revealed that in monocytes, there is a correlation between irs2 and timp3 expression (fig. 3d), with subjects in the lowest tertile of irs2 expression having reduced timp3 levels (fig. 3e) and increased ectodomain shedding activity, as suggested by increased circulating soluble il-6 receptor and svcam-1 (fig. a : timp3 expression is higher in insulin - sensitive compared with insulin - resistant fdr subjects (p < 0.05 for low m [n = 14 ] compared with high m [n = 13 ] by anova with bonferroni multiple comparison tests). b : adam17 activity is significantly higher in monocyte extracts from insulin - resistant (black bar ; n = 14) compared with insulin - sensitive (white bar ; n = 13) fdr subjects (p < 0.05 by student t test). c : mrna expression of timp3 in monocytes from fdrs of type 2 diabetic subjects is negatively correlated with subclinical atherosclerosis. d : expression of timp3 in monocytes from fdrs of type 2 diabetic subjects is positively correlated with irs2 mrna levels. e : expression of timp3 in monocytes from fdrs of type 2 diabetic subjects is reduced according to irs2 mrna expressed in tertiles. f : soluble il-6 receptor (rec), a marker of increased ectodomain shedding, is significantly higher in subjects with lowest irs2 mrna expression levels. p < 0.05 for low irs2 (n = 14) compared with high irs2 (n = 14) by student t test. a.u., arbitrary unit. the contradictory results from monocyte - specific insr knockouts do not provide definitive evidence for a positive or negative role of myeloid insulin resistance in the pathogenesis of diabetes and atherosclerosis in humans (47,12). here, we observe no correlation between insulin resistance, subclinical atherosclerosis, and insr in monocytes from human subjects. in contrast, expression of irs2, the major transduction element of insr tyrosine kinase in myeloid cells (13,14), was correlated to both systemic insulin resistance and subclinical atherosclerosis. overall, in subjects at risk for diabetes, those with insulin resistance and increased imt carry lower expression of irs2 in circulating monocytes, suggesting that myeloid - specific insulin resistance at the molecular level facilitates the development of atherosclerosis and diabetes. the reduced irs2 expression might be explained by the exposure to different insulin levels, since relative hyperinsulinemia and insulin resistance are known to affect irs2 expression through akt / foxo1 activation (15).. one extracellular factor regulating innate response is timp3, through its ability to restrain release of cytokines and chemokines from the plasma membrane (11,17). monocytes from subjects characterized by increased insulin resistance and atherosclerosis exhibit reduced mrna timp3 levels. we previously established that timp3 is a genetic modifier for insulin resistance in mice ; it is reduced in atherosclerotic plaques of subjects with type 2 diabetes, as a result of altered sirt1 activity on vascular smooth muscle cells and monocytes (18,19). hyperinsulinemia (a compensatory response to peripheral insulin resistance) is known to increase adam10 and adam17 activity, the inflammatory metalloproteases that are restrained by timp3, causing increased release of transmembrane proteins as soluble factors (20,21). among transmembrane proteins with chemokine activity, we found that in offspring of patients with type 2 diabetes, soluble il-6 receptor and svcam-1 were positively correlated with insulin resistance and markers of atherogenic dyslipidemia, suggesting a role for these chemokines in the early phases of metabolic inflammation. in conclusion, in monocyte cells from human subjects with increased risk for diabetes and atherosclerosis, we found that gene expression and protein activity of irs2, but not insr, negatively correlates with insulin resistance and atherosclerosis. moreover, timp3, a natural checkpoint for inflammation, is reduced along with insulin resistance. our data suggest that the reduction of timp3 may increase the release of inflammatory soluble factors generated through the ectodomain shedding activity of metalloproteases such as adam17, a process starting at preclinical levels with release of soluble il-6 receptor. intriguingly, data in experimental models suggested that low timp3 expression defines a subpopulation of highly invasive foam - cell macrophages with increased proliferation and apoptosis, all properties expected to destabilize atherosclerotic plaques (22). | objectivein humans, it is unclear if insulin resistance at the monocyte level is associated with atherosclerosis in vivo. here we have studied first - degree relatives of patients with type 2 diabetes to investigate whether a reduction in components of the insulin signal transduction pathways, such as the insulin receptor (insr) or insr substrate 1 or 2 (irs1 or irs2), or a reduction in genetic modifiers of insulin action, such as the timp3/adam17 (tissue inhibitor of metalloproteinase 3/a disintegrin and metalloprotease domain 17) pathway, is associated with evidence of atherosclerosis.research design and methodsinsulin sensitivity was analyzed through euglycemic - hyperinsulinemic clamp, and subclinical atherosclerosis was analyzed through intimal medial thickness. monocytes were isolated through magnetic cell sorting, and mrna and proteins were extracted and analyzed by quantitative pcr and pathscan enzyme - linked immunosorbent assays, respectively.resultsin monocyte cells from human subjects with increased risk for diabetes and atherosclerosis, we found that gene expression, protein levels, and tyrosine phosphorylation of irs2, but not insr or irs1, were decreased. timp3 was also reduced, along with insulin resistance, resulting in increased ectodomain shedding activity of the metalloprotease adam17.conclusionssystemic insulin resistance and subclinical atherosclerosis are associated with decreased irs2 and timp3 expression in circulating monocytes. |
crohn 's disease is a systemic inflammatory disorder that primarily targets the gastrointestinal system, but infrequently the disease may also have extraintestinal manifestations (eims) that can affect almost any organ system. eims may vary in severity and can be more debilitating than the underlying crohn 's disease. certain eims may parallel crohn 's disease activity, while others can have an independent course. because eims can involve almost any organ system, the clinical presentation is diverse. well - characterized manifestations include ocular involvement with uveitis and episcleritis, cutaneous manifestations with erythema nodosum and pyoderma gangrenosum, musculoskeletal involvement with reactive arthritis and spondyloarthritis, and hepatobiliary disease. pulmonary manifestations are less well recognized but can involve airways as well as parenchyma. because pulmonary involvement is seldom seen with crohn 's disease, making the diagnosis can present a challenge. moreover, the correlation may be overlooked when the pulmonary disease has an independent course from the gastrointestinal disease, especially when different medical specialists evaluate the patient. we present a case summary of a patient with what we later suspected was pulmonary eim prior to the diagnosis of crohn 's disease, which is not well defined in the current literature. a 44-year - old woman was initially referred to the pulmonary clinic in 2012 for recurrent pneumonias, persistent shortness of breath, and chest pain. she said that her clinical course began when she was diagnosed with adult - onset asthma in 2007. her symptoms were relatively mild until 2011, when she was diagnosed with pneumonia, for which she was treated with antibiotics and short courses of prednisone. despite treatment, she never felt she fully recovered to her usual state of health. she continued to have episodes of dyspnea on exertion and pleuritic chest pain, complicated by several episodes of pneumonia over the next year and a half. her abdomen was soft and nontender, and there was no skin or joint involvement. initial workup revealed normocytic anemia (hemoglobin, 11.4 gm / dl) with peripheral eosinophilia (1.3 k / mm). she had mixed obstructive and restrictive pattern, with reduced diffusing capacity of the lung for carbon monoxide (dlco) on pulmonary function testing and multiple computed tomography exams with diffuse, migratory, nodular, and consolidative parenchymal lung disease (fig 1a, b). elevated inflammatory markers corresponded with active symptoms of dyspnea on exertion and pleuritic chest pain (erythrocyte sedimentation rate, 32 mm / h ; c - reactive protein, 2.3 mg / dl). infectious workup was positive for aspergillus precipitins but negative for coccidioidomycosis, histoplasmosis, strongyloides, quantiferon assay, and hiv screen. extensive serologic evaluation revealed weakly positive antinuclear antibodies at 1 : 80 and ige in the 200s but was otherwise negative. a pet scan was completed to better characterize the pulmonary lesions, which showed bilateral pleural and parenchymal nodules with the largest in the left lower lobe (fig 1c). the pet scan incidentally revealed a mural mass arising from the cecum (fig 1d). computed tomography - guided biopsy of the left lower lobe showed predominant necrosis with scant surrounding granulation tissue, negative for acid fast bacilli and without organisms. due to nonspecific findings, in 2013, she eventually underwent video - assisted thoracoscopic surgery lung biopsy of the right upper, middle, and lower lobes showing a mix of necrotizing and nonnecrotizing granulomas, neutrophilic inflammation, and scattered eosinophils (fig 2a c). the biopsy findings suggested that the patient had chronic, idiopathic granulomatous lung disease, and the decision was made to start the patient on a moderate dose of prednisone and taper her dose over 6 months. her symptoms recurred with discontinuation, and she complained of persistent pleuritic chest pain, dyspnea on exertion, headache, fatigue, and diffuse arthralgias. our medical team was confounded by her symptomatology in spite of treatment. upon further review of her past workup, there was evidence of a mural mass in the cecum on pet scan that had not been pursued previously because she had no significant gastrointestinal symptoms. she was referred for colonoscopy in september 2014 with endoscopic findings of isolated nodular and friable cecum (online suppl. the cecal biopsy revealed acute cryptitis, crypt abscess, and a single poorly formed granuloma, thus raising the differential diagnosis of crohn 's disease (fig 2d f). crohn 's disease is a chronic, idiopathic autoimmune inflammatory disorder characterized by transmural inflammation of the gastrointestinal tract that can occur anywhere from the mouth to the anus. it is estimated that eim affects 2136% of patients with crohn 's disease, but the incidence and prevalence of pulmonary involvement varies in the literature. pulmonary manifestations of crohn 's disease were first described in the late 1960s, but it was not until the mid-1970s when it was widely accepted in the literature as eim of inflammatory bowel disease (ibd) [2, 3, 4, 5 ]. pulmonary involvement is not commonly associated with crohn 's disease and often overlooked, especially if respiratory symptoms are present before the diagnosis of gastrointestinal manifestations, as in the present case. it is suggested that ongoing bowel inflammation is not required in order to have respiratory symptoms, as there is embryologic overlap between the respiratory and colonic epithelium. the lungs and the gastrointestinal tract share similar submucosal lymphoid tissue that is crucial in host defense as well as in the development of inflammatory dysregulation [3, 6, 7 ]. however, the diagnosis was delayed in this case as the pulmonary symptoms preceded the ibd diagnosis. to the best of our knowledge, this is one of the few case presentations in an adult with pulmonary eim before the diagnosis of ibd [6, 8, 9 ]. key differentiating points in this case were the peripheral eosinophilia, which is not typically seen in sarcoidosis, and the normal serum angiotensin - converting enzyme levels, with normal serum calcium and 24-h urine collection of calcium. serum angiotensin - converting enzyme levels are consistently low to normal in crohn 's disease, especially during periods of active inflammation. the patient had normocytic anemia with iron studies suggestive of anemia of chronic inflammation with iron deficiency (ferritin, 8 ng / ml ; iron percent saturation, 11% ; and red blood cell distribution width, 17 units), which is suggestive of crohn 's disease, but not typically seen in sarcoidosis. there was low suspicion for infectious etiologies given the negative serologies, cultures, and special stains performed on the open lung biopsy. granulomatosis with polyangiitis was briefly considered given the granulomatous inflammation, radiographic distribution, history of asthma, and peripheral eosinophilia. however, in this case, the absence of necrotizing vasculitis and negative anti - pr3 serology did not support the diagnosis of granulomatosis with polyangiitis. pulmonary eim in crohn 's disease remains underrecognized largely due to the heterogeneous and wide spectrum of involvement. in this case, pulmonary manifestations preceded the detection and, ultimately, led to the diagnosis of crohn 's disease. as highlighted in this case, it is important to complete an extensive infectious, rheumatologic, and pathologic evaluation. the break in this case came when our team decided to further investigate the mural mass in the patient 's cecum by obtaining an endoscopic evaluation with biopsies. it was through the workup of her colonic findings that the pulmonary disorder was discovered to be a manifestation of crohn 's disease. pulmonary function tests have been studied in patients with ibd, but results have been subclinical and often mixed, which is thought to be due to inadequate power. however, compared to normal subjects, those with ibd consistently had decreased dlco, and it may be significantly lower during active disease [4, 6 ]. additionally, corticosteroids are considered the mainstay of therapy in treating pulmonary eim in crohn 's disease. however, up to one - third of patients fail to respond to treatment or can not taper off, as seen in this patient. after 1 year of dual therapy, the patient was transitioned to single therapy with infliximab and continues to do well. the take - away lesson of this case is that diseases do not always present in textbook fashion. in particular, eims of crohn 's disease may baffle even the most astute clinician, especially when the extraintestinal involvement precedes any significant inflammatory signs and symptoms of gastrointestinal disease. after exhaustive evaluation of her pulmonary symptomatology, it was the patient 's pet scan, and a little serendipity, that led us to further evaluate her for ibd. with the diagnosis of crohn 's disease, we made the association that her pulmonary disease was the manifestation of ibd. | crohn 's disease is a chronic, idiopathic autoimmune disorder that primarily targets the gastrointestinal (gi) system. it is characterized by transmural inflammation of the gi tract that can occur anywhere from the mouth to the anus. not infrequently, the disease may also have extraintestinal manifestations (eims) that can affect almost any organ system. it is estimated that eims affect up to 36% of patients with crohn 's disease, but the incidence and prevalence of pulmonary involvement are variable in the literature and may be as low as 0.4%. there are few case reports documenting pulmonary manifestations, as they are often overlooked, especially if respiratory symptoms are present before the diagnosis of gi manifestations, as in the present case. a 44-year - old otherwise healthy woman presented with nonspecific respiratory complaints, recurrent pneumonias, and multiple computed tomography images showing diffuse, migratory, nodular, and consolidative parenchymal lung disease, with a largely unremarkable infectious and rheumatologic evaluation. lung biopsy revealed necrotizing and nonnecrotizing granulomas, raising concern for sarcoidosis. subsequent imaging revealed an incidental mass in the cecum. biopsy of the cecum lesion revealed acute cryptitis, crypt abscess, and a single poorly formed granuloma, suggesting the possibility of crohn 's disease. in this report, we present a patient whose pulmonary manifestations ultimately led to the diagnosis of crohn 's disease. |
in patients with atherosclerotic internal carotid artery (ica) or middle cerebral artery (mca) occlusive disease, chronic reduction in cerebral perfusion pressure (chronic haemodynamic compromise) increases the risk of ischaemic stroke14 and can be detected by directly measuring haemodynamic parameters.513 accurate evaluation of haemodynamic status is essential for determining patient prognosis. furthermore, therapeutic strategies to prevent recurrent strokes should differ between patients with and without haemodynamic compromise. however, strategies for selecting treatments based on haemodynamic measurements have not been clearly established.14 identification of patients with impaired perfusion may be essential for informing the proper control of blood pressure (bp) to reduce stroke recurrence. hypertension is a major risk factor for stroke, and antihypertensive therapy provides general benefits to patients with a history of stroke or transient ischaemic attacks (tias).15 16 however, the level to which bp should be lowered to achieve maximal benefits among survivors of stroke and tias is not precisely known, although post hoc analysis of progress17 suggests a goal 70% exhibit an inverse relationship between bp and stroke risk.20 notably, these studies did not include direct evaluations of baseline patient haemodynamic status. they also did not include patients with symptomatic occlusion of the major cerebral arteries, in which the incidence of impaired perfusion is greater than in patients with stenosis of the major cerebral arteries. thus, the interpretation of these studies was limited by the fact that the proportion of patients with impaired perfusion was unknown and potentially low. the relationship between bp and stroke risk in patients with impaired perfusion may be different from that in patients without impaired perfusion, and lower bp in this specific population may increase recurrent stroke risk.20 therefore, a more thorough characterisation of the relationships among perfusion, bp and stroke risk should be performed to inform selection of the most appropriate treatment regimen for individual patients. in this study, we retrospectively analysed the relationship between bp during follow - up and stroke risk in a population of a relatively large number of patients with symptomatic ica or mca occlusion. we quantitatively evaluated baseline haemodynamic status with positron emission tomography (pet) and o - gas. the purpose of this study was to investigate the relationships among bp, impaired perfusion and recurrent stroke risk in symptomatic major cerebral artery occlusive disease. we retrospectively analysed the data collected from 130 medically treated patients enrolled in an observational study that investigated the relationship between haemodynamic compromise and stroke risk in symptomatic patients with atherosclerotic occlusive disease of the major cerebral arteries other than extracranial ica stenosis.13 patients were first referred to the pet unit at shiga medical centre from the outpatient clinic or other hospitals in shiga prefecture to undergo haemodynamic parameter evaluation as part of clinical assessment to determine the need for extracranial - to - intracranial bypass. although the benefit from bypass surgery in patients with haemodynamic compromise remains to be proven, the operation is nevertheless performed in some patients in japan and elsewhere. inclusion criteria for the observational study were as follows : (1) occlusion of the extracranial ica or occlusion or stenosis (> 50% diameter reduction) of the intracranial ica or mca as documented by conventional or magnetic resonance angiography, (2) ability to independently carry out daily life activities (modified rankin scale score 50% diameter reduction) of the intracranial ica or mca as documented by conventional or magnetic resonance angiography, (2) ability to independently carry out daily life activities (modified rankin scale score <3) and (3) history of tia or complete stroke involving the relevant ica or mca territory at any time before pet examination. tia was defined as the development of focal symptoms of presumed ischaemic cerebrovascular origin lasting < 24 h. the exclusion criteria were (1) history of vascular reconstruction surgery or (2) presence of potential sources of cardiogenic embolism.13 overall, 35 of the 165 patients enrolled in the study underwent bypass surgery due to haemodynamic impairment observed on pet and were excluded from the present study. the study included 103 men and 27 women aged 4490 years (meansd : 648 years, table 1). all but two patients had symptoms of cerebral hemispheric (rather than retinal) ischaemia. the interval between the latest ischaemic event and pet evaluation was 815 months (range, 4 days to 72 months). recurrent symptoms prior to pet were identified in 52 patients, including 25 after angiographic demonstration of arterial disease. in 9 of 21 patients with tia, mri was normal. in 121 patients, mri revealed only minor abnormalities in the mca territory or watershed areas of the hemisphere with symptomatic arterial disease. the symptomatic qualifying artery included the extracranial ica occlusion in 61 cases, intracranial ica occlusion in 1 case, intracranial ica stenosis in 13 cases, mca occlusion in 24 cases and mca stenosis in 31 cases. among vascular risk factors, hypertension, diabetes mellitus, ischaemic heart disease, hypercholesterolaemia and smoking status were evaluated from patient histories recorded at pet examination (table 1). hypertension, diabetes mellitus, ischaemic heart disease and hypercholesterolaemia were judged as present based on treatment history. the ethics committee of our centre approved the study protocol, and each patient provided written informed consent prior to their participation in this study. characteristics of patients with and without normal sbp (< 130 mm hg) during follow - up ace, angiotensin - converting enzyme ; arb, angiotensin receptor blocker ; cbf, cerebral blood flow ; cbv, cerebral blood volume ; ica, internal carotid artery ; mca, middle cerebral artery ; pet, positron emission tomography ; sbp, systolic blood pressure ; tia, transient ischaemic attack. all patients underwent pet scans with a whole - body advance pet scanner (general electric medical system, wauwatosa, wi), which permits simultaneous acquisition of 35 image slices with interslice spacing of 4.25 mm.22 the intrinsic scanner resolution was 4.65.7 mm in the transaxial direction and 4.05.3 mm in the axial direction. as part of the scanning procedure but before tracer administration, ge / ga transmission scanning was performed for 10 min for attenuation correction. functional images were reconstructed as 128128 pixels, with each pixel representing an area of 2.02.0 mm. co2 and o2 were inhaled continuously through a mask.22 the scan time was 5 min. bolus inhalation of co with 3-min scanning was used to measure cerebral blood volume (cbv). cerebral blood flow (cbf), cerebral metabolic rate of oxygen and oxygen extraction fraction (oef) were calculated based on the steady - state method.23 24 the ratio of cbf to cbv was calculated pixel - by - pixel as an indicator of cerebral perfusion pressure.25 26 we analysed 10 tomographic planes from 46.25 to 84.5 mm above and parallel to the orbitomeatal line, which corresponded to the levels from the basal ganglia and thalamus to the centrum semiovale. each image was examined by placing 1012 circular rois 16 mm in diameter compactly over the grey matter of the outer cortex in each hemisphere. according to the atlas,27 the rois in all 10 images covered the distribution of the mca, as well as the watershed areas.28 the same rois were transferred to the other images. the mean hemispheric values in each hemisphere were calculated as the average of the values of all circular rois. in patients with cerebral cortex infarction, the circular rois that overlapped low - intensity areas on t1-weighted mr images were excluded from analysis using a simple method correlating pet images with mr images.29 normal control values of the o - gas pet variables were obtained from seven normal volunteers (four men and three women), aged 477 years (meansd) who underwent normal routine neurological examinations and mri scans. hemispheric oef values beyond the upper 95% limit defined in normal subjects (above 52.9%) were considered to represent increased oef. comparative values for cbf and cbf / cbv in normal controls were 44.64.5 and 11.41.8, respectively. hemispheric cbf and cbf / cbv values below 35.0 ml/100 g / min and 7.6/min, respectively, were considered abnormal. patients with increased oef, decreased cbf and decreased cbf / cbv in hemispheres with arterial disease were categorised as having misery perfusion, while patients with decreased cbf / cbv were categorised as having decreased cerebral perfusion pressure (impaired perfusion). attending physicians were informed of pet findings, but treatment of risk factors and use of drugs was left to individual clinical judgment. all patients were examined at 1-month or 2-month intervals after pet studies in the outpatient clinic in our centre or related hospitals in shiga prefecture. at each visit, an interim history was obtained, bp was measured and a neurological examination was performed. in patients with recurrent stroke, mr imaging or ct scan was obtained and compared with initial studies to confirm recurrent stroke. recurrent ischaemic stroke was defined as the acute onset of new focal neurological deficit of cerebral origin persisting for more than 24 h without primary intracranial haemorrhage on ct or mri scan. bp during the follow - up period was defined as the value of bp obtained just before stroke recurrence, death or the end of the 2-year follow - up period. continuous sbp measurements were categorised in the same way as in the study by rothwell (< 130, 130149, 150169 and 170 mm hg).20 we defined normal bp as sbp<130 mm hg or diastolic bp (dbp) < 85 mm hg.30 31 for persons with higher values (sbp 130139 mm hg or dbp 8589 mm hg) within the prehypertensive range, stroke risk is reported to be substantially increased.32 a guideline recommends treatment for subjects with sbp 130 mm hg.31 clinical backgrounds were compared between groups using student t tests or tests, as appropriate ; significance was established at p<0.05. survival analysis of subsequent endpoints began on the day of pet examination, which was considered the date of entry into the study. multivariate analysis with the cox proportional hazards model was used to test the effect of multiple variables on stroke recurrence. covariate selection was performed by including the following covariates in a stepwise model : age, sex, recurrent symptoms (recurrent episodes of ischaemic attack prior to pet or after angiographic demonstration of arterial disease), time between the last symptoms and pet, symptomatic arterial occlusion, extracranial ica occlusion, complications (hypertension, diabetes mellitus, prior ischaemic heart disease, hypercholesterolaemia), smoking habit, bp during follow - up (categorisation or normal bp) and decreased cbf / cbv or misery perfusion. a forward stepwise selection was performed, and covariates were included and selected based on a significant relationship (p<0.05) with an outcome event to enter into the model and p<0.05 to remain in the model. the difference of the relationship of follow - up bp level with recurrent strokes in different subgroups of participants (patients with or without impaired perfusion) was evaluated by adding an interaction term to the model. thirty - two of the 130 patients had normal sbp (< 130 mm hg) during follow - up (table 1). these same patients also had normal dbp (< 85 mm hg) except for one patient (88 mm hg). none of the patient characteristics were significantly different between patients with normal sbp and those without. all but two patients in our study were treated with antiplatelet therapy. on the basis of the cbf / cbv values in the hemisphere supplied by the previously symptomatic artery, 39 patients (30.0%) the incidence of decreased cbf / cbv in patients with arterial occlusion (34/86, 39.5%) was significantly higher than that in patients with stenosis (5/44, 11.3%) (p=0.001). there were seven ischaemic strokes in the territory of the diseased artery, and six (including two haemorrhages) in other vascular territories. none of the patients was lost to follow - up. in univariate analysis using the cox proportional hazards model (table 2), there was a negative linear relationship between sbp and risk of stroke in the territory of the diseased artery ; the relative risk per 20 mm hg was 0.27 (95% ci 0.08 to 0.93, p<0.05). on the other hand, there was a positive linear relationship between sbp and risk of stroke in the other vascular territory ; the relative risk per 20 mm hg was 4.02 (95% ci 1.4 to 10.8, p<0.01). the 2-year incidence of ischaemic stroke in the territory of the diseased artery in patients with normal sbp (5/32 ; 15.6%) was significantly higher than that in patients without normal sbp (2/98, 2.0%, p<0.005 ; figure 1, table 3). six strokes, including two haemorrhages, in the other vascular territory occurred only in patients without normal sbp (6.1%). therefore, the total stroke incidence was 5/32 (15.6%) in patients with normal sbp and 8/98 (8.2%) in patients without. four patients without normal sbp died of non - cerebral causes during follow - up. univariate analysis of recurrent stroke risk factors categorisation=1, < 130 ; 2, 130149 ; 3, 150169 ; 4, 170 mm hg. bp, blood pressure ; cbf, cerebral blood flow ; cbv, cerebral blood volume ; ica, internal carotid artery ; ne, not estimable ; pet, positron emission tomography ; sbp, systolic blood pressure. two - year stroke occurrence and sbp misery perfusion or decreased cbf / cbv in territory. cbf, cerebral blood flow ; cbv, cerebral blood volume ; sbp, systolic blood pressure. meier cumulative failure curves for ipsilateral ischaemic stroke in patients with and without normal sbp. the number of patients who remained event - free and available for follow - up evaluation during each 6-month interval is shown at the bottom of the graph. sbp, systolic blood pressure. in multivariate analysis using the cox proportional hazards model, normal sbp and decreased cbf / cbv were selected and included in the final model for stroke in the territory of the diseased artery. normal sbp and decreased cbf / cbv were independently associated with increased risk of ischaemic stroke in the territory. the relative risk conferred by the presence of normal sbp and decreased cbf / cbv was 6.3 (95% ci 1.2 to 32.6, p<0.05) and 12.3 (95% ci 1.5 to 102.9, p<0.05), respectively. when misery perfusion was used as a covariate instead of decreased cbf / cbv, only misery perfusion was selected and included in the final model. for stroke in the other vascular territory, only sbp (categorisation) was selected and included in the final model. the risk of stroke in the other vascular territory was positively correlated with sbp. in the subgroup comparisons of total stroke recurrence rate with sbp, high total stroke risk was observed at lower bp values in patients with impaired perfusion and at higher bp values in patients without (interaction, p<0.01 ; figure 2). when data on both subgroups were combined, the 2-year incidence of total strokes in patients with values of sbp within the 130149 mm hg range (2/57, 3.6%) was significantly lower than in those whose bp fell outside of that range (11/73, 15.1%, p<0.05 ; figure 2). line graph showing subgroup comparisons of total stroke recurrence rate as a function of systolic blood pressure. when dbp values were categorised as < 75, 7584 and 85 mm hg, a similar tendency was observed between dbp and stroke risk without statistical significance ; the 2-year incidence of total strokes in each category was 5/27 (19%), 2/8 (25%) and 0/4 (0%) in patients with impaired perfusion, and 4/43 (9.3%), 0/36 (0%) and 2/12 (17%) in patients without, respectively. this study demonstrated that lower sbp during follow - up and impaired perfusion significantly increased the risk of ischaemic stroke in the territory of the diseased artery, while higher bp significantly increased the risk of stroke in other vascular territories. we demonstrated this by following 130 patients with symptomatic major cerebral arterial occlusive disease, including 86 patients with arterial occlusion. overall, high total stroke risk was observed at lower bp values in patients with impaired perfusion and at higher bp values in patients without. our results indicate that the relationship between follow - up bp level and recurrent stroke risk differs between patients with or without impaired perfusion. we observed a statistically significant interaction between the presence of impaired perfusion and the sbp stroke risk relationship in the present study. this finding supports a previous report documenting a similar interaction between the presence of bilateral severe ica stenosis and the sbp stroke risk relationship that may have been influenced by the presence of impaired perfusion.20 impaired perfusion is probably absent in the majority of patients with unilateral stenosis of the extracranial ica or intracranial large artery, which may explain the reported increase in stroke risk with bp in such patients.1921 lower bp during follow - up may increase the risk of recurrent stroke in patients with impaired perfusion at baseline. aggressive medical managements for secondary prevention may progressively decrease recurrent stroke risk in patients with ica or mca occlusive disease in general.33 34 treatment of hypertension may prevent progression of large or small cerebral artery disease, which may decrease stroke recurrence. bp control is also needed to prevent cerebral haemorrhage during antiplatelet therapy. however, the present results suggest that patients with impaired perfusion should be treated differently to those without. bp could be strictly controlled only in patients without impaired perfusion, but aggressive bp lowering should be avoided in patients with impaired perfusion. in the present study, patients with impaired perfusion who had normal bp (< 130 mm hg) and recurrent stroke during a follow - up visit exhibited higher bp (130 mm hg) at baseline, while no patients with impaired perfusion who exhibited normal bp at baseline and normal or higher bp during follow - up had recurrent stroke (data not shown). thus, bp lowering per se, as well as a lower target bp, might be associated with stroke risk in patients with impaired perfusion. we do not recommend lowering bp to the normal level (< 130 mm hg) in patients who had impaired perfusion and higher bp (130 mm hg) at baseline. treatment with antihypertensive drugs may be safe and reduce stroke recurrence only when individual haemodynamic status is correctly evaluated and an individualised goal is selected based on the presence of impaired perfusion. the presence of a j - shaped association between bp and risk of recurrent stroke is a matter of debate.17 35 in the present study, the relationship between sbp and total stroke recurrence was j - shaped. the incidence of total strokes was lowest in patients with sbp values within the 130149 mm hg range. furthermore, the present results clearly demonstrate that this j - shaped association was caused by the combined effects of the negative association with recurrent stroke in patients with impaired perfusion and the positive association with recurrent stroke in patients without impaired perfusion. the negative association in patients with impaired perfusion would be masked in a patient sample with a low prevalence of impaired perfusion.20 the difference of the proportion of patients with impaired perfusion and large artery disease may have contributed to the discrepant results among previous studies investigating the association between bp and stroke recurrence.17 35 this study was a post hoc analysis of an observational study based on just 13 strokes in 130 selected patients ; therefore, we can not exclude the possibility that unmeasured confounding variables may explain some of our findings. the patients had a mixture of ica and mca diseases, which may make it difficult to accurately compare patient groups. in addition to referral bias, exclusion of patients who underwent bypass may have caused selection bias. although patients with bypass surgery had a higher incidence of impaired perfusion, they had similar baseline clinical characteristics. bp was obtained with a single - visit measurement, which may have led to a misclassification of bp levels. although the bp measurements might lead to a change in treatment, using bp measured at the last visit might allow analysis of the relationship between stroke and bp near the time of the event. in some patients, haemodynamic compromise severity might not have been reflected by pet variables in the whole hemisphere ; rather, they may have been more regional (eg, in a watershed region). however, such patients with regional haemodynamic compromise may be less susceptible to bp decreases. correct evaluations of haemodynamic status using o - gas pet could identify a subgroup of patients with impaired perfusion and high stroke risk at lower bps. the cbf / cbv is the reciprocal of the expression for vascular mean transit time (mtt) that can be evaluated by perfusion imaging with mri or ct in routine clinical practice.36 37 hemispheric cbf / cbv values below 7.6/min correspond to mtt values above 7.8 s. future studies should use perfusion mri or ct methods to assess relationships among impaired perfusion, bp and stroke recurrence in a larger patient sample. a randomised controlled trial including direct haemodynamic measurement is needed to determine the level to which bp should be lowered to achieve maximal benefits in patients with or without impaired perfusion. our results indicate that the relationship between follow - up bp level and recurrent stroke risk differs between patients with or without impaired perfusion. we observed a statistically significant interaction between the presence of impaired perfusion and the sbp stroke risk relationship in the present study. this finding supports a previous report documenting a similar interaction between the presence of bilateral severe ica stenosis and the sbp stroke risk relationship that may have been influenced by the presence of impaired perfusion.20 impaired perfusion is probably absent in the majority of patients with unilateral stenosis of the extracranial ica or intracranial large artery, which may explain the reported increase in stroke risk with bp in such patients.1921 lower bp during follow - up may increase the risk of recurrent stroke in patients with impaired perfusion at baseline. aggressive medical managements for secondary prevention may progressively decrease recurrent stroke risk in patients with ica or mca occlusive disease in general.33 34 treatment of hypertension may prevent progression of large or small cerebral artery disease, which may decrease stroke recurrence. however, the present results suggest that patients with impaired perfusion should be treated differently to those without. bp could be strictly controlled only in patients without impaired perfusion, but aggressive bp lowering should be avoided in patients with impaired perfusion. in the present study, patients with impaired perfusion who had normal bp (< 130 mm hg) and recurrent stroke during a follow - up visit exhibited higher bp (130 mm hg) at baseline, while no patients with impaired perfusion who exhibited normal bp at baseline and normal or higher bp during follow - up had recurrent stroke (data not shown). thus, bp lowering per se, as well as a lower target bp, might be associated with stroke risk in patients with impaired perfusion. we do not recommend lowering bp to the normal level (< 130 mm hg) in patients who had impaired perfusion and higher bp (130 mm hg) at baseline. treatment with antihypertensive drugs may be safe and reduce stroke recurrence only when individual haemodynamic status is correctly evaluated and an individualised goal is selected based on the presence of impaired perfusion. the presence of a j - shaped association between bp and risk of recurrent stroke is a matter of debate.17 35 in the present study, the relationship between sbp and total stroke recurrence was j - shaped. the incidence of total strokes was lowest in patients with sbp values within the 130149 mm hg range. furthermore, the present results clearly demonstrate that this j - shaped association was caused by the combined effects of the negative association with recurrent stroke in patients with impaired perfusion and the positive association with recurrent stroke in patients without impaired perfusion. the negative association in patients with impaired perfusion would be masked in a patient sample with a low prevalence of impaired perfusion.20 the difference of the proportion of patients with impaired perfusion and large artery disease may have contributed to the discrepant results among previous studies investigating the association between bp and stroke recurrence.17 35 this study was a post hoc analysis of an observational study based on just 13 strokes in 130 selected patients ; therefore, we can not exclude the possibility that unmeasured confounding variables may explain some of our findings. the patients had a mixture of ica and mca diseases, which may make it difficult to accurately compare patient groups. in addition to referral bias, exclusion of patients who underwent bypass may have caused selection bias. although patients with bypass surgery had a higher incidence of impaired perfusion, they had similar baseline clinical characteristics. bp was obtained with a single - visit measurement, which may have led to a misclassification of bp levels. although the bp measurements might lead to a change in treatment, using bp measured at the last visit might allow analysis of the relationship between stroke and bp near the time of the event. in some patients, haemodynamic compromise severity might not have been reflected by pet variables in the whole hemisphere ; rather, they may have been more regional (eg, in a watershed region). however, such patients with regional haemodynamic compromise may be less susceptible to bp decreases. correct evaluations of haemodynamic status using o - gas pet could identify a subgroup of patients with impaired perfusion and high stroke risk at lower bps. the cbf / cbv is the reciprocal of the expression for vascular mean transit time (mtt) that can be evaluated by perfusion imaging with mri or ct in routine clinical practice.36 37 hemispheric cbf / cbv values below 7.6/min correspond to mtt values above 7.8 s. future studies should use perfusion mri or ct methods to assess relationships among impaired perfusion, bp and stroke recurrence in a larger patient sample. a randomised controlled trial including direct haemodynamic measurement is needed to determine the level to which bp should be lowered to achieve maximal benefits in patients with or without impaired perfusion. in patients with symptomatic major cerebral arterial occlusive disease, impaired perfusion modifies the relationship between bp and stroke risk. total stroke risk may be high at lower bp in patients with impaired perfusion and at higher bp in patients without. for appropriate bp control, patients with and without impaired perfusion should be treated differently, and aggressive bp lowering should be avoided in patients with impaired perfusion. thus, the identification of patients with impaired perfusion is essential for regulating bp to reduce stroke recurrence. | objectiveblood pressure (bp) lowering may increase stroke risk in patients with symptomatic major cerebral artery disease and impaired perfusion. to investigate the relationships among bp, impaired perfusion and stroke risk.methodswe retrospectively analysed data from 130 non - disabled, medically treated patients with either symptomatic extracranial carotid occlusion or intracranial stenosis or occlusion of the carotid artery or middle cerebral arteries. all patients had baseline haemodynamic measurements with 15o - gas positron emission tomography and were followed for 2 years or until stroke recurrence or death.resultsthere was a negative linear relationship between systolic bp (sbp) and risk of stroke in the territory of the diseased artery. the 2-year incidence of ischaemic stroke in the territory in patients with normal sbp (< 130 mm hg, 5/32 patients) was significantly higher than in patients with high sbp (2/98, p<0.005). multivariate analysis revealed that normal sbp and impaired perfusion were independently associated with increased risk of stroke in the previously affected territory, while risk of stroke elsewhere was positively correlated with sbp. overall, high total stroke risk was observed at lower bp in patients with impaired perfusion and at higher bps in patients without (interaction, p<0.01). overall, the relationship between sbp and total stroke recurrence was j-shaped.conclusionsimpaired perfusion modified the relationship between blood pressure and stroke risk, although this study had limitations including the retrospective analysis, the potentially biased sample, the small number of critical events and the fact that bp was measured only as a snapshot in clinic. |
usually, for a successful surgical eradication of medium ear diseases, the otologic surgeon must remove diseased anatomic structures and, sometimes, even normal structures. canal wall down mastoidectomy (cwd) is one of those common surgical techniques with variations of long - term outcomes. although the majority of patients experience little to no long - term problems postoperatively, there is a small but expressive number of patients with chronic complaints associated with the persistent mastoid bowl.1 recurrent drainage and infection are the most common cause of discontent and medical return for patients with mastoid bowls. other frequent complaints may include water intolerance, leading to infection, the need for frequent otomicroscopic cleaning, calorically induced vertigo from either water or air exposure, barometrically induced vertigo, and, in those with compromising hearing loss, being unable to wear traditional hearing aids.2 mosher, in 1911, started the idea of mastoid obliteration to promote healing of a mastoidectomy defect. mosher described an obliteration technique using a superiorly based postauricular soft tissue flap.3 the researcher noticed that the muscle atrophied over time, causing a progressive enlargement in cavity size. this observation is supported by histological data from the temporal bone study of linthicum,4 which demonstrates the replacement of muscle with fibro - connective tissue and fat. palva5 modified and popularized the technique, further adding to it the use of bone chips and bone pate in combination with an anteriorly based musculoperiosteal flap.5 over the course of the last decades, there have been a large number of reports detailing a multiplicity of techniques for obliterating the mastoid cavity. the most frequent and popular techniques consist of either local flaps (muscle, periosteum, or fascia) or free autologous grafts (bone, cartilage, fat, fascia), or even alloplastic grafts (hydroxyapatite, silicon, synthetics bones, among others).1 the decision whether to perform a intact canal wall mastoidectomy (icw) or cwd operation in patients with chronic ear disease is usually based on several factors, such as the extent of disease, an assessment of middle ear ventilation, the hearing in the ear in question, the state of the opposite ear, any preoperative complications, the condition of the patient, the possibility for follow - up, and the surgeon 's preference.6 the benefits and drawbacks of icw and cwd for cholesteatoma are well established. the greatest problem with icw techniques are the recidivism rates, reported as high as 40 to 60% in children and 20% in adults. this high rate of recurrence is associated with the relatively deficient exposure during surgery, the persistence of eustachian tube dysfunction, and the persistence of mucosa in the mastoid that keeps resorbing gas and creates a negative pressure environment for resurging of retraction pockets.7 although the cwd technique is known to have lower residual and recurrent cholesteatoma rates, as mentioned previously, it is often accompanied by the problems associated by the mastoid cavity such as crust accumulation, water intolerance and intermittent discharge. the principle behind the mastoid obliteration is that it combines the advantages of both techniques (cwd and icw).3 the purpose of this review is to evaluate the effectiveness of mastoid obliteration with autologous bone in mastoidectomy surgery with canal wall down for chronic otitis, with or without cholesteatoma, mainly for infection control and drainage, recurrence of cholesteatoma and water tolerance. in january 2015, we searched online databases for the following keywords : mastoid obliteration bone chronic otitis canal wall down. we searched medline, lilacs and ebsco databases. we were only able to find journal articles at medline, where 26 articles were found. we included other different and interesting articles that have met our selection criteria, which we obtained through the references in the articles initially searched. first, we tried to locate articles with randomized case - control studies, with no success. we selected articles with case series that included the technique used in the surgery specifically those that use autologous bone to obliterate the mastoid cavity associated with a canal wall down procedure with or without posterior reconstruction of the wall, and at least one year of mean follow - up of patients. we have included articles that used cartilage, fascia, skin grafts, or musculoperiosteal flaps to cover the obliterated bowl. we excluded any article that : was not specific to surgery in chronic otitis ; was on other associated mastoid filler materials like silicon, ceramics or other alloplastic materials ; was on musculoperiosteal and/or cartilage without using autologous bone parts ; was on total tympanomastoid obliteration ; was not written in english, spanish, or portuguese. after applying the selection criteria to the initial 26 articles, we selected six of them. they all had level 4 evidence : five were retrospective and one was a prospective case series, according to oxford centre for evidence - based medicine (table 1). one article, by walker was an updated version of a previous one,8 so we discarded the less current version. notes : last updated on march 2009. source : oxford centre for evidence - based medicine (http://www.cebm.net/oxford-centre-evidence-based-medicine-levels-evidence-march-2009/). when reviewing the references the articles mentioned above, as well as others pertinent to mastoid obliteration, we found four new studies that met the selection criteria. these were all retrospective case series, without a control group or randomization, and with level 4 evidence. number ; oblit, obliteration ; ocr, ossicular chain reconstruction ; pcw, posterior canal wall ; yrs, years. walker showed a retrospective case series of consecutive patients treated from 1997 to 2011 with a canal wall reconstruction (cwr) tympanomastoidectomy with mastoid obliteration using bone pate. the sample consisted of 285 ears with cholesteatoma in 273 patients, with a mean age of 35 years. there were 25 children under 10 years of age that had undergone surgery (average 6.9 years old). thirteen patients (4.6%) were lost to follow - up right after the surgery. thirty percent of the patients had previous surgery, with 20% having undergone icw mastoidectomy. the authors collected bone pate from healthy cortical bone with a sheehy pate collector and performed a simple mastoidectomy and atticotomy. they removed the incus and the malleus head, cut the posterior bone canal (pbc) superiorly and inferiorly with a saw and removed it. after removing the pbc, they cleaned the entire middle ear of cholesteatoma, put the pbc back, placing a large single block of bone harvested from mastoid tip blocking the attic to avoid retraction of the pocket into the attic space. smaller bone chips are placed to block the facial recess and prevent bone pate from entering the middle ear. the authors filled the bowl with bone pate and the original meatus skin would cover the pbc. typically, a second - look tympanoplasty with ossiculoplasty is performed 6 months after the initial tympanomastoidectomy. in this case series, 253 (89%) of 285 ears underwent the second - look operation, of which 30 (12%) had residual cholesteatoma only in the middle ear, which was successfully removed. of the returning patients, 38 (14%) developed retraction pockets toward the attic ; however, only 16 (5.9% of total) required an endaural atticotomy to improve access for debridement. these ears are now dray and self - cleaning. after the attic blocking technique was replaced with a single large bone block in 2005, only 7.1% of the patients developed retraction pockets. seven patients (2.6%) developed a recurrence of cholesteatoma, having to convert to an open cavity. when making the canal wall cuts, 14 ears (4.9%) had intraoperative cerebral spinal fluid leakage, all of which were immediately detected and repaired. edfeldt 9 published an article with a series of 330 operated ears in adults (over 12 years in age) with cholesteatoma in 301 patients. they underwent an operation performed by three senior surgeons between 1982 and 2004 using an identical technique. from this sample, 156 ears (47%) had undergone previous surgeries, while 61% had undergone one previous operation. the surgeons performed a cwd mastoidectomy, meatoplasty, and used cartilage from the tragus or meatus to rebuild the wall. when necessary, they reconstructed the ossicular chain at the same stage with autologous cortical bone or shaped incus. a large temporal fascia was used for myringoplasty and to cover the reconstructed ear canal. they did not use computer tomography (ct) nor magnetic resonance imaging (mri). nine cases (3%) had residual disease and 33 cases (10%) had recurrent disease during the study period. the study did not inform whether there was a need to convert to an open cavity in any of the cases. they did report, however, that only one case had recurrent ear discharge, after 6 years of follow - up. edfeldt published another retrospective case series that included only children under 12 years of age, with a mean age of 8.2 years. the group consisted of 57 children with cholesteatoma, five of which presented congenital cholesteatoma. they all underwent operations by three senior surgeons between 1983 and 2004, who used the exact surgical technique described in the previous paragraph. all of the patients had a follow - up period of at least 6 years. the authors confirmed and checked three residual (5%) and seven recurrent cholesteatoma (12%). three (42%) of the recurrent cholesteatoma were located in the reconstructed ear canal. the authors compared these results to their database from operated adults, and found that they were similar. mokbel and khafagy11 showed a prospective case series with 100 adults operated between 2003 and 2010. the inclusion criteria were patients with unilateral chronic suppurative otitis media, with no history of mastoidectomy or systemic debilitating condition. the minimum follow - up period was 12 months, extending up to 72 months (52% of the patients). the authors performed a cwd mastoidectomy, large meatoplasty, anterior and inferior canaloplasty, obliterated with cortical bone pate, and covered it with musculoperiosteal flap. the flap and exposed bone was covered with temporal fascia and split - thickness skin grafts. all cases completed the 12-month follow - up and 78% had complete dry cavity, 16% had intermittent otorrhea and 6% with persistent discharge. throughout the follow - up period, 10 patients presented persistent discharge, all of them caused by the presence of granulation tissues. these patients were treated with a revision surgery (6%) and cauterization (4%), which resulted in 8 patients becoming dry. kronenberg came forth with a retrospective case series that included 49 consecutive patients (31 children and 18 adults) that had undergone surgery between 2008 and 2011. they all had cholesteatoma and their mean follow - up period was 28 months (the authors did not mention the minimum or the maximum follow - up time). the authors used a technique similar to that used by walker whereby they collected bone pate from cortical bone, made a simple mastoidectomy and atticotomy, removed the incus and the malleus head, cut the posterior bone canal (pbc) superiorly and inferiorly, and removed it. after removing the pbc, they fully cleaned the middle ear of cholesteatoma, examined the sinus tympani with a 30 endoscope, restored the pbc, placed cartilage blocking the attic, and filled the bowl with bone pate. they covered the pbc with tragus perichondrium and the tympanic membrane with temporalis fascia. in the secondary surgery group, if there was damage to the pbc, the patients underwent a reconstruction using cartilage. the authors found recurrent cholesteatoma in six patients (12%) ; three from the group undergoing first surgery and three in the other group. the authors identified all the cholesteatomas using non - epi diffusion - weighted (dw) mri, and observed that they were small and located only in the tympanic cavity. thirty - five patients (77.8%) were water safe during the follow - up period. in primary surgery, however, the surgeons achieved 85.7% water - safe and 90% with dry ear, contrasting with the other group, which had 64% and 73%, respectively. sun presented a retrospective case series that consisted of 45 children aged between 5 and 12 years (mean age was 10 years), with a total of 48 ears that had undergone procedures in the period between 1999 and 2006. the surgeons performed a cwd mastoidectomy, removed the incus and the head of the malleus, performed a meatoplasty and harvested cartilage from concha. they used bone pate to seal the epitympanum and bone pate, cartilage, and musculoperiosteal flap to cover the mastoid. then, a temporalis fascia graft was placed to reconstruct the tympanic membrane and cover the obliteration. the study found recurrent cholesteatoma in two patients (4.16%) (at 16 months and 33 months) and all were located in the tympanic cavity. epithelization of the mastoid bowl was completed within 810 weeks, and all ears were dry within the same 810 weeks. beutner demonstrated a case series of patients that had already been submitted to cwd mastoidectomy and were undergoing a revision surgery with cwd mastoidectomy with obliteration using autologous bone pate, covered with cartilage plates. the surgeon performed a meatoplasty and reconstructed the tympanic membrane with thinned slices of cartilage. the authors selected 26 patients, but only 18 of them agreed to a complete follow - up, including vestibular testing. the median follow - up period was 6 years and mean age was 46 years. none of the selected patients had residual or recurrent cholesteatoma. in analyzing preoperative data, 14 patients of the 26 patients (53.8%) had reported that caloric stimuli (such as wind, water, or suction cleaning) regularly induced vertigo. after the surgery, none of the patients reported similar symptoms in the same situations and all patients had dry ear with complete epithelization. ramsey presented a retrospective clinical study of 60 consecutive surgeries between 1995 and 2000 for active chronic otitis media. all patients had cwd mastoidectomy with simultaneous tympanoplasty, including split - thickness skin grafting. an inferiorly pedicled periosteal - pericranial flap was used in conjunction with autologous bone pate to obliterate the mastoid cavity. the ages ranged from 4 to 84 years, with a mean of 39 years. fifty - three ears (88%) had cholesteatoma, and the others presented granulation tissue without cholesteatoma. the minimum follow - up period was 12 months, with a mean of 32 months (maximum 80 months). the authors followed - up on 36 ears (60%) for over 24 months and 18 ears (30%) for over 36 months. of all procedures six patients (10%) had frequent discharge, of which four had meatal stenosis and underwent revision surgery. the other two cases were attributable to granulation tissue, treated with office management debridement with secondary split - thickness skin grafting. roberson presented a retrospective case series of 57 patients with 62 operated ears. the average of patients with previous surgery before obliteration was 2.2 (ranging from 07). twenty - seven patients had cholesteatoma at the time of the obliteration ; other indications were recurrent infections, water intolerance, hearing device intolerance, excessive recurrent cleaning, and caloric induced vertigo or vestibular fistula. the technique was a cwd mastoidectomy or revision of it, associated with an adequate meatoplasty, if necessary, and the removal of incus and head of malleus. it is important to avoid the exposure of any pate to either the middle ear or the external auditory canal, without a fascia covering it. the mean follow - up period was 18.5 months (ranging from 0.254.8 months). thirty - six ears underwent second - stage reconstructive surgery and four patients (6.4% of 62 ears) had residual cholesteatoma. two patients presented partial reabsorption of bone pate, having early and recurrent infections. for both of these patients, the surgical indications were recurrent infection. eight patients had early canal infections, 6 of them with subsequent clearing, and the other two were the ones presenting reabsorption. ninety - two percent of patients who had complete take of the bone graft did not require any cleaning (87% of all ears). in january 2015, we searched online databases for the following keywords : mastoid obliteration bone chronic otitis canal wall down. we searched medline, lilacs and ebsco databases. we were only able to find journal articles at medline, where 26 articles were found. we included other different and interesting articles that have met our selection criteria, which we obtained through the references in the articles initially searched. first, we tried to locate articles with randomized case - control studies, with no success. we selected articles with case series that included the technique used in the surgery specifically those that use autologous bone to obliterate the mastoid cavity associated with a canal wall down procedure with or without posterior reconstruction of the wall, and at least one year of mean follow - up of patients. we have included articles that used cartilage, fascia, skin grafts, or musculoperiosteal flaps to cover the obliterated bowl. we excluded any article that : was not specific to surgery in chronic otitis ; was on other associated mastoid filler materials like silicon, ceramics or other alloplastic materials ; was on musculoperiosteal and/or cartilage without using autologous bone parts ; was on total tympanomastoid obliteration ; was not written in english, spanish, or portuguese. after applying the selection criteria to the initial 26 articles, we selected six of them. they all had level 4 evidence : five were retrospective and one was a prospective case series, according to oxford centre for evidence - based medicine (table 1). one article, by walker was an updated version of a previous one,8 so we discarded the less current version. notes : last updated on march 2009. source : oxford centre for evidence - based medicine (http://www.cebm.net/oxford-centre-evidence-based-medicine-levels-evidence-march-2009/). when reviewing the references the articles mentioned above, as well as others pertinent to mastoid obliteration, we found four new studies that met the selection criteria. these were all retrospective case series, without a control group or randomization, and with level 4 evidence. number ; oblit, obliteration ; ocr, ossicular chain reconstruction ; pcw, posterior canal wall ; yrs, years. walker showed a retrospective case series of consecutive patients treated from 1997 to 2011 with a canal wall reconstruction (cwr) tympanomastoidectomy with mastoid obliteration using bone pate. the sample consisted of 285 ears with cholesteatoma in 273 patients, with a mean age of 35 years. there were 25 children under 10 years of age that had undergone surgery (average 6.9 years old). thirteen patients (4.6%) were lost to follow - up right after the surgery. thirty percent of the patients had previous surgery, with 20% having undergone icw mastoidectomy. the authors collected bone pate from healthy cortical bone with a sheehy pate collector and performed a simple mastoidectomy and atticotomy. they removed the incus and the malleus head, cut the posterior bone canal (pbc) superiorly and inferiorly with a saw and removed it. after removing the pbc, they cleaned the entire middle ear of cholesteatoma, put the pbc back, placing a large single block of bone harvested from mastoid tip blocking the attic to avoid retraction of the pocket into the attic space. smaller bone chips are placed to block the facial recess and prevent bone pate from entering the middle ear. the authors filled the bowl with bone pate and the original meatus skin would cover the pbc. typically, a second - look tympanoplasty with ossiculoplasty is performed 6 months after the initial tympanomastoidectomy. in this case series, 253 (89%) of 285 ears underwent the second - look operation, of which 30 (12%) had residual cholesteatoma only in the middle ear, which was successfully removed. of the returning patients, 38 (14%) developed retraction pockets toward the attic ; however, only 16 (5.9% of total) required an endaural atticotomy to improve access for debridement. these ears are now dray and self - cleaning. after the attic blocking technique was replaced with a single large bone block in 2005, only 7.1% of the patients developed retraction pockets. seven patients (2.6%) developed a recurrence of cholesteatoma, having to convert to an open cavity. when making the canal wall cuts, 14 ears (4.9%) had intraoperative cerebral spinal fluid leakage, all of which were immediately detected and repaired. edfeldt 9 published an article with a series of 330 operated ears in adults (over 12 years in age) with cholesteatoma in 301 patients. they underwent an operation performed by three senior surgeons between 1982 and 2004 using an identical technique. from this sample, 156 ears (47%) had undergone previous surgeries, while 61% had undergone one previous operation. the surgeons performed a cwd mastoidectomy, meatoplasty, and used cartilage from the tragus or meatus to rebuild the wall. when necessary, they reconstructed the ossicular chain at the same stage with autologous cortical bone or shaped incus. a large temporal fascia was used for myringoplasty and to cover the reconstructed ear canal. they did not use computer tomography (ct) nor magnetic resonance imaging (mri). nine cases (3%) had residual disease and 33 cases (10%) had recurrent disease during the study period. the study did not inform whether there was a need to convert to an open cavity in any of the cases. they did report, however, that only one case had recurrent ear discharge, after 6 years of follow - up. edfeldt published another retrospective case series that included only children under 12 years of age, with a mean age of 8.2 years. the group consisted of 57 children with cholesteatoma, five of which presented congenital cholesteatoma. they all underwent operations by three senior surgeons between 1983 and 2004, who used the exact surgical technique described in the previous paragraph. all of the patients had a follow - up period of at least 6 years. the authors confirmed and checked three residual (5%) and seven recurrent cholesteatoma (12%). three (42%) of the recurrent cholesteatoma were located in the reconstructed ear canal. the authors compared these results to their database from operated adults, and found that they were similar. mokbel and khafagy11 showed a prospective case series with 100 adults operated between 2003 and 2010. the inclusion criteria were patients with unilateral chronic suppurative otitis media, with no history of mastoidectomy or systemic debilitating condition. the minimum follow - up period was 12 months, extending up to 72 months (52% of the patients). the authors performed a cwd mastoidectomy, large meatoplasty, anterior and inferior canaloplasty, obliterated with cortical bone pate, and covered it with musculoperiosteal flap. the flap and exposed bone was covered with temporal fascia and split - thickness skin grafts. all cases completed the 12-month follow - up and 78% had complete dry cavity, 16% had intermittent otorrhea and 6% with persistent discharge. throughout the follow - up period, 10 patients presented persistent discharge, all of them caused by the presence of granulation tissues. these patients were treated with a revision surgery (6%) and cauterization (4%), which resulted in 8 patients becoming dry. kronenberg came forth with a retrospective case series that included 49 consecutive patients (31 children and 18 adults) that had undergone surgery between 2008 and 2011. they all had cholesteatoma and their mean follow - up period was 28 months (the authors did not mention the minimum or the maximum follow - up time). the authors used a technique similar to that used by walker whereby they collected bone pate from cortical bone, made a simple mastoidectomy and atticotomy, removed the incus and the malleus head, cut the posterior bone canal (pbc) superiorly and inferiorly, and removed it. after removing the pbc, they fully cleaned the middle ear of cholesteatoma, examined the sinus tympani with a 30 endoscope, restored the pbc, placed cartilage blocking the attic, and filled the bowl with bone pate. they covered the pbc with tragus perichondrium and the tympanic membrane with temporalis fascia. in the secondary surgery group, if there was damage to the pbc, the patients underwent a reconstruction using cartilage. the authors found recurrent cholesteatoma in six patients (12%) ; three from the group undergoing first surgery and three in the other group. the authors identified all the cholesteatomas using non - epi diffusion - weighted (dw) mri, and observed that they were small and located only in the tympanic cavity. thirty - five patients (77.8%) were water safe during the follow - up period. in primary surgery, however, the surgeons achieved 85.7% water - safe and 90% with dry ear, contrasting with the other group, which had 64% and 73%, respectively. sun presented a retrospective case series that consisted of 45 children aged between 5 and 12 years (mean age was 10 years), with a total of 48 ears that had undergone procedures in the period between 1999 and 2006. the surgeons performed a cwd mastoidectomy, removed the incus and the head of the malleus, performed a meatoplasty and harvested cartilage from concha. they used bone pate to seal the epitympanum and bone pate, cartilage, and musculoperiosteal flap to cover the mastoid. then, a temporalis fascia graft was placed to reconstruct the tympanic membrane and cover the obliteration. the study found recurrent cholesteatoma in two patients (4.16%) (at 16 months and 33 months) and all were located in the tympanic cavity. epithelization of the mastoid bowl was completed within 810 weeks, and all ears were dry within the same 810 weeks. beutner demonstrated a case series of patients that had already been submitted to cwd mastoidectomy and were undergoing a revision surgery with cwd mastoidectomy with obliteration using autologous bone pate, covered with cartilage plates. the surgeon performed a meatoplasty and reconstructed the tympanic membrane with thinned slices of cartilage. the authors selected 26 patients, but only 18 of them agreed to a complete follow - up, including vestibular testing. the median follow - up period was 6 years and mean age was 46 years. none of the selected patients had residual or recurrent cholesteatoma. in analyzing preoperative data, 14 patients of the 26 patients (53.8%) had reported that caloric stimuli (such as wind, water, or suction cleaning) regularly induced vertigo. after the surgery, none of the patients reported similar symptoms in the same situations and all patients had dry ear with complete epithelization. ramsey presented a retrospective clinical study of 60 consecutive surgeries between 1995 and 2000 for active chronic otitis media. all patients had cwd mastoidectomy with simultaneous tympanoplasty, including split - thickness skin grafting. an inferiorly pedicled periosteal - pericranial flap was used in conjunction with autologous bone pate to obliterate the mastoid cavity. the ages ranged from 4 to 84 years, with a mean of 39 years. fifty - three ears (88%) had cholesteatoma, and the others presented granulation tissue without cholesteatoma. the minimum follow - up period was 12 months, with a mean of 32 months (maximum 80 months). the authors followed - up on 36 ears (60%) for over 24 months and 18 ears (30%) for over 36 months. of all procedures six patients (10%) had frequent discharge, of which four had meatal stenosis and underwent revision surgery. the other two cases were attributable to granulation tissue, treated with office management debridement with secondary split - thickness skin grafting. roberson presented a retrospective case series of 57 patients with 62 operated ears. the average of patients with previous surgery before obliteration was 2.2 (ranging from 07). twenty - seven patients had cholesteatoma at the time of the obliteration ; other indications were recurrent infections, water intolerance, hearing device intolerance, excessive recurrent cleaning, and caloric induced vertigo or vestibular fistula. the technique was a cwd mastoidectomy or revision of it, associated with an adequate meatoplasty, if necessary, and the removal of incus and head of malleus. it is important to avoid the exposure of any pate to either the middle ear or the external auditory canal, without a fascia covering it. the mean follow - up period was 18.5 months (ranging from 0.254.8 months). thirty - six ears underwent second - stage reconstructive surgery and four patients (6.4% of 62 ears) had residual cholesteatoma. eight patients had early canal infections, 6 of them with subsequent clearing, and the other two were the ones presenting reabsorption. ninety - two percent of patients who had complete take of the bone graft did not require any cleaning (87% of all ears). usually, otologists treat recurrent mastoid disease with techniques that remove tissue and further changes to the normal anatomy. cwd mastoidectomy removes the entire posterior bony wall, showing excellent exposure of the middle ear and epitympanum. this helps to complete disease elimination with lower rates of recidivism, reported herein as 2% to 17%. the open cavity procedure is widely considered the gold standard for cholesteatoma management due to the low recurrence rates.7 it is generally accepted that the goals that lead to a trouble - free cavity include complete remove of the disease, a smoothly contoured cavity with a low facial ridge, and extensive meatoplasty.16 patients may undergo multiple surgeries in an attempt to achieve such goals. in many cases, however, greater tissue removal during revision surgery yields disappointing results or may even be counterproductive. although this strategy is successful in the majority of patients, some continue to have issues, such as : recurrent infections ; the need for continued microscopic debridement ; water intolerance ; calorically induced vertigo ; or the inability to wear a hearing device, because the large mastoid cavity becomes easily infected when the external auditory canal is occluded, allowing moisture and bacterial proliferation within an existing canal wall down mastoid cavity.2 throughout many years, surgeons have been developing different techniques to reduce mastoid cavity and epitympanic space in the hope of avoiding such complications. isolating the attic from the middle ear and obliterating the attic and mastoid with bone pate prevents retraction pockets and new cholesteatoma development.17 there is no evidence to date that indicates that one particular filler material is better than another is. autologous bone and cartilage, and traditional alloplastic materials such as hydroxyapatite and serenocem (miamisburg, usa) have all stood the test of time. the factors that are most likely to influence the surgeos choice of filler materials are the material user - friendliness and cost and the surgeos personal preference, rather than scientific reasons.3 the diversity of flaps available indicates that there is no ideal flap for this purpose.18 bone pate is an autologous material that is readily available in primary and revision cases. after reviewing all those articles, we can safely affirm that mastoid obliteration with autogenous cranial bone pate is a safe and extremely effective option in the treatment of problematic canal wall down mastoid cavities, which result in a dry, trouble - free mastoid cavity. linthicum4 reported that the bone pate became encircled by fibroconnective tissue without inflammation. in the immediate surrounding area, removing the head of the malleus allows for an inspection of the total posterior epitympanic space and removal of the cog. it is hard to inspect the anterior epitympanum and tympanum together with the canal wall in place, and this deficiency of exposure may partially account for higher rates of recurrence in icw mastoids.7 most surgeons consider cholesteatoma in children to be more aggressive and difficult to treat than in adults.10 this may mean that toddler cholesteatoma has a different biology, with an elevated grade of cell proliferation, which would explain the higher rate of recurrence and residual disease in children. consequently, optimal functional outcome could be more intricate to accomplish, requiring the second look principle.19 looking over the selected articles, we could find great infection control rates, with four articles presenting 0% recurrence of cholesteatoma, going up to 15%. these achievements are similar to those expected from cwd mastoidectomy without obliteration, with the added advantage of patients ' having greater water resistance and needing less clinical care in the cavity. he compared the cohort to a group with less than 10 years of follow - up and found that the group with a follow - up period of 10 years or greater had higher rates of recurrence. for the group with 10 years or greater of follow - up, the recurrence rate was 17%, but those with less than 10 years had only 8.8% recurrence.20 this implies that even cwd mastoidectomy needs to be followed - up in the long term, in clinical offices and in cohort studies. based on these findings and on the increasing cholesteatoma rates over time found in the walker case series, we come to the conclusion that we need more long - term follow - up articles, closer to or greater than a 10-year minimum. one of the most criticized aspects of mastoid obliteration is the possibility of a silent cholesteatoma within the obliterated cavity, resulting in a severe complication. perhaps one of the most exciting developments in cholesteatoma research is magnetic resonance imaging (mri). this technique allows the differentiation of cholesteatoma from granulation, cholesterol granuloma, and various filler materials within the mastoid cavity.3 aarts examined the result of three non - echo - planar (non - epi) diffusion - weighted (dw) mri studies and found that the corresponding pooled sensitivity, specificity, positive predictive value and negative predictive value in cholesteatoma detection were 97% to all four.21 the recent development of mri means there is now a reliable way to detect cholesteatoma within the obliterated mastoid cavities, which mitigates concerns that hidden cholesteatoma could be missed. in reality, many otologists had been performing mastoid obliteration surgery long before dw mri imaging was available, and the long - term outcome was favorable. therefore, non - availability of non - epi dw mri should not be an obstacle for the introduction of mastoid obliteration into one 's otological practice.3 all the articles mentioned in table 2 have a c grade for recommendation level (table 1). for a more confident recommendation level, the studies should have an improved design, adopting prospective long - term randomized case control studies. in analyzing the current studies, we are not able to determine the better technique : the cwd or the cwd with obliteration with autologous bone. however, compiling all the conclusions found in the articles selected for this study, we can conclude that mastoid obliteration with autologous bone has been utilized for many years now and that is has proven to be a safe low - cost technique with low recurrence rates. although it is similar to traditional canal wall down procedures, it produces more favorable results in terms of water resistance and quality of life for patients. the procedure could be done in primary surgery, or upon revision surgery on patients with unstable cavities, even after radical mastoidectomy. there are many different surgical techniques and filler materials for mastoid obliteration, and so far, there has not been any evidence of a better one. the main factor in selecting a technique seems to be the surgeons previous experience and cost.3 | introduction the objectives of mastoidectomy in cholesteatoma are a disease - free and dry ear, the prevention of recurrent disease, and the maintenance of hearing or the possibility to reconstruct an affected hearing mechanism. canal wall down mastoidectomy has been traditionally used to achieve those goals with greater or lesser degrees of success. however, canal wall down is an aggressive approach, as it involves creating an open cavity and changing the anatomy and physiology of the middle ear and mastoid. a canal wall up technique eliminates the need to destroy the middle ear and mastoid, but is associated with a higher rate of residual cholesteatoma. the obliteration technics arise as an effort to avoid the disadvantages of both techniques. objectives evaluate the effectiveness of the mastoid obliteration with autologous bone in mastoidectomy surgery with canal wall down for chronic otitis, with or without cholesteatoma. data synthesis we analyzed nine studies of case series comprehending similar surgery techniques on 1017 total cases of operated ears in both adults and children, with at least 12 months follow - up. conclusion mastoid obliteration with autologous bone has been utilized for many years to present date, and it seems to be safe, low - cost, with low recurrence rates - similar to traditional canal wall down procedures and with greater water resistance and quality of life improvements. |
genetic studies applied in this research were approved by the ethics committees of the zna (hospital network antwerp), the antwerp university hospital, and university of antwerp. clinical protocols were approved by the ethics committees of the zna, the antwerp university hospital, and local ethical review boards of the participating research centers. all human biological samples were collected, fulfilling ethical approvals, and used in accordance with the terms of subjects ' written informed consent. the genetic epidemiology of parkinson 's disease (geo - pd) consortium includes investigators from 60 sites from 30 countries and 6 continents (http://www.geo-pd.org/about/). a total of 18 sites representing 12 countries and 4 continents contributed either dna or genotypic data, and clinical data of in total 15,123 individuals (tables 1 and 2). after thorough quality control as described in the procedures section below, 13,669 samples were included in this study. we excluded all duplicate samples, sex mismatches, and samples that failed in the dna fingerprint analysis because of low quantity or quality of dna or because of contamination of the sample. demographics and diagnostic criteria of each series included in this study and the sample size breakdown from each site are provided in table 2. synopsis of this global geo - pd study characteristics of the geo - pd cohorts included in the study concentration and purity were checked spectrophotometrically using the trinean dropsense96 uv / vis droplet reader (trinean, gentbrugge, belgium) for all consortium genomic dna samples. developed multiplex pcr panel composed of 13 short tandem repeat (str) markers distributed over multiple autosomal locations : d20s480, d22s1174, d3s1287, d3s1744, d3s1764, d7s672, d7s2426, d8s1746, d14s1005, d20s866, d10s1237, d20s912, and d6s965. this panel also includes a marker specific for the x chromosome (dxs1187) and one for the sry gene on the y chromosome, and enables fast and accurate sample identification and sex determination in a single assay. after selective amplification of 20 ng genomic dna, amplification products were size separated on an abi 3730 automatic sequencer (applied biosystems, foster city, ca) using genescan-600 liz (applied biosystems) as internal size standard and genotypes were assigned using in - house developed traci genotyping software (http://www.vibgeneticservicefacility.be). to screen the geo - pd cohorts for the pathogenic (g4c2)>60 c9orf72 repeat expansion, we designed a 2-step procedure : an str fragment length assay with flanking pcr primers optimized for alleles with high gc content (str - pcr) followed by 2 repeat - primed pcr assays (forward and reverse rp - pcr) as described earlier. four participating research groups performed the genotyping in their local facilities according to previously published procedures. for consistent allele scoring of repeat lengths between geo - pd groups and accurate interpretation of the repeat length, we designed a reference dna set of 14 samples covering a range of normal repeat sizes that was genotyped by each of these facilities. furthermore, for 2 of the cohorts, a random set of samples homozygous for the str - pcr assay were included in the rp - pcr analysis at the antwerp site for independent validation of the absence of a pathogenic repeat expansion. to investigate the association between repeat units and pd susceptibility, 3 explorative approaches were followed, based on (1) allele counts of the distinct repeat sizes, to determine whether one or more specific repeat sizes were associated with pd, (2) the total number of repeat units (sum of both alleles) per individual, and (3) the size of the longest repeat per individual (maximum allele). summary statistics were computed in a random - effects meta - analysis (dersimonian - laird) for each approach in the rmeta package implemented in the r environment version 2.15.3. based on the results obtained in the above - mentioned analyses details are provided in the e - methods on the neurology web site at neurology.org. to take into account the number of tests performed (n = 22), a bonferroni - corrected 2-sided p value of 0.002 was considered statistically significant. population attributable risk of (g4c2)10, (g4c2)10, and (g4c2)17 was estimated using the epir package in r. for the meta - analyses, only the cohorts including both the patients with pd and the controls that were size - corrected based on the reference panel were included in the study. genetic studies applied in this research were approved by the ethics committees of the zna (hospital network antwerp), the antwerp university hospital, and university of antwerp. clinical protocols were approved by the ethics committees of the zna, the antwerp university hospital, and local ethical review boards of the participating research centers. all human biological samples were collected, fulfilling ethical approvals, and used in accordance with the terms of subjects ' written informed consent. the genetic epidemiology of parkinson 's disease (geo - pd) consortium includes investigators from 60 sites from 30 countries and 6 continents (http://www.geo-pd.org/about/). a total of 18 sites representing 12 countries and 4 continents contributed either dna or genotypic data, and clinical data of in total 15,123 individuals (tables 1 and 2). after thorough quality control as described in the procedures section below, 13,669 samples were included in this study. we excluded all duplicate samples, sex mismatches, and samples that failed in the dna fingerprint analysis because of low quantity or quality of dna or because of contamination of the sample. demographics and diagnostic criteria of each series included in this study and the sample size breakdown from each site are provided in table 2. synopsis of this global geo - pd study characteristics of the geo - pd cohorts included in the study concentration and purity were checked spectrophotometrically using the trinean dropsense96 uv / vis droplet reader (trinean, gentbrugge, belgium) for all consortium genomic dna samples. developed multiplex pcr panel composed of 13 short tandem repeat (str) markers distributed over multiple autosomal locations : d20s480, d22s1174, d3s1287, d3s1744, d3s1764, d7s672, d7s2426, d8s1746, d14s1005, d20s866, d10s1237, d20s912, and d6s965. this panel also includes a marker specific for the x chromosome (dxs1187) and one for the sry gene on the y chromosome, and enables fast and accurate sample identification and sex determination in a single assay. after selective amplification of 20 ng genomic dna, amplification products were size separated on an abi 3730 automatic sequencer (applied biosystems, foster city, ca) using genescan-600 liz (applied biosystems) as internal size standard and genotypes were assigned using in - house developed traci genotyping software (http://www.vibgeneticservicefacility.be). to screen the geo - pd cohorts for the pathogenic (g4c2)>60 c9orf72 repeat expansion, we designed a 2-step procedure : an str fragment length assay with flanking pcr primers optimized for alleles with high gc content (str - pcr) followed by 2 repeat - primed pcr assays (forward and reverse rp - pcr) as described earlier. four participating research groups performed the genotyping in their local facilities according to previously published procedures. for consistent allele scoring of repeat lengths between geo - pd groups and accurate interpretation of the repeat length, we designed a reference dna set of 14 samples covering a range of normal repeat sizes that was genotyped by each of these facilities. furthermore, for 2 of the cohorts, a random set of samples homozygous for the str - pcr assay were included in the rp - pcr analysis at the antwerp site for independent validation of the absence of a pathogenic repeat expansion. to investigate the association between repeat units and pd susceptibility, 3 explorative approaches were followed, based on (1) allele counts of the distinct repeat sizes, to determine whether one or more specific repeat sizes were associated with pd, (2) the total number of repeat units (sum of both alleles) per individual, and (3) the size of the longest repeat per individual (maximum allele). summary statistics were computed in a random - effects meta - analysis (dersimonian - laird) for each approach in the rmeta package implemented in the r environment version 2.15.3. based on the results obtained in the above - mentioned analyses, we performed hypothesis - driven dichotomized genotypic meta - analyses. details are provided in the e - methods on the neurology web site at neurology.org. to take into account the number of tests performed (n = 22), a bonferroni - corrected 2-sided p value of 0.002 was considered statistically significant. population attributable risk of (g4c2)10, (g4c2)10, and (g4c2)17 was estimated using the epir package in r. for the meta - analyses, only the cohorts including both the patients with pd and the controls that were size - corrected based on the reference panel were included in the study. concentration and purity were checked spectrophotometrically using the trinean dropsense96 uv / vis droplet reader (trinean, gentbrugge, belgium) for all consortium genomic dna samples. developed multiplex pcr panel composed of 13 short tandem repeat (str) markers distributed over multiple autosomal locations : d20s480, d22s1174, d3s1287, d3s1744, d3s1764, d7s672, d7s2426, d8s1746, d14s1005, d20s866, d10s1237, d20s912, and d6s965. this panel also includes a marker specific for the x chromosome (dxs1187) and one for the sry gene on the y chromosome, and enables fast and accurate sample identification and sex determination in a single assay. after selective amplification of 20 ng genomic dna, amplification products were size separated on an abi 3730 automatic sequencer (applied biosystems, foster city, ca) using genescan-600 liz (applied biosystems) as internal size standard and genotypes were assigned using in - house developed traci genotyping software (http://www.vibgeneticservicefacility.be). to screen the geo - pd cohorts for the pathogenic (g4c2)>60 c9orf72 repeat expansion, we designed a 2-step procedure : an str fragment length assay with flanking pcr primers optimized for alleles with high gc content (str - pcr) followed by 2 repeat - primed pcr assays (forward and reverse rp - pcr) as described earlier. four participating research groups performed the genotyping in their local facilities according to previously published procedures. for consistent allele scoring of repeat lengths between geo - pd groups and accurate interpretation of the repeat length, we designed a reference dna set of 14 samples covering a range of normal repeat sizes that was genotyped by each of these facilities. furthermore, for 2 of the cohorts, a random set of samples homozygous for the str - pcr assay were included in the rp - pcr analysis at the antwerp site for independent validation of the absence of a pathogenic repeat expansion. to investigate the association between repeat units and pd susceptibility, 3 explorative approaches were followed, based on (1) allele counts of the distinct repeat sizes, to determine whether one or more specific repeat sizes were associated with pd, (2) the total number of repeat units (sum of both alleles) per individual, and (3) the size of the longest repeat per individual (maximum allele). summary statistics were computed in a random - effects meta - analysis (dersimonian - laird) for each approach in the rmeta package implemented in the r environment version 2.15.3. based on the results obtained in the above - mentioned analyses, we performed hypothesis - driven dichotomized genotypic meta - analyses. details are provided in the e - methods on the neurology web site at neurology.org. to take into account the number of tests performed (n = 22), a bonferroni - corrected 2-sided p value of 0.002 was considered statistically significant. population attributable risk of (g4c2)10, (g4c2)10, and (g4c2)17 was estimated using the epir package in r. for the meta - analyses, only the cohorts including both the patients with pd and the controls that were size - corrected based on the reference panel were included in the study. a total of 12,710 samples, including 7,232 patients with pd and 5,478 control individuals, were successfully genotyped with the 2-step (g4c2)n repeat genotyping assay. rp - pcr analysis revealed the typical sawtooth tail pattern indicative of a pathogenic repeat expansion (g4c2)>60 in one german (ms_rk cohort) (1/1,304 ; 0.08%) and 3 french (sl cohort) (3/1,182 ; 0.25%) patients but none in the other geo - pd patient cohorts (table 1). based on these results, we calculated a prevalence of pathogenic c9orf72 repeat expansions in this global consortium cohort of 0.06%. one year after onset, clinical examination revealed hypomimia, hypokinesia, resting tremor of the right arm, minor postural instability, mild bilateral rigidity, and slowed shuffling gait but also short - term memory disturbances, social withdrawal, and minor apathy. all 3 french patients were diagnosed with pd without cognitive dysfunction at disease onset, and a detailed clinical description has been reported previously. briefly, the first patient developed left hemiparkinsonism at age 29 years and symptoms worsened progressively while dopamine agonists were only partially effective. in the second patient, parkinsonism began at age 48 years and a cognitive decline was noted at age 56 years. the third patient developed parkinsonism at age 64 years and developed a mild cognitive deficit at age 69. although these 3 patients were clinically diagnosed with pd, they all had family histories of atypical parkinsonism, degenerative dementias, or als. no expansions were detected in patients with sporadic pd or patients with a familial history of pd. moreover, mutations in known pd genes had previously been excluded in these 4 pathogenic expansion carriers. we identified one asian control of chinese origin with an age at inclusion of 52 years carrying a pathogenic (g4c2)>60 expansion (table 1). currently, there is no record of any symptoms related to pd, ftld, or als in this individual. this brings the estimated prevalence of pathogenic repeat expansions in controls to 0.02% (1/5,478). apart from the expansion mutations, the distribution of repeat lengths ranged from 0 to 32 in the caucasian and from 7 to 14 in the asian control persons. first, we assessed the distribution of the alleles in patients with pd vs controls in the geo - pd cohort (figure 1). the frequencies of the (g4c2)10 allele and of (g4c2)17 were nominally increased in pd vs the controls but the differences were not statistically significant after bonferroni correction (figure 1, table 3, figure e-1, a and b). genotypic frequencies for (g4c2)10 (table 3, figure e-1, c) and (g4c2)17 (table 3, figure e-1, d) were not significantly different between patients and controls after correction for multiple testing. when considering the sum of the alleles and the size of the maximum allele as a quantitative variable, we observed a small but significant increase of disease risk with a rising number of repeat units (sum of alleles p = 0.0012, summary effect [] = 0.0128 [0.005040.0205 ], figure e-2, a ; maximum allele p = 0.0010, summary effect [] = 0.0181 [0.007310.029 ], figure e-2, b). together, these results suggested that the risk effect may not only be linked to the (g4c2)10 repeat but may be increasing with length while the effect in the larger alleles is probably masked by the small number of carriers. therefore, we decided to analyze the risk effect of c9orf72 repeat expansions as a binary categorical value with a cutoff between 9 and 10. however, neither allelic nor genotypic meta - analysis of the geo - pd cohorts revealed significant association with pd for (g4c2)10 repeat alleles after bonferroni correction (table 3, figure e-3, a and b). only cohorts including both patients with pd and controls that were size - corrected based on the reference panel were included in the study. when the highest count for a specific allele was 5 or less across cohorts, the allele was clumped with the next allele for each cohort. the p values for individual alleles were calculated using a dersimonian - laird random - effect meta - analysis. con = controls ; geo - pd = genetic epidemiology of parkinson 's disease ; pd = parkinson disease. a total of 12,710 samples, including 7,232 patients with pd and 5,478 control individuals, were successfully genotyped with the 2-step (g4c2)n repeat genotyping assay. rp - pcr analysis revealed the typical sawtooth tail pattern indicative of a pathogenic repeat expansion (g4c2)>60 in one german (ms_rk cohort) (1/1,304 ; 0.08%) and 3 french (sl cohort) (3/1,182 ; 0.25%) patients but none in the other geo - pd patient cohorts (table 1). based on these results, we calculated a prevalence of pathogenic c9orf72 repeat expansions in this global consortium cohort of 0.06%. one year after onset, clinical examination revealed hypomimia, hypokinesia, resting tremor of the right arm, minor postural instability, mild bilateral rigidity, and slowed shuffling gait but also short - term memory disturbances, social withdrawal, and minor apathy. all 3 french patients were diagnosed with pd without cognitive dysfunction at disease onset, and a detailed clinical description has been reported previously. briefly, the first patient developed left hemiparkinsonism at age 29 years and symptoms worsened progressively while dopamine agonists were only partially effective. in the second patient, parkinsonism began at age 48 years and a cognitive decline was noted at age 56 years. the third patient developed parkinsonism at age 64 years and developed a mild cognitive deficit at age 69. although these 3 patients were clinically diagnosed with pd, they all had family histories of atypical parkinsonism, degenerative dementias, or als. no expansions were detected in patients with sporadic pd or patients with a familial history of pd. moreover, mutations in known pd genes had previously been excluded in these 4 pathogenic expansion carriers. we identified one asian control of chinese origin with an age at inclusion of 52 years carrying a pathogenic (g4c2)>60 expansion (table 1). currently, there is no record of any symptoms related to pd, ftld, or als in this individual. this brings the estimated prevalence of pathogenic repeat expansions in controls to 0.02% (1/5,478). apart from the expansion mutations, the distribution of repeat lengths ranged from 0 to 32 in the caucasian and from 7 to 14 in the asian control persons. first, we assessed the distribution of the alleles in patients with pd vs controls in the geo - pd cohort (figure 1). the frequencies of the (g4c2)10 allele and of (g4c2)17 were nominally increased in pd vs the controls but the differences were not statistically significant after bonferroni correction (figure 1, table 3, figure e-1, a and b). genotypic frequencies for (g4c2)10 (table 3, figure e-1, c) and (g4c2)17 (table 3, figure e-1, d) were not significantly different between patients and controls after correction for multiple testing. when considering the sum of the alleles and the size of the maximum allele as a quantitative variable, we observed a small but significant increase of disease risk with a rising number of repeat units (sum of alleles p = 0.0012, summary effect [] = 0.0128 [0.005040.0205 ], figure e-2, a ; maximum allele p = 0.0010, summary effect [] = 0.0181 [0.007310.029 ], figure e-2, b). together, these results suggested that the risk effect may not only be linked to the (g4c2)10 repeat but may be increasing with length while the effect in the larger alleles is probably masked by the small number of carriers. therefore, we decided to analyze the risk effect of c9orf72 repeat expansions as a binary categorical value with a cutoff between 9 and 10. however, neither allelic nor genotypic meta - analysis of the geo - pd cohorts revealed significant association with pd for (g4c2)10 repeat alleles after bonferroni correction (table 3, figure e-3, a and b). only cohorts including both patients with pd and controls that were size - corrected based on the reference panel were included in the study. when the highest count for a specific allele was 5 or less across cohorts, the allele was clumped with the next allele for each cohort. the p values for individual alleles were calculated using a dersimonian - laird random - effect meta - analysis. con = controls ; geo - pd = genetic epidemiology of parkinson 's disease ; pd = parkinson disease. molecular reclassification of complex brain diseases based on genetic etiology is of utmost importance to improve differential diagnosis and to rationalize drug development. assessment of the contribution of novel disease genes to clinically and pathologically overlapping diseases is instrumental in this reclassification. in this global study, we assessed the prevalence of (g4c2)n repeat alleles and expansions in an extended pd cohort ascertained within the geo - pd consortium and excluded a major role for pathogenic (g4c2)>60 repeat expansions in the causation of pd. the low frequency of these expansions (0.06%) in the geo - pd cohort is in agreement with earlier findings in distinct patient groups and falls in the range of frequencies observed in controls by us (0.02%) and others (00.6%). furthermore, 75% of the pathogenic expansion carriers in this global study showed a decline in cognitive functions within 1 to 8 years after onset. in the absence of autopsy diagnoses, we therefore can not exclude that some if not all of these expansion carriers are primarily ftld / als patients with pronounced early parkinsonian symptoms or comorbidity of pd and ftld / als. this hypothesis is supported by the identification of only one pathogenic mutation carrier in 826 (0.1%) autopsy - confirmed pd cases. of note, this carrier presented, in addition to lewy body pathology, with frontotemporal degeneration and c9orf72-als / ftld pathology with numerous p62-positive inclusions. furthermore, although substantia nigra involvement is common in c9orf72-positive als, it can be clearly distinguished from pd - related mechanisms by the presence of p62-positive inclusion and absence of lewy body pathology. altogether, it is not advisable to include c9orf72 (g4c2)n repeat expansion testing in a medical genetic diagnostic setting for typical pd patients. exceptions can be made for patients with pd who have cognitive and/or behavioral deficits early in the disease process or in patients with a personal or familial history of ftld / als. given differences in the existing literature on c9orf72 (g4c2)n repeat length as risk factor for pd, we used the size of this global cohort to estimate a pd - related threshold of c9orf72 repeats. calculation of the risk for each of the observed c9orf72 (g4c2)n alleles in the geo - pd cohorts suggested a role for the 10-units repeat and for the pooled alleles of 17 units or more in pd susceptibility. genotypic meta - analysis supported a possible link between (g4c2)10 and increased risk of pd but the association did not reach significance after correction for multiple testing. in addition, the number of carriers of these intermediate alleles is small and one should be cautious with the interpretation of these results. furthermore, it is difficult to envisage the biological relevance of risk associated with a single allele. of note, we observed a small but significant increase in risk with an accumulative number of repeats supporting the idea of a threshold size rather than a single allele as the culprit of increased risk. we therefore decided to study the combined effect of (g4c2) alleles of 10 units and larger in the global geo - pd cohort. although meta - analyses implicated a potential role for these intermediate - sized repeats in pd risk, none of the associations survived bonferroni correction suggesting that if c9orf72 repeats of 10 units or larger have a role in pd susceptibility, the effect is small. this is supported by the fact that none of the published genome - wide association studies revealed the c9orf72 locus as a risk factor for pd. a limitation of this study is that we did not yet include all published association studies of c9orf72 in pd ; however, we chose to include only those studies that were corrected for allele scoring bias based on a reference panel. altogether, these data support the current hypothesis that pathogenic (g4c2)n repeat expansions in c9orf72 appear to be specific for the ftld / als spectrum with little or no contribution to the wider spectrum of movement disorders. it will be of interest to study the role of intermediate repeats 10 units in other neurodegenerative disorders, however, to obtain a more profound knowledge on their role in neurodegenerative diseases and a better understanding of the underlying mechanism. from the neurodegenerative brain diseases group (j.t., a.v., k.s., e.w., c.v.b.), department of molecular genetics, vib, antwerp ; institute born - bunge (j.t., c.v.b.), university of antwerp ; department of neurology (d.c., p.c.), antwerp university hospital, edegem ; department of neurology and memory clinic (s.e., p.p.d.d.), hospital network antwerp, middelheim and hoge beuken, antwerp, belgium ; department of neurology and alzheimer research center (p.p.d.d.), university of groningen and university medical center groningen, the netherlands ; department of neurodegenerative diseases (m.s., r.k.), hertie - institute for clinical brain research and dzne - german center for neurodegenerative diseases, tuebingen ; institute for clinical epidemiology and applied biometry (m.s.), university of tuebingen, germany ; inserm, umr_s975 (s.l., a.b.), universit pierre et marie curie - paris, cnrs, umr 7225, ap - hp, piti - salptrire hospital ; cnrs (s.l., a.b.), umr 7225, paris ; ap - hp (a.b.), piti - salptrire hospital, department of genetics and cytogenetics, paris, france ; department of neurology (s.j.c., m.- j.k., y.j.k.), asan medical center, university of ulsan college of medicine, seoul, korea ; departments of neuroscience (o.a.r.) and neurology (z.k.w.), mayo clinic, jacksonville, fl ; tanz centre for research in neurodegenerative diseases (e.r., z.x.), department of medicine, university of toronto ; toronto western hospital research institute (a.e.l.), university health network, toronto, canada ; institute of neurogenetics (c.k., a.w.), university of luebeck, germany ; eskitis institute for drug discovery (g.d.m.), griffith university, queensland ; university of queensland (p.a.s.), centre for clinical research, queensland, australia ; department of neurology (g.m.h., e.d.), neuroscience unit, faculty of medicine, school of health sciences, university of thessaly, larissa, greece ; department of neurology (n.h., k.o.), juntendo university school of medicine, tokyo, japan ; department of neurology (e.- k.t., y.z.), singapore general hospital, national neuroscience institute, singapore ; duke nus graduate medical school (e.- k.t., y.z.), singapore ; department of neurology (j.a.), st. olav 's hospital, trondheim ; department of neuroscience (j.a.), norwegian university of science and technology (ntnu), trondheim, norway ; irccs casa sollievo della sofferenza hospital (m.v., s.p.), mendel laboratory, san giovanni rotondo ; institute of molecular bioimaging and physiology (g.a., a.q.), national research council, section of germaneto (cz) ; institute of neurology (a.q.), department of medical sciences, university magna graecia, catanzaro ; department of neuroscience (c.f., l.b.), section of neurology, university of milano - bicocca, san gerardo hospital, monza, italy ; department of neurology (a.d.), max planck institute of psychiatry, munich, germany ; department of clinical sciences (a.p.), section of neurology, lund university ; department of neurology (a.p.), lund, skne university hospital ; department of clinical sciences (c.n.), clinical memory research unit, lund university, sweden ; human genetic centre (g.g.), university hospital of lige, belgium ; department of neurology (m.s.l., r.f.p.), university of tennessee health science center, memphis ; department of neurology (m.b.- j., g.o.), medical university of silesia, katowice, poland ; and department of neurology (d.m.m.), northshore university healthsystem, evanston, il. jessie theuns : drafting and revising the manuscript for content, study concept and design, analysis and interpretation of data, acquisition of data, statistical analysis, study supervision and coordination, obtaining funding. aline verstraeten : revising the manuscript for content, study design, analysis and interpretation of data, acquisition of data, statistical analysis, study coordination. kristel sleegers : drafting and revising the manuscript for content, study concept, analysis and interpretation of data, statistical analysis, obtaining funding. eline wauters : revising the manuscript for content, analysis and interpretation of data, acquisition of data. ilse gijselinck : revising the manuscript for content, analysis and interpretation of data, acquisition of data. stefanie smolders : revising the manuscript for content, analysis and interpretation of data, acquisition of data. david crosiers : revising the manuscript for content, analysis and interpretation of clinical data, acquisition of clinical data, contribution of vital reagents. ellen corsmit : revising the manuscript for content, analysis and interpretation of data, acquisition of data. ellen elinck : revising the manuscript for content, analysis and interpretation of data, acquisition of data. manu sharma : revising the manuscript for content, analysis and interpretation of data, acquisition of data. rejko krger : revising the manuscript for content, analysis and interpretation of data, acquisition of data. suzanne lesage : revising the manuscript for content, acquisition of data, analysis and interpretation of data, contribution of vital reagents, local study coordination. alexis brice : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents, local study supervision. sun ju chung : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents, local study supervision. mi - jung kim : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. young jin kim : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. owen a. ross : revising the manuscript for content, analysis and interpretation of data, acquisition of data, contribution of vital reagents. zbigniew k. wszolek : revising the manuscript for content, analysis and interpretation of clinical data, acquisition of clinical data, contribution of vital reagents. ekaterina rogaeva : revising the manuscript for content, analysis and interpretation of data, acquisition of data, contribution of vital reagents. zhengrui xi : revising the manuscript for content, analysis and interpretation of data, acquisition of data. anthony e. lang : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. christine klein : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. anne weissbach : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. george d. mellick : revising the manuscript for content, acquisition and interpretation of clinical data, contribution of vital reagents. peter a. silburn : revising the manuscript for content, acquisition and interpretation of clinical data, contribution of vital reagents. georgios m. hadjigeorgiou : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. efthimios dardiotis : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. nobutaka hattori : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. kotaro ogaki : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. eng - king tan : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. yi zhao : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. jan aasly : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. enza maria valente : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. simona petrucci : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. grazia annesi : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. aldo quattrone : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. carlo ferrarese : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. laura brighina : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. angela deutschlnder : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. andreas puschmann : revising the manuscript for content, acquisition of clinical data and biospecimen, contribution of vital reagents, local study design, obtaining funding for local site. christer nilsson : revising the manuscript for content, local study design, obtaining funding for local site. gatan garraux : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. mark s. ledoux : revising the manuscript for content, acquisition and interpretation of clinical data and biospecimen, contribution of vital reagents. ronald f. pfeiffer : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents. magdalena boczarska - jedynak : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. grzegorz opala : revising the manuscript for content, acquisition of clinical data, contribution of vital reagents, local study coordination. demetrius maraganore : revising the manuscript for content, acquisition of clinical data, executive approval and sponsorship of the study, leadership and coordination of the geo - pd consortium that participated in the study. sebastiaan engelborghs : revising the manuscript for content, acquisition of clinical data, analysis and interpretation of clinical data, contribution of vital reagents. peter paul de deyn : revising the manuscript for content, local study design, acquisition of clinical data, interpretation of clinical data, contribution of vital reagents, local study supervision. patrick cras : revising the manuscript for content, local study design, acquisition of clinical data, interpretation of clinical data, contribution of vital reagents, local study supervision. marc cruts : drafting and revising the manuscript for content, study concept and design, analysis and interpretation of data, study supervision or coordination, obtaining funding. christine van broeckhoven : drafting and revising the manuscript for content, study concept and design, analysis and interpretation of data, contribution of vital reagents / tools / patents, statistical analysis, study supervision or coordination, obtaining funding. belgium - antwerp : the research is in part funded by the belgian science policy office interuniversity attraction poles (iap) program ; the european initiative on centers of excellence in neurodegeneration (coen) ; the flemish government initiated methusalem excellence program ; the alzheimer research foundation (sao / fra) ; the queen elisabeth medical foundation (qemf) ; the research foundation flanders (fwo) ; the agency for innovation by science and technology flanders (iwt) ; the university of antwerp research fund, belgium ; and the metlife foundation for medical research award to c.v.b. the iwt provided a phd fellowship to a.v. and e.w. and the fwo a postdoctoral fellowship to i.g. the authors acknowledge the personnel of the genetic service facility of vib (http://www.vibgeneticservicefacility.be) and the antwerp biobank of the institute born - bunge for their expert support. france : the authors thank the french parkinson 's disease genetics study group : y. agid, m. anheim, a.- m. bonnet, m. borg, a. brice, e. broussolle, j.- c. corvol, p. damier, a. deste, a. drr, f. durif, s. klebe, p. krack, e. lohmann, m. martinez, p. pollak, o. rascol, f. tison, c. tranchant, m. vrin, f. viallet, and m. vidailhet ; france - parkinson association and the french program usa - florida : mayo clinic florida is a morris k. udall center of excellence in pd research nih / ninds p50 ns072187, and is supported by ninds r01 ns078086, the michael j. fox foundation, mayo clinic center for regenerative medicine, and a gift from carl edward bolch, jr., and susan bass bolch. germany - tuebingen : the kora (cooperative research in the region of augsburg) research platform was started and financed by the forschungszentrum fr umwelt und gesundheit, which is funded by the german federal ministry of education, science, research, and technology and by the state of bavaria. this work has also been made possible by the kind support of the michael j. fox foundation (mjff) for parkinson 's research (to manu sharma). this study was also funded by the german national genome network (ngfnplus number 01gs08134, german ministry for education and research) ; by the german federal ministry of education and research (ngfn 01gr0468, popgen) ; and 01ew0908 in the frame of era - net neuron and helmholtz alliance mental health in an ageing society (ha-215), which was funded by the initiative and networking fund of the helmholtz association. greece : this work was supported in part by the research committee of university of thessaly (code : 2845 for g.m.h.). italy - san giovanni rotondo : italian ministry of health (ricerca corrente 2013). sweden : andreas puschmann received funding from the swedish parkinson foundation (parkinsonfonden) and governmental funding for clinical research within the swedish national health services (alf - yf). usa - tennessee : research was funded, in part, by grants from the nih (r01ns069936 ; r01ns058850) to m.s.l. korea : this work was supported by a grant of the korea healthcare technology r & d project, ministry of health & welfare, republic of korea (a092042) and asan institute for life sciences (2010 - 0416). usa - evanston : research was funded, in part, by a grant from the nih (r01es10751) to d.m.m. | objectives : the objective of this study is to clarify the role of (g4c2)n expansions in the etiology of parkinson disease (pd) in the worldwide multicenter genetic epidemiology of parkinson 's disease (geo - pd) cohort.methods:c9orf72 (g4c2)n repeats were assessed in a geo - pd cohort of 7,494 patients diagnosed with pd and 5,886 neurologically healthy control individuals ascertained in europe, asia, north america, and australia.results:a pathogenic (g4c2)n>60 expansion was detected in only 4 patients with pd (4/7,232 ; 0.055%), all with a positive family history of neurodegenerative dementia, amyotrophic lateral sclerosis, or atypical parkinsonism, while no carriers were detected with typical sporadic or familial pd. meta - analysis revealed a small increase in risk of pd with an increasing number of (g4c2)n repeats ; however, we could not detect a robust association between the c9orf72 (g4c2)n repeat and pd, and the population attributable risk was low.conclusions:together, these findings indicate that expansions in c9orf72 do not have a major role in the pathogenesis of pd. testing for c9orf72 repeat expansions should only be considered in patients with pd who have overt symptoms of frontotemporal lobar degeneration / amyotrophic lateral sclerosis or apparent family history of neurodegenerative dementia or motor neuron disease. |
community style acupuncture is an economical, high volume technique for delivering traditional chinese medicine to a group of patients who prefer this approach or who can not afford private sessions. this delivery of care method enhances access to acupuncture for those who may not afford it otherwise. this method of delivering healthcare increases access to care for patients who can not afford the higher cost of individualized treatments in the typical private practice acupuncture office. participants will learn the evidence base as well as logistical and financial aspects of setting up a community style acupuncture program in their offices. | focus areas : mental health, alleviating painthis poster includes a discussion of the use of acupuncture in a community setting for various conditions. logistics, staffing, and financial aspects of community style acupuncture will be discussed.rationale:community style acupuncture is an economical, high volume technique for delivering traditional chinese medicine to a group of patients who prefer this approach or who can not afford private sessions. this delivery of care method enhances access to acupuncture for those who may not afford it otherwise.objectives:community style acupuncture has been in use for centuries. this method of delivering healthcare increases access to care for patients who can not afford the higher cost of individualized treatments in the typical private practice acupuncture office.participants will learn the evidence base as well as logistical and financial aspects of setting up a community style acupuncture program in their offices. |
hair restoration is a safe procedure and most of its associated complications are preventable ; however, they usually arise from variables that are directly controlled by the surgeon and/or the patient. donor site adverse reactions include : scarring, keloid formation, wound dehiscence, necrosis, donor site depletion, hypoesthesia, neuralgia, arteriovenous fistula formation, telogen effluvium, infection, hiccups, pyogenic granuloma formation, and hematoma formaton. recipient site adverse reactions include poor hairline restoration, hair color mismatch, chronic folliculitis, in - grown hairs, cysts, and necrosis. recipient area necrosis is a rare but dangerous complication that arises when an increased number of recipient grafts are utilized and de - vascularization of the scalp occurs as a result of dense splitting of recipient skin that results in large wound areas. although in the literature it has been mentioned that this complication is rare, our survey in iran determined that many hair transplant centers face this complication but do not officially report these cases. accordingly, after describing the standard methods of prevention of scalp skin necrosis used so far, we decided to locate these cases from the literature and iranian hair transplant centers to determine the dangerous zone in an effort to develop a method for prevention of scalp necrosis in dense packing transplantation. predisposing factors of skin necrosis : recipient - site necrosis is a result of vascular compromise. predisposing influence composed of patient s factors and technical factors are as follows : patient s factors : smoking, atrophic skin damage, diabetes mellitus, scarring of the recipient site or a history of scalp surgery.technical factors : dense packing, megasessions, large openings, use of solutions with high epinephrine concentration, and deep recipient incisions. patient s factors : smoking, atrophic skin damage, diabetes mellitus, scarring of the recipient site or a history of scalp surgery. technical factors : dense packing, megasessions, large openings, use of solutions with high epinephrine concentration, and deep recipient incisions. methods of hair grafting / hair transplantation techniques and the risk of the recipient site skin necrosis : follicular unit transplantation (fut) : the donor strip can be harvested with a knife, after the strip has been harvested, the gap can be closed either with staples or sutures. the grafts are placed into the recipient slits / holes using fine - angled forceps. follicular unit extraction (fue) : fue is a type of hair transplantation in which the method of extraction is different but implantation is the same as fut. it is a sutureless method of hair restoration in which hair follicles are extracted from the back of the head under local anesthesia with the help of special micropunches that are then implanted in the bald area. automated fue hair transplantation or s.a.f.e.r [suction assisted follicular extraction and reimplantation ] : the fue matic machine (medicamat ; malakoff, france) is an automated hair transplant machine that seeks to assist the doctor in performing a hair transplant using the fue technique. however, there is greater pulling and twisting of grafts, which puts the graft at risk of damage, resulting in greater transection. notably these techniques have almost the same graft insertion but with a different donor harvesting process, and all of them have the same risk of donor site necrosis according to the above - mentioned risk factors. our study was composed of two parts : comparing all case reports in the literature, from search engines and from hair transplant centers in iran to determine the danger zone of the scalp.performing a case series to identify a method to decrease scalp necrosis in dense packing transplantation. comparing all case reports in the literature, from search engines and from hair transplant centers in iran to determine the danger zone of the scalp. performing a case series to identify a method to decrease scalp necrosis in dense packing transplantation. the danger zone of scalp necrosis is the area on the scalp most vulnerable to necrosis. interestingly there were many unofficial pictures of recipient scalp necrosis on google and from iranian hair transplant centers ; however, we could not find even one formal case report in literature. accordingly, we decided to determine the danger zone based on informal reported pictures from google and from iranian hair transplant centers. an extensive literature and google search was carried out to find out the likely sites of recipient area necrosis. eighteen pictures were found and examined, but due to copyright restrictions, we only present pictures from the iranian hair transplant centers in this manuscript (figures 19). we drew a straight line on all of the pictures from the nose to the vertex and decided to draw a line from the back of one ear to the back of the other ear allowing the scalp to be divided into four equal regions. due to poor picture quality, we could not draw the second line on most pictures. necrosis was compared in all of the identified pictures in which vertical division of scalp from the nose to the vertex of the scalp was conducted. pictorial analysis revealed that most of the necrosis (14 of 18) occurred in central region of the scalp and was inclined to the right parietal region of the scalp (figures 17 and 10). from others two cases occurred in central scalp without any inclination (figure 8) and two cases occurred in central of scalp and was inclined to the left parietal region (figure 9). because mean velocities of blood flow do not differ significantly between the left and right hemisphere, it is not clear why the most of recipient scalp necrosis in our survey occurred on the right part of the central scalp region. we noticed that after slitting, some patients were troubled by dark areas on some parts of the recipient site. we hypothesize that the darkness can be a predisposing factor for scalp necrosis and may outline potential danger zones. based on this information, a prospective case series was designed in which 16 consecutive patients undergoing dense slit hair transplant procedures were troubled by dark areas on the recipient site after slitting. on the first day all 16 patients underwent dense slitting in the recipient zone resulting in dark areas on the some part of scalp. in patient 1 we put dense grafts in one dark zone and zero grafts in the other dark zone (figure 11 a after one day necrosis was evident in the region where grafts were placed but no necrosis in the non - transplanted region (figure 12). of note, transplantation in patient 1 composed of slitting and hair grafting in both dangerous and non - dangerous regions on the first day with subsequent engrafting of the remaining slits on the second day (figures 11, 12). however, in the other 15 patients, transplantation on the first day composed of just slitting of the entire scalp and engraftment in the non - dangerous area in a horseshoe - shaped pattern in which the left arm was wider than the right with subsequent graft insertion of remaining slits on the second day (figures 1319). the danger zone of scalp necrosis is the area on the scalp most vulnerable to necrosis. interestingly there were many unofficial pictures of recipient scalp necrosis on google and from iranian hair transplant centers ; however, we could not find even one formal case report in literature. accordingly, we decided to determine the danger zone based on informal reported pictures from google and from iranian hair transplant centers. an extensive literature and google search eighteen pictures were found and examined, but due to copyright restrictions, we only present pictures from the iranian hair transplant centers in this manuscript (figures 19). we drew a straight line on all of the pictures from the nose to the vertex and decided to draw a line from the back of one ear to the back of the other ear allowing the scalp to be divided into four equal regions. due to poor picture quality, we could not draw the second line on most pictures. necrosis was compared in all of the identified pictures in which vertical division of scalp from the nose to the vertex of the scalp was conducted. pictorial analysis revealed that most of the necrosis (14 of 18) occurred in central region of the scalp and was inclined to the right parietal region of the scalp (figures 17 and 10). from others two cases occurred in central scalp without any inclination (figure 8) and two cases occurred in central of scalp and was inclined to the left parietal region (figure 9). because mean velocities of blood flow do not differ significantly between the left and right hemisphere, it is not clear why the most of recipient scalp necrosis in our survey occurred on the right part of the central scalp region. we noticed that after slitting, some patients were troubled by dark areas on some parts of the recipient site. we hypothesize that the darkness can be a predisposing factor for scalp necrosis and may outline potential danger zones. based on this information, a prospective case series was designed in which 16 consecutive patients undergoing dense slit hair transplant procedures were troubled by dark areas on the recipient site after slitting. on the first day all 16 patients underwent dense slitting in the recipient zone resulting in dark areas on the some part of scalp. in patient 1 we put dense grafts in one dark zone and zero grafts in the other dark zone (figure 11 a after one day necrosis was evident in the region where grafts were placed but no necrosis in the non - transplanted region (figure 12). of note, transplantation in patient 1 composed of slitting and hair grafting in both dangerous and non - dangerous regions on the first day with subsequent engrafting of the remaining slits on the second day (figures 11, 12). however, in the other 15 patients, transplantation on the first day composed of just slitting of the entire scalp and engraftment in the non - dangerous area in a horseshoe - shaped pattern in which the left arm was wider than the right with subsequent graft insertion of remaining slits on the second day (figures 1319). pictorial analysis in part one of this study revealed that the majority of necrosis (14 of 18) occurred in the central region of the scalp and was inclined, particularly, to the right parietal aspect of the scalp. our experimental study determined that patient 1 had necrosis localized to the dark area that was grafted immediately following slitting without resultant necrosis in the dark area that was not grafted on the first day of transplantation (figure 12) interestingly there was no evidence of necrosis following engraftment on the remaining 15 patients with dark areas on the scalp after slitting, which was grafted in the dangerous zone on the second day and subsequent days after the procedure (figures 1319). to better elucidate the chain of events, we describe some facts regarding flaps that is connected to our commentary on scalp necrosis. with regard to free tissue transfer surgery, a major problem that surgeons face is the rescuing of a flap that is at risk of failing due to ischemic complications in the postoperative period (postoperative vascular compromise leading to secondary ischemia). a study performed on mouse skin flaps subjected to combinations of primary ischemia, reperfusion, and secondary ischemia revealed that flap survival significantly decreased due to a decreased reperfusion time (the time between primary and secondary ischemia). a longer period of primary ischemia and/or decreased reperfusion time lowers the tolerance of that flap to subsequent ischemic insults and secondary ischemia. based on this information, we could describe the ischemia timeline for the scalp in the hair transplant process. the process is composed of three phases : primary and secondary ischemia, and reperfusion time. dense slitting cause s primary ischemia in the scalp, following which the scalp skin begins to reperfuse until engraftment. hair follicle insertion in the slits causes secondary ischemia due to an increased demand of blood. basically, slitting is primary ischemia, engraftment is secondary ischemia and the period of time in between these two phases of ischemia is the reperfusion time. we believe that by increasing the reperfusion time after slitting, the tolerance of scalp to secondary ischemia insult and ultimately necrosis would decrease (table 1). another study on flaps demonstrated that a reperfusion time of 24 hours before a complete ischemic episode had the best result in tolerance to ischemia. in our study we dense - slit the scalp and put some of the grafts in the non - dangerous zone on the first day in a horseshoe pattern, and after 24 hours of reperfusion time for the dangerous zone and the other dark areas we continued to engraft the remaining slits. with this method if colleagues decide to graft hair follicles in one session, we recommend slitting the scalp as the first step in the session, followed by a rest period of a few hours, with subsequent engraftment because more reperfusion time would decrease the ischemic insults that most likely occur as a result of angina of the scalp skin where demand of oxygen is greater than the supply to implanted hair follicles. based on our knowledge, this is the first study regarding the recipient scalp necrosis which compares several cases of necrosis and provides a method for prevention of this vascular catastrophe. in order to prevent development of recipient area necrosis following a hair transplant procedure, graft insertion ideally should occur 24 hours following dense slitting. in our method, we recommend dense slitting the scalp with some engraftment in the non - dangerous zones on the first day in a horseshoe pattern with a 24-hour rest reperfusion time for danger zones and other dark areas. following this, we recommend engrafting of the slits. adequate reperfusion time is required to allow for appropriate development of implanted hairs and prevents development of necrosis. in our experience, with this method we have performed many dense packing hair transplantation processes without any vascular compromise. | hair restoration is a safe procedure and most of its associated complications are preventable by the surgeon and/or the patient. recipient area necrosis is rare but arises when an increased number of recipient grafts are utilized and de - vascularization of the scalp occurs. the aim of this study was to investigate and compare all cases and pictures reported in main search engines and iranian centers of hair transplant to find the dangerous zone of necrosis and to provide a new method for prevention of necrosis. pictorial analysis of this study revealed that the majority of necrosis (14 of 18) occurs in central region of the scalp and is inclined, particularly, to the right parietal aspect of the scalp. accordingly, a case series was done and a new method for prevention of scalp necrosis even in dense packing transplantation was discussed. |
a 60-year - old woman had been diagnosed with hypertension and cardiomegaly in 2003 but was doing well without any specific medication or treatment. she visited the department of cardiovascular internal medicine at konkuk university medical center with a complaint of aggravating dyspnea on exertion, functional impairment class 3 (new york heart association) in december 2010. then, she was referred to our department of cardiovascular surgery upon the diagnosis of a double - chambered right ventricle with pulmonary infundibular hypertrophy by two - dimensional transthoracic echocardiography (tte). upon physical examination, she was found to have mild hypertension (135/92 mmhg) with a regular heartbeat of 67 beats / min and a body temperature of 36. cardiac auscultation revealed grade iii systolic ejection murmur at the left lower parasternal border. the patient 's electrocardiogram showed a sinus rhythm with a right bundle branch block, right axis deviation, and right ventricular hypertrophy. chest radiography revealed mild cardiomegaly with a computed tomography (ct) ratio of 60%. a cardiac ct revealed a perimembranous septal aneurysm (size : 5.910.1 mm) without thrombus and rupture, right ventricular outflow tract obstruction (rvoto), and bronchiectasis with atelectasis at the medial segment of right middle lobe. transesophageal echocardiography revealed a high - velocity systolic jet (4.8 m / sec, peak pressure gradient=93 mmhg) through the right ventricular outflow track due to a discrete and round muscular obstruction, but remarkable tricuspid regurgitation or leakage through a ventricular septal defect was not noted. magnetic resonance imaging verified thickened muscular bands between the thin - walled infundibulum and the inflow segment of the right ventricle causing the double - chambered right ventricle (fig. after cardiopulmonary bypass (cpb) was initiated as usual, fibrillatory arrest was performed while avoiding deep hypothermia. we first incised the main pulmonary artery and then, proceeded to reconstruct the right ventricular outflow tract with infundibulectomy of the hypertrophied muscle. whitish fibrotic thickening was noted in the resected infundibular muscle, so we sent it to the pathology laboratory. the patient was transferred to the general ward from the intensive care unit 3 days after the operation. a peak pressure gradient in the right ventricular outflow tract estimated on the basis of tte was 12 mmhg in the 7 days after surgery ; this was a remarkable decrease from the peak pressure gradient of 93 mmhg obtained by preoperative echocardiography. a postoperative follow - up ct also revealed satisfactory results displaying no significant rvoto or other abnormalities in the right ventricle or the pulmonary valve and the arteries (fig. 2). meanwhile, histopathological findings of the resected infundibular muscle in the right ventricle demonstrated trichinellosis, a type of roundworm infection (fig. we asked the patient again for other information about her dietary habits for the past few years. we noted that she had eaten undercooked wild boar and birds for quite a long time approximately 20 years earlier. the patient recovered uneventfully and was discharged on postoperative day 14 after taking some doses of albendazole (400 mg) daily postoperatively. since the surgery, in the last 28 months, she has visited the outpatient clinic periodically and has been found to be in good condition. trichinellosis, also known as trichinosis, is a food - borne parasitic infection widely dispersed in various regions all over the world. further, the disease is endemic in many areas of asia, eastern europe, and latin america. humans are exposed to the infection by ingestion of undercooked or raw meat of animals such as pigs, wild boars, and horses contaminated with the trichinella spiralis larvae. reported in 55 countries across the world, human trichinellosis has become an important public health problem. there have also been quite a few outbreaks of trichinellosis in asia, particularly in china and thailand. including the first outbreak in 1997, 34 cases of human trichinellosis were reported in korea until 2010. a parasitic cycle can be divided into two phases : the gastrointestinal (gi ; enteral) phase and the muscular (parenteral or systemic) phase, which may coexist for a certain period of time lasting from a few days to weeks. after ingestion of the contaminated meat, the trichinella spiralis larvae are released in the stomach in the gi phase ; these then penetrate the mucosa of the small intestine, where they mature into adult worms 4 to 5 days after infection. after copulation in the intestine, the female worms shed newborn larvae into the lymphatic vessels. in the muscular phase, the larvae released in the gi mucosa migrate to the blood vessels by spreading throughout the body. the penetration and persistent presence of these larvae in the cells of the striated skeletal muscles lead to three major cell modifications : the disappearance of sarcomere myofibrils, the encapsulation of the larvae, and the development of a capillary network around the infected cells. the length of the incubation period varies from 1 to 4 weeks, depending on the severity of the disease. the incubation period is generally shorter in the case of more severe forms of trichinellosis. in most cases, the predominant symptoms are gi problems such as vomiting, diarrhea, and abdominal pain, as well as fever, periorbital edema, and myalgia. other complications such as encephalitis, ocular disease, pneumonia, and pleuritis can also be observed in some severe cases. trichinellosis is a common infective disease, with cardiovascular complications occurring in 10% to 60% of all patients ; further, most of the myocardial damage occurs during the invasive infective stage. these cardiovascular problems can occur in moderate - to - severe cases of trichinellosis, usually later in the infection. among them twenty fatalities out of 10,030 cases were reported in a worldwide survey conducted by the international commission on trichinellosis between january 1995 and june 1997. at the time of detection, trichinellosis infection and leukocytosis with eosinophilic predominance is usually noticed. eosinophilia, the earliest and the most common laboratory finding, is present in almost all cases. the serum levels of cardiac enzymes such as creatine kinase or troponin - i usually increase. electrocardiography may display sinus bradycardia or tachycardia, right bundle branch block, atrial fibrillation, first - degree atrioventricular block, and supraventricular premature beats. trichinellosis is definitively diagnosed by revealing the encysted larvae through a muscle biopsy, but this method can not be applied to all patients. thus, serologic tests may be helpful for the diagnosis, and an enzyme - linked immunosorbent assay is the most commonly used assay with 99% sensitivity and 91% to 96% specificity. finally, the diagnosis of an infection depends on the correlation of various clinical symptoms and the relevant laboratory results, as well as a carefully taken anamnesis. although medical treatment during the early stages of infection has been shown to be effective, the treatment of trichinellosis with drugs has been debated for years. there are several known anthelmintics such as mebendazole, albendazole, and thiabendazole. among them, a certain study revealed that thiabendazole has certain side effects of intolerable dizziness, urticaria, generalized maculopapular rash, and tinnitus ; hence, the use of thiabendazole to treat trichinellosis has been discontinued. drug therapy is effective if it starts within 1 week (early stage) after infection, but it is difficult to discriminate whether the patient is infected or not until the occurrence of specific symptoms. therefore, the patient is usually recommended to take medications within 4 to 6 weeks after infection, and 48 hours after ingestion of undercooked or raw meat, particularly that of wild boars or bears. the steroid treatment of glucocorticoids should be combined with mebendazole or albendazole for the protection of immediate - type hypersensitivity reactions. additionally, albendazole should be administered with care because the administration of dexamethasone might increase the serum level of albendazole. | here, we present a rare case of cardiac parasitic infection found in an adult female patient who had the symptoms of dyspnea upon exertion. she was diagnosed with a double - chambered right ventricle due to infundibular hypertrophy confirmed by transthoracic echocardiography and cardiac computed tomography. we performed surgery of infundibulectomy around the pulmonary valve. in the end, histopathological findings of the resected infundibular muscle demonstrated trichinellosis, a type of roundworm infection. |
the etiology of delayed puberty is heterogeneous and includes : constitutional delay, hypogonadotropic states, hypergonadotropic states as well as chronic illness1). the current approach to the diagnosis of hypothalamic hypophyseal lesions using a combined pituitary function stimulation test and pituitary mri have improved detection and allowed for the diagnosis of hypopituitarism as a cause of delayed puberty2). we report a case of a 22-year old man who presented with absent secondary sexual characteristics and was otherwise asymptomatic. using a combined approach with the pituitary function stimulation test and pituitary mri, we could identify the cause of delayed puberty to be hypopituitarism due to a pituitary structural abnormality, i.e., pituitary stalk dysgenesis and ectopic neurohypophysis. a 22-year old man was referred to our clinic because of the absence of the development of secondary sexual characteristics. the family history was negative for growth failure, pituitary or thyroid disease. during childhood, however, after a delayed growth spurt, he began to grow steadily at 20 years of age. at the time of admission he weighed 75 kg and his body mass index (bmi) was 22.4 kg / m. physical examination revealed a micropenis, no pubic or axillary hair and palpable though small testes (figure 2). the patient denied physical discomfort, had no signs of gynecomastia, no signs of orthostatic hypotension, nor any symptoms that could be associated with hypothyroidism. the laboratory findings showed normal erythrocyte sediment rate, hematological parameters, blood glucose, serum sodium, potassium, calcium, phosphate, magnesium, and creatinine. random testosterone (0.08 ng / ml, reference range 2.4~18.3 ng / ml) and luteinizing hormone (lh) (below 0.1 mlu / ml, reference range 0.4~5.7 mlu / ml) levels were all low ; the follicle stimulating hormone (fsh) levels were within normal limits. the karyotype was normal, 46,xy. as a result of the random sexual hormone levels and karyotyping analysis therefore, we performed a combined pituitary function stimulation test and pituitary mri for further assessment. we injected regular insulin (0.1 u / kg), trh (200 ug), and lhrh (100 ug) and observed that 2 hours later the blood sugar fell to 60 with patient complaint of hypoglycemic symptoms. the combined pituitary function stimulation test showed no increase in serum lh, fsh, growth hormone (gh), adrenocorticotropin hormone (acth) level, and the serum levels of prolactin and thyroid stimulating hormone (tsh) showed a normal increment (table 1). the mri showed decreased pituitary stalk enhancement and an enhancing structure in the hypothalamic area, which appeared to be ectopic neurohypophysis (figure 3a, 3b). therefore, considering the results of the above evaluation, the delayed puberty, in this 22 year old man, was the result of hypopituitarism due to pituitary stalk dysgenesis and ectopic neurohypophysis. the patient was started on hormone replacement therapy with prednisolone 5 mg / day, levothyroxine 0.1 mg / day and testosterone 250 mg i m every 3 weeks. after 3 months of treatment, secondary sexual characteristics began to develop ; pubic and axillary hair was noted and the voice changed to a lower pitch. the serum testosterone level, previously 0.08 ng / ml, increased to 0.57 ng / ml. delayed puberty is generally defined when puberty development is two standard deviations (sd) below the mean for a given population1, 3). hypopituitarism is not a common cause of delayed puberty, but recently the incidence has increased due to improvement in diagnostic tools2). the clinical manifestations associated with hypopituitarism vary, depending on the severity of the pituitary hormone deficiency4, 5). presentation of symptoms are variable and include : acute adrenal insufficiency and profound hypothyroidism, symptoms indicating a pituitary mass lesion ; or the symptoms may be nonspecific such as : fatigue and delayed puberty, as reported in our case2, 4, 5). therefore, hypopituitarism should be considered in all patients with abnormal development of secondary sexual characteristics even if they are otherwise asymptomatic. in our case, the cause of delayed puberty was hypopituitarism due to pituitary dysgenesis. the pituitary gland develops as a result of a fusion of the adenohypophysis and neurohypophysis during the embryonic period. incomplete downward migration of the neurohypophysis as a result of a genetic defect or a pituitary stalk injury, from perinatal trauma, may lead to fusion defects. fusion defects are associated with anterior pituitary gland atrophy due to the lack of stimulation from the hypothalamus6). reported a high frequency of perinatal insults, such as breech delivery or neonatal hypoxemia, in children with idiopathic hypopituitarism9, 10). fujisawa and kikuchi. reported the findings of stalk transection and ectopic posterior pituitary at mri in patients with hypopituitarism who had a history of perinatal insult ; these findings suggested that the traumatic ischemic injury of the pituitary stalk or median eminence was the primary cause of the pituitary hormonal deficiencies7, 8). however, other studies propose a congenital cause for this form of pituitary abnormality. in these reports mutations in genes responsible for normal posterior pituitary lobe descent and stalk development are suggested to explain cases of hypopituitarism due to a pituitary structural abnormality11 - 15). to date, although there are possible candidates such as hesx116) and lhx4 genes17), the specific genetic abnormalities leading to pituitary stalk dysgenesis and posterior pituitary ectopia have not been identified. future analysis is planned to examine other transcription factors and signaling molecules, important during pituitary embryogenesis, especially those involved in posterior pituitary ectopia and pituitary stalk dysgenesis. in a high proportion of patients with non - familial idiopathic growth hormone deficiency (both isolated growth hormone defect and multiple pituitary hormone defect), characteristic radiographic findings include a) small to absent anterior pituitary gland b) small or absent pituitary stalk and c) ectopic posterior pituitary hyperintensity located at the base of the hypothalamus14). if an enhancing structure in the hypothalamic area is identified, the diagnosis must distinguish an ectopic neurohypophysis from granulomatous disease and metastatic disease. the findings in our case suggested an ectopic neurohypophysis because of an enhancing structure that showed high signal intensity in both precontrast and postcontrast images. the presence of the neurosecretory granule containing arginine vasopressin neurophysin complex in the astrocytic glial cell can explain the high signal intensity of posterior pituitary lobe18). in previously reported cases, many patients with an ectopic neurohypophysis had no posterior pituitary gland dysfunction. in 1996, adamsbaum reported, in three thousand normal individuals, that the posterior pituitary gland was always located in a fixed site ; however, in patients with growth hormone deficiency ectopic neurohypophysis was identified in 40~60%, and 60~80% of them had partial pituitary hormone deficiency but rarely diabetic insipidus19). this is because of the proliferation of axons and reorganization of the posterior pituitary lobe at the site above the cutting point of the pituitary stalk7). our patient had no sign of diabetes insipidus and therefore we did not test for it with water deprivation. our patient had no history of abnormal gestation, breech presentation, and ischemic insult at birth. so we could assume that the structural pituitary abnormality of this 22-year old man might come from the result of congenital and genomic abnormality. the combined pituitary function testing was noted for no response for cortisol and growth hormone. however, the patient had no complaints suggestive of adrenal insufficiency and the height was within normal limits (183 cm). extensive destruction of the pituitary gland, greater than 60~70 percent, is required for symptoms of pituitary insufficiency ; when present these symptoms are diverse. however, with greater stress symptoms may become more apparent ; this might occur as a result of infection or in association with a surgical procedure. prior reports have shown that in spite of gh deficiency, due to pituitary stalk dysgenesis, height is within normal limits. d.t den ouden explained such phenomenon by offering the following three hypotheses : first, because of the total absence of estradiol, the epiphyses do not close, and the patient continues to grow possibly due to other factors such as insulin. second, the fact that estrogens have a slightly antagonistic effect on the bioactivity of gh could explain why, in the absence of estrogens, low gh secretion has a greater effect than expected. last, a possible growth stimulus in patients with high prolactin (prl) levels, in patients with low gh, which has been implicated in the pathophysiology of growth without gh in craniopharyngioma20). in conclusion, there are many cases of partial hypopituitarism that go undiagnosed because they are asymptomatic, and only have absence of secondary sexual development. therefore, it is important to consider the possibility of hypopituitarism, even in patients who present without other symptoms, as in our case. furthermore, if hypopituitarism results from a structural pituitary abnormality, especially without a history of perinatal birth injury such as breech presentation, further evaluation is indicated at the molecular level to determine whether a genetic abnormality may explain the structural pituitary malformation, such as posterior pituitary ectopia and pituitary stalk dysgenesis. | hypopituitarism is not a common cause of delayed puberty. a 22 year old man was referred to our clinic because of the absence of the development of secondary sexual characteristics. the patient had no complaints of physical discomfort. random serum testosterone and luteinizing hormone level were obtained and found to be low. the combined pituitary function stimulation test revealed a partial hypopituitarism. a pituitary magnetic resonance imaging (mri) was obtained and showed decreased pituitary stalk enhancement and ectopic neurohypophysis. therefore, we conclude that the delayed puberty was a result of hypopituitarism due to pituitary stalk dysgenesis and ectopic neurohypophysis. the patient was started on hormone replacement therapy and gradually developed secondary sexual characteristics. |
fifty - seven patients with intracranial tumors confirmed by pathologic examination were included in this study. the group comprised 32 men and 25 women aged 13 to 81 (mean, 44.9) years. all underwent mr imaging prior to treatment, which included surgery, chemotherapy, and radiation therapy. the pathologic diagnosis of the 57 brain tumors included 21 cases of high - grade glioma (12 glioblastoma multiformes, 3 anaplastic astrocytomas, 3 anaplastic oligodendrogliomas, and 3 anaplastic oligoastrocytomas), eight low - grade gliomas (3 oligodendrogliomas, 2 pilocytic astrocytomas, 1 astrocytoma, 1 mixed oligoastrocytoma and 1 pleomorphic xanthoastrocytoma), eight lymphomas, six hemangioblastomas, seven metastases, and seven various other tumors (2 germinomas, 2 medulloblastomas, 1 ganglioglioma, 1 choroid plexus papilloma, and 1 pineal parenchymal tumor). the seven metastatic tumors arose from squamous cell carcinoma of the lung in two patients, and small cell carcinoma of the lung, large cell carcinoma of the lung, and adenocarcinoma of the thyroid, cervix, and rectum in one patient each. for pathologic confirmation, 49 patients underwent total or subtotal tumor resection and all with lymphoma underwent biopsy for the verification of diagnosis. since gliomas are typically heterogeneous and histologic samples obtained during biopsy may be subject to sampling error (13, 14), we sought to avoid this pitfall by including only gliomas which had undergone subtotal or gross total resection. all patients underwent preoperative conventional and perfusion mr imaging using a 1.5-t imager (signa, ge medical systems, milwaukee, wis., we used a gradient - echo single - shot echo - planar imaging (epi) sequence with the following parameters : tr/ te, 2000/ 60 msec ; flip angle, 90 ; field of view, 28 28 cm ; 128 128 matrix ; section thickness/ gap, 5 mm/ 2 mm. a series of images (10 slices, 50 images / slice) was obtained at 2-second intervals before, during, and after administration of the contrast agent. after 10 seconds, during which time the first five images were acquired and an imaging baseline thus established, a bolus of 15 ml gadopentetate dimeglumine (magnevist, schering, berlin, germany) was power injected at a rate of 5 ml / second through an 18- or 20-gauge intravenous catheter. in each case, multisection data acquisition was used to record a tumor in its entirety, and a total of 500 images was obtained. for the postprocessing of perfusion mr data, changes in the relaxation rate (r2) can be calculated from signal intensity using the following equation : r2= ln (s / s0)/te, where ln is the natural logarithm, s is signal intensity, and s0 is baseline signal intensity (15). tracer recirculation was reduced by fitting a gamma - variate function to the measured r2 curve (15, 16). rcbv maps were generated as gray scale images by numerical integration of the area under a fitted curve on a pixel - by - pixel basis. time - to - peak (ttp) maps were also obtained as gray scale images from the measured r2 curve on a pixel - by - pixel basis (17, 18). for quantitative analysis, normal white matter within the contralateral hemisphere was used as the internal reference standard (19). to determine maximum rcbv ratios, a region of interest (roi), including at least 20 pixels, was carefully established in the area of a tumor which according to an rcbv map showed maximal intensity, and also in contralateral normal white matter. a circular roi was drawn, and measured three times, and its average value was then recorded. rcbv or ttp ratios were calculated by dividing the mean cbv or ttp of a tumor by that of contralateral normal white matter. visual inspection of rcbv map images showed that the signal intensity of all tumors was higher than or similar to that of normal white matter. thus, after visual grading, we assigned a tumor to the high rcbv group if rcbv maps depicted any intratumoral area with a signal intensity higher than that of gray matter. similarly, if visual grading showed that the signal intensity of all intratumoral areas was similar to or lower that of gray matter, the tumor was assigned to the low rcbv group. in addition, we assessed the relationship between the visual grades depicted by rcbv maps and the intratumoral enhancement seen at contrast - enhanced t1-weighted imaging. student 's t test was used to determine statistical differences in rcbv or ttp ratios regarding the histopathologic grades of gliomas and to analyze quantitative differences in rcbv ratios between the two groups visually categorized as high or low cbv on rcbv maps. the one - way anova test fifty - seven patients with intracranial tumors confirmed by pathologic examination were included in this study. the group comprised 32 men and 25 women aged 13 to 81 (mean, 44.9) years. all underwent mr imaging prior to treatment, which included surgery, chemotherapy, and radiation therapy. the pathologic diagnosis of the 57 brain tumors included 21 cases of high - grade glioma (12 glioblastoma multiformes, 3 anaplastic astrocytomas, 3 anaplastic oligodendrogliomas, and 3 anaplastic oligoastrocytomas), eight low - grade gliomas (3 oligodendrogliomas, 2 pilocytic astrocytomas, 1 astrocytoma, 1 mixed oligoastrocytoma and 1 pleomorphic xanthoastrocytoma), eight lymphomas, six hemangioblastomas, seven metastases, and seven various other tumors (2 germinomas, 2 medulloblastomas, 1 ganglioglioma, 1 choroid plexus papilloma, and 1 pineal parenchymal tumor). the seven metastatic tumors arose from squamous cell carcinoma of the lung in two patients, and small cell carcinoma of the lung, large cell carcinoma of the lung, and adenocarcinoma of the thyroid, cervix, and rectum in one patient each. for pathologic confirmation, 49 patients underwent total or subtotal tumor resection and all with lymphoma underwent biopsy for the verification of diagnosis. since gliomas are typically heterogeneous and histologic samples obtained during biopsy may be subject to sampling error (13, 14), we sought to avoid this pitfall by including only gliomas which had undergone subtotal or gross total resection. all patients underwent preoperative conventional and perfusion mr imaging using a 1.5-t imager (signa, ge medical systems, milwaukee, wis., u.s.a.). for the latter, we used a gradient - echo single - shot echo - planar imaging (epi) sequence with the following parameters : tr/ te, 2000/ 60 msec ; flip angle, 90 ; field of view, 28 28 cm ; 128 128 matrix ; section thickness/ gap, 5 mm/ 2 mm. a series of images (10 slices, 50 images / slice) was obtained at 2-second intervals before, during, and after administration of the contrast agent. after 10 seconds, during which time the first five images were acquired and an imaging baseline thus established, a bolus of 15 ml gadopentetate dimeglumine (magnevist, schering, berlin, germany) was power injected at a rate of 5 ml / second through an 18- or 20-gauge intravenous catheter. in each case, multisection data acquisition was used to record a tumor in its entirety, and a total of 500 images was obtained. for the postprocessing of perfusion mr data, changes in the relaxation rate (r2) can be calculated from signal intensity using the following equation : r2= ln (s / s0)/te, where ln is the natural logarithm, s is signal intensity, and s0 is baseline signal intensity (15). tracer recirculation was reduced by fitting a gamma - variate function to the measured r2 curve (15, 16). rcbv maps were generated as gray scale images by numerical integration of the area under a fitted curve on a pixel - by - pixel basis. time - to - peak (ttp) maps were also obtained as gray scale images from the measured r2 curve on a pixel - by - pixel basis (17, 18). for quantitative analysis, normal white matter within the contralateral hemisphere was used as the internal reference standard (19). to determine maximum rcbv ratios, a region of interest (roi), including at least 20 pixels, was carefully established in the area of a tumor which according to an rcbv map showed maximal intensity, and also in contralateral normal white matter. a circular roi was drawn, and measured three times, and its average value was then recorded. rcbv or ttp ratios were calculated by dividing the mean cbv or ttp of a tumor by that of contralateral normal white matter. visual inspection of rcbv map images showed that the signal intensity of all tumors was higher than or similar to that of normal white matter. thus, after visual grading, we assigned a tumor to the high rcbv group if rcbv maps depicted any intratumoral area with a signal intensity higher than that of gray matter. similarly, if visual grading showed that the signal intensity of all intratumoral areas was similar to or lower that of gray matter, the tumor was assigned to the low rcbv group. in addition, we assessed the relationship between the visual grades depicted by rcbv maps and the intratumoral enhancement seen at contrast - enhanced t1-weighted imaging. student 's t test was used to determine statistical differences in rcbv or ttp ratios regarding the histopathologic grades of gliomas and to analyze quantitative differences in rcbv ratios between the two groups visually categorized as high or low cbv on rcbv maps. the one - way anova test rcbv and ttp ratios are summarized in tables 1 and 2. for high- and low - grade gliomas, these varied from 3.02 to 16.66 (mean sd, 9.33 3.96) and from 1.30 to 5.07 (mean sd, 3.64 1.50), respectively (figs. 1, 2). in general, the rcbv ratios of high - grade gliomas of a specific histologic type were not significantly different from those of other high - grade gliomas, and this was also the case with low - grade gliomas. hemangioblastomas showed the highest rcbv ratios (mean, 26.60 8.98), which was statistically higher than those of all other tumors (p 0.05). the relationship between visual grade according to rcbv maps and the intratumoral enhancement seen at contrast - enhanced t1-weighted imaging is summarized in table 3. at visual assessment of tumors on rcbv maps, a high rcbv was found in 17 (81%) of 21 high - grade gliomas. in five of these 17 patients, however, contrast - enhanced t1-weighted images demonstrated no obvious enhancement within the tumor. visual examination of rcbv maps showed that four (19%) of 21 high - grade gliomas belonged to the low rcbv group, and in two of these, contrast enhanced t1-weighted images depicted intratumoral enhancement. after visual inspection, four of the eight low - grade gliomas, namely two oligodendrogliomas, one astrocytoma, and one oligoastrocytoma, were assigned to the low rcbv group, and at contrast - enhanced t1-weighte imaging, enhancement of theses tumors was either absent or equivocal. high rcbv was visually determined in two pilocytic astrocytomas, one oligodendroglioma, and one pleomorphic xanthoastrocytoma. rcbv mapping demonstrated high rcbv in all hemangioblastomas, which at contrast - enhanced t1-weighted imaging showed strong contrast enhancement (fig. high rcbvs were found in six of seven metastases, each of the two germinomas, each of the two medulloblastomas, the ganglioglioma, and the choroid plexus papilloma. the rcbv ratios of tumors assigned at visual examination to the low and the high group ranged from 1.30 to 4.06 (mean, 2.48), and from 4.62 to 40.75 (mean, 12.07), respectively. the presence of contrast enhancement at conventional mr imaging represents a pathologic alteration in the blood - brain barrier, with or without concomitant vascular hyperplasia, whereas the degree of mr perfusion abnormality reflects the degree of microvascularity, with or without destruction of the blood - brain barrier (5, 6, 20, 21). in the grading of gliomas, previous studies (5 - 7, 9) reported statistically significant differences in rcbv values between low- and high - grade tumors, and demonstrated that high - grade gliomas with high rcbv might not enhance at contrast - enhanced mr imaging. there was a statistically significant difference in rcbv ratios between low- and high - grade gliomas (p=0.001), and five high - grade gliomas with high rcbv showed no obvious contrast enhancement. in our study, four high - grade gliomas had low rcbv, a finding which reflects a low level of neovascularity or contrast leakage through the altered blood - brain barrier. (22) reported two cases of anaplastic glioma without increased vascularity, suggesting that a lack of neovascularity within a tumor did not necessarily indicate benignancy. our results also showed that in two of the four high - grade gliomas with visually determined low rcbv, enhancement was evident at contrast - enhanced t1-weighted mr imaging, a finding which may reflect a falsely low rcbv related to contrast leakage through the altered blood - brain barrier. when this is disrupted, perfusion mr may underestimate the real microvascular blood volume. in a region of severe blood - brain barrier breakdown, unwanted t1 effects caused by extravasated gadolinium counteract the t2 signal - lowering effects of gadolinium, resulting in falsely low rcbv values (23). despite their relatively low rcbv ratios, a signal intensity equal to or lower than that of gray matter was apparent at visual analysis of rcbv maps in only four of eight low - grade gliomas these results may be explained by the relatively high neovascularity of the tumors, revealed at histologic examination. likewise, previous studies (9, 23) described pilocytic astrocytomas containing foci of high rcbv, and oligodendrogliomas, regardless of their histologic grade, with high blood volume foci. despite the fact that an oligodendroglioma, independently of its histologic grade, is relatively hypervascular, our study demonstrated a statistically significant difference in rcbv ratio between low - grade and anaplastic oligodendroglioma (p=0.009, student 's t test). to clarify this discrepancy, further study of a larger series is, however, necessary. in our study, a frequently occurring hypervascular tumor such as hemangioblastoma was shown to have an exceedingly high rcbv ratio ; this ratio was lowest in lymphomas, in which it was significantly lower than in high - grade gliomas or metastases. (24) reported that cerebral lymphomas tended to have lower vascularity than malignant gliomas. our study findings suggest that rcbv maps based on perfusion mr imaging data can provide additional information for use in the differential diagnosis of brain tumors. first, they may be useful in differentiating solid cerebellar tumors, including metastatic tumor, lymphoma, and solid hemangioblastoma, in adults ; these occasionally show similar conventional mr features of homogeneous enhancement at contrast - enhanced t1-weighted imaging, and intermediate or mild hyperintensity at t2-weighted imaging, though in our cases, quantitative analysis showed indicated that the signal intensity of lymphoma was similar to or lower than that of gray matter, while hemangioblastomas and metastases showed high intensity on rcbv maps of perfusion mr imaging. second, an rcbv map is also useful in differentiating cystic astrocytoma from cystic hemangioblastoma. at conventional mr imaging, both cerebellar hemangioblastomas and astrocytomas often appear as small, enhancing nodules within a well circumscribed, thin - walled cyst, as in our cases. despite some differential features such as an intratumoral signal void, differentiation by conventional mr imaging alone is difficult, especially where tumors are smaller than 1 cm (25, 26). perfusion mr imaging, however, permits differentiation without the need for additional invasive conventional angiography. quantitative analysis indicated that the rcbv ratio of hemangioblastomas was significantly higher than that of cerebellar astrocytomas, and it was also found that compared with that of gray matter, the signal intensity of hemangioblastomas was higher, while that of cystic astrocytomas was slightly higher (figs. compared to other studies (5 - 7), the rcbv ratios of tumors in our series were higher in the titer, a fact which may be due to the different way in which rois were selected : the rois we chose were, for each tumor, in the area which showed maximal perfusion. we noticed that ttp was a useful parameter in stroke cases (27), so sought to identify on ttp maps any differences between various tumor groups, especially between lymphomas and other hypervascular tumors. ttp maps, in contrast to rcbv maps, played only a small part in both the grading and differentiation of the various brain tumors we encountered. a limitation of this study is the inclusion of only small numbers of cases of low - grade glioma, especially low - grade astrocytoma and oligodendroglioma. to determine the practical utility of perfusion mr imaging in differentiating between low- and high - grade astrocytomas or oligodendrogliomas, further study involving a larger series of these tumors the grading of gliomas, determination of a cut - off value for rcbv may be helpful. in summary, the rcbv ratios of high - grade gliomas were significantly higher than those of low - grade gliomas. for hemangioblastomas, these ratios were exceedingly high ; for high - grade gliomas and metastases they were relatively high ; and for low - grade gliomas and lymphomas they were relatively low. perfusion mr imaging may be helpful in the differentiation of the various solid tumors found in the brain, as well as in assessing the grade of the various glial tumors occurring there. | objectiveto determine the utility of perfusion mr imaging in the differential diagnosis of brain tumors.materials and methodsfifty - seven patients with pathologically proven brain tumors (21 high - grade gliomas, 8 low - grade gliomas, 8 lymphomas, 6 hemangioblastomas, 7 metastases, and 7 various other tumors) were included in this study. relative cerebral blood volume (rcbv) and time - to - peak (ttp) ratios were quantitatively analyzed and the rcbv grade of each tumor was also visually assessed on an rcbv map.resultsthe highest rcbv ratios were seen in hemangioblastomas, followed by high - grade gliomas, metastases, low - grade gliomas, and lymphomas. there was no significant difference in ttp ratios between each tumor group (p>0.05). at visual assessment, rcbv was high in 17 (81%) of 21 high - grade gliomas and in 4 (50%) of 8 low - grade gliomas. hemangioblastomas showed the highest rcbv and lymphomas the lowest.conclusionperfusion mr imaging may be helpful in the differentiation of thevarious solid tumors found in the brain, and in assessing the grade of the various glial tumors occurring there. |
atopic dermatitis (ad) is one of the most common skin diseases with a complex multifactorial pathogenesis. the diagnosis is established using the modified hanifin - raijka criteria as described by williams. the clinical presentation, the aggravating factors and the complications differ according to the age of the patients. about 60 - 80% of the patients present for the 1 time before the age of 12 months. the worst sign of ad is pruritus, which also often indicates an exacerbation and is considered to be the most discomforting feature of ad. scoring atopic dermatitis (scorad)-index or objective scorad or easi evaluation are the most validated systems for evaluating the severity. follow - up of the patients may be done with easier systems such as the three - item severity (tis) evaluation. systemic therapy is warranted in those in whom the disease activity and the exacerbations can not be controlled adequately with topical treatment regimens. in children from 6 months to 9 years one can use the wet - wrap crisis intervention therapy as a topical recent european academy for dermatology and venereology guidelines on the treatment of ad published by ring. in 2012 can be considered as a basic document. since systemic therapy is difficult to apply on practical grounds and also because it is not patient - friendly in small children aged 6 months to 10 years, one can in fact enhance the effect of topical treatment 10-fold leading to a systemic effect of the therapy by means of wet - wrap. this approach should be limited to cases with severe disease intensity and extent (with an objective scorad of more than or equal to 40 or scorad - index of more than or equal to 50). the use of wet - wraps with diluted corticosteroids for at least 3 days and up to 14 days is a safe crisis intervention treatment under strict controlled criteria and circumstances [table 1 ]. one can apply this regimen for long - term use based on the principles of proactive treatment in which anti - inflammatory drugs are used in combination with 2 - 6 times daily applications of liberal amounts of emollients on the entire body. technique of the wet - wrap method with diluted fluticasone propionate 0.05% cream (oranje 1999, with method adaptation as described by goodyear.). this involves a schedule for a clinical treatment with a duration of, in principle, 5 days the effectiveness is partly explained by a systemic effect. it was reported in two different double - blind placebo - controlled randomized controlled trials (rcts) that oral cyclosporine was superior to placebo. the efficacy of cyclosporine at a dose of 3 - 5 mg / kg / daily was demonstrated both in adults and in children. except in two small rcts evaluating systemic glucocorticosteroids in severe childhood ad, no other data were found in the literature by schmitt. as described in their systemic review published in 2007. especially no data was identified for prednisolone, which is the standard systemic glucocorticosteroid used in routine clinical practice as stated by schmitt. the often chosen dose of prednisone is 1 - 3 mg / kg / daily. mtx is very effective as an immunosuppressive drug in the treatment of several chronic inflammatory conditions. a lot of experience with mtx has been available for many years in dermatology and rheumatology. it was shown to be effective, safe and without serious side - effects such as minor gastro - intestinal complaints especially in children. according to my own experience it is also very effective in ad. studied mtx in 20 adults with severe ad and reported a very positive therapeutic effect. it works well with good response, but it is not always well - tolerated. the enzyme thiopurine methyltransferase plays an important role in metabolizing the drug and deficiency of this enzyme has been associated with a high risk of myelosuppression. murphy and atherton studied its effect in pediatric patients and showed that the drug also works very well in children. a study done by schram. compared the efficacy and the safety of mtx and azathioprine in adults with severe ad. the drugs were equally effective, achieved significant improvement and were safe for the study - period of 12 weeks. they are alternatives in resistant cases of adult ad, but enough large randomized trials are not available yet. these drugs should not be considered for routine practice. a study done by waxweiler. they found that both drugs were equally effective (retrospectively studied), but did show similar rates of skin infections. one should consider systemic treatment only when ad is non - responsive to adequate topical treatment. for children aged 6 months to 10 year, one can consider topical systemic treatment according to the wet - wrap method applied in a pro - active way as practiced by me since the 1990s. of the systemic treatment options, cyclosporine and azathioprine are the evidence - based options, whereas mtx used by many experts still lacks enough evidence - based proof of efficacy. all the above mentioned drugs such as cyclosporine, mtx and azathioprine may be used in routine practice, with as a note to realize that cyclosporine is the ideal drug for crisis intervention with a quick response, whereas it takes at least 3 weeks before the effects of mtx and azathioprine are observed. it is important to evaluate thiopurine methyltransferase levels in monitoring azathioprine and also during the course of the treatment repeatedly. mycophenolate and biologicals should be considered as experimental and should be used in exceptional adult cases. intravenous gammaglobulin may also be considered as an option for cases resistant to all the drugs mentioned above and recalcitrant ad in adults. | atopic dermatitis (ad) is one of the most common skin diseases with a complex multifactorial background. the clinical presentation, the aggravating factors and the complications vary according to the age of the patients. most cases, approximately 60 - 80%, present for the 1st time before the age of 12 months. adult - onset ad has been observed as a special variant. pruritus is the worst sign of ad, which also often indicates an exacerbation and is considered to be the most annoying symptom of ad. treatment is preferably started based on the severity of ad. in only 10% of the cases, ad is so severe that systemic treatment is necessary. systemic treatment including topical wet - wrap treatment is indicated in the worst and recalcitrant cases of ad. systemic treatment of ad is discussed with regards to the evidence - based efficacy and safety aspects. i prefer wet - wraps as a crisis intervention in severe childhood cases, whereas uv and systemic treatments are the choices in patients older than 10 years. probiotics are not useful in the treatment. if they have any effect at all it may only be in food - allergic children with ad. finally, anti - histamines are not effective against pruritus in ad. they are only effective against urticarial flares and in cases with food - allergy. this article consists of an expert opinion on evidence - based pharmacological treatment of ad, but it is not a systemic review. |
postoperative perineal hernia occurs after conventional abdominoperineal resection (apr) and after the extralevator technique of apr (extralevator abdominoperineal excision ; elape) or pelvic exenteration. it has traditionally been reported to have a low incidence, ranging from 0.6% to 7%.1 various techniques, including primary suture, muscular flaps, and synthetic or biological meshes, have been used to repair the defect in the pelvic floor. biological meshes are currently used in perineal reconstruction after elape, but the literature on biologics in pelvic floor surgery is limited to case series / reports, with limited follow - up and lack of randomized trials.2,3 only a few complications have been reported to date, such as seroma and perineal pain. to our knowledge, we present the first case of an enterocutaneous fistula as a late complication to reconstruction of the pelvic floor with a permacol mesh (covidien, dublin, ireland) after perineal hernia. a 70-year - old man with a t3v1n0m0 rectal tumor underwent laparoscopic apr followed by adjuvant chemotherapy with oxaliplatin, fluorouracil, and calcium folinate. at 1 year control, radiological work - up and colonoscopy showed no signs of recurrence or distant metastases. thirteen months after the apr, the patient developed a perineal hernia and had a reconstruction of the pelvic floor with a biological mesh (permacol) via a transperineal approach. the postoperative course was uneventful, and the initial follow - up with a pelvic abdominal computed tomography (ct) scan 4 months after the surgery showed no signs of locoregional recurrence or reherniation. a thoracic abdominal ct scan was performed and showed multiple metastases to the liver and lungs. the patient was treated with chemotherapy : bevacizumab, irinotecan, calcium folinate, and fluorouracil. twelve months after the perineal hernia operation, but only 6 weeks into chemotherapy, the patient developed signs of sepsis with a high temperature, tachycardia, and hypotension and complained of pain in the right buttock. possible differential diagnoses could have been local recurrence of the rectal cancer, intraabdominal abscess, or pelvis sepsis. we could have chosen to examine the patient with a positron emission tomography scan or, for example, an ultrasound (us)-guided biopsy, but we chose an acute us examination. this revealed an abscess, and drainage was established by a us - guided procedure. the patient was moved to an intensive unit and started treatment with intravenous fluids and broad - spectrum antibiotics. the following ct scan with contrast given through the drain showed a subcutaneous abscess cavity located in the perineum, with communication to the small bowel (figure 1). the patient underwent a laparotomy, and operative findings confirmed a perineal fistula from the distal ileum (figure 2). the patient was in the intensive care unit for a total of 16 days before treatment with pressors, intravenous fluids, and parenteral nutrition stabilized the patient. the perineal wound was treated with vacuum - assisted closure for a total of 20 days. there were no complications in the closure treatment. according to the patient s request, synthetic meshes have been used in the repair of perineal hernias, but they have limitations in potentially contaminated or infected fields, with risk for fistula formation, chronic inflammation, stiffness, erosion, small bowel adhesions, and chronic mesh infections.1,2 blow reported that intraoperative perforation is a significant risk factor for local and distant recurrence and survival in rectal cancer patients, and therefore should be avoided.4 in such a setting, the potential risk for erosion, and thereby perforation of the bowel, makes the use of synthetic mesh adverse in rectal cancer surgery.4 biological meshes use the collagen network of human, porcine, or bovine tissues instead of synthetic materials, and they have theoretical advantages compared with synthetic meshes, such as superior incorporation and less risk of infection.1,2 more recently, they have been used to close the perineum after elape and in the treatment of perineal hernias.3 there is now considerable literature to support the use of biologic meshes.13 hbner reviewed the use of flap reconstruction against reconstruction with a biological mesh after elape. perineal wound complications occurred in 28% of the participants and 3.5% developed a perineal hernia after reconstruction with a biological mesh compared with 32% and 3.9% after flap reconstruction, respectively.2 in our case, we used permacol (tissue science laboratories / covidien plc, dublin, ireland), which is a natural acellular biological collagen that is gradually absorbed and replaced by the patient s own collagen. ahmed recently reviewed pelvic floor reconstruction with either a synthetic or a biological mesh. they found 4% mesh erosion with nonabsorbable synthetic mesh repair in sacrocolpopexy, compared with 0% with biological graft repair. these lower erosion rates are reproduced in the repair of transvaginal rectocele, where using permacol had 0% erosion compared with 7% erosion with synthetic mesh. ahmad also report lower infection rates using permacol (0%) versus synthetic mesh (13%) in transperineal rectocele repair.3 although we used permacol for pelvic reconstruction in our patient, other factors may have played a role in the enteric fistula formation. for example, chemotherapy against metastatic disease, and especially bevacizumab, is suspected to cause enteric fistulas. the incidence of gastrointestinal perforations in colorectal cancer patients treated with bevacizumab has been reported, ranging from 0.9 to 2.0.5 the relative risk of gastrointestinal perforation in patients with metastatic colorectal cancer treated with bevacizumab has been reported to be between 3.68 and 5.04.5 the majority of the gastrointestinal perforations occurred within the first 6 months of treatment with bevacizumab. ganapathi investigated the correlation between bevacizumab treatment and fistula formation after resection of advanced colorectal cancer.6 a total of nine patients (4.1%), who had undergone surgical excision for colorectal cancer and subsequently received bevacizumab, developed enteric fistulas. it was pointed out that the development of fistulas was probably secondary to bevacizumab therapy, rather than a surgical complication. the average time elapsed from the initial operation to the initiation of bevacizumab was 23.6 (range, 942) months. the average time before developing a complication after treatment with bevacizumab was 3.9 (range, 19) months. in our case, reported symptoms of the fistula started 6 weeks into bevacizumab treatment and approximately 12 months after the perineal hernia operation. thus, it seems most likely that the complication was a result of the bevacizumab treatment, rather than a complication to the perineal hernia repair with a permacol mesh. there is no evidence that a late fistula caused by erosion or chemotherapy alters oncological outcome. in conclusion, it seems that hernia repairs with biological meshes have lower erosion and infection rates compared with synthetic meshes, and so far, evidence suggests that biological grafts are safe and effective in the treatment of pelvic floor reconstruction. however, our case report supports the literature about the association between bevacizumab and fistula formation among rectal cancer patients, even after pelvic reconstruction using a biological mesh and without local recurrence. | this is the first reported case of an enterocutaneous fistula as a late complication to reconstruction of the pelvic floor with a permacol mesh after a perineal hernia. a 70-year - old man had a reconstruction of the pelvic floor with a biological mesh because of a perineal hernia after laparoscopic abdominoperineal resection. nine months after the perineal hernia operation, the patient had multiple metastases in both lungs and liver. the patient underwent chemotherapy, including bevacizumab, irinotecan, calcium folinate, and fluorouracil. six weeks into chemotherapy, the patient developed signs of sepsis and complained of pain from the right buttock. ultrasound examination revealed an abscess, which was drained, guided by ultrasound. a computed tomography scan showed a subcutaneous abscess cavity located in the right buttock with communication to the small bowel. operative findings confirmed a perineal fistula from the distal ileum to perineum. a resection of the small bowel with primary anastomosis was performed. the postoperative course was complicated by fluid and electrolyte disturbances, but the patient was stabilized and finally discharged to a hospice for terminal care after 28 days of hospital stay. it seems that hernia repairs with biological meshes have lower erosion and infection rates compared with synthetic meshes, and so far, evidence suggests that biological grafts are safe and effective in the treatment of pelvic floor reconstruction. there have been no reports of enteric fistulas after pelvic reconstruction with biological meshes. however, the development of intestinal fistulas after chemotherapy with bevacizumab has been described in the literature. our case report supports this association between bevacizumab and fistula formation among rectal cancer patients, as symptoms of a fistula started only 6 weeks into bevacizumab treatment but approximately 12 months after the perineal hernia operation, even after pelvic reconstruction using a biological mesh and without local recurrence. |
with obesity rates on the rise, more individuals are attempting to lose weight for improved health. unfortunately, the vast majority of weight loss attempts are short - lived and are followed by weight gain. that is, for individuals that successfully achieve weight loss of at least 10%, approximately 80% will regain the weight in the first year alone [1, 2 ]. repeated attempts at weight loss results in a phenomenon referred to as weight cycling (also known colloquially as unfortunately, clinical studies have produced conflicting results with some studies suggesting that weight cycling may decrease lifespan [712 ] while others suggest that weight cycling has no negative effect [4, 5, 1317 ]. review of these clinical studies suggests that inclusion of confounding factors, such as unintentional weight loss, likely accounts for the discrepancies and that further research is needed [18, 19 ]. additionally, these authors indicate that when intentional weight loss is evaluated, little to no evidence exists for an adverse effect of weight cycling ; however, better controlled studies are needed [18, 19 ]. in attempts to perform a controlled animal study, our laboratory set out to evaluate the impact of lifelong weight cycling on longevity in mice. results of this study showed that weight - cycled mice lived significantly longer than obese mice (801 vs 544 days), suggesting that periodic, repeated, weight loss attempts were preferable to no weight loss attempts in obese mice. to better understand the molecular changes that occur during weight cycling, we analyzed cellular senescence via senescence - associated -galactosidase staining in white adipose tissue (wat) and circulating levels of activin a, a recently identified marker of cellular senescence. a total of 130 male c57bl/6j mice were placed on one of four diets at 4 weeks of age : 1) a high - fat (hf) diet (n = 40 ; d12492 ; research diets ; 60% of energy from fat, 20% from carbohydrates, and 20% from protein) ; 2) a standard chow (lf) diet (n = 40 ; prolab rmh 3000, pmi nutrition international ; 14% of energy from fat, 60% from carbohydrates, and 26% from protein) ; 3) a cycled diet in which mice alternated between 4 weeks on the lf diet and 4 weeks on the hf diet (n = 40) and were sacrificed at the end of a hf cycle (yoyohf) ; and 4) a smaller group on a cycled diet (n = 10), which were identical to group 3 except the cycles were offset in order to provide wat from cycled mice at the end of a lf cycle (yoyolf). plasma was collected from groups 13 at 12 and 13 months of age to determine the effects of cycling on activin a levels in the same group of mice at the end of a hf and a lf cycle. plasma levels of activin a were measured using activin a elisa kits (dac00b, r&d systems) according to manufacturer s instructions. all procedures were approved by the ohio university institutional animal care and use committee and fully complied with all federal, state and local policies. forty mice were sacrificed at 15 months of age (n = 10 per diet group). four wat depots (inguinal subcutaneous, mesenteric, epididymal, and retroperitoneal) were collected from each mouse, and senescence - associated -galactosidase assays were performed to determine senescent cell numbers as previously described. stained samples were analyzed under a nikon eclipse e600 fluorescent microscope. the number of senescent cells (x - gal stained cells) and dapi stained nuclei were used to determine percentages of senescent cells per nuclei. comparisons were made by one - way anova across all four groups and post - hoc tukey analysis. 1a while body weight and fat mass at the time of the dissection are shown in fig. as expected, body weight and fat mass fluctuated dramatically in cycled mice with each diet transition. these results help confirm that the current dietary regimen replicates the weight cycling observed in our initial longevity study published in 2013. 1d) were highest in and did not differ between hf mice and weight - cycled mice at the end of a 4 week hf cycle. activin a levels were significantly lower in lf and cycled mice at the end of a 4 week lf cycle. the number of senescent positive cells in the four wat depots is shown in fig. 2. in all wat depots, hf fed mice had a significantly higher percentage of senescent cells than lf mice. in inguinal and retroperitoneal wat, yoyolf had significantly less senescent cells than the yoyohf, but there was no significant difference in senescent cells between hf and yoyohf groups or between lf controls and yoyolf groups. while the trend for the other two wat depots was similar, statistical significance for example, in epididymal wat, yoyohf had a higher percentage of senescent cells compared to yoyolf, but none of the other group comparisons reached statistical significance. likewise, in mesenteric wat, no statistical difference was seen between lf, yoyohf, and yoyolf groups. in this study and in agreement with other studies [2326 ], we show that obesity induced by a hf diet results in a significant increase in senescent cells in wat compared to lf controls. circulating activin a levels importantly, our data indicate that 28 days of weight loss are sufficient to significantly reduce the number of senescent cells as shown by significantly reduced activin a levels and a significant reduction in senescent beta - galactosidase stained cells in inguinal and retroperitoneal wat depots. of note, since inguinal and retroperitoneal wat were the most responsive to the weight loss, there appears to be a depot specific difference in cellular senescence in response to this dietary manipulation. recently, the kirkland laboratory at mayo clinic published a comprehensive study identifying activin a as a marker for cellular senescence in humans and mice. in this study, it was determined that i) human senescent fat cell progenitors release activin a, ii) activin a impedes the normal function of stem cells and fat tissue, iii) older mice have higher levels of activin a in both their blood and fat tissue than young mice, and iv) eliminating senescent cells from mice leads to lower levels of activin a. since most procedures used to determine senescent cell accumulation require tissue collection, the discovery of a circulating marker of cellular senescence represents an important step for detection of senescent - related disease. this is particularly important in a clinical setting since blood is relatively easy to collect. research has shown there is a correlation between obesity and increased cellular senescence [2326 ], which may account for increased mortality and progression of age - related diseases. thus, the possibility of senolytic treatment (agents that clear senescent cells), particularly in wat, has been suggested as a potential therapeutic target. duel treatment with dasatinib (an anti - cancer drug) and quercetin (a flavonol found in fruits and vegetables) has been shown to reduce the amount of senescent cells and improve vasculature dysfunction in aging mice and mice with atherosclerosis. ruxolitinib (an fda approved jak 1/2 inhibitor) has also been shown to eliminate senescent cells and reduce activin a, which results in improved adipogenesis and insulin sensitivity. for those reasons, clearance of senescent cells in wat with senolytic agents or, as we show here, with dietary manipulation, may be a promising approach for treatment of metabolic syndrome, type 2 diabetes, and other age - related complications. in conclusion, data from the current study shows that weight loss due to diet can decreases cellular senescence in wat. | previously, our laboratory reported that weight - cycled mice outlive their obese counterparts. to gain a better mechanistic understanding of these results, we evaluated cellular senescence in white adipose tissue (wat) of lean, obese, and weight cycled mice. our results show that at the end of a 28 day weight loss cycle cellular senescence is significantly reduced in multiple wat depots compared to obese mice, which also corresponds to a reduction in circulating activin a (a marker of senescence). these findings suggest that a previously undescribed benefit to weight loss may be a reduction of cellular senescence in wat. |
loss of lumbar lordosis causing pain and curvature of the vertebral skeleton to one side is a relatively uncommon disease. to our knowledge, successful treatment of loss of lumbar lordosis with any potentized homeopathic drug diluted above avogadro s limit (that is, above a potency of 12c) has not been documented so far. in this communication, we intend to document a relatively rare case of loss of lumbar lordosis with osteophytic lippings, disc desiccation, and protrusion, causing a narrowing of secondary spinal canal and a bilateral neural foramina, leading to vertebral column curvature with acute pain in an adolescent boy. the patient had undergone treatment with orthodox western medicines, but did not get any relief from, or cure of, the ailment ; finally, surgery was recommended. the patient s family brought the patient to the khuda - bukhsh homeopathic benevolent foundation where a charitable clinic is run every friday with the active participation of four qualified homeopathic doctors. a holistic method of homeopathic treatment was adopted by taking into consideration all symptoms and selecting the proper remedy by consulting the homeopathic repertory, mainly of kent. the symptoms were effectively treated with different potencies of a single homeopathic drug, calcarea phos. x - ray and magnetic resonance imaging (mri) supported recovery and a change in the skeletal curvature that was accompanied by removal of pain and other acute symptoms of the ailment. homeopathy can be a safe, much less expensive, non - invasive, and viable alternative for the treatment of such cases. in the homeopathic mode of treatment, micro doses of ultra - highly - diluted remedies are often used with great benefits to the patient. some such homeopathic remedies have been reported earlier by us to show their beneficial effects in ameliorating / removing disease symptoms of patients bearing ovarian cysts [2 - 6 ], including their successful removal, but no such documentation on any potentized homeopathic drug having shown the ability of ameliorating / curing the symptoms of loss of lordosis seems to exist. in this communication, therefore, we intend to record a case where a patient with a rare type of structural deformity causing a change in body curvature and pain due to loss of lordosis was cured by the administration of a homeopathic remedy used in different potencies (grades of homeopathic dilution). lordosis refers to the normal inward curvature of the lumbar and the cervical regions of the spine. normal lordotic curvatures, also known as secondary curvatures, cause a difference in the thickness between the front and the back parts of the intervertebral disc. though lordosis is relatively rare, it can sometimes occur at puberty, usually not becoming evident until the early or mid - twenties. lumbar hyperlordosis is a condition that occurs when the lumbar region (lower back) experiences stress or extra weight and is arched to the point of muscle pain or spasms. common causes for such a condition generally include tight lower - back muscles, excessive visceral fat, and pregnancy. rickets, a vitamin d deficiency in children, can also lead to manifestations of lumbar lordosis. younger dancers or sportspersons are more at risk for developing lumbar hyperlordosis because the lumbar fascia and hamstrings tighten when a child starts to experience a growth spurt into adolescence. in such cases, in the treatment with the orthodox or western method, rather complicated surgery is often advised to correct the curvature back to its normal position and to remove the severe pain resulting from the undue curvature. a boy aged 16 years visited the clinic on march 28, 2016, with excruciating pain in the lower back and hip region. he showed external curvature of his lower back, which gave him a tilted posture, with signs of loss of lordosis. before coming to this clinic, he visited the clinics of some renowned orthopaedic / neurologic physicians / surgeons after he had started suffering from a gradual development of an awkward curvature of his waistline sidewise and downward due to loss of lordosis. from november 13, 2015, through march 10, 2016, he took allopathic medicines as advised by the different orthopaedic-/neuro - physicians, but without any apparent amelioration of his suffering and pain. gradually, he started becoming almost immobilized because of his continuous severe back pain during normal movements of the body. as he had already been diagnosed with loss of lordosis at l4-l5 and l5-s1 and with disc desiccation and disc protrusion causing a narrowing of the secondary spinal canal and bilateral neural foramina based on x - ray and magnetic resonance imaging (mri) reports, he was referred for possible surgical intervention. the guardians of the family, who otherwise belonged to the lower middle class, were unable to arrange for the cost of surgical intervention and further medical treatment. finally, the patient was brought to our homeopathic foundation clinic by his family members on a van rickshaw ; he was lying in a peculiar posture with the help of strategic pillow support. on examination, mind - anger, irascibility, anxiety, irritability, quarrelsome, prostration of mind from talking, ailments from grief ; 2. tingling, prickling pain in the lower limbs and hip and in the gluteal muscles of the leg and foot, with the pain being wandering and shifting in nature and being worse in the morning and the evening and changing with the weather and motion ; 4. pain in lower limbs, bones, joints, as wells as sciatica - like pain in the lower limbs ; 5.. symptoms being aggravated by cold air in general. the patient s father agreed to sign the after recording the case history, the most suitable homeopathic remedy and the potency were selected. the selection of the homeopathic remedies was made in consultation with the repertories of kent [8, 9 ], and the best remedy indicated for him was calcarea phos. the treatment was started with the 30c potency of calcarea phosphoricum (calc phos 30c), diluted as per homeopathic dilution procedure 10 times. the gradual progress in the straightening of the gait of the patient after administration of the drug is shown in the photographs of the patient in fig. 1, which are arranged in order from the beginning of drug administration through recovery and discontinuation of the drug ; the x - ray images and mri results are presented in fig. 2 (before drug administration) and fig. the course of treatment is as follows : on march 28, 2016, calc phos 30c was prescribed thrice a day for 10 days ; the patient was advised to visit after 15 days. on april 14, 2016, calc phos 30c was prescribed twice daily for 7 days. on april 28, 2016, calc phos 200c was prescribed twice daily for 2 days because he had reported the re - appearance of pain and discomfit. the curvature was also found to be slightly less on this day. on may 12, 2016, calc phos 1000c was prescribed once in the morning on an empty stomach for two consecutive days. at this visit, he reported that at first, the pain had been alleviated quite remarkably and that he had remained well, but the pain had re - appeared with much less intensity. the patient showed encouraging favorable changes in his standing posture, indicating clear signs of a straightening of the curvature. on may 21, 2016 the curvature had further straightened ; the vertebral column had straightened and considerable mobility had been restored. the patient was advised to undergo an x - ray of the lumbar - sacral regions of the spine. on may 23, 2016, the report for an x - ray on may 22 revealed that lumbar lordosis was now maintained. inter- vertebral disc spaces were normal, and no evidence of osteophyte protrusion was seen in vertebral bodies ; both s.i. the patient s gait looked quite normal, and he had resumed his normal daily activities. he was given a placebo for medication, and he was advised to return after one month. on june 23, 2016, the patient was doing well and had no problems in movement ; he could now ride bicycle. he was advised to undergo an mri test of the lumbar - sacral regions of the spine. on august 3, 2016, a few salient findings were as follows : i) no obvious osteophytic or degenerative end plate changes were found. iii) now, only mild bilateral neural foraminal stenosis was seen at the l3-l4 level. iv) bilateral facet joints and ligamental flagum were normal ; visualized cauda equine and conus medullaris appeared to be normal. however, the lumbar curvature was only stated to be impaired, and the disc bulges seen at the l3-l4 and the l5-s1 levels showed only minor bilateral neural foraminal stenosis. further the spinal cord at all segments of the inter- vertebral regions showed a much improved ap diameter, indicating vast improvement over before. the patient was prescribed only a placebo and was advised to visit the clinic if he ever again experienced any discomfit or return of any of the symptoms. taking into consideration the symptoms in totality, we, after consultation with the repertory of kent [8, 9 ], selected calc phos at a potency of 30c, which was to be administered in repeated doses. the boy apparently started responding suitably after receiving the remedy for about 10 days, but then the subsided pains re - emerged, necessitating the introduction of a higher potency of 200c as per homeopathic principles. the boy again started to recover in all respects, including the first sign of a straightening of the curvature and a sense of rapid recovery as his pains had again subsided. in addition, his symptom of excessive thirst had been reduced to a great extent ; his sweating was also diminished. however, after a few days, his pain re - appeared, but at a much reduced intensity. these observations indicated the need for an even higher potency of calc phos, 1000c. his x - ray report was also very encouraging and corresponded well with the lessening of his external symptoms. in all, the condition of this patient, who had earlier been advised to undergone surgery as treatment for his condition, had been perfectly controlled, and his symptoms had been ameliorated to the extent that he no longer needed surgery. this case report shows that ultra - highly - diluted potentized homeopathic remedies, if selected properly, can work wonders in rendering relief to patients suffering from difficult physiological conditions such as the one discussed in this report. furthermore, the study clearly demonstrates that the homeopathic remedy used in this case can provide a viable alternative to surgery for all patients suffering from this rather rare disease, not to mention being of particular help in providing affordable healthcare to the less fortunate persons of society. 1a, before treatment ; 1b-1e, treatment continuing ; 1f-1 g, after treatment. mri, magnetic resonance imaging. before administration of homeopathic medicine : a, mri of ls spine ; b, x - ray of ls spine ; c, report of mri. mri, magnetic resonance imaging. after administration of homeopathic medicine : a, mri of ls spine ; b, x - ray of ls spine ; c, report of mri ; d, report of x - ray of ls spine. | objectives : loss of lumbar lordosis causing pain and curvature of the vertebral skeleton to one side is a relatively uncommon disease. to our knowledge, successful treatment of loss of lumbar lordosis with any potentized homeopathic drug diluted above avogadro s limit (that is, above a potency of 12c) has not been documented so far. in this communication, we intend to document a relatively rare case of loss of lumbar lordosis with osteophytic lippings, disc desiccation, and protrusion, causing a narrowing of secondary spinal canal and a bilateral neural foramina, leading to vertebral column curvature with acute pain in an adolescent boy.methods:the patient had undergone treatment with orthodox western medicines, but did not get any relief from, or cure of, the ailment ; finally, surgery was recommended. the patient s family brought the patient to the khuda - bukhsh homeopathic benevolent foundation where a charitable clinic is run every friday with the active participation of four qualified homeopathic doctors. a holistic method of homeopathic treatment was adopted by taking into consideration all symptoms and selecting the proper remedy by consulting the homeopathic repertory, mainly of kent.results:the symptoms were effectively treated with different potencies of a single homeopathic drug, calcarea phos. x - ray and magnetic resonance imaging (mri) supported recovery and a change in the skeletal curvature that was accompanied by removal of pain and other acute symptoms of the ailment.conclusion:homeopathy can be a safe, much less expensive, non - invasive, and viable alternative for the treatment of such cases. |
several investigations have studied caregivers ' burden and need for support and services in the care of a person with dementia [17 ]. caregivers require information on dementia and its consequences, training in coping strategies and stress management, financial support, communication assistance with a person with dementia and various professionals in the service system, legal advice, information on drug treatment, and help with end - of - life issues. although services have been developed to meet caregivers ' needs, a number of studies have suggested that services fail to meet these needs adequately [29 ]. although caregiving leads to strain and burden, families of dementia patients are often reluctant to use the services offered [2, 913 ]. only one third of caregiving families use these services. barriers to service use include reluctance of the person with alzheimer 's disease (ad) or the caregiver, hassles for the caregiver, concerns over the quality of services, and concerns related to finances. to succeed, both the person with dementia and the caregiver should be involved in daily care decisions [15, 16 ]. formal services are typically engaged when informal services are unavailable or only in moments of crisis. families are often unaware of available service, and are in great need for information [2, 9 ]. caregivers may have had previous disappointing experiences with staff insufficiently trained to cope with patients with alzheimer 's disease (ad) or with high staff turnover. however, few studies have reported on caregivers ' experiences with the use of services, their critiques of those services, or their reasons for not using them. the aim of this study was to describe the critiques of support services by the spouses of persons with alzheimer 's disease. the study is based on their responses to an open - ended question in our survey of alzheimer 's patients ' spouses. this is the first large - scale study investigating the critics of the caregivers of persons with alzheimer 's disease regarding the support services. a random sample was gathered from the alzheimer 's drug users ' register of the social insurance institution of finland. the social insurance institution of finland takes the responsibility of the implementation of all finnish social services justified by law (e.g., drug reimbursements, pensions, and financial support for persons with disabilities). each person with alzheimer 's disease (ad) found in the register had been approved for compensation for ad drugs and had a spouse living at the same address. the gathering of the sample has been described in our previous study reporting on the quantitative findings of our survey of caregivers ' satisfaction with these services. we sent a postal questionnaire to a random sample of 1943 such spouses of persons with ad in five urban or nonurban regions in finland to obtain a representative picture of the overall situation in finland (helsinki, tampere, central finland, northern carelia, and lapland with northern ostrobothnia). of the original random sample, population and mortality registers served to remove participants no longer living or living separately according to current address information. questionnaires were sent on september 2005 and were resent on november 2005 to those spouses who had failed to respond to the initial questionnaire. of the remaining potential respondents (n = 1866), 1434 responded (a 76.8% response rate). we excluded all caregivers who were themselves hospitalized in permanent institutional care (n = 15), couples who lived separately (n = 4), and spouses who did not identify themselves as caregivers (n = 29). of the remaining 1386, 728 (52.5%) provided written responses to the open - ended question (figure 1). of them, 566 (77.7%) altogether, 74 indicated that they had no need for service, and 15 provided positive comments on the service system. the rest (n = 175) described how their personal caregiving situation affected their choice of service use. in this paper, the questionnaire consisted of questions on demographic variables, the physical and psychological symptoms of the spouse with dementia, the support and services the family received from the official service system, and the caregivers ' subjective needs and satisfaction with these services. in our previous paper, we provided an open - ended question : what kind of problems have you faced with the services ? the helsinki university hospital ethics committee approved the research protocol. we used thematic content analysis to analyze the responses of the open - ended question. the answers to the open - ended question concerning the difficulties the caregivers of spouses with ad experienced with the services the data were organized into codes and further into broader categories encompassing the initial codes. each item was compared to the rest of the data to establish analytical categories (constant comparison) [18, 19 ]. the data were reviewed and coded independently by two authors to ensure reliability. in some cases, the authors had discussions to reach a consensus on different items. the mean age of the respondents (n = 728) was 77.8 years (sd 6.1), and 65.1% were females. the mean age of the persons with dementia was 80.8 years (sd 3.9). the mean duration of marriages was 51.8 years (sd 9.6). over half of the caregivers (53.3%) and spouses with dementia had an education of less than eight years. over one third (41.0%) of the caregivers had poor subjective health. of the care recipients, 41.5% needed continuous support from their caregiver. over half of them (56.8%) had had symptoms of depression, more than two thirds (76.2%) had had symptoms of agitation, and 48.5% had had hallucinations. urinary or bowel incontinence was very common (49.6%) among these home - living spouses with ad. almost half (43.5%) was not able to move indoors without aid. the caregivers ' critiques of the service system could be categorized into two major groups : (1) problems with the service application process (n = 296) and (2) criticism on the services offered (n = 270). in addition, 74 caregivers indicated that they had no need for services and 15 had positive views about the services (figure 2). they especially complained about difficulties obtaining information about services (n = 106), the bureaucracy (n = 83), delays in receiving services (n = 42), dissatisfaction with service decisions (n = 143), and secrecy in decision - making process (n = 7). some also felt that health and social care workers behaved impolitely or even rudely towards them (n = 47). caregivers found that obtaining information about services was very difficult and that the service system was very complicated and difficult to comprehend : i did not get any information about what kind of support i am entitled to receive. several caregivers suggested that there should be one person to contact or one place where they could obtain information : even one appointment ; then all the matters could be discussed. the caregivers felt that the service system is complicated even for the authorities.. they do not seem to know themselves how to manage the system. several responses included constructive suggestions for improving the availability of information about the official service system : one single counselling coordinator, would make it unnecessary to go to many different professionals. she or he could even come to our home once a month to ask how we are managing and what we need : do we need a house cleaning, milk from the store or sticks of wood ? many caregivers felt that a lot of bureaucracy surrounded decision making concerning support services : it requires a lot of things they always need more and more information. some respondents complained of secrecy behind decisions to give support services and that the grounds for decisions are often unclear : they do not tell about the services available to those who might need them. the only way to get information is through the grapevine. in addition to the bureaucratic application process, delays in receiving services worsened caregiving situations : the situations change while waiting for the decisions and may already be different by the time we get help. many small communities lack the funds to support dementia families, which leads to rejections of the communal support service : the war veteran rehabilitation application was rejected, and they could not tell why. they could not offer us home help while i was undergoing surgery at the hospital, so our daughter took a day off from her work to take care of her father. a poor municipality can offer nothing. in particular, these families having to face difficult behavioral disturbances and needing emotional support require healthcare and social care professionals to possess not only clinical but also good communicational skills. the caregivers offered their critiques : i was even advised to divorce my husband because of his alzheimer 's disease. when i inquire about services i often become so sad and angry ; everyone is so dismissive and superficial. the caregivers experienced various problems with both open care services (n = 239) and institutional care (n = 57). the caregivers complained about the lack of support services (e.g., home care, cleaning, meals on wheels) (n = 134), as well as the lack of physicians ' services or expertise in dementia care (n = 51), and often mentioned that they had problems obtaining their legally entitled financial support (n = 73). the problems with institutional care usually involved a lack of respite care (short - term institutional care) (n = 34) and long delays in securing permanent institutional care for their spouses (n = 24). lack of offered support servicesthe spouses felt that obtaining the services was difficult even when they really needed them:it was so difficult to get help. i grew exhausted and my husband had to be admitted to hospital. when i fell ill and the ambulance came for me, i could not go to the hospital because nobody would take care of my wife. many respondents complained of receiving the wrong services or of receiving inadequate services : when i requested someone to take care of him so that i could go walking outside a couple of times a week, they asked if half an hour a week is enough.i lost my confidence that someone (from service system) could understand these things. the spouses felt that obtaining the services was difficult even when they really needed them : it was so difficult to get help. i grew exhausted and my husband had to be admitted to hospital. when i fell ill and the ambulance came for me, i could not go to the hospital because nobody would take care of my wife. many respondents complained of receiving the wrong services or of receiving inadequate services : when i requested someone to take care of him so that i could go walking outside a couple of times a week, they asked if half an hour a week is enough.i lost my confidence that someone (from service system) could understand these things. lack of physicians ' knowledge of services or expertise in dementia caresome caregivers felt that health care workers lacked sufficient expertise in dementia : they (physicians and nurses) did not take us seriously we received no referral for further investigations. the doctors in primary care change often. some caregivers felt that health care workers lacked sufficient expertise in dementia : they (physicians and nurses) did not take us seriously we received no referral for further investigations. the doctors in primary care change often. they do not have enough time to familiarize themselves with the patient 's situation. problems in obtaining legally entitled financial supportin finland, caregivers are legally entitled to financial support caregiver 's financial support the financial support itself raised many feelings : the caregiver 's financial support should be easier to obtain : it should not be like begging for mercy. what is such financial support ? 100 euros per month for a caregiver who is 86 years old ? and in addition, they take away 28% in taxes. in finland, caregivers are legally entitled to financial support caregiver 's financial support when they care for a person with a chronic disability. the application process and the financial support itself raised many feelings : the caregiver 's financial support should be easier to obtain : it should not be like begging for mercy. what is such financial support ? 100 euros per month for a caregiver who is 86 years old ? and in addition lack of respite carerespite service is one of the most common services offered to caregiving families, because the law stipulates that those caregivers who are officially entitled to receive caregiver 's financial support are also entitled to receive three days off per month. respite service is often organized by offering respite in a nursing home for the person with dementia, although demand for this service often exceeds availability : we very seldom receive respite services. i have to be really exhausted to receive one week of respite (for my spouse). many caregivers reported having lack of confidence in the quality of respite care : when my spouse returns from respite care, his health is often worse since they have no time to go out with him. many caregivers reported in their open responses that they would have needed a few hours of home respite instead of overnight respite care : i have to take him with me every time i go to my dentist or physician, and this is not easy. respite service is one of the most common services offered to caregiving families, because the law stipulates that those caregivers who are officially entitled to receive caregiver 's financial support are also entitled to receive three days off per month. respite service is often organized by offering respite in a nursing home for the person with dementia, although demand for this service often exceeds availability : we very seldom receive respite services. i have to be really exhausted to receive one week of respite (for my spouse). many caregivers reported having lack of confidence in the quality of respite care : when my spouse returns from respite care, his health is often worse since they have no time to go out with him. many caregivers reported in their open responses that they would have needed a few hours of home respite instead of overnight respite care : i have to take him with me every time i go to my dentist or physician, and this is not easy. i asked for home respite, but could not receive it. delays in obtaining permanent institutional careof the 24 comments related to institutional care, most (n = 18) described the difficulties in securing a permanent place in a nursing home : i had to submit a claim to the state authorities before we secured a permanent place in an institution. i was so exhausted that i almost needed a place in a nursing home for myself. it took a long time to secure a place in a nursing home ; it required a lot of my activity on my part i had to struggle for it ; it was not easy for an old invalid. caregivers also had other concerns about their spouse 's nursing home being too far from their own home, problems with professionals caring for their spouse, or repeated transfers from one institutional place to another. of the 24 comments related to institutional care, most (n = 18) described the difficulties in securing a permanent place in a nursing home : i had to submit a claim to the state authorities before we secured a permanent place in an institution. i was so exhausted that i almost needed a place in a nursing home for myself. it took a long time to secure a place in a nursing home ; it required a lot of my activity on my part i had to struggle for it ; it was not easy for an old invalid. caregivers also had other concerns about their spouse 's nursing home being too far from their own home, problems with professionals caring for their spouse, or repeated transfers from one institutional place to another. to our knowledge, this is the first large - scale study to explore in - depth the critiques of support services by spousal caregivers of persons with ad. even though the spousal caregivers were very old themselves, they were nonetheless eager to respond to our open - ended question about problems with the service system : over half of them provided responses. their critiques were diversely directed at problems with the service application and delivery process as well as various open care and institutional health and social services. the friction and problems between the families and the service system are familiar from previous literature, but the new contribution of our study is that our results reflect openly on the caregivers ' own voices, feelings, and reasoning. some feel that they are battling their situation from one professional to another, while nobody takes responsibility. their many questions concerned ethical issues, which have been acknowledged in a recent european report guiding dementia care. one limitation of our study is that we only inquired about problems with the support service system. consequently, we can not draw the conclusion that the entire service system is problematic. however, that nearly a half of our large sample had disappointing experiences with the service system and also wanted to share them was surprising. it is unlikely that the problems the caregivers described could be culturally specific or related only to finland, as several international studies have also described these same problems [2, 3, 8, 14, 21, 22 ]. however, these studies have been smaller - scale qualitative studies or exploring the problems of services. it must be emphasized that the caregivers ' opinions reflect not only the poor quality of the service system, but also caregivers ' own stress, burden, anxiety, and feelings of loneliness related to their life situation [2, 23 ]. some changes have taken place since then : several communities are going to apply dementia care coordinator programmes after we published the positive findings of our previous study. all caregivers are spouses of real ad patients because the random sample was retrieved from the ad drug register. therefore, the caregivers are truly involved with the everyday problems of dementia. however, this sample represents the more fortunate persons with ad in finland, because in real life many persons with ad go undiagnosed or live alone with no support. consequently, we have no data on those with perhaps the more challenging problems. the caregivers ' open - ended responses were detailed and descriptive of the life and needs of ad caregiving, the caregivers described the problems related to the service application and delivery process in detail. the service system seems very complicated and bureaucratic, and the caregivers have a great need for information related to their rights. these issues have also been noted in many previous studies [5, 8, 24 ]. since over half of the caregivers had an education less than eight years, which is typical to their cohort, these elderly people have even greater need for tailored information regarding available services. the complexity of the present service system is illustrated in figure 3. in our previous project, we showed thatabout 25 different authorities and professionals are responsible for delivering services to ad families (figure 3). thus, it may be very time consuming and needs much patiency from the 80-year - old caregiver to comprehend this jungle to have access to the services they need. as a consequence, we developed a successful care coordinator programme which proved effective in delaying institutional care for dementia patients. many caregivers in the present study also suggested the same kind of single - person counselling service. the responses reflect a great need for information about services, disappointments with the service decisions, and delays in the application process. professionals ought to take the initiative to provide information and to take comprehensive responsibility for dementia families [1, 7, 26 ]. the responses seem to indicate, however, that some professionals have instead taken on the role of a gatekeeper rather than a client - centered approach. many caregivers were aware and understood that their municipalities have lack of funds and resources. however, it is surprising how large proportion of caregivers reported bureaucracy and professionals ' inconsiderate behavior especially taking into account that these caregivers are elderly, stressed, and unable to defend themselves. bureaucracy and secrecy around decisions regarding social benefits evoked suspiciousness and hopelessness among the caregivers. to our knowledge, no previous studies have examined this important issue. in this respect, these elderly people caring for their spouses with ad also benefit from the help of coordinators familiar with the needs of these families. the caregivers also reported a lack of physicians ' knowledge of services and expertise in dementia care. this result is in line with those of a recent canadian qualitative study in which 25 doctors were questioned about their knowledge of and interest in support services. they concluded in stating that physicians are poorly informed about the large array of available services and may even be perhaps uninterested in learning. these elderly couples often feel abandoned with their difficulties, not even knowing what and whom to ask for help, and with nobody informing them about the services to which they may be entitled. problems related to respite and institutional care were also common. the caregivers reported difficulties in obtaining respite care, and after receiving such support, the care recipient may even return in worse condition than when they left home. caregivers want these services not only to provide them relief, but also to improve the care recipients ' situation. providing caregivers emotional and ethical support and adequate knowledge about the disease may be one way of enhancing the coping skills of caregivers in their demanding situations [7, 2830 ]. as in previous studies, [15, 16 ] the message from our caregiving families is that the voice of the entire family caring team (both the care recipient and caregiver) should be heard when planning the service system to reduce the strain of caregiving. when inquiring for problems about the service system, this study produced a surprisingly large number of criticism. caregivers ' own voices could be heard in their responses. in many cases, in describing their situations, officially organized services too often fail to meet the needs of spousal caregivers of demented individuals. the opinions and needs of caregivers and the equality of persons regardless their education or living area or caregiver strain should carry more weight in plans to improve the service system. m. m. raivio has been working part time for the social insurance institution of finland. details of the contributors : (1) conception and design (k. h. pitkl, m. m. raivio, m. l. laakkonen), (2) acquisition, statistical analysis, and interpretation of the data (k. h. pitkl, m. m. raivio) (3) drafting or revising the manuscript critically for important intellectual content (k. h. pitkl, m. m. raivio, m. l. laakkonen), and (4) final approval of the version to be submitted (k. h. pitkl, m. m. raivio, m. l. laakkonen). m. m. raivio is the guarantor. | introduction. caregiving families of patients with dementia are often reluctant to use support services. the aim of this study was to describe their subjective critiques of these services. material and methods. a cross - sectional questionnaire was sent to a random sample (n = 1943) of alzheimer 's patients ' spouses in finland with an open - ended question : what kind of problems have you faced with the services ? their responses were analyzed with thematic content analysis. results. of the responders identifying themselves as caregivers (n = 1386), 728 (mean age 77.8, 65.1% females) responded. opinions could be divided into two categories : (1) problems with the service application process (n = 296) ; (2) critiques of the services offered (n = 270) including either problems with community care support services or institutional care. 74 indicated that they had no need for services, and 15 praised the services they had received. conclusions. from the caregiver 's perspective, the service system is complicated, bureaucratic and works organization centredly. |
stress is defined as a biological response elicited when an individual perceives a threat to his / her homeostasis and the threat causing stress is referred to as a stressor (1, 2). stress has been also defined as a dynamic, progressive relationship between the person and the environment (3, 4). several studies have found that stress has a dichotomous nature ; it has both good and bad sides. both of these effects have been documented to affect all aspects of human condition (e.g. physiological, psychological, cognitive, and social dimensions) for the past six decades (58). for the purposes of this study, labor stress is defined as the level of psychological stress, representing a combination of fear and pain, which is experienced by women during labor. labor, as a life event, is characterized by tremendous physiological and psychological changes that require major behavioral adjustments in a short period of time (6, 89). consequently, the process of labor constitutes a unique set of stressors that challenges a woman 's ability to cope. labor stress has been shown to trigger and enhance adaptive responses in both mother and fetus, which may contribute to the prevention of adverse labor outcomes such as fetal and/or maternal morbidity and mortality. conversely, labor stress has been linked to detrimental outcomes including immunosuppression, fluid and electrolyte imbalances, delayed wound healing, diminished uterine contractions and prolonged labor in the mother (6). furthermore, labor stress may cause poor adaptation to extrauterine life and create neonatal conditions including heart anomalies, respiratory distress, impaired immunity, hyperbilirubinemia, and necrotizing enterocolitis. (1998) have also reported that labor stress can have deleterious effects on neonatal neural development and behavior including impaired motor ability, impaired balance reactions, shorter attention spans, impaired muscle coordination and tonicity, greater infant irritability, and decreased coping ability. labor stress may also contribute to depression, development of concerns regarding children, concerns about parenting capacities, negative interpretations of the pregnancy experience, and decreased confidence (9). furthermore, a high degree of labor stress has been associated with cesarean delivery, increased numbers of labor procedures and longer labors (1012). labor pain is a complex and subjective interaction between multiple physiologic, psychosocial, environmental plus cultural factors and a woman 's interpretation of labor stimuli (13). it must be emphasized that a women 's internal experience of pain is affected by the environment in which she is laboring. the labor environment includes the totality of the animate and inanimate forces that influence women 's experience. these factors include the persons who are present and their verbal and nonverbal communications ; the quality of support the woman feels from those presets ; the degree the environment is strange, including objects such as furniture and equipment ; noise ; light ; temperature ; space for movement ; hospital beds ; monitors ; vaginal examinations and some routine procedures such as intravenous injections ; restriction of fluid intake ; constant evaluations of the fetus 's heart beats ; limitations of mother 's mobility, etc (1417). although some levels of anxiety is considered normal during labor, excessive anxiety is an emotional factor that results in severe pain due to a decrease in pelvic blood flow and increased muscle tension, as a result of an increase in the secretion of catecholamines (13). hodnett (18) finding that physical birth environment, immobility and medical intervention influence womens evaluation of their childbirth experiences and can affect pain experience. in addition some studies have reported that anxiety may be precipitated during the course of labor through the environmental factors such as noise and unfamiliarity (13). in general, any event associated with oxytocin release is highly dependent on environmental factors (copulation, parturition, lactation, etc.) (19). many women have had the experience of their labor stopping when they have entered unfamiliar surroundings and crowded wards of a hospital. however, women choose to give birth in hospitals because they believe they are safer than giving birth in other places. when a laboring woman does not feel safe or protected or when the progress of her normal labor is altered, catecholamine levels rise and labor slows down or even stops (20). intervention to reduce pain and discomfort during labor and birth is a major part of modern obstetric care of laboring women. it is important for midwifes to explore various strategies for diminishing or managing the pain caused by labor and birth. many strategies may be adopted to alleviate pain and a major responsibility of the midwife is promoting and using nonpharmaco - logical techniques to minimize labor pain (21). hence, further exploration of the complex phenomenon of labor stress should take place if positive outcomes in reproductive health are to be achieved. environmental stressors are likely to vary not only from country to country but from individual to individual. the present study explores perceived environmental stressors and pain perception among some iranian parturient women. the present descriptive - comparative study was carried out on 600 primiparous and multiparous women, who had vaginal deliveries in tabrize alzahra hospital during 2005 - 2006. the inclusion criteria included having gestational ages of 37 - 42wk ; absence of any verbal communication limitations ; no history of psychological problems before or during pregnancy ; vaginal delivery candidacy ; absence of fast or prolonged (difficult) delivery, presence of a live and healthy fetus, no need for the use of auxiliary instruments during delivery such as forceps or vacuum extraction ; no analgesic intake and being a singleton pregnancy. the data was collected by two questionnaires. the demographic questionnaire consisted of 40 questions on personal, social and obstetric particulars that had been tailored for the study after an extensive review of the literature. to assess labor stress in physical dimensions, the questionnaire was composed of a 20 likert type (four - point scale) items that ranged from none (0) to high (3). high scores on the environmental factor questionnaire (> 17) indicating more tension from the aforementioned factors and hence depicting more stress. the reliability of questionnaires was tested using test - retest, yielding the following results. furthermore, visual analogue scale (vas) was used for the assessment of perceived pain. there are verbal anchors at each and of the line : no pain and worst possible pain. the test - retest reliability of vas on recalled labor pain in postpartum women was high (r= 0.95), (22). the parturient women were interviewed after signing an informed consent form and after their physical condition allowed an interview. descriptive statistics such as frequency, mean and standard deviation were used to analyze the data. in addition, sample t - test was used to compare the means. to determine the association between environmental factors and pain, approximately, 33.7% of the primiparous and 23% of the multiparous women had attended elementary schools. almost 51.3% of the primiparas and 66.7% of the multiparas had a gestational age of 3738 and 39 - 41weeks respectively. the mean weights of the newborns were 3236.54.2 and 3650.033.2gr for the primiparas and multiparas, respectively. approximately, 97% of the primiparas and 94.7% of multiparas had planned pregnancies. for 81.3% of the primiparous and the mean of the mothers height in primiparas and multiparas were 163.44.9 and 163.24.9 cm, respectively. the means of weight gain during pregnancy were 9.682.1 and 9.652.3 kg in the primiparas and multiparas, respectively. the means of the duration of the active phase of labor were 5.861.6 and 4.971.7 hours in the primiparas and multiparas, respectively. the mean duration for the second phase of labor was 14.93.4min in the primiparas and 12.73.7min in the multiparas. approximately, 58% of the primiparas and 42% of the multiparas reported undergoing 5 - 7 vaginal examinations during labor. in the present study 76.3% of the primiparas and 73.3% of the multiparas reported delivery pain scores of 8, which indicates the most severe pain experienced by an individual table 1 the means of pain scores in primiparous and multiparous women were 8.310.99 and 8.371.16, respectively. comparison of pain scores between the two groups using student 's t - test did not demonstrate any statistically significant relationship (p=0.63). a total of 53.7% of the primiparas and 68.7% of the multiparas had moderate levels of tension. cross - tabulation between reported pain level and parity of the sample scores of pain (0 - 5) were not reported in the present study. comparison of the means of environmental factors between the two groups revealed a statistically significant relationship (p<0.0005), table 2. approximately, the greatest stressors faced by the primiparas related to the large number of patients in the delivery room (70%) and restriction of movement and mobility (67%) and the lowest was related to ward overload (10%). in the multiparas, the greatest stressor was related to noise in the delivery ward (84%) and restriction of fluid intake (78%) and the lowest level of stress was related to lack of privacy (11%) table 3. regardless of any other variables, multiparous women scored higher on the environmental factor questionnaire than primiparas women, in general. distribution of mothers according to tension and stress levels (n=600) mean and standard deviations (msd) of environmental factors questionnaire in the two groups (n=300) values in this table are the mean score of each item in each group. in this study significant positive correlations were found between pain and labor stress from environmental factors in primiparas (r=0.16, p<0.01) and in multiparas (r=0.22, p<0.05). linear regression analysis showed that environmental factors were major predictors of pain in primiparas (=0.654, r=0.83, p<0.05) and multiparas (=0.574, r=0.69, p<0.05). comparison of labor pain and environmental factors in its perception in primiparous and multiparous iranian women in tabriz demonstrated that women consider labor a painful experience, irrespective of the number of previous deliveries, and the majority of the subjects in the present study reported a high score of pain during labor (8). the results of the present study are consistent with the results of the study carried out by abushaikha., there is a dynamic and reciprocal relationship between the woman who is experiencing labor and the birthing environment. the relationship is dynamic because stress during labor is a changing entity that easily shifts from eustress to distress and vice versa throughout the different stages of labor. it is reciprocal because the birthing environment exerts certain stresses on a woman who is giving birth and in return, the woman produces certain stress responses., there was a statistically significant relationship between environmental factors and labor pain in both groups. a parturient woman 's stress and anxiety may be aggravated by environmental factors such as noise or an unfamiliar environment (13). in this study they found that noise exposure resulted in fear and physiological arousal which might enhance pain processing. noise, temperature of the labor room, light and the feeling of being observed are some of the main factors that can stimulate human neocortex. beta endorphin is one of the endorphin hormones which are released by the brain in times of stress or pain. therefore, unpleasant noise can stimulate the brain and release beta - endorphins that can slow labor by reducing oxytocin (19). in the present study, primiparous women believed that restriction in movement and mobility contributed to environment stress and tension. (15) demonstrated that immobility during labor generally has a negative effect and it increases pain. (24) noted that moving freely in the labor room, improves a woman 's sense of control, decreases the need for pain medications, and it may reduce the length of her labor. sometimes it is hard to move in labor room due to routine procedures such as continuous monitoring of the baby 's heart rate and intravenous lines. there is agreement that many women desire mobility during labor and evidence does not exist that such activity could be harmful to the fetus or to the mother (24). the lowest level of stressors was related to ward overload in primiparas but the study carried out by delaram. does not confirm this finding. they found that bright and dim lights were less important environmental stressors (17). in many birthing units, it is common practice to restrict oral fluid intake during labor and delivery (25). according to several studies, the practice of eating and drinking during labor does not impose a threat and, in fact, they may benefit laboring women. benefits of oral intake during labor include maternal satisfaction, maintenance of serum glucose, preservation of muscle glycolgen and a possible reduction in maternal fatigue (26, 27). mcerleen (28) reviewed the historic importance and function of the taken food and fluids during labor. he noted that if intravenous therapy was initiated to treat dehydration, other interventions were more likely to follow. he concluded that positive practices such as providing nutrition would prevent dehydration and ketosis, minimize analgesic requirements and improve the laboring women 's moral. in this study, however, the study carried out by klassen (26) does not confirm this finding. he noted that there were no differences in feeling pain with or without restricting drinking. furthermore, parsons. (30) found that mothers who ate food in the labor room tended to experience a longer labor. in general, as the duration of delivery increases the mother gets more tired and this leads to a decrease in the individual 's capacity to tolerate environmental conditions and an increase in the mother 's anxiety about herself and her baby, which in itself retards the progression of the labor process. fear from not eating and drinking during labor is a predictor for increased perception of pain in labor. in multiparas, lothian (20) noted that lack of privacy would induce catecholamine surge that would terminate early labor, make contractions ineffective and cause severe pain. in our study this disparity between the results of the present study and other studies might be attributed to the influence of different environmental contexts of birth and culture. the results of this study emphasize the important role that midwives could play in alleviating labor stress. dannenbring (31) demonstrated that constant support for parturient women by midwives, especially psychological support, is an important factor in decreasing labor pain. support from midwives relieves labor pains and at the same time changes the parturient women 's attitude toward labor pain to a positive one and helps them easily bear it. the physical environment in which women undergo labor and give birth can have a great effect on the amount of fear and anxiety they experiences. on the other hand, positive aspects of birth environment are associated with positive outcomes such as lower rates of analgesia, lower augmentation and operative delivery, as well as greater satisfaction with the given care (32). a physically more pleasant environment, which is very clean, welcoming, warm, smelling nice and aesthetically pleasing, can help women relax, particularly when labor is long. hospitals are strange and uninviting places where we have usually experienced stress or pain. when giving birth, these feelings are more likely to be felt. by making the labor suite more comfortable and less hospital like, it should be emphasized that some disparities between the results of the present study and other studies might be attributed to the influence of cultural differences in pain perception, the individuals different attitude to pain, educational achievements and the types of facilities available in delivery rooms in different countries. lack of sufficient interaction with parturient women, ward overload with differing populations, fatigue experienced by the mothers, differing past labor experiences between multiparas and primiparas may affect the type and intensity of stressors. since pain does not seem to serve any known purpose for the mother and the baby and only leads to severe complications, easing such pain can transform labor into an enjoyable experience throughout a mother 's life and lead to a sharp decrease in demands for cesarean deliveries. we can help women to better cope with labor pain by improving and modifying the environment, providing privacy, avoiding unnecessary procedures and identifying sources of fear or disturbance and re - moving them. such an understanding will not only help patients learn how to participate in their own pain control, but will also help the clinicians create a nurturing environment. many of these factors are attributes of the laboring women, and others are components of their relationships with others and the environment. therefore, it is suggested that for a better understanding of pain perception in labor and birth, psychological factors that have different meanings to different women be foci of future studies. further investigations pertaining to labor stress are warranted due to limited studies in this area of research. | introductionpain experienced during labor is probably the most painful event in the lives of women. environment itself influences a mother 's experience of pain. tension and stress resulting from pregnancy crisis and labor increase when the mother is hospitalized, which is concomitant with stressful situations and factors that affect pain perception during labor. the purpose of this study was to explore selected aspects of labor stress and specifically study the relationship between environmental factors and pain perception among parturient women.materials and methodsthis descriptive - comparative study was carried out in tabriz alzahra hospital during 2005 - 2006. in this study, 300 primiparous and 300 multiparous women who were candidates for vaginal delivery, were randomly selected and interviewed. the data were collected by a questionnaire and the intensity of pain was determined by visual analogue scale (vas).resultssignificant positive correlations were found between pain and tension from environmental factors in primiparous (r=0.16, p<0.01) and in multiparous (r=0.22, p<0.05) women. furthermore, primiparous women believed that a crowded delivery room (70%) and restriction of movement and mobility (67%) contributed to their environmental stresses. multiparas women believed that noise in the delivery ward (84%) and restrict of fluid intake (78%) increased their stresses.conclusionperformance of routine diagnostic tests in hospitalized pregnant woman, provision of invasive medical care during labor process and a noisy and crowded environment all influence the mother 's experience and perception of pain. therefore, the medical staffs seem to play a great role in alleviating labor pain by reducing stressors, especially the objective ones that are more stressful. |
perovskite oxides exhibit a wide variety of physical properties, including superconductivity, ferroelectricity, and magnetism.(1) the possibility of coherent integration of the functions present in their rich ground states has prompted us to explore the growth of artificial superlattices that may exhibit even a wider variety of the properties than the bulk. most of the previous attempts have been made with (001)-orientated films,(2) whereas there has been very limited success on the growth of (111)-oriented superlattices, perhaps due to lack of our understanding of the epitaxial growth mechanism. more generally, it is not necessarily guaranteed that the properties of epitaxial films grown along the (111) direction are the same as those of bulk or (001)-oriented films, which is a key point to explore in a new class of superlattices such as double perovskites.(3) pulsed - laser deposition (pld) is regarded as one of the best methods to grow high - quality complex oxide thin films and has been widely applied for the heteroepitaxial growth of the perovskite oxides.(4) pld has many growth parameters, which need to be optimized to get the desired materials properties. in addition, a careful study on a model system is essential to know how the structural and physical properties of a material change as a function of growth direction under the same growth conditions. to pursue the research aimed at this purpose, we choose a perovskite ferrate compound, srfeo3, which exhibits a wide variety of physical properties and structures that depend strongly on oxygen stoichiometry. under ambient conditions, the crystalline symmetry varies with increasing ; cubic srfeo3 (= 0), tetragonal sr8fe8o23 (= 0.125), orthorhombic sr4fe4o11 (= 0.25) and sr2fe2o5 (or srfeo2.5, so - called brownmillerite),(5) and recently discovered infinite layer compound srfeo2 (= 1).(6) two end members have been epitaxially grown on (001) perovskite substrates by pld, followed by postgrowth annealing with strong oxidizing (= 0) or reducing (= 1) agents (i.e., ozone or cah2, respectively). in all the studies, srfeo2.5 films are first prepared as precursors because the valence state of fe is robust in a typical range of growth conditions.(8) nevertheless, the details of the epitaxial growth and structure of (001)-oriented srfeo2.5 films have not yet been reported. as for the physical properties, srfeo3 with the high spin fe ions has attracted much attention because of its metallicity and intriguing spin ordering structures : an antiferromagnetic long - range order with a helical spin structure below 134 k under atmospheric pressure and a ferromagnetic order above 400 k under pressures above 17 gpa. particular interest in the epitaxial growth of an (111)-oriented srfeo3 film also stems from the fact that the helicoid vector is parallel to the 111 direction.(10) to explore possible spintronics applications based on perovskite ferrates, controlling the heteroepitaxial growth of the (111)-oriented srfeo2.5 will provide a starting point. in this paper, we have studied the pld growth and structural properties of srfeo2.5 (sfo) films on srtio3 (sto) (001) and (111) substrates. such growth parameters as substrate temperature and oxygen partial pressure were fixed so that a two - dimensional layer - by - layer growth mode was achieved in the initial growth on both substrates, while we tuned the laser spot area, which has been recently found to influence the epitaxial structures significantly.(13) the films exhibit various types of multidomain structures depending on the growth direction and laser spot area, which is attributed to an epitaxial stabilization with a monoclinic structure derived from the original orthorhombic structure of bulk brownmillerite. in order to explain the complicated manner of the epitaxial stabilization, we propose structure models, which in general provide a guidance to control the epitaxial growth and structure of noncubic perovskites on (111) substrates. the sfo films were grown on atomically flat (001) and (111) surfaces of sto substrates (shinkosha, co., ltd.) using a pld system equipped with a semiconductor - laser - diode heater.(14) krf excimer laser pulses (248 nm, 4 hz) were focused on a target (a sfo ceramic tablet, 99.99% purity) with two different spot areas (0.35 0.10 cm and 0.70 0.17 cm, hereafter referred as to small and large spot areas, respectively) at a constant fluence of 1 j / cm. the as - delivered (001) sto substrates were first ultrasonically cleaned in ethanol and acetone and then annealed in air at 1150 c for 1 h to get tio2-terminated terrace and straight step structures. the sto (111) substrates were treated in hot water followed by cleaning in the organic solvents and annealing in air at 1050 c for 1 h to obtain an atomically flat and ti - terminated surface.(15) the substrates were loaded into an ultrahigh vacuum chamber and heated at 950 c for 30 min in an oxygen partial pressure (po2) of 1 10 torr prior to growth. the pld growth was performed at 830 c in po2 = 0.8 mtorr with in situ monitoring of the reflection high - energy electron diffraction (rheed) pattern. some preparatory experiments were conducted to optimize the growth parameters so that clear rheed intensity oscillations were observed. after the growth, the temperature was lowered at a rate of 20 c / min, keeping po2 constant. the surface morphology of the as - grown films as well as the annealed substrates was observed in air using atomic force microscopy (afm, spi-400, sii nanotechnology). the film composition was analyzed for those grown on mgo (001) under the same conditions using a scanning electron microscope equipped with an electron probe microanalyzer (jed-2300f / jsm-6701f, jeol) and the sfo target as a composition standard. using four - circle x - ray diffraction (xrd, xpert mrd, panalytical) with cu k radiation (= 1.541838) all the results are shown and discussed for the four samples listed in table 1. rheed intensity oscillations for the specular beam during the initial growth of srfeo2.5 films on (a) (001) and (c) (111) srtio3 substrates with small spot area of ablation laser. schematics of growth unit cells of the (b) (001)- and (d) (111)-oriented films, showing that each single oscillation corresponds to a thickness of 4 and 2.3, respectively. the insets of parts a and c depict afm images of the substrates (left) and films (right) ; scale bars are 1 m, and color codes are 7 nm in height. figure 1a and c shows typical rheed intensity oscillations recorded during the initial growth of sfo films on (001) and (111) sto substrates, respectively, indicating a two - dimensional layer - by - layer growth mode. it is found that the persistency of the oscillations was quite different for substrate orientations. the oscillation amplitude as well as reflected intensity damped quickly for the (111) case, indicating a transition to a three - dimensional growth mode, perhaps at the initial stage of domain formation. the difference in the growth mode is reflected in the surface morphologies, as shown in the inset afm images. the (001)-oriented film displays the original atomically flat surface structure of the substrate, including 0.4-nm - high steps, whereas the surface of the (111) film is rough, exhibiting small triangular islands. we notice that (111)-oriented perovskite epitaxy is often uneasier than that for (001)- and (110)-oriented ones, to which a possible origin of our particular case will be discussed in terms of disordered atomic structures at heterointerfaces. we estimated the growth rate from the total film thickness measured by a surface profilometer to find that the thicknesses corresponding to one oscillation were 0.4 and 0.23 nm on (001) and (111) substrates, respectively, which is consistent with the charge - neutral formula unit cells along each orientation (figure 1b and d). the growth rate was found to be independent of laser spot area [3.5 10 nm / pulse and 3.2 10 nm / pulse on the (001) and (111) surfaces, respectively ]. x - ray diffraction patterns for srfeo2.5 films grown on (a) (001) and (b) (111) srtio3 substrates. the upper and lower curves in each panel were taken for films grown with small and large spot area, respectively. all the patterns were taken by aligning to substrate reflections, except for the one shown by a dotted line (aligning to film reflection). the composition of cations in all the films was confirmed to be identical to that of the target regardless of laser spot area. wide - range xrd scans along the out - of - plane reflections revealed that single phase sfo has been formed without any secondary phase. sharp film peaks were observed near substrate peaks, as indicated by arrows in figure 2. as for the (111)-oriented film grown with small spot area, no apparent film peak was seen when the pattern was taken with aligning to the 222 sto reflection (solid line in the upper panel of figure 2b) ; however, a clear peak appeared, when aligned to the 222 sfo reflection (dotted line). this result indicates that the film plane tilts with respect to the substrate plane, which was not seen in the other samples. x - ray pole figures (along the - and -axes) of 222 srfeo2.5 reflections for films grown on (111) srtio3 (sto) substrates with (a) small and (b) large spot area. red and white curves display contour lines leveled at 50% and 10% of peak intensity of the film reflections, respectively. (c and d) reciprocal space maps around 222 sto reflections taken at = 0 [incidence parallel to the (110) sto plane ] for the films shown in parts a and b, respectively. in order to evaluate tilt angle and direction, we measured pole figures (scans) for 222 sfo reflections, which are shown in figure 3a and b for films grown with small and large spot area, respectively. the former sample clearly showed 3-fold peaks located at 0.5 and 0, 120, and 240, indicating that the dominant tilting directions coincide with the 112 directions. note that a contour at the half - maximum intensity is shown by a red solid line. in addition, there can be seen tails at 60, 180, and 300, as highlighted by a white solid line (contour level of 10%). such predominant tilting configurations should be attributed to a crystallographic origin, as will be explained later. as for the films grown with large spot area, only a single pole centered at a narrow region was observed. it is worth mentioning that while we took the pole figures, there have been seen sharp and high intensity peaks at the centers. they were actually associated with long tails of the substrate peak (i.e., critical truncation rods along hhh) but not with film components, as shown in reciprocal lattice maps around 222 sto reflections (figure 3c and d). we notice that slightly asymmetric shapes of the peaks seen in pole figures are artifacts due to misalignment of the goniometer and/or asymmetric -scan geometry (an x - ray beam with an oval projection was exposed on rectangular - shaped samples). reciprocal space maps around 114 srtio3 (sto) reflections for films grown on (001) sto substrates with (a) small and (b) large spot area, and around 330 sto reflections for films grown on (111) sto substrates with (c) small and (d) large spot area. the inset at the right bottom in each panel depicts schematic domain structures. crossing bars (red) indicate two splitting peaks of the film reflections, and vertical dashed lines (black) are guides for the substrate peak positions. the red horizontal lines shown in parts a and b correspond to the positions of 004 srfeo2.5 reflections. the bars shown at the bottom of parts c and d are referred to in the text. to understand the origin of the tilt, we measured reciprocal space maps around asymmetric sto reflections. as shown in figure 4a and b, (001)-oriented films exhibited two split peaks along 00l for 114 sfo reflections, which at first sight may appear due to the presence of a twin structure, as often seen in the orthorhombic high - tc superconducting cuprites.(16) when maps were taken for h0l and 0kl reflections, however, these splittings appeared with three peaks equally spaced along 00l (data not shown). in addition, given the fact that the centers of split peaks were always located at the positions of symmetric 00l reflections (for example, indicated by red crossing bars and lines in figure 4a and b), these features are consistent with the presence of four monoclinic domains observed for a (001)-oriented srruo3 film on srtio3.(17) this situation is schematically drawn for a pair of mirror domains in insets. the tilt angles estimated from split peak positions were 1.4 and 1.3 for the films grown with small and large spot areas, respectively. different c - axis lattice parameters, induced by change of laser spot area (figure 2a), can be understood in terms of the shift of the a - axis lattice parameters. the film grown with small (large) spot area was strained (partially relaxed), exhibiting a value identical to (longer than) that of sto along the a - axis, which is responsible for the longer (shorter) value along the c - axis. as a result, the unit cell volumes (v) in both films are almost identical (see table 1). thus, it is concluded that tuning laser spot area merely affects the strain relaxation dynamics but not much the oxygen nonstoichiometry in the films. similar data were obtained for the films grown on (111) sto substrates (figure 4c and d), but the splitting directions were rather diagonal, neither vertical nor horizontal, such as one may expect on the basis of the results shown in figures 3a and 4a and b. the diagonal tilt is due to different degrees of tilt divided into vertical and horizontal directions ; in other words, neither the out - of - plane nor in - plane lattices are restricted to be parallel to those of substrate. the predominant tilt directions were in - plane for film with small spot area and out - of - plane for film with large spot area. the sums of the tilt angles in both directions were approximately 1 in both films, and the unit cell volume was found to be slightly larger for film with small spot area. it is worth noting that components of vertical splitting must have appeared in symmetric reflections. this is true for film with small spot area (figure 3c) that display two different intensities for the majority (right spot) and minority domains (left spot). however, only a single broad peak is seen for films with large spot areas due to small peak separation (figure 3d). the ranges of visible 222 sfo reflections along the horizontal axis in figure 3c and d are shown by red bars at the bottom of figure 4c and d to compare different situations. the impact of laser spot area on the epitaxial structure of (111)-oriented films is summarized as follows : the predominant tilt direction shifts from in - plane to out - of - plane with increasing laser spot area, and meanwhile the number of domains tends to increase from three to six. (a) monoclinic and triangular prism unit cells shown with the original orthorhombic unit cell, where the ambm - plane and a triangular plane (crosshatch) are thought to face the (001) and (111) planes, respectively. in these configurations, film cross sections are comprised of the amcm - plane and an internal mirror plane of the triangular prism indicated with r1 r4 (hatch), both of which are parallelograms with and equal to 91.5. these tilts will give rise to multidomain structures for the films grown on (b) (001) and (c, d) (111) substrates. (e, f) possible atomic arrangements at the interface (shaded cross sections in parts c and d). semitransparent bars and arrows depict the a - site atom column along the direction and the sfo direction, respectively. having established variant tilting and domain configurations resulting from monoclinic structure figure 5a shows their relationship as well as a triangular prism cell representing an epitaxial unit cell on (111) substrates. (note that such a large unit cell of brownmillerite is caused by the ordering of oxygen vacancies in the perovskite framework, with one oxygen - deficient srfeo2 row alternating with one fully occupied srfeo3 row along the ao - axis.(18)) the parent cell is divided into eight fundamental perovskite blocks having a cell volume of 61.02, one of which is indicated with the green shade. in this configuration, the original lattice parameters (ao = 5.6685, bo = 15.5824, and co = 5.5265)(19) are reduced to am = cm = (aoco/2) = 3.9577 and bm = bo/4 = 3.8956. the obtuse angle in the amcm - plane () is 91.45. two different planes, rectangle (patch) and parallelogram (crosshatched), have averaged lattice mismatches of 0.6 and 1.4% to the sto (001) plane, respectively. therefore, the former must face down to the substrate, while the latter comprises a side plane. as a natural consequence, the cm - axis of sfo tilts toward the 4-fold a- and b - axes of sto by 1.5 and four mirror - variant domains are formed (figure 5b). the tilt angles as well as cell volumes for films grown on (001) substrates are in good agreement with those obtained with this model. similar arguments are possible to account for the case of the (111) substrate. there are two possible planes to be faced to the substrate, the one of them giving smaller lattice mismatch (0.4%) is drawn with an isosceles triangle (crosshatched) situated on an orange - shaded triangular prism cell in figure 5a. another triangular plane shares one edge with an orthorhombic cell along the ao - axis (lattice mismatch 1.3%). considering a cross section of the unit cell, we choose an internal mirror - symmetry plane, of which corners are indicated with r1 r4, because the reciprocal space maps shown in figure 4c and d have been measured parallel to this plane. one of its interior angles () is calculated to be 91.54 ; therefore, the situation is very similar to the case of the (001) substrate. two ideal cases can be considered as schematically drawn in figure 5cf. in the first case, the (111) film plane is tilted toward the 3-fold 112 direction of sto so that the (110) planes of film and substrate become parallel to each other. the opposite situation is represented in the second case except for allowing formation of mirror variant domains. second, the number of the majority domains in the film with the small spot area is three. in addition, the triangular islands seen in the afm image for the film with the small spot area (see the inset of figure 1c) are preferentially oriented to the 112 directions, just like those shown in figure 5c. third, the presence of mirror variant domains manifests itself in vertical splitting of the asymmetric reflection observed for films with large spot area, being analogous to (001)-oriented films. the formation of mirror variant domains has been observed for monoclinic oxide films grown on cubic (111) substrates.(20) our discussion is so far restricted to the situations at room temperature. according to the temperature dependence of lattice parameters reported for sfo and sto, the model mentioned above holds its relevance at temperatures up to 900 c, above which sfo transforms to cubic due to disorder in oxygen vacancy sites. however, we note that asymmetry in unit planes (crosshatched rectangle and isosceles triangle) has been smeared in the films, meaning that for all the samples the in - plane lattice constants along different axes were identical to each other. although the origin is unclear, it may be attributed to the disordering of oxygen vacancies, since films were grown under the conditions in the vicinity of the structural transition. using pld, we have studied the heteroepitaxial growth of oxygen deficient sfo perovskite films on sto (001) and (111) substrates and their epitaxial structures as a function of laser spot area. the models explaining the observed epitaxial structures are developed, which we believe provide important guidelines for the preparation and stabilization of noncubic perovskite heterostructures having versatile functionalities. (1) the change of laser spot area significantly alters lattice parameters along different axes, while keeping the unit cell volume nearly constant. (2) the films with both orientations were stabilized with the monoclinic structure derived from the bulk orthorhombic structure. (3) different orientations of the monoclinic lattice appear with different numbers of mirror variant domains. (4) in the case of the (111) substrate, the predominant tilting directions of the axis shift from in - plane to out - of - plane with increasing laser spot area, giving rise to a higher degree of orientation along the growth direction, whereas the number of domains tends to increase from three to six. this compromise can be overcome by the use of a miscut substrate, as demonstrated for domain engineering of rhombohedral bifeo3 films grown on (001) sto.(22) | we report epitaxial growth and structures of srfeo2.5 (sfo) films on srtio3 (sto) (001) and (111) substrates by pulsed - laser deposition. reflection high - energy electron diffraction intensity oscillations were observed during the initial growth on both substrates, reflecting a layer - by - layer growth mode of the formula unit cell. it was found that the films were stabilized with a monoclinic structure that was derived from the original orthorhombic structure of bulk brownmillerite. using an x - ray reciprocal space mapping technique, in - plane domain structures and the orientation relationship were investigated. in addition, the impact of laser spot area on the epitaxial structures was studied. for the films grown on the (001) sto, the orientation relationship was robust against the change of the laser spot area : sfo(001)//sto(001) and sfo(100)//sto(100) for the out - of - plane and the in - plane, respectively, with the [001 ] axis tilted toward the 4-fold a- and b - axes by 1.4, whereas nearly (111)-oriented films were obtained on the (111) sto, exhibiting a complicated manner of tilting that depended on laser spot area. the observed variation in tilting configurations can be understood in terms of possible atomic arrangements at the sfo / sto interface. these results present a guide to control the heteroepitaxial growth and structure of (111)-oriented noncubic perovskites. |
in japan, a super - aged society, gastric cancer is the second most frequent cause of cancer - related death, because it is largely a disease associated with old age.1 chronic obstructive pulmonary disease (copd) is another major age - related public health problem, and its prevalence is increasing worldwide.2,3 copd is characterized by persistent airflow limitation, resulting in cough, productive sputum, and dyspnea on exertion.4 it is also one of the major risk factors for postoperative pulmonary complications (popcs). in gastric cancer patients undergoing upper abdominal surgery, including gastrectomy, popcs are an important cause of postoperative morbidity and mortality because of the impaired wound healing associated with tissue hypoxia.57 jeong reported that the independent predictor of postoperative morbidity after gastrectomy was abnormal spirometry findings as that of copd. in the surgical treatment for gastric cancer, lymph node dissection and esophageal transection may lead subphrenic inflammation, resulting in pleural effusion. wound pain, which suppresses sufficient respiratory movement and early ambulation, often leads to atelectasis. therefore, in these patients, preoperative evaluation of pulmonary function is an important aspect of patient management. preoperative treatment with bronchodilators, antibiotics, and chest physiotherapy, and encouraging patients to quit smoking may decrease the incidence of popcs in copd patients.9 to reduce postoperative morbidities, copd management might be important, and bronchodilators are thought to be a central to disease management. however, it is unknown whether bronchodilators prevent postoperative morbidities. several reports have shown that tiotropium, a long - acting inhaled anticholinergic drug, improves dyspnea and lung function compared with placebo in patients with copd.10,11 a significant bronchodilator response was shown within 30 minutes after the first dose of tiotropium and maintained over 24 hours.12 therefore, tiotropium is the preferred maintenance therapy for patients with moderate - to - very severe copd.13 the issue of whether preoperative tiotropium improves the postoperative outcome of patients with copd is unclear. kobayashi reported that preoperative use of inhaled tiotropium facilitated the surgical treatment of lung cancer patients with copd. however, according to a recent report, while tiotropium significantly improved the preoperative global pulmonary function, there were no differences in outcomes, including postoperative complications (pocs) and postoperative stay, compared with the control group.15 therefore, the aim of the present randomized phase ii study was to determine the efficacy of perioperative intervention with inhaled tiotropium in gastric cancer patients with copd and to select an appropriate comparison arm for the next phase iii study. the patients enrolled in this study had histologically confirmed gastric adenocarcinoma and mild - to - moderate copd. before their enrollment in the study, the patients were diagnosed with copd based on clinical symptoms or forced expiratory volume after 1 second (fev1)/forced vital capacity (fvc) ratio of 80% of predicted value ; stage ii (moderate copd), fev1 ratio between 50% and 80% ; and stage iii (severe copd), fev1 ratio between 30% and 50%. other criteria for inclusion were : 1) eastern cooperative oncology group performance status of 02 ; 2) no significant cardiac failure or arrhythmia ; and 3) preoperative interval for tiotropium use of > 1 week. the criteria for exclusion were : 1) previous history of asthma ; 2) moderate - to - severe symptomatic prostatic hypertrophy ; and 3) narrow - angle glaucoma. this study was approved by the institutional review boards of each of the 15 participating institutions, and the procedures were performed in accordance with the declaration of helsinki. all patients provided written informed consent to participate in the study, in accordance with the institutional guidelines. the patients enrolled in this study had histologically confirmed gastric adenocarcinoma and mild - to - moderate copd. before their enrollment in the study, the patients were diagnosed with copd based on clinical symptoms or forced expiratory volume after 1 second (fev1)/forced vital capacity (fvc) ratio of 80% of predicted value ; stage ii (moderate copd), fev1 ratio between 50% and 80% ; and stage iii (severe copd), fev1 ratio between 30% and 50%. other criteria for inclusion were : 1) eastern cooperative oncology group performance status of 02 ; 2) no significant cardiac failure or arrhythmia ; and 3) preoperative interval for tiotropium use of > 1 week. the criteria for exclusion were : 1) previous history of asthma ; 2) moderate - to - severe symptomatic prostatic hypertrophy ; and 3) narrow - angle glaucoma. this study was approved by the institutional review boards of each of the 15 participating institutions, and the procedures were performed in accordance with the declaration of helsinki. all patients provided written informed consent to participate in the study, in accordance with the institutional guidelines. this was an open - label, randomized, multicenter phase ii study (umin 000004496). after checking eligibility, random assignment was carried out at the data center using a minimization method with the following adjustment factors : age (< 75 versus 75 years), body mass index (< 25 versus 25 kg / m), cessation of smoking (yes versus no), copd stage (1 versus 2), and surgical procedure (laparoscopic versus open). patients were randomly assigned at a 1:1 ratio to receive perioperative pulmonary rehabilitation alone (control group) or pulmonary rehabilitation with 18 g of tiotropium (boehringer ingelheim pharma, ingelheim, germany) once daily (tiotropium group). the patients in the tiotropium group were treated with tiotropium for more than 1 week before surgery and for 2 weeks after surgery. the operable patients with gastric cancer usually underwent gastrectomy 12 weeks after introduction to present participating instructions, and the length of postoperative hospital stay after gastrectomy is 1014 days. furthermore, vincken showed that the values of both fev1 and fvc improved just 1 week after tiotropium intervention, and those values were equivalent to the values treated for 1 year. these results support the idea that tiotropium given 1 week before and 2 weeks after may be sufficient for evaluating its efficacy. preoperative pulmonary rehabilitation was performed according to pulmonary rehab guidelines for copd as follows : upper - body exercises ; simple repetitive lifting of the arms against gravity, and exercises for breathing muscles ; breathing through a mouthpiece against resistance.16 the primary endpoint was the rate of change in postoperative fev1 compared with the preoperative value. the secondary endpoints included the number of days for o2 support after surgery, postoperative morbidity rate, and assessments of postoperative fvc and fev1/fvc (%) compared with the pretreatment values. this study was designed to assess the efficacy of preoperative pulmonary rehabilitation with and without perioperative tiotropium intervention. to simultaneously estimate the efficacy of these two treatments, and to minimize patient selection bias, we designed the study as a randomized phase ii study, rather than a comparative study. sample size was calculated with an assumed reduction rate of more than 20% in postoperative fev1, based on the results from a previous study.17 the tiotropium intervention would be regarded as a promising candidate for further evaluation, if a reduction rate in postoperative fev1 could be achieved. assuming a dropout rate of 5%, spss 16.0 software (spss inc., chicago, il, usa) was used for the statistical analyses. quantitative data were calculated as means and standard deviations, and compared between the groups using mann between december 2010 and may 2013, 84 patients were enrolled in this randomized study carried out in 15 hospitals in japan. of these, 42 patients were assigned to the control arm and 42 to the tiotropium arm. one patient refused to undergo surgical treatment and another patient completed treatment with endoscopic submucosal dissection. after surgical treatment, spirometry could not be performed in two patients because of reoperation and unforced errors. finally, 80 patients (38 patients in the control arm and 42 patients in the tiotropium arm) were evaluated. postoperative pulmonary function parameters, including fev1, fvc, and fev1/fvc (%), were evaluated in comparison with their preoperative values. mean decreased rate of fev1 was 1.12% in the control group and 0.73% in the tiotropium group. a decrease in fev1 of more than 20% was seen in only three patients (7.9%) in the control group and four patients (9.5%) in the tiotropium group (figure 2). mean rate of fvc compared with preoperative value was 93.1% in the control group and 92.1% in the tiotropium group. a reduction in fvc of more than 20% was seen in three patients (7.9%) in the control group and in nine patients (21.4%) in the tiotropium group (figure 3). mean changed fev1/fvc (%) was 4.7% in the control group and 6.7% in the tiotropium group. although there was no significant difference in fev1/fvc among two groups (figure 4), the copd severity decreased in 18 patients in the control group and in 24 patients in the tiotropium group. the mean length o2 support after surgery was 3 (range : 110) days in the control group and 3 (range : 116) days in the tiotropium group. as shown in table 3, 19 patients (23.2%) developed pocs according to the clavien dindo classification (grade ii and above), including five cases of pneumonia. table 4 lists the pocs in the two groups according to risk factors for pocs. perioperative tiotropium intervention significantly decreased the rate of pocs in patients who are smokers (p=0.044) and moderate copd (p=0.046). the incidence of pocs in patients who underwent total gastrectomy or proximal gastrectomy was considered to be higher than in those who underwent distal gastrectomy, because left diaphragm inflammation associated with surgical procedures resulted in pleural effusion or atelectasis. between december 2010 and may 2013, 84 patients were enrolled in this randomized study carried out in 15 hospitals in japan. of these, 42 patients were assigned to the control arm and 42 to the tiotropium arm. one patient refused to undergo surgical treatment and another patient completed treatment with endoscopic submucosal dissection. after surgical treatment, spirometry could not be performed in two patients because of reoperation and unforced errors. finally, 80 patients (38 patients in the control arm and 42 patients in the tiotropium arm) were evaluated. postoperative pulmonary function parameters, including fev1, fvc, and fev1/fvc (%), were evaluated in comparison with their preoperative values. mean decreased rate of fev1 was 1.12% in the control group and 0.73% in the tiotropium group. a decrease in fev1 of more than 20% was seen in only three patients (7.9%) in the control group and four patients (9.5%) in the tiotropium group (figure 2). mean rate of fvc compared with preoperative value was 93.1% in the control group and 92.1% in the tiotropium group. a reduction in fvc of more than 20% was seen in three patients (7.9%) in the control group and in nine patients (21.4%) in the tiotropium group (figure 3). mean changed fev1/fvc (%) was 4.7% in the control group and 6.7% in the tiotropium group. although there was no significant difference in fev1/fvc among two groups (figure 4), the copd severity decreased in 18 patients in the control group and in 24 patients in the tiotropium group. the mean length o2 support after surgery was 3 (range : 110) days in the control group and 3 (range : 116) days in the tiotropium group. as shown in table 3, 19 patients (23.2%) developed pocs according to the clavien dindo classification (grade ii and above), including five cases of pneumonia. table 4 lists the pocs in the two groups according to risk factors for pocs. perioperative tiotropium intervention significantly decreased the rate of pocs in patients who are smokers (p=0.044) and moderate copd (p=0.046). the incidence of pocs in patients who underwent total gastrectomy or proximal gastrectomy was considered to be higher than in those who underwent distal gastrectomy, because left diaphragm inflammation associated with surgical procedures resulted in pleural effusion or atelectasis. this study is the first multicenter, prospective, randomized phase ii study to evaluate the efficacy of perioperative tiotropium treatment for gastric cancer patients with copd. multiple factors, including advanced age, obesity, smoking, incision site, and operation time, are responsible for the genesis of popcs.18 in this study, the patients were randomized after stratification for these risk factors, allowing the efficacy of tiotropium intervention to be rigorously evaluated (table 1). following upper abdominal surgery, including gastrectomy, pulmonary function usually decreases because of reduced diaphragmatic activity and microatelectasis, which in turn may result in popcs. based on the literature, we expected that postoperative pulmonary function would be better in the tiotropium group than in the control group. casaburi found that the combination of tiotropium and pulmonary rehabilitation resulted in greater improvement in exercise tolerance compared with pulmonary rehabilitation alone. however, in our study, there were no significant differences in postoperative pulmonary function between the control and tiotropium groups (figures 24). in a meta - analysis study, the values of fev1 and fvc were found to be reduced by almost 50% after open cholecystectomy and by 19%27% after laparoscopic cholecystectomy.17 it is not thought to be necessary to treat patients with mild copd. however, we expected that tiotropium intervention might be useful for patients who received gastrectomy combined with lymph node dissection, because of its high invasiveness compared with cholecystectomy. although the postoperative values of fev1 and fvc were initially expected to decrease by more than 20% in the control group, only a few patients showed the expected values. spirometry should be performed three times : before randomization, just before surgery, and at 2 weeks postoperatively. however, conduction of three spirometry tests for gastrectomy is not allowed by health insurance schemes. the reduction rate for fev1 might be large, if the values just before surgery and after surgery are compared. interestingly, the postoperative spirometry results in many of our patients with mild copd were the same as those of non - copd gastric cancer patients (table 2). this implies that, in gastric cancer patients with mild copd, pulmonary rehabilitation alone can result in sufficient improvement even within the limited preoperative period. unfortunately, our results did not provide any evidence for differences in the frequency of pocs, including popcs, between the control and tiotropium - treated patients. however, this study had important limitations : the number of patients with moderate copd was small and patients with severe copd were not included. nonetheless, by stratifying patients according to risk factors for popcs, the effects of tiotropium intervention could be evaluated accurately. thus, a subgroup analysis showed that perioperative tiotropium intervention significantly decreased the rate of pocs in patients who are smokers and with moderate copd. kobayashi also reported that the response to tiotropium was more effective in lung cancer patients in accordance with the severity of copd. in conclusion, although patients undergoing upper abdominal surgery are prone to respiratory complications, among those with mild copd, simple pulmonary rehabilitation alone may be sufficient to avoid such complications. despite the absence of differences in postoperative outcomes between our control and tiotropium - treated patients, perioperative tiotropium intervention may still be beneficial for gastric cancer patients with moderate - to - severe copd. a study based on a larger sample size of gastric cancer patients with moderate - to - severe copd is needed to further evaluate the efficacy of perioperative tiotropium intervention. | backgroundtiotropium, a long - acting inhaled anticholinergic drug, has been widely used in the treatment of chronic obstructive pulmonary disease (copd). however, the issue of whether perioperative tiotropium improves postoperative outcomes for gastric cancer patients with copd remains unclear. thus, the aim of this study was to determine the efficacy of perioperative tiotropium intervention for gastric cancer patients with copd.patients and methodseighty - four gastric cancer patients with mild - to - moderate copd were randomly assigned to receive perioperative pulmonary rehabilitation alone (control group) or pulmonary rehabilitation with 18 g of tiotropium once daily (tiotropium group). the patients in the tiotropium group received tiotropium for more than 1 week before surgery and for 2 weeks after surgery. spirometry was performed prior to group assignment and at 2 weeks after surgery. postoperative complications, forced expiratory volume in 1 second, forced vital capacity, and the ratio of forced expiratory volume in second to forced vital capacity (%) were compared between the two groups.resultsthere were no significant differences between the two groups in terms of age, body mass index, smoking, gastrectomy incision, operation time, and bleeding volume (all p>0.05). postoperative complications and pulmonary functions did not differ significantly between the control and tiotropium groups. a subgroup analysis of gastric cancer patients with moderate copd showed that perioperative tiotropium intervention significantly decreased the rate of postoperative complications compared with the control group (p=0.046). however, even after gastrectomy, many patients with mild copd in both the control and tiotropium groups showed improved pulmonary function.conclusionalthough perioperative tiotropium intervention had no significant effects in gastric cancer patients with mild copd, it may be beneficial in those with moderate copd. therefore, the next prospective study should further evaluate perioperative tiotropium intervention for gastric cancer patients with moderate - to - severe copd. |
common ototoxic drugs include antibiotics like aminoglycosides,1 loop diuretics2 such as furosemide, platinum - based chemotherapy agents3 such as cisplatin, and a number of non - steroidal anti - inflammatory drugs.4 nephrotoxicity has frequently been reported as an adverse effect of amphotericin - b, but its ototoxic effect has not been reported so far. we report a case of resistant visceral leishmaniasis in an elderly male, who developed a reversible form of ototoxicity after treatment with liposomal amphotericin - b (l - amb). in our opinion a 65-year - old male patient from the endemic zone of visceral leishmaniasis in bihar, india, was admitted to the geriatric medicine ward with complaints of high - grade fever (measured as high as up to 104 f) with chills and rigor for about four months. one month before the present hospitalization, he had been evaluated by a physician in his locality and diagnosed with leishmaniasis by card test. he was treated with miltefosine and sodium stibogluconate for an optimum period of time with no subsidence in his fever. the patient was then referred to our center. on examination, his vitals were stable except for a fever of 102 f. as a part of cga, baseline hearing and vision of the patient were normal. abdominal examination revealed massive, firm, and non - tender splenomegaly with soft, non - tender hepatomegaly with a span of 16 and 14 cm, respectively. respiratory system, cardiovascular system, nervous system, and musculo - skeletal system revealed no abnormality on examination. ultrasonography of the abdomen revealed splenomegaly of 20 cm with portal vein diameter of 15 mm and hydronephrosis of the right - sided kidney with calculus of size 8 mm in the renal pelvis. non - contrast computed tomography of the abdomen revealed right kidney of size 11.7 cm with hydronephrosis, with normal ureter, and a calculus measuring 1 cm in the right renal pelvis. a cortical cyst measuring 2.6 1.7 cm was also seen near the lower pole of the right kidney (bosnaik grade 2). left kidney measured 9.7 cm and was displaced anteromedially by the massively enlarged spleen. enzyme - linked immunosorbent essay (elisa)-based immunoglobulin - g (igg) level against kala - azar was 5.7 units (significant : 115 units). bone - marrow aspiration revealed cellular marrow with normal marrow elements, mild prominence of plasma cells, and presence of leishmania donovani amatigotes. based on the bone - marrow aspirate findings, the diagnosis was confirmed as visceral leishmaniasis probably resistant to sodium stibogluconate and miltefosine. as the patient was immune - competent (non - reactive for hiv1 and hiv2, no history of immunosuppressive medications, and no other co - morbidities like diabetes mellitus), he was treated with l - amb in a renal modified dose of 150 mg per day (3 mg / kg). the treatment regimen followed in this patient was l - amb 35 mg / kg / day for first five days then repetition of the same dose (3 mg / kg) on the 14th and the 21st day of initial treatment. on the fifth day of treatment with l - amb, but the patient s hearing loss gradually progressed and around the 10th day of initiation of treatment, hearing was completely lost in bilateral ears in this patient. urgent otorhinolaryngology consultation was carried out on the very first day of hearing impairment, and audiometry was planned. otoscopic examination revealed no abnormality except for the presence of soft wax in the right external ear, which was cleaned in the same sitting. pure tone audiometry (pta) done on the seventh day of starting treatment revealed bilateral sensorineural deafness of profound grade (table 2). in the presence of no other obvious local or systemic causes of new onset of deafness, his medication chart was thoroughly reviewed to ascertain the drug - induced cause of sensorineural deafness. he did not receive any documented ototoxic medications in recent past or during the present admission. therefore, it was assumed that his deafness was medication induced ; probably l - amb, the only medication which he received just before the hearing loss. days 14 and 21 of l - amb therapy for kala - azar was deferred. after one week of starting prednisone, there was progressive recovery in the hearing of the patient. there was improvement in air conduction (ac) and bone conduction (bc) in both ears (table 2). the patient was discharged home and followed up after four weeks with another pta by the otolaryngologist. this time, he had normal hearing both clinically and audiometrically (table 2). a 65-year - old male patient from the endemic zone of visceral leishmaniasis in bihar, india, was admitted to the geriatric medicine ward with complaints of high - grade fever (measured as high as up to 104 f) with chills and rigor for about four months. one month before the present hospitalization, he had been evaluated by a physician in his locality and diagnosed with leishmaniasis by card test. he was treated with miltefosine and sodium stibogluconate for an optimum period of time with no subsidence in his fever. the patient was then referred to our center. on examination, his vitals were stable except for a fever of 102 f. as a part of cga, baseline hearing and vision of the patient were normal. abdominal examination revealed massive, firm, and non - tender splenomegaly with soft, non - tender hepatomegaly with a span of 16 and 14 cm, respectively. respiratory system, cardiovascular system, nervous system, and musculo - skeletal system revealed no abnormality on examination. ultrasonography of the abdomen revealed splenomegaly of 20 cm with portal vein diameter of 15 mm and hydronephrosis of the right - sided kidney with calculus of size 8 mm in the renal pelvis. non - contrast computed tomography of the abdomen revealed right kidney of size 11.7 cm with hydronephrosis, with normal ureter, and a calculus measuring 1 cm in the right renal pelvis. a cortical cyst measuring 2.6 1.7 cm was also seen near the lower pole of the right kidney (bosnaik grade 2). left kidney measured 9.7 cm and was displaced anteromedially by the massively enlarged spleen. enzyme - linked immunosorbent essay (elisa)-based immunoglobulin - g (igg) level against kala - azar was 5.7 units (significant : 115 units). bone - marrow aspiration revealed cellular marrow with normal marrow elements, mild prominence of plasma cells, and presence of leishmania donovani amatigotes. based on the bone - marrow aspirate findings, the diagnosis was confirmed as visceral leishmaniasis probably resistant to sodium stibogluconate and miltefosine. as the patient was immune - competent (non - reactive for hiv1 and hiv2, no history of immunosuppressive medications, and no other co - morbidities like diabetes mellitus), he was treated with l - amb in a renal modified dose of 150 mg per day (3 mg / kg). the treatment regimen followed in this patient was l - amb 35 mg / kg / day for first five days then repetition of the same dose (3 mg / kg) on the 14th and the 21st day of initial treatment. on the fifth day of treatment with l - amb, the patient complained of slight loss of hearing in both ears. but the patient s hearing loss gradually progressed and around the 10th day of initiation of treatment, hearing was completely lost in bilateral ears in this patient. urgent otorhinolaryngology consultation was carried out on the very first day of hearing impairment, and audiometry was planned. otoscopic examination revealed no abnormality except for the presence of soft wax in the right external ear, which was cleaned in the same sitting. pure tone audiometry (pta) done on the seventh day of starting treatment revealed bilateral sensorineural deafness of profound grade (table 2). in the presence of no other obvious local or systemic causes of new onset of deafness, his medication chart was thoroughly reviewed to ascertain the drug - induced cause of sensorineural deafness. he did not receive any documented ototoxic medications in recent past or during the present admission. therefore, it was assumed that his deafness was medication induced ; probably l - amb, the only medication which he received just before the hearing loss. days 14 and 21 of l - amb therapy for kala - azar was deferred. after one week of starting prednisone, there was progressive recovery in the hearing of the patient. there was improvement in air conduction (ac) and bone conduction (bc) in both ears (table 2). the patient was discharged home and followed up after four weeks with another pta by the otolaryngologist. this time, he had normal hearing both clinically and audiometrically (table 2). clinical recognition of ototoxicity came to medical limelight with the discovery of streptomycin in 1944.5 since then, a number of pharmacologic agents have been incriminated to cause ototoxicity, mostly irreversible. the list of ototoxic drugs includes aminoglycosides, other antibiotics, platinum - based anti - neoplastic agents, salicylates,6 quinine,7 and loop diuretics. few experimental and hypothetical explanations on the patho - biochemical basis of drug - induced ototoxicity have been available in medical literature. the mechanism of irreversible ototoxicity has been attributed to destruction of outer hair cells in the organ of corti, predominantly at the basal turn of the cochlea.8 similarly, reversible ototoxicity induced by some aminoglycosides, loop diuretics, and salicylates has been linked mainly to involvement of stria vascularis of the inner ear, which becomes edematous and can cause changes in the ionic gradients between the perilymph and endolymph by inhibiting adenylate cyclase and g - proteins.9 in our case, the incriminated ototoxic drug was amphotericin - b, a broad spectrum antifungal, which has been documented to be very effective in the treatment of antimony - resistant visceral leishmaniasis. drugs like paramomycin used in the treatment of leishmaniasis can cause reversible ototoxicity, but there are no reports of amphotericin - b causing so. in a randomized controlled trial conducted by sundar, 501 patients of visceral leishmaniasis were treated with paramomysin and 165 patients with amphotericin - b. among them, seven patients in the paromomycin arm developed reversible ototoxicity ; none of the 165 patients in the amphotericin - b arm developed it.10 though the therapeutic efficacy of all three lipid formulations of amphotericin - b (amphotericin - b lipid complex, l - amb, and amphotericin - b colloidal dispersion) are almost the same, the adverse effects such as dose - related nephrotoxicity and other infusion - related reactions vary from one to another.11 the least side effects have been seen with l - amb. infusion - related toxicities associated with amphotericin - b include fever, chills, rigors, arthralgias, nausea, vomiting, and headaches.12 amphotericin - b - induced nephrotoxicity leading to acute renal dysfunction has been generally attributed to two main causes.13 first, the dose - related rapid vasoconstriction of the afferent renal arterioles causes a decrease in renal blood flow, leading to suppression of glomerular filtration rate. second, amphotericin - b forms pores in tubular membranes and changes the dynamics of the ion - transport system, enhancing tubular dysfunction. ototoxicity as an adverse effect of amphotericin - b has been scarcely reported in the literature. rafael mention hearing loss as one of the neurotoxic potentials of intravenous use of amphotericin - b.13 reports mentioning ototoxicity as an adverse effect of amphotericin - b irrespective of its formulations used, has not yet been documented. however, there is evidence about inner ear tissues being immunologically, biochemically, and functionally related to kidney tissues.1417 it is likely that medications affecting renal tubular ion - transport system may also alter ionic homeostasis of the inner ear causing functional problems like hearing loss, which is reversible and dose dependant.15,18 similar mechanism has also been illustrated to be involved in reversible form of ototoxicity induced by few medications as mentioned above. impaired renal function may allow excessive or persistently high plasma (and perilymph endolymph) concentrations to develop, thus increasing the risks for ototoxicity. as our patient had an underlying mild renal impairment, he probably underwent a similar patho - biochemical process with amphotericin - b infusion leading to ototoxicity. the gradual progression of hearing loss leading to complete deafness may be due to cumulative dose - related effects of amphotericin - b in a setting of existing mild renal impairment. subjective improvement of hearing along with improvement in pta after the discontinuation of drug indicates that the patient had reversible form of ototoxicity. from this, we can infer that there is definitely a cause and effect relationship between l - amb and ototoxicity. however, we can not explain or authenticate the role of steroid (prednisolone) in reversing the hearing impairment in this case. this is the first reported case to show that amphotericin - b, even its lipid formulation (l - amb), can cause a reversible form of ototoxicity in certain vulnerable patients, especially in the elderly and those with renal impairment. therefore, physicians should exercise discernment and awareness of this disabling adverse effect, when treating patients with amphotericin - b. | amphotericin - b, a broad spectrum antifungal agent, has been known to cause adverse effects such as nephrotoxicity and infusion - related side effects such as fever, chills, rigor, and arthralgias. however, ototoxicity as an adverse effect of amphotericin - b has not yet been reported in medical literature. we here report a case of a reversible form of ototoxicity induced by liposomal amphotericin - b (l - amb). |
tyrosinase (ec 1.14.18.1) is a copper - containing bifunctional enzyme, widely distributed in mammals, plants and micro - organisms (1). this enzyme catalyzes hydroxylation and oxidation of mono - phenols and diphenols, respectively (2). in fact, it catalyzes the hydroxylation of tyrosine to form 3,4-dihydroxyphenylalanine (l - dopa), and l - dopa to dopa quinine (3). quinones, in turn, develop chemically to melanins and other polyphenolic compounds (4). engagement of tyrosinase in important cell signaling pathways has made the enzyme an attractive target in the search for therapeutic inhibitors for prevention and treatment of different disorders including skin hyperpigmentation and cancers (5, 6). in addition, inhibition of tyrosinase with various kinds of inhibitors has been a useful tool for gaining better understanding of the mechanism of action of the enzyme (7, 8). in the past decade, a large number of compounds such as benzaldehyde and benzoate derivatives have been identified that inhibit the enzyme activity (916). it is known that the aldehyde group in the benzaldehyde derivatives react with functional groups including hydroxyl, amino and sulfhydryl group (9, 10). previous studies have indicated that benzaldehyde inhibitors restrict the enzyme activity by forming a schiff base with a primary amino group in the enzyme structure (14, 15). it has also been suggested that benzoate inhibits tyrosinase by a copper chelating mechanism (16). it is thought that carboxyl group in the molecular structure of benzoate acts as a nucleophile, perhaps chelating cu, the essential cofactor of tyrosinase (17). although aromatic derivatives, including benzoate and pyridine ones, reversibly restrict tyrosinase activity (9, 10), the mechanisms of inhibition through which they exert their inhibitory effects are not fully understood. in the present work, we, therefore, accomplished comprehensive kinetic analysis to gain better understanding of the mechanisms by which some aromatic derivatives including 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid restrict the mushroom tyrosinase activity. to do so, we kinetically analyzed both monophenolase and diphenolase activities of the enzyme in presence and absence of the inhibitors using spectroscopic methods. in addition, to check whether these inhibitors were able to induce cytotoxicity, the melanoma cell lines were treated with the inhibitors at the concentration range that they imposed their inhibitory effects on the purified mushroom tyrosinase. our data clearly demonstrated that the aromatic derivatives reversibly inhibited monophenolase and diphenolase activities of the enzyme and despite the close structural similarity (figure 1), these analogues showed differences in mechanism of inhibition. importantly, our data clearly showed that only nicotinic acid and picolinic acid had cytotoxic effects on the melanoma cells. the chemical structures of substrates and inhibitors of mushroom tyrosinase mt used in this study. a) 2-amino benzoic acid b) 4-amino benzoic acid c) caffeic acid d) picolinic acid e) p - coumaric acid f)nicotinic acid mt (mushroom tyrosinase : ec 1.14.18.1) were prepared as previously described (18). p - hydroxycinnamic (p - coumaric acid max = 288 nm, = 19400 m-1. cm), 3,4-dihydroxycinnamic acid (caffeic acid, max = 311 nm, = 12000 m-1. cm), 4-amino benzoic acid, 2-amino benzoic acid, nicotinic acid, and picolinic acid were purchased from sigma. the water used was re - distilled and ion - free ; spectrophotometric measurements were carried out using a rayleigh model 2100 spectrophotometer. the chemical formulas of all compounds (substrates and inhibitors) used in this research are given in (figure 1). the buffer used throughout this research was 15 mm phosphate buffer solution (pbs), ph=6.8, and the corresponding salts were obtained from merck. all experiments were carried out at 293 k and all solutions prepared in doubly distilled water. all enzymatic reactions were run in phosphate buffer (10 mm) at ph=6.8, in a conventional quartz cell, thermostated to maintain the temperature at 200.1c. the selected conditions of solvent, buffer, ph, temperature, and enzyme concentration were applied for assaying the oxidase activity of mt according to our previous studies (19 - 20). cresolase reactions were measured by depletion of p - coumaric acid for 10 min at max=288 nm and enzyme concentration of 70.8 m, 240 unit / ml. the reactions were followed using six different fixed concentrations of substrate (550 m) at different concentrations of acids as inhibitors. catecholase activity was followed by depletion of caffeic acid for 2 min at max = 311 nm and enzyme concentration of 11.8 m, 40 unit / ml at different concentrations of acids as inhibitors. the reactions were carried out using fixed concentration of substrate (50 m) at different concentrations of acids. substrate was added when the incubation time (2 min) for the mixture of enzyme with each concentration of inhibitors was completed. accordingly, one unit cresolase activity was equal to 0.001 change in optical density of l - tyrosine per minute at 280 nm in 3 ml of the reaction mixture at 25c and ph= 6.5. similarly, one unit of catecholase activity was equal to 0.001 change in optical density of ascorbic acid per minute at 265 nm in 3 ml of the reaction mixture (25c and ph = 6.5), when catechol or l - dopa were used as substrates. the michaelis constant (km) and maximum velocity (vmax) of the tyrosinase were determined by the lineweaver - burk plots. the velocity equation for the competitive inhibition in reciprocal form is : 1/v = km / vmax(1 + [i]/ki)1/[s]+1/vmax. the inhibition constants (ki) of the competitive inhibitors were calculated by the following equation : km, app = km [1+([i]/ki) ], where km, app is the apparent km in the presence of an inhibitor. the reciprocal equation for the noncompetitive inhibition is : 1/v = km / vmax(1+[i]/ki)1/[s]+1/vmax(1+[i]/ki). ki of the noncompetitive inhibitors were calculated using the following equation : 1/vmaxapp = (1+[i]/ki) /vmax, where vmaxapp is the apparent vmax in the presence of an inhibitor. melanoma cell lines (ncbi code : c136 ; human skin) were grown in rpmi1640 (gibco, no 51800 - 019) medium supplemented with 10% fetal bovine serum (fbs). the stock solutions of 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid were prepared by dissolving the compound in 100 l isopropanol and then dissolved by pbs buffer. the different concentrations of aromatic acids were prepared and treated with the melanoma cell lines. cells were plated in the appropriate media on 24-well micro plates in a 500 l total volume at a density of 10 cell / ml. the plates were incubated at 37c in 5% co2 for time course of 24 hr. the required concentration (ic50) of cape that can lead to 50% decrease in melanoma cell viability 24 hr after incubation was calculated from the logarithmic regression equation derived from graphing the viability of the cells at 24 hr versus the concentration of aromatic acids. the calculated concentration was then used to guide further selection of aromatic acid concentrations for fine tuning of ic50 determination, experimentally. viability percentage was evaluated as (od treatment / od control) 100 (22). mt (mushroom tyrosinase : ec 1.14.18.1) were prepared as previously described (18). p - hydroxycinnamic (p - coumaric acid max = 288 nm, = 19400 m-1. cm), 3,4-dihydroxycinnamic acid (caffeic acid, max = 311 nm, = 12000 m-1. cm), 4-amino benzoic acid, 2-amino benzoic acid, nicotinic acid, and picolinic acid were purchased from sigma. the water used was re - distilled and ion - free ; spectrophotometric measurements were carried out using a rayleigh model 2100 spectrophotometer. the chemical formulas of all compounds (substrates and inhibitors) used in this research are given in (figure 1). the buffer used throughout this research was 15 mm phosphate buffer solution (pbs), ph=6.8, and the corresponding salts were obtained from merck. all experiments were carried out at 293 k and all solutions prepared in doubly distilled water. all enzymatic reactions were run in phosphate buffer (10 mm) at ph=6.8, in a conventional quartz cell, thermostated to maintain the temperature at 200.1c. the selected conditions of solvent, buffer, ph, temperature, and enzyme concentration were applied for assaying the oxidase activity of mt according to our previous studies (19 - 20). cresolase reactions were measured by depletion of p - coumaric acid for 10 min at max=288 nm and enzyme concentration of 70.8 m, 240 unit / ml. the reactions were followed using six different fixed concentrations of substrate (550 m) at different concentrations of acids as inhibitors. catecholase activity was followed by depletion of caffeic acid for 2 min at max = 311 nm and enzyme concentration of 11.8 m, 40 unit / ml at different concentrations of acids as inhibitors. the reactions were carried out using fixed concentration of substrate (50 m) at different concentrations of acids. substrate was added when the incubation time (2 min) for the mixture of enzyme with each concentration of inhibitors was completed. accordingly, one unit cresolase activity was equal to 0.001 change in optical density of l - tyrosine per minute at 280 nm in 3 ml of the reaction mixture at 25c and ph= 6.5. similarly, one unit of catecholase activity was equal to 0.001 change in optical density of ascorbic acid per minute at 265 nm in 3 ml of the reaction mixture (25c and ph = 6.5), when catechol or l - dopa were used as substrates. the michaelis constant (km) and maximum velocity (vmax) of the tyrosinase were determined by the lineweaver - burk plots. the velocity equation for the competitive inhibition in reciprocal form is : 1/v = km / vmax(1 + [i]/ki)1/[s]+1/vmax. the inhibition constants (ki) of the competitive inhibitors were calculated by the following equation : km, app = km [1+([i]/ki) ], where km, app is the apparent km in the presence of an inhibitor. the reciprocal equation for the noncompetitive inhibition is : 1/v = km / vmax(1+[i]/ki)1/[s]+1/vmax(1+[i]/ki). ki of the noncompetitive inhibitors were calculated using the following equation : 1/vmaxapp = (1+[i]/ki) /vmax, where vmaxapp is the apparent vmax in the presence of an inhibitor. melanoma cell lines (ncbi code : c136 ; human skin) were grown in rpmi1640 (gibco, no 51800 - 019) medium supplemented with 10% fetal bovine serum (fbs). the stock solutions of 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid were prepared by dissolving the compound in 100 l isopropanol and then dissolved by pbs buffer. the different concentrations of aromatic acids were prepared and treated with the melanoma cell lines. cells were plated in the appropriate media on 24-well micro plates in a 500 l total volume at a density of 10 cell / ml. the plates were incubated at 37c in 5% co2 for time course of 24 hr. media- only treated cells served as the indicator of 100% cell viability. the required concentration (ic50) of cape that can lead to 50% decrease in melanoma cell viability 24 hr after incubation was calculated from the logarithmic regression equation derived from graphing the viability of the cells at 24 hr versus the concentration of aromatic acids. the calculated concentration was then used to guide further selection of aromatic acid concentrations for fine tuning of ic50 determination, experimentally. viability percentage was evaluated as (od treatment / od control) 100 (22). the inhibition kinetics of benzoic acid (2-amino benzoic acid and 4-amino benzoic acid) and pyridine derivatives (nicotinic acid and picolinic acid) on the monophenolase activity of the mushroom tyrosinase were investigated using p - coumaric acid as substrate and then the kinetic parameters for the enzyme were acquired from lineweaver burk double reciprocal plots and the secondary plots of the slope versus concentration of inhibitors (figures 2a2d). the reaction was done in 10 mm pbs, ph 6.8, at 20c and 70.8 m enzyme, in the presence of different concentrations of (a) 2-amino benzoic acid : 0 m (), 4 m (), 8 m (), 12 m (), 16 m () ; (b) 4-amino benzoic acid : 0 m () 5 m (), 10 m (), 20 m (), 30 m () ; (c) nicotinic acid : 0 mm () 1 mm (), 1.5 mm (), 2 mm (), 2.5 mm () and (d) picolinic acid : 0 mm () 2 mm (), 4 mm (), 6 mm (), 8 mm (). inserts : secondary plots, the slope against different concentrations of inhibitor, which gives the inhibition constant (ki) from the abscissa - intercepts our kinetic data showed that, under the conditions used in this study, the monophenolase activity followed the michaelis these data also demonstrated that, similar to 2-amino benzoic acid (figure 2a), 4-amino benzoic acid inhibited the monophenolase activity reversibly in a noncompetitive manner (figure 2b). this is evidenced by the fact that increasing the concentration of the inhibitors led to a set of lines with different slopes, intercepting one another at a common point on the x- axis (figures 2a and 2b). the equilibrium constants for binding of inhibitors to the free enzyme or enzyme - substrate complex, ki, were obtained from the plots of the slope lines versus the concentration of the inhibitors, which were linear (figures 2a and 2b ; inserts). as summarized in table 1, the calculated constants were 5.15 m and 3.8 m for 2-amino benzoic acid and 4-amino benzoic acid, respectively. inhibition parameters obtained from kinetic investigations of mushroom tyrosinase with and without presence of 2- and 4-amino benzoic, nicotinic and picolinic acids similar kinetic analysis was performed to characterize inhibitory effects of nicotinic acid and picolinic acid on the enzyme s monophenolase activity. from our kinetic data, it appeared that both inhibitors restricted the monophenolase activity reversibly in a competitive fashion (figures 2c and 2d). burk double reciprocal plots, showing that increasing the concentration of the inhibitors results in a family of lines with different slopes, intercepting one another at a common point on the y - axis (figures 2c and 2d). the inhibition constants for binding of these inhibitors to the free enzyme (e) were calculated from the secondary plots of the slope versus concentrations of the inhibitors (figures 2c and 2d ; inserts), which were also linear. as tabulated in table 1, the obtained kis were 1.21 mm and 1.97 mm for nicotinic acid and picolinic acid, respectively. consistent with the calculated kis, the inhibitory concentration of the inhibitors, leading to 50% monophenolase activity lost (ic50), were estimated to be 5.15 m, 3.8 m, 3.41 mm and 3.55 mm for 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid, respectively (table 1). the kinetic behavior of mushroom tyrosinase was studied during the oxidation of caffeic acid as substrate. under the conditions employed in this work, the oxidation reaction of caffeic acid by mushroom tyrosinase followed the michaelis the results illustrated in figures 3a and 3b show that 2-amino benzoic acid and 4-amino benzoic acid inhibited the tyrosinase diphenolase activity reversibly in a noncompetitive way. this is evident by the fact that increasing the concentration of the inhibitors resulted in a family of lines with different slopes, intercepting one another at a common point on the x axis (figures 3a and 3b). the equilibrium constants for binding of inhibitors with free enzyme or enzyme - substrate complex were obtained from a plot of the slope lines versus the inhibitor concentration, which were linear (figures 3a and 3b ; inserts). the obtained kis were 4.72 m and 20 m for 2-amino benzoic acid and 4-amino benzoic acid, respectively (table 1). the kis were fully consistent with the estimated ic50s, which were about 4.72 m and 20 m for 2-amino benzoic acid and 4-amino benzoic acid, respectively (table 1). the reaction was done in 10 mm pbs, ph 6.8, at 20c and 11.8 m enzyme, in the presence of different concentrations of (a) 2-amino benzoic acid : 0 m (), 4 m (), 8 m (), 12 m (), 16 m () ; (b) 4-amino benzoic acid : 0 m (), 4 m (), 8 m (), 12 m (), 16 m () ; (c) nicotinic acid : 0 mm () 1 mm (), 2 mm (), 3 mm (), 4 mm (), and (d) picolinic acid : 0 mm () 2 mm (), 4 mm (), 6 mm (), 8 mm (). inserts : secondary plots, the slope against different concentrations of inhibitor, which gives the inhibition constant (ki) from the abscissa - intercepts further kinetic analysis revealed that both nicotinic acid and picolinic acid restricted reversibly the diphenolase activity of the enzyme in a competitive manner (figures 3c and 3d). burk double reciprocal plots, showing that increasing the concentration of the inhibitors led to a family of lines with different slopes, intercepting one another at a common point on the y - axis (figures 3c and 3d). kis for binding of these inhibitors to the free enzyme (e) were also estimated from the secondary plots of the slope versus concentrations of the inhibitors, which were linear (figures 3c and 3d ; inserts). the calculated kis were 2.4 mm and 2.93 mm for nicotinic acid and picolinic acid, respectively (table 1). in line with the kis, ic50s were estimated to be 3.8 mm and 3.7 mm for nicotinic acid and picolinic acid, respectively (table 1). to evaluate whether the inhibitors are able to contain proliferation of melanoma cells, the melanoma cell lines were treated with various concentrations of 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid and picolinic acid and then the cell viability was analyzed by measuring the microwell cell density using a microplate reader (figure 4). media - only treated cells served as the indicator of 100% cell viability. as shown in figure 4, treatment of the cell lines by 2-amino benzoic acid and 4-amino benzoic acid caused no significant change in the cell viability. on the contrary, presence of nicotinic acid and picolinic acid in the microwells declined remarkably the viability of the melanoma cells in a dose - dependent manner (figure 4). this is evidenced by the fact that increasing the concentrations of nicotinic and picolinic acids from 0 to 8 mm led to an 80% drop in the melanoma cell viability (figure 4). the concentrations at which the inhibitors reduced the cell density up to 50% (ic50) were 3.61 mm and 2.42 mm for nicotinic acid and picolinic acid, respectively. cell viability of melanoma cell line after 24 hr treatment with different concentrations of 2- and 4-amino benzoic acid, nicotinic acid, and picolinic acid the inhibition kinetics of benzoic acid (2-amino benzoic acid and 4-amino benzoic acid) and pyridine derivatives (nicotinic acid and picolinic acid) on the monophenolase activity of the mushroom tyrosinase were investigated using p - coumaric acid as substrate and then the kinetic parameters for the enzyme were acquired from lineweaver burk double reciprocal plots and the secondary plots of the slope versus concentration of inhibitors (figures 2a2d). the reaction was done in 10 mm pbs, ph 6.8, at 20c and 70.8 m enzyme, in the presence of different concentrations of (a) 2-amino benzoic acid : 0 m (), 4 m (), 8 m (), 12 m (), 16 m () ; (b) 4-amino benzoic acid : 0 m () 5 m (), 10 m (), 20 m (), 30 m () ; (c) nicotinic acid : 0 mm () 1 mm (), 1.5 mm (), 2 mm (), 2.5 mm () and (d) picolinic acid : 0 mm () 2 mm (), 4 mm (), 6 mm (), 8 mm (). inserts : secondary plots, the slope against different concentrations of inhibitor, which gives the inhibition constant (ki) from the abscissa - intercepts our kinetic data showed that, under the conditions used in this study, the monophenolase activity followed the michaelis these data also demonstrated that, similar to 2-amino benzoic acid (figure 2a), 4-amino benzoic acid inhibited the monophenolase activity reversibly in a noncompetitive manner (figure 2b). this is evidenced by the fact that increasing the concentration of the inhibitors led to a set of lines with different slopes, intercepting one another at a common point on the x- axis (figures 2a and 2b). the equilibrium constants for binding of inhibitors to the free enzyme or enzyme - substrate complex, ki, were obtained from the plots of the slope lines versus the concentration of the inhibitors, which were linear (figures 2a and 2b ; inserts). as summarized in table 1, the calculated constants were 5.15 m and 3.8 m for 2-amino benzoic acid and 4-amino benzoic acid, respectively. inhibition parameters obtained from kinetic investigations of mushroom tyrosinase with and without presence of 2- and 4-amino benzoic, nicotinic and picolinic acids similar kinetic analysis was performed to characterize inhibitory effects of nicotinic acid and picolinic acid on the enzyme s monophenolase activity. from our kinetic data, it appeared that both inhibitors restricted the monophenolase activity reversibly in a competitive fashion (figures 2c and 2d). burk double reciprocal plots, showing that increasing the concentration of the inhibitors results in a family of lines with different slopes, intercepting one another at a common point on the y - axis (figures 2c and 2d). the inhibition constants for binding of these inhibitors to the free enzyme (e) were calculated from the secondary plots of the slope versus concentrations of the inhibitors (figures 2c and 2d ; inserts), which were also linear. as tabulated in table 1, the obtained kis were 1.21 mm and 1.97 mm for nicotinic acid and picolinic acid, respectively. consistent with the calculated kis, the inhibitory concentration of the inhibitors, leading to 50% monophenolase activity lost (ic50), were estimated to be 5.15 m, 3.8 m, 3.41 mm and 3.55 mm for 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid, respectively (table 1). the kinetic behavior of mushroom tyrosinase was studied during the oxidation of caffeic acid as substrate. under the conditions employed in this work, the oxidation reaction of caffeic acid by mushroom tyrosinase followed the michaelis the results illustrated in figures 3a and 3b show that 2-amino benzoic acid and 4-amino benzoic acid inhibited the tyrosinase diphenolase activity reversibly in a noncompetitive way. this is evident by the fact that increasing the concentration of the inhibitors resulted in a family of lines with different slopes, intercepting one another at a common point on the x axis (figures 3a and 3b). the equilibrium constants for binding of inhibitors with free enzyme or enzyme - substrate complex were obtained from a plot of the slope lines versus the inhibitor concentration, which were linear (figures 3a and 3b ; inserts). the obtained kis were 4.72 m and 20 m for 2-amino benzoic acid and 4-amino benzoic acid, respectively (table 1). the kis were fully consistent with the estimated ic50s, which were about 4.72 m and 20 m for 2-amino benzoic acid and 4-amino benzoic acid, respectively (table 1). the reaction was done in 10 mm pbs, ph 6.8, at 20c and 11.8 m enzyme, in the presence of different concentrations of (a) 2-amino benzoic acid : 0 m (), 4 m (), 8 m (), 12 m (), 16 m () ; (b) 4-amino benzoic acid : 0 m (), 4 m (), 8 m (), 12 m (), 16 m () ; (c) nicotinic acid : 0 mm () 1 mm (), 2 mm (), 3 mm (), 4 mm (), and (d) picolinic acid : 0 mm () 2 mm (), 4 mm (), 6 mm (), 8 mm (). inserts : secondary plots, the slope against different concentrations of inhibitor, which gives the inhibition constant (ki) from the abscissa - intercepts further kinetic analysis revealed that both nicotinic acid and picolinic acid restricted reversibly the diphenolase activity of the enzyme in a competitive manner (figures 3c and 3d). burk double reciprocal plots, showing that increasing the concentration of the inhibitors led to a family of lines with different slopes, intercepting one another at a common point on the y - axis (figures 3c and 3d). kis for binding of these inhibitors to the free enzyme (e) were also estimated from the secondary plots of the slope versus concentrations of the inhibitors, which were linear (figures 3c and 3d ; inserts). the calculated kis were 2.4 mm and 2.93 mm for nicotinic acid and picolinic acid, respectively (table 1). in line with the kis, ic50s were estimated to be 3.8 mm and 3.7 mm for nicotinic acid and picolinic acid, respectively (table 1). to evaluate whether the inhibitors are able to contain proliferation of melanoma cells, the melanoma cell lines were treated with various concentrations of 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid and picolinic acid and then the cell viability was analyzed by measuring the microwell cell density using a microplate reader (figure 4). media - only treated cells served as the indicator of 100% cell viability. as shown in figure 4, treatment of the cell lines by 2-amino benzoic acid and 4-amino benzoic acid caused no significant change in the cell viability. on the contrary, presence of nicotinic acid and picolinic acid in the microwells declined remarkably the viability of the melanoma cells in a dose - dependent manner (figure 4). this is evidenced by the fact that increasing the concentrations of nicotinic and picolinic acids from 0 to 8 mm led to an 80% drop in the melanoma cell viability (figure 4). the concentrations at which the inhibitors reduced the cell density up to 50% (ic50) were 3.61 mm and 2.42 mm for nicotinic acid and picolinic acid, respectively. cell viability of melanoma cell line after 24 hr treatment with different concentrations of 2- and 4-amino benzoic acid, nicotinic acid, and picolinic acid in the present work, we characterized the inhibitory effects of the potential therapeutic inhibitors, i.e. benzoic acid (2-amino benzoic and 4-amino benzoic acids) and pyridine (nicotinic and picolinic acids) derivatives, on the diphenolase and monophenolase activities of mushroom tyrosinase. consistent with previous studies (9, 10, 17, 23), our comprehensive kinetic analyses explicitly showed that the inhibitors restricted reversibly both diphenolase and monophenolase activities of the enzyme. for the monophenolase activity, 2-amino benzoic acid and 4-amino benzoic acid inhibited the enzyme activity in a noncompetitive fashion, whereas nicotinic acid and picolinic acid competitively restricted the enzyme activity. additionally, comparison of the calculated kis suggested that the inhibitors imposed their inhibitory effect on the monophenolase activity with the potencies ranking as follows : picolinic acid nicotinic acid < < 2-amino benzoic acid < 4-amino benzoic acid. similarly, the benzoic acid and pyridine derivatives inhibited the diphenolase activity in noncompetitive and competitive manners, respectively, with inhibitory potencies ranking as follows : picolinic acid nicotinic acid < < 4-amino benzoic acid 2-amino benzoic acid. the observed trends in inhibitory potencies of the inhibitors were supported by the estimated ic50s of the monophenolase and diphenolase activities, confirming that the benzoic acid derivatives have significantly greater inhibitory effects on the enzyme activities as compared to the pyridine compounds. the non - competitive inhibitions exerted by the benzoic acid derivatives suggest that they bind to a site other than the active site of the enzyme and interact with either free enzyme (e) or the enzyme - substrate complex (es), thus forming a non - productive complex (esi). furthermore, the competitive inhibitions imposed by the pyridine derivatives indicate that the inhibitors combine only with the free enzyme, competing with the substrate for binding to the active site of the enzyme. search for nontoxic, potent tyrosinase inhibitors has been the subject of extensive studies (24). among the nontoxic and potentially therapeutic inhibitors of tyrosinase, aromatic compounds have gained much attention due to their potential applications in the cosmetic industry and medicinal purposes (8, 2427). it has been previously suggested that some of these compounds impair melanin synthesis and dna repair, and even act as anti - proliferative agents by interfering with tyrosinase and the melanocyte stimulating hormone receptor (mc1r) activity (8, 2627). given that the benzoic acid and pyridine derivatives used in this study inhibit potently the tyrosinase activity ; it is tempting to hypothesize that these particular aromatic derivatives could also restrict proliferation of the melanoma cells. to check our hypothesis, we treated the melanoma cell lines with increasing concentrations of inhibitors and then the cell viability was assessed using mtt assay (figure 4). our data showed that only pyridine derivatives were able to induce cytotoxicity in the melanoma cell lines (figure 4). this finding was fully in agreement with those from previous reports, suggesting nicotinic acid and picolinic acid as anti - proliferative agents (2830). raising concentrations of nicotinic acid and picolinic acid (from 0 to 8 mm) resulted in a significant decrease (about 80%) in the melanoma cell viability. the concentrations of the inhibitors, leading to 50% decrease in the cell density (ic50), were very close and comparable to those resulting in 50% drop in the monophenolase and diphenolase activities, suggesting that the observed cytotoxicity is likely due to the tyrosinase inhibition. in line with previous studies (31), our cell - based analysis showed that the particular benzoic acid derivatives applied in the present work led to no significant cytotoxic effect on the growth of the melanoma cells (figure 4). since the applied benzoic acid derivatives can be absorbed by melanoma cell lines (31), it is reasonable to speculate that these compounds were not reachable by the cellular tyrosinase, hence were unable to impose their inhibitory effects on the enzyme activity. it is well - known that the benzoic acid can be converted to nontoxic hippuric acid in the liver and kidney cells (32). similarly, it is possible that 2-amino and 4-amino benzoic acids are transformed to various ineffective metabolites, which are unable to limit the enzyme activities within melanoma cells. this, along with the possibility that the benzoic acid derivatives interact with high affinity with cellular proteins other than tyrosinase, perhaps reduce significantly effective concentrations of these derivatives required for inhibition of the enzyme activities. collectively, we characterized mechanisms of inhibition by which the benzoic acid and pyridine derivatives exert their inhibitory effects on the monophenolase and diphenolase activities of mushroom tyrosinase. despite similar molecular structures, our kinetic data demonstrated that the applied benzoic acid and pyridine derivatives inhibited the tyrosinase activities with different mechanisms. in fact, the pyridine derivative restricted the enzyme activities in a competitive fashion, whereas their benzoic acid counterparts imposed their inhibitory effects in a non - competitive manner. moreover, our cell - based data showed that the pyridine derivatives acted as anti - proliferative agents, inducing cytotoxicity in melanoma cell lines probably by inhibition of the tyrosinase activities. given these findings, nicotinic acid and picolinic acid could be considered as the potential therapeutic inhibitors for the treatment and prevention of melanoma and skin hyperpigmentation disorders. | objective(s):involvement of tyrosinase in the synthesis of melanin and cell signaling pathway has made it an attractive target in the search for therapeutic inhibitors for treatment of different skin hyperpigmentation disorders and melanoma cancers.materials and methods : in the present study, we conducted a comprehensive kinetic analysis to understand the mechanisms of inhibition imposed by 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid on the monophenolase and diphenolase activities of the mushroom tyrosinase, and then mtt assay was exploited to evaluate their toxicity on the melanoma cells.results:kinetic analysis revealed that nicotinic acid and picolinic acid competitively restricted the monophenolase activity with inhibition constants (ki) of 1.21 mm and 1.97 mm and the diphenolase activity with kis of 2.4 mm and 2.93 mm, respectively. 2-aminobenzoic acid and 4-aminobenzoic acid inhibited the monophenolase activity in a non - competitive fashion with kis of 5.15 m and 3.8 m and the diphenolase activity with kis of 4.72 m and 20 m, respectively.conclusion:our cell - based data revealed that only the pyridine derivatives imposed cytotoxicity in melanoma cells. importantly, the concentrations of the inhibitors leading to 50% decrease in the cell density (ic50) were comparable to those causing 50% drop in the enzyme activity, implying that the observed cytotoxicity is highly likely due to the tyrosinase inhibition. moreover, our cell - based data exhibited that the pyridine derivatives acted as anti - proliferative agents, perhaps inducing cytotoxicity in the melanoma cells through inhibition of the tyrosinase activities. |
most people have a dominant hand, meaning the hand which is used for specific activities2. hands are a part of the body which we by necessity use in our daily life, and likewise the majority of objects which we use in daily life were also produced by hands3. the activities which clearly show a dominant hand include writing, using utensils, and using scissors4. dominance is measured through a demonstrated preference for or performance using a single hand5. in addition, the hand which is used to carry out tasks requiring special motor techniques or complex tasks is also used to classify the dominant hand6. it is not difficult to find a dominant hand through clinical means ; for example, the hand which is used for writing, tooth - brushing, eating meals, and throwing a ball is the dominant hand7. however, in some cultures, due to environmental factors, the use of the left hand when writing and eating meals is suppressed and the right hand is used8. among the activities related to one s dominant hand, next to writing and eating meals, the activity which shows the most clear lateralization is the use of scissors9. when using scissors, left - handers pattern of twisting the body or excessively flexing the wrist appears in contrast to right handers10. there has been little research on the use of scissors until now, though recently there have been studies of precision and error of left - handed physicians who use scissors when performing operations11. the purpose of this study was to investigate wrist flexing when a left - hander uses left - handed scissors versus right - handed scissors, and was conducted using 3-dimensional motion analysis. this study aims to further the understanding of the kinematic function of left - handers upper limbs in work performance and whether it is related to risks of musculoskeletal disorders. through this investigation, the study subjects were healthy adults who had no problem carrying out the prescribed tasks and who agreed to the study s parameters. according to the study s criteria, those who did left - handers whose dominant hand was the right and those left handers who did not use scissors using their left hand were excluded. eighteen left - handers participated in 3-dimensional motion analysis of the scissor - using task. there were 10 male subjects (55.6%), and eight female subjects (44.4%), and their average age was 21.391.38 years (table 1table 1.general characteristics (n=18)left hander (n=18)gendermale10 (55.6%)female8 (44.4%)age (years)21.4 (1.4)). this study was conducted in accordance with the ethical principles of the declaration of helsinki regarding experiments with human subjects. when left - handers used left - handed scissors, they carried out the task while extending the wrist at 4.6714.60, but when they used right - handed scissors, they carried out the task while flexing the wrist at 1.1912.41. the results were significantly different. the time taken by left - handers was 37.818.14 seconds on average to conduct the task using left - handed scissors, and the time taken to conduct the task using right - handed scissors was 35.845.70 seconds on average. when left - handers used left - handed scissors, the error rate was 1.391.29 times on average, but when they used right - handed scissors, the rate was 0.720.67 times on average. these results showed statistically significant differences, with the number of errors when using the left - handed scissors being higher (table 2table 2.results of scissors type (n=18)left handed scissorsright handed scissorsmsdmsdflexion ()4.714.61.212.4time (sec)37.88.135.85.7error1.41.30.70.7significant difference p<0.05). significant difference p<0.05 this study was conducted to lay a scientific foundation for intervention for left - handers through quantified analysis of the function of the upper extremities of left - handers when conducting work - related tasks. however, if only about 10% of the population uses the left hand, the left hander number is great. and they added that there are cases where left - handers use their right hand for a particular task because of the difference in an absolute ration as 90% are right - hander. most research conducted until now has focused on right - handers and insufficient attention has been paid to left - handers13, 14. there have long been reports that left - handers are less skillful than right handers15. in addition, left - handers are much more likely than right - handers to suffer accidents or injuries when using tools and equipment designed for right - handers16. however, despite these aforementioned reports, systematic and scientific research on left - handers has not been consistently conducted and much research on the use of the left hand has focused on relations with other diseases, language or brain function. accordingly, there is insufficient research on the lowering of work performance and the onset of musculoskeletal disorders as a result of using the left hand. the results of this study suggest that, when using left - handed scissors, left - handers extend the wrist more than when they use the right - handed scissors, and that they make more errors. when using the left - handed scissors, it was possible to reduce flexion of the wrist more than when using the right - handed scissors. left - handed scissors have blades in the opposite direction from those of right - handed scissors. in other words, as the general scissors for right - handers face the center from the right side, left - handers have to change the intended direction to the opposite side when using right - handed scissors. for that reason, when using left - handed scissors, which have the blades in the opposite direction, it was possible to reduce flexion of the wrist. if enough research is done on the function of the upper extremities of left - handers, it will be possible to prevent musculoskeletal disorders, and make ergonomic designs for left - handers, thereby increasing their work efficiency. there is a need to continuously conduct research on left - handers and to establish an environment for their success. | [purpose ] the purpose of this study was to research the difference in wrist flexion and accuracy of left - handers when using regular scissors made for right - handed persons versus scissors made for left - handers. [subjects and methods ] eighteen left - handers participated in the experiment. there were ten males and eight females subjects. the degree of wrist flexion of 18 left - handers was analyzed when using scissors designed for left - handers and when using scissors designed for right - handers. [results ] when left - handers used left - handed scissors, they carried out the task while extending the wrist at 4.6714.60, but when they used right - handed scissors, they carried out the task while flexing the wrist at 1.1912.41. when left - handers used left - handed scissors, the error rate was 1.391.29 times on average, but when they used right - handed scissors, the rate was 0.720.67 times on average. [conclusion ] when left - hand dominant persons used left - handed scissors rather than right - handed scissors, the degree of wrist flexion decreased, which created more functionality, and the accuracy of the cutting increased. for improved cutting accuracy and wrist stability and to protect the wrist from extensive flexion, it is necessary for left - handers to use scissors that are made for left - handed people. |
burnout consists of three dimensions : emotional exhaustion (ee), depersonalization (dp), and reduced personal accomplishment (pa). ee refers to lack of energy and a feeling that emotional sources have been lost due to too much spiritual desire. red uced pa is defined as self - evaluative feelings of incompetence and lack of achievement at work. physical illness, emotional problems, increased turnover, absenteeism, poor job performance, and negative attitudes in general are some of the problems that have been associated with burnout. billions of dollars are lost annually due to low productivity, staff turnover, and work absence caused by burnout. one study with a large number of intensive care unit (icu) nurses (n = 3000) across europe found that burnout was contagious between colleagues. nurses who reported the highest amount of burnout in their colleagues were also the most likely to experience high levels of burnout themselves. another study showed that psychologically stressful situations, a physically demanding workload, and a high requirement for technological skills can lead icu caregivers to burnout. other studies have reported that 28% of nurses had high level of burnout and one - third of icu nursing staff had severe burnout. one study on more than 10,000 nurses from five different countries found an incidence of burnout that ranged from 54% to 32%. while critical care nurses are vulnerable to burnout because of the complex nature of wpatient 's health problems, working in critical care areas has become even more complicated by shift working schedules. with regard to the influence of day, afternoon, night, and rotating shifts on nurses, it was found that job performances and satisfaction was less on a rotating roster than on a fixed roster. in addition, this can result in psychosocial effects such as feeling of fatigue and disorientation. furthermore, studies have reported shift working as one of the inducing factors of burnout. despite the overwhelming statistical evidence for adverse health and well - being in shift workers, our knowledge about one of the reasons may stem from the fact that current schedules implemented in hospitals differ enormously. moreover, demands in each shift vary with the actual workload and time pressure, partly depending on the provision of co - workers and facilities, or a special setting such as critical care areas. a typical work schedule for a nurse who works in rotating shift is a combination of morning shift (7 h), evening shift (7 h), and night shift (12 h) within a month. for a nurse working with a fixed shift, the work schedule is morning shifts (without a combination of evening and night shifts), evening shifts (without a combination of morning and night shifts), or night shifts alone without combination of other shifts within a month. studies showed that burnout in different shift scheduling has a different prevalence. to our knowledge, there is no study to show particularly the relationship of fixed shifts and rotating shifts with burnout in critical care areas such as icu, cardiac care unit (ccu) and emergency room (er). consequently, there is a recognized need for more research on specific shift working characteristics that have detrimental impacts on health, burnout in particular. therefore, the purpose of this study was to determine the relationship between fixed and rotating shifts and burnout in a sample of critical care nurses working in critical care areas (including icus, ccus, and ers) in isfahan, iran. a retrospective cohort design was used to determine the relationship of fixed and rotating shifts with job burnout in nurses working in critical care areas in isfahan in 2013. rotating shift is considered as an exposed group, fixed shift as a non - exposed group, and burnout was considered as an outcome. a rotating shift consists of morning, evening, and night shifts altering during a month, and a fixed shift consists of fixed morning, fixed evening, or fixed night shifts alone during a month. exposure time was considered to be at least 1 year in each shift working, and critical care areas were defined as the icu, ccu, and er. the total population of critical care nurses in six selected hospitals (15 icus, 6 ccus, and 6 ers) was 850 of whom 170 were chosen using quota and random sampling. with regard to the population of the study, the quota of each hospital was determined and divided into two equal groups (exposed and non - exposed). the inclusion criteria were being a critical care nurse and working in either rotating or fixed shift for at least 1 year in the studied units (data were gathered from the records in nursing unit manager 's office), having a bsc degree or above, not having more than one job, no history of special chronic diseases such as a mental disorder, severe headaches, or backaches, and not having taken sick leave for more than 1 month in the 6-month period before the study. participation in the study was voluntary and based on the nurses ability to fill in and sign the informed consent. participants were assured that all gathered data and information would be strictly confidential and would not be accessed by others without obtaining prior permission from them. moreover, the participants had the right to withdraw at any time if they could not remember the past 1 year data to complete the questionnaire. the first instrument was created by the authors, including demographic data such as sex, age group, marital status, education level, years of professional experience, hours of overtime working, shift schedules, and the related hospitals and wards names. the second instrument was the maslach burnout inventory (mbi), version human services survey (hss), developed by maslach and jackson (1981) to assess the three dimensions of burnout. the mbi - hss consists of 22 items that measure burnout in terms of ee (nine items), dp (five items), and pa (eight items). frequency is measured on a seven - point likert 's scale anchored by never (0) and every day (6). the scores thus can range from 0 to 54 on the ee subscale, from 0 to 30 on the dp subscale, and from 0 to 48 on the pa subscale. intensity is measured on an eight - point likert 's scale anchored by barely noticeable (0) and very strong (7). the scores thus can range from 0 to 63 on the ee subscale, from 0 to 35 on the dp subscale, and from 0 to 56 on the pa subscale. higher mean scores on the ee and dp subscales correspond to higher levels of burnout, whereas lower mean scores on the pa subscale correspond to higher levels of burnout. total scores of each dimension were summed up and categorized as low, moderate, or high. in order to do so, high, moderate, and low scores were considered as 27, 17 - 26, and 0 - 16, respectively, in ee, 13, 7 - 12, and 0 - 6, respectively, in dp, and 0 - 31, 32 - 38, and 39, respectively, in personal performance. the cutoff values indicating the presence of burnout were 27 for ee, 10 for dp, and 33 for pa, which was scored in the opposite direction. internal consistency of the mbi - hss was established and reported using cronbach 's alpha coefficient (n = 1316). the reported reliability for ee subscale was 0.90, dp subscale was 0.71, and for pa subscale was 0.79. the employed questionnaire has been frequently assessed and confirmed to have a reliability of over 90% by iranian researchers. independent t - test and logistic regression was performed to analyze the data and a p < 0.05 indicated significance. the 85 subjects in the exposed group and 85 subjects in the non - exposed group who participated in the investigation did not differ significantly in demographic traits. the education level of 80 subjects (94.1%) was bachelor 's, and 41 (48.2%) were from icu, 34 (40%) were from er, and 10 were from (11.8%) ccu, which were the same in both groups. chi - square test showed no significant difference in the distribution of sex and marital status in the two groups. with regard to sex, females formed the highest percentage in the both groups, with 52 (67.1%) and 51 (68.2%) in the exposed and non - exposed groups, respectively. with regard to marital status, married subjects formed the highest percentage, with 52 (61.2%) subjects in the exposed group and with 51 (60%) subjects in the non - exposed group. whitney test showed that the distribution of age group, work experiences, and working overtime remained insignificant in both groups. with regard to age group, the highest percentage of subjects were in 22 - 29 years age group with 38 (44.7%) in the exposed group and in 30 - 39 years age group with 44 (51.8%) in the non - exposed group. with regard to work experience, the highest percentage had 1 - 9 years of experience with 48 (56.5%) in the exposed group and 10 - 19 years of experience with 44 (51.8%) in the non - exposed group. with regard to overtime work, the highest percentage worked 1 - 49 h per month in both groups, with 54 (63.5%) in the exposed group and 61 (71.8%) in the non - exposed group. analysis of the demographic data as mentioned above indicated that the two groups were matched which is ideal. independent t - test in the frequency scale of burnout dimensions indicated that the mean scores of ee (p < 0.001) and dp (p = 0.01) were significantly high in the non - exposed group, but the mean score of pa had no significant difference in the two groups [table 1 ]. independent t - test in the intensity scale of burnout dimensions revealed the same results as well [table 1 ]. mean scores of burnout dimensions in frequency and intensity scales in the two groups with respect to the burnout cutoff values indicating the presence of burnout, it was observed that the burnout percentage in the exposed group was 12.9% in ee, 29.4% in dp, and 45.9% in pa, and in the non - exposed group was 60% in ee, 48.1% in dp, and 34.1% in pa. logistic regression analysis, using the cutoff values of burnout, showed that the non - exposed group (fixed shift schedule) was significantly associated with burnout in ee (odds ratio, 10.1 ; 95% confidence interval, 4.68 - 21.75) and dp dimensions (odds ratio, 2.2 ; 95% confidence interval, 1.19 - 4.21). in other words, the non - exposed group was 10.1 times more likely to be exposed to ee and 2.2 times more likely to be exposed to dp, in comparison with the exposed group [table 2 ]. the results of logistic regression analysis for the relationship between two groups and three dimensions of burnout table 3 indicates the frequency of low, moderate, and high levels of burnout in the two groups and the total number of participants in each level. the present study reveals that nurses with a fixed shift schedule display more burnout compared to those with rotating shift schedule. the findings of this study show that the type of shift work had a significant relationship with burnout in critical care nurses. to be more precise, high level of burnout in ee and dp dimensions was significantly associated with fixed shift schedule. although pa was high in fixed shift nurses compared with rotating shift nurses, independent t - test showed no significant differences between the two groups. on the contrary, other studies found rotating shift midwives had high scores of burnout in pa, and the relationship between work pattern and ee and pa was found to be significant. furthermore, pa level of nurses working in fixed day shifts was higher than the level of those working in fixed night shifts. also ee level was higher in nurses who worked in fixed night shifts compared to those working in fixed day shifts and those working in rotating shifts. found high level of ee and dp in fixed night shifts and high level of pa in fixed morning shifts, which indicates high level of burnout in fixed shift schedules. with regard to the mean scores in the two groups, the non - exposed group had moderate level of burnout in ee, dp, and pa and the exposed group had moderate level of burnout in dp and pa and low level in ee. some studies found moderate level of ee and pa, which is consistent with our results, but low level of dp which is not in line with our results. high levels of burnout in the non - exposed group were 60%, 32.9%, and 27.1%, and in the exposed group were 12.9%, 18.8%, and 43.5% in ee, dp, and pa, respectively. santos. observed high level of ee in 26.47%, dp in 26.47%, and pa in 29.41% of the responders, while pavlakis. observed high level of ee, dp, and pa in 21.5%, 33%, and 30.7% of participants, respectively. in comparison with the studies mentioned above, ee and dp were much more frequently identified in the present study (in the non - exposed group), but pa was less frequent. high level of burnout in fixed shift schedules in the present study, mainly fixed morning (42%) and fixed night shifts (39%), may be attributed to the fact that there are fewer nurses working at night and the ratio of nurses to patient is not appropriate. furthermore, most of the attending visitations and interventions taking place in the morning shift result in a heavier workload than in other shifts. on the contrary, according to our observations, in rotational shifts, there are usually three shifts, namely morning, evening, and night shifts. most rotational shifts are repetitive and do not require special skills to pass from one shift to another, and hence, they are interchangeable. there is tremendous convenience in this type of shift and provides the opportunity for additional inputs. in order to maximize the relevance of these findings, we relied on the logistic regression to determine whether fixed and rotating shift nurses are at risk for burnout or not. fixed shift nurses, who worked in mainly fixed morning (42%) and fixed night shifts (39%) in our study, had approximately 10.1 times the odds to expose to ee and 2.2 times the odds to expose to dp. on the contrary, based upon the study findings, fixed shift nurses are generally a population at risk to burnout, and should be given special attention such as medical screening. for example, with regard to the significant predictors obtained from the current analyses, rotating shift may be useful to reduce job burnout. however, literature reports have explained that there is no perfect schedule, and recommendation should be pertinent to specific groups and work systems. literature reviews have also revealed the incongruousness in shift work research design and methodology, making comparison between studies intricate or even unachievable. experimental research would better reveal whether rotating shift schedule may help to reduce job burnout in critical care nurses. further studies are required to find out more information, and the management will benefit with further research in this area. | background : while critical care nurses are vulnerable to burnout because of the complex nature of patients health problems, working in critical care areas has become even more complicated by shift working schedules. this study aimed to determine the relationship between fixed and rotating shifts and burnout in a sample of critical care nurses working in critical care areas.materials and methods : in this retrospective cohort design, 170 critical care nurses from six selected hospitals were chosen using quota and random sampling and divided into two groups (exposed and non - exposed). maslach burnout inventory was used for data collection and independent t - test and logistic regression was performed to analyze the data.results:the mean scores of emotional exhaustion (ee) and depersonalization (dp) were significantly high in the non - exposed group, but the mean score of personal accomplishment (pa) had no significant difference in the two groups. furthermore, the non - exposed group had 10.1 times the odds to expose to ee and 2.2 times the odds to expose to dp in comparison with the exposed group. high levels of burnout in the non - exposed group were 60%, 32.9%, and 27.1%, and in the exposed group were 12.9%, 18.8% and 43.5% in ee, dp and pa, respectively.conclusions:the present study has revealed that critical care nurses with fixed shift schedules display more burnout compared to those working with rotating shift schedules. |
even though the detection and spectroscopy of single molecules in condensed phases was first demonstrated 25 years ago, the field has continued to expand in physics, chemistry, biology, and materials science. critical to the progress in understanding single - molecule behaviors has been theoretical insight to define underlying mechanisms, such as spectral diffusion and other dynamical processes in solids, for example. although early work at low temperatures relied on the power of high - resolution spectroscopy, the current focus on room temperature measurements and biological applications provides a continuing impetus to extract more and more information from the emitted photons. in particular, the optical field emitted by a single molecule in the far - field is given by the emission pattern of an oscillating electric dipole, which itself contains information that can be extracted by clever design of imaging systems. this paper describes how a careful examination of the electric field patterns emitted by a single molecule as well as fourier plane modulation of these patterns can be utilized to obtain much deeper insight about precise physical properties of the single molecule. optical fourier processing is a powerful tool that has been leveraged throughout the many disciplines of microscopy to tease information from a sample. filtering the individual spatial fourier transform components of an image allow experimental information that is not directly observable from a conventional image to become more readily accessible. currently, implementations of fourier filtering within the imaging and illumination pathways of a microscope have permitted researchers to better quantify features such as the optical phase, and three - dimensional structure of a specimen. furthermore, judicious fourier processing permits images to be enhanced, and optical aberrations to be mitigated. the fundamental technique is quite simple : by placing a lens one focal length behind a spatially coherent light source (such as a laser, a fluorescent molecule (which is coherent with itself), or a star viewed in the night sky), a scaled fourier transform of the electric field associated with the source will be projected onto a plane one focal length behind the lens. the individual spatial frequencies associated with the image of the source may then be independently adjusted by placing a transmissive or reflective mask of varying opacity (to perform amplitude modulation), or varying refractive index or thickness (to perform phase modulation). a modulated image of the optical signal may then be obtained by performing an additional fourier transform, i.e., an inverse fourier transform and a reflection of image coordinates, using one more lens. the advent of single - molecule fluorescence imaging has provided researchers with unparalleled insight into the nanoscale structure and organization of biological systems. using only a wide - field optical microscope, it is possible to acquire images of individual molecules on a camera sensor with single - photon detection sensitivity. to some extent, the image formed from a single molecule s fluorescence will resemble the diffraction - limited point - spread function (psf) of the microscope. by fitting a model function, such as a gaussian, to recorded single - molecule images, one may infer the lateral position of a molecule with precision approaching a single nanometer, depending upon the number of photons emitted by the probe. this technique, termed super - localization, permits the locations and movements of biomolecules within living cells to be determined. the ability to select different single emitters in the same irradiated volume by a control variable such as spectral scanning has allowed imaging beyond the diffraction limit, thus achieving super - resolution. in the past decade, super - resolution imaging an order of magnitude beyond the diffraction limit has expanded to room temperature studies by using various methods of actively controlling the concentration of emitting molecules and sequential imaging. today, using merely a widefield epifluorescence microscope, single - molecule super - resolution imaging has yielded impressive results. however, with the addition of optical fourier processing, it is possible to obtain even more information about the physical processes occurring in a specimen under observation. that is, it is possible to modify a microscope s psf to yield a raw (image) data set more amenable to extracting additional parameters of the molecules. for example, optical processing may be used to infer the axial depths of individual molecules within a sample, permitting super - localization and thus super - resolution to be extended into three dimensions. furthermore, the orientation of a molecule with respect to the microscope objective lens may be more readily determined. it is our hope that this article will inspire other researchers to further develop and refine fourier processing techniques and apply their innovations to single - molecule imaging. this article has been organized as follows : in section 2, we survey some of the latest fourier processing techniques that are most applicable to single - molecule imaging. in section 3, we provide the rigorous theoretical background necessary to computationally simulate the image of a fluorescent molecule on a camera sensor and describe how phase or amplitude modulation applied at the fourier plane may be incorporated into the simulation. particular attention is paid to modeling the features of a high - na optical system, as well as polarization effects that are normally not considered for fourier processing applications, yet are required to accurately model single - molecule emission. in section 4 we present a phase mask design and experimental apparatus recently developed by our laboratory specifically tailored for acquiring single - molecule orientation measurements. in section 5, we adapt our phase mask design to super - localize molecules in three dimensions, while simultaneously collecting data pertaining to molecular orientation and rotational mobility. to properly explain the techniques covered in this section, it is necessary to introduce a modicum of specialized vocabulary and mathematical formalism. for convenience it is best to have in mind a widefield fluorescence microscope which illuminates a region of a sample and records the image of the emitted fluorescence on a two - dimensional detector. the additional experimental apparatus used for optical fourier processing is often termed a 4f imaging system and is sketched schematically in figure 1. the plane at which the fourier transformed electric field is present, one focal length between the two lenses of the 4f system, will also be assumed to be conjugate to the back focal plane or pupil plane of the microscope. that is, even though the back focal plane is physically located at a limiting pupil (aperture) one focal length behind the objective lens of a conventional microscope, the 4f system recreates a scaled image of this plane onto a region of space outside the microscope where one can place a phase or amplitude mask responsible for modulating the incident light field. hence, from a modeling standpoint, the mask may be assumed to have been placed physically inside the microscope. mathematically, the 4f system can be described using the following formula:1 in eq 1, ein(x,y) and eout(x,y) are vectorial quantities denoting the electric fields at the input and output planes of the 4f system, parametrized by cartesian spatial coordinates { x, y } and { x, y}. ebfp(x, y) is the fourier transformed input electric field, scaled by the focal length f4f of the lenses used to construct the 4f system. this field is equivalent to the electric field present at the microscope s back focal plane, after a scaling of spatial coordinates. k = 2/ is the wavenumber, is the wavelength, and the refractive index of the medium surrounding the 4f system is assumed to be 1. however, this term will not affect the relative amplitudes of the fields at the output of the 4f system, and therefore it may generally be ignored. finally, (x, y) is a complex - valued scalar that denotes the amplitude and phase modulation imparted by a mask placed one focal length between the two lenses of the 4f system. although amplitude modulation masks have found numerous applications in other fields, use of partially opaque optics is generally frowned upon in the context of single - molecule fluorescence microscopy, as one can not easily afford to waste precious photons. hence for the remainder of this article, we will assume that the modulation function (x, y) has modulus 1 and is thus a pure phase mask:2where (x, y) is the desired phase function applied at the back focal plane. the features of ebfp(x, y) may be stretched or compressed by choosing a different focal length, f4f, for the lenses used to construct the 4f system. that is, the electric field at the back focal plane, ebfp(x, y), associated with a lens of focal length f4f can be computed as3where the leading amplitude - scaling term enforces conservation of energy. hence, given a phase mask of fixed dimensions, it is feasible to choose lenses to appropriately scale the spatial extent of the impinging electric field. it is practically expedient to construct a 4f system from relatively weak lenses of focal lengths 150 mm, as this will make the dimensions of the lenses themselves small relative to the overall extent of the optical system, thus minimizing the impact of optical aberrations. furthermore, our laboratory generally uses achromatic doublets for constructing a 4f system to ensure that the focal length, and hence the location of the back focal plane does not change significantly as a function of wavelength. schematic diagram of a 4f optical processing system. in a conventional microscope, light is collected by an objective lens, collimated, and relayed through the back focal plane of the objective. (the z direction is always assumed to lie parallel to the optical axis.) a tube lens focuses the collected light into an image at the intermediate image plane. the 4f system (red box) is inserted a distance f4f behind the intermediate image plane. the fourier transformed electric field, ebfp(x,y) (a scaled image of the back focal plane), is projected onto a phase mask, and the phase modulated field is then focused into an image on a detector by a second lens. the precise scaling of the back focal plane image incident upon the phase mask will depend upon the numerical aperture of the objective, and the magnification of the objective / tube lens pair (calculated from fobj and ftube). practically, phase masks with a desired response (x, y) may be implemented by varying the thickness of a transparent glass or polymer dielectric using photolithographic fabrication techniques. alternatively, if one wishes to dynamically alter (x, y) over the course of an experiment (for example, to correct for sample - specific optical aberrations), high - diffraction - efficiency liquid crystal on silicon spatial light modulators (slms) are commercially available. these devices are typically composed of individual cells, or pixels, containing a liquid crystal material embedded above a reflective surface (transmissive slms are also available but suffer from reduced photon - efficiency). in response to an applied voltage on each pixel, the liquid crystal effectively changes refractive index and hence varies the phase - lag accrued by incident light. slms are an excellent choice for generating phase masks with discontinuities, as the refractive index of a given pixel may be adjusted independently of its neighbors. hence, care must be taken to either reject light of the incorrect polarization or correctly rotate its polarization before incidence on the slm. if the phase function (x, y) possesses no fine discontinuities, deformable mirrors (which currently are only available with limited numbers of pixels for reasonable cost) may be used to encode the desired modulation. recent developments in microelectromechanical system (mems) fabrication techniques have enabled the emergence of deformable mirrors featuring a single continuous metallic surface, which may be bent into a desired shape using an array of electro - static (or magnetic) actuators. because the individual actuators of deformable mirrors can travel distances of 10 m, these devices often have a greater range of phase modulation than slms. furthermore, their reflectivity is superior to that of slms, leading to better overall collection of emitted photons. hence, deformable mirrors are often the method of choice for correcting optical aberrations, which are generally smoothly varying functions. on the other hand, slms are used to impart more exotic phase masks that contain rapidly varying features. microscopists have developed a menagerie of phase masks for single - molecule applications. the experimenter s responsibility is to decide upon the measurements that need to be acquired and then choose the phase mask that is optimal. in this section, we give a brief overview of the designs recently reported in the literature, and the scope of their application. by far, the most popular single - molecule application of a phase mask is to precisely determine the z - positions (depths) of molecules within a sample. depth information may be trivially obtained simply by inserting a cylindrical lens in the imaging pathway. use of such an optic will make the microscope s psf appear elliptical, or astigmatic. that is, the microscope will exhibit two different focal planes along the x- or y - axis at different z - positions. the z - position of a molecule is recovered as follows : an asymmetric 2d gaussian function is fit to the image of an emitter formed on the detector, and the widths of the fitted (elliptical) gaussian along the x- and y - axis of the detector are recorded. the z - position is then inferred from a lookup table relating the image widths along the x- and y - directions to depth, which is constructed by translating the microscope objective lens in known increments relative to a fluorescent bead. though the use of an astigmatic lens is cheap, simple, and effective, a number of alternatives for inferring depth have been proposed, offering considerable advantages. for example, in collaboration with researchers at the university of colorado, boulder, our lab has implemented a double helix point spread function (dh - psf) that modulates the psf into a particular superposition of gauss laguerre modes causing the psf to resemble two gaussian lobes, which appear to revolve about a fixed point as the emitter is translated along the microscope s optical axis. by fitting two gaussians to this raw data, and measuring the angle of the line formed by connecting the centers of the two lobes, depth the efficacy of the dh - psf has been demonstrated in biological tracking applications, as well as in super - resolution imaging experiments in living cells. the double helix point spread function is an attractive alternative to astigmatism, because it has superior fisher information content, which means that given a photon shot noise - limited image, a 3d localization can be obtained to greater precision than would be possible using the astigmatic psf. sophisticated image - fitting algorithms that make more effective use of raw data are also currently available. recently, related psf designs have specifically sought to maximize the fisher information throughout a range of microscope defocus settings. laguerre modes may cause the psf to appear as one revolving lobe as opposed to two, thus forming a corkscrew shape. a similarly behaved psf design was also derived using spiral phase gradients (vorticies) applied in successive fresnel zones throughout the microscope s back focal plane. this design variant may be particularly useful when one attempts to detect or compensate for spherical aberration. furthermore, using a dual polarization configuration, a phase mask design based upon airy beams has been developed, capable of localizing emitters with z - precision equivalent to the lateral (x / y) localization performance. although phase masks that allow emitter depth to be measured cause a well understood z - dependent aberration to become manifest in the microscope psf, it is sometimes preferable to induce as little change in the psf as possible over a given range of z - positions, effectively increasing the microscope s depth of field. a variety of extended depth of field (edof) designs relying on a cubic phase function have been investigated. furthermore, these designs have been characterized with regard to the effects of spherical aberration (a common occurrence in microscopy when a sample s refractive index does not match that of the immersion medium of the objective). additionally, an expanded point information content (epic) phase mask has been developed that exhibits extended depth of field on one side of focus, and permits the z - position to be measured on the other side of focus. hence, these two favorable qualities in the psf may be simultaneously realized by dividing the fluorescence emitted by the microscope into two separate imaging channels, and recording images using two sensors focused at different z - positions within the sample (biplane). the majority of applications of fourier processing to single - molecule microscopy have emphasized either retrieving a molecule s depth or mitigating the effects of microscope defocus or aberration. however, specialized phase masks may be used to extract other physical parameters. for example, the orientation of individual molecules is a subject of enduring interest to microscopists. fortunately, the far - field emission pattern associated with a rotationally immobile molecule is highly anisotropic, which implies that light emanating from a molecule will form a nonuniform intensity distribution upon a microscope s back focal plane, which is a function of the molecule s orientation relative to the imaging system. this feature may be exploited to deduce the underlying orientation of any molecule of interest. phase masks especially devoted to performing single - molecule orientation measurements, as well as simultaneously inferring position and orientation information will be described in the final two sections of this paper. to profit from the potential that optical fourier processing provides for single - molecule imaging, it is necessary to develop an accurate theoretical framework capable of predicting the emission patterns that are acquired from an optical system. given a phase mask design and a fluorescent molecule, we wish to simulate the image that would actually appear on a camera sensor, prior to doing an actual experiment. although simply approximating a single - molecule image as the microscope s psf may be sufficient for some applications, a more robust simulation model is generally required to maximize information extracted especially for applications involving the determination of molecular orientation. by comparing simulated images to actual data, it is then possible to draw conclusions about the sample under observation. in this section, we present formulas that may be used to computationally generate images of a single molecule at an arbitrary depth or orientation within a sample of interest. furthermore, we discuss the modeling considerations that may be used to accurately predict the effects of a phase mask upon the final image recorded by the optical system. though eq 1 from the previous section tells us much of what we need to know to choose a proper phase mask for a given application, it does not tell us the precise functional form of the electric field input into the 4f system, or the field impinging upon the back focal plane. these fields can turn out to be quite exotic when one considers a single molecule as an illumination source. the derivation contains two major steps : in the first step, we must calculate the far - field emission from a molecule, in addition to modeling the high numerical - aperture (na) objective used to collect light exiting the sample with vectorial diffraction theory. this allows us to determine the intensity distribution present at the back focal plane, which is essentially the scaled (spatial) fourier spectrum of the intensity distribution at the image plane of the microscope. in the second step, we incorporate the use of a phase mask into our imaging model, which involves the far simpler theory of fourier optics because the optical fields are paraxial at this point in the imaging system. furthermore, we demonstrate some computational shortcuts to calculating image plane intensity distributions. our method involves the use of basis functions which allow molecules of arbitrary orientation to be simulated rapidly, after some modest preliminary computation. under most circumstances, the emission pattern of a single fluorescent molecule most closely resembles that of the far - fiels of an oscillating electric dipole. we begin by specifying the orientation of the transition dipole moment of a molecule using the unit vector. the orientation of the dipole is defined by an azimuthal angle and a polar angle, where4as shown in figure 2a. by solving maxwell s equations for an impulse current source, it can be shown that the intensity distribution that appears in the far - field, a distance r from the molecule in question, resembles a torus centered along the axis specified by (figure 2b). that is, if one were to measure the far - field intensity iff along a single ray emanating from the molecule in a direction specified by a unit vector r, or by the angles {, }, such that5one would find6where is the angle between the two vectors, r and. to describe the electric fields that give rise to this intensity distribution, a convenient mathematical object exists, which is called the green s tensor:7 in the above equation, n1 is the refractive index of the medium in which the molecule has been embedded. denotes the adjoint operator. to find the electric field at any point along the surface of a sphere of radius r, simply compute8where a denotes the amplitude of the molecule s dipole moment. by examining the expression for gff(,), one may observe the following features : first, the term (i rr) enforces the sin() intensity dependence and also ensures that the electric field traveling along a ray specified by r will have no component parallel to the direction of propagation. the scalar term, e/4r, accounts for the fact that as the sphere defined by r grows, the total energy emitted must remain constant, leading to an attenuation of the electric field measured at a single point along the sphere s surface. the exponential term arises due to the phase - lag incurred by a light wave traveling a distance r away from the molecule. it is also useful to make the following observation : if the molecule is moved along the optical axis a short distance d r, such that r r and (figure 2c), then the resulting field may be calculated by augmenting eq 8 with an additional phase factor:9equation 9 is helpful when the effect of microscope defocus is considered, which may be modeled as an axial displacement of the microscope s focal plane from the molecule of interest. schematic of coordinate systems used to calculate the images formed from single molecule fluorescence. (a) two equivalent parametrizations for expressing the orientation of a molecule s transition dipole moment. either a unit vector or a pair of angles {, } is used. (b) ray emanating from a molecule with trajectory defined by the unit vector r having intensity iff(,) sin (), where is the angle between and r. the distribution of iff(,) is thus a torus (pictured). (c) approximations used for modeling defocus : if d r, then r r and. (d) overview of the complete imaging system modeled by our simulations. note that we assume is small, and therefore the electric fields emerging from the tube lens will have a z - component that is nearly zero. we now consider how an objective lens interacts with the electric field emanating from the dipole. we specify the objective as having a focal length fobj as well as a maximum collection angle max. the objective acts in the following manner : any ray emanating from the dipole with an inclination max will be rotated such that it is parallel to the optical axis. this transformation ensures that the s - polarized component of the electric field (with respect to the plane of the objective) remains unchanged, whereas the p - polarized component of the electric field will be rotated such that it is orthogonal to the optical axis. unless acted upon by another optical component, the rotated ray will remain at a fixed distance away from the optical axis. each of the rays collected by the objective will propagate parallel and in - phase with one another, until impinging upon the back focal plane located fobj behind the objective. we may now specify a new green s tensor, for determining the electric field at the back focal plane:10the matrix robj(,) is responsible for accomplishing the desired ray rotation and is expressed using the formula11 in eq 11, n0 is the refractive index at the back focal plane (normally n0 1). the leading factor of n1/[n0 cos() ] was derived in ref (56) and ensures that the total energy contained in the hemispherical portion of the far - field collected by the objective is identical to the energy in the back focal plane. by plugging eqs 9 and 11 into eq 10, we arrive at an explicit expression for gbfp:12note that in eq 12, r has been replaced by fobj. also, the third row of gbfp contains only zeros, ensuring that the electric fields will be rotated into the plane perpendicular to the optical axis. furthermore, we recall that, if a ray leaves the dipole at a trajectory > max, then it will not be collected by the objective, and gbfp will simply be the null - matrix. although gff was used to calculate the electric field at a point on a sphere, it is our intention to use gbfp to determine the fields on a planar surface. it is therefore more natural to work in polar {, } coordinates as opposed to spherical {, }. this transformation is accomplished using the following substitutions:13 in the transformation defined by eq 13, we have found it convenient to choose our units of length to be in terms of fobj. that is, = 1 corresponds to a distance of fobj from the center of the back focal plane. therefore, the radius of the circle within the back focal plane in which intensity is nonzero is max = sin(max). hence in polar coordinates, we obtain14the back focal plane electric field is simply15the intensity at the back focal plane may also be calculated as16note that the defocus term, e) in figure 3, we show the effects of molecular orientation upon the resulting ibfp patterns. note that changes in orientation will cause the intensity to shift to different regions within the back focal plane. when a molecule is oriented along the optical axis (= 0), the rays carrying the majority of intensity will propagate away from the dipole at an inclination > max, leading to a decrease in the objective s overall collection efficiency. if an ensemble of molecules is fluorescing simultaneously, their back focal plane emission patterns will overlap. the back focal plane intensity distribution for an ensemble of randomly oriented molecules is also presented in figure 3. bottom row : intensity distribution for a molecule at an air (n2 = 1) glass (n1 = 1.518) interface. though defocus alone does not perturb the back focal plane intensity distribution, inhomogeneities within the sample (such as a refractive index mismatch between a microscope coverslip and the medium in which the emitting molecule is embedded) will have a profound impact on ibfp(,). in the appendix we provide formulas for properly augmenting gbfp(,) to account for the presence of a planar interface between the emitter and the objective, over which refractive index changes. in figure 3, the back focal plane intensity distributions modified to account for the presence of an air - glass interface are also presented. this is caused by the enhancement of the evanescent electric field, and its conversion into propagating waves. furthermore, one may note that when an interface is present, a molecule perpendicular to the interface exhibits superior collection efficiency to a molecule of parallel orientation. the modified equation for gbfp(,) will be of use to us in section 4, when single molecules are simulated at an air glass interface. we now turn our attention to calculating the intensity distribution present in the image plane. when a phase mask is included, it is placed conjugate to the back focal plane (figure 2d) using the 4f optical system. however, for simulation purposes, the additional relay optics need not be explicitly modeled. the phase mask may simply be rescaled by a factor of ftube / f4f (the magnification of the back focal plane by the first lens of the 4f system), then treated as if it were actually located inside the microscope. the physical effect of the phase mask is simply to multiply the back focal plane electric field ebfp(,,d) by a spatially varying phase - lag function (,). that is17note that the phase - lag function (,) is identical to the one discussed in the previous section. we have simply found it convenient to parameterize in terms of polar as opposed to cartesian coordinates. as shown in figure 2d, conventional microscopes have a tube lens placed a distance ftube behind the back focal plane, which serves to focus the collimated rays exiting the objective into an image. it is feasible to derive an additional transformation matrix rtube(,) and then calculate the fields in the image plane by integrating the contributions from each individual ray. referring to the diagram in figure 2d, we realize that if a ray enters the objective at an inclination, it will leave the tube lens at the inclination = sin[(fobj / ftube) sin() ]. for example, if max = 65, fobj = 3 mm, and ftube = 180 mm, then the maximally inclined ray exiting the microscope will have the trajectory of only maxtube = 0.87. hence, we conclude that the paraxial theory of fourier optics will be sufficient for our analysis. practically, the small value of maxtube also ensures that electric fields exiting the tube lens will reside primarily in the plane orthogonal to the optical (z) axis. from the diagram, we note that the tube lens is placed one focal length behind the back focal plane and one focal length in front of the image plane. the electric fields between the two planes are therefore related by a scaled fourier transform:18here, we have assumed that the medium surrounding both the image and back focal plane have refractive index n0. note that we have expressed the fourier integral in eq 18 using polar coordinates as opposed to cartesian coordinates, used earlier in eq 1. as mentioned previously, the primed coordinates {, } indicate position within the image plane, and the constant c incorporates a phase curvature term and an overall amplitude scaling factor. by substituting eqs 15 and 17 into eq 18, and moving the constant vector outside of the integral, one can express eimg as19where we have defined20it is expedient to evaluate the integrals contained in eq 20 numerically, using the two - dimensional fast fourier transform algorithm. we will denote the resulting components of the matrix gimg using the following shorthand:21for a given component, gji, the superscript i refers to whether a component gimg is contributing to either the x- or y - polarized portion of the resulting electric field eimg, whereas the subscript j indicates the component of by which gji is multiplied. the image plane intensity distribution is thus calculated as22the first term enclosed in brackets above is the contribution to overall intensity from x - polarized light, whereas the second term is the y - polarized contribution. furthermore, note that although ibfp did not depend upon microscope defocus, iimg is a function of d. if we expand the two terms in eq 22, we arrive at the following:23where denotes complex conjugation and indicates the real portion of the complex argument inside the brackets. making the definitions24simplifies eq 23 to the following inner - product:25the functions { xx, yy, zz, xy, xz, yz } may be regarded as basis functions defined over the image plane. any measurement of iimg by a camera will be the result of a linear superposition of these functions. furthermore, their proper weighting may be straightforwardly determined by the emitting dipole s orientation, and the amplitude a. the basis function representation of iimg has been used extensively by some authors. however, it is our opinion that the computational advantage of this approach has been overlooked. using a total of just six two - dimensional fast fourier transforms, the proper basis functions may be calculated and stored for future use. then, the proper intensity distribution for a molecule of arbitrary orientation may be simulated simply by computing the correct weighting factors. additionally, one may incorporate the effects of a linear polarizer in a straightforward fashion. x / y - polarized images may be computed as26 in general, a new set of basis functions must be calculated if one wishes to vary d, the amount of microscope defocus. hence, when a simulation is designed, it is best practice to first decide upon the set of defocus values that are most relevant and then simulate a library of basis functions at different d, which are saved and later used to simulate single - molecule images. figure 4 demonstrates a proof - of - concept simulation. a dipole fixed in orientation at {, } = { 45, 45 } is axially translated a distance up to d = 1000 nm from the microscope s focal plane. we calculate iimg at different values of d. the basis functions used to simulate iimg at d = 1000 nm are also shown. for this simulation, we have assumed that no phase mask is included in the microscope, and hence (,) = 0 throughout the back focal plane (this configuration is termed clear aperture). although we have found it convenient to specify our optical system using the parameters { fobj, ftube, max }, it is common practice to instead describe a microscope by its numerical aperture na = n1 sin(max), and magnification m = (n1/n0)(ftube / fobj). finally, it is worth noting that if one wishes to simulate the psf of the optical system (the image of an isotropic point source), this may be accomplished simply by superimposing the images of three orthogonally oriented dipoles. (a) overview of simulation : a molecule (= 600 nm) is translated a varying distance d from the objective s focal plane in isotropic media. we specify that the objective has an immersion medium of n1 = 1.518, and an na of 1.4 (max = 67.26). (b) simulated images for a molecule with dipole moment oriented at : {, } = { 45, 45}. (c) basis functions used to simulate the defocused image d = 1000 nm. units of length are specified in object space, i.e., before accounting for the magnification imparted by the objective / tube lens combination. single - molecule microscopy features many methods for determining a fluorescent molecule s dipole orientation. the first measurement techniques incorporated polarizing / analyzing optics in confocal microscope designs. however, orientation measurements may be readily performed using widefield configurations as well. by precisely fitting simulations to single - molecule image data, both the position and orientation of rotationally immobilized molecules have been simultaneously determined. as a molecule is moved an increasing distance from the objective s focal plane (figure 4), the effects of orientation become more readily apparent upon the acquired image. thus, by simply defocusing a microscope, one may collect images that are more amenable to quantitative analysis. however, as is evidenced in figure 4b, the acquired image data will vary quite rapidly as a function of the precise amount of microscope defocus applied. because neither defocus distance nor orientation is generally known beforehand, they must be simultaneously estimated when data are fit to simulations. our recently developed phase mask for measuring orientation, termed the quadrated pupil, addresses this problem by permitting orientation to be inferred without also requiring a precise depth estimate. using a simple data analysis algorithm, and a customized dual - polarization 4f imaging system, we have achieved orientation measurement precisions of 2 for both and. in this section, we review the principles of this novel technique. figure 5 depicts our experimental apparatus. using a polarizing beamsplitter, fluorescence exiting the microscope is separated into a reflected (r) and transmitted (t) channel, respectively containing s- and p - polarized light, as defined relative to the surface of the beamsplitter. using the 4f optical processing configuration, the electric fields associated with the two polarization channels are fourier transformed and projected onto an slm using a pyramidal mirror (figure 5a, c). the geometrical arrangement of our setup ensures that both the t and r channels will be polarized along the x - axis, defined relative to the slm surface. this configuration is desirable because our liquid crystal slm is capable of modulating only one polarization of incident light. after the slm imparts a phase function (x, y), another set of lenses performs a second fourier transform and images the t and r emission channels onto separate regions of an electron multiplication charge coupled device (emccd) detector. the slm is programmed with a pyramidal phase function (figure 5b) consisting of four linear phase ramps:27the constant c0 is set by the dynamic range of the slm (6), and c = c0/max, where max is the radius of the region in which intensity may be nonzero, as enforced by the numerical aperture, magnification, and the focal lengths of the lenses used in the 4f system. intuitively, the function of this phase mask is as follows : light falling into a given quadrant of the phase mask will be shunted into one of four separate points at the image plane. because each polarization channel is independently phase modulated and imaged on a separate region of the emccd, fluorescence from a single molecule will appear as a total of eight separate spots on the detector. because the distribution of intensity at the back focal plane will depend upon a given molecule s orientation, the intensity distribution among each of the eight spots on the image sensor will also vary. (when isotropic emitters, such as fluorescent beads, are imaged, each of the image points will contain equal intensity.) dual - polarization/4f optical processing system. adapted from ref (69) with permission. e and e denote p- and s - polarized electric fields with respect to the beamsplitter, which subsequently are separated into e and e, the fields present in the transmitted and reflected polarization channels, respectively. (c) geometry of our setup ensures that both the r and t channels are polarized along a single axis, so that the slm can properly modulate all light emitted by the specimen. a sample widefield fluorescence image is presented in figure 6a showing both the r and t polarization channel images for single dye molecules, dicyanomethylenedihydrofuran - n-6 (dcdhf - n-6), spin - coated in a layer of 1% (by mass) poly(methyl methacrylate) (pmma) dissolved in toluene, which served to immobilize them both in space and in orientation. the molecules were excited with circularly polarized widefield illumination using a 514 nm laser at 1 kw intensity measured at the sample. imaging was performed with a 1.4 na objective (as modeled in our simulations). to quantitatively estimate orientation, a molecule of interest is identified in both the t and r channels, and the background - subtracted area - integrated f photons in each of the eight spots is calculated (figure 6b). photon counts are stored in a vector. the maximum - likelihood estimate of a given orientation is achieved by maximizing an objective function incorporating poisson noise statistics:28o(,) is related to the log - likelihood, l(,b|,), by addition of a constant which may be neglected because it does not influence the optimization procedure. b is the mean background fluorescence per pixel, and n is the number of pixels in the region used to calculate a given imeas. the eight - element expected image vector is determined by simulating intensity - scaled polarized images of a single - molecule fixed at orientation {, } embedded at an air - glass interface (as described in the appendix) and incorporating the quadrated phase mask using eq 17. (a) widefield image of single dye molecules. both t and r channels are shown. note that due to the geometry of the experimental setup, the r channel image undergoes an additional reflection before being projected onto the emccd. inset : the pair of angles {, } denote a single point on the unit hemisphere. (b) partitioning scheme used for processing measured and simulated data into the vectors and. for our technique to produce accurate orientation estimates, the defocus distance between a given molecule and the objective s focal plane need not be known with high precision. microscope defocus does not dramatically alter the intensity distribution within the back focal plane and is therefore not a critical modeling consideration. to better understand this feature, we performed the following simulation : in figure 7a, we simulate polarized images of a molecule embedded in isotropic media, with varying amounts of defocus applied (the quadrated pupil phase mask is in use). throughout a range of |d| 150 nm, defocus will cause fine variations in the image recorded but will not drastically change the total amount of intensity contained in a given quadrant of a polarized image. if defocus exceeds this amount, the four spots in a given polarized image will either begin to overlap (d 150 nm). to further quantify this effect, the intensity - normalized components of the vector are plotted over a 0.5 m range (figure 7b). as expected, the components of this vector do not change appreciably over the range |d| this implies that even though the images that are acquired at different defocus settings will be slightly altered, the data input into our estimation algorithm will be nearly identical. though knowledge of defocus need not be exact, it is necessary to have accurate information about any refractive index variations throughout the sample. changes in refractive index will affect the back focal plane intensity distribution (figure 3) and must therefore be well accounted for in simulation. so long as simulations accurately model any refractive index mismatches, this technique suffers no loss in accuracy. however, when samples such as cells are imaged, it is important to ensure that inhomogeneity within the sample is not so severe as to significantly alter the back focal plane intensity such that it is no longer well - modeled by simulations such verification may be carried out by directly inspecting the back focal plane using a bertrand lens. (a) representative simulated images of a single molecule { = 40, = 25}. (b) plot of normalized entries of as a function of defocus d. in the 150 nm range indicated, the components of change minimally. for this simulation, an isotropic medium was assumed (no index mismatch). as a proof - of - concept, maximum likelihood orientation measurements for two representative dcdhf - n-6 molecules are shown in figure 8a, b. to benchmark our precision, 20 successive 1 s frames of data were acquired, and the orientation of the same molecules was repeatedly estimated. the estimated angles {, }, are plotted as points on a unit hemisphere (inset in figure 6a). furthermore, the objective function o(,) may be evaluated throughout the unit hemisphere, to gauge the relative likelihood of different orientations. in figure 8c, d, we demonstrate our technique to be insensitive to minor defocus errors. the objective lens of our microscope was translated in 50 nm steps, with 11 frames of data recorded at each step. when the focal plane is within 150 nm of the layer of single molecules, the orientation measurements are largely invariant. (a) and (b) orientation measurements for two molecules. at left : raw data and simulated images obtained from the mean orientation estimate. center : repeated orientation measurements for the same molecule, plotted on the unit hemisphere. the 2 ellipse computed from the data - covariance matrix is plotted in green. right : magnified view of the region of interest. for the molecule in (a), the mean orientation was : { avg = 42.2, avg = 242.2 } with a standard deviation of { = 1.8, = 1.7}. an average of 2370 photons were detected per exposure. for the molecule in (b), we found { avg = 73.9, avg = 326.9 } and { = 5.8, = 4.3}. an average of 921 photons were detected. (c) orientation measurements for a single molecule over a 150 nm range. (d) sample images taken at different focal planes demonstrate robustness to defocus. for this molecule, an average of 916 photons per exposure were detected. in this section we present an adaptation to the quadrated pupil phase mask design, termed the bisected pupil, which enables the lateral (x / y) position of fluorescing emitters to be estimated, in addition to emitter depth thus achieving three - dimensional super - resolution imaging. although the quadrated pupil phase mask design provides accurate, high precision orientation estimates for all actively fluorescing molecules in a field of view, it is not a particularly well - suited phase mask for the task of localizing individual molecules (even in x and y) for two reasons : when the quadrated pupil is used, emission from a given molecule is divided into eight lobes in two polarization channels. in the presence of even modest background, distributing photons over such a diffuse region will have negative consequences from a signal - to - noise standpoint. furthermore, in the context of super - resolution imaging, it is necessary to detect large quantities of individual molecules over many frames of data. it is difficult for automated detection algorithms to properly identify molecules in the presence of modest background fluorescence, if signal photons are spread over many pixels. to confidently identify molecules from raw image data, and obtain both precise position and orientation measurements, we propose a compromise instead of partitioning the back focal plane using four phase ramps, we instead use only two. the resulting phase mask, the bisected pupil, splits emission into only four lobes over two polarization channels, and may be much more readily applied to single - molecule localization analysis. the functional form of the bisected pupil phase mask can be expressed as29analogous to eq 27, c0 and c are tunable constants that control the slope and magnitude of phase variation throughout the phase mask. figure 9b shows a series of simulations of an isotropic emitter (i.e., three orthogonal dipoles superimposed) imaged in the t- and r - polarization channels at different defocus depths. due to the geometry of the setup, the lobes in the t - channel image are rotated 90 from those in the r - channel image. furthermore, we make the following key observation : as the depth of the emitter varies, the two lobes in a given polarization channel will appear to contract (d 0). this feature suggests that by measuring the interlobe distance for the image of a given emitter, the precise z - position of the object may be inferred. in figure 9c, we translate an objective lens relative to a fluorescent bead spin - coated onto a microscope coverslip. by fitting gaussian functions to the two lobes in a given polarization channel, we are able to create a lookup - table relating lobe - spacing to depth. furthermore, by calculating the midpoint between the centers of the two gaussians, the lateral position may be determined. overview of the bisected pupil. adapted from ref (71) with permission. (a) the bisected pupil phase mask is plotted, and the polarization axis of incident light is indicated. (b) simulations of an isotropic emitter imaged with the bisected pupil, at varying depths (color scale has been renormalized for each d, to display fine features of the psf). this calibration was acquired by translating the objective lens relative to a fluorescent bead. a polynomial curve fitted to the data is also shown, indicating a nearly linear relationship. given a recipe for determining the positions of single molecules in three dimensions, the technique of super - localization may be leveraged to construct super - resolved widefield images of extended biological structures. a variety of methods, such as (f)palm and storm, have achieved resolution enhancements an order of magnitude below the diffraction limit using the following procedure : (1) by optical or chemical means, the concentration of actively fluorescing molecules labeling a structure of interest is limited such that their individual emission patterns become distinguishable in the image plane. (2) single molecules are then super - localized to within a few tens of nanometers by fitting a model function (two gaussians in the case of the bisected pupil) to the image recorded on a detector. (3) multiple frames of data are recorded, and all detected molecules are individually localized, such that the labeled structure is fully sampled. (4) the underlying structure is then reconstructed by plotting the positions of all localized molecules. we will refer to super - resolution methods employing this strategy as single - molecule active control microscopy, we used the dual - polarization 4f system to image microtubules in fixed bsc-1 cells, immunolabeled with the dye alexa fluor 647 (invitrogen). the sample was imaged in a buffer containing -mercaptoethylamine thiol and a glucose, glucose oxidase, and catalase oxygen - scavenging system. by imaging at intensities 10 kw measured at the sample, with a circularly polarized 641 nm laser, the individual dye molecules were forced to blink on and off, permitting their individual emission patterns to become visible. after a 10 min sequence of 30 ms exposures, individual molecules were identified in the t - polarization channel, super - localized, and binned into 25 nm pixels, which were color coded according to depth. the resulting image is shown in figure 10b. in comparison to a conventional diffraction - limited widefield fluorescence image (inset), the resolution enhancement is clearly evident. for this data set, an average of 2000 photons per polarization channel per molecule was detected. this signal and background level permitted molecules to be localized with 20 nm precision. super - resolution imaging in 3d with a bisected pupil. adapted from ref (71) with permission. (b) super - resolution image of microtubules in fixed bsc-1 cells. in the previous subsection, our analysis ignored the dipolar features of single - molecule images, discussed at great length in sections 4 and 5. previous studies have suggested that fitting simplistic model functions that do not properly account for dipole emission to single - molecule images can cause systematic localization errors. this effect is accentuated by slight microscope defocus (|d| 250 nm), which can induce mislocalizations on the order of 200 nm. these huge localization errors are most prominent when asymmetric features arise in the acquired data, due to molecules with transition dipole moments tilted away from both the optical axis and the plane of the microscope coverslip (45). a number of studies have sought to mitigate these errors and benchmark the effects of orientation upon localization precision limits. in previous work, we demonstrated that the three - dimensional positions of molecules immobilized in a polymer could be accurately inferred by first estimating their dipole orientation and subtracting the respective systematic localization error using a lookup - table. in biological specimens, molecules labeling structures often undergo some degree of rotational motion, depending upon the specific probe, and the labeling method employed. as a molecule s rotational mobility increases, its fluorescence image will appear as that of a superposition of immobilized dipoles. the molecule will thus resemble an isotropic emitter, mitigating any localization errors introduced by orientation. to characterize rotational mobility, it is often assumed that a molecule is free to rotate about a fixed axis, within a cone defined by an angle (figure 11a). this model may be augmented with rotational diffusion and excited state fluorescence lifetime data, making it possible to estimate the amount of rotational freedom necessary to mitigate localization error. our calculations indicate that if 65, lateral localization errors are bounded to fewer than 10 nm. (a) the rotation within a cone model : a molecule is assumed to have a mean orientation described by the pair of angles {, }, and may rotate to any orientation within the cone specified by the angle. (b) diagram indicating the regions of an image that are summed when the linear dichroism (ld) and lobe asymmetry (la) of a molecule are calculated. (c) histograms of simulated single molecule images (blue) indicate that rotational mobility is high. experimentally acquired data (red) most closely matches simulation using = 75. note that as rotational mobility increases, standard deviations la and ld, of histogrammed data decrease. (d) super - resolution images color coded according to ld and t - channel la. to gauge the rotational freedom of the alexa-647 molecules used in our super - resolution imaging experiment, we define two experimentally measurable quantities from the bisected mask images : the linear dichroism (ld) and lobe asymmetry (la). these quantities are defined as (figure 11b):30where at, r is the number of background - subtracted photons contained in one polarization channel attributed to a given molecule and l1,2 is the number of photons contained in one lobe of the single - molecule image in a given polarization channel (different lobe asymmetries may be calculated for the t- and r - polarization channels). in general, these quantities will vary as a function of a molecule s mean orientation. however, overall, both of these parameters tend to decrease in magnitude as the rotational freedom,, increases. to quantitatively investigate this feature, an ensemble of 10 000 single - molecule images was simulated using the bisected pupil phase mask. the resulting ld and (t - channel) lat values were then histogrammed. the mean orientation of each molecule was drawn randomly from a uniform distribution, and was kept fixed. this simulation was repeated three times using = { 25, 50, 75 } (figure 11c). emccd noise statistics were simulated, assuming a mean of 2000 signal photons per polarization channel for a molecule oriented parallel to the optical axis, and 20 photons per pixel of background. for these simulations, we adjusted detected signal photons to account for the relative pumping / collection efficiencies of molecules at different mean orientations with respect to the optical axis. the molecules were assumed to be immersed in water, in perfect focus, yet far enough above the water glass interface such that the evanescent field decayed almost completely before it could be converted into supercritical light. furthermore, molecules were assumed to visit all orientations within the cone described by with equal frequency. however, more sophisticated rotational diffusion models may be employed. by comparing our simulated ld and lat values to a histogram constructed from 10 000 single - molecule images drawn from our experimental data set, we find that our experimental data most closely matches the = 75 trial (figure 11c). it is therefore likely that the majority of emitters are almost completely rotationally mobile. furthermore, by color - coding pixels in a super - resolved image according to ld and lat, we find that these parameters are uniformly low throughout a field - of - view. we thus conclude that orientation - induced mislocalizations have not degraded or distorted this image. scrutinizing the data in figure 11c, we note that the experimentally obtained histograms have longer tails than the simulations. it is thus entirely possible that a small, yet detectable, subpopulation of immobile molecules may, in fact, be present in this sample. in this article, we have summarized the usage of fourier processing with a variety of phase masks and imaging systems for tracking fluorescent probes, imaging biological structures, and determining the orientation and rotational mobility of single molecules. for example, in the previous section our analysis of la and ld statistics confirmed that orientation caused minimal degradation of localization accuracy for a specific sample. however, we discourage making broad assumptions from this particular study. for example, researchers have reported significant polarization anisotropies in actin specimens. because much additional information normally hidden in the pupil plane of the microscope is transferred into the final image on the camera, optical fourier processing will thus serve as a useful diagnostic and measurement tool for future single - molecule imaging applications. | this article surveys the recent application of optical fourier processing to the long - established but still expanding field of single - molecule imaging and microscopy. a variety of single - molecule studies can benefit from the additional image information that can be obtained by modulating the fourier, or pupil, plane of a widefield microscope. after briefly reviewing several current applications, we present a comprehensive and computationally efficient theoretical model for simulating single - molecule fluorescence as it propagates through an imaging system. furthermore, we describe how phase / amplitude - modulating optics inserted in the imaging pathway may be modeled, especially at the fourier plane. finally, we discuss selected recent applications of fourier processing methods to measure the orientation, depth, and rotational mobility of single fluorescent molecules. |
previous reports suggest that about two thirds of middle - aged men and women suffer from nocturia [1 - 4 ]. according to one study, the prevalence of nocturia increased at an annual rate of 7.3% in men and 3.5% in women. generally, the prevalence of nocturia is thought to be higher in men than in women, especially in the elderly population. however, nocturia is also one of the most bothersome lower urinary tract symptoms (luts) in women as well as in men. newman and koochaki showed that 72% of women with overactive bladder (oab) reported that nocturia was very or extremely bothersome among their luts. the results of a meta - analysis of the prevalence of nocturia showed that 20.4% to 43.9% experienced nocturia of more than 1 episode, and 4.4% to 18% experienced nocturia of more than 2 episodes. in older women, the incidences were increased : 74.1% to 77.1% of older women showed nocturia of more than 1 episode and 28.3% to 61.5% of women showed nocturia of more than 2 episodes. in addition, research on the association between age and nocturia in korean women showed that the most common cause of nocturia was nocturnal polyuria as shown by use of 3-day frequency volume charts. also, the incidence of nocturnal polyuria tended to increase as the women grew older. desmopressin is a synthetic analogue of antidiuretic hormone that has been used to reduce nocturia, especially nocturnal polyuria, which is an overproduction of urine at night. the clue to the use desmopressin is that secretion of antidiuretic hormone is decreased in elderly people compared with young adults ; therefore, replacement of antidiuretic hormone can reduce nocturnal voids. studies of the effect of desmopressin have shown significant decreases in the number of nocturia episodes, nocturnal urine volume, and nocturnal diuresis. as a result, the first sleep period was longer and sleep quality was improved after medication with desmopressin. adverse effects such as hyponatremia were similar between patients who received placebo and those who were treated with desmopressin according to randomized controlled trials [10 - 12 ]. for women, desmopressin can also help to reduce the nocturia caused by nocturnal polyuria, which is the most prevalent cause of nocturia in elderly women. in addition, nocturia is related to various voiding problems that are common in old - age women. for example, most nocturia is associated with oab - related storage symptoms ; therefore, reduced functional bladder capacity is regarded as one of the causes of nocturia. as a result, nocturia can also be improved by resolving the voiding problems causing nocturia. we analyzed concomitant voiding dysfunction occurring with nocturia and the effect of desmopressin on nocturia retrospectively. we reviewed the medical records of 84 women who were treated with desmopressin 0.1 or 0.2 mg and had reported more than 2 nocturnal voids on a pretreatment frequency volume chart in the urologic outpatient clinic between january 2008 and december 2011. all patients underwent a physical examination with a comprehensive history taking, physical examination, urinalysis, international prostate symptom score (ipss), and a 3 day frequency volume chart. patients who had neurologic diseases, previous radical pelvic surgeries, or pelvic organ prolapses were excluded from the study. numbers and volumes of voids over 24 hours were calculated as an average over the 3 days of the frequency volume chart. nighttime urine production, maximal functional bladder capacity, and nocturnal index (nocturnal polyuria index [npi ] and nocturnal bladder capacity index [nbci ]) were calculated according to the international continence society. the mean age of the women was 66.8 years old ; therefore, we defined nocturnal polyuria as a nighttime urine volume of more than 33% of the total daily urine volume (npi>0.33). reduced nocturnal bladder capacity was defined as nbci greater than 1. mixed - type nocturia was defined as a combination of nocturnal polyuria and reduced nocturnal bladder capacity. after 1 month, the dose of desmopressin was increased to 0.2 mg in patients who showed no effect with desmopressin 0.1 mg. the treatment effect was evaluated in the patients who needed dose escalation after 1 month to desmopressin 0.2 mg. after treatment with desmopressin, a reduction by more than half in the number of nocturnal voids compared with baseline was regarded as effectiveness. improvement was defined as a reduction of nocturnal voids regardless of the number compared with baseline. the data were analyzed by using the mann whitney u - test, and p - values 1 according to a frequency volume chart. a score of > 1 on the nocturia index suggests increasing nocturnal urine volume ; therefore, the cause of nocturia in patients showing an increase in the nocturia index can be regarded as nocturnal polyuria. after 3 weeks of medication, the authors observed that nocturia was reduced by half or more in 46% of the women. in the present study, 48.8% (41/84) of women experienced a reduction in the number of nocturia episodes of more than half after desmopressin 0.1 or 0.2 mg, and nocturnal polyuria was observed in 58.5% (24/41) of them. in addition, 40.7% (24/59) of the women with nocturnal polyuria showed a reduction in nocturia of more than half after medication with desmopressin. therefore, we also noticed the effect of desmopressin on women with nocturnal polyuria. on the other hand, 38.1% (32/84) of the women showed a reduction in nocturia that was not more than half of the baseline value after treatment with desmopressin. the difference between these women and those in whom nocturia was reduced by more than half seemed to be the baseline luts, especially urgency. the women who showed a reduction in nocturia that was not more than half of baseline complained of more severe urgency, which may have been the reason for the decrease in the treatment effect. this result suggests that attention should be paid to other luts to increase the treatment effect in patients with nocturia, because common voiding dysfunction like oab is usually combined with nocturia. in addition, there were women who complained of voiding problems other than oab in this study. the women complaining of voiding symptoms, low maximal flow rate, and increased postvoid residual urine volume were regarded as having fvd. therefore, physicians should consider fvd if women with nocturia have symptoms and signs of voiding difficulties. among the women treated with desmopressin, concern about nocturia seems to be necessary after treatment of stress urinary incontinence, because nocturia can be persistent or newly developed regardless of the stress urinary incontinence. although the results of this study might indicate an influence of luts on the treatment outcome of desmopressin in women with nocturia, this study had some limitations. first, it was an uncontrolled, retrospective study and thus the therapeutic effect of desmopressin was not confirmed in the combined medication or anti - incontinence surgery group. second, the number of subjects in this study was small, and therefore further evaluation is necessary in a large number of women with nocturia and other voiding dysfunction. the majority of women showed nocturia and other voiding dysfunction such as oab concurrently. regardless of the type of nocturia as shown by the frequency volume chart, treatment with desmopressin can effectively reduce nocturia. therefore, consideration of luts other than nocturia is needed to increase the treatment effect of desmopressin on nocturia in women. | purposeto investigate the type of nocturia and concomitant voiding dysfunction (vd) and the effect of desmopressin treatment on nocturia in women.materials and methodswe reviewed 84 women who experienced more than 2 nocturia episodes as recorded on a pretreatment frequency volume chart and who were treated with desmopressin. all patients underwent history taking, physical examination, urinalysis, international prostate symptom score assessment, completion of a urinary sensation scale, and completion of a 3 day frequency volume chart. nocturia was divided into nocturnal polyuria (np), reduced nocturnal bladder capacity (rnbc), and mixed type. after treatment with desmopressin, a reduction in nocturia of over 50% compared with baseline was regarded as effective.resultsamong 84 women, the most common concomitant vd was overactive bladder (oab, 60.7%). np was observed in 70.2% (59/84) of the women, rnbc in 7.1% (6/84), and mixed type in 22.6% (19/84). after medication with desmopressin, 73 women (86.9%) showed a significantly reduced number of nocturia episodes (1.41.5) compared with baseline (3.71.3, p<0.05). eleven women (13.1%) did not show improvement. of the 73 women who showed improvement, 41 women showed a reduction of more than 50% over baseline, and these women had a lower baseline urgency grade.conclusionsin the majority of women, nocturia coexisted with other vd such as oab. treatment with desmopressin effectively reduced the nocturia. however, other lower urinary tract symptoms (luts) such as urgency may reduce the effect of desmopressin. therefore, consideration of concomitant luts seems to be necessary to increase the treatment effect of desmopressin on nocturia in women. |
on august 8, 2005, marshfield laboratories (marshfield, wi, usa) was contacted to test 2 deceased captive waterfowl from a farm with a suspected outbreak of wnv. kidney, spleen, and oral and cloacal swabs were taken and tested by using reverse transcriptase (rt)-pcr (5). when tissues and swabs were found positive, we contacted the farm operator to determine the extent and nature of the outbreak and obtained permission to conduct a site visit. on the first, on august 18, 2005, we collected frozen, dead carcasses for testing and collected swabs, serum, or both from 8 clinically ill birds. at the second visit, on august 2425 the farm was primarily operated for production of breeding stock and included > 25 species of domestic and exotic species of geese, ducks, and poultry. in a typical year of operation, 150 breeding stock are on the farm in early spring ; by june the flock expands to 1,250 birds. hatch - year birds are raised to adults and sold to breeders in the fall. an average of 3 deaths per month from various causes, including trauma and infections, occur in the flock. the birds are housed in large, clean, well - drained outdoor pens constructed of wood beams and large - gauge nylon netting. birds are not segregated by species, and 320, and 160, respectively. at the onset of the investigation, infections due to avian influenza and exotic newcastle disease virus were considered in the differential diagnosis. oral swabs from all dead birds were tested at the wisconsin veterinary diagnostic laboratory (madison, wi, usa) for both agents and were negative. this report is the first to document wnv in a commercial waterfowl operation in the united states. the extent of this outbreak, as evidenced by the seroconversion rate in cohort b, far exceeded deaths in the flock. this outbreak caused a considerable economic loss for the operator, and the occurrence of infection among a large number of birds posed a major occupational hazard to the farm workers. our study has limitations because it was a retrospective analysis and we were not able to collect some key data, such as vector infection rates, or to sample the water for wnv. however, the concentrated loss of birds within a small number of housing pens during late july and early august, along with the high seroconversion rate among asymptomatic and recovered birds in the flock, suggests that nonvector transmission may have occurred. previous studies have documented that feather pulp in infected birds often contains high titers of wnv (8). in addition, the tendency of waterfowl to congregate on ponds at night provides an opportunity for nonvector transmission through prolonged contact with virus shed into a common water source (9). during the mid to late summer, when wnv transmission is highest, most birds in this commercial flock were hatch - year birds and may have been more susceptible to infection (2). in contrast, older birds that may have immunity due to prior exposure to wnv made up the minority of the bird population. because avian influenza and exotic newcastle disease were the only other pathogens tested for in this outbreak, we can not completely rule out the possibility that coinfection with other pathogens contributed to death in certain species. previous studies have shown that coinfection and other stressors can contribute to high death rates within captive flocks (3). in this outbreak we saw no evidence of symptomatic infection with wnv among the limited number of workers regularly exposed to the birds. in contrast, the outbreak of wnv among breeder turkeys in wisconsin in 2002 was heralded by illness among farm workers (4). in silent outbreaks, the potential risk for humans is masked yet may still be substantial (10). in light of growing concerns about a possible avian influenza pandemic, universal precautions, as outlined by the us department of labor occupational safety and health administration (11), should be applied when working in avian husbandry. additionally, more timely reporting of suspected outbreaks to public health officials would permit comprehensive investigations that could elucidate the transmission dynamics of disease in agricultural settings. timely reporting is also important in implementing control strategies that mitigate spread of infectious diseases to farm workers. | a west nile virus (wnv) outbreak occurred at a commercial waterfowl operation in wisconsin in 2005. retrospective analysis of dead and live birds was conducted. wnv was detected by pcr in 84.1% of 88 dead birds ; neutralizing antibodies were found in 14 of 30 randomly sampled asymptomatic or recovered birds. |
actin filaments in cells are highly dynamic, rapidly assembling in some regions of the cell while disassembling in others. fast actin depolymerization allows cells to rapidly reconfigure their cytoskeleton in response to both internal and external cues. at the biochemical level, fast actin depolymerization is necessary to replenish the pool of polymerizable actin monomer that is used to rapidly assemble actin filaments and perform work (pollard and borisy, 2003). therefore actin depolymerization is critical for actin - dependent processes, but the mechanism of actin depolymerization operating in cells is not known. actin filaments in pure solution turn over slowly at steady state through an atp - dependent process know as treadmilling (wegner, 1982). to treadmill, actin uses a small portion of the energy from atp hydrolysis on actin to destabilize the filament to a slight extent, resulting in the slow release of adp - actin subunits from the pointed ends of filaments. classic photobleaching experiments performed at the leading edge of migrating cells were consistent with a model in which actin filaments assembled at the tip of the lamellipodium and disassembled at the base hence treadmilling (wang, 1985). protrusion of the leading edge could thus be neatly explained by the intrinsic properties of f - actin. the model is very appealing, and treadmilling is a popular model for describing actin filament turnover in cells. the first is that actin filaments in cells are too densely packed to directly visualize the mode of disassembly at the single - filament level by light microscopy. the extent to which this problem limited interpretation of mechanism became very apparent with the application of fluorescence speckle microscopy to actin arrays (watanabe and mitchison, 2002 ; ponti. speckling revealed that actin assembly and disassembly reactions are not restricted to the tip and base of the lamellipodium. instead some of the filaments are polymerizing, whereas others right next to them are disassembling. therefore we can no longer unequivocally state the mechanism of depolymerization at the single - filament level. any and all modes of actin filament disassembly depicted in figure 1 could be operating in cells. pure actin treadmills at steady state, which is a popular model for describing actin turnover in cells. (b) dynamic instability would occur if atp hydrolysis were to convert the barbed end from one that grows to one that shrinks. microtubules and prokaryotic parm filaments undergo dynamic instability, but dynamic instability has not been seen with actin. (c) severing cuts a filament to produce two daughter filaments without loss of polymer mass. (d) whole - filament destabilization proposes a highly cooperative process in which long stretches of polymer abruptly convert to monomer. whole - filament destabilization might describe actin disassembly in the presence of cofilin, coronin, and aip1. the second caveat is that actin filaments depolymerize much faster in cells than in pure solution, implying the existence of cellular factors that accelerate actin disassembly (zigmond, 1993). these factors could in principle accelerate pointed - end dissociation to enhance treadmilling, but treadmilling need not be an essential feature of actin filaments based on evidence from the world of bacterial actin filaments. prokaryotic parm, for example, is structurally related to actin (carballido - lopez, 2006), but parm uses the energy from atp hydrolysis to drive dynamic instability, not treadmilling (garner., 2004). in principle, then, if cellular factors were to help actin capture more of the energy from atp hydrolysis, they could alter the mechanism to any of those depicted in figure 1. the discrepancy between in vitro and in vivo actin disassembly rates motivated the search for actin disassembly factors, and members of the cofilin family of small actin - binding proteins were the leading candidates (bamburg, 1999). lappalainen and drubin (1997) combined yeast genetics with imaging and a small - molecule inhibitor of actin assembly to prove that cofilin is essential for actin depolymerization in cells. cofilin severs actin filaments in pure solution but does not appear to accelerate the rate at which actin subunits dissociate from filament ends (andrianantoandro and pollard, 2006), and cofilin - mediated severing of actively growing filaments has been detected in vitro (michelot., 2007). cofilin - mediated actin filament severing, presumably followed by slow depolymerization from the pointed end, is now the prevailing model for actin disassembly in cells. bundles of actin filaments can be seen fragmenting in neuronal growth cones of aplysia (medeiros., 2006). we do not know the fate of such severed filaments, however, or how they might depolymerize down to monomer. nor is it even clear whether actin - filament severing is the dominant mode of disassembly operating in cells. fluorescence speckle microscopy of actin in lamellipodia, for example, suggests that fast actin depolymerization extends all the way to the tip of the leading edge (watanabe and mitchison, 2002), but the short filaments we expect to see from frequent severing events are not found in electron tomograms of lamellipodia (urban., 2010). in fact, a number of nagging observations of actin filament turnover in cells are inconsistent with the hypothesis that cofilin - mediated actin - filament severing is the primary mode of disassembly driving actin dynamics in cells. several years ago hao yuan kueh, tim mitchison, and i compared the effects of two drugs, latrunculin b and cytochalasin d, on the dynamics of listeria actin comet tails (kueh., 2008). cytochalasin d is a drug that caps the barbed ends of actin filaments, preventing it from growing or shrinking. latrunculin, on the other hand, binds to actin monomer and prevents it from incorporating into polymer. listeria is a bacterial pathogen that harnesses the energy of actin polymerization on its surface to propel it through the host 's cytoplasm (tilney and portnoy, 1989). as the bacterium is propelled forward, it leaves an actin comet tail behind it that rapidly depolymerizes with exponential kinetics (theriot., 1992). cofilin is necessary for comet tail disassembly (rosenblatt., 1997). the cytochalasin d result is inconsistent with treadmilling why should capping the barbed end block disassembly at the pointed end ? this is not an isolated case unique to listeria, because cytochalasin d also blocked actin depolymerization in protruding lamellipodia (kueh., 2008). either we have more to learn about cytochalasin d or, just maybe, actin filaments in cells depolymerize from their barbed ends. one might be tempted to brush aside the cytochalasin d result as some effect of the drug other than capping of filament barbed ends (cooper, 1987). nevertheless, cofilin - mediated actin filament severing remains an unsatisfactory model for actin filament turnover in cells because it can not explain the morphogenesis of the listeria actin comet tail. comet tail assembly is restricted to the bacterial surface, whereas the rest of the comet tail only depolymerizes (theriot., 1992 ; kueh., although severing will produce more pointed ends that shrink, severing will also create more barbed ends that grow. actin - filament barbed ends produced by cofilin - mediated severing serve as sites for actin assembly in vitro (ichetovkin., 2002). furthermore, acute activation of cofilin at the leading edge of migrating cells results in a burst of actin assembly, not disassembly, presumably due to the abrupt formation of new barbed ends created by a round of severing (ghosh., 2004). disassembly dominated by severing can not be operating in the listeria actin comet tail because no new actin assembly can be detected along the length of the dissolving comet tail (kueh., 2010). finally, loss of polymer mass from comet tails via severing alone would require two cuts before the resulting filament could diffuse away from the comet tail, which is inconsistent with their exponential decay profile (kueh., 2010). thus cofilin - mediated filament severing alone can not account for actin disassembly dynamics detected in cells. the implication is that cells express additional factors that augment cofilin function and alter the mechanism of depolymerization. in fact, whereas cofilin is necessary for actin depolymerization, it does not appear to be sufficient under conditions normally found inside cells, and additional factors appear to be required to help cofilin overcome intracellular obstacles that would otherwise inhibit actin disassembly. cells contain high concentrations of polymerizable actin monomer, which is used to drive fast actin assembly, and depolymerization must occur against this thermodynamic barrier. there is also a stoichiometric problem caused by the high concentration of actin polymer in cells that is in large excess of the depolymerizers. a variety of auxiliary factors have been identified that augment cofilin function, including aip1, coronin, and cap (ono, 2007). the importance of these factors in actin turnover dynamics has been demonstrated in multiple organisms (ono, 2007), and some of them help cofilin to overcome inhibition of disassembly by excess monomer and polymer (brieher., 2006 ; normoyle and brieher, 2012). the key question is whether these auxiliary factors simply accelerate cofilin - mediated severing or alter the mechanism. in many cases the auxiliary factors, 2004 ; ono, 2007 ; moseley., 2006 ; gandhi., 2009 ; normoyle and brieher, 2012 ; chaudhry., in contrast, the combination of cofilin, coronin, and aip1 altered the mechanism of depolymerization to one in which long stretches of actin polymer appeared to disassemble catastrophically in a single step (kueh., 2008). this mechanism has been referred to alternatively as bursting or whole - filament destabilization to reflect either the abruptness of the disassembly event or the possibility that the filament is disassembling under these conditions through every imaginable pathway (severing, pointed - end loss, barbed - end loss, unraveling of the protofilaments). the molecular mechanism underlying whole - filament destabilization is not known, but it is presumably a highly cooperative process. one possibility is that the combination of cofilin and coronin drives highly cooperative cofilin binding to f - actin to create long stretches of polymer coated with cofilin and possibly coronin. these coated segments of polymer are envisioned to be highly unstable in the presence of aip1. the cooperativity is weak (andrianantoandro and pollard, 2006), but it might be strengthened by coronin, which enhances cofilin binding to listeria actin comet tails as well as f - actin in pure solution (brieher., 2006)this, despite the fact that coronin occludes the cofilin - binding site on f - actin (galkin., 2008) and the two proteins compete for binding to the filament (cai., 2007). such stretches of cofilin - coronin laden polymer are then envisioned to be superior substrates for aip1-mediated disassembly. our understanding of the mechanism of disassembly under these conditions is still in its infancy and arguably too murky to justify the names that i helped assign to it. nevertheless, despite what we call it, severing does not suffice to describe filament disassembly in the presence of these three factors, and the triple mixture of cofilin, coronin, and aip1 is the only depolymerization cocktail that we know of that is blocked by cytochalasin d, which is the situation in cells (kueh., 2008). catastrophic disassembly that removes entire filaments in a single step could also account for exponential decay of listeria actin comet tails (kueh., 2010). determining whether this mode of actin disassembly is operating in cells and understanding why cytochalasin d blocks it will require a detailed understanding of the underlying mechanism driving bursting / whole - filament destabilization. the number of auxiliary factors, in conjunction with their potential ability to alter the mechanism of actin depolymerization, could have important consequences for actin - dependent cell biology. cells could conceivably control the activities of the disassembly factors to tune the mechanism of depolymerization to meet physiological demands. whole - filament destabilization, for example, could be advantageous when cells needs to remove an actin array quickly and completely, such as during phagosome maturation (bengtsson., 1993). a severing - dominated regime, on the other hand, could allow cells to deform an actin array without losing much polymer mass. semaphorin 3a, for example, induces neuronal growth cone collapse (fan., 1993). the process requires both cofilin and myosin ii (aizawa., 2001 ; although actin polymer mass is lost upon exposure to semaphorin 3a, some f - actin remains, and myosin ii pulls on it to retract the neurite (gallo, 2006). severing might weaken the array, allowing it to flow more freely in response to myosin ii dependent contractile forces. different auxiliary factors could also be used to selectively control the stability of different actin arrays in cells. the stability of actin within different networks can vary from seconds to hours (zigmond, 1993 ; kueh and mitchison, 2009). how cells manage to simultaneously maintain actin arrays of such varying stabilities in a shared cytosol is not known. selectively stabilizing certain actin arrays with tropomyosin appears to be one mechanism (kuhn and bamburg, 2008). selectively destabilizing different actin arrays with different combinations of cofilin and supplementary factors selective destabilization of a particular actin array might be operating in drosophila nurse cells, in which cap specifically controls the amount of actin that assembles at apical cell cell junctions, whereas cofilin controls the amount of actin throughout the entire cell (baum and perrimon, 2001). the extent to which other disassembly factors help control the amount and stability of f - actin in other actin arrays is an interesting question for the future. identifying which mechanisms of actin depolymerization are operating in cells is the obvious goal, but directly visualizing depolymerization of single filaments in cells is still beyond the resolution of light microscopy. as an alternative, we can analyze actin depolymerization in vitro under defined conditions in greater detail to better distinguish between different mechanisms of disassembly. this information could then be used to help better detect the mechanism of actin depolymerization operating within an actin array in vivo. in the process, we might uncover new roles for actin depolymerization in controlling the morphogenesis of the actin cytoskeleton, with potential consequences for our understanding of actin - dependent processes such as cell motility. | the actin cytoskeleton is constantly assembling and disassembling. cells harness the energy of these turnover dynamics to drive cell motility and organize cytoplasm. although much is known about how cells control actin polymerization, we do not understand how actin filaments depolymerize inside cells. i briefly describe how the combination of imaging actin filament dynamics in cells and using in vitro biochemistry progressively altered our views of actin depolymerization. i describe why i do not think that the prevailing model of actin filament turnover cofilin - mediated actin filament severing can account for actin filament disassembly detected in cells. finally, i speculate that cells might be able to tune the mechanism of actin depolymerization to meet physiological demands and selectively control the stabilities of different actin arrays. |
mice : the inbred mouse rr strain was purchased from riken bioresource center (tsukuba, japan), and the inbred mouse c57bl/6j (hereafter b6) strain was purchased from clea japan inc. (tokyo, japan). to compare nurturing ability and tendency to lose pups between rr and b6 mothers, we performed test crosses reciprocally ; i.e., rr b6 and b6 rr. nurturing ability was evaluated by litter weight, and tendency to lose pups was evaluated by scoring whether or not the mothers lost their f1 pups (for details, see below phenotyping b6 females were crossed with rr males to produce b6 rr f1 mice. f1 females were crossed with rr males to produce (b6 rr) rr backcross (hereafter bc) progeny. all mice were maintained in a specific pathogen - free facility with a regular light cycle and controlled temperature and humidity. all animal experiments were approved by the institutional animal care and use committee of the national institute of agrobiological sciences. phenotyping : throughout the study, we crossed nulliparous bc females, and only data on primiparous females were analyzed. bc mice were weaned at 4 weeks of age. at the age of 810 weeks,, the number of newborn offspring was culled to 6 per dam. when the number of pups was less than 6, pups from other litters with the same birthday were added to constitute 6 pups per dam. the number of surviving pups and the total weight of the surviving pups (litter weight) were scored at 12 days after birth (day 12). nurturing ability was evaluated by litter weight, and tendency to lose pups was evaluated by scoring whether or not the mothers lost their pups. qtl mapping : qtl analysis was conducted using r / qtl [1, 2 ]. threshold logarithm of odds (lod) scores for suggestive (p<0.63) and significant (p<0.05) linkages was determined by performing 1,000 permutations for each trait. for significant qtls, a 95% confidence interval (ci) after single qtl scans, we performed pairwise evaluations for potential interactions between loci. at this stage, we initially genotyped 165 f2 mice with the following 92 microsatellite markers : d1mit211, d1mit236, d1mit303, d1mit49, d1mit217, d1mit33, d1mit36, d1mit291, d2mit312, d2mit297, d2mit274, d2mit285, d3mit60, d3mit25, d3mit230, d3mit254, d3mit162, d4mit235, d4mit214, d4mit178, d4mit327, d4mit306, d4mit279, d4mit69, d4mit232, d5mit267, d5mit184, d5mit259, d5mit240, d5mit95, d5mit221, d6mit116, d6mit188, d6mit149, d6mit14, d7mit340, d7mit76, d7mit246, d7mit228, d7mit232, d7mit250, d7mit253, d7mit12, d8mit191, d8mit248, d8mit211, d8mit113, d9mit90, d9mit191, d9mit107, d9mit196, d9mit212, d10mit188, d10mit42, d10mit297, d11mit229, d11mit86, d11mit219, d11mit212, d11mit124, d12mit109, d12mit201, d12nds2, d13mit139, d13mit110, d13mit230, d13mit35, d14mit11, d14mit64, d14mit193, d14mit165, d15mit175, d15mit63, d15mit159, d15mit193, d16mit131, d16mit4, d16mit139, d16mit71, d17mit16, d17mit139, d17mit93, d17mit123, d18mit21, d18mit149, d18mit123, d19mit40, d19mit53, d19mit35, d19mit6, dxmit64 and dxmit121. the reported genetic map positions were retrieved from the mouse genome informatics database (mgi, http://www.informatics.jax.org). because the locations of three microsatellite marker loci (d5mit267, d13mit110 and d19mit6) were not available, their locations from adjacent markers were calculated on the basis of our own linkage map. binomial test : for bc females that lost their pups, we used a binomial test to assess the statistical significance of a deviation from the expected 1:1 ratio of homozygosity to heterozygosity for the rr allele (rr / rr and rr / b6, respectively) genotypes. the probability (p) that x of the n bc females that lost pups had an rr / rr genotype was calculated using the following binomial formula : under the null hypothesis of no linkage, the probability (p) that bc females that lost their pups have an rr / rr genotype was 0.5. p<0.0001 was considered to indicate significant linkage, and p<0.0034 was considered to indicate suggestive linkage. we also assessed the strength of the linkage on the basis of the bonferroni correction. in this case, because additional 7 microsatellite markers (d9mit144, d9mit303, d9mit289, d9mit263, d9mit343, d16mit165 and d16mit152) were genotyped for the binomial test (giving a total of 99 markers), the significant threshold p value was 0.00051 (0.05/99). nurturing ability and tendency to lose pups between rr and b6 mothers : nurturing ability was apparently inferior in rr mothers, and tendency to lose pups was substantially higher in rr mothers (table 1table 1.comparison of nurturing ability and tendency to lose pups between rr and b6 motherstest crossno. oflittersaverage littersize(range)no. of dams that lost all orsome of f1 pups (no. ofsurviving pupssurvivalrate (%) average litterweight (g)(range)average bodyweight ofsurviving pup (g)damsirerrb6135.6(39)11(10)1316.75.47(034.41)5.47b6rr79.1(712)0(0)4210042.55(37.5649.08)7.09the number of newborn f1 offspring was culled to 6 per dam at the day of parturition. when the number of pups was less than 6, pups from other strain litters with the same birthday were added to constitute 6 pups per dam. the number of surviving pups and the litter weight were scored at day 12. b) pups were supplemented with those from other strains (rr b6 f1, b6, ddd / sgn and/or icr ; ddd / sgn and icr have also been maintained at our facility) in 7 litters.). the number of newborn f1 offspring was culled to 6 per dam at the day of parturition. when the number of pups was less than 6, pups from other strain litters with the same birthday were added to constitute 6 pups per dam. the number of surviving pups and the litter weight were scored at day 12. b) pups were supplemented with those from other strains (rr b6 f1, b6, ddd / sgn and/or icr ; ddd / sgn and icr have also been maintained at our facility) in 7 litters. reproduction in f1 mice : nurturing ability was assessed in 20 (b6 rr) f1 females. twenty f1 females gave rise to 169 pups, yielding an average litter size of 8.45 (range 312). in the f1 study, we did not cull pups, irrespective of litter size, and all pups were successfully weaned in all litters. the tendency to lose pups therefore, we used bc females of a cross of (b6 rr) f1 rr for subsequent analyses. qtl mapping analyses in bc mice : among 255 litters, litter weight was not determined for 33. overall, 13 of 255 bc females lost all pups, and whether bc females lost their entire litter or not was included as the covariate pl1 (bc females that lost pups were labeled as 1, whereas those that did not were labeled as 0). similarly, 36 of 255 bc females lost all or some of their pups, and this was included as the covariate pl2. three of the 255 dams did not have any living pups, and 13 of the 255 dams lost all their pups ; thus, litter weights of these 16 were 0 g (fig. solid and broken lines indicate the results obtained using nonparametric and parametric methods, respectively. for the parametric method, pl1 was included as an additive covariate. the horizontal dashed lines indicate the significant threshold lod scores as determined by 1,000 permutations. threshold lod scores for significant and suggestive linkages were 2.42 and 1.31 for autosomes and 2.45 and 1.37 for the x chromosome, respectively. we identified one significant qtl on chromosome 4 and 3 suggestive qtls on chromosomes 7, 9 and 17 (table 2table 2.identification of qtls for prolificacy - associated traitstraitchromosomelocation95% cimax lodnearest markerhigh allelenamelitter weight45127734.27d4mit306b6naq2793821.65d7mit76b693618571.98d9mit107b6171818561.61d17mit16b6pl1162512402.47d16mit4rrpl24494781.35d4mit306rr93818571.56d9mit107rr16256481.82d16mit4rra) pl1 (whether bc females lost their entire litter or not) and pl2 (whether bc females lost all or some of their pups) were analyzed not only as the covariate but also as independent binary traits. b) location indicates a chromosomal position showing a peak lod score in cm. f) assignment of the qtl name is limited to significant qtls. and fig. at all loci, the rr allele was associated with lower litter weight (fig. we named the significant qtl on chromosome 4 naq2 (nurturing ability qtl 2). when the parametric method was applied, no significant qtls were identified (data not shown). however, when pl1 was included as an additive covariate, one significant qtl was again identified on chromosome 4 (fig. solid and broken lines indicate the results obtained using nonparametric and parametric methods, respectively. for the parametric method, pl1 was included as an additive covariate. the horizontal dashed lines indicate the significant threshold lod scores as determined by 1,000 permutations. threshold lod scores for significant and suggestive linkages were 2.42 and 1.31 for autosomes and 2.45 and 1.37 for the x chromosome, respectively. a) pl1 (whether bc females lost their entire litter or not) and pl2 (whether bc females lost all or some of their pups) were analyzed not only as the covariate but also as independent binary traits. b) location indicates a chromosomal position showing a peak lod score in cm. we analyzed pl1 and pl2 as binary traits and identified one suggestive qtl for pl1 on chromosome 16 and 3 suggestive qtls for pl2 on chromosomes 4, 9 and 16 (table 2 and fig. 2afig. (a) genome - wide lod score plots for pl1 (blue lines) and pl2 (red lines). horizontal dashed lines indicate the suggestive threshold lod scores as determined by 1,000 permutations. for pl1, threshold lod scores for significant and suggestive linkages were 2.78 and 1.49 for autosomes and 2.92 and 1.59 for the x chromosome, respectively. for pl2, threshold lod scores for significant and suggestive linkages were 2.63 and 1.34 for autosomes and 2.78 and 1.44 for the x chromosome, respectively. (b) plots of percentages of mice homozygous for rr alleles at each locus among 99 microsatellite marker loci. blue and red lines are plots for pl1 and pl2, respectively.). because 13 of the 255 dams lost their entire litter (pl1) and 36 of the 255 dams lost part of or entire litter (pl2), we next analyzed these small fractions of mice by binomial tests. after genotyping 7 additional microsatellite markers (d9mit144, d9mit303, d9mit289, d9mit263, d9mit343, d16mit165 and d16mit152), we evaluated the percentage of mice that were homozygous for the rr allele. we observed that a locus on chromosome 16 near d16mit4 showed evidence of an association with regard to pl1 (fig. overall, 12 of 13 (92.3%) mice were homozygous for the rr allele at this locus. although the percentage was very high (p=0.0016), the association was not significant ; however, it was suggestive when the genome - wide threshold was applied. finally, we investigated whether or not d16mit4 had effects on litter weight. although the rr allele was associated with lower litter weight (mean se litter weight in rr / rr and rr / b6 was 34.99 1.32 g and 37.97 1.07 g, respectively), the difference was not significant. (a) genome - wide lod score plots for pl1 (blue lines) and pl2 (red lines). horizontal dashed lines indicate the suggestive threshold lod scores as determined by 1,000 permutations. for pl1, threshold lod scores for significant and suggestive linkages were 2.78 and 1.49 for autosomes and 2.92 and 1.59 for the x chromosome, respectively. for pl2, threshold lod scores for significant and suggestive linkages were 2.63 and 1.34 for autosomes and 2.78 and 1.44 for the x chromosome, respectively. (b) plots of percentages of mice homozygous for rr alleles at each locus among 99 microsatellite marker loci. because the results of reciprocal test crosses strongly suggested that the low survival rate of rr pups was attributable to the defects in mothers rather than to those in pups, we examined the low survival rate of rr pups by analyzing the following : (1) inferior nurturing ability of rr mothers based on the litter weight of surviving pups and (2) tendency to lose pups by scoring whether or not rr mother lost their pups. on the basis of the analysis of inferior nurturing ability, we identified one significant qtl on chromosome 4 (naq2) and three suggestive qtls on chromosomes 7, 9 and 17. using a similar analysis, we had previously identified one significant and one suggestive qtl for litter weight on chromosomes 5 (naq1) and 9 in kk rr f2 mice [10, 11 ]. naq1 and naq2 are suggested to be related to lactational yield, because the total weight of 6 pups at 12 days after birth has been known to reflect maternal lactational yield [3, 6, 7 ]. it was important to note that the rr allele was associated with lower litter weight in all qtls. although significant qtls for litter weight differed between the two studies, we considered this to be due to the fact that a different counterpart strain was used in the two analyses. on the other hand, on the basis of the analysis of tendency to lose pups, we identified suggestive qtls on chromosomes 4, 9 and 16. it was again important to note that the rr allele was associated with an increased tendency to lose pups at all qtls. of these qtls, those on chromosomes 4 and 9 may be allelic with those identified in the analysis of inferior nurturing ability according to their chromosomal locations. therefore, naq2 on chromosome 4 had significant and suggestive effects on litter weight and tendency of losing pups, respectively. we submitted the term abnormal maternal nurturing as a query to the mgi database, which then retrieved 161 genotypes with 188 annotations. of 8 gene loci that were located on chromosome 4, 4 gene loci (ambp, khdrbs1, vc and whrn) were located within 95% ci for naq2 as candidate genes (table 3table 3.candidate genes for naq2 on chromosome 4gene / locuslocationreferencesymbolnamecmmbpvcvacillanssyntenic57.19mgiambpalpha 1 microglobulin / bikunin33.9663.14whrnwhirlin33.9763.41mgikhdrbs1kh domain containing, rna binding, signal transduction associated 163.34129.70data are retrieved from mgi (december 16, 2014). candidate genes within 95% ci for naq2 are sorted in the order of chromosomal location.). of these candidates, 2 genes, i.e., vc and whrn, were unlikely to be causative of naq2, because homozygous mutants also displayed behavioral abnormalities, including tremors and swaying gait (vc), and circling and head - shaking (whrn). ambp - deficient males are fully fertile ; however, mutant females show severe infertility. ambp - deficient females normally copulate with males, although more than half of these individuals do not become pregnant. although some ambp - deficient females produce young, litter size was very small (1.6 in average). the neonatal pups usually die within 2 days after birth when fostered by homozygous mutant (ambp) mothers ; however, these survive when fostered by heterozygous mutant (ambp) mothers. in contrast to the ambp - deficient females, most of the rr females become pregnant after copulation. the rr mothers predominantly tend to lose their pups ; the time of pup loss considerably varies among litters. on the other hand, khdrbs1-deficient females rarely provide adequate care to their young, and many of khdrbs1 pups die at birth because of unknown causes. based on these findings, khdrbs1 mutants resemble the rr mice. however, one conclusive difference between the khdrbs1 mutants and rr mice is that the males of the former strain were sterile (rr strain males are fully fertile). thus, both ambp and khdrbs1 were unlikely to be causative of naq2. candidate genes within 95% ci for naq2 are sorted in the order of chromosomal location. although the association was not significant, the suggestive association of chromosome 16 with pl1 was noteworthy. according to this sample size, a significant association was accomplished only when all 13 mice were homozygous for the rr allele. when statistical evaluation was confined to the portion of chromosome 16 that was identified to contain suggestive qtls for both pl1 and pl2 by the preceding genome - wide qtl scan, the association was significant. thus, we expect that there would be a locus concerning the tendency to lose pups on chromosome 16. in contrast to naq2 on chromosome 4, the locus on chromosome 16 had a suggestive effect only on the tendency to lose pups. taken together, these results support our hypothesis that the low survival rate phenotype was attributable, at least in part, to the phenotypes of inferior nurturing ability and tendency to lose pups. | newborn offspring of the inbred mouse rr / sgn strain have a low survival rate prior to weaning. we hypothesized that this is a consequence of an inferior nurturing ability of rr / sgn mothers and that rr / sgn mothers have a tendency to lose their pups. we performed quantitative trait locus (qtl) mapping for inferior nurturing ability and tendency to lose pups in rr / sgn mothers. the number of pups was adjusted to 6 per dam on the day of delivery, and the number of surviving pups and their total weight (litter weight) were scored at 12 days after birth. nurturing ability was evaluated by litter weight, and tendency to lose pups was evaluated by scoring whether or not the mothers lost their pups. for litter weight, we identified one significant qtl on chromosome 4 and three suggestive qtls on chromosomes 7, 9 and 17. the rr / sgn allele was associated with lower litter weight at all loci. for the tendency to lose pups, we identified three suggestive qtls on chromosomes 4, 9 and 16. the rr / sgn allele was associated with an increased tendency to lose pups at all loci. these results supported our hypothesis that the low survival rate phenotype was attributable, at least in part, to a phenotype whereby mothers display inferior nurturing ability and a tendency to lose pups. thus, it suggests that these two traits share genetic basis. |
several studies have illustrated that lower urinary tract symptoms (luts) are related to depression [1 - 3 ]. several studies have also shown that a significant correlation exists between incontinence, nocturia, and depression [4 - 8 ]. a recent study showed that overactive bladder (oab) symptoms can also aggravate anxiety and depressive symptoms [9 - 12 ]. however, there has been little study of which specific urinary symptoms are more likely to be associated with depression among the various voiding and storage symptoms. previously, we reported an association of depression with luts in a korean population - based study. the aim of this study was to evaluate which specific urinary symptoms are more likely to be associated with depression in the korean population. the data for this study were derived from the korean longitudinal study on health and aging (klosha). the detailed procedure was described in a prior article. among 992 participants, 392 men completed urological and psychiatric evaluations and did not meet the following exclusion criteria : prostate - specific antigen (psa) level 10 ng / ml, pyuria, prostate cancer, and history of prostate surgery. the study protocol was approved by the institutional review board of seoul national university bundang hospital (snubh). within 2 weeks of the initial contact the korean version of the international prostate symptom score (ipss) was administered to male respondents to evaluate urinary symptoms. the ipss consists of a total of seven questions that deal with voiding symptoms (incomplete emptying, intermittency, weak stream, and straining to void) and storage symptoms (frequency, urgency, and nocturia). the ipss voiding subscore was the sum of question 1 (incomplete emptying), question 3 (intermittency), question 5 (weak stream), and question 6 (straining to void). the ipss storage subscore was the sum of question 2 (frequency), question 4 (urgency), and question 7 (nocturia). subjects with an ipss subscore of more than 3 points were considered to have a high ipss subscore. prostate volumes were calculated by using transrectal ultrasonography, and serum prostate - specific antigen levels were determined by using an immunoradioassay. all respondents were administered the korean version of the mini international neuropsychiatric interview to diagnose depression. to evaluate depression, researchers used questionnaires, including the revised korean version of the geriatric depression scale, the korean version of the center for epidemiologic studies depression scale, and the 17-item hamilton depression rating scale. depression diagnoses were made by a panel of 4 neuropsychiatrists according to the dsm - iv on the basis of the data collected through the questionnaires. the subjects were divided into two groups according to the presence of depression : the depression group and the euthymic group, who did not have depression. the total ipss, ipss voiding subscore, ipss storage subscore, and scores on each question were compared between the subjects with depression (depression group) and those without depression (euthymic group) and the relationship between depression and luts severity was assessed. we compared the clinical variables between the subjects with depression (depression group) and those without depression (euthymic group) by using student t - tests. chi - square analysis was used for categorical variables, and variables in the univariate analysis with p<0.05 were included in the multivariate analysis. multiple logistic regression analyses were conducted to estimate the odds ratio with a 95% confidence interval for high ipss subscore and presence of depression. statistical analyses were conducted by using spss ver. 17.0 (spss inc., chicago, il, usa), and p - values of < 0.05 were considered significant. the data for this study were derived from the korean longitudinal study on health and aging (klosha). the detailed procedure was described in a prior article. among 992 participants, 392 men completed urological and psychiatric evaluations and did not meet the following exclusion criteria : prostate - specific antigen (psa) level 10 ng / ml, pyuria, prostate cancer, and history of prostate surgery. the study protocol was approved by the institutional review board of seoul national university bundang hospital (snubh). within 2 weeks of the initial contact, an extensive interview was administered to each subject. the korean version of the international prostate symptom score (ipss) was administered to male respondents to evaluate urinary symptoms. the ipss consists of a total of seven questions that deal with voiding symptoms (incomplete emptying, intermittency, weak stream, and straining to void) and storage symptoms (frequency, urgency, and nocturia). the ipss voiding subscore was the sum of question 1 (incomplete emptying), question 3 (intermittency), question 5 (weak stream), and question 6 (straining to void). the ipss storage subscore was the sum of question 2 (frequency), question 4 (urgency), and question 7 (nocturia). subjects with an ipss subscore of more than 3 points were considered to have a high ipss subscore. prostate volumes were calculated by using transrectal ultrasonography, and serum prostate - specific antigen levels were determined by using an immunoradioassay. all respondents were administered the korean version of the mini international neuropsychiatric interview to diagnose depression. to evaluate depression, researchers used questionnaires, including the revised korean version of the geriatric depression scale, the korean version of the center for epidemiologic studies depression scale, and the 17-item hamilton depression rating scale. depression diagnoses were made by a panel of 4 neuropsychiatrists according to the dsm - iv on the basis of the data collected through the questionnaires. the subjects were divided into two groups according to the presence of depression : the depression group and the euthymic group, who did not have depression. the total ipss, ipss voiding subscore, ipss storage subscore, and scores on each question were compared between the subjects with depression (depression group) and those without depression (euthymic group) and the relationship between depression and luts severity was assessed. we compared the clinical variables between the subjects with depression (depression group) and those without depression (euthymic group) by using student t - tests. chi - square analysis was used for categorical variables, and variables in the univariate analysis with p<0.05 were included in the multivariate analysis. multiple logistic regression analyses were conducted to estimate the odds ratio with a 95% confidence interval for high ipss subscore and presence of depression. statistical analyses were conducted by using spss ver. 17.0 (spss inc., chicago, il, usa), and p - values of < 0.05 were considered significant. the mean age of the subjects was 75 years, and 6.4% of the subjects were diagnosed as having major depressive disorders. there were no statistically significant differences in prostate volume, serum psa level, or the prevalence of comorbidities such as diabetes or hypertension between the depression group and the euthymic group. the depression group showed higher total ipsss than did the euthymic group (16.19.9 vs. 11.68.6, p=0.01). the ipss voiding subscore and the ipss storage subscore were also higher in the depression group (table 1). among the 7 questions on the ipss questionnaire, ipss subscores for question 1 (incomplete emptying), question 3 (intermittency), question 4 (urgency), and question 6 (straining to void) were higher in the depression group than in the euthymic group (fig. chi - square tests showed that high scores on ipss questions 1, 3, 4, and 6 were associated with depression, but the multivariate analysis identified only a high score on ipss question 4 (urgency) as a significant prognostic factor for depression. subjects who had a high urgency ipss had a 1.33 increased odds of having major depressive disorders compared with those with low or no urgency symptoms (p=0.01) (table 2). depressive disorders are a very common group of diseases, with an overall prevalence of 2% to 17.1% [14 - 16 ]. depression can have a severe impact on overall health and plays an important role in the pathogenesis of many chronic diseases, such as chronic obstructive pulmonary disease, inflammatory bowel disease, arthritis, asthma, diabetes, and congestive heart failure [17 - 25 ]. this relationship also exists between depression and many urological symptoms, such as urinary incontinence and other luts. wong. showed a significant association between moderate - to - severe luts and clinically relevant depressive disorders in a large study that included 1980 men aged 65 to 92 years. investigated luts and depression in a homogeneous cohort of 673 healthy men and reported a significant effect of ipss on depression measured by use of the beck depression inventory score. we reported similar results in the previous klosha study, in which depression was associated with a 5.8-fold increased odds of having moderate to severe luts. although several studies have shown an association of luts and depression, there are few studies regarding the effects of subcategories of luts, such as nocturia and urgency, on depression. nocturia was reported to be strongly associated with depression in some studies [7,27 - 29 ]. in one study, conversely, johnson. reported that patients with 5 or more episodes of nocturia per night experienced a 6.5-fold increased risk of depression compared with patients without nocturia. recent study results from epiluts showed that men and women with oab were more likely to have worse scores on anxiety and depression assessments. in the present study, to investigate the effect of subcategories of luts, we used the ipss questionnaire and analyzed the effect of ipss subscores on depression. although both storage and voiding symptoms, including incomplete emptying, intermittency, urgency, and straining to void, were higher in the depression group a 1-point increase in urgency score was associated with 1.33 increased odds of having major depressive disorders. the association between urgency and depression could be attributable to several different mechanisms. obviously, moderate and severe oab decrease quality of life in many ways and urgency is the key symptom of oab. quality of life is sometimes decreased to such an extent that a patient can develop depressive moods. although there is no question item on the ipss questionnaire that addresses urgency incontinence, the urgency subscore can represent the oab status in the population. a limitation of this study is that the data were cross - sectional and do not provide information regarding the temporal cause - effect relationship between urgency symptoms and depression. more specific questionnaires evaluating oab symptoms would be more informative for revealing the relationship of oab symptoms and depression. also, the cause of depression that would be related to luts was not analyzed. finally, the small number of subjects in the depression group and interactions between factors, such as answers on the questionnaire, are limitations of this study, especially in the statistical analysis. the prevalence of depression was not so high that a larger study population will be needed to prove the definite correlation of urgency and depression. despite these limitations, it is meaningful that this study showed a relationship of urgency and depression in a population - based study. our population - based study showed that older men with depression are more likely to have more severe luts than a population without depression. among the various urinary symptoms, patients who have moderate to severe luts and especially urgency may need an evaluation of their mental health status. | purposeto evaluate the association of a specific type of lower urinary tract symptom (luts) and the depression in community - dwelling elderly korean men.materials and methodsa total of 392 men aged 65 years or older, who completed urological and psychiatric evaluations as a participant of the korean longitudinal study on health and aging, were included. from each subject, an interview on the demographic characteristics and medical history, ipss, and psychiatric questionnaire were taken. subjects were divided into two groups ; depression and euthymic. subjects with ipss subscore more than 3 points was considered ' high ' subscore. ipss subscores were compared between the two groups, and the relationship between depression and luts severity was assessed.resultsthe mean age of the subjects was 75, and 6.4% of the subjects were diagnosed to have major depressive disorders. the depression group showed higher ipss scores than the euthymic group (16.19.9 vs. 11.68.6, p=0.01). ipss subscores of question 1 (incomplete empty), question 3 (intermittency), question 4 (urgency) and question 6 (straining to void) were higher in the depression group compared with the euthymic group. chi - square test revealed subjects with high ipss 1, 3, 4, and 6 score were associated with depression, but multivariate analysis identified only high ipss question 4 as a significant prognostic factor for depression.conclusionselderly population with depression is more likely to have more severe luts than population without depression. among the urinary symptoms, urgency was strongly associated with depression. patients with moderate to severe luts and especially urgency may need their mental health status evaluation. |
sinus lift surgery is recommended in maxillary edentulous region when the remaining available bone is inadequate as consequence of maxillary sinus pneumatization. other uses have been explained for this technique for outpatient posterior maxillary segmental orthognathic surgery and orthodontic purposes. bone suture consists of creating a hole in the bone for the purpose of anchoring soft tissues to the bone. creating bone holes in lateral maxillary sinus wall above the antrostomy window for fixing torn schneiderian membrane is a known indication for bone suture technique [figure 1 ]. elevating schneiderian membrane from the medial maxillary sinus wall and securing it to the bone hole above the antrostomy window securing the buccal fat pad (bfp) to the periphery of the antrostomy window for better nourishment of the grafted material in maxillary sinus and as an alternative to bone tags for fixation of collagen membrane are the other applications. a new indication for firmly anchoring the bfp to the medial maxillary sinus wall as the last resort for the management of perforated schneiderian membrane is explained in this article. the patient was 62-year - old male who had decided to replace his lost teeth in the jaws with fixed dental implants. during the lateral sinus lift surgery, a large perforation occurred that was not amenable to local application of collagen membrane. the bfp was brought out through a 1-cm incision behind the maxillary buttress and was firmly attached to the medial wall with the aid of the bone suture. the biomaterial (dfdba : cenobone, hamanand saz baft, kish, iran) was added beneath that, between bfp and maxillary sinus floor. six months after lateral sinus lift surgery, two dental fixtures (biohorizons : birmengam, usa) were inserted. (a) buccal fat pad () is fixed to the palate by means of bone suture ; (b) schematic representation ; (c) cone - beam computed tomography taken 1-month after the operation shows the ability of the flap to retain the biomaterial between the flap and maxillary sinus floor ; (d) postoperative photograph 1-year after prosthetic replacement using bfp as the last resort for managing perforated schneiderian membrane is increasing today. suturing this flap to the remaining schneiderian membrane is difficult and has the risk of suture release through the delicate thin schneiderian membrane. firmly securing the bfp to the medial maxillary sinus wall has the benefit of isolating the graft / biomaterial from maxillary sinus and participating in graft nourishment. we do every effort to complete the procedure in the first sinus lift surgery because stopping the procedure and re - entry to the surgical field in another session is associated with a great failure rate in our hands. lateral sinus lift is a modified form of caldwell - luc surgery in which the integrity of maxillary sinus membrane is preserved. when the schneiderian membrane is torn and the surgeon decide to stop the procedure and doing another attempt several month later, then the clinician is confronted with previously operated sinus with established increased risk of complications. bone suture in the medial maxillary sinus wall is a useful aid in managing large perforated schneiderian membrane, with the aid of the bfp. | bone suture in lateral sinus lift has four indications. three of them depend on creating a hole in the lateral maxillary sinus wall above the antrostomy window for securing the elevated medial maxillary sinus membrane to manage perforated schneiderian membrane. covering the buccal antrostomy window with the buccal fat pad (bfp) for better nourishment of the inserted graft and as an alternative for bone tags in fixation of collagen membrane has been reported previously. a new indication for firmly anchoring the bfp to the medial maxillary sinus wall as the last resort for the management of perforated schneiderian membrane is explained in this article. |
normal aging is associated with declining sensorimotor control and cognitive functions which may result from changes in the cortex - basal ganglia circuits involved in planning, initiation, and control of voluntary movements. along with a gradual partial atrophy of the basal ganglia with advanced aging human brain imaging studies revealed age - related alterations in the basal ganglia - neocortex connectivity at rest and during execution of motor tasks [13 ]. functional organization and rearrangement of networks involved in learning and execution of motor skills is thought to be associated with long - term changes in corticostriatal neurotransmission [46 ]. two major forms of synaptic plasticity, long - term depression (ltd) and long - term potentiation (ltp) of corticostriatal neurotransmission, have been shown in the rodent striatum [4, 7 ]. as a primary input structure of the basal ganglia the striatum receives cortical information through topographically organized glutamatergic projections to its principal medium size spiny neurons which integrate and transfer it to the output structures under control of dopaminergic input from the substantia nigra and striatal cholinergic and nitrergic interneurons. this interaction of dopamine, acetylcholine, and nitric oxide neurotransmitter systems determines whether corticostriatal transmission is amplified (ltp) or dampened (ltd) following repetitive activation. although numerous neurochemical and pharmacological studies have reported alterations in all major striatal neurotransmitter systems with aging [913 ], only a few analysed alterations in corticostriatal synaptic plasticity in animal models of normal aging showing an age - related decrease in short - term plasticity and some deficit in two different forms of long - term plasticity associated with activation of n - methyl - d - aspartate- (nmda-) type glutamate receptors (nmdar) [14, 15 ]. one of the key modulators of striatal neuronal activity is nitric oxide (no) whose production by striatal nitrergic interneurons is stimulated by activation of glutamatergic corticostriatal and dopaminergic nigrostriatal pathways through nmdar and d1-like dopamine receptors (d1r). no regulates, through its physiological receptor soluble guanylate cyclase (sgc), producing cyclic guanosyl monophosphate (cgmp), short- and long - term plasticity at corticostriatal synapses in medium spiny neurons [1720 ]. aging is associated with considerable reduction in the number of striatal neurons containing no synthase [21, 22 ] suggesting a significant decrease in no production and corresponding alterations in no - dependent processes. in fact, the data on age - related changes in the striatal no synthase (nos) activity and in no - cgmp - protein kinase g (pkg) signaling are controversial [2325 ]. the aim of the present study was to investigate age - related alterations in the expression of genes involved in no signaling and to explore the manifestation of several forms of no - dependent plasticity in the dorsal striatum of mice at four different ages. we found that striatal tissue from old (18 months) mice is characterized by decreased expression of major genes involved in no production, namely, genes encoding for the essential nr1 subunit of the nmdar, d1r, and neuronal nos (nnos). analysis of no - dependent plasticity of corticostriatal neurotransmission revealed that aging is associated with alterations in the expression of electrically induced ltp and ltd and with a significant decrease in long - term depression of responsiveness after pharmacological activation of group i metabotropic glutamate receptors (group i mglur) with (s)-3,5-dihydroxyphenylglycine (dhpg - ltd). pharmacological inhibition of cgmp degradation recovered dhpg - ltd suggesting the impaired no - cgmp signaling as a cause of its age - related deficit. male gfp - gfap transgenic mice at the age from 2 to 24 months were used. green fluorescent protein (gfp) integrated in the mouse genome under control of the gfap promoter has the ability to fluoresce when irradiated by ultraviolet light and its simultaneous expression with gfap allows the visualization of astrocytes in the mouse brain. transgenic mice fvb / n - tg(gfapgfp)14 mes / j (details on genotype can be found in) purchased from jackson laboratories (stock # 003257, jaxmice, us) were bred and aged in our facility. male mice were kept in groups (26 animals per cage) on a 12 h day-12 h night light schedule with ad libitum access to food and water. four age groups were selected for the analysis : group i (2 - 3 months old), group ii (6 - 7 months old), group iii (12 - 13 months old), and group iv (1824 months old). all procedures were in compliance with german law and were approved by the university of dusseldorf authorities. horizontal brain slices containing striatum and hippocampus (400 m, figure 1(a)) were prepared with a vibratome (campden instruments, uk) from the brain immersed in an ice - cold modified artificial cerebrospinal fluid (acsf) with complete sucrose substitution for nacl and collected in a glass dish filled with the same solution. one half of them were immediately treated for further histology and gene expression analysis while another half was transferred to a store glass with a standard acsf containing (in mm) 125 nacl, 1.8 kcl, 1.2 kh2po4, 2.4 cacl2, 1.2 mgcl2, 26 nahco3, and 10 d - glucose, constantly saturated with 95% o2/5% co2 gas mixture (ph 7.4) and after at least 2 h preincubation at room temperature was used for electrophysiological experiments. after fixation and cryopreservation (1 h in 20% sucrose) slices were cryosectioned at 25 m thickness, mounted on gelatin - coated slides, dried, and covered with aqua poly / mount (polysciences inc., the middle portion of each section (the analyzed area seen in figure 1(a)) was photographed on conventional fluorescence or confocal microscopes (lsm meta 510, zeiss, germany). fluorescent gfp - expressing cells were counted from photographs within 300 m square fields, if their soma was in focus and the intensity of fluorescence clearly exceeded the background level. cell counts were obtained by averaging the counts from 410 sections (1 - 2 randomly selected fields per section) taken from each animal. between - group comparison striatal tissue was isolated from 13 slices and total cellular mrna was extracted using an mrna isolation kit (quickprep micro mrna purification kit, ge healthcare, gb). the pcr array (pamm-062z, sa bioscience) was used to detect age - related alterations in gene expression. in this array 84 wells are filled with pcr primers for the genes involved in no signaling, oxidative stress, and antioxidant defence (see supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/458123, for the whole list of the genes) (a1-g12 samples). seven wells are used to test nontranscribed genomic dna contamination and pcr performance (h06h12) and 5 wells contain primers for housekeeping genes (h01h05) : beta - actin, actb ; beta-2-microglobulin, b2 m ; glyceraldehyde-3-phosphate dehydrogenase, gapdh ; heat - shock protein 90, hsp90 ; and glucuronidase beta, gusb. to determine the most appropriate reference gene among them we used criteria described previously [28, 29 ]. as actb showed the smallest difference between young (3 months) and old groups (18 months) and the highest p value in student 's t - test applied to individual 2 values, all real - time pcr reactions were normalized to actb. one gene array was run without cdna and served as negative control to determine the primer melting temperature (tm). amplified gene products consistently showing primer artefacts in their dna melting curve, a tm lower than 75c, or double peaks in the dna denaturation curve were excluded from the list of analyzed genes. among those were the following : epx, gpx2, gpx5, hmgb1, idh1, noxa1, and txnrd2 (for the full names see supplementary table 1). the genes whose expression was significantly age - dependent according to the pcr array were further explored with conventional real - time rt - pcr. additionally, we analyzed the expression of genes encoding dopamine receptors, group i mglurs, the endocannabinoid receptor cb1, involved in corticostriatal plasticity, as well as the expression of genes associated with redox and immune status (see supplementary table 2). for the reverse transcription 8 l of purified mrna was added to 7 l of the first strand cdna synthesis kit (ge healthcare, gb) reaction mix. after incubation for 1 hour at 37c the reverse transcription was stopped by freezing at 20c. the rt - pcr was performed in an applied biosystems stepone real - time pcr machine using the sybr green master mix kit (applied biosystems). reactions were performed in microamp optical 96-well plates in a total volume of 10 l comprising the final concentration of sybr green pcr master mix, cdna (100150 ng), and primers. the following thermal protocol was used : initial incubation at 50c for 2 min to activate uracil n - glycosylase, 10 min at 95c to inactivate the uracil n - glycosylase and activate the amplitaq gold polymerase, and finally 40 cycles of 15 s at 95c, 2 min at 50c, and 1 min at 60c. for the conventional real - time rt - pcr 10 to 50 pm forward and reverse primers (for sequences see supplementary table 2) were used. representative conventional rt - pcr products were purified in water and sequenced (known sequences to which they showed 100% identity with genbank are given in supplementary table 2). standard curves for real - time pcr protocols were obtained for each primer pair. values for r (linear regression coefficient) and e (efficiency) were found suitable for the relative quantification of gene expression and are provided in supplementary table 2. relative mrna level encoding each gene was estimated by the 2 method as described previously, where ct = ct target gene- ct actb. average 2 values for the young group were taken as 100% and the individual values for other age groups were expressed as percentage of this value. after at least 2 h preincubation at room temperature a single slice was transferred to a submersion - type recording chamber where it was continuously perfused with a standard acsf at a flow rate of 1.52 ml / min at 32c. a bipolar nickel - chrome stimulation electrode was positioned on the subcortical white matter at the border between cortex and striatum (figure 1(b)). corticostriatal field potentials were recorded with low - resistance (24 mom) acsf - filled micropipettes positioned within the striatum at a distance up to 0.3 mm from the stimulation electrode. after the initial testing of stimulus - response relationships, the stimulus intensity was adjusted to induce a postsynaptic peak response of about 50%60% of its maximal value and stimulation frequency was set to 0.033 hz. each experiment included a 1520 min period of control recording, application of high - frequency electrical stimulation (hfs) or chemical stimulus, and 60-min monitoring of poststimulus alterations in responsiveness. hfs consisted of 4 trains of 100 stimuli at 100 hz with 10 sec intertrain intervals. the chemical stimuli were 10-min perfusion with 100 m s- 3,5,-dihydroxyphenylglycine (dhpg) or 1015 min perfusion with phosphodiesterase inhibitor, zaprinast or rolipram. dhpg was purchased from abcam (germany) and zaprinast and rolipram were purchased from sigma. the drugs were prepared as stock solutions, stored in aliquots at 20c, and defrozen and diluted by acsf before application. signals were amplified, digitized at 10 khz, stored on a hard disk of a pc using clampex software of pclamp (axon instruments), and analyzed offline, using clampfit and excel software. the averaged postsynaptic peak response was measured as an average of its minimum (from the early positive peak to the peak negativity) and maximum (from the peak negativity to the late positivity peak) values. all measurements were normalized to baseline (the mean value for a 1520 min period before conditioning stimulus) and plotted against time. the presence of long - term alterations of corticostriatal neurotransmission after hfs was determined by a persistent deflection of the peak amplitude by 15% from baseline, and the magnitude of ltd or ltp was calculated from the data points acquired during the last 20 min of recording. changes in responsiveness induced by chemical stimuli were evaluated by comparing the response values averaged through the first and the last 20-min periods of poststimulus recordings with the baseline. the data were statistically analysed using graphpad prism 5 software and are presented as mean sem with n indicating the number of slices per group (each group included slices from at least 4 animals). gene expression data were analysed using one - way analysis of variance (anova) with the dunnett 's posttest and mann - whitney u test. between - group comparisons of electrophysiological data were performed using one - way and two - way anova with the dunnett and bonferroni posttests. paired t - test and wilcoxon chi - square test and fisher 's exact probability tests were used for the analysis of ltd / ltp distribution. old age is associated with astrogliosis, low - grade inflammation, and oxidative stress in the brain [3133 ]. as the life span of fvb mice, the genetic background for generation of gfp - gfap mice, varies within 1.52 years, transgenic mice at the age of 18 months may be classified as old animals. to substantiate this classification we compared the expression of glial, oxidative stress and inflammation markers in striatal tissue of 2 - 3-month - old (group i) and 1820-month - old mice (group iv), referred to as young and old mice. semiquantitative rt - pcr analysis revealed significant upregulation of the striatal level of gfap mrna in old mice (figure 1(c)). according to rt - pcr analysis the striatum of old mice showed also significantly higher transcript levels for some other glial markers. thus the level of the mrna encoding for the s100 in old striatum (134 10%, n = 12) exceeded significantly (p 0.05). comparative analysis of ltd and ltp magnitudes showed that both ltd and ltp were expressed at the highest levels in group ii mice (figure 4, table 2). the slices from aged mice (groups iii and iv) displayed a difference from younger slices in the time course of ltd : in the striatum of group i and ii mice hfs - induced depression manifested itself within several minutes after the conditioning stimulus and persisted at a relatively constant level to the end of the 60-min observation period (figures 4(a) and 4(b)), whereas the comparable level of depression in the slices from older mice arose only gradually (figures 4(c) and 4(d)), and ltd was often preceded by a transient potentiation, which seemingly impeded the manifestation of ltd. unexpectedly, striatal slices from group ii and iii mice showed considerably enhanced ltp as follows : a significantly increased ltp magnitude was accompanied by a noticeable, though not statistically significant, increase in its occurrence. in the slices from old mice (group iv), the ltp magnitude and occurrence decreased compared to middle - aged groups (figure 4, table 2), but still remained at a level higher than in the young striatum. thus, normal aging was accompanied by alterations in the expression and dynamics of electrically induced corticostriatal synaptic plasticity with only insignificant shifts in the ltd / ltp balance. bath application of 100 m dhpg to the striatal slices from young mice (n = 8) reduced corticostriatal field responses to 82 2% by the end of a 10-min perfusion and this depression became even more pronounced towards the end of the observation period (64 4% of baseline at 4560 min after dhpg) (figures 5(a) and 5(b)). in the three other age groups dhpg evoked no initial depression and much less pronounced ltd than in young slices (figures 5(a) and 5(b)). the magnitude of dhpg - ltd in groups ii (n = 8), iii (n = 9), and iv (n = 8) constituted 83 2%, 85 3%, and 83 3% of baseline, respectively (p < 0.05 with baseline, p < 0.001 with the young value). thus, both the initial depression and dhpg - ltd underwent robust reduction already at 6 - 7 months of age and were not significantly modified with further aging. age - related variability in the expression of dhpg - ltd and electrically induced plasticity may be caused by functional alterations in intracellular signaling cascades. since dhpg - ltd in young striatum critically depends on no and cgmp synthesis, its impairment may be caused by some functional alterations in the no - scg - pkg signaling cascade. in turn, functional alterations in d1r - adenylate cyclase - camp - protein kinase a (pka) signaling may underlie alterations in hfs - ltp. in the next set of experiments we used specific phosphodiesterase inhibitors to assess the age - related differences in the effects of intracellular accumulation of cgmp and camp on corticostriatal neurotransmission. short perfusion of striatal slices with zaprinast (zprn, 40 m), an inhibitor of cgmp - degrading phosphodiesterase pde5, induced pronounced ltd of corticostriatal responses in the striatal slices from young mice (68 4% of baseline, n = 8) at 6075 min after zprn, whereas in the slices from older animals zprn evoked either no (94 3% and 83 5% in the striatum from group ii and iv animals, n = 8 each) or only minor (83 3% in group iii, n = 8) depression (figures 6(a) and 6(b)). the striatal slices from young and older animals differed also in the initial responses to zprn : in the young striatum significant depression of field responses was observed already during zprn application, whereas no significant changes in responses during this period occurred in the striatal slices from older animals (figures 6(a) and 6(b)). thus, the immediate and long - lasting effects of zprn demonstrated similar age - dependence as the effects of dhpg favouring the idea on a causal link between functional alterations in the no - signaling cascade and dhpg - ltd suppression with aging. rolipram (rlpm, 30 m), an inhibitor of camp - specific phosphodiesterase pde4, induced considerable (by 2030%) enhancement of field responses in the striatal slices of all age groups (figures 6(c) and 6(d)). in the striatum of group ii and iii mice (n = 7 each) this enhancement was persistent, so that a small but significant increase in responses was observed towards the end of monitoring (118 4% and 117 2% of baseline, p < 0.05, in groups ii and iii, resp.), while in the slices from the young (n = 9) and old (n = 8) groups the responses returned to the baseline after washing out the drug (90 4% and 97 5%, resp.). as an enhanced pka stimulation by camp might determine the increased amplitude of corticostriatal ltp, the revealed age - related difference in the effects of elevated camp may underlie the significant enhancement of the hfs - ltp in the middle - aged striatum. studies on neurotoxic and transgenic rodent models of parkinson 's disease showed that inhibition of cgmp hydrolysis by the pde5 inhibitor zaprinast is able to rescue corticostriatal hfs - ltd [37, 38 ]. in our previous study we also found that treatment with zaprinast restored both hfs - ltd and dhpg - ltd impaired by long exposure of corticostriatal slices to hyperammonemic conditions. to test whether this inhibitor could reverse age - dependent reduction of dhpg - ltd we compared the effects of dhpg application in the absence and presence of zaprinast in slices from group ii and group iii mice. in both groups preapplication of zaprinast increased dhpg - ltd to the level characteristic of young animals (to 66 3% and 64 4% of baseline in group ii (n = 8) and iii (n = 9), resp.). the difference with the corresponding values of control dhpg - ltd for both groups is significant at p < 0.001 (figure 7). this study shows that advanced aging gradually increases the expression of genes regulating immune and redox states, decreases the expression of genes involved in no - dependent synaptic plasticity (nmdar, d1r, nnos), and modifies the expression of some forms of corticostriatal plasticity associated with activation of nmdar and group i mglurs. the following age - dependent alterations in corticostriatal plasticity were observed : (i) suppression of ltd induced by pharmacological activation of group i mglurs, dhpg - ltd ; (ii) slowdown of ltd induced by electrical stimulation of the cortical input, hfs - ltd ; (iii) enhanced expression of electrically induced ltp (hfs - ltp). functional alterations in signaling cascades are considered a possible cause of age - related alterations in corticostriatal plasticity. at corticostriatal synapses, induction of hfs - ltd is initiated by calcium entry via l - type voltage - dependent calcium channels, coactivation of d2-like dopamine receptors (d2r), and group i mglur - stimulating postsynaptic synthesis of endocannabinoids (ecb). it is expressed presynaptically due to retrograde signaling via activation of ecb receptors (cb1r) on cortical terminals resulting in persistent inhibition of glutamate release [4, 5, 4042 ]. induction of hfs - ltd critically depends also on activation of no - cgmp signaling pathway. chemical ltd which is evoked in the dorsal striatum by brief activation of group i mglurs with the specific agonist dhpg (dhpg - ltd) shares with hfs - ltd the major requirements such as the necessity of group i mglurs and cb1r activation as well as dependence on the activity of nos and no - dependent soluble guanylate cyclase. these two kinds of corticostriatal ltd displayed, however, different age - dependence : while dhpg - ltd was significantly reduced already at the age of 6 - 7 months remaining at the same low level with further aging, hfs - ltd magnitude peaked at this age showing largely dynamic rather than magnitude alterations in older animals. the absence of any significant age - dependent changes in the mrna expression for group i mglurs, d2r, and cb1r implies that age - related alterations take place downstream of the receptors. induction of corticostriatal ltd by dhpg requires no - dependent synthesis of cgmp ; therefore a significantly decreased activity of nnos and/or lower efficiency of the no - cgmp - pkg cascade would explain its age - related suppression. this suggestion is supported by the parallel age - related decreases in nnos mrna expression, in the magnitude of dhpg - ltd, and in the responses to zaprinast, as well as by the restoration of normal dhpg - ltd by inhibition of cgmp hydrolysis with zaprinast. however, dysfunction of the no - cgmp - pkg cascade can hardly explain age - related dynamics of corticostriatal hfs - ltd showing no amplitude reduction with aging. it should be noted that the no - cgmp - pkg cascades associated with hfs - ltd and dhpg - ltd have different localizations : the hfs - ltd induction requires postsynaptic no - dependent stimulation of pkg, while the no - stimulated cascade in dhpg - ltd is activated downstream of cb1r, that is, located presynaptically. the different age - dependence of dhpg - ltd and hfs - ltd may therefore be attributed to different age - sensitivity of pre- and postsynaptic no - dependent regulatory mechanisms. besides, in contrast to dhpg - ltd which is independent of d2r activation, hfs - ltd critically depends on the activation of both d2r and d1r [4, 43 ] which trigger opposite effects on the intracellular level of camp and consequently on pka activity. the major pka substrate in striatal spiny neurons is the dopamine and the camp - regulated phosphoprotein 32 kda (darpp-32), which is also the substrate for pkg. being a key regulator of protein kinase and phosphatase signaling in striatal principal neurons darpp-32 is critically involved in responses to physiological and pharmacological stimuli and regulation of bidirectional corticostriatal plasticity [43, 45 ]. enhanced magnitude of hfs - ltd in the 6 - 7-month - old striatum as well as slow development of hfs - ltd impeded by preceding potentiation in the striatum of older animals may be the consequences of age - related alterations in darpp-32 activity regulation via dopamine and glutamate receptors. age - related alterations in the camp - pka function are suggested by our data on the increased sensitivity of corticostriatal neurotransmission to the inhibitor of camp degradation rolipram in the two middle age groups. activation of nmdar and d1r is required for ltp induction by hfs at corticostriatal synapses. as aging is accompanied by a significant decrease in mrna encoding the essential nr1 subunit of these receptors (our study), a decrease in the number [36, 4648 ] and function of striatal nmdar, some impairment in nmdar - associated plasticity would be expected. in fact, one previous study reported the reduced occurrence of hfs - induced ltp of corticostriatal responses in old rats. exploring corticostriatal plasticity in four age groups in mice we found more complex age - related alterations in the characteristics of hfs - ltp with its enhancement in the middle ages followed by some decline in the old age. it is of interest that the magnitude of hfs - ltp in the old striatum exceeded that in the young one. potentiation of nmda - evoked responses in medium spiny neurons through the d1r - camp - pka pathway is thought to play a pivotal role in the induction of corticostriatal hfs - ltp. in fact, an increase in intracellular camp was shown to promote ltp induction, while pka inhibitors prevent it. if d1r - dependent stimulation of postsynaptic pka activity determines the magnitude of ltp, the enhancement of corticostriatal ltp may be attributed to the enhanced d1r - activated signaling compensating the age - related decrease in the amount of d1r mrna (our study) and receptor number [5255 ]. this suggestion is supported by our data on the distinct, long - term potentiating effects of rolipram on corticostriatal responses in the striatum of animals of 6 - 7 and 12 - 13 months old. oxidative damage of critical biological molecules resulted from alteration in a cellular redox state and accumulation of reactive oxygen species (ros) is considered one of the causal factors of aging [5658 ]. our study revealed considerable upregulation of genes associated with ros production (cyba), antioxidant defence system (gpx6), regulation of redox state (txnip), and membrane lipid sensitivity to oxidation (scd2) in the old striatum, which is consistent with previous findings [29, 5962 ]. the cyba or p22phox gene encodes the -subunit of the membrane - associated nad(p)h which is the second most important intracellular source of ros after mitochondria. crosstalk signaling between these two sources may amplify and sustain ros concentration [64, 65 ]. upregulation of nad(p)h oxidases has been reported for a variety of age - related diseases including neurodegenerative disorders [6669 ]. the functional role of gpx6, a member of the glutathione peroxidase family, remains poorly understood, but significant age - related upregulation of the gpx6 gene has been recently reported for the rat cochlear nucleus [29, 61 ]. in the old striatum we observed a noticeable increase in the expression of scd2 encoding stearoyl - coenzyme a desaturase, a rate - limiting enzyme in the biosynthesis of monounsaturated fatty acids. an increased content of oxidation - sensitive monounsaturated lipids in cell membranes at old age may be the cause of an age - associated increase in membrane lipid peroxidation. thioredoxin - interacting protein (txnip) is a major intracellular regulator of redox state and inflammatory activation ; therefore oxidative stress is closely associated with neuroinflammatory processes. indeed, our study showed a gradual age - dependent increase in the expression of genes associated with the innate immunity and immune response (irgm1, b2 m, and lcn2). some of the immune response markers were noticeably elevated already in 6 - 7-month - old mice and significantly increased with further aging. one of these markers called beta-2-microglobulin (b2 m) is a component of the major histocompatibility complex (mhc) class i molecules, which is necessary for mhc expression on the cell surface. another marker, lipocalin-2 (lcn2), is an innate immune protein which is synthesized and secreted from activated microglia, reactive astrocytes, neurons, and endothelial cells and is considered to be a major actor in orchestrating neuroinflammatory processes. despite the increased expression of prooxidant and proinflammatory state markers and reduced expression of plasticity - associated genes, old mouse striatum did not show such dramatic alterations in the expression of hfs - induced corticostriatal synaptic plasticity as the loss of hfs - ltd and overexpression of hfs - ltp reported for the 3-nitropropionic and 6-hydroxydopamine models of neurodegenerative diseases associated with oxidative stress and neuroinflammation [37, 7173 ]. at the same time, the suppression of dhpg - ltd and the enhancement of hfs - ltp with advanced aging recall these pathologies and may represent the consequences of prooxidant and proinflammatory conditions. the role of inflammatory cytokines released by activated microglia and astrocytes in synaptic plasticity and its age - related modulation has been shown for major hippocampal synaptic systems (see for recent reviews [74, 75 ]), whereas cytokine contribution to age - related alterations in corticostriatal plasticity remains to be investigated. comparative analysis of age - dependent alterations in several forms of corticostriatal plasticity and striatal gene expression in mice showed that age - related alterations in plasticity may be associated with functional changes in receptor - activated signaling cascades rather than with receptor gene expression. these functional changes may result from the gradually increasing neuroinflammation and the concomitant oxidative stress. | age - related alterations in the expression of genes and corticostriatal synaptic plasticity were studied in the dorsal striatum of mice of four age groups from young (2 - 3 months old) to old (1824 months of age) animals. a significant decrease in transcripts encoding neuronal nitric oxide (no) synthase and receptors involved in its activation (nr1 subunit of the glutamate nmda receptor and d1 dopamine receptor) was found in the striatum of old mice using gene array and real - time rt - pcr analysis. the old striatum showed also a significantly higher number of gfap - expressing astrocytes and an increased expression of astroglial, inflammatory, and oxidative stress markers. field potential recordings from striatal slices revealed age - related alterations in the magnitude and dynamics of electrically induced long - term depression (ltd) and significant enhancement of electrically induced long - term potentiation in the middle - aged striatum (6 - 7 and 12 - 13 months of age). corticostriatal no - dependent ltd induced by pharmacological activation of group i metabotropic glutamate receptors underwent significant reduction with aging and could be restored by inhibition of cgmp hydrolysis indicating that its age - related deficit is caused by an altered no - cgmp signaling cascade. it is suggested that age - related alterations in corticostriatal synaptic plasticity may result from functional alterations in receptor - activated signaling cascades associated with increasing neuroinflammation and a prooxidant state. |
we obtained csf from a cohort of children (1 of the following signs or symptoms : severe headache, altered mental status, seizures, or focal neurologic signs (6). to investigate whether uncharacterized infectious agents were associated with neurologic disease, we obtained csf specimens from 12 patients with acute cns infection (i.e., febrile illness with csf leukocyte count > 5 cells / mm or protein > 45 mg / dl). these patients had negative diagnostic test results for pathogens known to cause cns infection in this region of india at the time of investigation (e.g., japanese encephalitis virus, chikungunya virus, dengue fever virus, and plasmodium falciparum) ; in addition, csf culture was performed and no bacterial organisms were found (5). total nucleic acid was extracted from whole csf and randomly amplified as previously described with the modification that 6-nt barcodes were added to the 5 end of the primers used for the amplification (7). the amplified materials were pooled together and processed by using a high - throughput pyrosequencing technique on a gs flx titanium platform (454 life sciences / roche, branford, ct, usa). the raw sequence reads were deconvoluted on the basis of the barcode and then processed through a standardized bioinformatic pipeline (2). the sequences of interest were then categorized into taxonomy groups based on the best blast (www.ncbi.nlm.nih.gov/blast/) hit. for 2 of the 12 patients, patients ves085 and ves065, we identified 17 (92.6%98.2% sequence identity) distinct sequence reads in the csf of patient ves085 and 6 (95.6%98.9%, sequence identity) distinct reads from patient ves065 with pairwise identities based on blastn alignment of each read to the reference genome (genbank accession no. eu175855.1). to verify the results, we used parv4-specific pcr primers to screen all 12 original csf samples as described (8). only samples from ves085 and ves065 were positive ; all other samples were negative by pcr. parv4 viral loads in the 2 csf samples and the corresponding serum sample from 1 patient collected contemporaneously were semiquantified by limiting dilution pcr by using primers on 5 replicate samples of each dilution. the pcr conditions demonstrated single copy sensitivity (data not shown), and endpoint titers of 50% positivity were calculated by using the reed - muench formula (8,9). both the csf and 1 serum sample demonstrated high endpoint titers, indicating acute infection and substantial virus spread into the cns of the 2 patients (table 1). csf, cerebrospinal fluid ; i d, patient identification code ; wcc, leukocyte count ; ig, immunoglobulin ; +, positive ;, negative ; na, not available. leukocyte count differential 100% lymphocytes for each patient. to genetically characterize parv4 variants infecting the patients, we generated overlapping sets of amplicons spanning the complete genome of parv4 from the 3 samples. the fully assembled coding regions of the variants generated from both patients were compared to previously described parv4 variants (n = 18 viral proteins 2/1 and n = 19 nonstructural sequences) (table 2). phylogenetic analysis of (a) complete nonstructural (ns) and (b) viral protein (vp) 1/vp 2 gene sequences of human parvovirus 4 (parv4) variants isolated from patients with encephalitis of unknown etiology using 167 available sequences from human parv4 variants (genotypes 13). blue, study sample ; red, genotype 1 ; orange, genotype 2 ; yellow, genotype 3. the porcine hokovirus sequence (genbank accession no. the trees were constructed by neighbor - joining of pairwise maximum - composite likelihood corrected distances between nucleotide sequences ; bootstrap values 70% are shown. the serum sample was screened for immunoglobulin (ig) g and igm parv4-specific antibodies by using a previously developed serologic assay for parv4 antibodies (10). the serum of ves085 was igm positive and igg negative, consistent with an acute infection (table 1). through serologic screening of age - matched controls, we were able to largely rule out the possibility that detection of parv4 dna in samples from 2 of the 12 patients was simply incidental to a high background incidence of parv4 infection in this age group. although published data on the duration of viremia in patients with acute parv4 infections has not been directly determined, viral loads as found in the study patients are of relatively short duration in other parvovirus infections (16 days for viral loads > 5,000 dna copies / ml in the case of b19) (11). furthermore, through testing sequential samples from persons exposed to parv4, we have found no persons with viremia duration of > 6 weeks (c. sharp. data). using the 6-week (maximum) estimate and a background incidence of infection of 2.2% per year (based on the detection of 4/41 seropositive children with a mean age of 4.5 years), the likelihood of viremia detection would be at most 0.25%, a figure consistent with the actual measured absence of viremia detection in the control cohort. parv4 is a recently identified virus found in human blood and in a variety of tissues but with no known disease association. in this study we detected parv4 dna in 2 of 12 csf samples from patients with suspected encephalitis of unknown cause in southern india the presence of parv4 dna and igm against parv4 in acute - phase serum from the 1 child with this sample available further supports the contention that this was an acute infection. more often than not, clinicians have to rely on surrogate markers to diagnose encephalitis (e.g., csf pleocytosis, febrile illness, and focal neurologic signs in the right clinical context). it is more common to have csf pleocytosis than not, though of course there are well characterized cases of cns infection (e.g., dengue) with no pleocytosis (6). although it is theoretically possible the parvovirus detected in the csf could have reflected spillover from a blood - contaminated spinal tap, there was no overt evidence of hemorrhagic csf. the fact that patient ves085 was febrile with a neurologic syndrome and positive serum igm, and patient ves065 had similar clinical signs with high parv4 viral csf levels suggests that they did indeed have a cns infection. parv4 is primarily found in injection drug users and persons who have received blood products ; parv4 is therefore presumed to be transmitted parenterally. however, the risk for such transmission in the children in our study was low, which supports the possibility of an alternative route of transmission (8,12). the use of high - throughput sequencing for identifying an unexpected possible cause of cns infection (parv4) is cutting edge ; this technique s utility also extends to a recent identification of astrovirus in a case of encephalitis (13). with the high seroprevalence of parv4 infection highlighted in recent reports (5%37%), there is a clear need to further assess the role of parv4 in cns infection across the globe (14,15). | to investigate whether uncharacterized infectious agents were associated with neurologic disease, we analyzed cerebrospinal fluid specimens from 12 children with acute central nervous system infection. a high - throughput pyrosequencing screen detected human parvovirus 4 dna in cerebrospinal fluid of 2 children with encephalitis of unknown etiology. |
we initially attempted to co - express s. cerevisiae cog5, cog6, cog7, and cog8 (cog5 - 8) using the pqlink vector system in escherichia coli ; however, the levels of cog6 protein were undetectably low. the four coding sequences, inserted into pqlinkh, were co - expressed in e. coli bl21-codonplus(de3)-ripl cells (agilent technologies). cells were grown at 37c to an od600 of approximately 0.60.8 in lb medium containing 100 g / ml ampicillin. protein expression was induced using 0.5 mm isopropyl -d-1-thiogalactopyranoside (iptg). the growth temperature was then lowered to 18c and cells were grown for 12 - 18 h before harvesting. cell pellets were resuspended in lysis buffer (20 mm tris - hcl, ph 8.0, 150 mm nacl, 5% glycerol, 1 mm phenylmethanesulfonyl fluoride (pmsf), 0.25 tablet of edta - free protease inhibitor cocktail (sigma - aldrich) per liter of bacterial culture, 2 g / ml dnase i) and lysed using a cell disruptor (avestin). the cog5 - 8 complex was purified using affinity (ni - nta ; clontech), anion exchange (monoq ; ge healthcare), and size - exclusion (superdex 200 ; ge healthcare) chromatography and stored in storage buffer (20 mm tris, ph 8.0, 150 mm nacl, 1 mm dithiothreitol, 1 mm edta, 0.2 mm pmsf and 1 tablet per liter edta - free protease inhibitor cocktail). we also constructed nine additional vectors, each encoding a single gfp - tagged subunit and three untagged subunits. the gfp tags were placed at the n and c termini of each subunit ; in the ninth vector, the gfp tag was placed at the n terminus of a truncated cog6 gene encoding cog6 without its first 146 residues, cog6n. the corresponding gfp - tagged cog5 - 8 complexes were purified as described above (supplementary fig. cog5 - 8 complexes with n- and c - terminal gfp tags on cog6 were his6-tagged at the c terminus of cog6 and the n terminus of cog7, respectively ; all other gfp - tagged cog5 - 8 complexes were (like untagged cog5 - 8) his6-tagged at the n terminus of cog6. first, we prepared two pqlinkh plasmids containing either all eight k. lactis cog genes or all eight s. cerevisiae cog genes. in neither case, however, we were able to isolate the intact cog complex. we next sought to overproduce k. lactis cog1 - 4 according to the same strategy, with the idea of combining it with k. lactis cog5 - 8, but found that cog4 was insoluble when overproduced in bacteria. as a final approach, we sought to overcome our above - mentioned difficulty in producing s. cerevisiae cog5 - 8 that is, that cog6 was not expressed at detectable levels reasoning that this might allow us to combine s. cerevisiae cog5 - 8 with s. cerevisiae cog1 - 4, the subject of an earlier study. to increase the expression level of s. cerevisiae cog6, we had the corresponding gene synthesized (genewiz) using codons optimized for bacterial expression and reinserted it into the pqlinkh vector. co - expression with s. cerevisiae cog5, cog7, and cog8 yielded small amounts of the s. cerevisiae cog5 - 8 complex, although the cog6 protein was partially degraded during purification. this degradation problem was alleviated by co - lysing cell pellets containing the s. cerevisiae cog1 - 4 and cog5 - 8 subassemblies, enabling us to purify fully assembled cog1 - 8. specifically, cog1 - 4 containing n - terminally his6-tagged cog2 was overproduced in c43(de3) (lucigen), while cog5 - 8 containing n - terminally his6-tagged cog6 was overproduced in bl21-codonplus(de3)-ripl cells (agilent technologies). after growing cells at 37c to an od600 of approximately 0.60.8 in lb medium containing 100 g / ml ampicillin, the cells containing cog1 - 4 and cog5 - 8 were induced at 23 and 18c, respectively, with 0.5 mm iptg and grown an additional 1218 h. after harvesting, the cells were resuspended in lysis buffer, combined, lysed using a cell disruptor, and purified as described above for k. lactis cog5 - 8. bovine cog was purified as previously described. to prepare negatively stained grids, 3 l sample was added to a glow - discharged carbon - coated grid and stained with 2% uranyl formate as described. the grids were imaged with an fei tecnai t12 electron microscope operated at 120 kv at a defocus of 1.5 m using low - dose procedures. images were acquired at a nominal magnification of 42,000x using a gatan 4k 4k ccd camera, which gave a calibrated pixel size of 2.61 on the specimen level. particles were picked with e2boxer.py, windowed into 145 145-pixel images (all cog5 - 8 complexes) or 240 240-pixel images (cog1 - 8 complex), and normalized. the images were reduced to 64 64 pixels, and the particles were centered and then classified using the iterative stable alignment and clustering (isac) procedure. for s. cerevisiae cog1 - 8 (total of 31,872 particles), 18 isac generations with 100 particles per group and a pixel error threshold of 2 yielded 271 classes (supplementary fig. 2), accounting for 5,182 particles (~16% of the entire data set). for untagged k. lactis cog5 - 8 (total of 8,825 particles), 14 isac generations with 200 particles per group and 1b), accounting for 4,958 particles (~56% of the entire data set). data were also collected for nine gfp - tagged k. lactis cog5 - 8 complexes (supplementary fig. it proved possible to locate gfp in class averages of k. lactis cog5 - 8 complexes containing gfp attached to : (1) the n terminus of cog6n, (2) the c terminus of full - length cog6, (3) the n terminus of cog8, and (4) the c terminus of cog8 (supplementary fig. 3b). for cog5 - 8 containing n - terminally gfp - tagged cog6n (total of 5,689 particles), 3 isac generations with 50 particles per group and a pixel error threshold of 0.7 yielded 73 classes, accounting for 1,189 particles (~21% of the entire data set). for cog5 - 8 with c - terminally gfp - tagged cog6 (total of 6,412 particles), 4 isac generations with 100 particles per group and a pixel error threshold of 0.7 yielded 125 classes, accounting for 3,109 particles (~48% of the entire data set). for cog5 - 8 with n - terminally gfp - tagged cog8 (total of 7,237 particles), 14 isac generations with 200 particles per group and a pixel error threshold of 2 yielded 72 classes, accounting for 2,434 particles (~34% of the entire data set). for cog5 - 8 with c - terminally gfp - tagged cog8 (total of 8,247 particles), 8 isac generations with 200 particles per group and a pixel error threshold of 2 yielded 97 classes, accounting for 4,185 particles (~51% of the entire data set). for the other five gfp - tagged k. lactis cog5 - 8 complexes, class averages did not allow the gfp to be localized (supplementary fig. 3b and data not shown). for cog5 - 8 with n - terminally gfp - tagged cog5 (total of 11,380 particles), 3 isac classifications with 100 particles per group and a pixel error threshold of 0.7 yielded 137 classes, accounting for 3,012 particles (~26% of the entire dataset). for cog5 - 8 with c - terminally gfp - tagged cog5 (total of 11,477 particles), isac classifications with 50 particles per group and a pixel error threshold of 2 yielded 225 classes, accounting for 4,431 particles (~39% of the entire dataset). for cog5 - 8 with n - terminally gfp - tagged cog6 (total of 7,645 particles), isac classifications with 100 particles per group and a pixel error threshold of 0.7 yielded 155 classes, accounting for 4,616 particles (~60% of the entire dataset ; supplementary fig. 3b). for cog5 - 8 with n - terminally gfp - tagged cog7 (total of 10,494 particles), isac classifications with 100 particles per group and a pixel error threshold of 0.7 yielded 181 classes, accounting for 3,797 particles (~36% of the entire dataset). for cog5 - 8 with c - terminally gfp - tagged cog7 (total of 9,997 particles), isac classifications with 50 particles per group and a pixel error threshold of 2 yielded 257 classes, accounting for 4,163 particles (~44% of the entire dataset). we initially attempted to co - express s. cerevisiae cog5, cog6, cog7, and cog8 (cog5 - 8) using the pqlink vector system in escherichia coli ; however, the levels of cog6 protein were undetectably low. the four coding sequences, inserted into pqlinkh, were co - expressed in e. coli bl21-codonplus(de3)-ripl cells (agilent technologies). cells were grown at 37c to an od600 of approximately 0.60.8 in lb medium containing 100 g / ml ampicillin. protein expression was induced using 0.5 mm isopropyl -d-1-thiogalactopyranoside (iptg). the growth temperature was then lowered to 18c and cells were grown for 12 - 18 h before harvesting. cell pellets were resuspended in lysis buffer (20 mm tris - hcl, ph 8.0, 150 mm nacl, 5% glycerol, 1 mm phenylmethanesulfonyl fluoride (pmsf), 0.25 tablet of edta - free protease inhibitor cocktail (sigma - aldrich) per liter of bacterial culture, 2 g / ml dnase i) and lysed using a cell disruptor (avestin). the cog5 - 8 complex was purified using affinity (ni - nta ; clontech), anion exchange (monoq ; ge healthcare), and size - exclusion (superdex 200 ; ge healthcare) chromatography and stored in storage buffer (20 mm tris, ph 8.0, 150 mm nacl, 1 mm dithiothreitol, 1 mm edta, 0.2 mm pmsf and 1 tablet per liter edta - free protease inhibitor cocktail). we also constructed nine additional vectors, each encoding a single gfp - tagged subunit and three untagged subunits. the gfp tags were placed at the n and c termini of each subunit ; in the ninth vector, the gfp tag was placed at the n terminus of a truncated cog6 gene encoding cog6 without its first 146 residues, cog6n. the corresponding gfp - tagged cog5 - 8 complexes were purified as described above (supplementary fig. cog5 - 8 complexes with n- and c - terminal gfp tags on cog6 were his6-tagged at the c terminus of cog6 and the n terminus of cog7, respectively ; all other gfp - tagged cog5 - 8 complexes were (like untagged cog5 - 8) his6-tagged at the n terminus of cog6. first, we prepared two pqlinkh plasmids containing either all eight k. lactis cog genes or all eight s. cerevisiae cog genes. in neither case, however, we were able to isolate the intact cog complex. we next sought to overproduce k. lactis cog1 - 4 according to the same strategy, with the idea of combining it with k. lactis cog5 - 8, but found that cog4 was insoluble when overproduced in bacteria. as a final approach, we sought to overcome our above - mentioned difficulty in producing s. cerevisiae cog5 - 8 that is, that cog6 was not expressed at detectable levels reasoning that this might allow us to combine s. cerevisiae cog5 - 8 with s. cerevisiae cog1 - 4, the subject of an earlier study. to increase the expression level of s. cerevisiae cog6, we had the corresponding gene synthesized (genewiz) using codons optimized for bacterial expression and reinserted it into the pqlinkh vector. co - expression with s. cerevisiae cog5, cog7, and cog8 yielded small amounts of the s. cerevisiae cog5 - 8 complex, although the cog6 protein was partially degraded during purification. this degradation problem was alleviated by co - lysing cell pellets containing the s. cerevisiae cog1 - 4 and cog5 - 8 subassemblies, enabling us to purify fully assembled cog1 - 8. specifically, cog1 - 4 containing n - terminally his6-tagged cog2 was overproduced in c43(de3) (lucigen), while cog5 - 8 containing n - terminally his6-tagged cog6 was overproduced in bl21-codonplus(de3)-ripl cells (agilent technologies). after growing cells at 37c to an od600 of approximately 0.60.8 in lb medium containing 100 g / ml ampicillin, the cells containing cog1 - 4 and cog5 - 8 were induced at 23 and 18c, respectively, with 0.5 mm iptg and grown an additional 1218 h. after harvesting, the cells were resuspended in lysis buffer, combined, lysed using a cell disruptor, and purified as described above for k. lactis cog5 - 8. to prepare negatively stained grids, 3 l sample was added to a glow - discharged carbon - coated grid and stained with 2% uranyl formate as described. the grids were imaged with an fei tecnai t12 electron microscope operated at 120 kv at a defocus of 1.5 m using low - dose procedures. images were acquired at a nominal magnification of 42,000x using a gatan 4k 4k ccd camera, which gave a calibrated pixel size of 2.61 on the specimen level. particles were picked with e2boxer.py, windowed into 145 145-pixel images (all cog5 - 8 complexes) or 240 240-pixel images (cog1 - 8 complex), and normalized. the images were reduced to 64 64 pixels, and the particles were centered and then classified using the iterative stable alignment and clustering (isac) procedure. for s. cerevisiae cog1 - 8 (total of 31,872 particles), 18 isac generations with 100 particles per group and a pixel error threshold of 2 yielded 271 classes (supplementary fig. 2), accounting for 5,182 particles (~16% of the entire data set). for untagged k. lactis cog5 - 8 (total of 8,825 particles), 14 isac generations with 200 particles per group and 1b), accounting for 4,958 particles (~56% of the entire data set). data were also collected for nine gfp - tagged k. lactis cog5 - 8 complexes (supplementary fig. it proved possible to locate gfp in class averages of k. lactis cog5 - 8 complexes containing gfp attached to : (1) the n terminus of cog6n, (2) the c terminus of full - length cog6, (3) the n terminus of cog8, and (4) the c terminus of cog8 (supplementary fig. cog5 - 8 containing n - terminally gfp - tagged cog6n (total of 5,689 particles), 3 isac generations with 50 particles per group and a pixel error threshold of 0.7 yielded 73 classes, accounting for 1,189 particles (~21% of the entire data set). for cog5 - 8 with c - terminally gfp - tagged cog6 (total of 6,412 particles), 4 isac generations with 100 particles per group and a pixel error threshold of 0.7 yielded 125 classes, accounting for 3,109 particles (~48% of the entire data set). for cog5 - 8 with n - terminally gfp - tagged cog8 (total of 7,237 particles), 14 isac generations with 200 particles per group and a pixel error threshold of 2 yielded 72 classes, accounting for 2,434 particles (~34% of the entire data set). for cog5 - 8 with c - terminally gfp - tagged cog8 (total of 8,247 particles), 8 isac generations with 200 particles per group and a pixel error threshold of 2 yielded 97 classes, accounting for 4,185 particles (~51% of the entire data set). for the other five gfp - tagged k. lactis cog5 - 8 complexes, class averages did not allow the gfp to be localized (supplementary fig. n - terminally gfp - tagged cog5 (total of 11,380 particles), 3 isac classifications with 100 particles per group and a pixel error threshold of 0.7 yielded 137 classes, accounting for 3,012 particles (~26% of the entire dataset). for cog5 - 8 with c - terminally gfp - tagged cog5 (total of 11,477 particles), isac classifications with 50 particles per group and a pixel error threshold of 2 yielded 225 classes, accounting for 4,431 particles (~39% of the entire dataset). for cog5 - 8 with n - terminally gfp - tagged cog6 (total of 7,645 particles), isac classifications with 100 particles per group and a pixel error threshold of 0.7 yielded 155 classes, accounting for 4,616 particles (~60% of the entire dataset ; supplementary fig. n - terminally gfp - tagged cog7 (total of 10,494 particles), isac classifications with 100 particles per group and a pixel error threshold of 0.7 yielded 181 classes, accounting for 3,797 particles (~36% of the entire dataset). for cog5 - 8 with c - terminally gfp - tagged cog7 (total of 9,997 particles), isac classifications with 50 particles per group and a pixel error threshold of 2 yielded 257 classes, accounting for 4,163 particles (~44% of the entire dataset). | the conserved oligomeric golgi (cog) complex orchestrates vesicular trafficking to and within the golgi apparatus. here, we use negative - stain electron microscopy to elucidate the architecture of the hetero - octameric cog complex from saccharomyces cerevisiae. intact cog has an intricate shape, with four (or possibly five) flexible legs, that differs strikingly from the exocyst complex and appears well - suited for vesicle capture and fusion. |
the global prevalence of type 2 diabetes which is often associated with obesity is increasing dramatically. bariatric surgery proved to be the most effective long - term treatment for obesity [26 ] and has been shown to improve glucose homeostasis independently of weight loss [7, 8 ]. the international diabetes federation recommends bariatric surgery for treatment of obese patients with a bmi > 35 and of patients with poorly controlled diabetes and a bmi between 30 and 35. bariatric procedures performed in patients and tested in animals include bypass of the foregut (duodenal - jejunal bypass (djb)) [10, 11 ], bypass of the foregut in combination with partial or total removal of the stomach (roux - en - y - gastric biliary bypass (rygb)), and interposition of a segment of the distal ileum into the proximal jejunum (ileal interposition (iip)) [12, 13 ]. these surgery procedures improve glycemic control and decrease body weight. considering that there are various routes and mechanisms of the gut involved in regulation of energy balance and metabolism [14, 15 ], the different surgical procedures are expected to improve glycemic control and decrease body weight in somewhat different ways. nutrient - dependent regulation of metabolism by the gut includes effects on food uptake, nutrient absorption, energy balance, metabolism, and glycemic control. it involves effects of enterohormones and neuronal signals from the gut on central regulations of food intake and energy balance, effects of enteric nerves on motility and secretion of digestive enzymes, effects of enterohormones on secretion of insulin and amylin, effects on metabolism, and nutrient - dependent regulation of small intestinal transporters [6, 1425 ]. previous investigations found that djb reduces food uptake and increases insulin sensitivity and secretion of glucagon like peptide-1 (glp-1) and peptide yy (pyy) [2629 ] ; rygb reduces food intake and increases energy expenditure, insulin sensitivity, and secretion of glp-1, pyy, glucagon like peptide-2 (glp-2), and ghrelin [3036 ] ; and iip improves insulin sensitivity, increases release of glp-1 and pyy, and accelerates small intestinal bile acid absorption [12, 26, 27, 29, 30, 3748 ]. all of the aforementioned bariatric procedures are supposed to cause postprandial elevation of l - cell secretagogues, including glucose, peptides, and short chain fatty acids in ileum and colon where the l - cells are located. stimulation of postprandial secretion of glp-1 and pyy appears to be common to the described bariatric procedures. via interaction with the glp-1 receptor, glp-1 stimulates glucose - dependent insulin secretion by pancreatic cells, stimulates insulin biosynthesis, has a trophic effect on cells, inhibits glucagon secretion in cells, and reduces appetite in the central nervous system. in addition presumed indirect effects of glp-1 such as improvement of insulin sensitivity, reduction of hepatic gluconeogenesis, and increase of glucose use in skeletal muscles have been described [20, 49 ]. because the bariatric procedures change the postprandial time concentration profiles of nutrients in small intestine, they are also thought to change the nutrient - dependent regulations of small intestinal regeneration, protein expression, and metabolism [32, 5052 ]. bariatric surgery procedures like rygb that include partial or total removal of the stomach alter regulatory mechanisms governed by the stomach such as increase of appetite by secretion of ghrelin and regulation of secretion of bile acid and pancreatic enzymes. these procedures are supposed to impair the vagal nerve integrity more strongly compared to djb and iip, which may impair the gut - brain cross talk [14, 15 ]. at variance with rygb and djb, iip is not thought to dramatically change food passage velocity. like djb thus, iip may be a good model for elucidating gut - related mechanisms regulating energy balance and metabolism to improve diabetic control by bariatric surgery. because stimulation of glp-1 secretion by bariatric surgery in animal models has been mostly demonstrated in response to gavage with glucose [27, 28, 40, 42, 44, 47, 48 ], physiological relevance of glucose - dependent stimulation of glp-1 secretion is implicated. this view is supported by recent data showing that pharmacological inhibition of na - d - glucose cotransporter sglt1 in small intestine, which is rate limiting for intestinal glucose absorption, leads to increased glucose - dependent secretion of glp-1 and improves glycemic control in type 2 diabetes [53, 54 ]. recently, we reported that djb in diabetic rats was followed by downregulated expression of the na - d - glucose cotransporter sglt1 in jejunum. thus, the glucose concentration in the distal ileum, where most l - cells are localized, is increased not only due to missing glucose absorption in the bypassed proximal jejunum but also due to downregulation of sglt1. we have discussed the possibility that the antidiabetic effect of djb and other bariatric surgery procedures may not only be due to increased glucose - induced glp-1 secretion but also result from a slowed down and reduced increase of blood glucose after glucose ingestion. this may influence glucose metabolism in the liver that is changed in type 2 diabetes mellitus [11, 5557 ]. to test this hypothesis, we investigate in the present study whether sglt1-mediated glucose transport in small intestine of diabetic rats which is rate limiting for intestinal glucose absorption is also downregulated after iip and may contribute to the antidiabetic effect in addition to improved exposure of l - cells to glucose. because morphological changes of the interposed ileum after iip have been described but not investigated in detail [12, 58 ] and changes in glucose metabolism associated with morphological changes after rygb have been described, we also investigated the morphology of the interposed ileum by light and electron microscopy and determined the expression of sglt1 protein in the enterocytes. male lewis rats aged 7 weeks with 180200 g body weight were obtained from harlan laboratories gmbh (venray, netherlands). the animals were maintained in groups of 24 animals in a pathogen - free environment under constant ambient temperature and humidity in a 12-hour light - dark cycle with free access to food and water unless otherwise stated. the study was approved by the animal care committee of the local government in accordance with national guidelines for animal care (german law for the protection of animals). the hypercaloric high - fat diet (hfd, altromin number 40003) contained 18.2% protein, 22.1% fat, 33.5% polysaccharides, 9.8% disaccharides, and 1.7% monosaccharides. the values represent percentage of wet weight. in male rats kept for three weeks on hfd (n = 18) diabetes was induced by an intraperitoneal injection of 35 mg / kg stz as described [11, 59, 60 ]. after midline laparotomy, iip surgery was performed in 9 animals by isolating a 10 cm ileal segment 5 cm oral to bauhin 's valve. the remaining ileal ends were reconstructed by termino - terminal ileoileostomy in single - stitch - technique. the isolated ileal segment was interposed to the proximal jejunum 5 cm aboral to the duodenojejunal flexure. jejunoileostomy and the ileojejunostomy were performed in single - stitch - technique (termino - terminal, isoperistaltic) (figure 1(a)). it included median laparotomy, transverse transection of the ileum, and sewing by single - stitch - technique. male lewis rats (n = 27) received hfd between the 9th and the 18th weeks of life. at 11 weeks of life, an oral glucose tolerance test (ogtt) and an insulin tolerance test (itt) were performed in all animals. at 12 weeks of life, ileal interposition (iip) or sham operation was performed on stz - treated animals (n = 9, each). at 15 weeks of life, a second ogtt and itt were performed in all animals. at 17 weeks of life, glucose - induced secretion of glp-1 one week later, the animals were sacrificed and the different segments of small intestine were used for ex vivo measurements of glucose uptake, immunohistochemistry, and electron microscopy. polyclonal antibodies against amino acids 585600 (pkdtieidaeapqkek) of rat sglt1 (rsglt1-ab) were raised in rabbits and affinity - purified using the respective antigenic peptide as described. polyclonal antibody against glucagon like peptide-1 (c-17, sc-7782, and glp-1-ab) raised in goat was obtained from santa cruz biotechnology inc. the secondary antibodies, cy3-labeled goat anti - rabbit igg (garcy3) and alexa fluor 488-labeled chicken anti - goat igg (cag-488f, a21467), were obtained from jackson immunoresearch laboratories inc. (west grove, pa) and life technologies (darmstadt, germany), respectively. fixation of the tissue with 4% paraformaldehyde, cutting of tissue cryosections, and immunostaining protocol were described in detail earlier. in brief, 4-m thick cryosections of fixed intestinal tissue were cut and collected on microscope slides. following rehydration, antigen retrieval was performed by heating the sections in 10 mm citrate buffer (ph 6.0) in a microwave oven and incubating them in triton - x-100-containing pbs solutions. the sections were blocked by incubation with 1% bovine serum albumin (in pbs) and incubated overnight in a refrigerator with pbs containing affinity - purified rsglt1-ab (1 : 500). then, the sections were rinsed and incubated for 60 min at room temperature with the secondary antibody garcy3. for immunostaining with glp-1-ab, sections were similarly processed with glp-1-ab and the secondary antibody cag-48. after staining, the sections were overlaid with vectashied (vector laboratories inc., burlingame, ca, usa), covered with a coverslip, and sealed with nail polish. stained slides were photographed with a keyence biorevo bz-9000 microscope (keyence corporation, osaka, japan). the full focus function of the bz - ii image analysis application was used to merge captured images into a single image. for comparison of staining intensities of rsglt1-ab immunoreaction ileum from sham - operated rats and interposed ileum were proceeded on identical slides. exposure time and rsglt1-ab concentration were adjusted to a range in which the observed fluorescence staining intensity was proportional to the concentration of the primary antibody. semiquantification was performed with program imagej 1.46r supplied by the national institute of health (bethesda, maryland, usa). to compare staining of bbm in different samples, fluorescence images with 100-fold magnification as shown in figures 7(d) and 7(e) were used. staining of the bbm was quantified by analyzing the staining intensity of bands with constant width covering bbm segments. the obtained staining intensities were normalized to the length of the analyzed bands which was determined in parallel. the total length of bbm in a given cross section was determined using the imagej function. ileal segments were fixed in 4.5% glutaraldehyde in 0.1 m phosphate buffer, ph 7.2. after washing with this phosphate buffer, specimens were fixed for 1 h with 1% osmium tetroxide in phosphate buffer and washed with water. specimens were dehydrated in ascending concentrations of ethanol including en - bloc contrasting using 2% uranyl acetate in 70% ethanol for 1 h, embedded in epon812, and ultrathin sections were prepared. sections were poststained with 2% uranyl acetate and 0.2% lead citrate and observed using a leo ab 912 transmission electron microscope (zeiss nts, oberkochen, germany). blood glucose was measured between 9 and 10 a.m. in nonstarved rats or in rats after an 18-hour fast. blood (2 l) was collected from the tail vein and analyzed using the amperometric glucose oxidase method (glucose meter, accu - chek aviva). for monitoring insulin levels after overnight starvation and 5 or 15 min after application of d - glucose (3 g d - glucose / kg body weight) by oral gavage, blood was collected from the portal vein. insulin measurements in the plasma were performed with the insulin elisa number 80-insmsu - e01 from alpco diagnostics (salem nh, usa) according to the manufacturer 's instructions. after 18 h of fasting, blood glucose was measured at 10 a.m. (time 0). then 3 g d - glucose / kg body weight was applied by oral gavage and blood glucose was determined 15, 30, 60, 90, 120, and 180 min after administration. at 10 a.m., 0.75 iu / kg human insulin (insuman rapid, sanofi - aventis deutschland, frankfurt, germany) was administered intraperitoneal to rats after an 18-hour fast. blood glucose was measured before insulin injection and 30, 60, and 90 min after insulin injection. to determine glp-1 in plasma, blood was obtained from tails before and 15 min after the rats had been challenged with 3 g d - glucose / kg body weight by oral gavage. total glp-1 was measured using the glp-1 total elisa ezglp1t-36k kit from emd millipore, merck kgaa (darmstadt, germany). uptake measurements were performed as described. in brief, rats were starved for 18 h and sacrificed between 10 a.m. and noon. the small intestines were removed and perfused with krebs - ringer buffer (25 mm hepes, 108 mm nacl, 4.8 mm kcl, 1.2 mm kh2po4, 1.2 mm cacl2, ph 7.4, and 37c). the small intestine was everted and the regions selected for uptake measurements (figure 1(a)) were cut into four segments of 1 cm length. the segments were incubated for 2 min at 37c with krebs - ringer buffer containing 10 m of the sglt1 specific glucose analogue [c]-methyl - d - glucopyranoside (amg), with or without 0.2 mm of the sglt1-specific inhibitor phlorizin. uptake was stopped by transferring the segments into ice cold krebs - ringer buffer containing 0.2 mm phlorizin. after washing with ice cold krebs - ringer buffer, the length of the individual segments was measured under a microscope, and the segments were solubilized with soluene-350 (perkin elmer inc., waltham, ma, usa). mean values sem are indicated. for changes in body weight or plasma glucose concentrations over time (figures 2, 3, and 4) significances of differences were analyzed by 2-way anova followed by bonferroni 's post hoc comparisons. for comparison of glp-1 concentrations and glucose uptake in more than two samples (figures 5 and 6), the 1-way anova test with tukey 's post hoc comparison was performed. the experiments were performed with male lewis rats (n = 27) fed with hfd between the 9th and the 18th weeks of life (figure 1(b)). after two weeks on hfd, the starting mean body weight of 204 9 g had increased to 276 2.5 g (p < 0.001) (figure 2). eighteen of the 27 animals were treated with stz in their 11th week of life. four weeks after surgery both groups showed a similar body weight that was slightly increased compared to two weeks after hfd (313 6.7 g) (figure 2). the body weight gain of these animals was significantly smaller compared to untreated control animals on hfd (395 6.6 g, p < 0.001). a similar reduction of weight increase during the first weeks after iip and sham surgery has been described for rats on standard diet with low - dose stz - induced diabetes and for a genetic type 2 diabetes mellitus rat model. however, in these experiments, a reduction of body weight after iip surgery compared to sham surgery was clearly evident after longer postsurgery periods [12, 26, 29, 30, 37, 38, 40, 41, 43, 44, 46, 47, 58, 62 ]. consistent with the previous results, we observed that hfd for eight weeks did not increase nonfasting blood glucose (figure 3). in 11-week - old rats on hfd, blood glucose was 116 3 mg / dl (n = 27). two weeks after stz treatment, nonfasting blood glucose was significantly increased to 434 24 mg / dl (n = 18) (figure 3). sham operation performed three weeks after stz treatment did not affect high blood glucose levels during the following three weeks (439 34.8 mg / dl, n = 9). in contrast, iip surgery significantly lowered nonfasting blood glucose to 142 8.7 mg / dl (n = 9) within three weeks after surgery (figure 3). ogtt and itt confirmed the previously described observations that the employed protocol for stz treatment of rats on hfd impaired glucose tolerance and decreased insulin sensitivity. presurgery ogtt measurements of plasma insulin and itt were performed on rats in the 12th week of life with and without diabetes (figure 1(b)). in nondiabetic rats, glucose values during ogtt increased significantly to 151 13.1 mg / dl after 30 min and decreased to the starting levels (95.7 1.5 mg / dl) after 3 h (figure 4(a)). in stz - treated diabetic rats, 3 h after glucose gavage, blood glucose was still significantly higher (186 14 mg / dl versus 95.7 1.5 mg / dl, p < 0.001). plasma insulin levels in blood from the portal vein were measured after overnight starvation and 5 min and 15 min after oral gavage with d - glucose. after overnight starvation, the plasma insulin in nondiabetic rats was higher compared to the stz - treated animals (0.44 0.07 ng / ml versus 0.09 0.01 ng / ml, p < 0.01, n = 4 each). 5 min after application of d - glucose, insulin levels were increased in nondiabetic rats (1.81 0.10 ng / ml, n = 4, p < 0.001) and in stz - treated rats (0.33 0.01 ng / ml, n = 4, p < 0.001). 15 min after glucose application, similar insulin concentrations were observed in nondiabetic and stz - treated diabetic rats (0.44 0.05 ng / ml versus 0.47 0.04 ng / ml). the data indicate that the insulin secretion by cells was strongly reduced after stz treatment but not abolished completely. after intraperitoneal injection of 0.75 iu / kg insulin in nontreated rats during itt, blood glucose decreased within 90 min from 98.5 1.8 mg / dl (100%) to 41.5 3.9 mg / dl (42%) (figure 4(b)). in the stz - treated rats, the same amount of insulin did not provoke a decrease in blood glucose indicating that these rats were insulin - resistant (figure 4(b)). diabetic rats received iip or sham surgery in the 13th week of life (figure 1(b)). ogtt and itt after surgery were performed in the 15th week of life (four weeks after stz treatment). in sham - operated animals, similar results in ogtt and itt were obtained (figures 4(c) and 4(d)) as in nonoperated animals in the 12th week of life (one week after the stz treatment) (figures 4(a) and 4(b)). this indicates that stz - induced glucose intolerance and insulin insensitivity were not changed by sham surgery or time. in the 15th week of life and two weeks after iip surgery, glucose excursion during ogtt was comparable to nondiabetic animals on hfd (compare figure 4(c) with figure 4(a)). remarkably, blood glucose measured 15 min after glucose gavage which mainly represents intestinal glucose absorption was not decreased significantly (figure 4(c)). this is in contrast to djb (see figure 4(c) in) and suggests that intestinal glucose absorption is not decreased after iip. the injection of 0.75 iu / kg insulin decreased blood glucose after 90 min from 99.7 2.5 mg / dl to 49.5 2.2 mg / dl (figure 4(d)). the data show that iip surgery improved glucose tolerance and insulin sensitivity in rats with t2ld. improved glucose tolerance and insulin sensitivity following iip surgery have been previously reported in two nonobese genetic diabetic models : the goto - kakizaki - rats [13, 26, 38, 39 ] and the zucker rats. to verify that iip surgery increased glucose - stimulated glp-1 secretion in the employed model of type 2 like diabetes as reported by strader and coworkers [37, 38, 40, 42 ], we measured glp-1 concentrations in systemic blood before and 15 min after glucose gavage. sham - operated and iip - operated animals were compared in the 17th week of life four weeks after surgery (figure 5). in sham - operated animals, no increase in plasma glp-1 levels 15 min after glucose gavage was observed. after iip surgery compared to sham surgery, an elevated basal glp-1 level was measured ; however, this difference was not significant (p = 0.057). 15 min after glucose gavage of animals with iip surgery, the glp-1 concentration in the blood was about 3-fold increased. the data are consistent with previous reports which indicate that iip surgery increases the glucose - dependent secretion of glp-1 in small intestine of diabetic rats [26, 38, 39, 42, 44 ]. glucose absorption in small intestine is mediated by glucose uptake into enterocytes across the brush - border membrane (bbm) via the na - d - glucose cotransporter sglt1 followed by glucose efflux across the basolateral membrane of the enterocytes which is mediated by the passive glucose transporter glut2. sglt1-mediated glucose uptake via the brush - border membrane is rate limiting for small intestinal glucose absorption. the highest expression of sglt1 is observed in duodenum, followed by jejunum and ileum. previously we reported that glucose absorption in small intestine after djb surgery was reduced not only due to the shortened small intestinal alimentary path but also due to a downregulation of sglt1 in the remaining jejunal part. to determine whether small intestinal glucose absorption is also reduced after iip surgery, we determined sglt1-mediated transport activity in the small intestinal regions of sham- and iip - operated rats in the 18th week of life in the small regions indicated in figure 1(a). we measured phlorizin - inhibited uptake of 10 m [c]amg by everted small intestinal fragments (figure 6). this transport activity is almost exclusively mediated by sglt1 [24, 25 ]. in sham - operated rats, the highest phlorizin - inhibited amg uptake related to intestinal length amg uptake in the three analyzed jejunal regions of sham - operated rats was similar and was about 30% smaller compared to duodenum. amg in ileum of sham - operated animals was about 70% smaller compared to duodenum. after iip surgery, amg transport measured in duodenum, in jejunal part proximal to the interposed ileal fragment (je1 iip in figure 6), and in jejunal part distal to the interposed ileal fragment (je2 iip in figure 6) was not influenced by iip surgery. amg transport in the ileal region distal to the dissected ileum (il2 iip in figure 6) was similar to transport in the ileal regions analyzed in sham - operated animals. importantly, phlorizin - inhibited amg uptake per intestinal length of the interposed ileal fragment (see figure 6, il1 iip interposed) was similar to uptake measured in jejunum. the data indicate that iip surgery did not decrease glucose absorption in small intestine at variance with djb. morphological changes of the interposed ileal segment after iip surgery have already been described three decades ago and were also observed since [12, 58, 62, 63 ]. the interposed ileal segment has been reported to increase in weight and diameter [12, 58 ]. it has been described that the wet weight, the protein content, and the dna content of the mucosa of the interposed ileal segment increase about 3-fold. five weeks after iip surgery, the diameter of the interposed ileal segment had increased 1.5 0.1 times (12 determinations performed in 9 sections of 3 animals, p < 0.01 for difference). the length of the villi had increased 1.6 0.1 times (30 determinations performed in 9 sections of 3 animals, p < 0.01 for difference), whereas the width of the villi did not change significantly (figures 7(b)7(e)). the length of the bbm per cross section had increased 4.8 0.6 times (7 determinations performed in 3 animals, p < 0.001 for difference). we compared the epithelial cell layer of the interposed ileum with the respective sham - operated ileal segment using transmission electron microscopy. in sham - operated animals, the ileal surface was continuously covered by the typical monolayer of cylindrical enterocytes (figure 8(a)). in contrast, only part of the interposed ileum was covered by a monolayer of enterocytes, whereas about 75% was covered by an epithelial layer containing 2 or more layers of nuclei indicating hyperplasia (figures 8(b) and 8(c)). in sham - operated animals, we never observed more than one nucleus per epithelium height (56 determinations performed in 9 sections of 3 animals) but determined 1.8 0.6 nuclei per epithelium height (56 determinations performed in 9 sections of 3 animals, p < 0.01 for difference) in regions of interposed ileum with hyperplasia. the mean height of enterocyte monolayer in sham - operated animals was 17.1 2.2 m. this is significantly smaller compared with the mean height in interposed ileum with hyperplasia (22.7 2.4 m) (figure 9(a)). the microvilli of enterocytes in ileum of sham - operated animals appeared to be longer (figure 8(d)) compared to microvilli of enterocytes in regions of interposed ileum with hyperplasia (figure 8(e)). significantly different values of 1.02 0.04 m and 0.86 0.04 m were determined (figure 9(b)). the data indicate hyperplasia and a lower degree of cell surface differentiation of epithelial cells in the interposed ileum. using a specific antibody against rat sglt1 (rsglt1-ab), we employed immunohistochemistry to compare the amounts of sglt1 at the brush - border membrane (bbm) of the interposed ileum with the respective segment of sham - operated animals. with this antibody, we had previously obtained staining of the bbm of rat small intestine that could be blocked with antigenic peptide. in figures 7(b)7(e) we compared rsglt1-ab staining of ileum from sham - operated animals with that of interposed ileum in iip animals. the bbm of ileum from sham - operated animals was stained more strongly than bbm of the interposed ileum (figures 7(b)7(e)). quantification of bbm immunostaining related to bbm length revealed 2.5 1.5-fold higher staining intensity in ileum of sham - operated animals than in interposed ileum (80 measurements in 9 sections of 3 animals each, p < 0.01 for difference). because the length of the bbm per cross section in interposed ileum was increased 4.8-fold compared to ileum of sham - operated animals (6 determinations in three animals each), 1.9-fold more sglt1 protein was associated with the total bbm - surface of the interposed ileum compared to ileum of sham - operated rats. the similar 2.3-fold increase in sglt1-mediated glucose uptake per intestinal length suggests that sglt1 in the bbm of interposed ileum is functionally active. the increased glucose - induced release of glp-1 from l - cells observed in animals after iip surgery may be explained by an increased stimulation of l - cells due to contact with higher intraluminal glucose concentrations after surgery. to determine whether the number of l - cells in the mucosa in the interposed ileum was altered, we stained interposed ileum and the corresponding ileal fragment of sham - operated animals with antibody against glp-1 and counted the immunoreactive l - cells per ileal cross sections. in ileum of sham - operated animals 9.2 2.5 and in the interposed ileum 17.5 1.2 l - cells per ileal cross section were counted (15 determinations in 3 animals each, p < 0.01 for difference). the data are consistent with previous reports [37, 39, 64 ]. they suggest that an increase in the number of l - cells in the interposed ileum contributes to the higher glucose stimulation of glp-1 secretion. in the present study, we show in rats with an experimental induced type 2 like diabetes (t2ld) that weight - independent improvement of diabetic control observed after iip can not be explained by changed glucose absorption. after glucose uptake, a slowed down increase of blood glucose was expected because interposition of the distal ileum with low expression of sglt1, which has been shown to be rate limiting for small intestinal glucose absorption, was supposed to decrease the rate of glucose absorption. however, we show that sglt1-mediated glucose uptake in the interposed ileal segment is upregulated to a similar level as in the jejunum. the upregulation of glucose uptake is due to an increase of total sglt1 protein at the enlarged luminal surface of the interposed ileal segment. to determine the direct role of sglt1-mediated glucose absorption for weight - independent improvement of glycemic control by bariatric surgery, we investigated the effects of iip surgery in rats with an experimental type 2 like diabetes. we chose iip because, unlike other bariatric procedures, it does not alter regulatory mechanisms governed by the stomach [14, 15 ]. in addition, iip does not alter the length of the alimentary pass in contrast to the djb and rygb. in rats on hfd although the employed model of experimental diabetes does not depict diabetes mellitus type 2 perfectly, close similarities to the type 2 diabetes were observed. fasting blood glucose was not increased significantly ; however, an increased and broadened peak of blood glucose was observed in the ogtt. furthermore, a reduced but not completely abolished function of pancreatic cells was demonstrated. fasting plasma insulin in the portal vein and the increase of insulin after oral gavage with glucose were reduced but not abolished. two weeks after iip, the pathologic glucose tolerance had improved and the insulin sensitivity increased resembling the parameters of nondiabetic animals. four weeks after iip, glp-1 secretion after glucose gavage had increased. because in our model the improvement in glycemic control was observed at a time when the body weights of the sham - operated and iip - operated animals were similar, overall metabolic changes are not supposed to cause the observed improvement of diabetes. contributions of changes in feeding behavior and energy expenditure can not be excluded because these parameters were not analyzed. to determine effects of iip on glucose absorption, we compared phlorizin - inhibited uptake of amg in various parts of small intestine five weeks after sham operation and iip surgery. phlorizin - inhibitable amg uptake is mediated by the na - d - glucose cotransporter sglt1 in the bbm of the enterocytes. it is proportional to the rate of small intestinal glucose absorption because transport via sglt1 across the bbm is rate limiting for glucose absorption. we performed the uptake measurements in various parts of small intestine including the interposed ileal segment in iip - operated animals. the measured uptake was related to the length of the analyzed small intestinal segments because, in contrast to intestinal mass, intestinal protein, or intestinal dna, the length of the ileum remains almost constant after iip. because the sglt1-mediated uptake of amg in the interposed ileal segment per unit length was increased to a value similar to uptake in jejunum of sham - operated animals, the rate of small intestinal glucose absorption remained largely unchanged after iip. consistent with previous reports, we observed an increase in the secretion of glp-1 in response to glucose gavage after iip [26, 3740, 42, 4448 ]. the effect of iip on glp-1 secretion by l - cells is probably critically involved in the body weight - independent therapeutic effect of iip surgery on diabetes. this supposition is supported by data showing that the improvement in the ogtt after iip was blunted in the presence of an antagonist of the glp-1 receptor. increased secretion of the anorexigenic enterohormone pyy after iip [30, 37, 46 ] may also be involved in weight reduction and long - term improvement of diabetes. because an increase in glucose - dependent glp-1 secretion has also been observed after other bariatric procedures, such as djb and rygb [26, 37, 38 ], an increase of glp-1 secretion is probably also involved in the weight - independent antidiabetic effects of these procedures. however, one or more additional antidiabetic mechanisms may contribute, at least in the case of rygb surgery. a recent study reports improvement in glycemic control after rygb surgery in mouse models with functional glp-1 receptor deficiency. the biological and biomedical functions of glp-1 strongly support its playing a pivotal role in the weight - independent improvement of diabetes after iip. glp-1 has been shown to be a highly effective antidiabetic enterohormone and glp-1 analogues are used for antidiabetic therapy. glp-1 increases glucose - dependent insulin secretion, exhibits trophic effects on cells, inhibits glucagon secretion, inhibits glucose production in liver, increases glucose uptake in heart, inhibits gastric emptying and postprandial gastrointestinal motility, and reduces appetite [21, 22, 66, 67 ]. a unifying hypothesis to explain why different bariatric procedures lead to an increase in glucose - induced glp-1 secretion is that all procedures lead to an increased glucose activation of l - cells after glucose - rich meals. after iip, the terminal ileum containing most l - cells is located within the proximal jejunum where the intraluminal glucose concentration is high. in djb and rygb, duodenum and the proximal part of jejunum are excluded from the alimentary path so that the amount of glucose reaching the ileum after a glucose - rich meal is increased. this effect is enhanced after djb and rygb by downregulation of sglt1 in the jejunal segment that remains in the alimentary path [11, 32, 68 ]. shortening of the food retention time in the stomach and changes in small intestinal motility after rygb are also thought to increase the glucose concentration in the ileum after glucose - rich meals. bariatric procedures may change intestinal morphology and the subcellular organization of enterocytes as well as the expression of functional proteins in enterocytes. these changes may occur in response to surgery - induced impairment of innervation and/or vascular supply as well as altered nutrient signals that regulate expression of transporters and of metabolic enzymes in the enterocytes. morphometric measurements after rygb surgery indicated an increase in bowel width, villus height, and crypt depth in the common alimentary limb [32, 67 ]. several morphological changes in the interposed ileum after iip have been described : an increase in weight and diameter [12, 58 ], broadening of the mucosal and muscular layers, and increase in villus height. the observed increase in a marker for epithelial proliferation indicates hyperplasia of the enterocytes [12, 37, 63 ]. in the present study, we confirm the increase in diameter, the thickening of total bowel wall, and the increase in villus height. with electron microscopy, we observed that about 70% of the intestinal mucosa showed thickening of the epithelial layer and that the monolayered cylindrical epithelium was partially transformed into a two- or triple - row epithelium. we further observed that the microvilli of enterocytes of the interposed ileum were shorter compared to the sham - operated ileum. semiquantitative analysis of sglt1-ab immunoreactivity revealed that the amount of sglt1 protein per unit length of the bbm decreased 2.5-fold after interposition. however, because the surface of the bbm lining the lumen of the ileum had increased 4.8-fold, the amount of sglt1 lining the luminal surface showed a 1.9-fold increase. this value is similar to the observed 2.3-fold increase of sglt1-mediated uptake per small intestinal length, suggesting similar plasma membrane incorporation and activity of sglt1 in both cases. noteworthy is the increased number of glp-1-secreting l - cells per cross section after interposition of the ileum. for example, diameter and luminal surface containing sglt1 increase, and glucose absorption capacity of the interposed ileal segment becomes similar to jejunum. thus, improvement of weight - independent glycemic control following iip surgery is independent of a change in glucose absorption. the observed increase of glucose - induced glp-1 secretion after iip due to increased number of l - cells in the interposed ileal segment and their enhanced exposition to nutrients including glucose provides a plausible explanation for the weight - independent antidiabetic effect of iip. whereas bypass procedures that are combined with partial or total removal of the stomach like rygb may be best suited to treat morbid obesity without and with diabetes, a surgical procedure that does not change the stomach, such as djb or iip, may be best suited to treat type 2 diabetes of nonobese or slightly overweight patients. | bariatric operations in obese patients with type 2 diabetes often improve diabetes before weight loss is observed. in patients mainly roux - en - y - gastric bypass with partial stomach resection is performed. duodenojejunal bypass (djb) and ileal interposition (iip) are employed in animal experiments. due to increased glucose exposition of l - cells located in distal ileum, all bariatric surgery procedures lead to higher secretion of antidiabetic glucagon like peptide-1 (glp-1) after glucose gavage. after djb also downregulation of na+-d - glucose cotransporter sglt1 was observed. this suggested a direct contribution of decreased glucose absorption to the antidiabetic effect of bariatric surgery. to investigate whether glucose absorption is also decreased after iip, we induced diabetes with decreased glucose tolerance and insulin sensitivity in male rats and investigated effects of iip on diabetes and sglt1. after iip, we observed weight - independent improvement of glucose tolerance, increased insulin sensitivity, and increased plasma glp-1 after glucose gavage. the interposed ileum was increased in diameter and showed increased length of villi, hyperplasia of the epithelial layer, and increased number of l - cells. the amount of sglt1-mediated glucose uptake in interposed ileum was increased 2-fold reaching the same level as in jejunum. thus, improvement of glycemic control by bariatric surgery does not require decreased glucose absorption. |
technology progress in all areas of life has resulted in a need for small devices with higher operating speeds, and this is why extensive researches in these fields have been completed. finding a suitable alternative is necessary since when mos transistors continue to scale deeper, several device non - idealities appear and cause significant intrinsic device hurdles such as leakage, power and quantum effect. cnfets are one of the molecular devices that avoid most fundamental silicon transistor restriction and have ballistic or near ballistic transport in their channel. in cnfets, carbon nanotubes (cnts) are used as transistor channel. while a cnt contact directly to source and drain, schottky barrier is made in their junctions ; therefore, these transistors are called schottky barrier cnfet (sb - cnfet) (fig sb - cnfets exhibit strong ambipolar characteristics that constrain usage of these transistors in conventional cmos - like logic families. this contact limits the transconductance in the on state, and thus ion / ioff ratio becomes rather low. 1b is doped in un - gated portions and has similar behavior to cmos transistors ; thus, this type is named mosfet - like cnfet. the features of mosfet - like cnfets are ; unipolar characteristics dissimilar to schottky - barrier transistors, more scalability in comparison to sb - cnfet, reducing the off leakage current and having higher on current in source - to channel junction because of absence of the schottky barrier. in this paper three possible types of cntfets a schottky barrier (sb) b doped - s / d transistors the cnfet threshold is dependant on the diameter of the cnt used as a channel, so with a suitable diameter, a transistor with desired threshold will be attained. with diameter dcnt, cnfet threshold can be calculated by using (1), and formula (2) depict how cnt diameter can be calculated where n1 and n2 are chirality of cnt and is the lattice constant equal to 2.49 there are two methods by which new devices can be built using cnfets ; first one is by transporting existing logical functions directly to a new technology with replacing mosfet with cnfet and the second one uses special properties of cnfets to design entirely new circuit. one of the important parts of the processor, which participates in many operations such as floating point computing and address generating, is full adders. some of these implementations have used one logic style for the whole full adder and others that are hybrid full adders have used two or more logic style in a cell. although they all have similar function, the way of designing intermediate nodes or the transistor count is varied. c - cmos full adder cell uses one logic style and is based on regular cmos structure with conventional pull - up and pull - down transistors. the outputs are full swing, but with 28 transistors, it utilizes a large space in a chip. the outputs are full swing and make complementary outputs simultaneously, but the number of transistors used (transistor count) is 32., hybrid full adder cells are categorized in three forms, xor - xor, xor - xnor and xnor - xnor adders and presented 24 transistor full swing full adder cell called hybrid - cmos full adder in xor - xnor form. the introduced adders are based on multiplexers, full adder presented in uses 10 transistors, but the outputs are not full swing. majority function is a logic circuit that performs as a majority vote to determine the output of the circuit. this function has only odd numbers of input, and its output is equal to 1 when the number of inputs 1 is more than 0. as depicted in (3), when this function has three inputs, it works like carry - out in full adder, so with applying (4), the sum can be calculated design uses four transistors and seven capacitors and has full swing outputs. in, two full adders are presented using cnfets in their designs, one used four cnfets and seven capacitors and the other utilized only two transistors but two resistors employed caused an increase to the power dissipation. in next section, we exploit cnfet characteristics in order to introduce a new full adder that uses eight carbon nanotube transistors with eight capacitors, and it has full swing outputs. in sect. 3, we will compare it with contemporary full adder based on carbon nanotube transistor with delay, power consumption and power - delay product criterions. majority - not (minority) function is a logic gate with odd numbers of inputs, and its output is high when the numbers of 1 s is less than the number of 2 presents a circuit used to implement minority function with inverter utilizing high - vth for both nmos and pmos. this circuit can be used to implement nand gate using high - vth nmos and low - vth pmos, and nor gate using low - vth nmos and high - vth pmos. formula (1) and (2) in previous section illustrate how the appropriate cnfet threshold voltage can be calculated. as shown in fig. 3, in this paper for designing nand and nor function, we calculate the output sum by formula (5) majority - not function schematic of proposed adder as mentioned before, using a conventional inverter and three capacitors, the majority function is attained and by replacing nand and nor gates with three capacitors and an inverter, fig. 4a will be attained. in view of the fact that three separate capacitors are used for designing each of these gates (9 in total) and that these input capacitors influence the circuit performance by reducing the number of capacitors, the overall performance of the system can be improved. we compared the proposed design with coeval cnfet full adders presented in. to compare these adders, delay, power dissipation and pdp (power - delay product) we have measured the delay of the cell from the moment that inputs reach 50% of supply voltage level to the time that the latest of the sum of the signal reach the same voltage level. for being more realistic, we place buffers in the two outputs (two cascaded inverter). simulations are carried out using hspice with cnfet model with the supply voltage at 0.6 v. table 1 illustrates the achieved values, and among the analyzed adders, the adder in, which does not use resistors, consumes less power but has more delay than our proposed adder. as illustrated in table 1, the proposed full adder cell has the best pdp in comparison to other contemporary full adders. in this paper, a novel high speed majority - not (minority) function based cnfet full adder is proposed. the main idea of this design is a new approach for implementing the sum output. that is, sum can be considered as minority(a, b, c,2nand(a, b, c),2nor(a, b, c)). this adder has a simple design, because it only uses capacitors and inverter in its structure. simulation results illustrate that we have achieved a significant improvement in terms of delay and power - delay product. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. | carbon nanotube filed - effect transistor (cnfet) is one of the promising alternatives to the mos transistors. the geometry - dependent threshold voltage is one of the cnfet characteristics, which is used in the proposed full adder cell. in this paper, we present a high speed full adder cell using cnfets based on majority - not (minority) function. presented design uses eight transistors and eight capacitors. simulation results show significant improvement in terms of delay and power - delay product in comparison to contemporary cnfet adder cells. simulations were carried out using hspice based on cnfet model with 0.6 v vdd. |
cell growth is as fundamental for organismal growth as cell division. without cell growth, no organism can grow. yet, compared to cell division, cell growth has been inexplicably neglected by cell biologists. proliferating cells in culture tend to double their mass before each division, but it is not known how cell growth is coordinated with cell - cycle progression to ensure that the cells maintain their size. we have been studying how this coordination is achieved in mammalian cells, using primary rat schwann cells as a model system. yeast cells are thought to coordinate cell - cycle progression with cell growth through the action of cell - size checkpoints in g1 and/or g2, where the cell cycle can pause until the cell reaches an adequate size before proceeding into s or m phase, respectively. it is still uncertain how such checkpoints work, although there is evidence that the coupling of the threshold levels of certain cell - cycle activators to the general rate of translation plays a part. it is also unknown whether mammalian cells have cell - size checkpoints, although it is widely believed that they do [3,7 - 9 ]. for most populations of proliferating eukaryotic cells in culture, including yeast cells and mammalian cells, the mean cell size remains constant over time, even though individual cells vary in size at division. thus, cells that are initially bigger or smaller than the mean after mitosis tend to return to the mean size over time. how is this achieved, and is the mechanism the same for all eukaryotic cells ? for yeast cells, it has been shown, by blocking cell - cycle progression and measuring cell growth rate, that big cells grow faster than small cells. thus, for a population of yeast cells to maintain a constant average cell size and cell - size distribution, it would seem that cell - size checkpoints must be operating. without such checkpoints, yeast cells that are born larger than the mean birth size will grow faster than those that are born smaller, and these larger cells will produce still larger daughters, which will then grow even faster. thus, the spread of sizes in the population would increase over time, which does not happen, presumably because cell - size checkpoints ensure that cells that are larger or smaller than the mean at cell division tend to return toward the mean before dividing again. cells proliferating in nutrient - rich media generally grow at a faster rate and divide at a larger size than cells proliferating in nutrient - poor media. when switched from a nutrient - poor medium to a nutrient - rich medium, the cell cycle arrests and resumes only when the cells have reached the appropriate size for the new condition, which occurs within one cell cycle. thus, the cells can adjust their size threshold rapidly in response to changing external conditions. it is often assumed that animal cells also coordinate cell growth with cell - cycle progression by means of cell - size checkpoints, although the evidence for this is weak. proliferating mammalian cells, like proliferating yeast cells, maintain a constant average cell size and size distribution over time despite differences in the size of cells at division, but this does not necessarily mean that cell - size checkpoints are operating. if large cells do not grow faster than small cells, a cell - size checkpoint is not required to account for this behavior. this is illustrated in figure 1, where the sizes of two, unequally sized, hypothetical daughter cells are followed through several cell cycles. if the cells and their progeny grow and progress through the cell cycle at the same rates, they will eventually converge to a common mean size (figure 1). the sizes converge, even in the absence of a cell - size checkpoint, because the larger cells do not double their cell mass each cycle, and the smaller cells more than double their cell mass each cycle. thus, proliferating cells can maintain a constant average size and size distribution without cell - size checkpoints, as long as individual cells grow at the same rate irrespective of their size. without cell - size checkpoints, however, cells that are born larger or smaller than the mean birth size will take longer to attain the mean birth size than if they had cell - size checkpoints. we showed previously that, unlike in yeasts, cell growth is not necessarily rate limiting for cell - cycle progression in primary rat schwann cells. extracellular mitogens that promote cell - cycle progression but not cell growth can shorten the cell cycle in schwann cells. this finding suggested that yeasts and schwann cells might use different strategies to coordinate cell growth and cell - cycle progression. it did not, however, indicate whether schwann cells use cell - size checkpoints for this coordination. here, we show that, unlike yeasts, primary rat schwann cells grow at a rate that is independent of their size, over a large range of sizes. in addition, we demonstrate that, unlike yeast cells, schwann cells do not adjust their size quickly when shifted from a relatively poor to a relatively rich environment ; instead, their mean cell size increases gradually over many divisions. these results suggest that schwann cells, and probably many types of mammalian cells, do not need and do not have cell - size checkpoints. instead, they apparently use extracellular signals to coordinate their growth with cell - cycle progression. we maintained the cells in a proliferative state in ' complete ' medium : dulbecco 's modified eagles ' medium (dmem), supplemented with 3% fetal calf serum (fcs), the neuregulin glial growth factor 2 (ggf 2), and the adenylyl cyclase stimulator forskolin. we passaged the cells before they reached confluence and measured their size (volume) in a coulter counter after removing the cells from the culture dish with trypsin at the time of passage. as expected, the average size of the cells remained unchanged with repeated passaging (figure 2). to determine if schwann cell growth depends on cell size, we used the dna polymerase inhibitor aphidicolin to arrest the cells in s phase. we then replated them and treated them with aphidicolin and simultaneously stimulated them with complete medium to re - enter the cell cycle and begin to grow. in these conditions, the cells remained arrested in s phase and continued to increase in size for many days. if schwann cell growth were like yeast cell growth, the rate of cell growth would increase over time as the cells enlarged, and the growth curve would be exponential - like. to determine cell - growth rate, we measured the volume of cells in parallel cultures every 24 hours after removing the cells from the culture dish with trypsin. as can be seen in figure 3a, cell growth was linear over a period of 5 days, indicating that the cells added a constant amount of volume each day, independent of their size. to confirm that the increase in cell volume reflected an increase in protein, we measured the amount of protein per cell, with similar results (figure 3b). these findings indicate that large schwann cells do not grow faster than small schwann cells, at least in these conditions. as explained in the background, this means that cell - size checkpoints need not be invoked to explain why these cells maintain a constant average size (figure 2) and cell - size distribution (not shown) when proliferating in complete medium. although the experiments were not done with this question in mind, there have been previous reports indicating that other types of mammalian cells grow linearly, independent of their size. hutson and mortimore, for example, starved mice, which causes the liver to shrink rapidly, solely as a result of hepatocyte shrinkage, rather than an increase in cell death or a decrease in cell proliferation. when they re - fed the mice, the liver re - grew rapidly, entirely as a result of hepatocyte growth, which was clearly linear. similarly, when deleu. stimulated dog thyrocytes with insulin, the thyrocytes grew but did not proliferate, and the growth was linear. in an experiment to test whether cell - size checkpoints were necessary, brooks and shields separated quiescent 3t3 cells by size and stimulated them to re - enter the cell cycle ; they found that large cells did not grow faster than small cells at the same point in the cycle, consistent with linear growth. we have not found any reports in which big mammalian cells have been observed to grow faster than small cells of the same type and at the same point of the cell cycle. it thus seems likely that most mammalian cells grow linearly, independent of their size, and that they therefore do not require cell - size checkpoints to maintain a constant size distribution as they proliferate. our finding that serum - stimulated, aphidicolin - arrested schwann cells add the same net amount of protein per cell per day, independent of their size, raised the possibility that big schwann cells synthesize protein at the same rate as small schwann cells. to test this possibility we cultured schwann cells in complete medium and aphidicolin and, after 24, 48, or 72 hours, added [s]-methionine and [s]-cysteine for two hours. as can be seen in figure 4a, the rate of protein synthesis increased as the cells increased in size over time. as the net amount of protein added per day does not increase as the schwann cells get bigger (figure 3), the rate of protein degradation (and/or secretion) must also increase as the cells get bigger. to determine the rate of protein degradation, we cultured the cells in complete medium and aphidicolin and, after various times, added [s]-methionine and [s]-cysteine for 2 hours, as before. we then washed the cells and incubated them in non - radioactive medium for a 2 or 6 hour ' chase '. as can be seen in figure 4b, the rate of decrease in radiolabeled protein increased as the cells increased in size. thus, the rates of both synthesis and degradation of short - lived proteins increase with schwann cell size, and the net accumulation of protein is independent of size. it remains a mystery how mammalian cells maintain a constant difference between protein synthesis and degradation independent of their size, although there is evidence that this tight coupling between protein synthesis and degradation can depend on extracellular signals. we showed previously that schwann cell growth depends on extracellular signals, such as those present in fcs. to determine if cell growth remains linear in different concentrations of such extracellular factors, we cultured quiescent schwann cells in aphidicolin and various concentrations of fcs, and measured cell volume over time. as can be seen in figure 5, the rate of growth remained linear for up to 9 days (figure 5a) but increased with increasing amounts of fcs (figure 5b). even in 50% serum, cell growth remained linear and was faster than in 10% serum (not shown). thus, even at high concentrations of fcs, it seems that the levels of extracellular growth factors, rather than anything inside the cells, limit schwann cell growth. in figure 5c, we show how the spread of cell sizes changed as aphidicolin - arrested schwann cells grew over time. like cell size itself, the spread of sizes increased linearly with time, as expected in a situation where some cells are growing faster and some slower than the mean rate, but all are growing linearly, independent of their size. we have shown that the growth rate of schwann cells is linear, unlike in yeasts, which means that cell - size checkpoints are unnecessary to explain how proliferating schwann cells maintain their size in a particular environment. as discussed in the background, a crucial line of evidence for the existence of cell - size checkpoints in yeasts is that they can rapidly change the size at which they divide, by adjusting their size threshold, when switched to different nutrient conditions. we therefore tested whether proliferating schwann cells behave similarly when shifted from serum - free to serum - containing culture medium. if schwann cells had cell - size checkpoints, one might expect them to adjust their size rapidly to the new condition. if they do not have such checkpoints, one would expect the cells to adjust their size only gradually to the new conditions over a number of cell cycles, much as illustrated for the small cells in figure 1. we maintained purified schwann cells in a proliferative state on laminin, in dmem supplemented with ggf 2, forskolin, insulin, and serum - free schwann - cell - conditioned medium, with or without 3% fcs, passaging the cells when they reached near - confluence. in both conditions, the schwann cells maintained their average size over time, when assessed at the time of passage (figure 6a), although the cells in serum were, on average, more than twice the size of cells without serum (figure 6b). in this respect, the cells behave similarly to yeast cells, which grow at a faster rate and divide at a larger size when proliferating in a nutrient - rich medium than in a nutrient - poor medium. we then switched the schwann cells that had been proliferating in serum - free medium to serum - containing medium. we plated these ' switched ' cells and the cells maintained throughout the experiment in serum - containing medium at the same plating density both now in serum - containing medium. we passaged them when they reached about 300,000 cells per well, which was usually every 3 days. we counted cell numbers and measured mean cell volume of the population every day using a coulter counter. the average cell - cycle times of the two populations were approximately the same (figures 6c, d). unlike yeasts, the switched cells took around six divisions and about 10 days before they divided at the characteristic size of schwann cells maintained in serum - containing medium all along (figure 6e). the finding that big schwann cells grow at the same rate as small schwann cells means that they do not require cell - size checkpoints to maintain a constant size distribution as they proliferate. the finding that they take many divisions to adjust to new culture conditions strongly suggests that they do not have such checkpoints, or at least not ones that resemble those operating in yeast cells. in addition, their slow adjustment to a change in culture conditions is the behavior predicted by the hypothetical model illustrated in figure 1 for proliferating cells that grow linearly and do not have cell - size checkpoints. whereas proliferating populations of yeast cells and schwann cells can both maintain a constant size over time, they seem to do so in very different ways. for yeasts, cell - size checkpoints apparently operate to coordinate cell growth and cell - cycle progression. for schwann cells, by contrast, extracellular signals that stimulate cell growth, cell - cycle progression, or both, appear to control the size at which the cells divide. although a population of schwann cells maintained a constant average cell size if passaged frequently (figure 2), the cells decrease in size if not passaged, even if the medium was replaced every day (figure 7a), although they continue to proliferate (figure 7b). this is presumably because there was increased competition for extracellular growth factors as the cultures got denser. a similar competition for extracellular signals has been shown to regulate the size of lymphocytes in vivo. apparently, signaling for schwann cell growth is more affected by the competition than signaling for cell - cycle progression. we found previously that schwann cells do not maintain a constant size over time when proliferating in insulin - like growth factor i (igf - i) and ggf 2 in the absence of fcs or schwann - cell - conditioned medium, presumably because growth stimulation was insufficient to keep up with mitogenic stimulation. we suspect that the size of most proliferating animal cells in vivo is controlled by the levels of extracellular signals in a way that is similar to how schwann cell size is controlled in culture. in the few studies that have analyzed the size of proliferating animal cells during normal development, for example, it seems that cell size can vary significantly for the same cell type. during development of the wing imaginal disc in drosophila, for instance, the size of the disc cells varies throughout development : the cells initially grow without dividing and then proliferate and get progressively smaller., each yeast cell grows and divides as fast as the nutrient supply allows, and it must quickly adapt to changing extracellular conditions. the growth and division of animal cells, by contrast, must be carefully controlled and coordinated for the good of the animal as a whole, and this control relies mainly on intercellular signaling. thus, whereas yeast cell proliferation is controlled mainly by nutrients, animal cell proliferation is controlled mainly by signals from other cells. as such signals seem usually to be present at limiting, rather than saturating, concentrations, small changes in their levels can powerfully influence cell growth and proliferation. given its importance, it is surprising how little is known about how the levels of such signals are controlled in animals. animal cell proliferation also depends on nutrients, however, and our results do not exclude the possibility that cell - size checkpoints might be revealed by nutrient deprivation experiments. our findings also do not exclude the possibility that animal cells such as lymphocytes, which can proliferate in suspension like yeast cells, might use cell - size checkpoints to coordinate their growth with cell - cycle progression. these will be important avenues to explore in the future, but we shall leave this to others. we maintained the cells in a proliferative state in ' complete ' medium : dulbecco 's modified eagles ' medium (dmem), supplemented with 3% fetal calf serum (fcs), the neuregulin glial growth factor 2 (ggf 2), and the adenylyl cyclase stimulator forskolin. we passaged the cells before they reached confluence and measured their size (volume) in a coulter counter after removing the cells from the culture dish with trypsin at the time of passage. as expected, the average size of the cells remained unchanged with repeated passaging (figure 2). to determine if schwann cell growth depends on cell size, we used the dna polymerase inhibitor aphidicolin to arrest the cells in s phase. we then replated them and treated them with aphidicolin and simultaneously stimulated them with complete medium to re - enter the cell cycle and begin to grow. in these conditions, the cells remained arrested in s phase and continued to increase in size for many days. if schwann cell growth were like yeast cell growth, the rate of cell growth would increase over time as the cells enlarged, and the growth curve would be exponential - like. to determine cell - growth rate, we measured the volume of cells in parallel cultures every 24 hours after removing the cells from the culture dish with trypsin. as can be seen in figure 3a, cell growth was linear over a period of 5 days, indicating that the cells added a constant amount of volume each day, independent of their size. to confirm that the increase in cell volume reflected an increase in protein, we measured the amount of protein per cell, with similar results (figure 3b). these findings indicate that large schwann cells do not grow faster than small schwann cells, at least in these conditions. as explained in the background, this means that cell - size checkpoints need not be invoked to explain why these cells maintain a constant average size (figure 2) and cell - size distribution (not shown) when proliferating in complete medium. although the experiments were not done with this question in mind, there have been previous reports indicating that other types of mammalian cells grow linearly, independent of their size. hutson and mortimore, for example, starved mice, which causes the liver to shrink rapidly, solely as a result of hepatocyte shrinkage, rather than an increase in cell death or a decrease in cell proliferation. when they re - fed the mice, the liver re - grew rapidly, entirely as a result of hepatocyte growth, which was clearly linear. similarly, when deleu. stimulated dog thyrocytes with insulin, the thyrocytes grew but did not proliferate, and the growth was linear. in an experiment to test whether cell - size checkpoints were necessary, brooks and shields separated quiescent 3t3 cells by size and stimulated them to re - enter the cell cycle ; they found that large cells did not grow faster than small cells at the same point in the cycle, consistent with linear growth. we have not found any reports in which big mammalian cells have been observed to grow faster than small cells of the same type and at the same point of the cell cycle. it thus seems likely that most mammalian cells grow linearly, independent of their size, and that they therefore do not require cell - size checkpoints to maintain a constant size distribution as they proliferate. our finding that serum - stimulated, aphidicolin - arrested schwann cells add the same net amount of protein per cell per day, independent of their size, raised the possibility that big schwann cells synthesize protein at the same rate as small schwann cells. to test this possibility we cultured schwann cells in complete medium and aphidicolin and, after 24, 48, or 72 hours, added [s]-methionine and [s]-cysteine for two hours. as can be seen in figure 4a, the rate of protein synthesis increased as the cells increased in size over time. as the net amount of protein added per day does not increase as the schwann cells get bigger (figure 3), the rate of protein degradation (and/or secretion) must also increase as the cells get bigger. to determine the rate of protein degradation, we cultured the cells in complete medium and aphidicolin and, after various times, added [s]-methionine and [s]-cysteine for 2 hours, as before. we then washed the cells and incubated them in non - radioactive medium for a 2 or 6 hour ' chase '. as can be seen in figure 4b, the rate of decrease in radiolabeled protein increased as the cells increased in size. thus, the rates of both synthesis and degradation of short - lived proteins increase with schwann cell size, and the net accumulation of protein is independent of size. it remains a mystery how mammalian cells maintain a constant difference between protein synthesis and degradation independent of their size, although there is evidence that this tight coupling between protein synthesis and degradation can depend on extracellular signals. we showed previously that schwann cell growth depends on extracellular signals, such as those present in fcs. to determine if cell growth remains linear in different concentrations of such extracellular factors, we cultured quiescent schwann cells in aphidicolin and various concentrations of fcs, and measured cell volume over time. as can be seen in figure 5, the rate of growth remained linear for up to 9 days (figure 5a) but increased with increasing amounts of fcs (figure 5b). even in 50% serum, cell growth remained linear and was faster than in 10% serum (not shown). thus, even at high concentrations of fcs, it seems that the levels of extracellular growth factors, rather than anything inside the cells, limit schwann cell growth. in figure 5c, we show how the spread of cell sizes changed as aphidicolin - arrested schwann cells grew over time. like cell size itself, the spread of sizes increased linearly with time, as expected in a situation where some cells are growing faster and some slower than the mean rate, but all are growing linearly, independent of their size. we have shown that the growth rate of schwann cells is linear, unlike in yeasts, which means that cell - size checkpoints are unnecessary to explain how proliferating schwann cells maintain their size in a particular environment. as discussed in the background, a crucial line of evidence for the existence of cell - size checkpoints in yeasts is that they can rapidly change the size at which they divide, by adjusting their size threshold, when switched to different nutrient conditions. we therefore tested whether proliferating schwann cells behave similarly when shifted from serum - free to serum - containing culture medium. if schwann cells had cell - size checkpoints, one might expect them to adjust their size rapidly to the new condition. if they do not have such checkpoints, one would expect the cells to adjust their size only gradually to the new conditions over a number of cell cycles, much as illustrated for the small cells in figure 1. we maintained purified schwann cells in a proliferative state on laminin, in dmem supplemented with ggf 2, forskolin, insulin, and serum - free schwann - cell - conditioned medium, with or without 3% fcs, passaging the cells when they reached near - confluence. in both conditions, the schwann cells maintained their average size over time, when assessed at the time of passage (figure 6a), although the cells in serum were, on average, more than twice the size of cells without serum (figure 6b). in this respect, the cells behave similarly to yeast cells, which grow at a faster rate and divide at a larger size when proliferating in a nutrient - rich medium than in a nutrient - poor medium. we then switched the schwann cells that had been proliferating in serum - free medium to serum - containing medium. we plated these ' switched ' cells and the cells maintained throughout the experiment in serum - containing medium at the same plating density both now in serum - containing medium. we passaged them when they reached about 300,000 cells per well, which was usually every 3 days. we counted cell numbers and measured mean cell volume of the population every day using a coulter counter. the average cell - cycle times of the two populations were approximately the same (figures 6c, d). unlike yeasts, the switched cells took around six divisions and about 10 days before they divided at the characteristic size of schwann cells maintained in serum - containing medium all along (figure 6e). the finding that big schwann cells grow at the same rate as small schwann cells means that they do not require cell - size checkpoints to maintain a constant size distribution as they proliferate. the finding that they take many divisions to adjust to new culture conditions strongly suggests that they do not have such checkpoints, or at least not ones that resemble those operating in yeast cells. in addition, their slow adjustment to a change in culture conditions is the behavior predicted by the hypothetical model illustrated in figure 1 for proliferating cells that grow linearly and do not have cell - size checkpoints. whereas proliferating populations of yeast cells and schwann cells can both maintain a constant size over time, they seem to do so in very different ways. for yeasts, cell - size checkpoints apparently operate to coordinate cell growth and cell - cycle progression. for schwann cells, by contrast, extracellular signals that stimulate cell growth, cell - cycle progression, or both, appear to control the size at which the cells divide. although a population of schwann cells maintained a constant average cell size if passaged frequently (figure 2), the cells decrease in size if not passaged, even if the medium was replaced every day (figure 7a), although they continue to proliferate (figure 7b). this is presumably because there was increased competition for extracellular growth factors as the cultures got denser. a similar competition for extracellular signals has been shown to regulate the size of lymphocytes in vivo. apparently, signaling for schwann cell growth is more affected by the competition than signaling for cell - cycle progression. we found previously that schwann cells do not maintain a constant size over time when proliferating in insulin - like growth factor i (igf - i) and ggf 2 in the absence of fcs or schwann - cell - conditioned medium, presumably because growth stimulation was insufficient to keep up with mitogenic stimulation. we suspect that the size of most proliferating animal cells in vivo is controlled by the levels of extracellular signals in a way that is similar to how schwann cell size is controlled in culture. in the few studies that have analyzed the size of proliferating animal cells during normal development, for example, it seems that cell size can vary significantly for the same cell type. during development of the wing imaginal disc in drosophila, for instance, the size of the disc cells varies throughout development : the cells initially grow without dividing and then proliferate and get progressively smaller. the lifestyles of yeasts and animal cells are crucially different. as a unicellular organism, each yeast cell grows and divides as fast as the nutrient supply allows, and it must quickly adapt to changing extracellular conditions. the growth and division of animal cells, by contrast, must be carefully controlled and coordinated for the good of the animal as a whole, and this control relies mainly on intercellular signaling. thus, whereas yeast cell proliferation is controlled mainly by nutrients, animal cell proliferation is controlled mainly by signals from other cells. as such signals seem usually to be present at limiting, rather than saturating, concentrations, small changes in their levels can powerfully influence cell growth and proliferation. given its importance, it is surprising how little is known about how the levels of such signals are controlled in animals. animal cell proliferation also depends on nutrients, however, and our results do not exclude the possibility that cell - size checkpoints might be revealed by nutrient deprivation experiments. our findings also do not exclude the possibility that animal cells such as lymphocytes, which can proliferate in suspension like yeast cells, might use cell - size checkpoints to coordinate their growth with cell - cycle progression. these will be important avenues to explore in the future, but we shall leave this to others. all reagents were from sigma - aldrich (gillingham, uk), unless indicated otherwise. for experiments on growth rate, schwann cells were purified from postnatal day 7 rat sciatic nerve by sequential immunopanning as described previously. the cells were expanded on poly - d - lysine- and fibronectin - coated culture dishes (falcon ; bd biosciences, oxford, uk) in ' complete medium ' : dmem (gibco ; invitrogen ltd, paisley, uk) supplemented with 3% fcs, 1 m forskolin (calbiochem ; merck biosciences, nottingham, uk) and 20 ng / ml recombinant ggf 2 (a gift from m. marchionni, cambridge neuroscience inc., cambridge, usa). cells were passaged every 3 days and were > 99.9% pure as judged by antigenic markers. for the switch experiments, purified schwann cells were maintained in a proliferative state on poly - d - lysine- and laminin - coated culture dishes, in dmem supplemented with 20 ng / ml ggf 2, 1 m forskolin, 10 g / ml insulin, serum - free schwann - cell - conditioned medium (to a final concentration of 20%), 100 g / ml transferrrin, 100 g / ml bovine serum albumin, 16 mg / ml putrescine, and 40 ng / ml selenium, either with (serum - containing sc medium) or without (serum - free sf medium) 3% fcs. cells were plated at a concentration of 100,000 cells per well of a six - well culture plate (falcon) and passaged when they reached a concentration of around 300,000 cells per well. for cell - growth experiments, about 4 10 quiescent cells were then plated in each well of a six - well poly - d - lysine- and fibronectin - coated culture dish in dmem containing 1%, 3%, 10%, or 50% fcs and 2 g / ml aphidicolin to arrest the cells in s phase. cell volume and cell number (to assess cell - cycle time) were assessed every 24 hours in a coulter counter (multisizer ii, beckman - coulter, high wycombe, uk), using a volumetric analysis, after removing the cells from the culture dish with trypsin - edta (gibco) and resuspending them in isoton ii (beckman - coulter). between 1,000 and 5,000 cells were counted per well, and the data were analyzed using coulter multisizer accucomp software (beckman - coulter). about 10quiescent cells were plated in a poly - d - lysine - and fibronectin - coated 15 cm culture dish (falcon) in dmem containing 1%, 3%, or 10% fcs and 2 g / ml aphidicolin. the cells were rinsed twice with phosphate - buffered saline (pbs), scraped off the dish, and centrifuged at 3,000 g for 3 minutes. cell number was determined by measuring the concentration of dna in the aliquot and assuming the haploid amount of dna per cell is 6 pg. protein concentration was determined by lysing the cells on ice for 15 minutes in 0.4% triton and 0.2% sodium dodecyl sulfate (sds), in the presence of protease inhibitors (boehringer mannheim) and using a micro - bca (bicinchoninic acid) assay with a bovine serum albumin (bsa) standard. about 10quiescent cells were plated in a poly - d - lysine- and fibronectin - coated 6 cm culture dish in medium containing 3% fcs and 2 g / ml aphidicolin. in one experiment, the protein synthesis rate of proliferating cells in complete medium was determined. at the time point to be investigated, cells were washed twice with cysteine- and methionine - free dmem (gibco). then, 2.5 ml of this dmem was added, together with glutamate, forskolin, 3% fcs, and 100 ci of [s]-methionine and [s]-cysteine (amersham, little chalfont, uk) for 2 hours at 37c. the amount of radiolabel was saturating, as the amount in the medium did not decrease significantly during the 2-hour incubation. to determine the protein synthesis rate, the cells were then washed, trypsinized, centrifuged at 3,000 g, and resuspended in serum - free medium. aliquots were taken for cell - number analysis in a coulter counter and for protein analysis. then, 100% ice - cold trichloroacetic acid (tca) was added to each aliquot to a final concentration of 10%, to precipitate the protein. after 10 minutes on ice, the solutions were centrifuged at 12,000 g to pellet the precipitated protein, and the amount of free radiolabel was assessed by removing three aliquots and counting them in a scintillation counter. the amount of radiolabel incorporated into protein was calculated by subtracting the value of the non - incorporated label from the value of the label in the total cell lysate. to determine the rate of protein degradation, cells were radiolabeled as above, washed three times with complete medium, and then left for either 2 or 6 hours at 37c. the amount of radiolabeled protein still remaining in the cells after the chase was determined as described above. for experiments on growth rate, schwann cells were purified from postnatal day 7 rat sciatic nerve by sequential immunopanning as described previously. the cells were expanded on poly - d - lysine- and fibronectin - coated culture dishes (falcon ; bd biosciences, oxford, uk) in ' complete medium ' : dmem (gibco ; invitrogen ltd, paisley, uk) supplemented with 3% fcs, 1 m forskolin (calbiochem ; merck biosciences, nottingham, uk) and 20 ng / ml recombinant ggf 2 (a gift from m. marchionni, cambridge neuroscience inc., cambridge, usa). cells were passaged every 3 days and were > 99.9% pure as judged by antigenic markers. for the switch experiments, purified schwann cells were maintained in a proliferative state on poly - d - lysine- and laminin - coated culture dishes, in dmem supplemented with 20 ng / ml ggf 2, 1 m forskolin, 10 g / ml insulin, serum - free schwann - cell - conditioned medium (to a final concentration of 20%), 100 g / ml transferrrin, 100 g / ml bovine serum albumin, 16 mg / ml putrescine, and 40 ng / ml selenium, either with (serum - containing sc medium) or without (serum - free sf medium) 3% fcs. cells were plated at a concentration of 100,000 cells per well of a six - well culture plate (falcon) and passaged when they reached a concentration of around 300,000 cells per well. for cell - growth experiments, quiescent schwann cells were obtained by culturing them to confluence in complete medium. about 4 10 quiescent cells were then plated in each well of a six - well poly - d - lysine- and fibronectin - coated culture dish in dmem containing 1%, 3%, 10%, or 50% fcs and 2 g / ml aphidicolin to arrest the cells in s phase. cell volume and cell number (to assess cell - cycle time) were assessed every 24 hours in a coulter counter (multisizer ii, beckman - coulter, high wycombe, uk), using a volumetric analysis, after removing the cells from the culture dish with trypsin - edta (gibco) and resuspending them in isoton ii (beckman - coulter). between 1,000 and 5,000 cells were counted per well, and the data were analyzed using coulter multisizer accucomp software (beckman - coulter). about 10quiescent cells were plated in a poly - d - lysine - and fibronectin - coated 15 cm culture dish (falcon) in dmem containing 1%, 3%, or 10% fcs and 2 g / ml aphidicolin. the cells were rinsed twice with phosphate - buffered saline (pbs), scraped off the dish, and centrifuged at 3,000 g for 3 minutes. cell number was determined by measuring the concentration of dna in the aliquot and assuming the haploid amount of dna per cell is 6 pg. protein concentration was determined by lysing the cells on ice for 15 minutes in 0.4% triton and 0.2% sodium dodecyl sulfate (sds), in the presence of protease inhibitors (boehringer mannheim) and using a micro - bca (bicinchoninic acid) assay with a bovine serum albumin (bsa) standard. about 10quiescent cells were plated in a poly - d - lysine- and fibronectin - coated 6 cm culture dish in medium containing 3% fcs and 2 g / ml aphidicolin. in one experiment, the protein synthesis rate of proliferating cells in complete medium was determined. at the time point to be investigated, cells were washed twice with cysteine- and methionine - free dmem (gibco). then, 2.5 ml of this dmem was added, together with glutamate, forskolin, 3% fcs, and 100 ci of [s]-methionine and [s]-cysteine (amersham, little chalfont, uk) for 2 hours at 37c. the amount of radiolabel was saturating, as the amount in the medium did not decrease significantly during the 2-hour incubation. to determine the protein synthesis rate, the cells were then washed, trypsinized, centrifuged at 3,000 g, and resuspended in serum - free medium. aliquots were taken for cell - number analysis in a coulter counter and for protein analysis. radiolabel incorporation into protein was assessed by lysing the cells in 0.2% triton and then removing three aliquots and counting each in a scintillation counter. then, 100% ice - cold trichloroacetic acid (tca) was added to each aliquot to a final concentration of 10%, to precipitate the protein. after 10 minutes on ice, the solutions were centrifuged at 12,000 g to pellet the precipitated protein, and the amount of free radiolabel was assessed by removing three aliquots and counting them in a scintillation counter. the amount of radiolabel incorporated into protein was calculated by subtracting the value of the non - incorporated label from the value of the label in the total cell lysate. to determine the rate of protein degradation, cells were radiolabeled as above, washed three times with complete medium, and then left for either 2 or 6 hours at 37c. the amount of radiolabeled protein still remaining in the cells after the chase was determined as described above. the authors of the second research article in this print issue () have both had close associations with journal of biology, and martin raff continues to do so. neither author was involved in the refereeing of this article, in the decision to publish it, or in the choice of accompanying commentary. this work and the authors were supported by the medical research council of the uk. we are grateful to robert brooks, murdoch mitchison, and paul nurse for helpful discussions. a hypothetical model showing why the progeny of large and small daughter cells eventually return to the mean population size over time if large and small cells grow and progress through the cell cycle at the same rates (after brooks). the initial division is unequal and produces one cell of 10 mass units and one cell of 1 mass unit ; the subsequent eight divisions of the progeny cells are equal. following thus, the initial small daughter cell grows to 6.5 units before it divides to produce two daughters of about 3.2 units each, while the initial large daughter cell grows to 15.5 units before it divides to produce two daughters of about 7.8 units. mean cell volume remains constant as purified schwann cells proliferate in complete medium and are passaged every three days. the growth of aphidicolin - arrested schwann cells is linear over time, indicating that it is independent of cell size. (a) quiescent cells were cultured in complete medium with aphidicolin to arrest the cells in s phase. each point represents the mean standard deviation of the results derived from three independent experiments, where, for each experiment, the mode cell volumes of three plates were measured and averaged. (b) cells were cultured as in (a), but protein per cell, rather than cell volume, was measured at the time points shown. the results are shown as the mean standard deviation of three cultures in one experiment, in which about 10cells were assayed for each point. the experiments in (a) and (b) were performed three times with similar results. (a) quiescent cells were cultured in 3% fcs, forskolin, and aphidicolin for various times. the rate of protein synthesis was then determined by measuring the amount of incorporation of [s]-methionine and [s]-cysteine into cellular protein over 2 hours. the results are shown as the mean standard deviation of nine independent plates of cells. (b) quiescent cells were treated as in (a) and then either harvested immediately (0 hours after pulse) to assess the rate of total protein synthesis or washed and ' chased ' with medium containing non - radioactive methionine and cysteine for 2 or 6 hours before harvesting to assess the rate of protein degradation. the shallowness of the curve for the 24-hour - arrested cells is likely to be the result of the lower than expected value at 0 hours. the 0 hour result in (a) is likely to be more accurate, as it represents the mean of nine independent cultures, instead of three. if one uses the value of 80, the curve in (b) for the 24-hour - arrested cells would be steeper. the experiments in (a) and (b) were performed three times with similar results. schwann cell growth remains linear for 9 days but increases with increasing concentrations of serum. in (a) the cells were cultured in 1% fcs, forskolin, and aphidicolin, while in (b) they were cultured in forskolin and aphidicolin and various concentrations of fcs. (c) the cells were cultured as in (a), but each point represents the mean standard deviation of cell volumes from one plate of cells. schwann cells adjust their size slowly when shifted from serum - free (sf) medium to serum - containing (sc) medium. the cells were plated at 100,000 cells per well and were passaged when they reached a density of about 300,000 cells per well. (a, b) the mean volume of cells proliferating in either sc or sf medium was measured in a coulter counter at the time of passage. the raw data for each condition are shown in (a), and the mean standard deviation of the mode cell volume at passage is shown in (b). (c, d) the cell - cycle time of schwann cells proliferating either in sc medium or in sc medium after a shift from sf medium was measured by determining the rate at which cell number increased. the raw data for each condition are shown in (c), and the mean standard deviation of four population - doubling times is shown in (d). (e) the size of cells proliferating in sc medium, in sf medium, or in sc medium after a shift from sf medium (' switched ' cells) was measured every day in a coulter counter. because the cells in sc medium and the switched cells had similar cycle times see (d) they were passaged about every 3 days in both cases, when they reached around 300,000 cells per well ; the cells in sf medium cycled more slowly and cells were cultured in serum - containing medium, with or without passaging on day 4. in both cases, 100,000 cells were plated per well, and the medium was changed every day. mode cell volume (a) and cell number (b) | backgroundit is widely believed that cell - size checkpoints help to coordinate cell growth and cell - cycle progression, so that proliferating eukaryotic cells maintain their size. there is strong evidence for such size checkpoints in yeasts, which maintain a constant cell - size distribution as they proliferate, even though large yeast cells grow faster than small yeast cells. moreover, when yeast cells are shifted to better or worse nutrient conditions, they alter their size threshold within one cell cycle. populations of mammalian cells can also maintain a constant size distribution as they proliferate, but it is not known whether this depends on cell - size checkpoints.resultswe show that proliferating rat schwann cells do not require a cell - size checkpoint to maintain a constant cell - size distribution, as, unlike yeasts, large and small schwann cells grow at the same rate, which depends on the concentration of extracellular growth factors. in addition, when shifted from serum - free to serum - containing medium, schwann cells take many divisions to increase their size to that appropriate to the new condition, suggesting that they do not have cell - size checkpoints similar to those in yeasts.conclusionsproliferating schwann cells and yeast cells seem to use different mechanisms to coordinate their growth with cell - cycle progression. whereas yeast cells use cell - size checkpoints, schwann cells apparently do not. it seems likely that many mammalian cells resemble schwann cells in this respect. |
large diaphyseal bone defects can be the result of trauma, osteomyelitis, or resection of bone tumors., massive cortical allografts are associated with problems like nonunion, infection, and fatigue fractures [2, 11, 20 ]. an alternative method for fixation and regeneration of new bone in large defects is distraction osteogenesis using external fixation systems. however, this method is technically demanding and has a high complication rate (as much as two to 3.2 difficulties per patient) [13, 18, 19 ]. numerous complications are relatively harmless such as pin tract infections (37%100%) [18, 19 ] and joint stiffness (39%). other more severe complications are persistent pain (17%), fractures at the docking site (21%), limb - length discrepancy (100%), and amputations (10%11%) [18, 19 ]. another disadvantage is the duration of treatment with several additional operative procedures, which requires considerable patient compliance [12, 18, 19 ]. impaction bone grafting in revision arthroplasty is effective for repair of large bone defects with survival rates of 90% to 94% after 10 to 18 years followup [25, 27 ]. with large segmental defects, containment of the impacted bone graft is achieved by metal meshes, which are placed around the original location of the missing bone. the initial stability of the morselized graft is related to the density of the graft, reinforcing the need for firm impaction [4, 14 ]. this procedure has been used in numerous animal studies in the acetabulum and femur [1, 5 ] and is performed routinely in revisions of failed hip implants [22, 23, 26, 27 ]. histologic analysis of retrieved specimens has revealed remodeling concomitant with gradual ingrowth of the graft, which is mandatory for long - term survival [7, 14, 31 ]. initially, cortical grafts obviously have better mechanical properties as compared with morselized bone grafts. however, from a biologic perspective, ingrowth of impacted morselized allograft is superior to structural cortical allograft, which might result in higher incorporation and union rate and thereby superior long - term characteristics [28, 29 ]. based on the results with impaction grafting for revision hip arthroplasty, we wondered whether morselized bone graft in a cage could be an alternative for a massive cortical graft in segmental diaphyseal defect reconstructions. using such a goat model, we asked (1) if the goats regained a normal walking pattern ; (2) if the reconstructions healed radiographically ; (3) if the strengths of the two reconstruction methods (morselized and cortical grafts) differed in a torsion test ; and (4) if the histologic appearance of the two graft types differed after incorporation. we used 12 dutch milk goats with 24 femurs (female, capra hircus sana ; weight range, 5764 kg), dividing the 24 femurs into four groups of six femurs (cage reconstruction, cortical graft reconstruction, nonoperated side of the cage group, nonoperated side of the cortical group). the variation was set at 8.75 nm, which was based on results of a pilot study and on previous experiments in the femur of goats. the difference in torsional strengths between groups was set at 15 nm, which is approximately 15% of the normal strength. the relevance of this difference for prediction of fracture risk is difficult because in the test animals, the central nail is still in situ during daily activity, which will contribute substantially to the torsional strength. the expected variation in a group and the difference between groups led to a group size of six goats in this study. the cage was a stainless steel mesh (x - change system ; stryker howmedica, newbury, uk) that was cut to a height of 4.5 cm and folded into a cylinder with a diameter of 22 mm (average diameter of the shaft of a goat femur). we harvested the morselized allograft used to fill the cages from the donor goats sternum. the cancellous bone was morselized by hand using a rongeur that produced small (13 mm), pure cancellous bone chips. we subsequently processed the bone chips in a noviomagus bone mill (spierings medische techniek, nijmegen, the netherlands) with the smallest rasping blade leading to a particle size of approximately 2 mm. each batch of cancellous allograft was washed using 2 l of saline with a pulse lavage jet system (stryker howmedica). the total amount of bone graft used in each reconstruction was approximately 28 g. after each layer, 10 standardized impactions were made with a mass of 1.5 kg that was dropped from a height of 35 cm. the last layer was followed by 40 similar impactions, after which the impacted graft in the cage had a height of 35 mm. at each end of the 45-mm high cages, 5 mm of the cage was left unfilled on both sides, which enabled the host bone to slide into the cage (fig. 1). during impaction, a central nail was positioned in the cage to reserve space for introduction of the intramedullary nail in the animals.fig. the long slot holes (for screw fixation of the nail) enable dynamic loading of the bone graft. the long slot holes (for screw fixation of the nail) enable dynamic loading of the bone graft. the arrows indicate the route of loading onto the bone graft. under general anesthesia using pentobarbital (doses 0.5 ml / kg, pentobarbital 60 mg / ml) the right leg was shaved and sterilized with betadine (mundipharma ag, basel, switzerland). using a lateral approach, the femur was exposed through an 8-cm skin incision. the periosteum was opened with a longitudinal incision and bluntly elevated circumferentially with the overlying soft tissues and left in situ. subsequently, a 3.5-cm segmental defect was created by two osteotomies performed 7 and 10.5 cm proximal of the lateral joint space line of the knee with an oscillating saw under constant cooling with saline solution. the resected diaphyseal segment of the femur was removed from the operated site in six goats and after 15 minutes placed back in the original position (fig. 2). in the other six goats, the cortical segment was replaced with a cage filled with morselized impacted bone graft (fig. 3). the lateral approach was extended with a lateral parapatellar arthrotomy to the knee and the patella was medially subluxated. in the intercondylar femoral notch, this 16-cm long, 10-mm thick stainless steel nail was bent preoperatively, meeting the average curvature of the goat femur that was measured on lateral radiographs of 40 different goat femurs. the nail was inserted retrograde using the insertion handle connected to the proximal end of the nail. in the group with the massive cortical graft, the nail was locked in a static way by two proximal and two distal screws, thereby following the most commonly applied technique. in the cage group, the nail was dynamically locked to load the bone graft (fig. 1). the handle with a custom - made aiming device was connected to the proximal end of the nail which avoided the use of an image intensifier for insertion of the nail and ao locking screws (synthes, davos, switzerland). the knee cavity was irrigated with saline solution to remove blood clots, and the capsule was sutured. antibiotic prophylactics consisted of ampicillin subcutaneously administered for 5 days postoperatively (doses 7.5 ml a day, albupen 100 mg / ml ; intervet, boxmeer, the netherlands).fig. 2a direct postoperative radiograph is shown with a segmental defect reconstructed with a structural cortical autograft.fig. 3a direct postoperative radiograph shows a segmental defect, which is reconstructed with an impacted morselized allograft in a cage. a direct postoperative radiograph is shown with a segmental defect reconstructed with a structural cortical autograft. a direct postoperative radiograph shows a segmental defect, which is reconstructed with an impacted morselized allograft in a cage. after the operative procedure, the goats were kept in a hammock for 1 week to prevent postoperative complications and improve wound healing. after 2 weeks, the animals were transported from the central animal facility to an outdoor farm. temgesic (buprenorfine) at a rate of 0.018 ml / kg was used as an analgesic three times a day for the first 2 days after surgery and thereafter when necessary. to assess new bone formation on histologic sections, each goat received fluorochromes, a subcutaneous injection of calcein green solution (20 mg / kg) at 13 weeks postoperatively for 2 days, and alizarin (30 mg / kg) solution for 2 days before the animals were euthanized. radiographs were taken 0, 12, and 26 weeks postoperatively using general anesthesia. the lateral and anteroposterior views of the femur were judged (by bs, mwm) for callus formation, alignment, fixation failure, and disappearance of the host bone - graft junction. the gait of the goats was monitored with the score originally developed by ypma, in which 0 = not used at all, 1 = supported incidentally, 2 = loaded in a standing position and incidentally while walking, 3 = loaded in a standing position and walking but with a limp, and 4 = normal walking and standing pattern. after 26 weeks, all goats were euthanized using an injection of 20 ml of 200 mg na - pentobarbital / ml into the jugular vein. our institution approved the animal protocol for this investigation, and all investigations were conducted in conformity with ethical principles of research. after removal of the nail and screw fixation, the proximal and distal ends of the operated and contralateral femurs were embedded in acrylic cement (autoplast ; candulor ag, wangen, switzerland) in such a way that a diaphyseal segment, with the former defect located in the center, was free with a margin of 3 cm distal and proximal to the former osteotomy site. the specimens were mounted in a materials testing system machine (mts gmbh, berlin, germany), in which the distal femur in cement was loaded in external torsion and the proximal cemented end of the femur was fixated except for axial translation. throughout the experiment, the specimens were kept moist with ringer s lactate (0.9%) at a room temperature of 20 c. all femora were tested for torsion to failure at a rate of 2 per second. the parameter chosen to reflect torsion strength was torque at failure. torsion strength of the operated femur was expressed as a percentage of torque at failure relative to the contralateral, nonoperated femur of the same animal. therefore, 100% torsional strength indicated the same strength as the intact case. on the first noticeable crack in the bone, all specimens were fixed in buffered (0.1 mol / l phosphate buffer, ph 7.4) paraformaldehyde (4%) for at least 1 week. thereafter, at three levels, thick slices were made for nondecalcified histologic analysis (see fig. 4 for a schematic representation of the section planes). of the structural grafts, decalcified histologic analysis was done of adjacent thick slices for quantification of necrosis and bone remodeling. in addition to the cross sections, two 1-cm thick slices were made of the former osteotomy site of the reconstruction with the host bone (fig. thicker nondecalcified sections (2030 m) were made with a sawing microtome (leica sp 1600 ; leica microsystems nederland bv, rijswijk, the netherlands) and left unstained for fluorescence microscopy or stained with hematoxylin and eosin.fig. 4a schematic representation shows the sectioning planes through the reconstructed segment and through the interface of the reconstruction with the host bone. a schematic representation shows the sectioning planes through the reconstructed segment and through the interface of the reconstruction with the host bone. all sections from each reconstruction were evaluated (ld, pb) by light microscopy, including fluorescence microscopy, for a qualitative assessment of the incorporation process. the quantification of the total bone area inside and outside the cage (only in the cage group) was performed on three slices at equal distance from each other (spaced approximately 875 m from each other) resulting in one level exactly in the center of the defect and two between the center and osteotomy planes. these cross sections were photographed digitally with an 8-megapixel camera at low magnification and mounted in the computer into a composition of the entire slide. with a digital image analysis system (soft imaging gmbh, mnster, germany), the surface area of the bone inside and outside the cage was measured. in addition, the extent of necrosis in the structural graft was quantified. in each cross section, in four images (one in each quadrant) at a magnification of 10, the surface area of new bone was measured interactively on digitized images and expressed as a percentage of the surface area of the total bone area. in nonstained thick sections, the distance of bone ingrowth was quantified in four locations in each section based on the penetration of fluorescence labels of calcein green (front at 13 weeks) and alizarin (front at 26 weeks). the torsional strength of the four groups (cage reconstruction, cortical graft reconstruction, nonoperated side of the cage group, and nonoperated side of the cortical group) was compared using an analysis of variance test to show differences between groups followed by a post hoc t - test (tukey). all 12 animals in both intervention groups were mobilized and regained normal gait 2 weeks after mobilization (score of 4). radiographically, all goats from both groups achieved consolidation and union (figs. 5, 6). in all goats, more bridging callus formation was observed in these goats compared with goats with a smaller femur, in which the nail was more press - fit in the intramedullary canal. in the cage group, five goats showed callus formation directly outside the cage, particularly anteriorly. in one goat with cage reconstruction, there was extensive callus formation around the entire cage and total absence of bone in the cage. the femurs with the cage reconstructions were slightly reduced in height during the postoperative period as could be judged from the changed position of the screw in the slot holes of the nail.fig. 5a radiograph of a structural cortical autograft reconstruction after a followup of 26 weeks shows union of the segment.fig. 6a radiograph of an impacted morselized graft in a cage after a followup of 26 weeks shows union of the segment. a radiograph of a structural cortical autograft reconstruction after a followup of 26 weeks shows union of the segment. a radiograph of an impacted morselized graft in a cage after a followup of 26 weeks shows union of the segment. the mean failure torque was similar (p = 0.77) between the reconstructions with cortical graft (52.8 14.4 nm) and the impacted graft (57.5 9.6 nm). all specimens showed a rather linear pattern on the torque versus angular displacement curves up to the moment of failure (spiral fracture). the mean failure torque of the massive cortical reconstructions and of the cage groups was 60.3% and 66.6%, respectively, lower than the failure torque of the contralateral femurs (93.5 14.8 nm and 86.9 5.9 nm ; p = 0.017 and p = 0.002, respectively). fluorescence microscopy showed different patterns of incorporation between the structural graft and the impacted morselized graft. in the cortical autograft reconstruction, the original cortical bone was a mixture of necrotic bone (71.5%) characterized by empty osteocytes lacunae and new osteons (28.5% 7.5%) with vital osteocytes (fig. the ingrowth distance after 13 weeks was 3783 1313 m, which was 70% of the thickness of the cortical bone (5403 681 m). after 26 weeks, the alizarin fluorescence was visible in the peripheral 5154 655 m, which indicated 95.4% of the cortical bone was revitalized by creeping substitution (fig. the new bone had a normal ultrastructure with fat marrow. in all specimens of the cage group, the new bone was seen predominantly around the cage with almost no bone inside the cage (fig. the average surface area of bone inside the cage was 50.3% (range, 13.1%69.3%) of the total surface area of bone inside and outside the cage. in all specimens, the gap was completely filled with woven bone that, based on the fluorochrome labels, was remodeling into lamellar bone (fig.. 7a section of a reconstruction with a structural cortical autograft after 26 weeks shows a mixture of necrotic dead bone (db) and new bone (nb) (stain, hematoxylin and eosin ; original magnification, 150).fig. 8a section of a structural cortical autograft after 26 weeks shows intense remodeling after labeling with calcein green, which resulted in a mixture of new and necrotic bone (unstained section, calcein green labeling shown with ultraviolet light ; original magnification, 150).fig. 9a sawing section of the reconstruction shows a morselized bone graft after 26 weeks. newly formed bone is evident outside the mesh (stain, hematoxylin and eosin ; original magnification, 20).fig. 10a hematoxylin and eosin - stained section using polarized light is shown of the transition of cortical bone (cb) and new bone (nb) that had been formed in the gap (stain, hematoxylin and eosin ; original magnification, 150). a section of a reconstruction with a structural cortical autograft after 26 weeks shows a mixture of necrotic dead bone (db) and new bone (nb) (stain, hematoxylin and eosin ; original magnification, 150). a section of a structural cortical autograft after 26 weeks shows intense remodeling after labeling with calcein green, which resulted in a mixture of new and necrotic bone (unstained section, calcein green labeling shown with ultraviolet light ; original magnification, 150). a sawing section of the reconstruction shows a morselized bone graft after 26 weeks. newly formed bone is evident outside the mesh (stain, hematoxylin and eosin ; original magnification, 20). a hematoxylin and eosin - stained section using polarized light is shown of the transition of cortical bone (cb) and new bone (nb) that had been formed in the gap (stain, hematoxylin and eosin ; original magnification, 150). large diaphyseal bone defects resulting from trauma, osteomyelitis, or resection of bone tumors often require reconstruction. in many of these situations structural allografts are used for large defections. however, massive cortical allografts are associated with various complications including nonunion, infection, and fatigue fractures [2, 11, 20 ]. we compared reconstructions of large segmental diaphyseal bone defects in goats with a structural autograft to reconstruction with impacted morselized bone graft. we focused on the clinical performance, on the radiographic healing, on the mechanical properties of the reconstructions, and on the histologic appearance of the two graft types. the height of the defect was 3.5 cm, which is a critically sized defect, but only approximately 20% of the length of the goat femur. in patients, larger reconstructions of as much as 15 to 20 cm are performed regularly, which will influence the primary stability and possibly limit the use of this technique. moreover, in patients, the healing capacity will be compromised by trauma, resection of the periosteum, or adjuvant therapy, and the fit of particularly the structural graft may be less optimal than in this study. the number of goats in this study was rather low which did not allow any conclusions regarding differences between impacted graft and structural graft. finally, goats may not show any discomfort after a surgical procedure because this would make them vulnerable to predators and they may walk effectively on three limbs. therefore the loading patterns in goats are less informative compared with bipedal humans. the radiographic unions in all goats matched the torsion tests because all femurs had torsion strength on the order of 60%, whereas the torsion strength of nonunions is reportedly approximately 20%. relative to allografts, autografts have generally superior biologic properties, which may have contributed to the optimal union with the host bone in the structural graft group. the location of callus in the cage group was different from the callus around the structural grafts. in the cage probably this is an effect of the changed loading conditions during the initial phase of the incorporation process, in which the ventral part is probably more loaded than the dorsal part. after the formation of this new bone, stress shielding by the bone and by the load transmitted through the mesh, which is in this stage intimately connected with the bone, might have been responsible for the formation of an osteopenic area in the dorsocentral part inside the cage [20, 21, 24 ]. the radiographs of structural graft specimens showed the callus formation appeared directly related to the width of the intramedullary canal. although small allograft chips were used to facilitate filling of the small space between the graft and the nail, in three goats with a wider intramedullary canal, the fit of the nail directly postoperatively was less optimal and this has led to more callus formation. the callus thus might be induced by instability and resulting micromotion during the healing period. these results show the importance of a perfect fit of the central rod in the femoral canal. for the future, another option to provide more stability is to add an extra rigid fixation plate, which might lead to better healing. the segmental diaphyseal defect may have been fixed with such an external plate, but screws then have to be inserted in necrotic bone and screw holes act as stress risers in these cases. the major clinical difference with revision arthroplasty is the direction of the load applied on the graft. the load in revision arthroplasty is induced by a subsiding conical - shaped stem, which generates mainly hoop and compressive stresses in the graft. in the segmental reconstruction, the dynamized fixation of the intramedullary nail results in primarily compressive stress in the graft material. as all goats survived the study period well, our experience suggests initial stability was adequate for direct load - bearing. moreover, the stem in revision hip arthroplasty is fixated in the graft reconstruction. in reconstruction of a segmental diaphyseal bone defect, the central rod has the same function as the stem in a revision situation but is fixed proximally and distally, which will reduce the bending forces in the graft material as compared with the hip situation. the torsion strength of the massive cortical graft and cage reconstruction appeared to be 60% and 67% of the normal value after 6 months, respectively. as a result of the limited number of animals included in this study, we were unable to show differences between the two groups. segmental defects in other animal models reconstructed with cortical autografts reportedly regained 50% in torsion strength after 6 months and nearly normal torsion strength after 1 year [9, 10 ]. the incorporation pattern in the structural graft was similar to that published for dogs. in our study, approximately 20% of the necrotic bone was revitalized by creeping substitution. in dogs, remodeling of 60% of a cortical fibula autograft was found after 1 year. in patients, massive cortical human allografts reportedly unite slowly and more periosteal bone is formed than internally repaired, which was only 20% of the graft by 5 years. however, this relatively slow revitalization probably is compromised by therapies for the disease process. although the porosity of the morselized graft will decrease during impaction, it still is less dense than the structural cortical graft. the relative open structure of the cages and the impacted bone graft facilitate ingrowth and revascularization in large bone defects. resorption of morselized bone graft is followed in all animal models by replacement of new bone. in the cage group, the original graft was resorbed completely and replaced by new bone, which is in concordance with previous studies in which morselized bone grafts in reconstructions remodel into healthy bone if applied under loaded conditions [17, 24, 25, 34, 35 ]. a retrieval analysis of failed cage reconstructions, in which the morselized bone was stress - shielded by the design of the cage, showed only 30% viable bone in the cages. in the long term, it seems necessary to load the morselized bone grafts to induce new bone with optimal quantity and quality. in our model, this load was applied continuously by the locking nails, which did not reach the end of their dynamization stage. load theoretically could lead to micromotions at the implant - bone interface during the remodeling phase. however, two long - term reports describing reconstructions with loaded morselized graft around a hip implant show very favorable results, which suggests that micro - motions are not large enough to be detrimental [14, 26 ]. our data showed a cage filled with impacted morselized graft was adequate to reconstruct and heal a segmental diaphyseal bone defect in a goat femur allowing full weightbearing. the reconstruction of segmental diaphyseal bone defects using a cage with a morselized graft had better biologic characteristics compared with a structural cortical autograft. a mechanically loaded morselized graft is a promising alternative for the massive cortical graft in reconstruction of large diaphyseal defects in an animal model. | large diaphyseal bone defects often are reconstructed with large structural allografts but these are prone to major complications. we therefore asked whether impacted morselized bone graft could be an alternative for a massive structural graft in reconstructing large diaphyseal bone defects. defects in the femora of goats were reconstructed using a cage filled with firmly impacted morselized allograft or with a structural cortical autograft (n = 6 in both groups). all reconstructions were stabilized with an intramedullary nail. the goats were allowed full weightbearing. in all reconstructions, the grafts united radiographically. mechanical torsion strength of the femur with the cage and structural cortical graft reconstructions were 66.6% and 60.3%, respectively, as compared with the contralateral femurs after 6 months. histologically, the impacted morselized graft was replaced completely by new viable bone. in the structural graft group, a mixture of new and necrotic bone was present. incorporation of the impacted graft into new viable bone suggests this type of reconstruction may be safer than reconstruction with a structural graft in which creeping substitution results in a mixture of viable and necrotic bone that can fracture. the data suggest that a cage filled with a loaded morselized graft could be an alternative for the massive cortical graft in reconstruction of large diaphyseal defects in an animal model. |
the prevalence of adult overweight and obesity has been increasing all over the world. this tendency has been observed for over 30 years. in the united states, in the years 1980 and 2002, the number of obese people above 20 years of age doubled. in thailand, in the period 19912004, the incidence of overweight in adult men increased from 13% to 22.4%, whereas in women the value rose from 23.2% to 34.3%. unfortunately, the problem of progressive overweight and obesity affects children as well. in the united states, in the years 19802002 in germany, the data collected in the years 19851997 (arbeitsgemeinschaft adipositas i m kindesund jugendalter 2000) show that the prevalence of overweight in children increased twice. subsequently, german children and adolescent health surveys (kiggs 2006) carried out in children aged 317 years revealed the prevalence of overweight in 15% of the examined cases out of which 6.3% were diagnosed as obese. in thailand, in the group of children aged 612 years, the incidence of overweight rose from 5.8% in 1997 to 6.7% in 2001. in some of the european countries, the highest rates of obesity are observed in eastern and southern european countries. in malta and southern italy overweight or obesity are diagnosed in 35% of children, whereas the same conditions are observed in 15% of cases in scandinavia and in 12% in the netherlands. in the year 2000, a research that was carried out in cracow, the third largest city in poland, revealed that overweight and obesity were identified in 15.13% of boys and 11.79% of girls. during the 19712000 period, a gradual increase in overweight and obesity in children aged 718 years (n = 3,733) was observed. the most remarkable increase was registered in boys aged 712 (n = 859) and in girls aged 710 (n = 483). in many countries, including poland, a gradual increase in the number of overweight and obese children was an incentive to carry out a research in order to determine the extent of adiposity in the young population. in cracow, such a study was performed in a group of children aged 613, inhabitants of the city proper as well as neighbouring rural areas. the purpose was to estimate the prevalence of overweight and obesity in preschool and school children with reference to gender and place of residence. at the end of 2008 and the beginning of 2009, a sample of 1,499 children aged 613 years, residences of cracow and neighbouring rural areas, was selected. the examined group consisted of 748 boys (549 urban and 199 rural ones) and 747 girls (553 urban and 194 rural ones). the group of rural subjects comprised the children between the ages of 7 and 12 years. the measurement of weight and height allowed the calculation of body mass index (bmi) for every examined child. \documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{bmi } } = { \text{weight } } \left ({ \text{kilogrammes } } \right)/{\text{height } } { \left ({ \text{metres } } \right)^{{2 } } } $ $ \end{document } the bmi is widely used to evaluate the incidence of overweight and obesity. in the case of adults, the ratio above 25 kg / m indicates overweight and above 30 kg / m obesity. bmi values estimated in children differ depending on gender and age of the examined subjects but the correlation is not the same as in adults. therefore, as far as children are concerned, it is best to use cut - off points applicable for children and adolescents that correspond with their age and gender. in the examination performed the prevalence of overweight and obesity in children was determined by means of the international obesity task force cut - offs with respect to age. it allows for a comparison of the results of the authors own research with the data provided in worldwide publications. additionally, overweight and obesity values in girls were determined according to age groups corresponding with the degree of sexual maturity. they were divided into two age groups : childhood (710 years) and early adolescence (1113 years). taking into consideration the difference in the pubertal progress in boys and girls, the division allows for other age categories : childhood and early adolescent. the examined subjects were grouped according to the criteria established by chrzanowska.. sex - related differences in all anthropometric indicators were analysed by the student s t test. wilcoxon test (also called the wilcoxon rank - sum test or w test) was used to determine whether the medians of the bmi in boys and girls included in data sets were equal. it was used instead of the student s t test in a case of non - normal distributions of variables. sex - related differences in all anthropometric indicators were analysed by the student s t test. wilcoxon test (also called the wilcoxon rank - sum test or w test) was used to determine whether the medians of the bmi in boys and girls included in data sets were equal. it was used instead of the student s t test in a case of non - normal distributions of variables. the comparison of body height in the examined subjects did not reveal any statistically significant differences in gender groups and in place of residence groups. in terms of bmi the differences in body mass in gender groups with respect to place of residence were not statistically significant. mean values, median values and standard deviation of weight and height in gender groups and in place of residence groups are presented in tables 1 and 2. table 1median values, ranges, mean values and standard deviation of weight and height in all boys and girlsallnumbermed.rangesmeansdboys748 height [cm]140.0103.5177.0139.912.9 weight [kg]35.016.1106.537.311.58girls747 height [cm]138.8103.3170.7139.213.9 weight [kg]33.816.183.035.511.19med. median values, sd standard deviationtable 2median values, ranges, mean values and standard deviation of weight and height in boys and girls from urban and rural areasurbanruralnumbermed.rangesmeansdnumbermed.rangesmeansdboys549199 height [cm]140.1103.5172.2140.713.3138.5116177139.811.6 weight [kg]35.516.1106.537.511.83420.879.636.710.9girls553194 height [cm]138.6103.3170.7138.914.3139.3115169139.812.5 weight [kg]33.716.18335.5611.734.717.765.335.189.63med. median values, sd standard deviation median values, ranges, mean values and standard deviation of weight and height in all boys and girls med. median values, sd standard deviation median values, ranges, mean values and standard deviation of weight and height in boys and girls from urban and rural areas med. median values, sd standard deviation descriptive statistics of bmi in the group of boys and girls was presented in tables 3 and 4. median values, ranges, mean values and standard deviation were shown with respect to gender and place of residence depending on age categories of the examined children. table 3median values, ranges, mean values and standard deviation of bmi in all examined groupsageallnumbermed.rangesmeansdboys74817.8713.138.218.623.29 63316.4614.419.716.511.34 79416.5913.224.417.162.22 810817.4613.126.417.652.37 911617.3413.327.018.112.69 1010317.8713.734.719.183.60 1110818.5613.834.319.133.47 1213719.4914.238.220.133.80 134919.2813.830.819.873.52girls74717.3911.932.017.862.92 63516.0513.428.416.802.70 78316.0011.923.316.372.36 811916.1813.427.316.752.28 99717.1413.425.517.532.55 1011317.4213.428.817.772.62 1113417.8413.626.818.303.21 1211819.0514.532.019.432.85 134819.2115.327.819.863.12med. median values, sd standard deviationtable 4median values, ranges, mean values and standard deviation of bmi in boys and girls from urban and rural areasageurbanruralnumbermed.rangesmeansdnumbermed.rangemeansdboys54917.9513.138.218.683.3619917.7213.933.718.443.09 63316.4614.419.716.511.34 76316.3913.224.417.312.523116.9613.919.416.851.49 87217.0713.126.417.572.573617.6314.523.617.801.98 98517.4713.327.018.402.933117.0314.420.917.281.70 106417.9013.734.719.323.853917.7615.330.518.933.22 117818.5513.834.319.173.523018.5614.430.819.033.46 1210619.5414.238.219.933.693219.1615.133.720.714.21 134819.2813.830.819.723.58girls55317.6012.632.018.033.0119417.2311.927.017.682.61 63516.0513.428.416.802.70 75316.1612.620.816.251.973015.8411.923.316.592.94 88916.4513.427.316.752.253016.0213.922.416.712.41 96716.9113.425.517.532.683017.4313.522.217.532.26 108017.2213.428.817.582.743317.6514.223.718.222.31 119618.0613.826.718.503.463817.1913.626.817.782.40 128519.1714.532.019.582.913318.5915.527.019.042.68 134819.2115.327.819.863.12med. median values, sd standard deviation median values, ranges, mean values and standard deviation of bmi in all examined groups med. median values, sd standard deviation median values, ranges, mean values and standard deviation of bmi in boys and girls from urban and rural areas med. median values, sd standard deviation the wilcoxon test was used to compare bmi values in age categories with reference to place of residence. on the basis of bmi values obtained in the examined group, overweight and obese children were distinguished. the prevalence of overweight in the groups of urban and rural boys is not statistically significant. a slightly higher percentage of overweight boys was observed in rural ones (28.14%). in the case of urban boys, those overweight obesity was observed in almost twice as high percentage of urban boys (7.78%) as in rural ones (3.52%). table 5prevalence of overweight and obesity in boys based on iotf criteria by place of residence and ageageurbanruralnumberow(n)ob(n)numberow(n)ob(n)633707631283190872206361019852093150106416939102117819330611210648632163134892total549151 (27.31%)43 (7.78%)19956 (28.14%)7 (3.52%)childhood50114241199567early adolescent4892iotf international obesity task force, ow(n) number of overweight, ob(n) number of obesity prevalence of overweight and obesity in boys based on iotf criteria by place of residence and age iotf international obesity task force, ow(n) number of overweight, ob(n) number of obesity the prevalence of overweight and obesity in the group of girls according to age and place of residence was shown in table 6. a higher percentage of girls diagnosed as overweight was observed in rural areas and equalled 16.49% as opposed to 16.09% in the case of urban girls. obesity was also prevailing in a higher number of rural girls and was 4.12% as opposed to 3.44% in urban girls. the prevalence of overweight and obesity in the group of girls was not statistically significant. table 6prevalence of overweight and obesity in girls based on iotf criteria by place of residence and ageageurbanruralnumberow(n)ob(n)numberow(n)ob(n)6359275310230458891223051967105309010809233701196174382112851413351134891total55390 (22.2%)19 (3.8%)19432 (16.49%)8 (4.12%)childhood3245013123256early adolescent2294067172iotf international obesity task force, ow(n) number of overweight, ob(n) number of obesity prevalence of overweight and obesity in girls based on iotf criteria by place of residence and age iotf international obesity task force, ow(n) number of overweight, ob(n) number of obesity the highest number of overweight boys was diagnosed in the group of 12-year - olds regardless of place of residence. half of the 12-year - old rural boys were overweight, while in the case of their urban peers the number was 48. the incidence of overweight in 12-year - olds was almost twice as high as in the remaining age groups. however, it must be mentioned that in the group of 13-year - old boys the number of overweight children decreases remarkably and totalled nine subjects. in 12-year - old rural boys, the highest number of obese urban children (n = 9) was observed in 9- and 10-years - olds. the examination did not register such big differences in the prevalence of overweight in urban girls as it did in the case of boys. the highest number of overweight girls was observed in 11-year - olds (n = 17) and the lowest in 6-, 10- and 13-year - olds (n = 9 in all three age categories). the highest number of obese urban girls was in the group of 9-year - olds (n = 5). noticed remarkable changes in the prevalence of overweight and obesity depending on the age was registered in rural girls. the highest number of overweight children was in the group of 9-year - olds and it equalled nine subjects. the number of obese girls was higher than that of overweight children and totalled five and four cases, respectively. taking into consideration the degree of sexual maturity, the incidence of obesity was more frequent in younger children regardless of the gender. a higher percentage of overweight was also registered in younger children with the exception of urban girls. the greatest difference in overweight incidence in the examined sample regardless of place of residence, a higher percentage of overweight children was in the group of boys. obesity was more prevalent in urban boys in comparison with other groups in which the values were similar (fig. 1). 1prevalence of overweight and obesity in gender groups by place of residence prevalence of overweight and obesity in gender groups by place of residence overweight and obesity pose a serious social and health problem in many developed and developing countries [2, 9, 19 ]. despite economic, social, cultural and religious differences among them, overweight and obesity are becoming a widespread issue common for all infrequently distant countries. the authors own research on the incidence of overweight and obesity that was carried out in 2009 in the group of children from cracow diagnosed 28% of boys as overweight and 7% as obese. in girls, 16.2% were overweight and 3.6% obese. comparing the authors own results with the ones acquired on the basis of a research project performed in three cycles in cracow in 1971, 1983 and 2000 a distinct increase in the prevalence of overweight and obesity in children and adolescents, the incidence of overweight and obesity in children from cracow doubled from 7.5% to 15.2% in boys and from 6.5% to 11.8% in girls. the results obtained in 2009 revealed a further increase in the percentage of overweight and obese children reaching 35% in boys (28% overweight (ow) and 7% obesity (ob)) and almost 20% in girls (16.2% ow and 3.6% ob). a higher percentage of obese children regardless of the gender of the examined subjects was observed in younger groups (612 years of age in boys and 610 years in girls). similar correlations are found in the publication by jebb. or chrzanowska.. alarming is the fact that the percentage of obese children increased dramatically from 1.04% in boys and 0.20% in girls in 1971 to 7% in boys and 3.6% in girls in 2009. a quick increase in the prevalence of obesity has been observed in germany. during the period of 20032006, in switzerland in the years 19902002, the percentage of obese children aged 612 years increased from 0.61% to 3.8% in boys and from 0.8% to 3.7% in girls. on the basis of a continuous research within china health and nutrition survey performed on school children and carried out in eight provinces in the years 19911997, the occurrence of obesity depending on the place of residence was determined. in urban areas, the incidence of overweight increased from 7.7% to 12.4%, whereas in rural areas the increase was lower and changed from 5.9% to 6.4%. chrzanowska and aska - mierzejewska analysed the prevalence of overweight and obesity in girls living in rural areas in four regions of poland. they observed that the incidence of overweight and obesity had increased by 7.4% in the years 19872001. many authors seek the causes of an increasing prevalence of overweight and obesity in economic and cultural changes that have taken place in poland following the emergence of a free market economy as well as in the media influence and nutritional changes, mainly a growing fast food availability [3, 12 ]. an increase in the occurrence of overweight and obesity in children since 2000 has been partly connected with subsequent changes that followed the accession of poland to the european union and the opening of borders. people in big cities such as cracow have experienced a visible improvement in the standard of living and have become attracted to a more consumptive lifestyle which may lead to the growing prevalence of overweight and obesity. the paper of jebb and lambert stressed that the data on overweight and obesity in children and adolescents are dominated by studies in northern and western europe and that their values are closest to us data due to a similar economic level of those countries. at the same time, authors showed that in the available literature there are few reports from european countries with lower economic status. our research presents data from eastern europe which complement the knowledge on the prevalence and trends of overweight and obesity in european children and adolescents. in the authors own research, the earlier research performed on the population of cracow confirms this observation although the differences were not as big as in 2009. in children from warsaw, overweight was twice as frequent in boys as in girls. in the czech republic, another east european country which has undergone the process of transformation in recent years, the situation is the same as in poland. in hungary, obesity was more common in men but at the same time more women were diagnosed as overweight. in countries such as china [21, 22 ] and thailand, the incidence of overweight and obesity is more frequently observed in boys than in girls, whereas in the united arab emirates there are more girls diagnosed as overweight and obese. in western countries with high economic status, the research performed and the analysis of the findings permit the conclusion that overweight and obesity occur in a remarkably high percentage of children in cracow, particularly in younger age groups. the differences related to place of residence are small and statistically insignificant excepting obesity which occurs twice as frequently in urban boy as in their rural peers (p = 0.05). a gradual increase in prevalence of overweight and obesity has been observed in cracow since 1971. a dramatic increase in obesity, registered in the authors own research in the studies carried out in various centres all over the world, | this study in children aged 613 years (n = 1,499) was performed between october 2008 and march 2009. height and weight measurements were taken to calculate bmi. the prevalence of overweight and obesity was determined by means of iotf cut - offs with respect to age. alarming is the fact that the percentage of obese children in cracow increased dramatically from 1.04% in boys and 0.20% in girls in 1971 to 7% in boys and 3.6% in girls in 2009. in this report, a higher percentage of overweight boys was observed in rural boys (28.14%) than in urban ones (27.31%). obesity was identified in an almost twice as high percentage of urban boys (7.78%) as in rural ones (3.52%). a higher percentage of overweight girls was registered in rural areas (16.49%) than in urban ones (16.09%). obesity was prevailing in rural girls (4.12%) relative to their urban counterparts (3.44%). the highest number of overweight urban boys was diagnosed in the group of 12-year - olds (n = 48) and rural boys in the group of 10-year - olds (n = 39), as well as in urban girls aged 11 (n = 17) and rural girls aged 9 (n = 9). the highest number of obesity was observed in rural boys aged 12 (n = 3) and in urban boys aged 9 and 10 (n = 9 in both groups). in the group of girls, obesity prevailed in urban 9-year - olds (n = 5) and in rural 7-year - olds (n = 5). conclusions : overweight and obesity affect boys almost twice as frequently as girls. obesity is twice as frequent in urban boys as in their rural peers. |
using appropriate impression materials and techniques guarantees accurate transfer of implant position and precise surface details of prepared teeth to the definitive cast [1, 2 ]. making accurate impressions is necessary as the first step for achieving passive fit in implant - supported restorations [3 ]. otherwise, many mechanical and biological complications such as screw loosening, fixture fracture, occlusal discrepancy and bone loss may occur [4 6 ]. different implant impression techniques including direct (open tray) and indirect (closed tray) techniques are commonly used [7 15 ]. while most authors advocated the direct technique [8 11 ], some have found the indirect technique to be more accurate [12, 13 ], requiring less working time, and being easier for the operator and the patient [9, 12 ]. this technique is frequently indicated when there is limited inter - arch space or tendency to gag, or working in the posterior region of the mouth [11 ]. making an accurate impression is affected by several factors, such as impression material, impression tray, and impression technique [14 21 ]. among impression materials, pvs and pe are of the best choices in fixed prosthesis and implant dentistry because of their improved physical and mechanical properties [14 18 ]. several studies have compared the accuracy of pe and pvs as implant impression materials and most of them found no significant difference between them [14, 18 ]. wee [16 ] reported that the torque resistance of pe was of the greatest value, which would make it more suitable for the open tray technique. on the other hand, impression of prepared teeth must be dimensionally accurate, and also must reproduce the surface details of prepared teeth [2, 19 ]. the pvs and pe are both dimensionally stable, because their polymerization reaction involves no loss of byproducts [19, 20 ]. surface detail reproduction of pvs and pe impression materials is excellent as well [19 ]. 19 which is continuous replication of at least two of the three horizontal grooves [20, 22 ]. therefore, to obtain accurate impressions of implants and teeth simultaneously, dimensional accuracy and surface detail reproduction both should be taken into account. chee and alexander [22 ] defined a technique to make an impression of both implants and natural teeth. first an impression was made of teeth using two - step putty wash technique with pvs impression material and a custom tray and in the next step, after securing transfer copings, an over impression was made by using regular body pvs. the purpose of this in vitro study was to evaluate and compare the accuracy of different impression materials (regular - body pe vs. regular - body pvs) and different impression techniques (open tray vs. closed tray) for transfer of implant position and surface detail reproduction of three grooves. two null hypotheses were postulated : a) there would be no significant difference in the accuracy of implant position transfer with the use of different impression techniques and impression materials, and b) there would be no significant difference in the accuracy of detail reproduction using different impression techniques and impression materials. two parallel holes, 3.8 mm in diameter and 10 mm in length according to the size of implants, were created in the site of the left first and second molars. two implants (implantium, dentium, seoul, south korea) were inserted and secured with auto - polymerizing acrylic resin (technovits 4000, heraeus kulzer gmbh & co., wehrheim, germany). the metal reference model (a). the schematic view of three grooves with 0.25, 0.50 and 0.75 mm depths (b). ney co., bloomfield, ct, usa) and was used to orient implants vertically on the surveyor while inserting them in the holes. also, three horizontal grooves of 0.25, 0.50 and 0.75 mm depths were inscribed between two vertical grooves on the flat superior surface of a die according to the iso 4823 (fig. conical transfer copings were adapted to the implants in the metal model and an irreversible hydrocolloid (alginoplast, heraeus kulzer gmbh & co., wehrheim, germany) impression was made to obtain a single cast on which forty custom trays were molded. two layers of baseplate wax (modeling wax, dentsply, weybridge, uk) were used to cover the primary cast before making the custom trays. in order to ensure proper tray positioning, forty identical 2 mm thick custom trays were made with light polymerizing resin (megatray, megadenta, radeberg, germany) to be used with open tray and closed tray techniques with the use of square and conical transfer copings, respectively (fig. regular - body pe (impregum f, 3 m espe, seefeld, germany) and regular - body pvs (elite hd, zhermack, rovigo, italy) were the impression materials of choice, and were prepared according to the manufacturers instructions and the ada specification number 19 [22 ]. impression making was performed in an environment with controlled temperature and humidity of 23 2c and 50 10%, respectively. adhesive (universal, 3 m espe, seefeld, germany) was used to coat the interior surface and 5 mm beyond the borders of all custom trays 15 minutes before impression making. the specimens were assigned into four groups. in closed tray groups, conical transfer copings and in open tray groups, square - shaped transfer copings of implantium (dentium) were adapted to the implants using uniform 10 n / cm torque. the impression materials were machine - mixed (pentamix, 3 m espe, seefeld, germany), and some of them were meticulously injected around the transfer copings and on the die to ensure complete coverage. the remaining impression material was loaded onto the impression trays. before securing the transfer copings and mixing the material for each group, the model was cleaned ultrasonically to remove any residue and was then air - dried. the impression tray was lowered over the reference model until the tray was fully seated on the location marks. to simulate the impression material polymerization conditions in the mouth, a 5 kg weight was placed over the impression trays which were placed in distilled water at 36 1c [14 ]. after five minutes, in all groups, the impression / matrix set was separated and impressions were inspected and repeated when inaccuracies such as air voids were found. in closed tray groups, the conical transfer copings were unscrewed from the matrix and fitted to the implant analogues, and immediately replaced in each respective notch left in the impression. the combined transfer coping - analogue unit was inserted into the impression by firmly pushing it into place to full depth and slightly rotating it clockwise to feel for the anti - rotational resistance. this tactile feel indicated that the three grooves on the coping were locked into place and that the implant orientation was accurately transferred. in open tray groups, the screws of the copings were removed with a screwdriver, and then the impression / matrix set was separated. impressions were poured with vacuum - mixed dental stone type iv (herostonel vigodent inc., rio de janeiro, rj, brazil) using a powder / water ratio of 30 g/7 ml, according to the manufacturer s recommendation. the impressions were separated from the definitive casts 120 minutes later. all impression making procedures were performed by a single operator. a single calibrated blinded examiner performed all readings randomly and out of sequence to evaluate the positional accuracy of the implant replica heads using a cmm (mistral, dea brown & sharpe, grugliasco, italy) capable of simultaneously recording x and y dimensions. a 0.5-mm - wide straight probe recorded the distance between the implant apertures in each direction (x and y) and the reference point (figs. 3 and 3b). to evaluate angular changes, the flat side of the transfer copings was used as reference for measuring the rotations (figs. 4a and 4b). the green lines show the measurement on the cast superimposed on the original diagram (b). schematic drawings of the measurements of implants for rotational displacement on the reference model (a), and on the cast superimposed on the original diagram (b). to determine the accuracy of surface detail reproduction by evaluating the reproducibility of the grooves, vmm (starrett, galileo vision system, birmingham city, england) was used. a 0.2-mm - wide straight probe recorded the three points in the deepest part of grooves. the data obtained from the readings were recorded and presented in absolute values in each direction. the mean values and standard deviations (sd) were calculated and then submitted to the anova with two variables (impression technique and impression material) at a significance level of 5% (p0.05) (tables 1 and 4). calculated p - values of the effect of impression material on linear and angular displacement variables by t - test. according to t - test, the comparison between open tray and closed tray techniques using pvs impression material revealed less x and r for closed tray technique (p0.05) (tables 1 and 4). calculated p - values of the effect of impression material on linear and angular displacement variables by t - test. making an impression to simultaneously transfer the 3-dimentional position of implants and reproduce details of prepared teeth is sometimes needed in partially edentulous patients. using appropriate impression materials and techniques helps to achieve precise and passively fitting superstructure in implant supported prosthesis [3 ] and proper fit for the cast restorations [2 ]. there is a variety of impression techniques for impression making of implants [7 15 ] and yet there is no agreement on the most accurate technique and material for all the situations. although there is a technical report about an impression technique for arches requiring impression making of both implants and natural teeth by chee and alexander [22 ], this issue has not been investigated as an original research before. in the current study, regular - body pvs and pe were used with open tray and closed tray impression techniques. both techniques require a blind manipulation, one in attaching an analogue, the other in fully seating the coping - analogue combination. according to most previous studies, both impression materials used in this study have excellent dimensional accuracy and are capable of precise surface detail reproduction [14 21 ]. to measure the dimensional and rotational displacement of implants during transfer to the definitive casts, the cmm was used which had considerable precision and its accuracy was 2.8 m. however, most other studies have used traveling microscopes in which inaccuracy was expressed in only two dimensions [12 ], or strain gauges to indirectly quantify distortion [10 ]. according to the results of this study, the null hypothesis emphasizing no significant difference between two impression techniques and materials for the implant position transfer was refuted. however, the results supported the second null hypothesis declaring no significant difference in the surface detail reproduction using different impression techniques and materials. data analysis showed that when open tray technique was used, pe impression material showed less linear displacement compared to pvs impression material (p0.05). thus, it can be stated that both pvs and pe are appropriate choices for fabricating cast restorations. according to the american dental association specification no.19, elastomeric impression materials should be able to reproduce fine details of 25 m or less to be considered suitable for fabrication of precision castings [22 ]. while in this study, vmm with 0.3 m accuracy was used to evaluate surface detail reproduction of three different depths of grooves on the definitive casts, some studies used the criteria of ada specification no.19 for this purpose, which is continuous replication of at least 2 of the 3 horizontal grooves under 10 magnification [19 ] or by use of a measuring microscope with an accuracy of 0.001 mm [20 ]. in some groups, there may be some factors contributing to these deviations, including errors in impression procedure, contraction of the impression material, investment expansion or higher accuracy of vmm compared to the wire cutting machine, which was used for inscribing the grooves on the reference model. one advantage of the current study was to consider the importance of transferring the exact dimensional position of implants and recording the detailed information simultaneously, which has not been investigated by other pertinent articles. the main concern in the impression making of implants is to transfer their 3d spatial status intra - orally to the definitive casts, while reproducing the surface details of the prepared tooth is an important concern as well. another advantage of this study is using measuring systems with high degree of accuracy, while most previous studies used 2d measuring devices with less accuracy. further studies should be conducted with different number and angulation of implants of various systems in presence of prepared teeth, which may require a tray removal path not perpendicular to the horizontal plane. one of the limitations of the current study was that the surface detail reproduction of impression materials was investigated in a dry condition. therefore, further research is needed to determine the accuracy of impressions in wet conditions similar to the mouth and also to evaluate the effect of another limiting factor on surface detail reproduction, which is the ability of gypsum die materials to replicate the fine details. within the limitations of this in vitro study, it can be concluded that the choice of impression material and impression technique may be influenced by one another, and it is better to choose certain impression materials in combination with a certain impression technique. there was less inaccuracy for open tray technique when pe impression material was used, and also generally, open tray technique seemed to be a better choice when using pe. both closed tray and open tray techniques were acceptable when they were used with pvs. also, when closed tray technique was used, both pe and pvs impression materials produced acceptable results. also, the choice of impression material caused no significant difference in surface detail reproduction accuracy. | objectives : the purpose of this study was to compare the accuracy of implant position transfer and surface detail reproduction using two impression techniques and materials.materials and methods : a metal model with two implants and three grooves of 0.25, 0.50 and 0.75 mm in depth on the flat superior surface of a die was fabricated. ten regular - body polyether (pe) and 10 regular - body polyvinyl siloxane (pvs) impressions with square and conical transfer copings using open tray and closed tray techniques were made for each group. impressions were poured with type iv stone, and linear and angular displacements of the replica heads were evaluated using a coordinate measuring machine (cmm). also, accurate reproduction of the grooves was evaluated by a video measuring machine (vmm). these measurements were compared with the measurements calculated on the reference model that served as control, and the data were analyzed with two - way anova and t - test at p= 0.05.results:there was less linear displacement for pvs and less angular displacement for pe in closed - tray technique, and less linear displacement for pe in open tray technique (p0.05).conclusion : the open tray technique was more accurate using pe, and also both closed tray and open tray techniques had acceptable results with the use of pvs. the choice of impression material and technique made no significant difference in surface detail reproduction. |
treatment of cancers with cytotoxic agents such as tyrosine kinase inhibiting drugs often, but not always, results in transient to permanent testicular dysfunction. germ cells are important targets of many chemicals. most of the drugs are genotoxins and induce irreversible effect on genetic makeup. this is alarmingly dangerous in youth and children, since these effects last longer, affecting fertility or forming basis for carcinogenesis. hence, the mutagenicity studies employing in vivo tests in mammals, which have close resemblance of metabolism to humans have received much attention. over the last 1020 years, there has been overwhelming interest in addressing this question as more people are being exposed to agents that alter fertility parameters. a number of animal studies as well as human epidemiological studies have demonstrated that exposure of males to various agents could result in abnormal reproductive, pregnancy, or progeny outcomes. adverse effects of drugs on male fertility are observed more often than they are expected. in general, they are not recognized till andrological examination for infertility. a transient or permanent inhibition of male fertility is possible by drugs via the interference of one of the following functions : spermatogenesis, sperm maturation within the epididymis, sperm transport, sperm metabolism and motility, semen liquefaction, capacitation, acrosomal reaction, or ovum penetration. imatinib mesylate is white to off - white to brownish or yellowish tinged crystalline powder. it inhibits proliferation and induces apoptosis in bcr - abl positive cell lines as well as fresh leukemic cells from philadelphia chromosome positive chronic myeloid leukemia. imatinib (gleevec) (formerly sti571), natco pharma pvt ltd, hyderabad, india has demonstrated high levels of efficacy in gastrointestinal stromal tumors (gists). there is a report of the gist patient with male gynaecomastia and testicular hydrocele after treatment with imatinib mesylate. also reports are available for gynaecomastia in men with chronic myeloid leukemia after imatinib. but hence, this study was planned to assess the effects of imatinib on biochemical markers of testicular functions in male swiss albino mice. breeding and maintenance of animals were done according to the guidelines of committee for the purpose of control and supervision of experiments on animals and animal welfare division, government of india, for the use of laboratory animals. all the animals were housed in polypropylene cage using paddy husk for bedding at 281c temperature and 505% humidity. animals were fed on laboratory feed (gold mohur feeds ; lipton india ltd, hyderabad, india.) and water ad libitum. eighteen groups were injected with imatinib at the dose levels of 50, 75, and 100 mg / kg body weight intraperitonealy for a continuous period of 5 days with an interval of 24 h between two injections. after the last dose, the animals were sacrificed on 1, 2, 4, 5, 7, and 10 weeks sample times by the overdose of anesthesia (pentobarbital sodium, 40 mg / kg, sigma aldrich, bangalore, india). these sample time (1 - 5 weeks) establishes the treatment of spermatozoa in the epididymis and testis, spermatids, primary spermatocytes, secondary spermatocytes, spermatogonia and 710 week sample time represents treatment as stem cells respectively.[79 ] testes was removed and weighed. the testes were then minced in phosphate buffer solution at a ratio of 1:10 using pestle and mortar. the tissue homogenate obtained was cold centrifuged at 4c at 1500 rpm for 30 min. the testicular level of testosterone was analyzed in the homogenate by using a kit designed for elisa (elagen testosterone - biochem immunosystem, roche diagnostics, germany.). about 50 l of calibrators and tissue homogenate sample were added into appropriate wells of strips. mixture was incubated for 2 h at 37c without covering the plate. following this, the solution was discarded, wells were rinsed thrice with the washing solution (tween 20, sigma aldrich, bangalore, india). and amphotericin b (2.5 g / ml) in citrate - borate buffer and the residual fluid was removed. immediately, 100 l of chromogen substrate mixture (0.26 mg / ml of 3, 3, 5, 5-tetramethyl benzidine and 0.01% (w / v) of hydrogen peroxide in citrate buffer) was added to the wells and incubated for 15 min at room temperature avoiding exposure to sunlight. reaction was stopped by pipetting 100 l of the stop solution (sulfuric acid-0.3 mol / l) into the wells. absorption was read in elisa at 450 nm within 1 h from the addition of the stop solution, as per manufacturer 's instructions. testicular lactate dehydrogenase (ldh) was estimated by the optimized standard kit method (roche / hitachi) based on the principle that ldh catalyses the conversion of pyruvate to lactate ; nadh is oxidized to nad in the process. the ldh level was estimated by a kit using a spectrophotometer (optimized standard kit ; roche diagnostics, germany). six animals were used for each group and mean sd (standard deviation) was calculated. results obtained from the present study were correlated and analyzed by one - way analysis of variance (anova) followed by bonferroni 's post hoc test. testes was removed and weighed. the testes were then minced in phosphate buffer solution at a ratio of 1:10 using pestle and mortar. the tissue homogenate obtained was cold centrifuged at 4c at 1500 rpm for 30 min. the testicular level of testosterone was analyzed in the homogenate by using a kit designed for elisa (elagen testosterone - biochem immunosystem, roche diagnostics, germany.). about 50 l of calibrators and tissue homogenate sample were added into appropriate wells of strips. mixture was incubated for 2 h at 37c without covering the plate. following this, the solution was discarded, wells were rinsed thrice with the washing solution (tween 20, sigma aldrich, bangalore, india). and amphotericin b (2.5 g / ml) in citrate - borate buffer and the residual fluid was removed. immediately, 100 l of chromogen substrate mixture (0.26 mg / ml of 3, 3, 5, 5-tetramethyl benzidine and 0.01% (w / v) of hydrogen peroxide in citrate buffer) was added to the wells and incubated for 15 min at room temperature avoiding exposure to sunlight. reaction was stopped by pipetting 100 l of the stop solution (sulfuric acid-0.3 mol / l) into the wells. absorption was read in elisa at 450 nm within 1 h from the addition of the stop solution, as per manufacturer 's instructions. testicular lactate dehydrogenase (ldh) was estimated by the optimized standard kit method (roche / hitachi) based on the principle that ldh catalyses the conversion of pyruvate to lactate ; nadh is oxidized to nad in the process. the ldh level was estimated by a kit using a spectrophotometer (optimized standard kit ; roche diagnostics, germany). six animals were used for each group and mean sd (standard deviation) was calculated. results obtained from the present study were correlated and analyzed by one - way analysis of variance (anova) followed by bonferroni 's post hoc test. testes was removed and weighed. the testes were then minced in phosphate buffer solution at a ratio of 1:10 using pestle and mortar. the tissue homogenate obtained was cold centrifuged at 4c at 1500 rpm for 30 min. the testicular level of testosterone was analyzed in the homogenate by using a kit designed for elisa (elagen testosterone - biochem immunosystem, roche diagnostics, germany.). about 50 l of calibrators and tissue homogenate sample were added into appropriate wells of strips. mixture was incubated for 2 h at 37c without covering the plate. following this, the solution was discarded, wells were rinsed thrice with the washing solution (tween 20, sigma aldrich, bangalore, india). and amphotericin b (2.5 g / ml) in citrate - borate buffer and the residual fluid was removed. immediately, 100 l of chromogen substrate mixture (0.26 mg / ml of 3, 3, 5, 5-tetramethyl benzidine and 0.01% (w / v) of hydrogen peroxide in citrate buffer) was added to the wells and incubated for 15 min at room temperature avoiding exposure to sunlight. reaction was stopped by pipetting 100 l of the stop solution (sulfuric acid-0.3 mol / l) into the wells. absorption was read in elisa at 450 nm within 1 h from the addition of the stop solution, as per manufacturer 's instructions. testicular lactate dehydrogenase (ldh) was estimated by the optimized standard kit method (roche / hitachi) based on the principle that ldh catalyses the conversion of pyruvate to lactate ; nadh is oxidized to nad in the process. the ldh level was estimated by a kit using a spectrophotometer (optimized standard kit ; roche diagnostics, germany). six animals were used for each group and mean sd (standard deviation) was calculated. results obtained from the present study were correlated and analyzed by one - way analysis of variance (anova) followed by bonferroni 's post hoc test. the intratesticular testosterone was significantly reduced in treated groups and severe effect was observed on weeks 4 and 5. a significant decline in testosterone concentration there were dose response relations for changes in testosterone concentrations except on week 1 between groups 50 mg / kg wt and 100 mg / kg wt. all the treated groups recovered and reached the normal values by the tenth week. the decline in testosterone level was highest on week 4 and thereafter it showed a progressive increase in all treated groups [figure 1 ]. p values are control vs treated p < 0.001 (50 mg / kg vs 100 mg / kg), p < 0.05, p < 0.001 (75 mg / kg vs 100 mg / kg), p < 0.05 imatinib increased intratesticular ldh level up to week 5 in all treated groups, beyond which there was no effect except 100 mg / kgwt that showed a significant increase when compared to the normal up to week 7. in groups treated with 50 mg / kg weight and 75 mg / kg weight, the recovery period was similar and reached nearer to the control values by week 7 where as in 100 mg / kg weight, the recovery period was 10 weeks. the ldh value reached the highest level on week 4 and 5 and significance between the treated groups was observed during these days [figure 2 ]. p values are control vs treated, p < 0.05, p < 0.01, p < 0.001 (50 mg / kg vs 75 mg / kg) : p < 0.001 (50 mg / kg vs 100 mg / kg), p < 0.001 (75 mg / kg vs 100 mg / kg), and (c) p < 0.05 intratesticular testosterone is thought to play a very important role in spermatogenesis ; however, it is very rarely measured. it has been observed that when sex hormone binding globulin (shbg) is elevated, more of the total testosterone is bound to shbg, and less of it remains available as free, or biologically active, testosterone. thus, levels of total testosterone may be normal or even elevated while the concentration of free, or bioactive, testosterone is reduced. however, it is known that imatinib can also inhibit c - kit tyrosine kinase and platelet - derived growth factor receptor (pdgfr) tyrosine kinase. c - kit activity is modulated by the stem cell factor which in combination with insulin - like growth factor has effect on the luteinizing hormone receptor and increases the expression of star, cyp11a, cyp17, and 3hydroxysteroiddehydrogenase mrna expression. therefore, imatinib can reduce testosterone biosynthesis by inhibiting c - kit and pdgfr in the testis. administration of a single dose of imatinib resulted in a decreased rate of proliferation of the mesenchymal precursor cells which affected their maturation to leydig cells and, thereby, the size and function of the adult leydig cell pool. these changes affecting leydig cells in their study resulted in the decreased production of testosterone. in our study, the intratesticular testosterone was significantly reduced in all treated groups of mice. the decline in the intratesticular testosterone level was highest during the fourth and fifth sampling week for all the dose levels. a high level of expression of pdgf receptors is observed in adult leydig cells in the mature testis, a fact which may be related to the clinical observation that oral treatment with imatinib may reduce testosterone secretion. the testosterone secretion may be impaired due to excessive oxidative stress and the degeneration of leydig cells. imatinib enhanced increased reactive oxygen species (ros) production and depolarization of the inner mitochondrial membrane. so the decrease in the levels of intratesticular testosterone observed in our study may be mainly due to the effect of imatinib on the leydig cells and also the enhanced ros production. ldh - c4 is a membrane enzyme unique to primary spermatocytes, spermatids, and spermatozoa and is the enzyme whereby the supply of lactate from the sertoli cell is utilized as an energy substrate. ldh levels provide a quantitative basis for the loss of cell viability and its application in assessing the cytotoxicity of the cell. in our study, the ldh level was increased in a significant manner from second to fifth week sampling time. the increase in ldh levels up to day 35 indicated that imatinib was cytotoxic to spermatogonia, hence, releasing the ldh. in our study, we have observed an increase in the ldh level and also thinning of seminiferous epithelium of testis (results not shown). similar observations are made by russell and buonaguidi, who reported that increase in the ldh level is due to the induced damaged of seminiferous epithelium. our study showed sloughing of seminiferous epithelium, reduced sperm count and increased percentage of abnormal sperms (results not shown) which resulted from an elevated ldh level. these findings are consistent with a previous study which stated that the increase in the ldh activity level has a direct effect on testicular functions such as sperm count, sperm production, as well as sperm morphology. imatinib does affect testosterone and ldh level significantly, but this effect is reversible once the drug is withdrawn. imatinib is not only toxic to germ cells, but also to the leydig cells. all these effects on the germ cells are reversible by day 70 after the last exposure indicating no effect on stem cell lines. the duration of spermatogenesis in human is about 74 days. considering that the human germ cells have same sensitivity as that of mouse germ cells, the young patients undergoing one cycle of chemotherapy with imatinib must avoid conception for the period of about 150 days. if chemotherapy is repeated in the cyclic fashion, long - term cytotoxicity, genotoxicity, and gonadotoxicity in human can be expected. this finding may help the clinicians to plan and address the fertility - related issues in young patients of reproductive age who are being treated with imatinib for gastrointestinal tumors and chronic myeloid leukemia. | background : treatment of cancers with cytotoxic agents such as tyrosine kinase inhibiting drugs often, but not always, result in transient to permanent testicular dysfunction. germ cells are important targets of many chemicals. most of the drugs are genotoxins and induce irreversible effect on genetic makeup. these mutagenic changes are proportionally related to carcinogenesis. this is alarmingly dangerous in youth and children, since these effects last longer, affecting fertility or forming basis for carcinogenesis. there is paucity of reports on planned studies of imatinib on the testicular function. hence, the study was planned to assess the effects of imatinib on biochemical markers of testicular functions in male swiss albino mice.materials and methods : male swiss albino mice were treated with imatinib and sacrificed at the end of first, second, fourth, fifth, seventh, and tenth week after the last exposure to imatinib. the testis were removed, weighed, and processed for biochemical analysis.results:the intratesticular testosterone level was significantly (p<0.001) reduced in treated groups and severe effect was observed on week 4 and 5. the intratesticular lactate dehydrogenase (ldh) level was significantly increased by imatinib in all treated groups up to week 5.conclusion:imatinib does affect testosterone and ldh level significantly, but this effect is reversible once the drug is withdrawn. this finding may help the clinicians to plan and address the fertility - related issues in young patients of reproductive age who are being treated with imatinib for gastrointestinal tumors and chronic myeloid leukemia. |
cellular neurothekeomas are considered a variant of neurothekeomas, with distinct microscopic and immunohistochemical features. lesions typically appear on the head and upper extremities of young adults. here we report a case of a cellular neurothekeoma on the scalp of a 12-year - old girl presenting with intermittent headaches. a 12-year - old girl presented with a 1-year history of a slow - growing papule on her right frontal scalp (fig. 1). the patient reported intermittent headaches increasing in frequency localized under the lesion, without any associated itchiness, drainage, or hair loss. physical exam revealed a firm, fixed, 5-mm orange - pink papule on the right frontal scalp, with tenderness to palpation. histopathologic examination revealed a diffuse proliferation of spindle and epithelioid cells within the superficial and deep reticular dermis, arranged in a nested and fascicular growth pattern (fig. 2, 3, 4). conservative re - excision with 2-mm margins was performed, and the patient reported a cessation of headaches after removal of the lesion. neurothekeoma was first described by harkin and reed in 1969 as a rare neoplasm arising in endoneurium of peripheral nerves and characterized by an abundant mucoid matrix and called myxoma of the nerve sheath. the term neurothekeoma was first used in 1980 by gallager and helwig. neurothekeomas were initially divided into three histological variants : classical (myxoid), cellular, and mixed, with mixed type tumors showing microscopic features of both classical and cellular variants. the classical lesions are characterized by myxoid stroma containing well - circumscribed nests of epithelioid and spindled cells. these subtypes generally stain positive for s-100, collagen type iv, and nerve growth factor, and do not stain for epithelial membrane antigen or markers of histiocytic differentiation. these lesions are best considered nerve sheath myxomas, as they demonstrate features of peripheral nerve differentiation including consistent s-100 positivity. cellular neurothekeomas were first described by rosati in 1986, but the histogenesis of the neoplasm remains ill - defined. they lack distinctive microscopic and immunohistochemical features consistent with neural differentiation, and contain a mixture of cell lines with immature features of fibroblasts, schwann cells, myofibroblasts, perineural cells, smooth muscle cells, and histiocytes. the tumors consist of poorly circumscribed nests and fascicles of epithelioid cells with pale eosinophilic cytoplasm. the cells stain positively for nk1c3 and ki - m1p, and do not stain for s-100, collagen type iv, and nerve growth factor. zelger. have suggested that cellular neurothekeomas may be a variant of dermatofibroma due to many similar features, including benign course with rare recurrence after excision, lack of visceral involvement, tendency to occur in young females, variable immunochemistry, predominately dermal locations and peripherally accentuated sclerotic collagen. the variability of microscopic and immunohistochemical findings in cellular neurothekeoma has created problems in establishing a universal set of criteria for diagnosis, leaving a broad differential diagnosis in many cases. suggested that reevaluation of these neoplasms is necessary, as well as a return to the original moniker of neural sheath myxoma for classic lesions, and the development of a new term to describe the cellular variants. in a study conducted by hornick and fletcher, 133 cases of cellular neurothekeomas of the cases reviewed, the mean age of tumor onset was 25 years, and 84% of the patients were under the age of 40, with a 1:1.8 male - to - female ratio. thirty - five percent of lesions were found on the upper extremities, and 33% on the head or neck, with a mean size of 1.1 cm. the significance of atypia (high mitotic rate, pleomorphism, and infiltration of the subcutaneous tissues) in these tumors has yet to be determined, although studies have suggested minimal clinical impact. the specimen stained positively for nk1c3 and did not stain for s-100, with histology showing spindled and epithelioid cells in nests and fascicles, all consistent with the diagnosis of cellular neurothekeoma. the complaint of headaches by our patient is a unique aspect of our case, as these lesions are most commonly associated with mild tenderness of the lesion upon palpation, and only cases featuring intracranial neurothekeomas have been associated with significant headaches. the connection between extracranial tumors and headaches has yet to be clearly defined, although intracranial processes are commonly associated with headaches secondary to mass effect. report a case of severe headaches caused by sebaceous cell carcinoma of the scalp, which resolved after removal of the lesion. detail a case involving headaches secondary to a lipoma of the scalp compressing a branch of the greater occipital nerve in a patient with adiposis dolorosa. we believe the headaches in our case may have been associated with the compression of a small cutaneous nerve, which was alleviated upon removal of the lesion. in summary, cellular neurothekeomas are uncommon, benign tumors of controversial origin, typically found on the head, neck or upper extremities of young adults. our case represents a unique presentation of an extracranial neurothekeoma of the scalp with complaint of headaches, previously unpublished in the literature. | a 12-year - old female presented with a 1-year history of a slow - growing lesion on the frontal scalp. the patient reported intermittent headaches increasing in frequency localized under the lesion. physical exam revealed a firm, fixed, 5-mm orange - pink papule on the right frontal scalp. excisional biopsy was performed using a 6-mm punch biopsy, after which the patient reported a cessation of headaches. histopathology showed a diffuse proliferation of spindled and epithelioid cells within the superficial and deep reticular dermis demonstrating a nested as well as fascicular growth pattern. there was also focal myxoid dermal change. immunohistochemical staining showed the tumor to be strongly positive for nk1c3 and negative for s-100. a diagnosis of cellular neurothekeoma was made. cellular neurothekeomas are slow - growing, asymptomatic nodules that most frequently appear on the head and neck of young adults. cellular neurothekeomas rarely present with symptoms beyond mild tenderness upon palpation. our case represents a unique presentation of a neurothekeoma of the scalp with complaint of headaches, previously unpublished in the literature. |
rate of unscheduled return visits (urvs) to the emergency department has been considered as a key indicator for evaluating the quality of the emergency department care for decades (1). unscheduled return visits are defined as return of a patient to the emergency department with the same chief complaint, which has not improved or has worsened within 72 hours of discharge (2). based on previous studies, patients with certain chief complaints such as chest pain and dyspnea are likely to return to the emergency department within 72 hours of discharge (1, 3, 4). the need to confirm diagnosis and provide rapid and correct management of these patients has brought about the concept of the chest pain unit (cpu) (5). although excluding the presence of coronary disease for any cpu is critical, in low - risk patients complaining of chest pain, the probability of the presence of a cardiac origin is less than 7% (6, 7). accordingly, more than 90% of chest pains in low - risk patients have a non - cardiac etiology (7, 8). failure to differentiate between cardiac and non - cardiac origins of chest pain in the cpu can have severe consequences. when the chest pain returns, it is natural for a patient to seek further medical attention and these patients may or may not have been given instructions about recurrent pains during their first hospital admission (7, 9). as a result, investigation on whether or not the patient has received inappropriate treatment or been discharged without effective treatment is of vital importance. rates of urvs less than 1% are deemed acceptable, yet this is far from constituting a universally accepted standard (2, 10, 11). hence, a rate of urvs more than a certain level reflects the malfunction of the emergency department (2, 12, 13). despite the fact that urvs should not be spontaneously regarded as a poor performance of health care service, there are multiple associated factors which should be investigated. previous studies on 72 hours urvs have demonstrated that a significant proportion of these visits are preventable. there have been only a few recent studies about factors associated with 72 hours returns. to our knowledge, in addition, to date, no study has addressed the reasons for urvs to a cpu. in the present study, we investigated the causes of 72 hours urvs to our cpu with a view to find inadequacies and to propose preventive strategies. this single - center, retrospective, case - control study was performed in the setting of the cpu of tehran heart center (a 460-bed, tertiary - care teaching hospital), tehran, iran. the medical records of the patients who were presented to the cpu with a chief complaint of chest pain between december 28, 2010 and february 28, 2011 were collected. the medical records of the patients with first - time cpu attendance as well as those of the patients with 72 hours urvs with the same chief complaint were studied. of the 6247 eligible patients who had referred to the emergency department with the chief complaint of chest pain during the study period, forty - nine urvs with chief complaint of chest pain during both visits, who were resident of tehran, with complete the control group consisted of 196 residents of tehran, who did not return to the emergency department during our study period. the number of the patients in the control group was four times greater than the case group. the patients demographic data, presenting complaints, vital signs, past medical history, drug abuse, presenting electrocardiography (ecg), first and second - visit disposition, and causes of revisits were recorded. medical records of the first and second visits were evaluated by two cardiologists, whose consensus determined reasons for the returns. reasons for return visits were classified to three groups of illness - related, patient - related and doctor - related. illness - related returns were defined as the exacerbation or absence of improvement in the patients symptoms or the occurrence of treatment side - effects. doctor - related returns were defined as situations in which the doctor was primarily responsible for the patient s return visits by misdiagnosis or incorrect treatment. patient - related returns were defined as situations in which the patient left the cpu against medical advice (ama). an abnormal ecg was defined as any non - sinus rhythm, st - segment deviation (0.5 mm), t - wave inversion (1 mm), abnormal axis deviation and bundle branch block. categorical variables were presented by frequencies and percentages and were compared between case and control groups using chi - square or fisher s exact test. continuous variables were expressed as mean standard deviation (sd) and were compared between cases and controls using student s t or mann - whitney test. to determine multiple predictors of 72 hours urvs, backward firth 's bias reduced logistic regression approach with penalized profile likelihood for parameter estimates was used (14). covariate effects on 72 hours urv were reported as odd ratios (or) with 95% confidence intervals (cis). package logistf from r software was used for the analysis (15). categorical variables were presented by frequencies and percentages and were compared between case and control groups using chi - square or fisher s exact test. continuous variables were expressed as mean standard deviation (sd) and were compared between cases and controls using student s t or mann - whitney test. to determine multiple predictors of 72 hours urvs, backward firth 's bias reduced logistic regression approach with penalized profile likelihood for parameter estimates was used (14). covariate effects on 72 hours urv were reported as odd ratios (or) with 95% confidence intervals (cis). package logistf from r software was used for the analysis (15). the mean age was 51.86 17.25 years for the total population, ranging between 17 and 95 years. the patients in the case group were more likely to be male (69.4% vs. 45.4% ; p value = 0.003). there was a significant difference between the case and control groups regarding the presence of dyspnea, which was the most frequently associated symptom (p value = 0.010). a significant difference was observed in the history of hypertension, dyslipidemia, diabetes and current cigarette smoking between the two groups. seventy patients in the control group and 20 patients in the case group had abnormal ecgs at presentation (35.7% vs. 40.8%). high - sensitivity cardiac troponin t test (hs - ctnt) was checked at presentation, which showed a significantly higher median value in the case group when compared to the control group (8.09 ng / l vs. 3.65 ng / l ; p value = 0.002). illness - related factors were the second most frequent reason for 72 hours urvs (34.7% of total bounce - back reasons). a large proportion of these subjects showed failure to improve (94.1 %) (table 2). doctor - related factors constituted the least common reason for 72 hours urvs (16.3%). among the reasons for ama, personal reasons and unavailability of beds were the most frequent (33.3 %) followed by overcrowding and leaving the emergency department without permission, respectively. in addition, our multivariable analysis revealed that ama, male sex, and hypertension were the most important independent predictors of 72 hours urvs (tables 3 and 4). abbreviations : ama, against medical advice ; ccu, cardiac care unit ; cpu, chest pain unit ; ed, emergency department. in this retrospective, case - control study, we found that in our cpu, leaving the emergency department ama, male sex, and hypertension were the most important predictors of 72 hours urvs. also, age was the other associated factor. equally important, first visit disposition to observation unit had a protective effect on urvs. emergency department return visits can lead to overcrowding and longer waiting times and can, thus, exert a negative impact on the quality of health care, time - to - treatment results and treatment outcomes. the 72-hour time point has been defined as a benchmark for measuring the emergency department return visits (16, 17). in our study, the return pattern showed that the average age in the case group was seven years older than that of the control group and this difference was significant (p value = 0.01). recurrent visits of elderly patients to the emergency department are an important component of increased urvs to the emergency department. a systematic review of elderly patients at the emergency department demonstrated that these patients were more likely to have an emergency department return (1, 18). consequently, older patients with chest pain should be evaluated with more caution and should not be discharged unless the source of their problem is defined correctly. one of other important risk factors for urvs among our study population was the male sex. there were significantly more males in the case group than in the control group. in a similar study at a general emergency department, sauvin. nonetheless, some other studies did not find significant differences with respect to urvs between the different sexes (18, 20). there were significantly more patients with a history of hypertension in the case group (p value = 0.003). hypertension is a major risk factor for coronary artery disease, heart failure, variety of arrhythmias, and sudden death. this finding may also reflect the fact that patients with hypertension are more concerned about their symptoms and are likely to return to the hospital after their first visit. among factors associated with urvs in our study, illness - related and doctor - related factors were determined as the second and third most frequent associated factors. leaving the hospital ama patients who leave ama probably need further care and, consequently, expose themselves to an increased risk of adverse medical outcomes. in a large retrospective study, patients with myocardial infarction (mi) who left ama had a 40% higher risk for death and readmission owing to mi during the next two years (21, 22). another study demonstrated that more than one in six ama patients return to the hospital within 30 days (23). the phenomenon of ama is worldwide and is not limited to underdeveloped countries. to the best of our knowledge, there is a paucity of data on the medical importance and etiologies of leaving ama from a cpu. identification of the risk factors allied with leaving the hospital ama is the first step in designing strategies to decrease the occurrence of leaving ama, to prevent a large proportion of urvs, and to boost health care quality. given that in our study, the most frequent reasons for leaving ama were personal reasons and unavailability of beds, it is reasonable to suggest that cpus should be expanded and more proper strategies be devised in order to prevent urvs. some of these strategies could include proper counseling and full clear explanation about the potential adverse outcomes of leaving ama, informing the patient about risks, benefits, and the consequences of such decision. it is also equally important to allow patients sufficient time so that they can properly weigh up their options (24). therefore, the application of these strategies necessitates good communication skills and good patient - physician relationships (21). in our study, ng. (22) reported that the most common reason for urvs was illness - related, which is similar to the finding in the wong s study (25). in contrast, pierce from the usa reported that patient - related factors were the most important cause of bounce backs (24). in our study, with the exception of one case, lack of improvement in the illness was identified as the illness - related factor. many of these short - time failures and worsening symptoms can be prevented by longer monitoring before discharge (20, 24). furthermore, thorough and comprehensive explanations before discharge in the form of written instructions and pamphlets can prevent some of such urvs. doctor - related factors were responsible for only 16.3% of all studied urvs. in another study, doctor - related issues made up a small minority of the reasons for return (22) an overcrowded emergency department creates an overload for treating physicians and therefore, physicians may be blamed for some urvs. correct diagnosis and management of patients and, by extension, lessening of the risk of untimely discharge from the emergency department requires longer monitoring periods and repeated examinations before discharge. firstly, it presents the experience of a teaching hospital with a cpu and these findings may, consequently, not be applicable to other cpus. secondly, its retrospective design and small sample size limit the extension of the results. thirdly, we only enrolled patients who presented chest pain and, thus, did not include patients presenting non - chest pain complaints such as shortness of breath, nausea, and other non - specific symptoms. also, some of urvs occurred at other centers, which we did not investigate. equally important, in case - control studies, information bias is common, and in our study the main decisions were based on the obtained information. in the present study, we sought to identify the causes of 72 hours urvs to our cpu with a view to propose preventive strategies. our results demonstrated that the patients who left the emergency department ama were more likely to return to the emergency department. in addition, male sex and history of hypertension were the most important independent predictors of 72 hours urvs. firstly, it presents the experience of a teaching hospital with a cpu and these findings may, consequently, not be applicable to other cpus. secondly, its retrospective design and small sample size limit the extension of the results. thirdly, we only enrolled patients who presented chest pain and, thus, did not include patients presenting non - chest pain complaints such as shortness of breath, nausea, and other non - specific symptoms. also, some of urvs occurred at other centers, which we did not investigate. equally important, in case - control studies, information bias is common, and in our study the main decisions were based on the obtained information. in the present study, we sought to identify the causes of 72 hours urvs to our cpu with a view to propose preventive strategies. our results demonstrated that the patients who left the emergency department ama were more likely to return to the emergency department. in addition, male sex and history of hypertension were the most important independent predictors of 72 hours urvs. | background : rate of unscheduled return visits (urvs) to the emergency department has been considered as a key indicator for evaluating the quality of the emergency department care for decades. a higher rate of urvs can have a negative impact on the quality of health care. investigations of the reasons for these returns have indicated that many of these visits can be preventable.objectives:given that there are no clear findings about the frequency and reasons for 72 hours urvs to the chest pain unit (cpu), in the present study, we investigated the causes of 72 hours urvs to our cpu in order to find out the inadequacies, and propose preventive strategies.patients and methods : this research was a single - center retrospective case control study in the setting of cpu of tehran heart center (a 460-bed, tertiary - care teaching hospital), tehran, iran. the medical records of the patients who were presented to our cpu with the chief complaint of chest pain between december 28th, 2010 and february 28th, 2011 were reviewed. of the 6247 eligible patients, forty - nine urvs that fulfilled our criteria were identified. the control group consisted of 196 patients who did not return to the emergency department during our study period.results:patient-related factors accounted for most 72 hours urvs (49%). multivariable analysis revealed that in our cpu, leaving against medical advice was the most important predictor for 72 hours urvs (p value < 0.001). additionally, male sex, history of hypertension, first - visit disposition to observation unit and age were the other factors associated with urvs.conclusions:considering that the most frequent reason for our urvs was patient - related factors, where all cases had left the cpu against medical advice (ama) during their first attendance, we recommend that further appropriate strategies be devised to prevent leaving against medical advice. |
site - specific labeling and modification of large rna molecules provide a wide variety of applications in many areas, such as biochemical and biophysical studies, synthetic biology, in vitro evolution, generation of functional nucleic acids, and construction of nanomaterials and biosensors. the site - specific incorporation of functional nucleotide analogs into rna molecules is performed by chemical synthesis, posttranscriptional modification, and enzymatic incorporation of nucleotide analogs as substrates. among them, chemical synthesis is a commonly employed method. other site - specific modifications of rna, by posttranscriptional modification [1, 2 ] and enzymatic incorporation using cap or triphosphate analogs [36 ], are limited to terminal modifications of rna. in contrast to these rna labeling methods, introducing an artificial, extra base pair (unnatural base pair), as a third base pair, to in vitro transcription systems allows the site - specific incorporation of an unnatural base linked with functional groups into desired positions of rna during transcription mediated by the unnatural base pair. thus, several unnatural base pairs that function in polymerase reactions have rapidly been developed for site - specific labeling of rna molecules [718 ]. here, for the site - specific incorporation of functional components into large rna molecules, we report a fusion pcr and transcription system that employs two unnatural base pairs of 7-(2-thienyl)-imidazo [4,5-b]pyridine (ds) and 2-nitro-4-propynylpyrrole (px) [19, 20 ] and ds and pyrrole-2-carbaldehyde (pa) (figure 1). the ds - px pair exhibits high efficiency and selectivity in pcr amplification as a third base pair. under optimized conditions, more than 97% of the ds - px pair survives in the 10-fold amplified dnas through exponential 100-cycle pcr (10 cycles repeated 10 times). in particular, a modified px base, 4-(4,5-dihydroxypent-1-yn-1-yl)-2-nitropyrrole (diol1-px, figure 1), has extremely high specificity as a pairing partner of ds, and thus the misincorporation rates of diol1-dpxtp and ddstp opposite the natural bases in templates during pcr amplification are as low as 0.005% per base pair per replication. here, we applied the ds - px pair to fusion pcr, using small dna templates containing ds with diol1-dpxtp and ddstp, to prepare large ds - containing dna templates for a genetic - expansion transcription system, and generated 282-bp double - stranded dna fragments containing the ds and diol1-px pair. using the ds - containing dna templates, we performed the site - specific incorporation of biotin - patp, as a functional unnatural base substrate, into 260-mer transcripts by t7 rna polymerase. in transcription, the pa base is superior to the px base in terms of both the incorporation selectivity opposite ds and the chemical stability of the nucleotide. however, in pcr amplification, the ds - px pair is more selective and efficient than the ds - pa pair, and thus to utilize both pairs ' advantages, we developed a two - unnatural - base - pair system, the ds - px pair for fusion pcr, and the ds - pa pair for t7 transcription (figure 2). by attaching functional groups of interest to the pa base, this fusion pcr and transcription system could be a powerful tool for the site - specific labeling and functionalization of large rna molecules. oligonucleotides containing ds were synthesized with an applied biosystems 392 dna synthesizer, using ce phosphoramidite reagents for the natural and ds bases (glen research), and were purified by gel electrophoresis. accuprime pfx dna polymerase, sybr gold nucleic acid gel stain, and 10x pbs were purchased from invitrogen. streptavidin and silica - membrane columns for pcr product purification (wizard sv gel and pcr clean - up system) were purchased from promega. toluidine blue o was purchased from chroma gesellschaft schmidt & co. the rna ladder marker (dynamarker, rna low ii) was purchased from biodynamics laboratory, inc. the dna ladder marker (2-log dna ladder) was purchased from new england biolabs. unnatural nucleoside triphosphates (ddstp, diol1-dpxtp, biotin - patp, ddpatp, and dpatp) were synthesized as described previously [17, 19, 20 ]. natural ntp and dntp sets (100 mm solutions : atp, ctp, gtp, and utp, and datp, dctp, dgtp and dttp, resp.) were purchased from ge healthcare. tsutomu kishi (riken). to prepare the 282-bp double - stranded dna fragments containing the ds - px pair as templates for t7 transcription, two steps of pcr using accuprime pfx dna polymerase first, 86-bp dna fragments containing the ds - diol1-px pair were amplified through 25-cycle pcr (50 l) from 1 ng/l plasmid dna template, by using 1 m 5-primer (p1 : 5-aagcttaatacgactcactatag caagttcttgaaaacaagaat-3, the t7 promoter region is italicized, and the region complementary to the plasmid is underlined) and 3-primer (p2 : 5-aggctttaatttgctctagacdsncagtactgacaataaaaag-3, n = t, g, a, and c ; the region complementary to the plasmid is underlined) and 0.02 u/l accuprime pfx dna polymerase, in the manufacturer 's reaction buffer with 600 m each natural dntp, 50 m diol1-dpxtp, and 2 mm mgso4. the final concentrations of dntps and mgso4 were adjusted by adding 300 m each natural dntp, 50 m diol1-dpxtp, and 1 mm mgso4 to the 1xaccuprime pfx reaction mix, which originally contained 300 m each natural dntp and 1 mm mgso4. pcr conditions were 30 sec at 94c, 30 sec at 55c, and 2 min at 65c per cycle, and the amplified pcr products were purified by gel electrophoresis. as control experiments, we also performed pcr amplification using the p1 and p2 primers without ds (5-aggctttaatttgctctagacatcagtactgacaataaaaag-3), in the presence and absence of diol1-dpxtp. a 216-bp double - stranded dna fragment was amplified by 25-cycle pcr using 1 m p3 primer (5-tctagagcaaattaaagccttcg-3, the sequence complementary to the p2 primer is underlined) and p4 primer (5-ccccacatccgctctaaccgaa-3) from 1 ng/l plasmid dna template in the reaction buffer, containing 600 m each natural dntp and 2 mm mgso4, followed by gel purification. next, we performed fusion pcr (100 l) with accuprime pfx dna polymerase, using 1 m each of the p1 and p4 primers, and the purified 86-bp (25 nm) and 216-bp (1 nm) dna fragments, in the reaction buffer with 600 m each natural dntp and 2 mm mgso4, in the presence or absence of 50 m each of ddstp and diol1-dpxtp. pcr conditions were 30 sec at 94c and 3 min at 65c per cycle. after 25-cycle pcr amplification, the products were purified by passage through silica - membrane columns, according to the manufacturer 's instructions. the cycle sequencing reaction (10 l) was performed with the cycle sequencing mix (4 l) from the bigdye terminator v1.1. cycle sequencing kit, 1 l of 2 m sequencing primer (5-tgacaagttcttgaaaacaagaat-3), 2 l of 250 m dpatp or ddpatp, and 3 l of 50 nm dna fragments. the sequencing cycle parameters were 25 cycles of 10 sec at 96c, 5 sec at 50c, and 4 min at 60c. the residual dye terminators were removed with centri - sep columns, and the solutions were dried with a centrifugal vacuum evaporator. the residues were resuspended in 3 l of a formamide / bluedextran / edta loading buffer and analyzed with an abi 377 dna sequencer, using a 6% polyacrylamide-6 m urea gel. the sequence peak patterns were analyzed with the applied biosystems prism sequencing analysis software, v3.2. transcription (20 l) was performed in a buffer containing 40 mm tris - hcl (ph 8.0), 24 mm mgcl2, 5 mm dtt, 2 mm spermidine, and 0.01% triton x-100, in the presence of 2 mm each ntp, 0 or 2 mm biotin - patp, 100 nm 282-bp dna template, and 2.5 u/l t7 rna polymerase. after an incubation at 37c for 3 h, the reaction was quenched by adding an equivalent volume of a denaturing solution, containing 10 m urea in 1xtbe. the reaction mixtures were heated at 75c for 3 min, and 7.5 l aliquots were fractionated on a 5% denaturing polyacrylamide-7 m urea gel. after electrophoresis, the transcribed products on the gel were stained with toluidine blue and detected by a las 4000 imager. for gel - mobility shift assays, the full - length products were purified on a 5% denaturing polyacrylamide-7 m urea gel. we detected the biotinylated rna transcripts (260-mer) by gel - mobility shift assays, using streptavidin. we incubated the mixture (10 l) of 0.5 pmol transcripts and excess amounts of streptavidin (800 ng) for 1 h at 25c, in 1x pbs containing 5% glycerol. the biotinylated rna - streptavidin complexes were separated from the free rnas on a non - denaturing 8% polyacrylamide gel, and the rnas on the gel were stained with sybr gold and detected by an las 4000 imager. to examine fusion pcr using the ds - px pair, we prepared the 282-bp double - stranded dna (dsdna) templates containing the ds and diol1-px pair at internal positions by two pcr steps, using four pcr primers (p1 to p4) and a plasmid dna, as shown in figure 2., we used the plasmid as an initial pcr template to introduce the ds - px pair, and prepared two dsdna fragments (86- and 216-bp) by using accuprime pfx dna polymerase. the 86-bp dna fragment was amplified by the p1 and p2 primers and corresponds to the 5 region of the 282-bp template, which contains the t7 promoter sequence in its 5 region and the ds - px pair in its 3 region. the 216-bp dna fragment was amplified by the p3 and p4 primers and corresponds to the 3 region of the 282-bp template, which comprises natural bases only. since the p2 and p3 primers share a 20-mer complementary sequence, the 282-bp templates can be prepared by the second pcr step (fusion pcr) using the 86-bp and 216-bp dna fragments and the p1 and p4 primers. for preparing the ds - containing 86-bp dna fragments, we performed 25 cycles of pcr using each of the four p2 primers encoding a 5-cdsn-3 sequence (n = t, g, c, or a), in the presence of diol1-dpxtp, as well as the natural dntps as substrates and the p1 primer. each amplified pcr product was purified by gel electrophoresis, to completely remove the original plasmid template. as control experiments, we also performed pcr amplification using a non - ds - containing p2 primer with a 5-cat-3 sequence, in the presence and absence of the unnatural base substrate, diol1-dpxtp. the end - point analysis of the pcr products on the agarose gel revealed no differences among their pcr amplification efficiencies (data not shown). thus, under the conditions employed here by using accuprime pfx dna polymerase, the nature of the natural base nucleotide at the 5-neighboring position of ds does not affect the amplification efficiency. to prepare the full - length 282-bp templates by fusion pcr, we performed 25-cycle pcr using the p1 and p4 primers and the gel - purified 86-bp and 216-bp dna fragments as templates, in the presence of diol1-dpxtp and ddstp together with the natural dntps as substrates. the fusion pcr involving the ds - px pair with all four sequence contexts generated the full - length products with high efficiency, similar to that of the control experiment using the dna fragments with only the natural base sequence context. the site - specific incorporation of the ds - px pair into each of the 282-bp dna fragments was confirmed by dideoxy dye terminator sequencing of the ds - containing dna strands in the presence of the dideoxyribonucleoside or deoxyribonucleoside triphosphate of 4-propynylpyrrole-2-carbaldehyde (dpatp or ddpatp, figure 1), another pairing partner of ds (figure 3), according to our previously reported method [19, 20 ]. in the presence of ddpatp, the sequencing reaction terminated at the unnatural base position because of the incorporation of ddpatp opposite ds in the dna templates, and thus the following base peaks disappeared. in the sequencing in the presence of dpatp, the dpatp was incorporated opposite ds in the dna templates, and the following base peaks appeared, but there is no peak at the unnatural base position because no dye terminator corresponding to the unnatural base was present in the sequencing reaction. by comparing the sequence patterns of the dna fragment containing 5-apxg-3 with that containing 5-atg-3, the differences are clearly observed. these results indicated that the ds - px pair functions well in fusion pcr using accuprime pfx dna polymerase, and from the sequencing analysis, the retention rate of the unnatural base pair in the amplified dna fragments was more than 97%. next, we examined the transcription by t7 rna polymerase, using the 282-bp dna templates containing ds and biotin - patp as a functional component. transcription was performed in the presence of 2 mm biotin - patp, as well as 2 mm natural ntps, at 37c for 3 h, and the full - length transcripts (260-mer) were analyzed by denaturing polyacrylamide gel electrophoresis (figure 4). as control experiments, the non - ds - containing dna templates with the 5-cat-3 sequence, which were pcr amplified with or without the unnatural base substrates, were transcribed with or without biotin - patp. all of the transcription reactions produced similar yields of the 260-mer products. to characterize the selectivity of the biotin - pa incorporation into rna fragments by transcription, we performed gel - mobility shift assays of the biotinylated transcripts in the presence of streptavidin (figure 4). as for the incorporation site, we already confirmed the site specificity of the biotin - pa incorporation opposite ds in templates with various sequence contexts [17, 18 ]. from the gel shift assays, we estimated the biotinylation yields of each transcript (92% of the transcript was biotinylated for the 3-cdsc-5 template sequence, 84% for 3-tdsc-5, 75% for 3-gdsc-5, and 72% for 3-adsc-5). thus, in contrast to fusion pcr involving the ds - px pair, the biotinylation selectivity depended to some extent on the neighboring bases of ds, and the order of the effective sequence contexts of the 282-bp dna templates was the same as that of the previously determined effective sequence context of the 35-mer synthetic dna template for a 17-mer rna transcript with pa. the biotinylation yields resulted from the sum of the 25-cycle pcr and t7 transcription selectivities. however, the sequencing analysis (figure 3) indicated that the retention of the unnatural - base - pair in the amplified dna was more than 97% after 25-cycle pcr, and thus the biotinylation yields actually depended on the transcription selectivities of the ds - pa pair when using each dna template. we also assessed the misincorporation of biotin - patp opposite the natural bases in the two - unnatural base pair system. the misincorporation rates of biotin - patp into the transcript using the control 3-tac-5 templates, which were prepared by fusion pcr in the presence and absence of ddstp and diol1-dpxtp, were 22% and 13%, respectively. thus, the misincorporations correspond to only 0.096% (for 22% total) and 0.054% (for 13% total) per position in the 260-mer transcript, as calculated by the following equation : y = (1 x/100), where x% is the biotin - pa misincorporation rate opposite the natural bases per position and y is the ratio of nonbiotinylated transcript. these misincorporation rates were lower than those of the noncognate natural base pairings, as we previously reported that the misincorporation of biotin - linked utp opposite g, c, and t in the t7 transcription of a non - a - containing template was around 0.16% per base. in addition, the value of 0.054% is quite consistent with the value (0.06%) that we previously determined by t7 transcription of 152-mer transcripts in the presence of 2 mm biotin - patp and 2 mm natural ntps. this misincorporation rate also corresponds to the sum of the 25-cycle pcr and t7 transcription selectivities. thus, the difference between 0.096% and 0.054% was caused by the ds misincorporation into the template strand during 25-cycle pcr amplification with ddstp and diol1-dpxtp. in the 25-cycle fusion pcr, the pcr primers were mostly consumed, and the theoretical amplification cycle was estimated as ten (2 1000 = [primer]/[216-bp dna fragments ]). therefore, the ds misincorporation opposite a natural base per replication was calculated as approximately 0.004% ((0.096% 0.054%)/10). consequently, the ds misincorporation into the nontemplate strand would occur, and thus the misincorporation rates of diol1-dpxtp and ddstp opposite the natural bases in templates during pcr amplification would be 0.008%, which is as high as that of the noncognate natural base pairings. in this study, we demonstrated the two - unnatural - base - pair system for the site - specific labeling of large rna molecules by fusion pcr and t7 transcription. in fusion pcr, more than 97% of the ds - px pair was retained in the amplified 282-bp dna fragments, and the misincorporation rate of the unnatural bases opposite the natural bases was 0.008% per base per replication. we employed the natural base substrates at relatively high concentrations (600 m each), as compared to the unnatural base substrates (ddstp and diol1-dpxtp, 50 m each) in the fusion pcr, to reduce the misincorporation rate. by using this method, the biotin - linked unnatural base was site - specifically incorporated at predetermined positions of rna transcripts with selectivities ranging from 72% to 92%, depending on the sequence contexts around the unnatural base. in addition, the misincorporation rate of the biotin - unnatural base opposite the natural bases was around 0.05% per natural base. these selectivity and misincorporation rates were obtained using 2 mm unnatural and natural base substrates in t7 transcription. the incorporation selectivity (9096%) and the misincorporation rate of biotin - pa depend on the ratio of biotin - patp to the natural base ntps in transcription. thus, the incorporation efficiency and misincorporation rates can be adjusted by changing the concentration ratios between the unnatural and natural base substrates. to reduce the misincorporation of the unnatural base substrate opposite the natural bases, with the sacrifice of the incorporation efficiency of the unnatural base substrate at the desired positions, transcription should be performed with 1 mm unnatural base substrate and 2 mm natural base substrates [12, 17 ]. since several functional groups can be attached to the pa base, this method could be applied to a wide range of site - specific labeling and functionalization of large rna molecules. | for the site - specific labeling and modification of rna by genetic alphabet expansion, we developed a pcr and transcription system using two hydrophobic unnatural base pairs : 7-(2-thienyl)-imidazo[4,5-b]pyridine (ds) and 2-nitro-4-propynylpyrrole (px) as a third pair for pcr amplification and ds and pyrrole-2-carbaldehyde (pa) for the incorporation of functional components as modified pa bases into rna by t7 transcription. to prepare ds - containing dna templates with long chains, the ds - px pair was utilized in a fusion pcr method, by which we demonstrated the synthesis of 282-bp dna templates containing ds at specific positions. using these ds - containing dna templates and a biotin - linked pa substrate (biotin - patp) as a modified pa base, 260-mer rna transcripts containing biotin - pa at a specific position were generated by t7 rna polymerase. this two - unnatural - base - pair system, combining the ds - px and ds - pa pairs with modified pa substrates, provides a powerful tool for the site - specific labeling and modification of desired positions in large rna molecules. |
the patient is an indian gujarati girl who presented at the age of 3 years, when she was noted to have developmental regression in her motor milestones. initial concerns arose at 3 years due to frequent falls, clumsiness, and deteriorating handwriting suggestive of poor fine motor skills. thereafter for the following year, she gradually appeared clumsier, developing an unsteady gait. she also started with slurring of speech and gradually over the year lost her ability to speak and communicate. furthermore, she appeared to develop hyperactivity with a limited attention span affecting her learning. a brain magnetic resonance imaging (mri) showed subtle altered signal intensity in the subcortical white matter of the anterior temporal lobes along with mild cortical and cerebellar atrophy. her urine and plasma metabolic screen did not reveal any abnormality except for elevated plasma lactate on 1 occasion. on examination at 8 years of age when the patient presented to our clinic, the patient s head circumference, height, and weight were around average. she could walk a few steps unaided, but her gait was unsteady and stiff. her deep tendon reflexes were slightly increased (3 +) with a negative babinski reflex. her repeat brain mri with spectroscopy showed mild progression of global cortical atrophy, cerebellar atrophy, and ill - defined diffuse white matter t2 hyperintensities along with signal alterations in the dentatorubral pathways. based on these imaging findings, a diagnosis of late infantile- or juvenile - onset neuronal ceroid lipofuscinosis was in fact considered higher in the list. an electroencephalogram study showed independent frontocentral spike - wave discharges with no abnormality with photic stimulation at 1 hz / s. her repeat basic metabolic screen was again normal. in view of the above features, a neurology genetic panel was sent followed by advanced metabolic testing confirming a diagnosis of juvenile - onset tay - sachs disease and will be described in detail subsequently. in general, currently, she seems to be troubled by frequent behavioral alterations usually seen as suddenly getting up from sleep followed by inconsolable crying lasting for hours together and not responding to multiple medications. she is on sodium valproate, clonazepam, and risperidone but with very little effect (figure 1). the parents were expecting twins, 2 years after the birth of the index child. the other twin was delivered normally at full - term gestation but unfortunately died on day 14 of life due to an undiagnosed illness that started with seizures on day 4. his mri of the brain at day 12 of life showed diffuse swelling with restricted diffusion. his findings, however, neither suggest nor refute a diagnosis of any lysosomal storage disorder, particularly neonatal - onset tay - sachs disease. dna isolated from blood was used to perform targeted region capture using agilent sureselectxt capture kit (agilent technologies, santa clara, ca). the libraries were sequenced to 80 to 100 coverage on illumina sequencing platform (illumina, inc., san diego, ca). the sequences obtained were aligned to human reference genome (grch37/hg19) using bwa program and analyzed using picard and gatk - lite toolkit to identify variants in whole exome relevant to clinical indication. -hexosaminidase activity was measured in leukocytes using artificial fluorogenic substrates, and test results were obtained for total (a + b) and -hexosaminidase a levels separately. dna isolated from blood was used to perform targeted region capture using agilent sureselectxt capture kit (agilent technologies, santa clara, ca). the libraries were sequenced to 80 to 100 coverage on illumina sequencing platform (illumina, inc., san diego, ca). the sequences obtained were aligned to human reference genome (grch37/hg19) using bwa program and analyzed using picard and gatk - lite toolkit to identify variants in whole exome relevant to clinical indication. -hexosaminidase activity was measured in leukocytes using artificial fluorogenic substrates, and test results were obtained for total (a + b) and -hexosaminidase a levels separately. the diagnosis was established with the genetic sequencing of the hexa gene and measurement of hexosaminidase a activity. sequencing the hexa gene resulted in the identification of 2 previously unreported mutations. (1) heterozygous 4 base insertion in exon 11 of the hexa gene (chr 15:72638921_72638924 ; insgata), which resulted in a frame shift and premature truncation of the protein 5 amino acids downstream to codon 427 (p.y427ifsx5 ; enst00000566304). this same mutation was found to be present in the mother and absent in the father. (2) heterozygous missense variation in exon 13 of the hexa gene (chr 15 : 72637817 ; c > c / t), which resulted in an amino acid substitution of histidine for arginine at codon 510 (p.r510h ; enst00000566304). thus, these variations that were earlier classified as likely compound heterozygous variants of unknown significance now showed that each parent was one of the carriers of the above - mentioned hexa variations, which were hence found in a compound heterozygous state in their daughter. a low percentage of hexosaminidase a activity was obtained in the leukocytes (2.8 nmol / h / mg, reference range : 62 - 310 nmol / h / mg). the total -hexosaminidase (a + b) the treatment for tay - sachs disease is largely supportive and directed to providing adequate nutrition and hydration, managing infectious disease, protecting the airway, controlling seizures, and preventing secondary complications. early experimental intravenous enzyme replacement trials were unsuccessful, as the large molecular weight enzyme did not cross the blood a clinical trial used hexosaminidase a inhibitors to reduce the biosynthesis of glycosphingolipid precursors to gm2 ganglioside, which though was promising in mouse models was found unsatisfactory in humans. a group of researchers explored the possibility that pharmacological chaperones can augment hexosaminidase a. chaperones are small molecules that can assist the folding of mutant misfolded proteins retaining partial catalytic function and thus allow better access of such partially functional enzymes to the lysosome, resulting in an increase in total enzyme activity. following extensive screening of candidate molecules, pyrimethamine an united states food and drug administration approved antimalarial / antitoxoplasmosis agent already used in humans, which is capable of entering the central nervous system was shown to enhance hexosaminidase a activity in vitro in human fibroblasts. several trials were conducted, which proved the efficacy of pyrimethamine in late - onset tay - sachs disease, and it is becoming clear that pyrimethamine therapy can increase hexosaminidase a activity in late - onset tay - sachs disease in vivo. optimal doses should be tailored individually to avoid loss of biochemical effects. considering the positive response in various trials around the world, after counseling the parents and obtaining necessary consent, we put this patient on a gradual stepping dose of pyrimethamine from 6.25 mg / d (0.5 mg / kg / d) attempting to reach a maximum of 50 mg / d (3 mg / kg / d) by doubling the dose every 4 weeks along with daily folinic acid (15 mg / d). her complete blood counts, g6pd levels, and renal function tests were done prior commencing the drug and were routinely followed up. her hexosaminidase a enzyme levels were done when she reached her maximum dosage and stayed on it for at least a month (figure 2). the treatment for tay - sachs disease is largely supportive and directed to providing adequate nutrition and hydration, managing infectious disease, protecting the airway, controlling seizures, and preventing secondary complications. early experimental intravenous enzyme replacement trials were unsuccessful, as the large molecular weight enzyme did not cross the blood a clinical trial used hexosaminidase a inhibitors to reduce the biosynthesis of glycosphingolipid precursors to gm2 ganglioside, which though was promising in mouse models was found unsatisfactory in humans. a group of researchers explored the possibility that pharmacological chaperones can augment hexosaminidase a. chaperones are small molecules that can assist the folding of mutant misfolded proteins retaining partial catalytic function and thus allow better access of such partially functional enzymes to the lysosome, resulting in an increase in total enzyme activity. following extensive screening of candidate molecules, pyrimethamine an united states food and drug administration approved antimalarial / antitoxoplasmosis agent already used in humans, which is capable of entering the central nervous system was shown to enhance hexosaminidase a activity in vitro in human fibroblasts. several trials were conducted, which proved the efficacy of pyrimethamine in late - onset tay - sachs disease, and it is becoming clear that pyrimethamine therapy can increase hexosaminidase a activity in late - onset tay - sachs disease in vivo. considering the positive response in various trials around the world, after counseling the parents and obtaining necessary consent, we put this patient on a gradual stepping dose of pyrimethamine from 6.25 mg / d (0.5 mg / kg / d) attempting to reach a maximum of 50 mg / d (3 mg / kg / d) by doubling the dose every 4 weeks along with daily folinic acid (15 mg / d). her complete blood counts, g6pd levels, and renal function tests were done prior commencing the drug and were routinely followed up. her hexosaminidase a enzyme levels were done when she reached her maximum dosage and stayed on it for at least a month (figure 2). she was noted to develop pallor and apathy with generalized weakness when her pyrimethamine dosage was increased to 31.25 mg / d. complete blood count was suggestive of pancytopenia, which responded rapidly on increasing the dose of leucovorin to 30 mg / d and reducing pyrimethamine back to 25 mg / d. apart from the above, no adverse effects were noted. after continuing her on pyrimethamine 25 mg / d for further 1 month, her hexosaminidase a enzyme levels were repeated. it was found that her hexosaminidase a levels increased from 2.6 to 4.4 nmol / h / mg. it looked like the patient s increase in leukocyte hexosaminidase a enzyme activity was a true biochemical response to pyrimethamine as the laboratory reconfirmed the levels taking into consideration the variation in enzyme activity expected with the leukocyte counts. more importantly, apart from the biochemical increase in enzyme levels, clinically she restarted independent walking for few steps, which she had lost briefly before commencing pyrimethamine. although the normal reference range of hexosaminidase a enzyme activity is 62 to 310 nmol / h / mg, the increase to 4.4 nmol / h / mg was highly encouraging as it nudged toward the theoretical value of 10 nmol / h / mg, which if achieved may halt the progression of the disease further. in spite of motor improvement, her behavioral and neuropsychiatric complaints showed no respite and continued unabated. however, after continuing the same dosage of 25 mg / d, we repeated levels 3 months later, which showed a drop from 4.4 to 3.8 nmol / h / mg. as her levels dropped, her regression in motor milestones returned and finally due to no further benefit, we decided to discontinue pyrimethamine soon thereafter. the total duration of treatment was 8 months, with 6 months on the maximum tolerable dose of 25 mg / d. the patient described is a case of juvenile - onset tay - sachs disease from the indian population where the prevalence is much rarer. the clinical features of the patient are similar to those reported for other juvenile tay - sachs disease cases. the b1 variant associated with individuals with juvenile or chronic and adult - onset forms of hexosaminidase a deficiency are usually compound heterozygotes for a null allele and an allele that results in residual but low activity of the hexosaminidase a enzyme toward gm2 ganglioside or 2 alleles that result in low - residual hexosaminidase a activity. one study from india done on infantile onset disease concluded that mutations responsible for tay - sachs disease in indian population are unique. according to this study, patients originating from gujarat state could be screened for a founder mutation, namely, p.e462v. however, except for this mutation, the rest of the mutations in this study were found to be nonrecurrent. apart from this review the mutations found in our case can thus help increasing the database from india. as we know, enzyme replacement therapy for lysosomal storage disorders is available for only few disorders and is expensive and out of reach for most people from developing countries. pharmacological chaperone therapy is emerging as an alternative therapy and appears advantageous when compared to enzyme replacement therapy, as the chaperones are better distributed in tissues, including the brain, and also because therapy may be administered orally.. the combination of enzyme replacement therapy and pharmacological chaperone therapy can result in a synergistic effect in few disorders, which would be helpful in patients responding poorly to enzyme replacement therapy and in tissues where corrective levels of recombinant enzymes are difficult to obtain. the number of chaperone molecules will increase in the next few years studies with high - throughput screenings represent an efficient way of identifying new compounds for new diseases. first, the increase in hexosaminidase a activity and then decrease in activity corresponded with the improvement and regression in her motor milestones, respectively. as with other case reports and trials, we also did not have any discernible neuropsychiatric benefits seen with pyrimethamine. this effect still fell short of reaching the theoretically desirable increase in hexosaminidase a to 10% of normal hexosaminidase a, above which a disease - free phenotype has been documented despite the presence of mutations. second, although the induced rise in hexosaminidase a was temporary, the levels continued to be above the initial baseline levels indicating a biochemical benefit without any clinical benefit. a new study shows that cyclic low dose of pyrimethamine can increase hexosaminidase a activity in patients with late - onset tay - sachs disease. although we discussed this option with our patient s parents, considering her rapidly deteriorating condition, they declined to try this option. finally, although pharmacological chaperones are a promising therapeutic tool in lysosomal storage diseases, the present report is only an example of limited success in their application and much needs to be discerned about this mode of therapeutics. | background : juvenile tay - sachs disease is rarer than other forms of tay - sachs disease and is usually seen in children between the age of 2 and 10 years. pyrimethamine as a pharmacological chaperone was used to increase -hexosaminidase a activity in this patient.patient:we describe a patient with tay - sachs disease from the indian population, a juvenile case who presented with developmental regression starting at the age of three, initially with motor followed by language regression. she is currently incapacitated with severe behavioral issues.conclusion:this brief communication gives an insight into the efficacy of pharmacological chaperones. it also describes two unreported mutations in hexosaminidase a gene from the indian population. after commencing pyrimethamine, though initial benefits with increase in levels corresponded with briefly halting the motor regression, the observed increase was only transient and not associated with discernible beneficial neurological or psychiatric effects. |
it is known that crush injury to peripheral nerves can adversely affect neural microcirculation and capillary occlusion, and can result in dysfunction of neural conduction. it has been reported by clinical and experimental studies that vasoactive treatment can alleviate the effects of lesions in peripheral nerves, and buflomedil is an effective agent for treating disorders of peripheral nerves.[48 ] however, its mechanism is incompletely understood. in addition, it is known that the vascular endothelial growth factor (vegf) can protect against neuronal lesions in brain and spinal cord disorders.[911 ] in order to explore the protective mechanisms involved in vasoactive treatment on peripheral nerves after injury, the sciatic nerves of rats were crushed, and the effect of the vasoactive agent, buflomedil, on expression of vegf was evaluated. total of 400 sprague dawley (sd) rats (200 males and 200 females, spf grade, body weight 180220 g, shanghai laboratory animal center, shanghai, china) were randomly divided into : sham - operated (s - o) ; saline (s) ; saline + vegf antibody (s + ab) ; buflomedil (b) ; and buflomedil + vegf antibody (b + ab) groups. all procedures were performed in accordance with the animal care guidelines of the nanjing medical university, which conform to the guide for the care and use of laboratory animals (nih publication no. the rats were fixed onto rat plates after they were anesthetized with 10 ml / kg of 3% pentobarbital through intraperitoneal injection (ip). an incision was made in the right hind limb to expose the sciatic nerve. in the s - o group the sciatic nerves of the rats in other groups were clipped with artery forceps for 30 s, the pressure was then released and the incisions were closed. the rats in the buflomedil [nanjing jinling pharmaceutical co. ltd., batch number 021104, nanjing, china ] and vegf antibody [beijing zhongsan jinqiao biotechnology ltd., beijing, china ] groups were administered drugs (20 mg / kg / d, approximately equal to five times in adult doses, ip) and rabbit igg polyclonal vegf antibody (diluted with saline to 1:100, 2 ml / d, ip), and an equivalent volume of saline (ip) was given to the rats in the saline group. the dorsal root ganglia (drgs) the ribs were sheared along both sides of the spine, and the spine 's lumbar and sacral segments and cauda equina were removed. the section was cut along the median line, the spine segments and drgs were placed in culture dishes containing oxygen - enriched, saturated dulbecco 's modified eagle 's medium (dmem), ph 7.4, the osmotic pressure was 340 mosm / l drgs. the drgs were taken at time points including : 0, 3, 6, 12, 24, 48, 72, and 96 h, as well as on day 7 after crushing the sciatic nerves. reverse transcribed - polymerase chain reaction (rt - pcr) was performed as guide of reverse transcribed kit (promega, madison, wi, usa, trizol from invitrogen, carlsbad, ca, usa). the oligonucleotide primers for vegf165 were 5-gaagtggtgaagttcatggatgtc-3 (forward) and 5-cgatcgttctgtatcagtctttcc-3 (reverse), and amplified a 541 bp fragment ; and for -actin the primers were 5-cgctgcgctggtcgtcgaca-3 (forward) and 5-gtcacgcacgatttcccgct-3 (reverse), amplified a 619 bp fragment (shanghai shenggong biotechnology limited - liability company, shanghai, china). amplification products were resolved by agarose (2%) gel homeothermic electrophoresis at 80 v for 30 min. the predicted sizes of the amplification products were observed after electrophoresis, under an ultraviolet lamp, and densitometry was done. then, the index of mrna (ri) was calculated (ri = vegf mrna density / -actin density 100%). immunohistochemistry : the drgs of each group were taken at 0, 3, 6, 12, 24, 48, 72, and 96 h, and also on day 7 after crushing the sciatic nerves. they were treated by immunohistochemistrical technique (pv-6001 / 6002 immunohistochemistry kit from beijing zhongsan jinqiao biotechnology ltd., china).image analysis : two specimens were randomly selected from each group at each time point and immunohistochemistry of vegf was performed. a light microscope (400) was used to observe the number of cells with positive expression in each sample (five fields were randomly taken from each section to count the positive cells and the average value was calculated), and a comparison was conducted. immunohistochemistry : the drgs of each group were taken at 0, 3, 6, 12, 24, 48, 72, and 96 h, and also on day 7 after crushing the sciatic nerves. they were treated by immunohistochemistrical technique (pv-6001 / 6002 immunohistochemistry kit from beijing zhongsan jinqiao biotechnology ltd., image analysis : two specimens were randomly selected from each group at each time point and immunohistochemistry of vegf was performed. a light microscope (400) was used to observe the number of cells with positive expression in each sample (five fields were randomly taken from each section to count the positive cells and the average value was calculated), and a comparison was conducted. statistical package for the social sciences (spss, bizinsight, beijing, china) 11.5 was used, and p values 0.05). compared with 0 h : (1) the vegf mrna levels were not different from the s - o group (p > 0.05) ; (2) vegf mrna from other groups increased at 3 h and 6 h (p 0.05) ; (4) vegf mrna from the s, s + ab, b and b + ab groups were significantly more than that of the sham - operated group at 6, 12, 24, 48, 72, and 96 h (p 0.05). there was no difference between the s + ab group and the s group (p > 0.05) [figures 1a, b ]. (a - a) vegf mrna in sham - operated group (m marker, n negative) (a - b) vegf mrna in saline group (m marker, n negative) (a - c) vegf mrna in saline + vegf - antibody group (m marker, n negative) (a - d) vegf mrna in buflomedil group (m marker, n negative) (a - e) vegf mrna in buflomedil + vegf - antibody group (m marker, n negative) (a - f) b - actin (m marker, n negative) (b) vegf mrna by rt - pcr there were only a few vegf - positive neurons in the drgs in the s - o group. in the b group, the number of vegf - positive neurons began to increase at 6 h (p 0.05). compared with 0 h : (1) the vegf mrna levels were not different from the s - o group (p > 0.05) ; (2) vegf mrna from other groups increased at 3 h and 6 h (p 0.05) ; (4) vegf mrna from the s, s + ab, b and b + ab groups were significantly more than that of the sham - operated group at 6, 12, 24, 48, 72, and 96 h (p 0.05). there was no difference between the s + ab group and the s group (p > 0.05) [figures 1a, b ]. (a - a) vegf mrna in sham - operated group (m marker, n negative) (a - b) vegf mrna in saline group (m marker, n negative) (a - c) vegf mrna in saline + vegf - antibody group (m marker, n negative) (a - d) vegf mrna in buflomedil group (m marker, n negative) (a - e) vegf mrna in buflomedil + vegf - antibody group (m marker, n negative) (a - f) b - actin (m marker, n negative) (b) vegf mrna by rt - pcr there were only a few vegf - positive neurons in the drgs in the s - o group. in the b group, the number of vegf - positive neurons began to increase at 6 h (p 0.05). compared with 0 h : (1) the vegf mrna levels were not different from the s - o group (p > 0.05) ; (2) vegf mrna from other groups increased at 3 h and 6 h (p 0.05) ; (4) vegf mrna from the s, s + ab, b and b + ab groups were significantly more than that of the sham - operated group at 6, 12, 24, 48, 72, and 96 h (p 0.05). there was no difference between the s + ab group and the s group (p > 0.05) [figures 1a, b ]. (a - a) vegf mrna in sham - operated group (m marker, n negative) (a - b) vegf mrna in saline group (m marker, n negative) (a - c) vegf mrna in saline + vegf - antibody group (m marker, n negative) (a - d) vegf mrna in buflomedil group (m marker, n negative) (a - e) vegf mrna in buflomedil + vegf - antibody group (m marker, n negative) (a - f) b - actin (m marker, n negative) (b) vegf mrna by rt - pcr there were only a few vegf - positive neurons in the drgs in the s - o group. in the b group, the number of vegf - positive neurons began to increase at 6 h (p < 0.05), but at 12 h in the other groups (p < 0.01) ; the numbers peaked at 72 h (p < 0.01) and then started to decrease, returning to normal level on day 7. the vegf - positive neurons in the b group were more compared with those of s group and b + ab group (p < 0.05) ; however, the vegf - positive neurons in s + ab group were less than that of the s group (p < 0.05) [figures 2a, b ]. (a - a) vegf - positive neurons in drgs in sham - operated group (a - b) vegf - positive neurons in drgs in saline group (a - c) vegf - positive neurons in drgs in saline + vegf - antibody group (a - d) vegf - positive neurons in drgs in buflomedil group (a - e) vegf - positive neurons in drgs in buflomedil + vegf - antibody group (b) vegf - positive neurons in drgs on week 4 after crushing, in the s and s + ab groups, many neurons were lost, the neuronal degeneration, for example, the grumose chromosomes and nuclear pyknosis appeared, the nucleoli or even nuclear structure disappeared. the tigrolysis, vacuolar degeneration, and many apoptosis body appeared in the cytoplasm and glial cells proliferated. the pathological changes of the s + ab group were more severe than those of the s group. in the b group, the mild nuclear pyknosis appeared, few apoptosis bodies appeared in the cytoplasm, and the other pathological changes were also less than those in the s group. the pathological changes in b + ab group were severe than those in the b group. there was no pathological change of drgs in the s - o group [figure 3 ]. (a) pathological changes of drgs light microscopically on week 4 in sham - operated group (b) pathological changes of drgs light microscopically on week 4 in saline group (c) pathological changes of drgs light microscopically on week 4 in saline + vegf - antibody group (d) pathological changes of drgs light microscopically on week 4 in buflomedil group (e) pathological changes of drgs light microscopically on week 4 in buflomedil + vegf - antibody group relevant research indicated that the expression of vegf could be upregulated by anoxia.[1315 ] the results of this experiment showed that with buflomedil treatment, vegf mrna as well as vegf - positive drg neurons increased at 3 and 6 h (p < 0.01 at 6 h) after crushing, and both of them decreased to baseline on day 7 in this experiment. the findings demonstrated that the vasoactive agent, buflomedil treatment in case of sciatic nerve injury would result in a momentary effect in the expression of vegf and vegf receptor in drgs of rats after crush injury to sciatic nerves. it was interesting especially that the number of the vegf plus vegf receptor - positive drg neurons increased with buflomedil treatment, but decreased when the vegf antibody was used. when vegf - ab was applied, they would combine with vegf, and block the combination of vegf with vegf receptors. it is well - known that vegf - ab by itself would not influence the expression of vegf. therefore, vegf mrna remained unchanged in s and s+vegf - ab, as well as b and b+vegf - ab. however, vegf - positive drg neurons were different in s, or b group compared with s+vegf - ab, or b+vegf - ab, respectively, and this is due to some of the vegf is occupied by vegf - ab. it is known that neuroprotection is one of the many important functions of vegf in the course of injury - repair. the vegf - positive drg neurons in s+vegf - ab, or b+vegf - ab were decreased significantly compared with that in s, or b, respectively, in this experiment. the results suggested that this might be due to the biological activity of vegf was inactivated or decreased when combined with the vegf antibody. taken together, the results, above, suggested that buflomedil could upregulate vegf and increase the combined expression of vegf and vegf receptors in drgs after crush injury to sciatic nerves. it has been shown that vegf was a key mediator of the angiogenesis in ischemic lesions in nervous tissues.[1618 ] uesaka demonstrated that angiogenesis is essential for the enlargement of any solid tumor, and vegf is considered to be a major regulator. recent evidence suggested that vegf was protective against the effects of lesions in neurons or nerves in brain ischemia,[91116 ] spinal cord disorders and even impairment of peripheral nerves.[162124 ] li found that when neurolemma was dissected during facial nerve decompression, the edematous nerves would immediately bulge, the blood vessels of the epineurium became dilate, the color of the nerves turned from pale to red, and facial movement would recover dramatically. the results of pathology in this experiment indicated that buflomedil could reduce the pathological injury and improve the functional recovery after crushing injury to sciatic nerves. the outcomes of this study indicate that the vasoactive agent buflomedil may decrease the pathological lesion of peripheral nerves and improve the rehabilitation of the neural function, which may relate to upregulation of the expression of vegf, following crush injury to peripheral nerves. | objectives : to study the effect of buflomedil on the morphological repair on crush injury of sciatic nerve and also the expression of vascular endothelial growth factor (vegf).materials and methods : rat sciatic nerves were crushed by pincers. all of the 400 sprague dawley rats were randomly divided into : sham - operated ; saline ; saline + vegf - antibody ; buflomedil ; and buflomedil + vegf antibody groups. the expression of vegf in dorsal root ganglia (drgs), following crush injury to sciatic nerves, was studied by rt - pcr, immunohistochemistry. the effects of buflomedil on expression of vegf and repair of neural pathology were also evaluated.results:vegf mrna was significantly increased in buflomedil and buflomedil + vegf - antibody groups, compared with other groups. the number of vegf - positive neurons was significantly increased in the buflomedil and the saline groups. besides, buflomedil also caused less pathological changes in drgs.conclusions:the vasoactive agent buflomedil may decrease the pathological lesion and improve the functional rehabilitation of peripheral nerves, which may correlate to upregulation of the expression of vegf, following crush injury to the peripheral nerves. |
many developed countries now include laboratoryconfirmed influenza tests as part of their national influenza surveillance programs, and this information is communicated through the internet to the public health community on a weekly basis., as influenza causes considerable mortality burden,, over a short period of time, deaths because of an influenzalike illness have been used to study transmission rates associated with influenza epidemics and pandemics. in temperate climates, the annual influenza epidemic typically peaks during the cooler, drier, winter months.,,, by contrast, semitropical regions such as hong kong often experience biannual epidemics, with evidence of a latitude gradient from tropical to semitropical regions. the shape of the national epidemic curve for canada (figure 1) is irregular compared to a typical epidemic curve as described by epidemic models. according to these epidemic models, once established, the epidemic proceeds through three distinct phases : a period of exponential growth, a period of peak activity, followed by epidemic decline. the apparent irregularity at the national level may be because of variation in the timing of the onset of the epidemic as it spreads from region to region. while influenza is estimated to affect 510% of the population each year,,, laboratory testing to confirm the viral aetiology of persons presenting with an influenzalike illness is not routine in canada,, and only a small proportion of influenza infections are confirmed through laboratory testing. in this study, we created a composite epidemic curve by pooling laboratoryconfirmed influenza a cases across cities, regions and/or seasons after controlling for the regional differences in epidemic timing, and used the composite epidemic curves as a tool to assess various hypotheses proposed to explain the seasonality and transmissibility of influenza. we expected to see different epidemic growth rates because of varying climatic conditions and latitude gradients across the countries examined. the variation in influenza epidemics and irregularity in influenza a epidemics at the national level is seen in this figure. (b) distribution of weekly influenza a confirmations for canada relative to the nationallevel epidemic midpoint, for seasons where at least 80% of influenzapositive specimens were antigenically similar. variation in the shape of the nationallevel epidemics remains after centring the nationallevel epidemics by their midpoint. (c) distribution of weekly influenza a confirmations relative to the census metropolitan area (cma)level epidemic midpoint for dominant a seasons. influenza epidemics, as viewed at the city level, follow a simple epidemic curve, the shape of which is remarkably consistent from year to year. it has been suggested that transmissibility of interpandemic influenza is highest when a new antigenic strain emerges and that it is higher in large cities compared to smaller towns. we assessed these hypotheses and looked as well for seasonal differences in the transmission rates that might contribute to the seasonality of influenza. influenza testing and reporting varies across jurisdictions and over time, and so the number of laboratoryconfirmed cases is not thought to reflect the number of cases at a population level. the construction of the composite epidemic curve was designed to control for geographical differences in testing procedures and asynchronous epidemics by centring each local epidemic relative to its midpoint. however, other systematic irregularities in testing and reporting procedures over a single season could occur and could not be controlled in this analysis (for example, limited laboratory capacity during peak periods or holiday periods). hence, we compared composite epidemic curves across jurisdictions and by calendar time to assess whether there were systematic irregularities in testing over the influenza season. laboratory confirmations for influenza a by province and week from september 1997 to august 2007 were obtained from the respiratory virus detection surveillance system (rvdss), public health agency of canada,, which collects, collates and reports weekly laboratory results from participating laboratories. specimens are submitted to laboratories by clinicians in the course of clinical care and by sentinel physicians participating in the national influenza surveillance program fluwatch. as influenza testing procedures, reporting practices and the availability of diagnostic services vary by jurisdiction, the number of confirmed cases is not considered geographically representative. the number of respiratory specimens in which influenza a was detected is reported weekly for each of the 10 provinces. most of the rvdss participating laboratories also provided additional epidemiological information on a casebycase basis. from the casebycase database, city of residence was available for approximately 80% of the influenzapositive tests reported to the rvdss, providing a finer geographical scale for analysis. the recorded city name was grouped into census metropolitan areas (cma) or census agglomerations (ca). a cma / ca is an area consisting of one or more neighbouring municipalities situated around a major urban core. a cma must have a total population of at least 100 000 of which 50 000 or more live in the urban core. as of the 2001 census, there were 33 cmas and 111 cas in canada. census metropolitan areas and cas reporting at least 50 influenza confirmations per season were included in the communitylevel analysis as separate geographical units. in the united states, weekly reports of specimens tested for influenza in about 80 u.s. world health organization (who) laboratories and 70 laboratories of the national respiratory and enteric virus surveillance system (nrevss) were provided by the us centers for disease control and prevention s (cdc) influenza division fluview program for nine influenza surveillance regions. the weekly number of influenza a positive specimens was obtained for each of the nine influenza surveillance regions in the united states for the 1997/1998 to 2006/2007 influenza seasons. the who global influenza surveillance network (gisn) provides virological data to flunet for dissemination through who s communicable disease global database. this database was explored as a source for weekly reports of influenza a isolates at the international level. for the 2006/2007 season, 20 european countries provided weekly reports of at least 50 influenza a isolates to the gisn. the data were collected by the european influenza surveillance scheme (eiss), and provided to the european influenza surveillance network (eisn), which also participates in the gisn. who / europe also provides reports on epidemiological and virological data from the 53 member states through its euroflu platform. although the international data available through gisn were limited, an analysis of the european data for the 2006/2007 season was included as a further international comparison. the population of canada used to estimate detection rates was obtained from statistics canada census and intercensus estimates. the epidemic midpoint, defined as the week when cumulative incidence reaches 50% of the cumulative total of the seasonal cases, was determined for each reporting geographical unit : canadian province, canadian cma or ca for which at least 50 laboratoryconfirmed cases of influenza a were reported, the us region and european countries. a composite epidemic curve was created by aligning the local epidemic curves relative to the week corresponding to the local epidemic midpoint and aggregating over various geographical units or seasons. seasons were characterized by national yearend summary reports,,,,, and with the exception of the 2004/2005 and 2006/2007 seasons, the predominant strains circulating in canada and the united states were similar (table 1a). as we were unable to control for the cocirculation of multiple strains, we chose to focus on seasons where one antigenic strain dominated. seasons where at least 80% of the influenza a strains were antigenically similar were defined in this study as dominant a seasons (1997/1998, 1998/1999, 1999/2000, 2000/2001, 2001/2002, and 2003/2004). of the dominant a seasons, the predominant a strain was antigenically similar to the predominant strain that circulated in the previous season in 1998/1999 and 1999/2000, and the vaccine was poorly matched to the dominant strain in the 1997/1998 and 2003/2004 seasons (table 1b). in the 2000/2001 and 2002/2003 seasons, h1n1 was the predominant subtype, though only the 2000/2001 season was considered a dominant a season. strain characterization subtyping and strain identification was based on a sample of all influenza a positive specimens. in seasons where at least 80% of the influenza a specimens characterized were antigenically similar, the season was labelled as a dominant a season, and the contribution of cocirculating strains to the influenza a epidemic curve were considered minimal. to describe the duration and general shape of an epidemic curve corresponding to different geographical scales, the citylevel and provinciallevel composite epidemic curves were summarized by the interquartile (iq) range, and the 90 and 98 percentile ranges. the iq range corresponds to the minimum number of consecutive weeks during peak activity that account for 50% of all cases, and the 90 and 98 percentile ranges correspond to the number of consecutive weeks centred around the epidemic midpoint that account for 90% and 98% of all cases, respectively. simple epidemic models, or seir models named for compartmentalizing the population as susceptible, exposed, infectious and recovered persons, were developed to model infectious disease epidemics. these models predict a period of exponential growth in the initial phase of the epidemic where the depletion of susceptibles is nearly negligible. we noted the approximate length of the exponential growth period and estimated the weekly epidemic growth rate,, from a composite epidemic curve over the approximately loglinear portion of the epidemic (poisson regression, proc genmod, sas) by fitting a loglinear trend line. the weekly epidemic growth factor, r, was calculated as e (a weekly growth rate of 069 per week gives a growth factor of e or 2, implying that the number of cases double every week). as peak influenza activity usually occurs during the winter period in temperate climates, it has been suggested that influenza transmission rates are higher during the winter period. to assess the seasonality of transmission rates by calendar week, the weekly growth factor for calendar week w, r w, was calculated as the ratio of the number of influenza a confirmations in calendar week w divided by the number of confirmations in week w1, where a data pair (regional confirmations in week w and w1) was included in the calculation of r w if the regional epidemic peaked in week w+2 or later. the choice of week 2 as a cutoff likely biased the estimate the weekly growth factor downward ; however, there were too few cases corresponding to earlier cutoffs to assess a calendar time trend, and this bias is unlikely to influence the trend. there are various approaches to calculate r 0, the basic reproduction number or the average number of new infections generated from one infected case in a totally susceptible population. whether one converts r to r 0,, or alternatively, estimates r 0 directly using an seir model, assumptions about the duration of the infectious and latency periods are still required. laboratory confirmations for influenza a by province and week from september 1997 to august 2007 were obtained from the respiratory virus detection surveillance system (rvdss), public health agency of canada,, which collects, collates and reports weekly laboratory results from participating laboratories. specimens are submitted to laboratories by clinicians in the course of clinical care and by sentinel physicians participating in the national influenza surveillance program fluwatch. as influenza testing procedures, reporting practices and the availability of diagnostic services vary by jurisdiction, the number of confirmed cases is not considered geographically representative. the number of respiratory specimens in which influenza a was detected is reported weekly for each of the 10 provinces. most of the rvdss participating laboratories also provided additional epidemiological information on a casebycase basis. from the casebycase database, city of residence was available for approximately 80% of the influenzapositive tests reported to the rvdss, providing a finer geographical scale for analysis. the recorded city name was grouped into census metropolitan areas (cma) or census agglomerations (ca). a cma / ca is an area consisting of one or more neighbouring municipalities situated around a major urban core. a cma must have a total population of at least 100 000 of which 50 000 or more live in the urban core. as of the 2001 census, there were 33 cmas and 111 cas in canada. census metropolitan areas and cas reporting at least 50 influenza confirmations per season were included in the communitylevel analysis as separate geographical units. in the united states, weekly reports of specimens tested for influenza in about 80 u.s. world health organization (who) laboratories and 70 laboratories of the national respiratory and enteric virus surveillance system (nrevss) were provided by the us centers for disease control and prevention s (cdc) influenza division fluview program for nine influenza surveillance regions. the weekly number of influenza a positive specimens was obtained for each of the nine influenza surveillance regions in the united states for the 1997/1998 to 2006/2007 influenza seasons. the who global influenza surveillance network (gisn) provides virological data to flunet for dissemination through who s communicable disease global database. this database was explored as a source for weekly reports of influenza a isolates at the international level. for the 2006/2007 season, 20 european countries provided weekly reports of at least 50 influenza a isolates to the gisn. the data were collected by the european influenza surveillance scheme (eiss), and provided to the european influenza surveillance network (eisn), which also participates in the gisn. who / europe also provides reports on epidemiological and virological data from the 53 member states through its euroflu platform. although the international data available through gisn were limited, an analysis of the european data for the 2006/2007 season was included as a further international comparison. the population of canada used to estimate detection rates was obtained from statistics canada census and intercensus estimates. the epidemic midpoint, defined as the week when cumulative incidence reaches 50% of the cumulative total of the seasonal cases, was determined for each reporting geographical unit : canadian province, canadian cma or ca for which at least 50 laboratoryconfirmed cases of influenza a were reported, the us region and european countries. a composite epidemic curve was created by aligning the local epidemic curves relative to the week corresponding to the local epidemic midpoint and aggregating over various geographical units or seasons. seasons were characterized by national yearend summary reports,,,,, and with the exception of the 2004/2005 and 2006/2007 seasons, the predominant strains circulating in canada and the united states were similar (table 1a). as we were unable to control for the cocirculation of multiple strains, we chose to focus on seasons where one antigenic strain dominated. seasons where at least 80% of the influenza a strains were antigenically similar were defined in this study as dominant a seasons (1997/1998, 1998/1999, 1999/2000, 2000/2001, 2001/2002, and 2003/2004). of the dominant a seasons, the predominant a strain was antigenically similar to the predominant strain that circulated in the previous season in 1998/1999 and 1999/2000, and the vaccine was poorly matched to the dominant strain in the 1997/1998 and 2003/2004 seasons (table 1b). in the 2000/2001 and 2002/2003 seasons, h1n1 was the predominant subtype, though only the 2000/2001 season was considered a dominant a season. strain characterization subtyping and strain identification was based on a sample of all influenza a positive specimens. in seasons where at least 80% of the influenza a specimens characterized were antigenically similar, the season was labelled as a dominant a season, and the contribution of cocirculating strains to the influenza a epidemic curve were considered minimal. dominant a seasons are shown in bold. to describe the duration and general shape of an epidemic curve corresponding to different geographical scales, the citylevel and provinciallevel composite epidemic curves were summarized by the interquartile (iq) range, and the 90 and 98 percentile ranges. the iq range corresponds to the minimum number of consecutive weeks during peak activity that account for 50% of all cases, and the 90 and 98 percentile ranges correspond to the number of consecutive weeks centred around the epidemic midpoint that account for 90% and 98% of all cases, respectively. simple epidemic models, or seir models named for compartmentalizing the population as susceptible, exposed, infectious and recovered persons, were developed to model infectious disease epidemics. these models predict a period of exponential growth in the initial phase of the epidemic where the depletion of susceptibles is nearly negligible. we noted the approximate length of the exponential growth period and estimated the weekly epidemic growth rate,, from a composite epidemic curve over the approximately loglinear portion of the epidemic (poisson regression, proc genmod, sas) by fitting a loglinear trend line. the weekly epidemic growth factor, r, was calculated as e (a weekly growth rate of 069 per week gives a growth factor of e or 2, implying that the number of cases double every week). as peak influenza activity usually occurs during the winter period in temperate climates, it has been suggested that influenza transmission rates are higher during the winter period. to assess the seasonality of transmission rates by calendar week, the weekly growth factor for calendar week w, r w, was calculated as the ratio of the number of influenza a confirmations in calendar week w divided by the number of confirmations in week w1, where a data pair (regional confirmations in week w and w1) was included in the calculation of r w if the regional epidemic peaked in week w+2 or later. the choice of week 2 as a cutoff likely biased the estimate the weekly growth factor downward ; however, there were too few cases corresponding to earlier cutoffs to assess a calendar time trend, and this bias is unlikely to influence the trend. there are various approaches to calculate r 0, the basic reproduction number or the average number of new infections generated from one infected case in a totally susceptible population. whether one converts r to r 0,, or alternatively, estimates r 0 directly using an seir model, assumptions about the duration of the infectious and latency periods are still required. the number of influenza a positive tests reported to the rvdss each year varied from 1000 to 11 000, even in recent years. assuming that influenza virus infection affects 510% of the population each year,,, the case detection rate in canada was likely less than a half of one per cent. from the 1997/1998 season through to the 2006/2007 season (10 seasons), the rvdss collected an average of 6000 positive test reports per season. for the same period, the casebycase database provided city of residence for an average of 4000 cases per season, of which 57% and 15% came from cmas and cas, respectively. as per the 2001 census, 64% of the population lived in a cma and 15% in a ca. the rest lived in rural areas (21%), of which over half lived in communities where at least 5% of the local labour force commuted to work in a nearby cma or ca. the number of cma / cas reporting more than 50 laboratoryconfirmed influenza a cases to the casebycase database varied by the severity of the season, with 18 cmas and 4 cas reaching this threshold in the 2003/2004 season, and only toronto and montreal in the 2002/2003 season. viewed at the national level, the canadian epidemic curves for each influenza season are seen to vary in intensity and timing of peak activity (figure 1a). after aligning the national epidemic curves for each influenza season by the week of the epidemic midpoint and normalizing by the total number of laboratoryconfirmed cases for each season, the irregular shape of the epidemic curve for canada remains (figure 1b). communitylevel epidemics peaked from early november to midapril, and even within a single season, the range in timing of the communitylevel peaks varied from 5 to 13 weeks across canada. in contrast, aligning epidemic curves for each cma before aggregating to the national level produced remarkably consistent composite epidemic curves for each dominant a season (figure 1c). it is noted that the epidemic midpoint aligns with the epidemic peak. in the canadian data, cmalevel and provinciallevel composite epidemic curves were similar in shape (figure 2a). as it was presumed that influenza would spread faster in large urban centres than across the broader rural areas, consisting of many smaller communities combined, the composite epidemic curve created for the rural areas (rest of the province) was expected to be much broader than the composite epidemic curve for cmas only. however, as shown in figure 2b, the composite epidemic curves for cmas and cas with at least 50 laboratoryconfirmed cases over the season were similar to the provinciallevel composite for the rest of the province. figure 2c provides confirmation that transmission patterns can be similar for large urban centres and neighbouring rural areas during a single season. in this figure, the epidemic curves for the 2003/2004 a / fujian/411/02 season for the two cmas in the province of alberta (edmonton and calgary) are compared with the epidemic curve for the rest of the province, showing both the level of synchronization as well as the similarity in shape. the composite epidemic pattern was also remarkably similar for canada, the united states and europe (figure 2d). (a) empirical distribution of weekly influenza a confirmations, a comparison of the use of census metropolitan area (cma)level and provinciallevel midpoints. the composite epidemic curves constructed at two different geographical scales (cma and province) were remarkably similar. (b) empirical distribution of weekly influenza a confirmations, a comparison of the cmalevel, calevel and provinciallevel midpoints for the rest of the province. the composite epidemic curves for cmas and cas with at least 50 laboratoryconfirmed cases over the season were similar to the provinciallevel composite for the rest of the province, with epidemics growing slightly faster in communities with a population under 100 000 (ca) than for the larger cmas (population over 100 000 persons). (c) weekly number of laboratory confirmed influenza a cases, alberta, canada, 2003/2004 season, by city type. the epidemic curves, by calendar date, for the two cmas in alberta (edmonton and calgary) and the many smaller towns are remarkably similar. while for some of the smaller towns, the epidemic likely peaked weeks earlier or later than the provincial average, this figure for the 2003/2004 season in which most influenza a positive specimens were antigenically similar to a / fujian/411/02 (h3n2), illustrates that transmission rates can be similar for large urban centres and for regions consisting of smaller towns and rural areas. (d) composite distribution of laboratory confirmations for influenza a, canada, the united states and europe. the composite epidemic curve for canada is similar to the composite epidemic curve for the united states and europe. for large urban centres (cmas) that reported more than 50 laboratoryconfirmed cases of influenza a in a season where a single influenza a strain dominated, 50% of the confirmed cases occurred within a 4 to 5 week period centred around the epidemic midpoint ; 90% within 913 weeks ; and 98% within 1222 weeks, where the given ranges correspond to the first and third quartile (for example, 90% of the confirmed cases for each season occurred within 913 weeks in 50% of the 139 cmalevel seasonal epidemics). for cas, the epidemic period was slightly shorter at 34 weeks, 79 weeks, 913 weeks, respectively, whereas, when cases were combined at the provincial level, 50% of the confirmed cases occurred within 46 weeks ; 90% within 1014 weeks ; and 98% within 1524 weeks. at the cma level, the exponential growth phase extended from approximately week 10 to week 2 relative to the epidemic midpoint. new cases increased by a factor of 173 per week (95% ci 167, 178), or doubling every 89 days in seasons where at least 80% of the influenza a positive specimens were antigenically similar (a growth factor of r = 173 means that the number of cases will increase by a factor of 173 each week during the exponential growth period. this is equivalent to a weekly growth rate of = ln(r) or a rate of exponential growth rate of 055 cases per week). in smaller communities, the rate of growth was slightly higher, increasing by a factor of 19 (95% ci 15, 23) per week (corresponding to the composite epidemic curve illustrated in figure 2b). as only a few cas confirmed more than 50 cases in a season, laboratoryconfirmed cases for the many small communities that had fewer than 50 cases each were combined into a rest of province category. the resulting epidemic growth was similar at 19 (95% ci 18, 20) per week (figure 2b). given the stochastic nature of epidemics, we would expect considerable variability in the time from the first imported case to the epidemic peak and some uncertainty in identifying the actual epidemic start date. the composite epidemic curves suggest that the exponential growth starts approximately 10 weeks prior to peak in larger urban centres ; though, the number of cases is still small at this point, perhaps a couple hundred cases per week per city of 1 million. detection of influenza activity is more likely to occur around 5 weeks before the peak, at which point the number of cases has increased to approximately 5% of the epidemic total. this conversion of laboratoryconfirmed cases into an estimate of the actual number of new infections per week based on the assumption of a 10% clinical attack rate in a city of 1 million people is presented in table 2. sample epidemic progression for seasonal influenza a in a community of 1 million 1 assuming a 10% clinical attack rate and that 2 out of 1000 infections are laboratory confirmed. at the provincial level, the epidemic increased by a factor of 177 per week (95% ci 172, 180), ranging from 15 to 20 with statistically significant differences for seasons and regions (the poisson regression model was adapted to include effects for season and region). for american regions, the corresponding growth factor was 182 (95% ci 18, 184) per week. in the canadian data, differences in the epidemic growth rate were most strongly associated with the month of the epidemic peak (pvalue < 00001). in the american data, the epidemic growth rate was not associated with the month of the epidemic peak (pvalue 009) but was associated with the emergence of a new antigenic strain (growth factor of 21 per week in the first wave versus 16 per week for subsequent waves, figure 3), and possibly subtype, although the number of laboratoryconfirmed cases during the h1n1 season were limited. (a) empirical distribution of weekly influenza a confirmations, a comparison of emerging and repeat strains for canada and the united states. the faster epidemic growth in the very early period of the epidemic growth phase shown to be associated with the emergence of a new antigenic strain in the us data may have been influenced by other confounding factors such as the presence of cocirculating strains during the period of early growth. (b) empirical distribution of weekly influenza a confirmations, a / fujian/411/02 2003/2004 h3n2 season. displaying composite epidemic curves by the month of epidemic peak shows sustained transmission from midseptember through to early june, with epidemics peaking in november through to march. the number of laboratoryconfirmed cases for april peaking epidemics was limited, resulting in an irregular epidemic curve for april (figure 4). transmission rates appeared slower in epidemics / regions that peaked later in the season with a significant trend primarily for canada (figure 5a). transmission by calendar week shows a similar pattern (figure 5b) in the canadian and american data. the downward trend in transmission rates is statistically significant (pvalue = 0004) ; though, calendar week may not be the only factor influencing observed trend. these composite epidemic curves by the month of epidemic midpoint show evidence of sustained transmission ranging from midseptember to the end of may. the number of confirmed cases for april peaking epidemics is limited, hence the irregular shape to the curve (random variation). (a) weekly epidemic growth factor during the epidemic growth period, by month of peak influenza activity. the weekly epidemic growth factor was estimated by fitting a loglinear trend to the epidemic growth period (weeks 8 to 3) of the composite epidemic curve corresponding to the month of peak activity. (b) average weektoweek epidemic growth factor over the epidemic growth period of seasonal influenza a epidemics. the weekly epidemic growth factor for this figure was calculated as the ratio of the number of laboratoryconfirmed cases in week w over week w1, where week w is at least 2 weeks before the regional peak. only dominant this figure shows little change in transmission over the twoweek christmas period when schools are closed, but children and adults socialized, and a slight decline from november to january. we were able to combine laboratoryconfirmed cases from different seasons or regions to illustrate that epidemics resulting from a single antigenic influenza a strain, follow a reasonably predictable period of epidemic growth, followed by a period of peak activity and then epidemic decline. the resulting composite epidemic curve showed that exponential growth occurred over a longer period of time than was identifiable using excess deaths or hospital admissions associated with pneumonia and influenza. the composite epidemic curves for canada, united states and european countries were remarkably similar. a at the city level appears to last approximately 20 weeks with 50% of the cases occurring with a 4 to 5 week period of peak activity. influenza seasonality is often identified by its period of peak activity (usually winter months of january and february in canada and the united states) ; however, the composite epidemic curves suggest that influenza a epidemics start to build at least 10 weeks earlier. an epidemic that peaks in january would therefore have already been established by the end of october. epidemic peaks occurred from november through to april in canada over the study period, providing evidence of sustained transmission (during the periods of epidemic growth or decline) from midseptember to early june. the seasonality of influenza epidemics in temperate climates has not been fully explained ; though, we saw some evidence that transmission rates may be slightly higher earlier in the season, which has been suggested as a possible explanation for the seasonality of influenza. we explored trends in transmission rates by calendar time, and both testing and transmission rates appeared to be consistent through the christmas holiday period when school is not in session and many people are away from work. increased surveillance activity early in the epidemic was not evident, though remains a possibility. testing patterns at the community level seem to have been consistent throughout the season. while the provinciallevel and citylevel composite epidemic curves were similar, a lack of synchronization at the subprovincial level has been observed, and surveillance at a finer geographical scale would be helpful to better assess the level of local influenza activity. as antigenic drift is thought to be a result of immunological pressure, and vaccines may be mismatched in the first season of a new antigenic strain, it has been suggested that transmissibility would be highest in the first season of a new antigenic strain. this hypothesis is supported by the studies of the three 1918 pandemic waves in europe which show a clear slowing of transmission rates between the first and subsequent waves, and a study of illness from army camps that provides evidence that infection during the spring wave provided substantial crossprotection during the more severe fall wave. chowell and colleagues using excess pneumonia and influenza (p&i) deaths in the united states, france and australia as a proxy for influenza cases did not detect a difference in r 0 between first and subsequent waves of the same antigenic strain of seasonal influenza. from our data, the effect of the emergence of a new antigenic strain was small, with some evidence that transmission rates may be slightly higher when a new antigenic strain emerges. the main limitation of the approach we used to study influenza epidemics is that various influenza a strains routinely cocirculate and strain characterization is not routine. in seasons with more than one a strain or subtype circulating, as the waves are unlikely to be synchronized, and because we could not identify cases resulting from the different a strains, it was not possible to properly align the epidemic curves. particularly if the more dominant strain emerges later in the season, the apparent growth rate of the combined influenza a epidemic curve will be dampened once the epidemic resulting from the first strain starts to peak. hence, an estimate of transmission rates associated with mixed seasons was not possible with this approach, limiting our analysis to six seasons where at least 80% of the influenza a positive specimens characterized were antigenically similar. as a result, differences in epidemic growth rates, while statistically significant, may be a result of confounding factors or the influence of a particular season. for example, the epidemic growth rate was initially higher in the a / fujian/411/02 2003/2004 season (figure 3b) and it remains unclear whether the rapid increase in the early growth period of the 2003/2004 a / fujian/411/02 season can be attributed to the lack of other cocirculating influenza a strains, to the novelty of the antigenic strain (a / fujian/411/02) or to the early emergence of this strain (the a / fujian/411/02 strain was responsible for the november peaks). the differences in the exponential growth rates seen in the canadian data could suggest that transmission rates are higher in the fall than winter, but this seasonal trend is less evident in the us data. the us data suggest that the emergence of a new antigenic strain is more important ; though, this observation is primarily a result of differences in the 1997/1998 a / sydney/05097 season which emerged 5 weeks earlier in the united states than in canada. we note, however, that these differences were small and translate into a small difference in susceptibility based on seir model calculations of r 0 (yan s c11 formula suggests that for a latent period of 14 days and infectious period of 4 days a difference in the susceptibility of 6% would account for a reduction in epidemic growth factor from 18 to 16, while a 20% reduction in susceptibility would drop the epidemic growth factor from 18 to 125.) the population is not homogeneous and other factors likely account for some of this difference. clearly, we are not seeing large differences in susceptibility from season to season, at least not in seasons where one strain dominates. for comparison purposes, the epidemic growth factor for influenza b and respiratory syncytial virus (rsv) are noted, 16 (95%ci 153165) and 127 (95% ci 126128), respectively (based on a similar analysis of the rvdss provinciallevel data for these viruses). the 2009 influenza a h1n1 pandemic drew the attention of public health to our current influenza surveillance system. current indicators of influenza activity vary in their sensitivity and specificity to influenza, their timeliness, their geographical scale, detection rate and representativeness both spatially and temporally. as we move forward with a review of our influenza surveillance needs approaches to surveillance and methods to summarize the level and extent of influenza activity vary internationally more systematic laboratory confirmation will likely play an increasing role in our understanding of influenza epidemics as well as in the further development of methods to summarize influenza activity. validation of infectious disease models against the empirical data should facilitate improved planning and better assessment of the effectiveness of interventions. as methods to estimate r 0 are still somewhat controversial, modellers would benefit from access to international data at an appropriate geographical scale and over many influenza seasons so that multiple epidemic waves could be studied using a single method. had the composite epidemic curve had a significantly different shape, even estimation of the epidemic growth rate would have been questionable, perhaps suggesting the need for more complex agentbased models to account for nonhomogeneous mixing, an approach that many modellers use. while influenza epidemics waves at the community level appear to behave in a manor consistent with theoretical models, the degree of asynchronization between communities within a geographical reporting unit may vary from season to season, and this geographical variation will still pose a challenge to the interpretation of surveillance data in real time. the technique of aligning epidemics locally as part of the analytical process was essential to the analysis of the influenza surveillance data presented in this study. based on the success of the alignment process used in this study, we will explore the geographical patterns at a fine spatial scale. beyond the analysis presented here, the composite epidemic curve itself has been a helpful tool in identifying small agespecific differences in the timing of infections, and we continue to develop opportunities to assess the effects of interventions on the epidemic growth rate. | please cite this paper as : schanzer. (2010) a composite epidemic curve for seasonal influenza in canada with an international comparison. influenza and other respiratory viruses 4(5), 295306. background empirical data on laboratoryconfirmed seasonal influenza is limited by very low and possibly nonsystematic case ascertainment as well as geographical variation. objective to provide a visual representation of an influenza epidemic at the community and regional level using empirical data and to describe the epidemic characteristics. methods weekly influenza a confirmations were obtained from the canadian fluwatch program and american fluview program for the 1997/19982006/2007 seasons ; 1 year data were also available for europe (flunet, who). for seasons where at least 80% of the influenza a strains were antigenically similar, a composite epidemic curve was created by centring the local epidemics relative to their epidemic midpoint. results the range in timing of the regional peaks varied from 5 to 13 weeks. once the epidemic curves were centred relative to their peak, the composite epidemic curves were similar for canada, the united states and europe, and the epidemic growth rates were similar for most subgroups (city size ; regions ; h1n1 versus h3n2 seasons). during the exponential growth period, the number of cases increased by a factor of 1520 per week, averaging 18. exponential growth was evident approximately 10 weeks before the peak. evidence of sustained transmission occurred from midseptember to early june. discussion the shape of the composite curve created in this study clearly demonstrates a consistency in the epidemic pattern across geographically disparate locales. laboratory confirmation will likely play an increasing role in the development of better methods for early detection and summary measures of influenza activity. |
oral health plays a vital role in people s general health and well - being and is a fundamental aspect of health (1). healthy and free of pain mouth enables an individual to eat, speak, and have higher self - esteem and enjoy quality of life (2). tooth decay is the most common chronic health problem of adolescents (3, 4). despite an overall decline in the worldwide prevalence of dental caries, the mean value of decay, missing, and filling tooth (dmft) among 12-year - old children in the world is 1.61. these values in europe, africa, america and west pacific have been reported to be 2.57, 1.3, 2.76, and 1.48, respectively (5). according to who (2005), the optimal index of dmft is 1 among 12-year - old children all over the world (6). forty percent of the population in iran, one of the youngest societies in the world, is younger than 20 years old (3). whereas youth is an important period in the life and development of oral health behaviors, the dmft index among iranian children (12-year - old) is 1.9 (7). and the percentage of the children who ignore daily brushing and flossing is 70% (8). whereas dental cleaning behaviors are one of the most effective tools for prevention of dental caries (9), it has been shown that development of dental caries depends on socioeconomic, cultural, political and environmental factors (10 - 12), as well as individual s perceptions and behaviors and personality traits (13). owing to the costly treatments of dental diseases (14, 15), the prevalence of dental caries in children (16), need for health promotion programs for students with dental caries (5) and better understanding of defective oral health behaviors (17), designing preventive programs and educational contents based on children s perspective suffering from dental caries is necessary (1). there were no qualitative studies exploring challenges for caring dental health in the iranian medical literature. in addition, it is to be noted that a quantitative design could not entirely describe factors influencing dental care. conducting qualitative studies will help improve our understanding of socioeconomic, cultural, political and environmental aspects influencing adolescents oral behavior. moreover, it will help design educational programs to prevent dental caries and enhance the effectiveness of educational interventions in this regard. the findings of this study can be used by health professionals to design operational interventions and by dentists to develop appropriate strategies to improve adolescents dental health. a qualitative design with content analysis approach was used to gather and analyze the data. this type of research aims to explore complex phenomena. it is also the most useful tool in understanding people emotions and perceptions, it is the most common approach employed in health research (18, 19). eighteen guidance schools were selected using simple random sampling from north (4 schools), south (5 schools), west (4 schools) and east (5 schools) of tehran city in iran. purposive sampling method with maximum variation in sampling was utilized to choose 18 school - aged students with the following inclusion criteria : - aged between 11 and 15 years - having dental caries - reporting at least one of the signs of toothache, bleeding gum, pulled and filled teeth, and/or orthodontics - willingness to sign the informed consent to participate in this study all participants were included in the study, and no one excluded because of the fact that all participants suffered from dental caries and reported at least one of the above- mentioned sings. at the beginning of the study, the first researcher expressed the purpose of research for students and invited them to participate in the study. of the participants, they were suffering from at least two dental diseases such as tooth decay, bleeding gums, tooth ache, pulled or filled teeth, and orthodontics. the study s proposal was approved by the research council affiliated with tarbiat modares university (no : 52.127819) which corroborated its ethical considerations. permission to enter the research zones all the students were informed about the aim and methods of the study, the confidentiality of their identities, and withdrawing from the study at any time. the interviews were conducted in classrooms and consulting rooms in schools. face to face semi - structured interviews, group discussions in persian, and memo writing were held to collect data by the first researcher who was trained to diagnose and identify tooth decay and gum diseases. also she received some skills in interview techniques and was a phd student in health education at the time of the study. the main foci of the interviews were describing the experiences of oral disease (bleeding gums, missing and pulled teeth and orthodontics), and how they deal with this situation. they were asked to clarify their responses, bring examples of the phenomenon and explain the reason for their answers. a situation that collected information did not add new variations or codes to the findings (20, 21). content analysis is suitable to analyze and interpret a large amount of textual data, identify codes and themes through the systematic classification of the text content and earn an understanding of the " themes " and details in the text (22). the following steps were taken to analyze the data : - researchers immersed themselves in the raw data through transcribing interviews and reading them several times to get the sense of the whole. - the participants remarks and connotations were coded ; all codes were then checked by the authors (indexing) (23). - the codes were classified and compared based on their similarities and differences (identifying a thematic framework) (23). - the description of the coding tree was provided (charting) (23). - the latent meanings of the text as themes were developed. the charts were used to describe the range of participants views in each theme and subtheme, and the findings linked back to the literature (mapping and interpretation) (23). as member checking, the participants reviewed a summary of the interviews and their primary analysis and confirmed that the researchers presented their real words. also participants provided feedback on the ndings (credibility) (24). the research team conduced the analysis independently (3 coders), compared their findings and in cases of disagreement ; they held discussions until they reached an agreement. for peer checking, three faculty members (research methodologist, dentist, and educational expert) reviewed the analysis report and confirmed it (conformability) (24). factors of prolonged engagement, constant comparative analysis, audit trail, and a transparent description of the research steps assured that the findings were consistent and could be repeated (dependability) (24). variance according to sex and age, socioeconomic status, parent s job, education and residential indicated that the findings were applicable in other contexts (transferability) (24). 4 students suffered from toothache and dental caries, 3 students from dental caries and bleeding gum, 6 students from dental caries, pulled and filled teeth, 3 students from dental caries, toothache, and orthodontics and 2 students were suffered from dental caries, bleeding gum, and pulled teeth. educational level of students parents were primary school (2 mothers, 1 father), diploma (9, 10), and bachelor s degree (6 mothers, 6 fathers) and above. demographic characteristics of the participants are presented in table 1. during data analysis, four main themes developed : barriers to dental health, maintaining dental health, uncertainty in decision - making, and supportive factors. these four themes explain challenges and strategies for caring dental health based on adolescents perspectives. it is noted that 10 subthemes were also developed for the themes (figure 1). barriers to dental health, uncertainty in decision - making and supportive factors were challenges, while maintaining dental health was a strategy for caring dental health among iranian adolescent. subcategories were external conditions and perceived inability. in this study, external conditions such as an inappropriate perception of the causes of dental caries, lack of attention, knowledge and skills related to dental health were reasons for not brushing teeth. the students did not have information about the roles of deciduous teeth, onset age of dental care, and the role of nutrition in the development of dental caries. for instance, their knowledge about the importance of deciduous teeth and their importance on speech and permanent teeth was low. lack of attention to deciduous teeth and not brushing them during childhood could be the reason for not brushing and flossing permanent teeth in adolescence. my posterior teeth are milk teeth and will fall, so i do not brush them (a 14-year - old girl). the participants declared that they did not enjoy brushing their teeth, because it was a boring task. they mentioned that their teeth were healthy and need not to be brushed. a difficult condition for the provision of care was described by the students as irksome activities, being busy, forgetting to do the tasks and a low priority, lack of knowledge and skills related to dental health. probably, students were dissatisfied with their own careless behaviors, because tooth decay or a threatening condition to their general health would be developed. for these students, decision - making and behavioral changes if they had confidence to clean their teeth, they would admit the responsibility of their dental health by themselves and overcome barriers. i do nt have time and often forgot brushing (a 12-year - old girl). when i floss or brush my teeth, my gum begins bleeding ; therefore, i do nt floss or brush my teeth the participants stated that dental caries were associated with perceived inability and uncontrollable characteristics such as inheritance and dental fear. they also had negative viewpoints toward dental care and believed that the causes of dental caries were uncontrollable. some people say that oral and dental diseases are hereditary, why i bother myself and try to take care of my teeth most adolescents mentioned that dental fear was an important reason to avoid the dentist and regular treatment. dental fear includes fear of dentist, fear of treatment, and fear of dental instruments. they are learned by personal experiences, friends, family members, relatives, and the mass media. the students said that they were unable to deal with the terrible fear and stress before going to the dentist. this category consisted of the following subcategories : role of mouth and teeth and dental care behaviors. the participants mentioned that their mouth and teeth were an important part of their lives. they stated that healthy mouth affected their confidence, self - image, and self - esteem, eating, speaking, and digestion. also the adolescents noted that dental healthcare improved their overall health and reduced the risk of serious diseases and even promoted their quality of life. some students were aware of the role of mouth and teeth on their overall health. i did not like to speak, because i felt that my friends ignored me and did not like me (an 11-year - old boy). the reaction of adolescents towards dental caries and pain was brushing and/or going to the dentist. the students strategies for maintaining their teeth healthy were brushing, flossing, scaling, avoiding high - sugar food, using mouth wash, filling teeth, eating apple, orthodontia, checkup, and endodontic. the main reason for referral to the dentist was tooth decay and dental pain. i am brushing my teeth with fluoride toothpaste twice a day for at least two minutes " (a 12-year - old girl). unwillingness to care was a barrier in decision - making for brushing and flossing teeth, and a problem in students who are unaware of how to tackle it. lack of motivation and enthusiasm were two main reasons for ignoring the teeth brushing habit. the students came up with many excuses why they did not or could not brush or floss, and resisted parents pressure for cleaning their teeth. my mom says to brush every day, but i do not do it, and i do nt pay attention to boring things (an 11-year - old boy). acceptance of inattention was a strong element in decision - making for brushing and flossing teeth. the participants stated that there was a relationship between dental caries and inattention to dental health. discomfort related to tooth decay was an important factor affecting decision - making in dental care and changing unhealthy behaviors. the participants noted that common social beliefs and religious and social motivators affected their decision - making regarding oral heath behaviors and dental care. the students connected oral health behaviors such as brushing and flossing with social and religious beliefs. on the other hand, religious and social motivators and unwillingness to follow dental health behaviors caused uncertainty in students decision - making regarding cleaning their teeth. god has given me teeth, so i have to keep them clean (an 11-year - old boy). all people pay attention to nice teeth, and i try to keep them clean this category has three subcategories, including living condition, triangle of family - school - peer, and administrative system and policies. these factors affected students dental health behaviors that both encouraged and discouraged students to follow healthy behaviors. the participants stated that any change in the living condition could lead to changes in students behavioral habits. the participants stated that their family s cultural and socioeconomic status was a critical factor for changing behaviors and referring the dentist. poor socioeconomic status of families increases the risk of dental caries and oral diseases. some people use a matchstick or knife to remove food from between their teeth, while they can afford to buy a toothbrush, the culture of oral health among people is low (a 13-year - old girl). the triangle of family - school - peer meant that the family, school, and peer could encourage students to clean their teeth and go to the dentist. the interaction between the student and these factors can result in dental cleaning behaviors. when i saw my friend who was nt brushing his teeth, i decided not to clean my teeth, too in school, there is no place to brush my teeth (a 13-year - old boy). my mom is nt sensitive to my dental care, thus i do nt keep my teeth clean (a 14-year - old boy). according to the participants, the health care system policies such as insurance, educational system, role of dentist and media were the strongest factors in encouraging people to follow dental care behaviors and follow the treatment of dental caries. in this respect also, the media provide learning opportunities through advertisements on the promotion of healthy dental behaviors. the participants mentioned that the dentist was responsible to inform them about the importance of brushing and flossing in dental care. i learned how to floss my teeth for the first time from a dentist (a 12-year - old girl). barriers to dental health, uncertainty in decision - making and supportive factors were challenges, while maintaining dental health was a strategy for caring dental health among iranian adolescent. subcategories were external conditions and perceived inability. in this study, external conditions such as an inappropriate perception of the causes of dental caries, lack of attention, knowledge and skills related to dental health were reasons for not brushing teeth. the students did not have information about the roles of deciduous teeth, onset age of dental care, and the role of nutrition in the development of dental caries. for instance, their knowledge about the importance of deciduous teeth and their importance on speech and permanent teeth was low. lack of attention to deciduous teeth and not brushing them during childhood could be the reason for not brushing and flossing permanent teeth in adolescence. my posterior teeth are milk teeth and will fall, so i do not brush them (a 14-year - old girl). the participants declared that they did not enjoy brushing their teeth, because it was a boring task. they mentioned that their teeth were healthy and need not to be brushed. a difficult condition for the provision of care was described by the students as irksome activities, being busy, forgetting to do the tasks and a low priority, lack of knowledge and skills related to dental health. probably, students were dissatisfied with their own careless behaviors, because tooth decay or a threatening condition to their general health would be developed. for these students, decision - making and behavioral changes were difficult. if they had confidence to clean their teeth, they would admit the responsibility of their dental health by themselves and overcome barriers. i do nt have time and often forgot brushing (a 12-year - old girl). when i floss or brush my teeth, my gum begins bleeding ; therefore, i do nt floss or brush my teeth the participants stated that dental caries were associated with perceived inability and uncontrollable characteristics such as inheritance and dental fear. they also had negative viewpoints toward dental care and believed that the causes of dental caries were uncontrollable. some people say that oral and dental diseases are hereditary, why i bother myself and try to take care of my teeth most adolescents mentioned that dental fear was an important reason to avoid the dentist and regular treatment. dental fear includes fear of dentist, fear of treatment, and fear of dental instruments. they are learned by personal experiences, friends, family members, relatives, and the mass media. the students said that they were unable to deal with the terrible fear and stress before going to the dentist. this category consisted of the following subcategories : role of mouth and teeth and dental care behaviors. the participants mentioned that their mouth and teeth were an important part of their lives. they stated that healthy mouth affected their confidence, self - image, and self - esteem, eating, speaking, and digestion. also the adolescents noted that dental healthcare improved their overall health and reduced the risk of serious diseases and even promoted their quality of life. some students were aware of the role of mouth and teeth on their overall health. i did not like to speak, because i felt that my friends ignored me and did not like me (an 11-year - old boy). the reaction of adolescents towards dental caries and pain was brushing and/or going to the dentist. the students strategies for maintaining their teeth healthy were brushing, flossing, scaling, avoiding high - sugar food, using mouth wash, filling teeth, eating apple, orthodontia, checkup, and endodontic. i am brushing my teeth with fluoride toothpaste twice a day for at least two minutes " (a 12-year - old girl)., acceptance of inattention, and motivations for caring. unwillingness to care was a barrier in decision - making for brushing and flossing teeth, and a problem in students who are unaware of how to tackle it. lack of motivation and enthusiasm were two main reasons for ignoring the teeth brushing habit. the students came up with many excuses why they did not or could not brush or floss, and resisted parents pressure for cleaning their teeth. my mom says to brush every day, but i do not do it, and i do nt pay attention to boring things (an 11-year - old boy). acceptance of inattention was a strong element in decision - making for brushing and flossing teeth. the participants stated that there was a relationship between dental caries and inattention to dental health. discomfort related to tooth decay was an important factor affecting decision - making in dental care and changing unhealthy behaviors. the participants noted that common social beliefs and religious and social motivators affected their decision - making regarding oral heath behaviors and dental care. the students connected oral health behaviors such as brushing and flossing with social and religious beliefs. on the other hand, religious and social motivators and unwillingness to follow dental health behaviors caused uncertainty in students decision - making regarding cleaning their teeth. god has given me teeth, so i have to keep them clean (an 11-year - old boy). all people pay attention to nice teeth, and i try to keep them clean this category has three subcategories, including living condition, triangle of family - school - peer, and administrative system and policies. these factors affected students dental health behaviors that both encouraged and discouraged students to follow healthy behaviors. the participants stated that any change in the living condition could lead to changes in students behavioral habits. the participants stated that their family s cultural and socioeconomic status was a critical factor for changing behaviors and referring the dentist. poor socioeconomic status of families increases the risk of dental caries and oral diseases. some people use a matchstick or knife to remove food from between their teeth, while they can afford to buy a toothbrush, the culture of oral health among people is low (a 13-year - old girl). the triangle of family - school - peer meant that the family, school, and peer could encourage students to clean their teeth and go to the dentist. the interaction between the student and these factors can result in dental cleaning behaviors. when i saw my friend who was nt brushing his teeth, i decided not to clean my teeth, too in school, there is no place to brush my teeth (a 13-year - old boy). my mom is nt sensitive to my dental care, thus i do nt keep my teeth clean (a 14-year - old boy). according to the participants, the health care system policies such as insurance, educational system, role of dentist and media were the strongest factors in encouraging people to follow dental care behaviors and follow the treatment of dental caries. in this respect also, the media provide learning opportunities through advertisements on the promotion of healthy dental behaviors. the participants mentioned that the dentist was responsible to inform them about the importance of brushing and flossing in dental care. i learned how to floss my teeth for the first time from a dentist (a 12-year - old girl). subcategories were external conditions and perceived inability. in this study, external conditions such as an inappropriate perception of the causes of dental caries, lack of attention, knowledge and skills related to dental health were reasons for not brushing teeth. the students did not have information about the roles of deciduous teeth, onset age of dental care, and the role of nutrition in the development of dental caries. for instance, their knowledge about the importance of deciduous teeth and their importance on speech and permanent teeth was low. lack of attention to deciduous teeth and not brushing them during childhood could be the reason for not brushing and flossing permanent teeth in adolescence. my posterior teeth are milk teeth and will fall, so i do not brush them (a 14-year - old girl). the participants declared that they did not enjoy brushing their teeth, because it was a boring task. they mentioned that their teeth were healthy and need not to be brushed. a difficult condition for the provision of care was described by the students as irksome activities, being busy, forgetting to do the tasks and a low priority, lack of knowledge and skills related to dental health. probably, students were dissatisfied with their own careless behaviors, because tooth decay or a threatening condition to their general health would be developed. for these students, decision - making and behavioral changes were difficult. if they had confidence to clean their teeth, they would admit the responsibility of their dental health by themselves and overcome barriers. i do nt have time and often forgot brushing (a 12-year - old girl). when i floss or brush my teeth, my gum begins bleeding ; therefore, i do nt floss or brush my teeth the participants stated that dental caries were associated with perceived inability and uncontrollable characteristics such as inheritance and dental fear. they also had negative viewpoints toward dental care and believed that the causes of dental caries were uncontrollable. some people say that oral and dental diseases are hereditary, why i bother myself and try to take care of my teeth most adolescents mentioned that dental fear was an important reason to avoid the dentist and regular treatment. dental fear includes fear of dentist, fear of treatment, and fear of dental instruments. they are learned by personal experiences, friends, family members, relatives, and the mass media. the students said that they were unable to deal with the terrible fear and stress before going to the dentist. i am scared of the dentist, his clothing, and his appliance (a 13-year - old girl). this category consisted of the following subcategories : role of mouth and teeth and dental care behaviors. the participants mentioned that their mouth and teeth were an important part of their lives. they stated that healthy mouth affected their confidence, self - image, and self - esteem, eating, speaking, and digestion. also the adolescents noted that dental healthcare improved their overall health and reduced the risk of serious diseases and even promoted their quality of life. some students were aware of the role of mouth and teeth on their overall health. i did not like to speak, because i felt that my friends ignored me and did not like me the reaction of adolescents towards dental caries and pain was brushing and/or going to the dentist. the students strategies for maintaining their teeth healthy were brushing, flossing, scaling, avoiding high - sugar food, using mouth wash, filling teeth, eating apple, orthodontia, checkup, and endodontic. i am brushing my teeth with fluoride toothpaste twice a day for at least two minutes " (a 12-year - old girl). this category consisted of reluctant to care, acceptance of inattention, and motivations for caring. unwillingness to care was a barrier in decision - making for brushing and flossing teeth, and a problem in students who are unaware of how to tackle it. lack of motivation and enthusiasm were two main reasons for ignoring the teeth brushing habit. the students came up with many excuses why they did not or could not brush or floss, and resisted parents pressure for cleaning their teeth. my mom says to brush every day, but i do not do it, and i do nt pay attention to boring things (an 11-year - old boy). acceptance of inattention was a strong element in decision - making for brushing and flossing teeth. the participants stated that there was a relationship between dental caries and inattention to dental health. discomfort related to tooth decay was an important factor affecting decision - making in dental care and changing unhealthy behaviors. the participants noted that common social beliefs and religious and social motivators affected their decision - making regarding oral heath behaviors and dental care. the students connected oral health behaviors such as brushing and flossing with social and religious beliefs. on the other hand, religious and social motivators and unwillingness to follow dental health behaviors caused uncertainty in students decision - making regarding cleaning their teeth. god has given me teeth, so i have to keep them clean (an 11-year - old boy). all people pay attention to nice teeth, and i try to keep them clean this category has three subcategories, including living condition, triangle of family - school - peer, and administrative system and policies. these factors affected students dental health behaviors that both encouraged and discouraged students to follow healthy behaviors. the participants stated that any change in the living condition could lead to changes in students behavioral habits. the participants stated that their family s cultural and socioeconomic status was a critical factor for changing behaviors and referring the dentist. poor socioeconomic status of families increases the risk of dental caries and oral diseases. some people use a matchstick or knife to remove food from between their teeth, while they can afford to buy a toothbrush, the culture of oral health among people is low (a 13-year - old girl). the triangle of family - school - peer meant that the family, school, and peer could encourage students to clean their teeth and go to the dentist. the interaction between the student and these factors can result in dental cleaning behaviors. when i saw my friend who was nt brushing his teeth, i decided not to clean my teeth, too in school, there is no place to brush my teeth (a 13-year - old boy). my mom is nt sensitive to my dental care, thus i do nt keep my teeth clean (a 14-year - old boy). according to the participants, the health care system policies such as insurance, educational system, role of dentist and media were the strongest factors in encouraging people to follow dental care behaviors and follow the treatment of dental caries. in this respect, also, the media provide learning opportunities through advertisements on the promotion of healthy dental behaviors. the participants mentioned that the dentist was responsible to inform them about the importance of brushing and flossing in dental care. i learned how to floss my teeth for the first time from a dentist (a 12-year - old girl). this study was the first qualitative research conducted to explore challenges and strategies for caring dental health among iranian adolescent. in this study, barriers were the main factors to do oral health behavior. some adolescents stated that they did not brush and floss their teeth. low priority for dental care, having no plan and time to follow health behaviors, having dental fear, tiredness, forgetfulness, and lack of knowledge and skill were the reasons for unwillingness to change behaviors or referral to the dentist. similarly, pakpour. in iran described that the reasons for ignoring oral health behaviors were tiredness, forgetfulness and having no plan or time to follow health behaviors (1). the adolescents believed that they could not prevent oral diseases and stated that prevention of tooth decay was not associated with following health behaviors. in a qualitative research in sweden, adolescents stated that their dental caries was uncontrollable, and hereditary (25). in iran, pakpour. mentioned that there was a relationship between controllable dental caries and self - efficacy (1). furthermore, greater perceived control leads to a stronger intention to perform oral heath behaviors that consequently can reduce the risk of dental carries (26). other main reasons for ignoring dentists were fear of treatment ; fear of dentists, individual s unpleasant experiences and other people s unpleasant experiences during referral to the dentist. negative perceptions of oral health and having no willingness and motivation to accomplish healthy behaviors are the causes of dental caries. there are several strategies to maintain and promote oral health such as increasing knowledge and skills regarding dental health and applying the process of coping with stress. schools and healthcare organizations can emphasize on the gingival index and plaque index before adolescents enrolment in the primary schools and employment. some adolescents applied behavioral strategies such as dental restoration, root canal treatment,, scaling, brushing, flossing, as well as using mouthwash to prevent the spread of tooth decay, dental pain, and oral diseases. the major problems and the most important reasons for seeking dental care and visiting the dentist were pain due to tooth decay, periodontal diseases, or injury. that dental pain was a main reason for brushing and dental treatment in adolescents (27). dental appearance, nice smile, good speaking, better chewing, enhancement of self - image and self - esteem among iranian adolescents were other motivators for dental care in the adolescents. similarly, trulsson. in sweden reported that teenager s reasons to undergo orthodontic treatment were dental appearance, self - image, and self - esteem (19). the result of this study indicated that decision - making was affected by factors such as unwillingness to care, acceptance of inattention and motivations for caring. religious and social motivations affect the adolescents decision - making regarding oral health. however, these were not strong enough to change individuals attitudes and behaviors toward dental care. in designing educational programs luzzi and spencer in australia reported that existence of religious and social beliefs in the physical environment impacted adolescents decision - making for oral health (28). ostberg in his research showed that worries the developed by inattention to teeth was the main factor for practicing oral health behaviors (29). the results of the present study showed that perceived tooth decay was under the influence of culture, life style, family members, dentist, school, and the mass media. suggested strategies to increase the confidence in control of dental carries include enhancing adolescents perception of risk factors in developing dental caries by the family, dentist, and school and changing incorrect social beliefs through designing appropriate educational programs (28, 30, 31). some studies showed that most adolescents start oral health behaviors, when they experience oral diseases (1, 29). according to our findings, external factors can also be more effective when adolescents have some previous experiences regarding oral diseases and low perceptions of oral health. the triangle of the family - school - peer, proper education, administrative system and policies, and socioeconomic status decreased unhealthy behaviors and improved healthy dental behavior. luzzi and spencer in australia and fallahi. in iran reported that the physical environment and family and peer impacted adolescents decision - making for oral health (28, 32). moreover, solhi. in iran showed that the mass media, interaction between people, and experiencing some form of the health problem facilitated decision - making on oral health in adolescents (33). the findings of this research emphasized on the weak effect of education in dental health behaviors in schools. the participants expressed that education of dental health did not sufficiently affect the prevention of tooth decay. in line with our findings, watt in the uk reported that interventions related to improving oral health were unsuccessful in adolescents and had no effect on the prevention of dental caries (14). when education related to dental health is poorly presented, the student s perception of oral health and confidence to do dental health will decline. this study showed that certainty in decision - making on maintaining dental health depends on overcoming the barriers of dental health. understanding adolescents views and experiences of dental healthy behavior is of vital importance in designing educational models and delivering appropriate educational programs for prevention of tooth decay in adolescents. while generalization is not the aim of qualitative studies, the findings of this study could be transferred to other contexts and cultures with caution and after conducting similar studies. further research is needed to explore the process of developing dental carries and dental care among people with different cultures and contexts to establish the findings of this study. to identify the strengths and weaknesses of the study, researchers in their countries can design children 's oral health program based on the findings of this study and compare the effect of this oral health training program with other training programs. | background : oral health plays a vital role in people s general health and well - being. with regard to the costly treatments of oral diseases, preventive programs need to be designed for dental caries based on children s perspectives.objectives:the purpose of this study was to describe and explore challenges for caring dental health based on children s perspectives.patients and methods : a qualitative design with content analysis approach was applied to collect and analyze the perspectives of students about factors influencing oral and dental care. eighteen iranian students in 8 guidance schools were chosen through the purposive sampling. semi - structured interviews were held for data gathering. in order to support the validity and rigor of the data, different criteria such as acceptability, confirmability, and transferability were utilized.results:during data analysis, four main themes developed : barriers to dental health, maintaining dental health, uncertainty in decision - making and supportive factors. uncertainty in decision - making and barriers to dental health were the main challenges for preventing dental caries among adolescents.conclusions:certainty in decision - making to maintain dental health depends on overcoming the barriers of dental health. further research is needed to confirm the findings of this study. |
lipomatous pseudohypertrophy (liph) of the pancreas is an extremely rare disease of unknown cause in which pancreatic tissue is replaced by proliferating fatty tissue. in most patients either the whole pancreas or only the pancreatic tail enlarges ; however, here we report an extremely rare case in which liph was limited to the pancreatic head. she had a medical history of angina pectoris and hyperlipidemia, and had undergone surgery for an ovarian cystic tumor. she presented to the department of internal medicine of our hospital with a one - month history of hypogastric pain. computed tomography (ct) indicated a tumor mass in the dorsal pancreas, and she was therefore referred to our department for further investigation and treatment. she was 153.0 cm tall and weighed 58.0 kg (body mass index 24.8 kg / m), and had no clinical signs of anemia or jaundice. tumor markers and hepatitis serology were also negative. in ct a tumor mass with a maximum diameter of approximately 18.0 it had the density of fatty tissue, and its interior was the same density as soft tissue. the pancreatic head was ventrally compressed and extended, but the tumor did not appear to directly invade the pancreas. pancreatic head mass lesions were present in the shape of ellipsoids extending from the porta hepatis to anterior to the vena cava inferior and reaching the pelvic cavity. on t1- and t2-weighted images, the tumor contained areas with similar signal intensity to subcutaneous and intraabdominal fat. fat suppression mri eliminated the signals from these areas, suggesting that the mass contained adipose tissue (fig. 2). laparotomy revealed a tumor mass with a thin capsule that was primarily located dorsal to the duodenum. the mass extended from the hepatoduodenal ligament cranially to dorsal to the transverse mesocolon caudally. by means of the kocher maneuver, the tumor mass, pancreatic head, and duodenum were mobilized up to the ligament of treitz, and the anatomical relationship was determined. from the pancreatic uncus the head region was strongly compressed and thinned, and the border with the tumor mass was unclear. complete enucleation of the tumor was impossible because the limits of the tumor mass capsule could not be clearly identified. we preserved as much of the capsule of the pancreatic head as possible to avoid damaging the principal pancreatic duct, and performed resection by partitioning the tumor mass. since we were concerned about creating a pancreatic fistula we sited a pleated drain on the inferior surface of the liver and a suction drain on the dorsal pancreas before completing surgery (fig. histopathologically the surgical specimen was an elastic and soft, xanthochromatic, lobulated tumor mass resembling adipose tissue. its maximum dimensions were 18.0 11.0 6.0 cm, and it weighed approximately 600 g. the proliferation of mature fatty tissue was observed throughout the tumor mass. chromogranin a staining revealed that islets of langerhans had remained intact, and cytokeratin 19 staining confirmed the presence of pancreatic duct epithelial cells. whereas the pancreatic duct and islets of langerhans components had remained relatively intact, acinar tissue was damaged and mostly replaced with fat infiltration. the presence of dysplastic cells was not seen, and well - differentiated liposarcoma was ruled out. 4). on postoperative day 7 (pod7), surgical drainage indicated a pancreatic fistula. since the amylase level in the drainage fluid became elevated at 200,000 iu / l, a continuous infusion of octreotide was started, and on pod21 the drain was exchanged for an aspiration drain. serum trypsin and lipase levels at that time were high, and we were convinced that the exocrine function of the remaining pancreas was preserved. since the pancreatic fistula also persisted, endoscopic retrograde cholangio - pancreatography was performed on pod28 to evaluate the principal pancreatic duct, and fortunately major leakage from this duct was not identified. from pod35 amylase levels in the drainage fluid started to fall, and the amount of fluid drained also decreased. on pod63 drainage was discontinued, and the fistula was thought to be almost closed since pod77. six months later, ct showed no new fat tissue replacing the remaining pancreatic head to body or pancreatic tail. liph of the pancreas is an extremely rare disease that is defined by (1) the enlargement and increased weight of the pancreas and morphological uniformity of the pancreas, (2) complete replacement of the pancreatic exocrine tissue by fatty tissue, and (3) sparing of the pancreatic duct system and islets of langerhans. a literature search of japana centra revuo medicina and pubmed revealed only 27 other cases worldwide, including those in which the condition was diagnosed with imaging alone. unlike steatosis resulting from obstruction of the pancreatic duct by pancreatolithiasis or a tumor, the causal factors of this disease are unknown. postulated causative mechanisms include congenital anomaly, pancreatic exocrine gland obstruction, and viral infection [2, 13 ]. the reported cases, including the present case, showed a wide range of age distribution from 9 months to 80 years, and comprised 16 males and 12 females. affected sites included the entire pancreas (20 cases), body and pancreatic tail (3 cases), pancreatic head (4 cases), and uncinate (1 case). besides the present case, there were only 4 cases in which liph developed in the pancreatic head [15, 16 ], hence this distribution appears to be extremely rare. the weight of the pancreas varied from 130 g to more than 1,200 g ; it was at least twice that of the normal pancreas, and in most cases 3 times or more [6, 13 ]. methods of diagnosis were autopsy (11 cases), surgery after diagnosis of liposarcoma or carcinoma (12 cases), and diagnostic imaging alone (5 cases). symptoms did not determine diagnosis, and although many cases were accompanied by abnormal glucose tolerance or fatty liver, these abnormalities were not necessarily present. coexisting diseases included cirrhosis of the liver (including that due to hepatitis b) and primary sclerosing cholangitis [9, 10, 15 ], and it seems possible that chronic liver injury influences the development of liph of the pancreas. furthermore, cases have been reported in which liph developed as a complication of squamous cell carcinoma of the pancreas, so it is also necessary to examine association with malignant tumors. however, in the present case there were no obvious associated conditions. concerning differential diagnosis, although symptoms such as abdominal pain and anorexia raise the suspicion of liposarcoma, preoperative diagnosis is difficult. in the present case, if magnetic resonance cholangio - pancreatography or endoscopic retrograde cholangio - pancreatography had been performed prior to surgery, we might have identified the pancreatic duct inside the tumor mass as normal. further, if we had performed contrast ct we might have identified the vessel arcade of the pancreatic head at the periphery of the tumor mass. regarding intraoperative diagnosis, unfortunately it is generally difficult to diagnose fatty tissue by intraoperative frozen section. indeed, the literature contains only one report that a sarcoma could be ruled out in this way. moreover, we did not suspect liph from intraoperative findings because the tumor is so rare. therefore, if we had recognized liph, and if we could have differentiated between malign and benign manifestations from intraoperative macroscopic findings, we could have avoided excessive intrusion and might have prevented postoperative pancreatic fistula. at operation, fortunately the pancreatic head was almost normal and pancreaticoduodenectomy could be avoided ; however, if we had expanded the scope of resection the main pancreatic duct would have been damaged, and complications might have been exacerbated. there are also reports in which standard pancreatic tail resection produced favorable results when the tumor mass was confined to the pancreatic tail [5, 13 ]. since liph is a benign disorder, conservative management with regular follow - up is thought to be sufficient. no specific therapies have been established for liph, but when symptoms of pancreatic exocrine function insufficiency are present, digestive enzymes including pancreatic enzymes are administered. the rarity of liph of the pancreas means that the growth rate and time span of the progression of fat replacement are unknown, but the condition is considered to take several years to develop. liph may begin from a certain point and gradually spread throughout other regions of the pancreas, it may gradually develop throughout the organ, or it may remain confined to a certain area. thus in the present case it is possible that we observed a transitional phase and that the whole pancreas would have eventually been replaced by fat. taking the above information into account, we propose to roughly classify liph of the pancreas by the affected site into diffuse type, head - nodular type and tail - nodular type. while tail - nodular type liph can be safely resected by removing the pancreatic tail, safe resection is difficult in diffuse - type and head - nodular type liph, and there are cases in which it might be necessary to restrict surgery to biopsy or subtotal resection. it should be possible to predict diffuse - type liph from diagnostic imaging. we believe that this classification is very important when considering treatment options for this condition. in the future, we hope that liph of the pancreas will be elucidated through long - term follow - up and the accumulation of further cases. | a 70-year - old woman presented with hypogastric pain. computed tomography and magnetic resonance imaging revealed a retroperitoneal tumor 18.0 cm in diameter with fatty tissue density, ventrally compressing the pancreatic head. we suspected a well - differentiated liposarcoma compressing the pancreas. at laparotomy, the tumor mass was the size of an infant 's head ; its center was located in the area corresponding to the pancreatic uncus. it was continuous with the pancreatic parenchyma through a poorly demarcated border, and we resected as much of the tumor mass as possible while conserving the pancreatic capsule. histopathological examination indicated lipomatous pseudohypertrophy of the pancreas with proliferation of mature fatty tissue as the main constituent. at the periphery, islands of acinar tissue were retained among the fatty infiltration, which also contained branches of the pancreatic duct and islets of langerhans. previous reports have stated that this disorder only causes fatty replacements throughout the pancreas or in the pancreatic body and tail ; however, in this patient, imaging and macroscopic examination revealed no fatty replacements in the pancreatic body and tail. we report this case, which we consider extremely rare, along with a brief review of the literature. |
it is well known that soft drinks have detrimental metabolic effects nowadays and their consumption should be limited. however, men do not limit the volume of soft drinks in their diet and consume them much more often than woman. the number of overweight adult males has tripled during the last three decades due to changing food and beverage diet patterns. soft drinks are the source of superfluous calories because of low satiety resulting from fluid consistency and high carbohydrate content. regular consumption of soft drinks (one or more soft drink per day) is correlated with an excessive energy intake that induces weight gain (a 330 ml soft drink contains approximately 150 kcal). it was investigated that reducing intake by 100 kcal / day would eliminate 71.2 million cases of obesity in the usa. this review focuses on the potential role of soft drinks, particularly the sugar component, in the pathogenesis of erectile dysfunction (ed). the hypothetical link between metabolic disorders, induced by sweetened soft drink overconsumption, and ed was analyzed. large studies found an association of ed with dyslipidemia, impaired glycemic control, central obesity, and hypertension. mets components were proven to be the result of soft drink overconsumption according to the nahnes iii study (national health and nutrition examination survey). high caloric intake, high refined - carbohydrates, and high fructose corn syrup (hfcs) content, and less satiety are the main factors responsible for the metabolic disorders related to soft drink overconsumption. one soft drink a day during a period of 20 years is enough to increase the risk of mets to 48%. the most important factor triggering hemodynamic changes during erection is nitric oxide (no). endothelium derived no is known to be the most potent endogenous vasodilator responsible for relaxing afferent blood vessels to the corpus cavernosum. no is formed by nitric oxide synthase (nos), which exists in three isoforms : neuronal (nnos), endothelial (enos), and inducible (inos). consumed soft drinks contain great amounts of refined carbohydrates such as sucrose. a refined - carbohydrate rich diet was shown to induce endothelium dysfunction, due to altered carbohydrate metabolism. soft drinks are characterized by a high glycemic index and can raise blood sugar levels quickly. this in turn triggers the release of insulin in an attempt to normalize the blood sugar. hyperglycemia increases oxidant stress that arises due to several mechanisms such as hyperglycemic pseudo - hypoxia, accumulation of sorbitol in endothelial cells, and glucose autoxidation [12, 13 ]. reactive oxygen species (ros) are produced in mitochondria by the cellular disturbances in glucose and lipid metabolism. oxidative stress occurs when there is an imbalance between the pro - oxidants and the ability of the antioxidants to scavenge excess production of ros. this hormone also stimulates hepatocytes to release vldl (very low destiny lipoprotein) and ldl (low destiny lipoprotein), which are major triglyceride carriers. increased triglycerides and ldl levels contribute to the vascular damage and trigger an inflammatory response, resulting in monocyte 's adhesion to the endothelial cells. prolonged duration of hyperglycemia causes insulin resistance, which is an important pathophysiological basis of endothelium dysfunction. insulin has important hemodynamic actions that involve stimulation of the production of nitric oxide (no) from endothelium and endothelial cells cell cycle regulation. these actions are impaired after the development of insulin resistance and lead to the establishment of a reverberating negative feedback between insulin resistance and endothelium dysfunction. endothelial dysfunction refers to impairment of many significant functions of the endothelium including anti - inflammatory and antiproliferative characteristics as well as vasodilatation. in such conditions, the release of vasodilating factors is decreased in the penile vascular bed including cavernous bodies as well. the small diameter (1 - 2 mm) and the high content of smooth endothelial and muscular cells by unit of tissue volume determine a higher cavernous arteries susceptibility to damage induced by hyperglycemia, oxidative stress, and other endothelium damaging factors. given the role of a rich refined - carbohydrate diet in impairing endothelium function through glucose and lipid metabolism disturbance, it is likely that erectile dysfunction is associated with high soft drink consumption. ed was correlated with less sensitivity of the cavernosal artery for vasoactive medications, such as nitrates, calcium antagonists, angiotensin - converting enzyme inhibitors, and -blockers. the major causes of increased resistant in penile arteries is impaired enos function combined with no - enhanced degradation by ros. insufficient arteriolar sphincter and corpus cavernosum relaxation mediated by endothelium is the reason for the inability to maintain erection. in addition to no, the function of other important vasoactive agents such as the endothelin family and vasoactive prostanoids is impaired in patients with ed associated with mets risks factors, contributing to enhanced vasoconstriction. it contracts arterial smooth muscles and dilates them through an endothelial no - related mechanism. found a significantly higher plasma concentration of endothelin and angiotensin ii coexisting with low levels of no in the venous blood obtained from a man suffering from ed. regular diet mistakes among human males, such as soft drink consumption, may lead to slow and asymptomatic progression of ed, finally resulting in the full claimed manifestation of ed. it is worth to notice that impaired penile endothelial function was found in many patients without the presence of a significant peripheral endothelial dysfunction. the penile vascular bed seems to be impaired in the early stage of endothelium dysfunction. ed is a well - documented predictor of cardiovascular disease and a precursor of its manifestations. common risk factors for cardiovascular diseases are frequently found in patients with ed. on the other hand, ed is frequently reported in vascular syndromes, such as coronary artery disease (cad), hypertension, cerebrovascular disease, peripheral arterial disease, and diabetes mellitus. it attracts increasing attention as the most harmful sugar component in terms of weight gain and by playing the initiating role in metabolic disorders. hfcs is more lipogenic than glucose and in high doses impairs carbohydrate metabolism, by the accumulation of fructose 2,6-bisphosphate. then hfcs leads to alterations in triglyceride and lipid metabolism thereby increasing the risk of metabolic syndrome, arteriosclerosis, and diabetes. proinflammatory molecules secreted by adipose tissue initiate chronic systemic inflammation affecting the function of the vascular system, peripheral nervous system, and hormonal milieu.. showed that all obese men with ed had higher circulating concentrations of interleukin-6 (il-6), interleukin-8 (il-8), interleukin-18 (il-18), and c - reactive protein (crp) than obese men without ed. tumor necrosis factor alpha (tnf) is a key part of the cytokine network that governs the inflammatory response. demonstrated in in vitro study that reduced corpora cavernosa smooth muscles reactivity after tnf administration. tnf knock - out mice exhibited increased no - dependent relaxation, which was associated with increasing cavernosal expression of both enzymes, enos and nnos. the final effect of long - term sugar sweetened soft drink over - consumption is the development of obesity. just seventy calories over the daily demand throughout the year results in weight gain of 8 kg. taking the soft drink 's popularity in diet, low price, and high calorie intake under consideration fat tissue secretion activities have negative impacts on the hormonal milieu that regulate male sexual functions. kaplan. examined testosterone levels in 864 males and found that obese men with mets had significantly decreased total testosterone (tt) compared to non - obese men with mets. twenty to forty percent of impotent patients characterize a reduce bioavailable testosterone (bt) level. visceral obesity is a major factor that modulates testosterone levels. according to knoblovits. aromatase activity in adipose tissue leads to higher circulating levels of estradiol, which modulate testosterone production. adipokinesis leads to cytokine mediated inhibition of shbg (sex hormone binding globulin) synthesis in the liver and interferes with lh / hcg - stimulated androgen secretion [46, 47 ]. a decrease of shbg level is observed in obese patients and corresponds to visceral obesity whereas subcutaneous fat tissue causes testosterone level fluctuation mainly by adipocyte aromatase [48, 49 ]. the action of testosterone is mediated via its conversion into 5-dht (dihydrotestosterone) by the enzyme 5-reductase. androgens control intracavernosal pressure by acting on corpus cavernosum muscles and vasomotor equilibrium during erection. testosterone induces no synthesis in endothelial cells and also regulates erectile function locally by acting on the smooth muscle potassium channel within the human corpus cavernosum. according to trash. a low testosterone level initiates differentiation of progenitor stromal cells of the corpus cavernosum into adipogenic lineages, producing fat - containing cells and altering erectile function. androgens deficiency causes structural disorders in the corpus cavernosum and tunica albuginea, resulting in venous leakage and erectile dysfunction. veno - occlusion is modulated by the tone of the vascular smooth muscle of the resistance arteries and the cavernosal tissue and a balance between trabecular smooth muscle content and connective tissue matrix. androgens determine the fibroelastic properties of penile tissue especially the most essential for erection, the corpus cavernosus and tunica albuginea. tunica albuginea, in the presence of lower androgen levels, increases thickness and loses proper arrangement of collagen fibers. the most common alterations linked to low testosterone level in the corpus cavernosum are smooth muscles atrophy and the accumulation of extracellular matrix, especially collagen fibrils, that in some cases even leads to fibrosis of the corpus cavernosum. no - dependent relaxation of corpus cavernosum smooth muscles is impaired because of decreased expression and enzymatic activity of nitric oxide synthases (enos and nnos) and phosphodiesterase type 5-(pde5). low testosterone level related changes are associated with cell cycle disorders in corpus cavernosum smooth muscles cells and endothelium cells of penile vessels. testosterone is involved in penile tissue cell apoptosis through protein p53, which is increased in low testosterone levels in males. burris. showed that men with decreased testosterone blood concentration had higher levels of depression, anger, fatigue, and confusion than men with acceptable testosterone levels. we assume that soft drink consumption may be higher in this population because the craving for sweet rewards is increased by depressed mood. soft drinks, due to high sucrose dose, are excellent addictive sweets. the reward feeling after sweet soft drink consumption is mediated by endogenous opioids in the nucleus accumbens shell, which correspond to glucose blood level [61, 62 ]. the most important factor triggering hemodynamic changes during erection is nitric oxide (no). endothelium derived no is known to be the most potent endogenous vasodilator responsible for relaxing afferent blood vessels to the corpus cavernosum. no is formed by nitric oxide synthase (nos), which exists in three isoforms : neuronal (nnos), endothelial (enos), and inducible (inos). consumed a refined - carbohydrate rich diet was shown to induce endothelium dysfunction, due to altered carbohydrate metabolism. soft drinks are characterized by a high glycemic index and can raise blood sugar levels quickly. this in turn triggers the release of insulin in an attempt to normalize the blood sugar. hyperglycemia increases oxidant stress that arises due to several mechanisms such as hyperglycemic pseudo - hypoxia, accumulation of sorbitol in endothelial cells, and glucose autoxidation [12, 13 ]. reactive oxygen species (ros) are produced in mitochondria by the cellular disturbances in glucose and lipid metabolism. oxidative stress occurs when there is an imbalance between the pro - oxidants and the ability of the antioxidants to scavenge excess production of ros. this hormone also stimulates hepatocytes to release vldl (very low destiny lipoprotein) and ldl (low destiny lipoprotein), which are major triglyceride carriers. increased triglycerides and ldl levels contribute to the vascular damage and trigger an inflammatory response, resulting in monocyte 's adhesion to the endothelial cells. prolonged duration of hyperglycemia causes insulin resistance, which is an important pathophysiological basis of endothelium dysfunction. insulin has important hemodynamic actions that involve stimulation of the production of nitric oxide (no) from endothelium and endothelial cells cell cycle regulation. these actions are impaired after the development of insulin resistance and lead to the establishment of a reverberating negative feedback between insulin resistance and endothelium dysfunction. endothelial dysfunction refers to impairment of many significant functions of the endothelium including anti - inflammatory and antiproliferative characteristics as well as vasodilatation. in such conditions, the release of vasodilating factors is decreased in the penile vascular bed including cavernous bodies as well. the small diameter (1 - 2 mm) and the high content of smooth endothelial and muscular cells by unit of tissue volume determine a higher cavernous arteries susceptibility to damage induced by hyperglycemia, oxidative stress, and other endothelium damaging factors. given the role of a rich refined - carbohydrate diet in impairing endothelium function through glucose and lipid metabolism disturbance, it is likely that erectile dysfunction is associated with high soft drink consumption. ed was correlated with less sensitivity of the cavernosal artery for vasoactive medications, such as nitrates, calcium antagonists, angiotensin - converting enzyme inhibitors, and -blockers. the major causes of increased resistant in penile arteries is impaired enos function combined with no - enhanced degradation by ros. insufficient arteriolar sphincter and corpus cavernosum relaxation mediated by endothelium is the reason for the inability to maintain erection. in addition to no, the function of other important vasoactive agents such as the endothelin family and vasoactive prostanoids is impaired in patients with ed associated with mets risks factors, contributing to enhanced vasoconstriction. it contracts arterial smooth muscles and dilates them through an endothelial no - related mechanism. found a significantly higher plasma concentration of endothelin and angiotensin ii coexisting with low levels of no in the venous blood obtained from a man suffering from ed. regular diet mistakes among human males, such as soft drink consumption, may lead to slow and asymptomatic progression of ed, finally resulting in the full claimed manifestation of ed. it is worth to notice that impaired penile endothelial function was found in many patients without the presence of a significant peripheral endothelial dysfunction. the penile vascular bed seems to be impaired in the early stage of endothelium dysfunction. ed is a well - documented predictor of cardiovascular disease and a precursor of its manifestations. common risk factors for cardiovascular diseases are frequently found in patients with ed. on the other hand, ed is frequently reported in vascular syndromes, such as coronary artery disease (cad), hypertension, cerebrovascular disease, peripheral arterial disease, and diabetes mellitus. it attracts increasing attention as the most harmful sugar component in terms of weight gain and by playing the initiating role in metabolic disorders. hfcs is more lipogenic than glucose and in high doses impairs carbohydrate metabolism, by the accumulation of fructose 2,6-bisphosphate. then hfcs leads to alterations in triglyceride and lipid metabolism thereby increasing the risk of metabolic syndrome, arteriosclerosis, and diabetes. proinflammatory molecules secreted by adipose tissue initiate chronic systemic inflammation affecting the function of the vascular system, peripheral nervous system, and hormonal milieu.. showed that all obese men with ed had higher circulating concentrations of interleukin-6 (il-6), interleukin-8 (il-8), interleukin-18 (il-18), and c - reactive protein (crp) than obese men without ed. tumor necrosis factor alpha (tnf) is a key part of the cytokine network that governs the inflammatory response. demonstrated in in vitro study that reduced corpora cavernosa smooth muscles reactivity after tnf administration. tnf knock - out mice exhibited increased no - dependent relaxation, which was associated with increasing cavernosal expression of both enzymes, enos and nnos. the final effect of long - term sugar sweetened soft drink over - consumption is the development of obesity. just seventy calories over the daily demand throughout the year results in weight gain of 8 kg. taking the soft drink 's popularity in diet, low price, and high calorie intake under consideration fat tissue secretion activities have negative impacts on the hormonal milieu that regulate male sexual functions. kaplan. examined testosterone levels in 864 males and found that obese men with mets had significantly decreased total testosterone (tt) compared to non - obese men with mets. twenty to forty percent of impotent patients characterize a reduce bioavailable testosterone (bt) level. visceral obesity is a major factor that modulates testosterone levels. according to knoblovits. aromatase activity in adipose tissue leads to higher circulating levels of estradiol, which modulate testosterone production. adipokinesis leads to cytokine mediated inhibition of shbg (sex hormone binding globulin) synthesis in the liver and interferes with lh / hcg - stimulated androgen secretion [46, 47 ]. a decrease of shbg level is observed in obese patients and corresponds to visceral obesity whereas subcutaneous fat tissue causes testosterone level fluctuation mainly by adipocyte aromatase [48, 49 ]. the action of testosterone is mediated via its conversion into 5-dht (dihydrotestosterone) by the enzyme 5-reductase. androgens control intracavernosal pressure by acting on corpus cavernosum muscles and vasomotor equilibrium during erection. testosterone induces no synthesis in endothelial cells and also regulates erectile function locally by acting on the smooth muscle potassium channel within the human corpus cavernosum. according to trash. a low testosterone level initiates differentiation of progenitor stromal cells of the corpus cavernosum into adipogenic lineages, producing fat - containing cells and altering erectile function. androgens deficiency causes structural disorders in the corpus cavernosum and tunica albuginea, resulting in venous leakage and erectile dysfunction. veno - occlusion is modulated by the tone of the vascular smooth muscle of the resistance arteries and the cavernosal tissue and a balance between trabecular smooth muscle content and connective tissue matrix. androgens determine the fibroelastic properties of penile tissue especially the most essential for erection, the corpus cavernosus and tunica albuginea. tunica albuginea, in the presence of lower androgen levels, increases thickness and loses proper arrangement of collagen fibers. the most common alterations linked to low testosterone level in the corpus cavernosum are smooth muscles atrophy and the accumulation of extracellular matrix, especially collagen fibrils, that in some cases even leads to fibrosis of the corpus cavernosum. no - dependent relaxation of corpus cavernosum smooth muscles is impaired because of decreased expression and enzymatic activity of nitric oxide synthases (enos and nnos) and phosphodiesterase type 5-(pde5). low testosterone level related changes are associated with cell cycle disorders in corpus cavernosum smooth muscles cells and endothelium cells of penile vessels. testosterone is involved in penile tissue cell apoptosis through protein p53, which is increased in low testosterone levels in males. burris. showed that men with decreased testosterone blood concentration had higher levels of depression, anger, fatigue, and confusion than men with acceptable testosterone levels. we assume that soft drink consumption may be higher in this population because the craving for sweet rewards is increased by depressed mood. the reward feeling after sweet soft drink consumption is mediated by endogenous opioids in the nucleus accumbens shell, which correspond to glucose blood level [61, 62 ]. erectile function is a complex of neurovascular physiological processes that depend on the interplay among neural, vascular, hormonal, and psychological factors, as well as the integrity of the vascular bed of the penis. visceral fat deposition seems to be superior to all disorders and is the main bridge between high soft drink consumption and erectile dysfunction. in light of the facts presented in this paper, high soft drink consumption an important question relating the influence of environmental factors on ed development may be : do all symptoms and disorders occurring in men during ageing (diabetes type 2, hypertension, hypercholesterolemia, ischemic heart disease, cardiac failure, and mets) have an influence on ed ? because we have a positive answer, we have to ask : can bad nutritional habits be regarded as a triggering factor to the above - mentioned disorders ? the highest rates of obesity and diabetes are among people with low level of income, who used energy - dense food as the best way to provide daily calories. obesity and obesity - related disorders, are epidemic in western countries, where cheap energy - dense food can be found, but not in really poor countries. soft drinks are often a main course in such cheap energy menus [6366 ]. on the other side, replacing sugar - sweetened beverages intake with water is associated with reductions in total calories and weight loss [67, 68 ]. based on their popularity and its influence on metabolism we think that the probability of such a coincidence is very high. to get a statistical proof of hypothesis it was proven on animal models that coca - cola had a destructive influence on rat homeostasis, but can we replace a long - term metabolic study in men with an animal model ?. | this review focuses on the potential role of soft drinks, particularly the sugar component, in the pathogenesis of erectile dysfunction (ed). we analyzed the hypothetical link between metabolic disorders, induced by sweetened soft drinks overconsumption, and ed. high caloric intake, high refined - carbohydrates, and high fructose corn syrup (hfcs) content and less satiety are main factors responsible for metabolic disorders contributing to ed development. regular diet mistakes among human males, such as soft drink consumption, may lead to slow and asymptomatic progression of ed, finally resulting in full claimed manifestation of ed. |
the hydrolysis of phosphate esters plays a central role in many biological processes, including energy production, signal transduction, and maintaining the integrity of genetic material. the rates of the uncatalyzed hydrolyses of these biochemically ubiquitous compounds are exceedingly slow, with half - lives potentially in the trillions of years, so the enzymes that catalyze these difficult reactions produce some of the largest known enzymatic rate enhancements. in light of its biological importance, a considerable body of experimental and theoretical data aimed at understanding the details of this reaction has accumulated over the years (for detailed reviews, see refs (6) and (7) and references cited therein). however, despite these data, just how this reaction proceeds in solution and in enzyme catalyzed processes remains controversial. understanding phosphate ester hydrolysis is made complicated by the availability of multiple plausible mechanisms for the same reaction (figure 1). for example, in the case of phosphate monoester dianions, experimental evaluation of kinetic isotope effects, linear free energy relationships and entropic effects have suggested that this reaction proceeds through a concerted pathway with a loose, metaphosphate - like transition state (ts) (in contrast to the more associative transition states expected for the hydrolysis of phosphate di- and triesters, see discussion in ref (6)). on the other hand, computational studies have suggested two viable concerted pathways with tss that are either dissociative or associative in nature, and become looser or tighter depending on the pka of the leaving group. additionally, a number of computational studies have suggested the existence of both phosphorane and metaphosphate intermediates, and sometimes even multiple different mechanisms have been suggested for the same system. finally, it has been suggested that the qualitative interpretation of traditional experimental markers such as linear free energy relationships, activation entropies and isotope effects can be ambiguous, with different pathways giving rise to similar experimental observables. a recent key point of discussion has revolved around deprotonation of the water nucleophile and the identity of the ultimate proton acceptor (see discussion in refs (6) and (7)). this becomes a particularly important issue when dealing with enzyme - catalyzed phosphoryl transfer, where the identity of the general base is not immediately obvious. in principle, the reaction could proceed via a substrate - assisted mechanism in which the phosphate is the ultimate proton acceptor, and theoretical works have argued in favor of such a mechanism in the cases of, e.g., gtp hydrolysis by gtpases such as ras and the elongation factor thermounstable (ef - tu) in complex with the ribosome. however, not just the viability of such a mechanism has been debated, but also, more recently, whether deprotonation of the nucleophile during bond formation to the phosphorus is necessary at all. hypothetical mechanisms for the hydrolysis of phosphate monoester dianions considered in this work. (a) concerted mechanism with substrate - assisted nucleophilic attack, in which the attacking water molecule is deprotonated by the substrate at some point along the reaction coordinate. (b) stepwise mechanism in which proton transfer from the nucleophile to the substrate, concerted with nucleophilic attack, leading to a pentacoordinate intermediate which breaks down with concerted proton transfer to the leaving group. (b) stepwise mechanism in which the proton transfers precedes nucleophilic addition and follows leaving group departure. (c) concerted mechanism with solvent - assisted nucleophilic attack, in which there is no proton transfer from the nucleophile in the rate - limiting step. note that this figure is condensed for clarity ; for considerations of microscopic reversibility, see the supporting information. computational studies on the reaction in water have supported an important role for proton transfer from the incoming water nucleophile, either through a ground state pre - equilibrium proton transfer followed by hydroxide ion attack on a monoanionic phosphate monoester in the case of methyl phosphate hydrolysis, or as a concerted process in the case of p - nitrophenyl phosphate hydrolysis. phosphate monoester dianions are difficult to study experimentally due to the very low reactivity of these compounds. as a result, aryl phosphate monoester dianions with good leaving groups, and especially p - nitrophenyl phosphate (pnpp), have been used to understand this reaction because they react sufficiently rapidly to allow for detailed mechanistic analysis. classically, their hydrolysis is described as proceeding through a loose dissociative transition state, based on a measured lg of 1.23, an inverse knonbridge isotope effect (0.9994) on the nonbridging oxygens of pnpp, a large normal isotope effect on the bridging oxygen to the p - nitrophenyl leaving group (kbridge = 1.0189), and a k isotope effect of close to the maximum that would be expected for breaking the bond to the leaving group at the transition state (1.0028). despite the experimental importance of this system, theoretical studies on pnpp hydrolysis have been very limited, with only two studies on the hydrolysis of this compound (involving alkaline and spontaneous reactions), along with a study on the related aminolysis. for the alkaline reaction, it should be noted that that phosphate monoester dianions are extremely resistant to hydroxide attack, and in fact there is no evidence for hydroxide attacking the phosphorus of this or any other phosphate dianion. for the spontaneous reaction, calculations provided the experimentally observed activation barrier of 29.1 kcalmol and suggested that the reaction proceeds through a single transition state with concerted proton transfer to the phosphate, consistent with previous theoretical studies of related compounds in aqueous solution. these same methods were able to reproduce the similar activation barrier for p - nitrophenyl sulfate monoester hydrolysis, and the rather large difference in activation entropy between the two reactions however, two features stand out in these calculations. first, the calculated energy landscape (figure s1) did not provide a clear saddle point, but only a high - energy ridge along which the transition state was found. the second issue is that despite agreement with some of the experimental data, it was not possible to reproduce the kinetic isotope effects, even though good agreement was obtained for the kinetic isotope effects for the sulfate monoester analogue, suggesting that this is not a complete picture of the reaction. to resolve the differences between experimental data and theoretical predictions, we have examined in detail the hydrolysis of three model compounds in aqueous solution : p - nitrophenyl phosphate (pnpp), methyl phosphate (mp) and p - nitrophenyl sulfate (pnps) monoesters. in doing so, we can directly compare the hydrolysis of phosphate monoesters with both good (aryl) and poor (alkyl) leaving groups, as well as the hydrolysis of the corresponding arylsulfate monoester. this is particularly important in the case of methyl phosphate where both associative and dissociative andn mechanisms, as well as a stepwise mechanisms involving proton transfer to substrate have been suggested as viable reaction pathways depending on the computational setup. in the latter case, these elegant calculations were computationally costly as they were performed in full explicit solvent. therefore, it is useful to compare the effect of using an implicit solvent model and a small number of discrete water molecules with the calculations in explicit solvent to find out if a simpler and less costly approach can provide comparable results. we demonstrate that including such microsolvation can substantially affect both the geometries and calculated activation barriers obtained for these species, but that the inclusion of even a few explicit water molecules allows the calculated energetics to converge within a range that would be expected from small variations in the positions of the water molecules. from these calculations, it can be seen that leaving group ability plays an important role not just in the choice of mechanism but also in the role of proton transfers in the reaction. the present work is also the only study to date that computationally reproduces the experimentally observed kinetic isotope effects for the hydrolysis of phosphate monoester dianions. finally, we note the limitations of using calculated 2-dimensional more oferrall jencks plots to deduce mechanistic conclusions for multidimensional systems. while they can be very powerful tools, without proper configurational sampling it is possible to lose the preferred reaction pathway from the calculated surface. two dimensional (2-d) energy surfaces for water attack on pnpp, mp and pnps in the presence of two extra explicit water molecules were generated in the space defined by the phosphorus oxygen distances to the departing leaving group (p olg, x - axis) and incoming nucleophile (p onuc, y - axis) using a grid of 0.1 increments, and mapping from 1.6 to 3.4 along each coordinate. at each point on this surface, the two relevant distances were kept fixed and all other degrees of freedom (including the proton of the attacking water molecule) were allowed to optimize. the energy landscapes were scanned in both the reactant - to - product and product - to - reactant directions in order to ensure that the true minimum energy surface was obtained. initial geometry optimizations were performed in the gas phase using the 6 - 31+g basis set, and the m06 - 2x functional, followed by single point calculations on the structures obtained with a larger (6 - 311+g) basis set to obtain the final energy for each point (relative to the reactant complex). solvation was primarily accounted for by the solvent model density (smd) continuum solvent model, with the inclusion of two additional explicit water molecules, one positioned to stabilize the leaving group and the other to stabilize the nucleophile. including these water molecules allows comparison with the corresponding surfaces previously obtained for these compounds using a purely implicit solvation model. note that we refer to these surfaces as energy landscapes rather than potential or free energy surfaces because the solvation entropy is implicitly accounted for by the continuum model, but the configurational entropy is not. despite this limitation, the 2-d surfaces provide initial insight into viable pathways and approximate locations of key stationary points which we then verified by unconstrained transition state optimizations and subsequent free energy corrections, as outlined below. in recent years, it has become increasingly popular to model phosphate and other group transfer reactions using a mixed solvation model in which the solvent is represented by an implicit model and a number of explicit water molecules (see refs (17), (26), (27), (34)). despite the technical limitations of such an approach, this has been shown to be especially useful in reactions involving highly charged species, where the charge on the solute atoms is not properly solvated by the continuum model. as the popularity of such mixed models increases, questions also arise about the extent to which the inclusion of explicit water molecules affects the energetics of the reaction and geometries of key stationary points, as well as the number of additional water molecules that are required before one obtains a stable, convergent result. to explore these issues, we have considered two potential pathways for the nucleophilic addition of water to each of the substrates considered in this work (figure 1). the first of these is a substrate - assisted mechanism in which nucleophilic attack occurs in either a concerted fashion (figure 1a) or via a metastable pentacoordinate intermediate (figure 1b and 1b). these are coupled with proton transfer from the attacking water molecule to one of the nonbridging oxygens of the phosphate, which can also be either stepwise (preceding nucleophilic attack) or concerted with nucleophilic attack. the second is a concerted mechanism in which the nucleophile is not deprotonated in the rate - limiting transition state (figure 1c), but is stabilized by the solvent. the initial product of this reaction is expected to be only transiently stable (estimated pka 5), and to transfer a proton from the nucleophile to either solvent or to a more basic site via a chain of water molecules. these will be henceforth referred to as either substrate - assisted (figure 1a and b) or solvent - assisted (figure 1c) mechanisms, respectively. in each case, the relevant transition states were optimized with no constraints at the m06 - 2x/6 - 31+g/smd level of theory, using an ultrafine numerical integration grid. the resulting transition state was characterized by frequency calculations, as well as by following the intrinsic reaction coordinate (irc) to minima in both directions, followed by unconstrained geometry optimizations at the same level of theory. additional single point frequency calculations (using a scaling factor of 0.970, by analogy to suggestions presented in related basis sets) for the key stationary points were performed using the larger 6 - 311+g basis set to correct for zero - point energies and entropies and obtain the final free energies for these reactions. it should be noted that alexeev. have argued for the importance of using a larger basis set for polarizable atoms such as p and s if one wants to achieve near chemical accuracy in the thermodynamic properties for these compounds. in terms of the basis set dependence, it has been shown by ribeiro. in their benchmark studies of phosphate diester hydrolysis that this is an important aspect for the hydroxide reaction, but less so for the water reaction. these authors showed that basis sets including polarization and dispersion terms such as 6 - 311+g(d, p) can already provide accurate results (with mue (mean unsigned error) of about 1.21.7 kcal / mol), no improvement was seen upon inclusion of a second diffuse function, and further reduction of mue values was also obtained using the 6 - 311+g(2d,2p) basis set (which in the cited benchmark study led to a mue of about 0.5 kcal / mol). in our case, moving to a larger (6 - 311+g(2d,2p)) basis set slightly affects the calculated energetics (by < 1 kcal / mol), but does not change the trends in our calculations (table s1). activation free energies were obtained relative to the reactant complex state (rs) ; in cases where multiple pathways are accessible, the lowest energy rs was chosen as a reference for all pathways. this procedure was repeated for each system in the presence of 08 explicit water molecules, in addition to the nucleophile, with the aim of examining the effect of including explicit hydrogen bonding interactions in the system. to avoid biasing the position of the water molecules, each additional water molecule was alternately positioned so as to stabilize first the leaving group and then the nucleophile side of the phosphate, thus maintaining the system as symmetric as possible. all quantum chemical calculations were performed using the gaussian09 simulation package. calculated energy landscapes and approximate transition state positions (ts) for the hydrolysis of (a) pnpp, (b) mp, and (c) pnps at the m06 - 2x/6 - 311+g(smd)//m06 - 2x/6 - 31+g(gas) level of theory in the presence of two additional explicit water molecules. all energies are presented in kcalmol relative to the reactant complex, and int indicates the position of a metastable intermediate. finally, the semiclassical kinetic isotope effects (kie) were evaluated directly from the vibrational frequencies using the biegeleisen note that in the context of the entropy calculations, in principle, one needs to take into account the entropic contribution from the explicit water molecules. in a previous work we examined both solvent and solute entropies using explicit molecular dynamics however, the complexity associated with using such a protocol for the large number of systems examined in this work is prohibitive, and therefore, we have relied on estimates from the qm - calculated vibrational frequencies (which allowed us to compare different mechanistic possibilities for the same system). given the unusual features of the previously reported energy landscape for pnpp (figure s1 and ref (25)), we have recalculated the energy landscape for this reaction in the presence of two extra explicit water molecules, as outlined in the methodology section, to see if the surface can provide insight into which reaction pathways are likely to be viable for this system. it can be seen that allowing for microsolvation of the negative charge and using a dispersion - corrected functional qualitatively changes the landscape quite drastically, such that a clear saddle point can be observed. however, the position of the approximate transition state is virtually identical to that obtained from the calculations in implicit solvent without the dispersion correction, and a substrate - assisted mechanism is again revealed by the energy landscape. performing an unconstrained transition state optimization on this structure and following the irc from this transition state to obtain reactant and product complexes resulted in a calculated activation barrier of 34.9 kcalmol, which is very close to the value (33.0 kcalmol) obtained in our previous work at a different level of theory with no extra explicit water molecules, and within 5.4 kcalmol of the experimental value of 29.1 kcalmol. further examination of the surface shown in figure 2a suggests that the reaction has a single low energy pathway with a compact ts (p o distances of 2.27 and 1.75 to the nucleophile and leaving group, respectively). as pointed out by a reviewer, even though a stable intermediate is not apparent, the reaction pathway passes very close to the an + dn corner of the diagram suggesting that an enforced concerted reaction may be an appropriate description. the energy contours near this corner (p o distances of 1.9 and 1.8 to the nucleophile and leaving group, respectively) show a broadening which is the pattern expected for this mechanism, and which would deepen into a potential well for poorer leaving groups. in this description, the reaction is concerted because the potential phosphorane intermediate is not stable enough to exist, and the structural changes resemble those for forming a phosphorane rather than a synchronous reaction. this is similar to previous theoretical studies, but conflicts with the dissociative expanded transition state that is widely used to rationalize experimental data, and with the suggestion that deprotonation of the nucleophile is not necessary in the rate - limiting step of the reaction. although an expansive ts is not evident from the surface, it was computationally observed for the analogous sulfate monoester (also see below). to test whether a similar ts is accessible for pnpp this revealed another lower energy ts with p o distances of 2.34 and 2.45 to the nucleophile and leaving group, respectively (figure 3). this pathway appears to be preferred over the corresponding substrate - assisted pathway by 8 kcal / mol (table s7 presents a summary of the energetics for the two different mechanisms). following from this, to check whether the direct transfer of a proton from the nucleophile to the phosphoryl oxygen through a 4-membered ring provides an artificially high barrier for the substrate - assisted pathway investigated, we have also explored the effect of using one of the additional water molecules as bridge for the proton transfer. in the case of pnpp hydrolysis, the bridging water ts is slightly (0.8 kcal / mol) higher in energy than the ts for direct transfer. in both cases therefore, irrespectively of whether protonation of the phosphate occurs via an intervening water molecule or through direct deprotonation of the nucleophile, the solvent assisted mechanism is still the preferred mechanism. representative stationary points for (a) substrate - assisted and (b) solvent - assisted hydrolyses of pnpp in the presence of two additional water molecules, as well as continuum solvent (smd). rs, ts and ps denote reactant, transition, and product states, respectively. it is surprising that the energetically preferred mechanism appears to be absent from the energy surface shown in figure 2a. to rationalize this, we note that in the solvent - assisted mechanism the nucleophile has not been deprotonated and the initial product state is a transient species with an elongated bond to the incoming nucleophile (table s8). this will have a very short lifetime as the nucleophile is rapidly deprotonated and the p the pathway to this species is overwhelmed by the exothermicity of the proton transfer involved in the substrate - assisted mechanism when calculating the surface shown in figure 2a, causing it to artificially vanish from the 2-d surface. specifically, the 2-d surface is a projection in which each point corresponds to only two fixed distances with multiple conformations satisfying these criteria. therefore, the system will always try to find the lowest energy structure even if this is not directly connected to the lowest energy transition state, creating hysteresis on the surface. h distances on the attacking water molecule can be constrained to prevent proton transfer to the phosphate and enforce a solvent - assisted mechanism, and such a surface for pnpp hydrolysis is shown in figure s2. however, completely preventing the proton transfer results in an energy landscape in which the transition state all but vanishes, and represents entry to the bottom of a high energy valley on the potential surface that describes the product state (as this constraint prevents transfer to solvent or to the phosphate late in the reaction). this highlights the danger of reducing a complex multidimensional reaction pathway to a simple two - dimensional geometric representation (see also refs (47) and (48)), despite the usefulness of such surfaces when studying less complex systems. to take into account the effect of the explicit water molecules, we repeated the transition state optimization by including 08 extra water molecules in the calculation. a comparison of the energetics between the solvent- and substrate - assisted pathways with an increasing number of explicit water molecules is presented in figures 4 and s3 and table s7, with the corresponding energy breakdowns shown in table s2 and s3. from these data, it can be seen that including extra explicit water molecules has a substantial effect on the calculated activation barrier, with each extra water molecule lowering the calculated activation barrier for the substrate - assisted mechanism, presumably due to better solvation of the ts by introducing explicit hydrogen bonding interactions. even after including 8 explicit water molecules, the calculations do not appear to be fully converged, although they appear to be close to that point. however, the ts optimizations and more problematically the subsequent irc calculations become computationally costly and so we did not add further water molecules. with enough explicit water molecules, it appears that the energies of the two pathways converge such that they are similar to each other (figure 4). interestingly, while the energetics of the substrate - assisted reaction appear to be substantially affected by the inclusion of the water molecules, the corresponding effect on the transition state geometries is small (figure 5a and table s8), and therefore the origin of the decreasing activation barrier is not structural but due to the energetic consequences of explicit h - bonding interactions introduced by the added water molecules. in contrast, adding an increasing number of explicit water molecules to the solvent - assisted reaction gradually tightens the transition state by up to 0.2 in the bond lengths to the nucleophile or leaving group (figure 5b and table s8). however, this still corresponds to very little bond order to either nucleophile or leaving group at the transition state. olg is 0.08 (see figure s4 for a comparison of the bond index at the ts for the different pathways). figure 4 (as well as figure s3 and table s7) shows that in the presence of no additional water molecules, the dissociative (solvent - assisted) pathway is initially energetically favorable over the associative (substrate - assisted) pathway by 9.2 kcalmol, but this drops to 2 kcalmol upon adding eight explicit water molecules, as the transition state for the substrate - assisted pathway is more stabilized upon adding explicit microsolvation. change in activation barriers for (a) substrate - assisted and (b) solvent - assisted mechanisms for the hydrolysis of pnpp upon adding an increasing number of water molecules to the calculation. that is, adding extra water molecules causes the calculated activation barriers for the solvent - assisted mechanism to fluctuate over a 4 kcalmol range, giving an average activation barrier of 26.5 1.3 kcalmol over all combinations of explicit water molecules tested in this work. this is about 3 kcalmol lower than the experimental value of 29.1 kcalmol at 25 c. however, our qm calculations probably underestimate the solvation of the charged species in the ground state, so the calculated activation barrier can be considered a lower limit. one feature is that the hydrogen atoms of the nucleophilic water are either stabilized by the microsolvation, leading to the solvent - assisted transition state, or interact with a nonbridging oxygen of the phosphate, leading to the substrate - assisted transition state. thus, one difference between the pathways appears to be the capacity to trap the acidic hydrogen with the phosphoryl group. less obviously, the preferred position of the aromatic ring relative to the scissile bond is different. here, there are two possible conformations depending on whether the scissile bond is coplanar with or perpendicular to the aromatic ring, with the phosphoryl group either moving away from or over the aromatic ring as the reaction proceeds (figure s5). for the substrate - assisted pathway, the scissile bond is preferentially coplanar with the aromatic ring at the transition state (table s2). in fact, tss for the perpendicular conformation are only accessible once three or more water molecules have been added to the system, and then with energy differences of up to 4 kcalmol between the two conformations (table s2). in contrast, for the solvent - assisted pathway, this discrimination is not apparent. the conformation in which the scissile bond is approximately perpendicular to the aromatic ring is the same energy within error as the coplanar conformation (table s3). thus, the conformational effect appears to be more important for the substrate - assisted pathway. interestingly, for pnps, there is a preference for the perpendicular conformation (obtaining the coplanar conformation was extremely difficult and only possible for a few cases, see below). this leads to different stereoelectronic features for the two mechanisms. for the substrate - assisted pathway, if the scissile bond is coplanar with the aromatic ring, conjugation into the aromatic ring is present during bond cleavage (which is not far advanced at the ts). for the solvent - assisted pathway, the scissile bond is largely broken at the ts and so the increasing charge density at the leaving oxygen atom can be stabilized by the aromatic ring in both conformations (table s9). the barrier to rotation in the ground state is only 2 kcalmol (figure s5), and inspection of the cambridge crystallographic database reveals that the major populations of the p o c c dihedral angle are centered around either 0 or 90, therefore both conformations seem to be readily populated. this suggests that there may be an element of conformational control that could dictate which pathway is favored. clearly, these observations only have potential relevance for aryloxy leaving group, and can not be readily extended to alkyl phosphates or phosphate anhydrides. we note that when comparing the energetics of the two different pathways, the reactant state should be the same regardless of the mechanism followed. in the present case, we have followed the minimum energy pathway that connects the respective reactant and transition state for each mechanism, but used the same (lowest energy) rs as a reference for the two different pathways / ring orientations. however, for comparison, in table s2 and s3 we also present the energetics obtained using the rs from following the irc for each mechanism and conformation. the use of a unique reference rs for the each mechanism does not change the overall trends nor the fact that the dissociative mechanism appears to be the favored pathway up until 7 or 8 water molecules are present where the difference between the two pathways becomes smaller (see figure 4). having analyzed the energetics of both pathways, both mechanisms appear plausible within the tolerance of the methods employed, and thus the relative energetics are inconclusive. the experimentally observed kinetic isotope effects (kies) remain to be accounted for and might be used to distinguish between the two pathways. variation in p / s onuc and p / s olg distances at the transition state upon adding an increasing number of water molecules to the calculation for the (a) substrate- and (b) solvent - assisted spontaneous hydrolyses of pnpp, as well as (c) the solvent - assisted spontaneous hydrolysis of pnps. in all cases the reactant state from the system without extra water molecules was used as the reference reactant state. note that similar calculated kie were obtained when using the reactant state from the irc optimization as a reference point, and therefore, the qualitative results are independent of reference reactant state. we were unable to reproduce the kies for pnpp hydrolysis, following the substrate - assisted mechanism, despite being able to reproduce the kies for pnps hydrolysis, which followed a solvent - assisted, dissociative mechanism. we assumed that this was because of complications due to the proton transfer and the fact that such isotope effects are rather difficult to calculate. in the present work, we have calculated kies for both the substrate - assisted and solvent - assisted transition states using the biegeleisen - meyer equation as outlined in methodology section. the resulting kies are shown in table 1. as with our previous work, the calculated kies for the substrate - assisted mechanism give rather poor agreement with experiment, despite this pathway appearing energetically plausible as long as sufficient explicit water molecules are included. in each case, the kie is very close to 1, and qualitatively wrong for the kbridge kie. the same outcome is obtained when the proton transfer occurs via a bridging solvent molecule (table s10), with the calculated kie still giving very poor agreement with experiment. in contrast, the calculated kies for the solvent - assisted mechanism give much better agreement with experiment, albeit with slightly overestimated values for the kbridge kie, and particularly good agreement for the k kie. the calculated kies are also very stable once two or more water molecules are added to the system and are apparently not affected by the extra degrees of freedom being introduced. while quantitative accuracy have been reported for the alkaline hydrolysis of phosphate diesters, this is, to the best of our knowledge, the first time it has been possible to theoretically reproduce the experimental kies for the spontaneous hydrolysis of phosphate monoesters, via a pathway normally not considered theoretically. an earlier study on the hydrolysis of pnpp assuming general base catalysis by a hydroxide ion obtained reasonable values for all kie except for the knonbridge, which was qualitatively wrong. overall, the system shows a preference for a dissociative pathway in which deprotonation of the nucleophile plays a marginal role with no need for general - base catalysis, although the corresponding substrate - assisted mechanism is sufficiently close in energy that an enzyme or synthetic catalyst could change the mechanistic preference of the system. detailed experimental studies on phosphate monoester hydrolysis have mostly focused on the reactivity of arylphosphate monoesters, with alkylphosphate monoesters much less studied due to their exceedingly slow rates : for example, the methyl phosphate dianion has an estimated rate constant of 2 10 s at 25 c. this estimate is an upper limit, as the reactivity of the monoanion dominates the observed reaction even in 1 m koh. however, based on the similarity of estimates from these data with that obtained from an extrapolation of the brnsted plot for the hydrolysis of arylphosphate monoester dianions, it has been suggested that both alkyl and aryl compounds follow a similar mechanism. theoretical work has generally (with a few exceptions) focused on the reactivity of phosphate monoesters with alkyl leaving groups, and computational studies have been highly contradictory concerning the nature of this mechanism. that is, both stepwise and concerted, as well as associative and dissociative pathways have been suggested depending on the level of theory and computational approach used, and it has been suggested that the associative and dissociative pathways may be indistinguishable by the available experimental methods. a particular point of discussion has been the importance of the potential proton transfer from the attacking nucleophile to the nonbridging phosphoryl oxygens. specifically, there has been considerable discussion in the literature about the viability of a substrate - assisted mechanism in which the phosphate itself deprotonates the attacking nucleophile in a pre - equilibrium proton transfer, which is followed by hydroxide attack on a protonated phosphate : a comparison of the transition state energies for the spontaneous hydrolysis of mp upon adding an increasing number of water molecules to the calculation. here, ts is the transition state for the solvent - assisted pathway, ts1 is the transition state for the addition step of the substrate - assisted pathway, and ts2 is the transition state for the elimination step of the substrate - assisted pathway. the key argument against such a mechanism is that the expected high cost of a ground state proton transfer from water to the phosphate (due to the large difference in pkas) would require the subsequent nucleophilic attack of hydroxide on the phosphate monanion to be extremely fast, far faster than the rate of reaction with a corresponding diester. computational studies using methyl phosphate as a model system and implicit solvation have suggested such a mechanism is viable. in contrast, studies of the alkaline hydrolysis of aryl alkyl phosphate diesters in which a methyl group is used as an analogue for a protonated phosphate have suggested that the rate of this reaction is far too slow to compensate for the low concentration of this ionic form. however, and as also pointed out by vigroux and co - workers, it is not clear that methyl phosphate hydrolysis proceeds through a similar mechanism to an aryl phosphate with a good leaving group, particularly in light of the potential importance of leaving group protonation. additionally, these arguments do not take into account the alternate possibility of a much later proton transfer to the phosphate that is concerted with or following bond formation to the nucleophile rather than driving the reaction, as was suggested by calculations in full explicit solvation. we also note that in a related study of phosphate diester hydrolysis, stepwise and concerted pathways had very similar activation energies. in the case of pnpp we find that once sufficient water molecules are added to the system, both associative and dissociative pathways become comparable in energy. we have performed an analogous assessment of the hydrolysis of mp, although in this case there is almost no experimental data available for validation of the calculations, and therefore we provide only a theoretical model. the energy landscape for the hydrolysis of this compound in the presence of two additional explicit water molecules is shown in figure 2b. as with our previous work using a different density functional in pure implicit solvent, two pathways are apparent on the energy landscape : an an + dn associative pathway with concerted proton transfer to the phosphate during the addition step and a concerted pathway involving solvent - assisted water attack. however, the solvent - assisted transition state is at least 10 kcalmol higher in energy than its substrate - assisted counterpart. as for pnpp, we explored whether the presence of an intervening water molecule significantly lowered the energy of the pathway involving proton transfer from nucleophile to phosphoryl oxygen (table s11). the nucleophile once again occurs prior to the ts (figure s6), one would expect the ts for direct proton transfer and via water to have similar energetics as a 4-membered ring with shortened bonds between the hydrogen and the donor / acceptor sites is not evident in the ts. although this pathway is not based on prequilibrium proton transfer, the ts is essentially the same as would be expected for this mechanism (see discussion below concerning reversibility). a comparison between the energetics of the solvent- and substrate - assisted pathways with increasing number of solvent water is presented in figure 6 (see also figure s7). once again, addition of extra explicit water molecules has a substantial effect on the calculated energetics, but in this case reducing the calculated activation barrier for the solvent - assisted pathway by up to 6 kcalmol, while having a comparatively small effect on the corresponding substrate - assisted pathway (see also tables s4 and s5 for the breakdown of the different energy contributions) with almost no changes in ts geometries (table s12 and figure s8). representative stationary points for (a) stepwise substrate - assisted and (b) solvent - assisted hydrolyses of mp in the presence of two additional water molecules, modeled using continuum solvent (smd). rs, ts, ts1/ts2, int and ps denote reactant, transition states, intermediate, and product states, respectively. variation in p onuc and p olg distances at the transition state upon adding an increasing number of water molecules to the calculation for the (a) solvent - assisted and (b) substrate - assisted (stepwise) hydrolyses of methyl phosphate (mp). performing the calculations in a pure implicit solvent model shows a substantial discrimination between the two pathways. however, once again, the introduction of explicit microsolvation by the addition of a sufficient number of explicit water molecules leads to a smaller energy difference between them (figure 6 and table s4 and s5), although preference for the substrate - assisted mechanism is still observed (previous studies have suggested similar energetics for both pathways). key distances of the stationary points for the two different mechanisms are shown in figure 7 and s9. the variation of the relevant distances at the transition state, with an increasing number of water molecules, is shown in figure 8 (and figure s8 and table s12), as can be seen the distances are more sensitive to the number of extra explicit water molecules for the solvent - assisted pathway compared to the substrate - assisted one. in pure implicit solvent, the solvent assisted pathway would appear to be extremely unfavorable, with an activation barrier of 50.3 kcalmol, although this is reduced to 44 kcalmol upon adding extra water molecules. as with the corresponding mechanism for pnpp hydrolysis, the product oh2 bond, prior to deprotonation of the nucleophile either by deprotonation to bulk water or tautomerization. this high energy species is expected to rapidly decay to a more stable product with a deprotonated nucleophile and a protonated leaving group, but we have not explored this outcome in detail as it is computationally challenging to model and not rate - limiting (note that in cases where the leaving group is protonated in the product state during the irc or subsequent optimization, the energy drops dramatically ; see figure s7). a slightly different mechanistic picture is obtained in the case of the substrate - assisted pathway, where the benefit of protonating the poor leaving group appears to provide a role for the formation of a transient phosphorane intermediate, with the proton of the nucleophile moving to a nonbridging oxygen of the phosphate. examination of the individual points along the irc suggests that this proton transfer occurs prior bond formation to the nucleophile. this is further validated by the analysis of both o h and p o distances along the reaction coordinate for both pnpp and mp systems (figure s8). the structures of key stationary points along this pathway (corresponding to the surface shown in figure s6), for the representative case with two extra water molecules, are shown in figure 7. as can be seen from this figure, in the intermediate state, the proton on the nonbridging oxygen of the phosphate is still oriented toward the oxygen of the nucleophile, and for this proton to potentially protonate the leaving group, it first needs to rotate toward the oxygen of the leaving group. schlitter and co - workers performed related calculations in explicit solvent and obtained an estimated activation barrier of about 8 kcalmol for this proton rotation. consistent with these data, we were able to obtain transition states for this proton rotation in almost all cases, with approximate activation barriers of 46 kcalmol (depending on how many extra water molecules are included in the system, cf. corresponding 1-d free energy profiles for both substrate - assisted and solvent - assisted pathways in the presence of eight additional explicit water molecules are shown in figure 9. for the substrate - assisted mechanism, once the addition step has taken place, two different pathways can be followed. in the first of these (red), the p oh of the intermediate phosphorane rotates to point the proton to the leaving group instead of the nucleophile, with a separate activation barrier to proton rotation (tsrot in figure 9), followed by subsequent elimination of methanol. in the second, the breakdown of the phosphorane intermediate occurs through the elimination of an anionic (methoxy) leaving group (blue). as can be seen from figure 9, these two scenarios are energetically indistinguishable, with the only difference that the rate limiting step changes from leaving group elimination to p oh rotation giving essentially no added benefit from rotating this hydrogen to protonate the leaving group at the transition state. once the proton rotation has occurred, leaving group departure becomes slightly easier than the corresponding reaction without the proton rotation (table s6 and figure s7). expulsion of methoxide would mean that decomposition of int1 does not mirror its formation, and would require an alternative mechanism for the formation of int1 which involves the attack of hydroxide on the monoanion (with the p however, it is apparent that the ts for the decomposition of both pathways from int1 have similar energies, and so the additional pathway does not change the key aspects of the mechanism. likewise, the solvent - assisted pathway has to have an alternative pathway where hydroxide attacks mp protonated on the leaving group to obey microscopic reversibility calculated free energy profiles for methyl phosphate hydrolysis via different mechanisms in the presence of eight additional water molecules. black : solvent - assisted ; blue : substrate - assisted with elimination of methoxide ; red : substrate - assisted with elimination of methanol following rotation of poh in phosphorane intermediate. finally, experimentally, the hydrolysis of mp is slightly exergonic, whereas our calculations show a slight endergonicity for the substrate - assisted pathway that leads to methanol as the initial product (ps3) and a very endergonic process for the solvent - assisted (ps1) and substrate - assisted pathways (ps2) that eliminate methoxide. the slightly endergonic substrate - assisted reaction is in part due to shortcomings of the implicit solvent model, which undersolvates methanol relative to water, introducing an approximate error of 2.2 kcal / mol into the calculated endergonicity (see the discussion in the supporting information). it is possibly that an underestimate exists in the change in solvation free energy upon moving from methyl phosphate to inorganic phosphate. in addition, elimination of methoxide is expected to lead to a transient, high - energy intermediary state that rapidly decays to more stable products through proton transfers that are not rate limiting. there is a high endergonicity associated with modeling anionic species that has been particularly well documented in the case of reactions involving hydroxide - anion as a nucleophile (see discussion in refs (42) and (57)). these problems result in artificial undersolvation of the anion, which in the case of hydroxide anion as a nucleophile leads to unphysically low activation energies (see discussion in our previous work), and in the present case most likely leads to additional artificially high endergonicity for the departure of methoxide compared to methanol (a more detailed discussion of this issue is presented in the supporting information). figure 9 shows a difference of 18.7 kcal mol, corresponding to a 14 pka unit difference, which reflects the difference in pka of methanol and the second ionization of inorganic phosphate ; this should be only 9 pka units. in contrast, the energy difference between the solvent- and substrate - assisted reactions that release methoxide is in good agreement with the estimated pka difference between the two tautomers of monoanionic inorganic phosphate (13 pka units). as with our previous work, we expect these problems to be mitigated at the ts, where there is partial bond formation to both incoming nucleophile and departing leaving group, allowing for meaningful trends to be obtained despite the uncertainties in the energetics of the product state. in recent years, it has been convincingly demonstrated that a large number of enzymes are capable of catalytic promiscuity in that they can facilitate the turnover of multiple substrates through chemically distinct transition states. this phenomenon has been particularly well described in enzymes that catalyze phosphoryl transfer reactions, with phosphatases multitasking as sulfatases and sulfatases multitasking as phosphatases (see refs (59) and references cited therein). to understand such promiscuity, it is important to understand the intrinsic reactivity of these compounds, so that the origins of any potential changes in how different transition states are recognized can be mapped, and substantial effort has been made in this direction, and how similar or different the intrinsic chemistry of aryl phosphate and sulfate hydrolysis actually is. both pnpp and pnps have similar (tetrahedral) ground state geometries, and similar experimentally measured rate constants and kies for their spontaneous hydrolysis. as a result, it has been assumed that these reactions proceed through very similar (dissociative) transition states. however, the two compounds differ by a full charge unit (resulting in potentially very different solvation effects at the transition state), and have very different experimentally measured activation entropies : 18.5 eu for the ph independent hydrolysis of pnps anion and + 3.5 eu for the hydrolysis of pnpp dianion. a major difference between pnpp and pnps is the acidity of the substrate : the second pka of pnpp is 4.9, whereas pnps has a pka of < 3. therefore, a mechanism involving initial proton transfer to the substrate is much less favorable for the sulfate. similarly, the product inorganic phosphate has a second pka of 6.82, whereas inorganic sulfate has a first pka of 3.0 and so there is no benefit for concerted proton transfer to the sulfate either. as can be seen from figure 2c, the surface suggests only a single pathway, involving an expanded transition state with s o distances of approximately 2.2 and 2.4 to the nucleophile and leaving group oxygen atoms respectively (similarly to our previous energy landscape). adding extra water molecules does slightly tighten this transition state (figure 5c and table s13), and also reduces the calculated activation barrier (table s14 and figure s11). in most cases, the product state still passes through a high - energy plateau, where the nucleophilic water molecule has now been deprotonated to yield a hydronium, hydrogen sulfate, and the aryloxy leaving group (as well as any extra water molecules). this hydronium ion ultimately protonates the leaving group, and the stability of the product state obtained from following the irc appears to depend on the position of this hydronium ion, as shown in figure 10. in contrast, for pnpp, the water molecule is not deprotonated at this inflection point on the reaction profile (for the solvent - assisted pathway), despite the similarity between the two transition states. representative stationary points for the solvent - assisted hydrolysis of pnps in the presence of two additional water molecules, modeled using continuum solvent (smd). rs, ts and ps denote reactant, transition, and product states, respectively. it should be noted that the pnps transition state obtained from the surface shown in figure 2c was crucial for locating the dissociative pnpp transition states shown discussed above. that is, all our prior attempts to optimize this transition states directly in pure implicit solvent resulted in decomposition of the phosphate to metaphosphate, water and p - nitrophenoxide (the optimization never converged), whereas it was possible to directly optimize the pnpp transition state shown in figure 3 using the pnps transition state presented here as a starting point. it should be noted that similar problems in obtaining ts for the hydrolysis of the sulfate monoester have also been recently reported. table 1 shows the calculated isotope effects at 85 c, demonstrating that, as with our previous work, we are able to obtain good agreement with experiment for this pathway even if the k effect is slightly overestimated. we also explored the potential substrate - assisted mechanism, but the calculated activation barriers lay in the range of 50 kcalmol (even after adding extra water molecules for explicit microsolvation), and so this mechanism was discounted as being too energetically unfavorable. therefore, in contrast to the picture previously given by theory, the hidden (but preferred) mechanism for pnpp hydrolysis and that for pnps hydrolysis are very similar and proceed through very similar transition states, as has been inferred from the experimental data. the main difference is that in the case of pnpp, there appears to be a second energetically similar pathway that is accessible and either an artificial or biological catalyst, depending on the local electrostatic environment, might shift the balance between these two mechanisms. this is not possible for pnps hydrolysis, where the substrate - assisted mechanism is extremely unfavorable and an external proton acceptor is always required. these results may provide insight into why it is apparently much harder for a proficient phosphatase to be also a good sulfatase (alkaline phosphatase (ap)) than the other way around (e.g., pseudomonas aeruginosa arylsulfatase (pas)). in the current work, we present a detailed theoretical study of the hydrolysis of three representative model compounds, namely methyl phosphate hydrolysis, p - nitrophenyl phosphate hydrolysis and, for comparison, p - nitrophenyl sulfate, using an implicit solvent model with increasing numbers of explicit solvent molecules included in our calculations. as expected, we see that including explicit hydrogen bonding interactions is clearly significant. that is, it affects not just the mechanistic balance between substrate- and solvent - assisted pathways by several orders of magnitude in rate, but in some cases also the transition state geometries. despite the fact that even eight water molecules are not enough to provide completely converging energies and geometries, it is possible to obtain chemical information that is far superior to using just an implicit solvent model, at much lower computational cost than full explicit ab initio qm / mm or metadynamics calculations, allowing multiple pathways to be tested relatively easily. considering the calculated kie for pnpp, the nonbridging kie are slightly inverse for both the substrate- and solvent - assisted pathways. for the solvent - assisted pathway, this is consistent with the slight shortening of these bonds in the ts, which presumably leads to stiffer stretching and bending. for the substrate - assisted pathway the slightly more inverse kie is presumably due to the protonation of one of the p o in the ts, as the other two bonds show a smaller decrease in bond length in the ts. the equilibrium isotope effect for protonating a phosphate monoester is 0.985, and so the calculated value is rather smaller than this, despite the observation that the proton transfer appears to be essentially complete by the time the ts is reached. it may be that the change in the p o bonding is greater in reaching the phosphorane - like ts than in the rs monoesters, which compensates for the protonation. although due to different structural effects, it appears that the nonbridging kie is not a sensitive criterion for discriminating between the two pathways. however, the kie at the bridging and remote n position do provide a clear distinction and can be rationalized by the far greater change in bonding to the leaving group in the solvent - assisted pathway. mechanistically, it would appear that the preferred pathway is dependent on the specific leaving group. for a good aryl leaving group, the preferred mechanism is a concerted reaction with a loose transition state, and is similar for both the aryl sulfate and the aryl phosphate monoesters, consistent with previous interpretations of the experimental data (see refs (8) and (68)), and in contrast to previous theoretical studies (see refs (16), (25), (55) which have argued for a more associative, substrate - assisted pathway). however, in the case of the aryl phosphates, once explicit water molecules have been introduced in the system to provide better solvation, the two mechanisms are close enough in energy that the balance between the two might easily be altered in a nonhomogenous environment such as an enzyme active site (due to the differences in charge distribution at the two transition states), even if the discrimination is not necessarily obvious in aqueous solution. for methyl phosphate, the preferred mechanism seems to switch to an associative addition elimination an + dn process, with an intermediate that exists in a very shallow potential well. interestingly, the differential behavior between the aryl and alkyl phosphates is in agreement with previous theoretical studies, which obtained very different qualitative results for the hydrolysis of a polyphosphate and for methyl phosphate, suggesting a dissociative solvent - assisted mechanism in the former case and an associative substrate - assisted mechanism in the latter case. these descriptions are consistent with our calculations, which show a strong leaving group dependence, and indicates that even limited microsolvation might be sufficient to reproduce similar results to high - level calculations in full explicit solvent, but at much lower computational cost. it should be noted, however, that the almost 10 kcal / mol discrimination between ts and ts2 of figure 6 for the hydrolysis of mp could include an overestimate due to inadequacies in the solvation of methoxide ion by the implicit solvent model (see discussion in the supporting information), and these two pathways are likely closer in energy than would be suggested by this figure, albeit still with a preference for the substrate - assisted pathway. the situation is more straightforward in the case of the arylsulfate. in this case the low pka of this compound precludes an associative substrate - assisted mechanism and the only viable pathway is through a solvent - assisted mechanism, with a water molecule acting as a proton acceptor after bond formation to the nucleophile. since phosphate monoesters also appear to be capable of a similar mechanism, an enzyme that has been fine - tuned to accommodate the demanding hydrolysis of sulfate monoesters could also in principle accommodate phosphate monoesters with relative ease, as is seen for example in the case of the arylsulfatase from pseudomonas aeruginosa (pas). the opposite is not necessarily true for phosphatases, if they have been evolutionarily optimized for the more associative pathway. we also observe that, for p - nitrophenyl phosphate and sulfate hydrolysis, there appears to be a structural basis to the choice of mechanism, depending on the position of the proton on the nucleophile and whether the leaving group aryl ring is coplanar with the phosphate or perpendicular to the phosphate. the final question concerns the role of the proton transfer in the reaction, and whether it is a driving force or a simple consequence of bond formation. recently, there has been a related debate about whether the mechanism of gtp hydrolysis by gtpases proceeds through a transition state with no deprotonation of the nucleophile, one with direct proton transfer to the phosphate, or one with proton transfer to the phosphate through an intervening water molecule, a so - called our calculations on pnpp support a solvent assisted mechanism, a conclusion that is strengthened by the fact that this pathway reproduces the experimentally measured kies. recent computational work has also suggested that the energy discrimination between a mechanism involving direct proton transfer to the phosphate and one involving an intervening water molecule is minimal, suggesting that the pathway for protonation of the phosphate does not affect the reaction greatly. to explore this issue further, we provide an overview of the protonation states of the nucleophile and phosphate at representative points on the calculated energy landscapes for pnpp and mp hydrolysis (figure 2a and b) in table s15. we have also provided an overview of key p o and o h distances along the calculated intrinsic reaction coordinate for pnpp and mp hydrolysis in the presence of two explicit water molecules (from the unconstrained ts optimization) in figure s6. from this figure and table it can be seen that, in both cases, nucleophile deprotonation and protonation of the phosphoryl group precedes attack at the phosphorus center, allowing the reaction to in effect proceed through the equivalent of a pre - equilibrium proton transfer to the phosphate. the effect of the proton transfer to the p o will be to inhibit the expanded transition state due to the formation of a very high energy protonated metaphosphate, pushing the pathway toward the phosphorane intermediate. likewise, if the nucleophile is not deprotonated, the trianionic phosphorane will be formed in a very high energy tautomer, and the pathway is pushed toward the expansive concerted pathway (see more extended discussion in supporting information). irrespective of whether it occurs directly or via intervening water, the protonation of the phosphoryl oxygen does however lead to the formation of a pentacoordinate intermediate in a plausible ionic state, considering the thermodynamic data gathered by guthrie ; the calculations presented here suggest that the kinetic barriers to forming this intermediate are not large. this may differ in the reaction of a diester with hydroxide, even though this would form an intermediate with similar stability. our calculations confirm that for both cases pnpp and mp, the proton transfer is coupled to changes in p o bonding patters and it clearly precedes bond formation to the nucleophile (figure s10). therefore, deprotonation of the nucleophile and generation of a hydroxide ion appears to be driving this reaction. this mechanism in turn potentially dominates for the poor alkyl leaving group, but is higher in energy in the case of the good aryl leaving group. therefore, the nature of the leaving - group appears to have a large impact on the choice of mechanism for the hydrolyses of these phosphates, as was also seen in recent calculations. this suggests it can be risky to extrapolate between experiments with highly activated aryl leaving groups and calculations with poor alkyl leaving groups. overall, we present here a consistent mechanistic framework that accounts both for a key experimental observable that was not reproduced in previous theoretical studies (i.e., the kinetic isotope effects), and for apparent discrepancies between theory and experiment. | understanding phosphoryl and sulfuryl transfer is central to many biochemical processes. however, despite decades of experimental and computational studies, a consensus concerning the precise mechanistic details of these reactions has yet to be reached. in this work we perform a detailed comparative theoretical study of the hydrolysis of p - nitrophenyl phosphate, methyl phosphate and p - nitrophenyl sulfate, all of which have served as key model systems for understanding phosphoryl and sulfuryl transfer reactions, respectively. we demonstrate the existence of energetically similar but mechanistically distinct possibilities for phosphate monoester hydrolysis. the calculated kinetic isotope effects for p - nitrophenyl phosphate provide a means to discriminate between substrate- and solvent - assisted pathways of phosphate monoester hydrolysis, and show that the solvent - assisted pathway dominates in solution. this preferred mechanism for p - nitrophenyl phosphate hydrolysis is difficult to find computationally due to the limitations of compressing multiple bonding changes onto a 2-dimensional energy surface. this problem is compounded by the need to include implicit solvation to at least microsolvate the system and stabilize the highly charged species. in contrast, methyl phosphate hydrolysis shows a preference for a substrate - assisted mechanism. for p - nitrophenyl sulfate hydrolysis there is only one viable reaction pathway, which is similar to the solvent - assisted pathway for phosphate hydrolysis, and the substrate - assisted pathway is not accessible. overall, our results provide a unifying mechanistic framework that is consistent with the experimentally measured kinetic isotope effects and reconciles the discrepancies between theoretical and experimental models for these biochemically ubiquitous classes of reaction. |
evidence has emerged that inflammatory mechanisms contribute to the onset and progression of type-1 diabetes (t1d). recent data further suggest that the initiation of autoimmunity is preceded by inflammation reflected by a proinflammatory metabolic serum profile. many autoimmune diseases are associated with increased histamine levels in serum and tissue fluids, such as rheumatoid arthritis, sjgren 's syndrome, multiple sclerosis, and diabetes mellitus [14 ]. similarly, it has been known for many years that histamine is elevated in tissue biopsies and secretions in the intestine of patients with crohn 's disease and ulcerative colitis [5, 6 ]. during inflammatory responses, histamine, a hydrophilic vasoactive amine, increases capillary permeability and facilitates the immune response by enhancing leukocyte rolling, adhesion, and vascular extravasation of inflammatory cells to the site of inflammation. histamine is recognized not only as an inflammatory mediator but also as a regulator of immune responses, including the th1/th2 balance and hematopoiesis. patients with diabetes are more susceptible to vascular diseases, which led to the assumption that their increased circulating histamine levels promoted lipolysis and facilitated the transport of lipids into tissues. beside its physiological role in vascular health, excess histamine, a result of physical or emotional stress or a chronic disease / inflammatory state, appears to elicit atherogenic effects. whether histamine is a critical marker or target in the treatment of type-1 diabetes has not yet been established. it is still poorly understood how the expression of histidine decarboxylase (hdc), the unique enzyme responsible for histamine generation, is controlled. hdc is induced in a variety of tissues in response to bacterial components (lipopolysaccharides, peptidoglycan) and to various cytokines such as il-1, il-3, il-12, tnf, g - csf, and gm - csf. its upregulation has been associated with pathological conditions, including t1d. on the other hand, an impaired glucose tolerance has been reported in hdc mice, together with autoantibodies reactive to glutamic acid decarboxylase (gad). histamine exerts important functions in allergy, inflammation, neurotransmission, and the gastrointestinal tract through g - protein - coupled specific histamine receptors, termed h1r - h4r. in the context of diabetic physiopathology, it plays a pivotal role in various physiological functions, such as feeding behaviour and energy homeostasis. mice with genes disrupted for hdc are prone to become obese on a high - fat diet or at advanced age. these metabolic changes presumably are due to the impaired regulatory loop involving hypothalamic histamine and h1r [12, 13 ]. consequently, treatment with imetit, a h3r agonist, reduced plasma histamine, leptin, and insulin levels and has anorexigenic effects in diet - induced obesity. histamine has been shown to regulate t cells by enhancing th1-type responses through the h1r and downregulating both the th1 and th2 type responses through the h2r [15, 16 ]. it has recently been described that anti - inflammatory and immunomodulatory functions of histamine are mediated through the h4r. thus, they can be reproduced using the h4r agonist clobenpropit, which has been shown to suppress il-12 production, modulate dendritic cell migration [18, 19 ], and regulate the growth of cancer cells through h4r. autoimmune diabetes in nod mice is characterized by a progressive mononuclear cell infiltration in the pancreatic islets of nod mice and leads to beta cell destruction and hyperglycemia. it has been recently demonstrated that leptin can reverse diabetes. assuming that histamine might be involved in the pathogenesis of diabetes, we investigated the relationship between endogenous histamine production and disease development in the nod mouse model, using histamine - deficient hdc mice backcrossed on a nod background. here, we show that the lack of endogenous histamine provides a notable protection against t1d. we observed an increase of ly6gcd11b immature myeloid cells in these mice that was not correlated with diabetes onset, while il-12 and ifn- levels in the serum were decreased, suggesting that endogenous histamine modulates the inflammatory pattern. paradoxically, we found that t1d onset was also delayed when exogenous histamine was given to nod. our study supports a metabolic role of histamine during the pathogenesis of autoimmune diabetes in accordance with previous findings supporting its immunomodulatory functions. conventional nod mice (k, i - a, and d) were bred in our animal facility at the hpital necker. hdc mice generated by ohtsu. received a histamine - low diet (safe (scientific animal food and engineering)) to avoid exogenous uptake. we generated hdc - deficient mice by speed backcrossing the hdc - deficient allele against the nod background. in order to confirm the allele maps of nod diabetes susceptibility genes, we analysed several representative microsatellite markers : we chose the alleles related to mhc and numerous insulin - dependent diabetes genes. then, mice were intercrossed to generate the hdc mice used in this study. we purchased histamine and 4-methylhistamine (4-mh) from sigma - aldrich and clobenpropit dihydrobromide (cb) from tocris. l of saline once a week for 10 weeks starting at 4 weeks of age. h4r agonists, cb (10 g / kg), 4mh (10 g / kg), and vehicle (control group for h4r - agonist) were injected i.p. in 100 leptin (millipore), ifn- (r&d), il-6 (r&d), and il-12 (r&d) were quantified in sera from mice, using elisa kits according to the manufacturer 's instructions. we treated nod mice with histamine, cb, or 4-mh and monitored weekly for clinical signs of diabetes using gluko - test reagent sticks, to detect glucose in urine samples (boehringer mannheim, meylan, france). when needed, glycemia was also measured in a drop of blood collected from the tail vein using a reflolux s glucometer (boehringer mannheim). incidence of diabetes was defined based on the discovery, upon serial monitoring, of glycosuria and hyperglycemia (fasting glycemia > 2.5 g / l). to induce t1d by adoptive transfer, purified cd4 diabetogenic t cells from prediabetic nod mice were injected i.v. into eight - week - old nod rag recipient mice with a cd11b population (5 10 cells / mice) bone marrow cells were stained with cd11b microbeads (miltenyi biotec) then sorted by positive magnetic separation on ls columns (macs separator, miltenyi). a high incidence of t1d is elicited within 10 weeks after t cell transfer. bone marrow (bm), spleen, and peripheral whole blood cells bm and spleen cells were prepared as previously reported [25, 26 ] and adjusted to a final concentration of 1 10 per ml in culture medium (pbs from gibco brl). cell suspensions were stained with the following appropriately labeled antibodies : cd11b, ly6g- ly6c, cd4, cd25, foxp3, mpdca-1, cd11c, cd115, mhc - ii, cd80, and cd86 (bd biosciences, pont - de - claix, france). mononuclear cells were gated according to forward- and side - scatter properties and analysed using the facs diva software. diabetes incidence was plotted using the kaplan - meier method, that is, nonparametric cumulative survival plot. statistical comparison between curves was performed using the log rank (mantel - cox) test that provided the corresponding values. when needed to evaluate the role of histamine in autoimmune diabetes, we generated nod mice deficient for the gene encoding hdc in the nod genetic background. these genetically engineered mice were healthy and heavier than their wild - type controls after several months. as shown in figure 1, the onset of t1d was delayed in nod hdc mice and the disease incidence remained lower than that among wild - type controls, suggesting a deleterious role of histamine during pathogenesis. it may be hypothesized that an increase in plasma and cellular histamine content contributes to disease progression by enhancing endothelial permeability, as suggested for the intimal damage in atherosclerosis. in favour of this hypothesis, histamine levels were effectively increased in diabetic nod mice (data not shown), similarly to what has been reported for streptozotocin - diabetic rats. to assess potential changes in immunological and hormonal parameters in the absence of histamine, we analysed interleukin-12 (il-12), il-6, and leptin. il-12 and ifn- levels were lower in hdc than in nod mice, but no differences were noted for il-6 or leptin (figure 1(b)). as histamine contributes to the differentiation and maturation of hematopoietic myeloid cells, we performed a comparative cytometry analysis of these populations in histamine - deficient and wild - type nod mice in various organs, such as bone marrow, spleen, and peripheral blood based on gr-1, cd11b, ly6 g, and ly6c expression by leukocytes. we found an increased percentage of immature cd11bgr-1 cells in the peripheral blood and the spleen from nod hdc mice (figure 2(a)). a similar result was observed for the cd11bly6 g ly6c subset from peripheral blood and spleen of nod hdc mice (figures 2(b) and 2(c)). these results confirmed the previously reported importance of histamine for the differentiation of cd11bgr-1 myeloid subsets in a different genetic background. we hypothesized that the increased proportion of immature myeloid cells (imcs) might be involved in the protection against type-1 diabetes in histamine - deficient mice. to test this assumption, we performed adoptive transfers of effector cd4cd62l t cells together with cd11b bone marrow cells from hdc - deficient or wt mice to nod rag recipients, which did not alter diabetes onset (figure 2(d)), ruling out the increase of imcs as a cause for diabetes progression. we also analysed the status of myeloid - derived suppressive cells (mdscs), which can modulate diabetes onset. however, no difference was observed when comparing this subset in both strains (figure 2(e)). similarly, the proportion of cd4cd25foxp3 regulatory t cells remained unchanged (figure 2(f)). since the generation of endogenous histamine appears to enhance the pathogenesis of t1d, we attempted to reproduce this deleterious effect by adding exogenous histamine. injections of either vehicle (100 l pbs) or histamine (4 mg / kg), respectively, once a week for 10 weeks. as shown in figures 3(a) and 3(b), exogenous histamine not only failed to increase the incidence of t1d, but also delayed the onset of disease in both wild - type and hdc mice. as shown in figure 3(c), decreased expression of class ii major histocompatibility complex (mhc - ii) and cd86 molecules occurred only on pdcs from pancreatic lymph nodes (lns) in mice treated with histamine, suggesting that this mediator may modulate the activation pattern of apcs. recent evidence supports the notion that the inflammatory functions of histamine are mediated through the h4r [20, 29, 30 ]. for this reason, we examined whether compounds characterized as potent h4r agonists could reproduce the protective effect provided by exogenous histamine. we injected nod mice with clobenpropit (cb), an isothiourea derivative of histamine, or 4mh for 10 weeks and found no significant protection as compared with mice having received vehicle alone (figures 3(d) and 3(e)). in the present study, we provide evidence that histamine deficiency causes a delay in diabetes onset and decreases its incidence. this result fits with clinical observations in diabetic patients since increased histamine levels were associated with pathogenesis in these patients. furthermore, there is now a compelling body of evidence for the contribution of histamine to the development of autoimmune diseases from animal studies. it has also been reported that inhibition of histamine synthesis in experimental diabetes reduces disease complication. several arguments suggest that in the present study the phenotype results from vascular and/or metabolic functions of histamine. this conclusion has already been proposed in a rat diabetic model, since the authors have shown that the gastric histidine decarboxylase activity and plasma gastrin levels were increased in connection with the depletion of insulin. we can thus anticipate that decreasing histamine levels in diabetic patients can decrease the risk of vascular complications, which is one critical issue in the cure for patients. there is increasing evidence that diabetes is under the control of numerous cytokines and hormones. since leptin can influence diabetes [22, 33 ], we have measured the level of this mediator in serum of starved mice of both strains. however, we observed no change in its level. we observed that il-12 and ifn- levels were lower in nod hdc female mice compared with wt controls. these cytokines are known for promoting diabetes progression in the nod strain, possibly via induction of th1-type cytokines [34, 35 ]. by contrast, circulating il-6 or leptin did not differ between wt and ko mice, ruling out a major involvement of these factors in the delayed disease onset in hdc - deficient mice. even though we detected hematopoietic anomalies in the myeloid population of hdc mice, these cells were not involved in the protective response, as demonstrated by adoptive transfer. although neutrophils express the same markers as imcs, the protection against diabetes in hdc - deficient mice can not be ascribed to an increase of this population among the cd11bgr-1 subset since neutrophil depletion has been shown to inhibit type-1 diabetes development in nod mice. furthermore, the expansion of imcs is not concomitant with mdscs since the two populations bear different markers and most mdscs do not express ly6 g. furthermore, we found that the proportion of regulatory myeloid cells was not modified comparing both strains. finally, the increased histamine levels associated with the pathogenesis of diabetes are expected to be a consequence rather than a cause of disease. therefore, adding exogenous histamine may act on the gastric mucosa to enhance the flow of the lipidic factors but will be unable to reverse the phenotype observed in hdc - deficient mice. indeed, we observed the opposite effect. we describe a new immunomodulatory function of histamine in our model since diabetes onset is delayed in both wild - type and hdc mice after treatment. for example, the role of the h3r on food intake has been well documented. since it has been previously established that h4r drives inflammatory responses in asthma, dermatitis, arthritis, and colitis [29, 30, 37 ], we hypothesized that its agonists could reproduce the effects of histamine. this was not the case in this study, but even though we could not validate the h4r pathway using the agonists cb or 4-mh, we can not exclude that the dose, the route of administration, or the choice of the agonists tested was inadequate. alternatively, a mixture of h2r and h4r agonists may be required to obtain a protective effect similar to the one induced by histamine. histamine, which is increased in inflammatory and pathological situations, has also been shown to decrease, in vitro, the production of il-12p70 of monocyte - derived dendritic cells (dcs) via h2r and h4r [17, 19, 38 ] and to inhibit il-27 production in activated apcs. the regulation of cytokine production in maturing dcs causes an alteration of the t cell polarization that has been well described [15, 40, 41 ]. more recently, it has been reported that histamine decreases the migration of human pdcs and their cytokine production, while increasing regulatory t cell recruitment. in histamine - treated nod mice, we observed that pdcs from pancreatic lymph nodes expressed lower levels of costimulatory and mhc - ii and cd86 molecules than their counterpart from control mice, consistent with a decreased inflammatory state. contrary to our anticipations, injection of histamine did not promote diabetes pathogenesis but, paradoxically, decreased disease onset. the immunomodulatory function of histamine has been described in other inflammatory models and histamine is used therapeutically in patients suffering from acute myeloid leukemia. histamine release can be induced by different stimuli, such as cytokines or microbial stimulation. it has been previously shown that human basophils release histamine in response to a toll - like receptor 2 (tlr2) agonist. interestingly, tlr2 agonists have also been implicated in the modulation of t1d in the nod mouse. similarly, parasites such as schistosoma mansoni protect nod mice and parasites stimulate basophils and induce histamine release. these results support our hypothesis that local histamine release upon stimulation of immune cells, such as basophils, may participate in immunoregulatory pathways in autoimmune diabetes. | recent evidence has highlighted the role of histamine in inflammation. since this monoamine has also been strongly implicated in the pathogenesis of type-1 diabetes, we assessed its effect in the nonobese diabetic (nod) mouse model. to this end, we used mice (inactivated) knocked out for the gene encoding histidine decarboxylase, the unique histamine - forming enzyme, backcrossed on a nod genetic background. we found that the lack of endogenous histamine in nod hdc/ mice decreased the incidence of diabetes in relation to their wild - type counterpart. whereas the proportion of regulatory t and myeloid - derived suppressive cells was similar in both strains, histamine deficiency was associated with increased levels of immature macrophages, as compared with wild - type nod mice. concerning the cytokine pattern, we found a decrease in circulating il-12 and ifn- in hdc/ mice, while il-6 or leptin remained unchanged, suggesting that histamine primarily modulates the inflammatory environment. paradoxically, exogenous histamine given to nod hdc/ mice provided also protection against t1d. our study supports the notion that histamine is involved in the pathogenesis of diabetes, thus providing additional evidence for its role in the regulation of the immune response. |
the electronic structure of cdse / cds core / shell seeded nanorods of experimentally relevant size is studied using a combination of molecular dynamics and semiempirical pseudopotential techniques with the aim to address the transition from type - i to a quasi - type - ii band alignment. the hole is found to be localized in the core region regardless of its size. the overlap of the electron density with the core region depends markedly on the size of the cdse core. for small cores, we observe little overlap, consistent with type - ii behavior. for large cores, significant core - overlap of a number of excitonic states can lead to type - i behavior. when electron hole interactions are taken into account, the core - overlap is further increased. our calculations indicate that the observed transition from type - ii to type - i is largely due to simple volume effects and not to band alignment. |
|
in the last century many products such as medicines, disinfectants, laundry detergents, paints, surfactants, pesticides, dyes, preservatives, personal care products, and food additives have been found to be threatening to human as well as the environment [1, 2 ]. various industries like fuel production units, atomic energy stations, electroplating and fertilizer industry, leather and electrical appliance manufactory, and iron enterprises generate enormous wastes containing large amount of toxic heavy metals discarded into the environment resulting in ecological imbalance. the pollutants and decaying organic matter in waste water take up the dissolved oxygen and excessive nutrients like phosphorus and nitrogen cause eutrophication which promotes excessive plant growth and reduces available oxygen in the water body. bacteria, viruses, and disease - causing pathogens also pollute beaches and contaminate shellfish populations, leading to restrictions on human recreation and drinking water consumption. metabolism dependent and independent processes can also result in the accumulation of large amount of metals and trigger the free radical response leading to oxidative stress. the removal of metals or nonmetals and tiny particulates from a solution by means of any biological component is known as biosorption. cellular products and living and nonliving biomass can be used for effective adsorption, but their cost - effectiveness and reusability factor still remains under question. there are various physical, chemical, and biological methods to remove metal ions from aqueous solutions. some of the conventional techniques like filtration, membrane technology, and ion exchange are very expensive and chemical precipitation and electrochemical treatment prove to be ineffective especially when the concentration of metal ion is 1100 mg / l. many biological materials have high eradication rate in decreasing the concentration of heavy metals from ppm to ppb level. few types of biosorbents bind onto heavy metals with no specific priority, whereas others are specific for certain types of metals [7, 8 ]. this is one of the major reasons that research and studies on biosorption have become one of the most active work areas. in particular the low cost biosorbents obtained from agricultural and animal wastes but the selection of biosorbent for a specific metal is a challenge and merely a hit and trial method, resulting from a series of experiments and in - depth research. we have attempted to carry out relevant researches on biosorption phenomena for the effective removal of metal ions using various agricultural wastes and to provide a summary of available information on a wide range of biosorbents through this paper as shown in figure 1. a separation where in certain fluid elements transfer of molecules from bulk solution to solid surface occurs based on concentration gradient. here when a solid surface is exposed to a fluid phase, the molecules from the fluid phase accumulate or concentrate at the surface of a solid. the process is referred to as desorption if the mass transfer takes place in opposite direction. highly porous materials are chosen as adsorbents, and adsorption occurs mostly on the pore walls or at particular sites within the particle. difference in shape, molecular weight, or polarity makes the molecule stronger on the surface of other materials which makes separation easier. adsorption can be carried out as batch, semibatch, and continuous processes. when little quantities are to be treated, batch processes are generally carried out and the equilibrium distribution depends on the contact time in batch process. heavy metals in waste water include cd, cu, zn, cr, and ni and most of the companies fail to solve the problems caused due to these discharge, as they lack proper technical knowledge and economic capabilities. the concentration of various heavy metals in waste water ranges from 10 ppm to 100 ppm. adsorbate and adsorbent experience certain attractive forces which bind them and these forces can be due to van der waals forces which are weak in nature or they may be due to chemical bonds which are strong in nature. on the basis of attraction and the strength of force prevailing between adsorbate and adsorbent, also known as physisorption, it occurs when the attractive forces present between adsorbate and adsorbent are weak like van der waals forces as in figure 2. it has low enthalpy of adsorption (i.e., hadsorption = 20 to 40 kj / mol) and occurs with development of multilayer of adsorbate on adsorbent. this phenomenon decreases with an increase in temperature and usually takes place at a lower temperature which is generally much below the boiling point of the adsorbate. (2) chemical adsorption. also known as chemisorption, it occurs when the attractive forces between the adsorbate and adsorbent are chemical forces of attraction or via chemical bond as in figure 3. here only a single layer formation of the adsorbate on adsorbent takes place and it has a high enthalpy of adsorption (i.e., hadsorption = 200 to 400 kj / mol). this phenomenon first increases and then decreases with a rise in temperature. over the past 20 years there has been an exponential growth in the world 's population. this has led to the environmental buildup of waste products, among which heavy metals are of major concern. heavy metals can be biodegradable which are being added to soil, water, and air in escalating amounts as well as nonbiodegradable. some metals like zinc, magnesium, and copper are required for animal and plant life as micronutrients but the same would become more hazardous if they are taken up by plants or animals in large amounts. the various factors on which the adsorption process depends are as follows. as the temperature increases, the adsorption capacity is found to decrease and vice versa. as ph increases from 7.0 to 7.5, the retention capacity of the adsorbing surface increased significantly, whereas in lower ph the adsorption process was affected. with increase in pressure, adsorption increases up to a certain extent till saturation level is reached but after that no more adsorption takes place no matter how high the pressure is. to provide higher number of vacant sites on surface of adsorbent, this can be done by breaking solid crystal in small pieces, heating charcoal at high temperature, breaking lump of solid into powder, or other methods suitable for particular adsorbent. thus for any big molecule with a higher surface area, the adsorption efficiency will increase. as we know, volume of an ideal gas at stp = 22.4 l = 22.4 dm and the number of gaseous molecules present at stp = 6.02310 molecules. let us assume that vmono is the adsorbed volume of gas at high pressure conditions so as to cover the surface with a uniform layer of gaseous molecules. then assuming the total number of adsorbed gas molecules as n corresponding to volume vmono, it can be given as(1)n the technologies which are being used at present for removal of metal ion from waste water are very expensive. they include ion exchange resin, solvent extraction, electrolytic and precipitation processes, electrodialysis, and membrane technology. these processes are, however, not economically feasible for small scale industries prevalent in developing economies due to large capital investment. the most widely used method for removing heavy metals from waste water is by precipitation process but it results in the production of sludge containing high levels of heavy metals. hence to purify the effluent prior to discharge there is a need for additional treatments like ion exchange, reverse osmosis, or adsorption process. the technologies are divided into three types, namely, physical, chemical, and biological. the physical and chemical processes form the principal method of waste water treatment in industries. since proper design of the adsorption process will create high quality treated effluents, adsorption process can be regarded as the best method for heavy metal removal from effluents. to achieve the desired water quality in the most economical way, processes of different combinations were used. electroflotation, electrokinetic coagulation, coagulation combined with flotation and filtration, conventional oxidation methods by oxidizing agents, irradiation, and electrochemical processes are the techniques which fall under chemical methods. even though these methods are efficient for removing the contaminants from waste water, they are commercially unattractive and very expensive. some of the common problems are high electrical energy demand and consumption of chemical reagents. new separation methods are necessary to reduce heavy metal concentrations to environmentally tolerable levels at reasonable cost because most conventional methods are neither effective nor economical, especially when used for the reduction of heavy metal ions to low concentrations. the accumulation and concentration of heavy metals from aqueous solutions using biological materials is known as bioremoval as shown in figure 2. many studies were done for the removal of heavy metals from solution by utilizing different agricultural products and byproducts. several studies showed the efficacy of many organic waste components as sorbents for heavy metals [4547 ]. if the adsorbent is inexpensive and does not require an additional pretreatment step before application, this process provides an outstanding alternative for treatment of contaminated water. but biological method is not favorable as it requires large area and has less design flexibility and lesser modes of operation and is constrained by sensitivity towards diurnal variation including certain chemical toxicity. in contrast to other techniques adsorption has originated to be superior for water reuse in terms of primary cost, elasticity and straightforwardness of design, ease of operation, and insensitivity to toxic pollutants and there is no production of dangerous materials. other than the above listed methods, the one method which is from the nature itself which would not just remove the metal ions but is also an example of effective usage of biowaste is bioadsorption, that is, the adsorption of any constituents, like metals, onto the surface of biological components. selecting the most capable types of biomass from an enormously huge pool of readily accessible and cheap biomaterials full scale biosorption process requires the biological materials which have high metal binding capabilities and specific heavy metal selectivity. it may involve one process or a blend of processes like adsorption, electrostatic interaction, chelation, microprecipitation, and ion exchange [3, 51, 52 ]. these biomasses have been tested and reported to bind a variety of heavy metals to different extents. microbial biosorption is another aspect under this which is carried out by different organisms like bacteria, fungus, and algae. nearly 50 microbial strains of microorganisms, capable of degrading xenobiotics, have been isolated, such as pseudomonas, mycobacterium, alcaligenes, and nocardia. microbial degradation of heavy metals assumes significance, since it provides an effective and economic means of disposing of toxic chemicals, particularly the environmental pollutants (figure 4). wheat bran acts as an efficient adsorbent for the heavy metal ions removal such as pb(ii), cu(ii), and cd(ii). another study stated that significant adsorption in copper ions could be achieved by pretreatment with strong dehydrating agent like sulphuric acid (h2so4) as the micropores and macropores conversion leads to increase in adsorption. the maximum capacity achieved for 30 min was 51.5 mg / l (at ph 5) for cu(ii) ions. this method when used for lead ions showed maximum removal up to 82.8% at ph 6 after 2 h of equilibrium time and for cadmium ions 101 mg / l at ph 5, efficient adsorption was seen at a contact time of 4 hrs. langmuir, freundlich, and redlich - peterson isotherm models were used to determine the adsorption capacity of wheat bran out of which redlich - peterson was found to be the best fitted model for adsorption. one of the agricultural wastes generated especially in rice producing countries, like asia, is rice husk. around 500 million metric tons of rice dry rice husk consists of 70 to 85% of organic matter, mainly sugars, lignin, cellulose, and so forth. it contains cellulose (32.24%), hemicelluloses (21.34%), lignin (21.44%), and mineral ash (15.05%) as well as high percentage of silica in its mineral ash, which is approximately 96.34% [55, 56 ]. rice husk is chemically stable, has high mechanical strength, and is insoluble in water which makes it one of the best adsorbents for heavy metal removal. the removal of heavy metals such as cd, pb, zn, cu, co, ni, and au from rice husk was also studied. either modified or unmodified rice husk can be used for the treatment of heavy metals. rice husk can be modified using hydrochloric acid or sodium carbonate or by sodium hydroxide or treated with epichlorohydrin. pretreating rice husks helped in reducing cellulose crystallinity and rise in surface area or porosity and in removal of lignin and hemicelluloses by which adsorption capacity on heavy metals increased. rice husk when treated with sodium carbonate and sodium carbonate or hydrochloric acid enhanced the cadmium adsorption capacity. an adsorption site on the rice husk surface was protonated when it was treated with hcl and hence the heavy metals were left in the aqueous solution itself. the base soluble materials on rice husk were removed through naoh treatment which also doubled the rate of cadmium adsorption (i.e., 7 mg / l) when compared to the rice husk adsorption of 4 some studies revealed that high reaction rate and improved cellulose hydrolysis can be achieved through pretreatment using dilute sulphuric acid. cellulose hydrolysis can be achieved through concentrated acids but they are corrosive and toxic, so they need to be recovered. another study showed the adsorption of copper and lead on rice husk modified using acids like citric acid, salicylic acid, tartaric acid, oxalic acid, mandelic acid, malic acid, and nitrilotriacetic acid. among these the effect of chelators on lead was also investigated which showed that when there was an increase in molar ratios of chelators like ethylenediaminetetraacetic acid and nitrilotriacetic acid there was a considerable raise in the adsorption of lead. parameters like ph, initial concentration of adsorbent, particle size, and temperature affected the adsorption efficiency and it was found that modified rice husk had maximum capacity to adsorb copper and lead from aqueous solutions mainly when the ph was around 2 - 3. rice husk treated with phosphate adsorbed maximum nickel and cadmium, whereas at a ph of 12, there was 90% adsorption of chromium when rice husk carbon was used as adsorbent. this was done by carbonizing rice husk with sulphuric acid and then activating it by co2 activation. rice husk showed 8.9 mg / g adsorption and commercial carbon showed 6.3 mg / g for chromium removal when column studies were done. another study using some of the dyes, procion red or procion yellow, showed that procion red dye treated rice husk removed 99.2% cadmium and 99.8% lead. procion yellow dye treated husk adsorbed 100% lead and 93.3% mercury. when waste water containing heavy metals was treated with rice husk it showed 79% chromium, 85% zinc, 80% copper, and 85% cadmium ions adsorption on the rice husk. another study with green algae as adsorbents resulted in 90% removal of heavy metals like sr, cd, ni, pb, zn, co, cr, and as but could remove only 80% nickel. microporous and mesoporous activated carbon forms of rice husk were considered for the adsorption of chromium. rice husk was classified into two types and could be used as adsorbents on small waste water treatment plants and found adsorption about 100% for many heavy metals such as iron, manganese, zinc, copper, cadmium, and lead. raw rice husk was utilized for the removal of cr(vi) and they concluded that an adsorbent dosage of 70 g / l for 2 hours at a ph 2 showed increase in the rate of adsorption and 66% of cr(vi) was removed. sugar refining industry produces waste called bagasse pitch where the residual cane pulp is left over after sugar has been extracted. they found that ionic strength was inversely proportional to the adsorption capacity and reported that adsorption of lead followed langmuir 's model and temperature greater than 30c worked best for cadmium removal. lignin which was carboxymethylated had the ability to adsorb more amount of lead compared to cadmium. temperature was found to be the most important as adsorption increased with increase in temperature. single and multicomponent cadmium and zinc adsorption was done by using activated carbon prepared from bagasse, where a ph greater than 8 gave 100% adsorption of cadmium and zinc. 0.8 g/50 ml of adsorbent was necessary to remove 80%100% of chromium at ph 1 but when they increased ph to 3, there was a decrease in adsorption efficacy by 15%. according to another study the removal of hexavalent chromium from waste water using bagasse and coconut jute required low ph for maximum adsorption. activated carbon obtained from jute had an adsorption efficiency of about 99.8% at ph 2. it was more stable at higher ph and hence it proved to be the most active adsorbent. the fruit / vegetable wastes like banana and orange peels were modified using acid and alkali solutions. the adsorption of cu2 +, zn2 +, co2 +, ni2 +, and pb2 + onto the modified fruit / vegetable wastes was studied lead was adsorbed to the maximum and cobalt to the least. banana showed an adsorption capacity of 7.97 (pb2 +), 6.88 (ni2 +), 5.80 (zn2 +), 4.75 (cu2 +), and 2.55 (co2 +) mg / l, when compared to orange peels which showed 7.75 (pb2 +), 6.01 (ni2 +), 5.25 (zn2 +), 3.65 (cu2 +), and 1.82 mg / l (co2 +). it was shown that adsorption capacity of acid treated peels was more efficient than alkali or water treated peels. saponified gels were prepared from orange peel constituents such as cellulose, hemicelluloses, pectin, limonene, and other lesser molecular weight compounds using ca(oh)2. two different types of saponified gels were prepared using ca form and h form and efficiency of both the saponified gels to remove heavy metals such as iron, lead, copper, zinc, cadmium, and manganese was analyzed. it was found that saponified gel prepared from ca can adsorb lead to the maximum compared to manganese and saponified gel prepared from h can adsorb metals in the order of lead > iron > copper > zinc > manganese. but in the case of fe it was not the same as it formed soluble complexes such as fe(oh), fe(oh)2, fe(oh)2, and fe(oh)4 at ph 3. significantly the study of both types of gels infers that they act as effective adsorbent in acidic solutions because of ion exchange mechanism. acid treated fruit wastes such as cornelian cherry, apricot stone, and almond shell were able to adsorb maximum cr(vi) at ph 1. they found out that the lower the concentration of metal ions, the higher the rate of adsorption. their studies also concluded that cornelian cherry required an equilibrium time of 20 h when chromium concentration was 53 mg / l but when the concentration was increased to 203 mg / l the equilibrium time also rose to 70 h. zncl2 treated olive stone showed maximum adsorption for cadmium and lead ions of about 85 mg / l, compared to untreated olive stone. citric acid treated orange peels showed maximum adsorption for cadmium. cadmium adsorption increases due to the interaction between cellulose present in orange peels and citric acid as a result of the formation of ester linkage and introduction of carboxylic group. adsorption and recovery of cadmium from orange peels increase, when they are treated with acids of high concentration. agricultural byproducts such as sugarcane, bagasse, peanut shells, macadamia, nut hulls, rice hulls, cottonseed hulls, corn cob, soybean hulls, almond shells, almond hulls, pecan shells, english walnut shells, and black walnut shells were also treated with citric acids to increase adsorption of copper. all these byproducts were treated with naoh and then with citric acid to increase adsorption of heavy metals. among all the byproducts, citric acid treated soya bean hulls showed maximum adsorption for copper whereas english walnut shells and black walnut shells showed least adsorption as they are high density materials and lignin present in them blocks the reactive sites to citric acid resulting in minimum adsorption of copper. another study reported that citric acid treated peanut shells showed maximum adsorption for metal ions such as copper, cadmium, nickel, zinc, and lead when compared to unmodified peanut shells. peanut shells were treated with naoh first and then with citric acid to obtain more active binding sites for metal adsorption. vegetable wastes such as carrot residues were treated with hcl to eliminate the tannins, resins, reducing sugars, and colored materials which in turn increase its capacity to remove metal ions such as chromium, copper, and zinc. kinetic study revealed that 70% of metal ions were adsorbed within 10 min and maximum adsorption of chromium (45.09 mg / l), copper (32.74 mg / l), and zinc (29.61 mg / l) was seen at higher ph values of 4 for chromium and 5 for both zinc and copper ions. copper ions were considered as typical metal ion for studying the adsorption of soybean hulls. 0.1 n naoh was used to extract the hulls, and then it was modified at 120c for 90 minutes using citric acid whose concentration ranged from 0.1 m to 1.2 m. unmodified hulls showed an adsorption capacity of 0.39 m moles / g whereas citric acid modified hulls had an adsorption capacity of 0.68 to 2.44 m moles / g. soya bean hulls when treated with naoh and modified with 0.6 m citric acid could remove about 1.7 m moles of copper ions. reaction with citric acid showed an increase in carboxyl group on the hulls which in turn resulted in an increased uptake of copper ions. on the basis of dry weight, soya bean consisted of 109, 10.0, 36.4, 49.1, 676, 137, and < 10 (mg / g) of protein, lipid ash, lignin, cellulose, hemicelluloses, and silica, respectively. soya bean and cottonseed hulls had higher adsorption efficacy when treated with naoh and hcl when compared to water washed hulls. when cotton seeds and soya bean hulls were heat treated they showed lower adsorption properties than water washed hulls. when the hulls were reprocessed after one adsorption / desorption cycle there was a decrease in adsorption capacity and so hulls were regarded as single use adsorbents. corncobs were initially activated by high temperature carbonization but a certain study revealed that corncobs can also be activated by chemical methods using acids for copper adsorption. corncobs were treated with acids containing functional groups such as -oh, -cooh, and -coo at 150c which reduced the ph from 5.2 to 2.7 and a maximum adsorption of copper (31.45 mg the copper adsorption by corncobs decreased to 53%, 27%, and 19% in presence of interfering ions like pb(ii), ca(ii), and zn(ii), respectively. hydrogen peroxide can be used to regenerate those acid treated corncobs and almost 90% of copper can be recovered. hydrochloric acid treated barks mainly sal (shorea robusta), mango (mangifera indica), and jackfruit (artocarpus integrifolia) were used in removal of copper from aqueous solutions. the advantage of pretreating the barks was the overcome of those organic compounds which gave color to metal ion containing solution. sal bark, mango, and jackfruit showed an adsorption capacity of 51.4 mg it was found that azadirachta indica bark (neem bark) has maximum adsorption capacity towards iron metal ions. the bark has different functional groups at the surface of adsorption site which makes it an efficient adsorbent for iron. maximum adsorption was seen within 30 minutes of contact time and later the reaction slowed down as it approached to steady state. when neem and babool tree barks were kept in solution containing many metal ions, 8090% of chromium, cadmium, and manganese were adsorbed within a contact period of 10 minutes at ph 2. the eucalyptus bark removed 99% of chromium(vi) and neem bark removed zinc metal ion within an equilibrium adsorption time of 35 minutes. due to less number of active adsorbent sites, the adsorption decreases as the contact time attains steady state and hence the removal of metal ions using neem bark acts as a low cost method for the treatment of toxic water containing iron metal ion. the ability of activated carbon prepared from almond shell to eradicate iron present in the synthetic solution proved that the ability of activated carbon to remove iron was very high. in this study the contact time was kept around 20 minutes and it was observed that there was an increase in iron uptake. later when the contact time was increased above 20 minutes, there was no change in the percentage uptake of iron. adsorption of iron present in synthetic water onto almond shells increased as the ph increased from 1 to 9. but iron removal was found to be highest at a ph value of 5 for almond shells. peanut shell biomasses were used for the study of biosorption of chromium ions and copper ions from aqueous solutions. biosorption was studied as a function of temperature, ph, and initial concentration of the biomass. these studies revealed that affinity of peanut shell towards cu(ii) and cr(iii) ions was very high. the adsorption capacity of copper and chromium was found to be 25.39 mg and 27.86 mg per gram of peanut shell biomass, respectively. these results proved that peanut shell can be used as an efficient low cost bioadsorbent for removing heavy metals in waste water. results of batch experiments showed an adsorptive capacity of 87.72 mg / g for peanut shells. to study the adsorption equilibrium of peanut shells langmuir isotherm model and freundlich isotherm model coconut shell is a byproduct which is composed of 3545% and 2343% of lignin and cellulose, respectively. it acts as a strong potential adsorbent for metal ion adsorption and also cellulose contains carboxylic and phenolic acids which are polar functional groups which help in metal binding [96, 97 ]. at lower to higher range of metal concentrations (201000 mg / l), the study was concluded for the best adsorption of cadmium metal ion at a ph value of 7. the adsorption data for cadmium ion obtained was studied using isotherm models such as freundlich and langmuir adsorption models at 27c. tamarind pod shells can be economically recycled for the treatment of water containing chromium metal ions. the shells were washed with distilled water in order to remove the dirt and other coloring substances by boiling the pod shells at 105c. the rate of adsorption for different concentrations of cr(vi) metal ions was done by varying the factors like agitation time, adsorbent dosage, and ph. there was maximum adsorption of chromium onto the tamarind shells at ph 2 whereas the rate of adsorption decreased as the ph value increased. equilibrium time for adsorption was considered using different concentrations of chromium metal ion solution and the time attained was about 60 minutes. binding of metal ion to shells must be possibly by chemisorptions or ion exchange which was inferred during the desorption studies of metal ion. the waste egg shells were calcinated in the pretreatment process for effective adsorption of heavy metals. these calcined egg shells were used in the removal of heavy metals from waste water. there was 100% adsorption of cadmium and 99% adsorption of chromium for a contact time of about 10 minutes. even natural egg shell can be used as adsorbent but it is more efficient for the removal of lead compared to cadmium and chromium. there was less adsorption of cadmium and chromium even when the contact time was increased to 60 min as the rate of reaction was slow for natural egg shell. cadmium and chromium showed a rapid adsorption rate, when the ph was raised from 6.55 to 12.0 within the contact time of 20 s. calcined egg shell can be used to treat heavy metals found in the electroplating waste water. silverleaf nightshade (solanum elaeagnifolium) was used as a biosorbent by base modification using naoh for the removal of metal ions such as lead, copper, nickel, cadmium, zinc, and chromium by means of batch experiments studies. the adsorption capability of silverleaf nightshade for lead, copper, nickel, cadmium, zinc, and chromium(iii) was determined by considering the parameters such as ph, equilibrium time, and metal binding capacity. at ph 5 within a time period of 10 to 15 minutes and at ph 2 there was optimal adsorption of chromium(vi). when solanum elaeagnifolium was base treated the concentrations of metal ions adsorbed were 20.6 mg / g, 13.1 mg / g, 6.5 mg / g, 18.9 mg / g, 7.0 mg / g, 208 mg / g, and 2.2 mg / g of lead(ii), copper(ii), nickel(ii), cadmium(ii), zinc(ii), chromium(iii), and chromium(vi), respectively. this indicates that silverleaf nightshade can be used in treating the waste water containing toxic metal ions and it is cost - effective when compared to other methods implied previously. the banana peels were cut, washed, dried, and then grounded into powder for using it as a bioadsorbent. some of the parameters like particle size, ph, temperature, and agitation speed, and contact time were studied to check the efficiency of copper adsorption onto banana peel. a ph of 6 was found to be optimum for the removal of copper ions. studies also showed that one gram of banana peel can remove 7.97 mg of lead ions at a ph of 5.5. lead and cadmium adsorption capability of light expanded clay aggregate at different ph, contact time, and adsorbent concentration was studied. the effluents from paint industry are rich in lead and cadmium so those effluents were considered to perform batch studies. the adsorption was analyzed by varying the amount of leca in the range of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 g / l of leca at a ph of 7 and that for cadmium at the same conditions was 89.7%. the experimental data agreed well with freundlich adsorption isotherm and the appropriate contact time was 1 to 2 hours. thus leca can be used as a low cost adsorbent for treatment of heavy metals especially lead and cadmium from industrial waste water. the current methods of removing heavy metals are very costly so there is need for low cost adsorbent for the removal of metals like copper ions present in the aqueous solutions. the effect of ph, mixing rate, contact time, and adsorbate concentration was analyzed using batch studies to examine the rate of adsorption of copper ions on papaya seeds. the adsorption kinetic data were estimated by second - order and pseudo - first - order kinetics and the data fitted langmuir and freundlich isotherms very well. the maximum rate of adsorption of copper was seen when the ph was maintained at 6 and solution stirred at 350 rpm. chemisorptions process was denoted as the rate limiting step in the process of adsorption and it was found out by using the pseudo - second - order kinetic model as the data correlated well with this model. finally these studies proved that papaya seed can be used as an effective adsorbent for the removal of heavy metals such as copper ions, from waste water. studies showed that black tea waste can be used to remove heavy metals like zinc, cadmium, and cobalt from waste water. an optimum ph of 6 is chosen for maximum adsorption of cobalt, cadmium, and zinc. around 13.77 mg / g of cd, 15.39 mg / g of co, and 12.24 mg / g of zn were adsorbed when only half gram of black tea waste was used. hence tea waste can be used as one of the best and efficient adsorbents for waste water treatment. the spent coffee grounds produced by instant coffee industry as a waste can be economically reused for the adsorption of toxic metal ions like copper, zinc, cadmium, and lead. the study was conducted with the aid of batch adsorption method in order to study the effect of parameters such as ph, metal ion concentration, adsorbent concentration, and temperature on metal adsorption. the best suited isotherm model was langmuir adsorption isotherm in which the data was well fitted. adsorption of metal ions to coffee residues was disturbed by flocculation at the adsorption site due to high density. so the formation of solid flocculent was treated by dispersant which showed increase in the maximum adsorption of metal ions. using dilute acid solution the adsorption property was well maintained from the loss of change in the sites in column adsorption studies. it was reported that coffee grounds could remove the metal ions at the level of gl. using potentiometric titration the acid base chemistry and stoichiometry of h ion were studied for tea leaves and coffee grounds. hence the study concluded that tea and coffee residues can be used to remove trace metal ions from water. table 1 shows the specific metal adsorption capacity of various agricultural wastes where several authors evaluated the adsorption efficiency for various heavy metals by using different isotherm models which shows the interaction pattern between the adsorbate and adsorbent. an increase in temperature led to a decrease in the amount of metal adsorbed, regardless of the residue employed for adsorption process. the activation procedure was the same for many adsorbents but the coir fibers showed higher adsorption capacity (263 mg / g), followed by dal husk (96.05 mg / g), wheat bran (69 mg / g), pumpkin waste (68 mg / g), and coffee waste (63 mg / g). the least adsorption was shown by peanut hull (0.180.21 mg / g), grape bagasse (0.428 mg / g), walnut shell (1.33 mg / g), nut shell (1.47 mg / g), and exhausted coffee (1.42 mg / g). the surface area of any adsorbent is the deciding factor for its efficiency ; that is, the higher the surface area, the higher the adsorption. phosphate treated saw dust showed an increased adsorption of chromium when compared to the unmodified one. ajmal., 1996, also reported that the adsorption of chromium depends on ph. a ph value of 2 and less than that was shown to be optimum for maximum removal of chromium from aqueous solution. synthetic waste water and electroplating waste water containing about 50 mg / l of chromium were used in column process as well as in batch studies and these adsorbents showed 100% adsorption of chromium. activated carbon prepared from coconut tree saw dust was used to study the removal of chromium from aqueous solution through batch experiments. initial cr(vi) concentration, carbon concentration, agitation time, and ph were the factors considered to study the adsorption process and the data was modeled using langmuir and freundlich adsorption isotherms. at an initial ph of 3.0 the adsorption capacity of the adsorbents with a particle size 125250 m was found to be 3.46 mg / g using langmuir isotherm. low cost adsorbents such as those discussed above are strongly recommended in industries for waste water treatment applications due to their local obtainability, technical viability, and engineering applicability. but before fermentation, acid - hydrolyzation of the agricultural wastes is done by breaking down the cellulose and lignin to produce bioethanol using microbes. other methods by which the biowastes could be treated are vacuum distillation, hydrotreatment, solvent extraction, thin film evaporation, and so forth. the contaminants can also be removed by using the right combination of heat and pressure at ambient conditions. in composting, enormous amount of readily organic matter which can be easily degraded is added to a contaminant that is further tailed by an aerobic incubation at a temperature ranging from 20 to 60c. this becomes slightly labour intensive as the carbon and nitrogen ratios need to be adjusted frequently. this helps in converting the waste organic matter of used leaves, shells, husks, and peels to useful soil modifications by employing aerobic and anaerobic microbes which promotes the growth of certain bacteria, fungi, and actinomycetes. land farming is another alternative method where the contaminated agricultural wastes or soil can be spread on fields to plow and fertilize the agricultural land which can be later redeveloped cost - effectively by planting heavy metal tolerant weeds and by using certain phytochelators. heavy metals can also be precipitated as sulfates, carbonates, or hydroxide sulfides from the waste soil and water. this can also help in cleaning up of aquifers that are contaminated by solvents such as trichloroethylene which can be degraded only by cometabolic processes using enzymes. but some approaches can be costly which can be managed well by development of protein hydrolysates and by using activated carbon along with the agricultural wastes. the latest development in the green technology is biosorption of heavy metals by nonliving biomass of aquatic plant species such as hydrilla verticillata, salvinia herzogii, potamogeton lucens, eichhornia crassipes, ceratophyllum demersum, and ludwigia stolonifera. these metals act as feed which is taken up for the microbial growth, metabolism, and living. the microbes release these heavy metals after a long time, but in a very lower concentration when compared to what they had initially absorbed. the absorption of the toxic substances such as a metal is at a rate faster than that at which the substance is lost by catabolism and excretion. other biological treatments using mixed microbial cultures and white rot fungi for decolorization of dyes are also common [108111 ]. the existing technologies for waste water treatment have major problems such as costs involved in the construction of waste water treatment plants which are high ; that is, they are uneconomical, consume lot of space, are commercially unattractive, and have disposal problems. reports suggest that there is a bulk production of chemicals from various waste water treatment plants and requirement for a high electrical energy input. handling of the dry sludge also becomes difficult and as well nature capacity to treat water remains unutilized. so there was a need for some alternative method which can overcome all these problems and treat the waste water in an appropriate way. thus making use of bioadsorbents is an effective method to adsorb toxic heavy metals from effluents not polluting the ground water and at the same time utilizing the discarded open waste in the environment for a useful purpose of waste water treatment. this method not only requires minimal energy input, less labour, and low investment, but also proves to be cost - effective, but additional information about the pore size distribution of adsorbent, molecular size of metal ions, functional groups present on surface of adsorbent, initial ph, temperature, particle size of adsorbent, and so forth are critical details which influence the efficiency of adsorption processes. several waste reduction programs should be held to reuse and recycle the wastes with an aim of zero waste production. | industrialization and urbanization have led to the release of increasing amounts of heavy metals into the environment. metal ion contamination of drinking water and waste water is a serious ongoing problem especially with high toxic metals such as lead and cadmium and less toxic metals such as copper and zinc. several biological materials have attracted many researchers and scientists as they offer both cheap and effective removal of heavy metals from waste water. therefore it is urgent to study and explore all possible sources of agrobased inexpensive adsorbents for their feasibility in the removal of heavy metals. the objective was to study inexpensive adsorbents like various agricultural wastes such as sugarcane bagasse, rice husk, oil palm shell, coconut shell, and coconut husk in eliminating heavy metals from waste water and their utilization possibilities based on our research and literature survey. it also shows the significance of developing and evaluating new potential biosorbents in the near future with higher adsorption capacity and greater reusable options. |
the glomerular capillary wall acts as a glomerular filtration barrier (gfb) and includes 3 components : fenestrated glomerular endothelium, glomerular basement membrane (gbm), and podocytes with processes bridged by slit diaphragms. the effects of the gbm and podocytes on the permselective properties of the gfb have attracted much interest in recent years ; however, the contribution of the endothelium has received less attention. because the fenestrae of glomerular endothelial cells are approximately 60 nm diameter without the diaphragm and albumin has a diameter of only 3.6 nm, the endothelium is thought to contribute little to the protein barrier function of the glomerular capillary wall. recently, several lines of evidence have suggested that there is a 200- to 400-nm - thick membrane - like layer covering the luminal surface of the glomerular endothelium ; this is called the endothelial cell surface layer (esl) [3, 4 ]. the esl is a hydrated, gel - like structure that includes 2 components : the glycocalyx, which is connected to the endothelium with several backbone molecules, mainly proteoglycans and glycoproteins, and the endothelial cell coat, which is attached to the glycocalyx and is composed of secreted proteoglycans, glycosaminoglycans, glycoproteins, and plasma proteins [1, 5, 6 ]. many studies have shown that the esl also plays an important role in the permeability barrier (including the gfb) [7, 8 ]. patients with preeclampsia or hemolytic uremic syndrome have albuminuria, and their glomerular endothelia are injured [9, 10 ]. additionally, jeansson and haraldsson showed that infusion enzymes, which digest glycosaminoglycans, decrease the thickness of the esl and promote increased flux of albumin across the glomerular capillary barrier [11, 12 ]. singh. demonstrated that treatment with heparanase on the human glomerular endothelial cell glycocalyx in vitro removed the majority of the glycocalyx and increased the passage of albumin across the cell monolayer. these studies suggested that injuries to the glomerular esl increased the flux of albumin across the gfb and caused proteinuria, indicating the importance of the esl in glomerular permselectivity. microalbuminuria has emerged as an important risk factor for the development of cardiovascular disease and a marker of diabetic nephropathy. however, studies have shown that endothelial dysfunction is present well before the onset of microalbuminuria in type 1 diabetes. additionally, reduced systemic glycocalyx volume is inversely correlated with the albumin - to - creatinine ratio in type 1 diabetes [15, 16 ]. high glucose reduces the biosynthesis of glycosaminoglycan in the glomerular endothelial cell glycocalyx and increases the passage of albumin across endothelial cell monolayers. studies have shown that hyperglycemia leads to reduced charge - selectivity and proteinuria, altering the composition of the glomerular barrier. however, to fully elucidate the mechanisms involved in these processes, we must first determine whether esl plays a role in the protein barrier function of the gfb in vivo. in this study, we investigated the passage of albumin across the glomerular barrier, especially the glomerular esl and gbm, using electron microscopy. we also examined changes in the 2 layers of the gfb in early diabetic rats. the experimental protocol was approved by the animal ethics review committee of shanghai institutes for biological sciences in the chinese academy of sciences. male sprague - dawley rats were fed with a standard laboratory diet and were provided with water ad libitum. experimental rats, weighing approximately 200 g, received an intraperitoneal injection of streptozotocin (stz, sigma, st. louis, mo, usa, 60 mg / kg body wt) dissolved in 0.1 mol / l sodium citrate, ph 4.6. six days after the injection of stz, rats with blood glucose levels above 16.7 mmol / l were included in the diabetes group (n = 6). no rats died during the study, and no signs of apparent exhaustion were observed during the experimental period. five weeks after the injection of stz, individual 24-hour urine sample collections were performed using metabolic cages. albumin concentrations were determined using an enzyme - linked immunosorbent assay (elisa) kit (raybiotech, inc., the absorbance of each well of the elisa plate was measured using a microplate reader (spectramax plus384, molecular devices, usa) at 450 nm. the concentration of urinary albumin was calculated using a standard curve. at 4 weeks after the initiation of treatment, kidneys were removed, fixed in 10% buffered formalin, and embedded in paraffin. sections were stained with hematoxylin and eosin (he) for observation by light microscopy. ten glomeruli in the cortex were examined per animal under high magnification (400). the glomerular tuft area and mesangial matrix area were measured by manually tracing the glomerular tuft and mesangial matrix using image - pro plus software. the mesangial matrix index represented the ratio of mesangial matrix area divided by the tuft area. the kidney cortex was cut into 1 mm pieces and fixed in 0.5% glutaraldehyde/4% paraformaldehyde in 0.1 m phosphate buffer (ph 7.2) at 4c for 2 h. tissues were then rinsed in 0.1 m phosphate buffer. specimens were dehydrated in a graded series of ethanol (70%, 80%, and 95%). infiltration with lr white resin was carried out for 24 h, and tissues were embedded in gelatin capsules. polymerization of the resin was carried out by the addition of lr white accelerator at 20c for 5 days. ultrathin sections (5060 nm) were obtained with a lkb - i ultracut microtome and were collected on 200-mesh nickel support grids. thin sections were sequentially quenched for 1 h at room temperature (rt) in phosphate - buffered saline (pbs) containing 1% bovine serum albumin (bsa), incubated for 2 h at rt with anti - albumin antibodies (abcam ltd, usa) diluted 1 : 150 in a - pbs, and washed 3 times for 15 min each with pbs. sections were then incubated with gold - tagged (6 nm) anti - rabbit igg (abcam ltd.) diluted 1 : 20 in pbs and fixed for 10 min with 2.0% ga. after staining with uranyl acetate, the sections were examined under a hitachi h-7650 electron microscope operating at 80 kv. the specificity of each immunolabeling assay was assessed by various control experiments : incubation with gold - tagged (6 nm) anti - rabbit igg alone, omitting the antibody, and incubation with the antibody solution containing excess antigen, followed by analysis with the gold - tagged antibody. micrographs were obtained from 1020 sections of the gbm (a total length of 40 m) per rat. images (final magnification of 20,000) were scanned and analyzed using image - pro plus software. for each section of the gbm, the number of albumin particles was manually counted. beijing) was centrifuged for 10 min at 3000 rpm to obtain enriched floating lipid - particle fractions. then, 1.5 ml of each fraction was injected into the inferior caval vein by puncturing with a thin needle. the lipid emulsion was allowed to mix with the circulating blood for 10 min, and the kidneys were then removed and fixed in 2.5% glutaraldehyde in 0.1 m phosphate buffer (ph 7.2) for 2 h at 4c. all specimens were postfixed in 1% oso4 for 2 h at 4c and dehydrated through increasing concentrations of ethanol (50%, 70%, and 90%) for 20 min. ultrathin sections (5060 nm) were obtained with a lkb - i ultracut microtome and were collected on 200-mesh nickel support grids. sections were contrasted with lead citrate and uranyl acetate and examined under a hitachi h-7650 electron microscope. images (final magnification of 8,000) were scanned and analyzed using image - pro plus software. the capillary luminal area was divided into 2 regions : (1) the peripheral region defined as extending 200 nm from the luminal surface of the endothelium and (2) the central region. for each glomerular capillary, the areas of these 2 regions were calculated, and the number of lipid particles was manually counted. gbm thickness was measured in electron micrographs, where the thickness was defined as the distance between the podocyte process and the corresponding endothelial cell. to ensure proper cross - sectioning, a slit diaphragm between the processes had to be visible and a single layer of endothelial cells had to be present. student 's t tests were used to compare data between 2 groups. differences with p values of less than 0.05 plasma glucose concentrations were significantly higher in diabetic animals than in nondiabetic animals (23.9 2.8 mmol / l versus 3.67 0.64 mmol / l, resp.). body weight was significantly lower in the diabetic group than in the nondiabetic group (272 27.4 g versus 466 31.8 g, resp.). to evaluate glomerular hyperfiltration induced by hyperglycemia in diabetic rats, we measured 24-hour urinary albumin excretion (uae, figure 1) morphometric analysis of glomeruli revealed that hyperglycemia in diabetic rats significantly increased mesangial matrix accumulation (mesangial matrix area / glomerular tuft area) compared with that observed in control rats (figure 2). we next used albumin - colloid gold (a - cg) as a tracer to quantify changes in albumin transport. the permeability of a - cg was quantified as described in the methods section. as shown in figure 3, in control rats, the tracer was located mainly over the glomerular capillary lumen, and the gbm and podocytes were almost completely free of labeling. in diabetic rats, many more gold particles were observed in the gbm and podocytes than in control rats. lipid particles were easily recognized on the micrographs as spherical bodies of medium electron density, seemingly randomly distributed in the glomerular capillary lumen (figure 4). the lipid - particle density was significantly lower in the 200-nm periendothelial region than in the central region of the glomerular capillaries in control rats (see figure 5). compared with control rats, there were significantly more lipid particles in the 200-nm periendothelial region of the glomerular capillary lumen in diabetic rats (see figure 5, p < 0.01). the thickness of the gbm did not differ significantly between control and diabetic rats (146 2 nm versus 148 5 nm, respectively ; see figures 6(a)6(c)). in the present study, a diabetic rat model was induced by stz and changes in blood glucose, body weights, and glomerular filtration were analyzed. our results showed that blood glucose in diabetic rats was higher than that in control rats. additionally, the body weights of diabetic rats were lower than those of control rats. although diabetic rats exhibited significant weight loss, they failed to show any signs of apparent exhaustion during the experimental period. therefore, we chose to analyze diabetic rats at 4 weeks after stz induction in this study. to evaluate glomerular hyperfiltration induced by hyperglycemia in diabetic rats, we measured 24-hour urinary albumin excretion (uae). our results showed that the uae of diabetic rats was higher than that of control rats, indicating that hyperglycemia increased the glomerular filtration of diabetic rats at 4 weeks after injection of stz. the pathological features of diabetic nephropathy, as observed under a light microscope, include expansion of the mesangial region and extracellular matrix. our study showed similar changes in glomerular morphology in diabetic rats, indicating that hyperglycemia damaged the glomeruli at 4 weeks after stz. a popular hypothesis is that layers of the glomerular capillary wall must be viewed as an integrated ultrafilter, in which defects in any of the 3 glomerular layers may result in proteinuria. moreover, examination of glomeruli under an electron microscope showed that there were few histological changes in the endothelium and gbm between diabetic and control rats. quantitative analysis of the gbm revealed that differences in gbm thickness between diabetic and control rats were minimal. therefore, we believe that hyperglycemia may have caused minimal changes in the endothelium and gbm in diabetic rats. however, it seems unlikely that albuminuria may be caused by such minimal changes in the endothelium and gbm in diabetic rats. it is unclear whether glomerular esl injury caused albuminuria in diabetic rats and little direct in vivo evidence is available to confirm or refute this hypothesis. the esl is a complicated structure to study ; it is easily dehydrated or disrupted and hard to visualize. as previously shown, functional data indicate that the glomerular capillary wall has a fixed negative charge density of 3540 meq / l. thus, the lipid - particle exclusion zone could reflect electrostatic interactions with an assumed esl formed by a negatively charged polysaccharide - rich gel. concerning measurement of the thickness of glomerular esl, detection with electron microscopy after injection of intralipid into kidney blood vessels had little influence on esl and can better show the real thickness of esl among all the detection approaches. therefore, we measured the thickness of the glomerular esl indirectly using electron microscopy after injection of intralipid into the veins of our experimental rats. our results showed that the frequency of intralipid droplets found 0200 nm from the endothelial cell membrane increased significantly in diabetic rats compared with control rats. these data indicated that the esl was injured in diabetic rats and that more intralipid droplets entered regions covered by glycocalyx. excessive generation of reactive oxygen species (ros) is central to the pathogenesis of diabetic nephropathy. a recent study showed that ros directly alters the critical components of the glomerular endothelial cell glycocalyx and that these changes have implications in the barrier function of this region, affecting the passage of albumin in vitro. finally, we also measured endogenous albumin passage across the gfb by immune electron microscopy. we found a significant increase in albumin entry into the gbm through the esl and endothelial cells in diabetic rats, indicating that the permeability of the esl increased. thus, we believe that the increased permeability of the gfb and the augmentation of albuminuria may be induced by esl injury in early diabetic rats. in summary, we present both morphological and functional evidence that injury to the esl changed the permeability of the glomerular barrier and induced albuminuria in early diabetes. | glomerular endothelial surface layer (esl) may play a role in the mechanisms of albuminuria in diabetic nephropathy, which lack evidence in vivo. the effects of high glucose on the passage of albumin across the glomerular esl were analysed in streptozotocin - induced diabetic sprague - dawley rats for 4 weeks. albuminuria and glomerular mesangial matrix were significantly increased in diabetic rats. the passage of albumin across the esl, as measured by albumin - colloid gold particle density in the glomerular basement membrane (gbm), was increased significantly in diabetic rats. the thickness of the glomerular esl, examined indirectly by infusing intralipid into vessels using an electron microscope, was significantly decreased and the gbm exhibited little change in diabetic rats. in summary, the glomerular esl may play a role in the pathogenesis of albuminuria in rats with early - stage diabetes. |
the endoplasmic reticulum (er) is the cellular site for ca storage and for synthesis, folding, and maturation of most secreted and transmembrane proteins. physiological or pathological processes that disturb protein folding in the endoplasmic reticulum cause er stress and activate a set of signaling pathways termed the unfolded protein response (upr). this concerted and complex cellular response is mediated initially by three molecules, pkr - like er kinase (perk), activated transcription factor 6 (atf6), and inositol - requiring enzyme 1 (ire1). the er luminal domain of perk, ire1, and atf6 interacts with the er chaperone grp78 (glucose - regulated protein) ; however, upon accumulation of unfolded proteins, grp78 dissociates from these molecules, leading to their activation. notably, activation of er stress sensors is modulated by other cellular factors, in addition to the dissociation of grp78. a mutant of yeast ire1, having deletion of grp78 binding site in the er luminal domain, is not constitutively active. furthermore activation of this mutant (grp78 binding site deleted) is regulated by accumulation of unfolded proteins in the er [4, 5 ]. dimerization of core stress - sensing region (cssr) of the er luminal domain of ire1 creates a shared central groove similar to the peptide binding domains of major histocompatibility complexes (mhcs) [68 ]. it is proposed that mhc - like groove binds portions of unfolded polypeptide chain to promote formation of higher - order oligomers necessary for upr activation [68 ]. indeed luminal domain of yeast ire1 interacts with unfolded proteins and inhibits aggregation of denatured proteins in vitro. however, the er luminal domain fragments of mammalian ire1 did not interact with unfolded proteins in vitro. ire1 and perk have conserved essential structural motifs in their er luminal domains required for their dimerization. similar to ire1, er luminal domain of perk can also inhibit aggregation of denatured proteins in vitro. thus ire1 and perk appear to be regulated both by grp78 and by direct binding of unfolded proteins. activation of atf6 is also regulated by combination of two discrete events : firstly by interaction with grp78 and secondly by intra- and intermolecular disulfide bridges [10, 11 ]. the er luminal region of atf6 has two golgi localization signals : gls1 and gls2. binding of grp78 masks the glss in the luminal domain of atf6, and dissociation of grp78 allows atf6 to be transported to the golgi body. further er luminal domain of atf6 is disulfide bonded and er stress - induced reduction plays important role in both translocation to golgi body and subsequent recognition by the site-1 and site-2 proteases (s1p and s2p). these differences may explain the different kinetics in the activation of ire1, perk, and atf6 to various er stress inducers. activated perk phosphorylates translation initiation factor 2 (eif2), thereby reducing the rate of translation and the protein load on the er [12, 13 ]. phosphorylation of eif2 paradoxically increases translation of atf4 mrna to produce a transcription factor that activates expression of several upr target genes [12, 14 ]. activation of the er protein kinase ire1 triggers its endoribonuclease activity to induce cleavage of x box - binding protein 1 (xbp1) mrna. is then ligated by an uncharacterized rna ligase and translated to produce spliced xbp1 protein. spliced xbp1 protein is a highly active transcription factor and one of the key regulators of er folding capacity. concurrently, atf6 is released from grp78 and transits to the golgi body where it is cleaved to release a transcriptionally active fragment. cleaved atf6 acts in concert with spliced xbp1 protein to induce expression of genes encoding protein chaperones and components of the er - associated degradation (erad) machinery [18, 19 ]. moreover, er stress can also induce autophagy, a catabolic cellular program that promotes cell survival in many contexts but which has been associated with induction of nonapoptotic cell death in others. as discussed above the three proximal sensors of er stress exposure to er stress activation of these proximal sensors leads to autophosphorylation of ire1 at serine 724, autophosphorylation of perk at threonine 980, and proteolytic processing of full - length atf6 [1, 2 ]. the 90 kda full - length atf6 is processed within the golgi body to its active 50 kda form through sequential cleavage by site-1 and site-2 proteases (s1p and s2p). therefore, proteolytic processing of atf6 and phosphorylation of perk and ire1 can serve as markers of their activation status. however, detection of cleaved atf6, phospho - perk and phosho - ire1 is quite difficult as these are expressed at very low levels and there is currently a lack of good commercial antibodies to detect them. over the last 10 years, rapid progress has been made in understanding the molecular mechanisms of the upr, and a number of genes modulated by the upr have been identified. therefore, these genes can be used as specific markers for the upr. in our experience detection of the proteolytic processing of atf6 or the phosphorylation of perk and ire1 instead we suggest that detection of downstream protein targets of er stress such as chop, herp, xbp1, grp78, and atf4 (http://saturn.med.nyu.edu/research/mp/ronlab/postings/upr.detect.html) be a more robust approach for detecting activation of the upr. one of the most commonly used indicators of er stress is an increase in the expression level and the nuclear translocation of the transcription factor c / ebp homologous protein (chop) [22, 23 ]. however, it was recently reported that three out of seven commercially available chop antibodies gave false results by western blotting and immunocytochemistry for detection of chop. furthermore, there was a lot - to - lot variance in specificity from the same commercial source. therefore, we advise first validating the specificity of the antibody used for detecting chop protein expression to establish the presence or absence of er stress. upr pathways are important for normal cellular homeostasis and development and also play key roles in the pathogenesis of many diseases [25, 26 ]. examples of pathophysiological conditions that can perturb the er homeostasis include stroke, ischemia, diabetes, viral infections, and mutations that impair protein folding [25, 26 ]. although the importance of er stress and the upr is being increasingly recognized, we still have only a limited number of good diagnostic methods to monitor the upr. this limitation impedes our complete understanding and monitoring of the upr, and in some cases, it may result in confusion. importantly, there are no absolute criteria for determining the upr signaling that can apply to every situation. this is because some assays are inappropriate, problematic, or may not work at all in particular cells, tissues, or model systems. in response to accumulation of unfolded proteins in the er, ire1 oligomerizes in the plane of the membrane, allowing for transautophosphorylation of juxtaposed kinase domains. the transautophosphorylation of the kinase domain of ire1 activates its unusual effector function, which causes the unconventional splicing of the mrna that encodes a transcription factor named xbp1. in metazoans, a 26-nucleotide intron is spliced out by activated ire1, leading to a shift in the codon reading frame (figure 1(a)). the xbp1 protein encoded by the spliced mrna is more stable and is a potent transcription factor of the basic - leucine zipper (bzip) family and one of the key regulators of er folding capacity [15, 16 ]. the splicing of xbp1 mrna can be detected by semiquantitative rt - pcr using primers specific for xbp1 which will detect both unspliced and spliced isoforms. the 5 to 3 sequences of primers used to detect unspliced and spliced xbp1 mrna are as indicated below. rat xbp1 forward primer : ttacgagagaaaactcatgggc reverse primer : gggtccaacttgtccagaatgc size of pcr products : unspliced xbp1 = 289 bp, spliced xbp1 = 263 bp. forward primer : ttacgagagaaaactcatgggc reverse primer : gggtccaacttgtccagaatgc size of pcr products : unspliced xbp1 = 289 bp, spliced xbp1 = 263 bp. human xbp1 forward primer : ttacgagagaaaactcatggcc reverse primer : gggtccaagttgtccagaatgc size of pcr products : unspliced xbp1 = 289 bp, spliced xbp1 = 263 bp. forward primer : ttacgagagaaaactcatggcc reverse primer : gggtccaagttgtccagaatgc size of pcr products : unspliced xbp1 = 289 bp, spliced xbp1 = 263 bp. mouse xbp1 forward primer : gaaccaggagttaagaacacg reverse primer : aggcaacagtgtcagagtcc size of pcr products : unspliced xbp1 = 205 bp, spliced xbp1 = 179 bp. forward primer : gaaccaggagttaagaacacg reverse primer : aggcaacagtgtcagagtcc size of pcr products : unspliced xbp1 = 205 bp, spliced xbp1 = 179 bp. we have detected ire1-dependent splicing of xbp1 mrna under conditions of er stress by using various mutants of ire1 (figures 1(a) and 1(b)). a variety of mammalian cell lines can be used to determine the splicing of xbp1. to follow this method, cells should be seeded on six - well plates and transfected with indicated ire1 mutants. twenty - four hours post transfection, cells are subjected to er stress stimuli, for example, tunicamycin, thapsigargin, or brefeldin a for different time points ranging from 648 hours. three chemicals are generally used to experimentally induce er stress : tunicamycin (sigma), thapsigargin (sigma), and brefeldin a (bfa) (sigma). although these chemicals target different components of the er, their common effect is to interfere with er functions and thereby lead to er protein misfolding. tunicamycin inhibits n - linked glycosylation, while thapsigargin blocks the er calcium atpase pump, leading to the depletion of er calcium stores. brefeldin a interferes with protein transport from the endoplasmic reticulum to the golgi apparatus by inhibiting transport in the golgi, which leads to proteins accumulating inside the er. the concentration and time of treatment depend on system being studied and need to be determined individually for each system. cells are harvested and total rna is isolated using rneasy kit (qiagen) or trizol reagent (invitrogen) according to the manufacturer 's instructions. reverse transcription (rt) is carried out with 2 g rna and oligo dt (invitrogen) using 20 u superscript ii reverse transcriptase (invitrogen). then standard conditions of rt - pcr can be used to determine the unspliced and spliced isoforms of xbp1 (figure 1(b)). the er stress - mediated splicing of xbp1 requires activation of ire1, and if the function of ire1 is compromised, er stress - mediated splicing of xbp1 is attenuated (figure 1(b)). the er stress response is an autoregulatory program that upregulates a large number of genes that expand the folding capacity of the er, such as er chaperones and erad components. mapping of the promoters of a number of er stress responsive genes, such as bip / grp78, grp94, calreticulin, herp, edem1, and hrd1, have identified three cis - acting response elements, namely, erse (er stress response element), erse - ii (er stress response element ii), and upre (unfolded protein response element) [2731 ]. erse has a consensus sequence ccaat - n9-ccacg, which is necessary and sufficient for the induction of at least three major er chaperones (grp78, grp94, and calreticulin) [28, 31 ]. herp, one of the most highly inducible genes during the upr, has a promoter that contains not only erse but also a cis - acting element with a sequence of attgg - n1-ccacg termed esre - ii. upre which contains the consensus sequence tgacgtgg / a was originally identified as a dna sequence bound by bacterially expressed atf6. loss of atf6 leads to reduced activation of upre containing genes such as edem1 and hrd1. we recommend determining the transcript levels of bona fide upr target genes whose induction has been reported to occur during conditions of er stress and whose promoter regions contain at least one of the three cis - acting response elements, namely, erse, upre, or erse - ii. in our laboratory, the induction of mrna of upr target genes has been detected in a variety of mammalian cell lines using real - time rt - pcr (figure 1(c)). cells were generally induced to undergo er stress by incubating with tunicamycin, thapsigargin, or brefeldin a. the concentration and time of treatment depend on system being studied and need to be determined individually for each system. in these experiments cells were treated with er stress inducing agents such as tg, tm, and bfa and total rna was isolated using rneasy kit (qiagen) or trizol reagent (invitrogen) according to the manufacturer 's instructions. reverse transcription (rt) was carried out with 2 g rna and oligo dt (invitrogen) using 20 u superscript ii reverse transcriptase (invitrogen). for real - time pcr experiments, cdna products were mixed with 2 taqman master mixes and 20 taqman gene expression assays (applied biosystems) and subjected to 40 cycles of pcr in steponeplus instrument (applied biosystems). we would like to point out that other methods for detection of mrna levels such as northern blotting, rnase protection assays, and conventional rt - pcr can also be used. we prefer real - time rt - pcr with taqman chemistry (also known as fluorogenic 5 nuclease chemistry) because of its sensitivity, specificity, speed, and ease of handling. table 1 provides a list of taqman assays (applied biosystems) that have worked reproducibly in our experience to detect the transcripts of the several upr markers. we recommend determining the protein levels of established upr target genes whose induction has been reported to occur during relevant conditions of er stress. activation of the upr has been found in various pathological states of the brain including ischemia and degenerative diseases. increased phosphorylation of perk has been shown after cerebral ischemia and reperfusion by immunohistochemical analysis. several postmortem studies of primary human alzheimer 's disease brain tissues show evidence of er stress in the form of enhanced er chaperone expression and immunohistochemical reactivity for specific markers of the upr [33, 34 ]. recently we found increased expression of grp78, chop, and xbp1 in acute, active, and chronic multiple sclerosis (ms) lesions by immunohistochemical and dual - immunofluorescent analyses. figure 2(a) shows immunohistochemical staining of fixed frozen paraffin - embedded (ffpe) brain tissue sections from ms patient which showed upregulation of chop, grp78, and xbp1. specific antibodies used are detailed in table 1. ffpe tissue was used in preference to frozen blocks as in our hands it yielded higher quality staining with lower background and fewer staining artifacts. following deparaffinization, all sections were incubated for 10 minutes at room temperature in 3% hydrogen peroxide in methanol (sigma - aldrich, dublin), to block endogenous peroxidases. for chop and grp78 staining, antigen retrieval was achieved by incubating sections in 0.01 m tris - edta ph 9 (sigma - aldrich, dublin) for 2 minutes in a tefal pressure cooker at full steam. to retrieve antigen before xbp1 staining, tissue was placed in 0.01 m citrate ph 9 (sigma - aldrich, dublin) before microwaving it for 20 minutes in a 700 watt sanyo microwave. bound chop, grp78, or xbp1 antibody was detected following incubation for 30 minutes at room temperature in peroxidase - labeled envision anti - mouse or anti - rabbit antibody (dako, ely, uk) with 3,3- diaminobenzidine (dab) as a chromogen (dako, ely, uk). when carrying out western blotting, we suggest performing standard procedures to determine the protein levels of bona fide upr target genes within protein samples (figure 2(b)). table 2 provides a list of antibodies that have worked best and most reproducibly in our experience to detect several upr marker proteins in western blotting and immunohistochemistry. the most salient feature of the upr is an increase in the transactivation function of a number of bzip transcription factors, such as atf6, atf4, and xbp1. it has been well established that transcriptional induction of upr target genes upon er stress is mediated by the cis - acting response elements. there are several reporter systems which can be used to detect atf6 and xbp1 activation. in the p5xatf6-gl3 reporter, the luciferase gene is under the control of the c - fos minimal promoter and five tandem copies of the atf6 consensus binding site identifed by in vitro gel mobility shift assays with recombinant atf6. in p4xxbpgl3 reporter, the luciferase gene is under the control of four tandem copies of the xbp1 consensus binding site 5-cgcg(tggatgacgtgtaca)4 - 3. in addition there are several other erse reporters which have promoter regions of grp78, grp94, calreticulin, xbp1, and an erse - ii reporter which has the herp promoter upstream of the luciferase reporter gene. these reporters should be used in combination with the corresponding mutant promoter where the functional cis - elements have been mutated. the advantage of these reporters is that they can be used to monitor the activation of endogenous er stress. however, there is some question as to whether these reporters respond primarily to endogenous atf6 and/or xbp1, since xbp1 's binding site is similar to the atf6 site, and activated forms of both atf6 and xbp1 can activate the reporter. furthermore, atf6 and xbp1 can heterodimerize in vivo and atf6-xbp1 heterodimer possesses 8-fold higher affinity for the upre than that for xbp1 homodimer. nevertheless, luciferase - based reporters are a very sensitive method to detect er stress whether it measures activation of atf6, xbp1, or both. a variety of mammalian cell lines can be used to determine the activity of xbp1/atf6 using these reporter constructs. cells should be seeded on six - well plates and transfected by the optimized transfection method 24 hours later. the transfection mixture for each well should contain the luciferase reporter gene and an internal control to normalize the transfection efficiencies (renilla luciferase or -galactosidase). 24 hours post transfection, cells are induced to undergo er stress by incubating with appropriate concentrations of tunicamycin, thapsigargin, or brefeldin a for different time points ranging from 648 hours. cells are then harvested and the firefly luciferase present in the cell lysate is measured along with the appropriate internal control (renilla luciferase or -galactosidase). the results should be normalized to the internal control for each point to determine the fold induction in the reporter activity. er stress - dependent splicing of xbp1 has been used to develop fluorescent reporter constructs by fusing xbp1 sequence to venus, a variant of green fluorescent protein which enables the activation of ire1 to be monitored [36, 37 ]. the design of the xbp1-venus reporter is shown in figure 3(a). in this construct, the gene encoding venus is cloned downstream the 26-nt er stress - specific intron of human xbp1. under normal conditions, the mrna of the fusion gene is not spliced, and its translation terminates at the stop codon near the joint between the xbp1 and venus genes. however, during er stress, the 26-nt intron is spliced out, leading to a frame shift of the chimeric xbp1-venus mrna, similar to that of the endogenous xbp1 mrna. translation of the spliced mrna produces an xbp1-venus fusion protein and cells experiencing er stress can be detected by monitoring the fluorescence activity of venus. as venus expression can only occur from the spliced form of the xbp1-gfp mrna, its presence signals the activation of ire1. upon transfection of the xbp1-gfp reporter into cells, tunicamycin treatment results in detectable fluorescence in the nucleus, whereas negligible fluorescence is detected in any compartment under normal conditions [36, 37 ]. moreover, venus expression during tunicamycin treatment has been shown in splicing assays to correlate with the extent of splicing of the upr intron from xbp1/gfp mrna [36, 37 ]. we have used 293 t cells to detect activation of ire1 using two different xbp1-venus reporter plasmids : f - xbp1-venus and f - xbp1dbd - venus (figure 3(a)). in f - xbp1dbd - venus f - xbp1dbd - venus construct is recommended for use as overexpression of f - xbp1dbd - venus does not affect induction of upr target genes and can be used to detect activation of ire1 similar to f - xbp1-venus construct. f - xbp1dbd - venus construct has been used to generate a transgenic mouse model for monitoring er stress (discussed later). twenty - four hours post transfection, cells are induced to undergo er stress by incubating with appropriate concentrations of tunicamycin, for 24 hours. in the cells transfected with f - xbp1-venus construct, tunicamycin treatment leads to appearance of green fluorescence in the nucleus (figure 3(b)). however in the cells transfected with f - xbp1dbd - venus construct, tunicamycin treatment leads to appearance of green fluorescence in the cytosol (figure 3(b)). one important point to note is that overexpression of f - xbp1-venus construct interferes with induction of upr target genes in a dominant - negative manner. the major drawback, however, is the relatively large amount of gfp that needs to be expressed in the cell for visualization by microscopy. thus, there will be a time lag between actual ire1 activation and its detection by the accumulation of gfp. a key regulatory step in atf6 activation is its transport from the er to the golgi body, where it is processed by s1p and s2p proteases [38, 39 ]. the cytoplasmic fragment of atf6, thereby liberated from the membrane, translocates into the nucleus and activates transcription of its target genes [38, 39 ]. a gfp - atf6 fusion protein, which relocates from the er to the nucleus via the golgi apparatus in response to er stress, can be used to monitor activation of atf6 by fluorescent microscopy [38, 39 ]. one limitation of this approach, however, is that overexpression can sometimes alter the subcellular localization and kinetics of protein trafficking. this problem has been addressed to some extent by expressing gfp - atf6 from a shortened cmv promoter which has a deletion of 430 base pairs from the 5 side. the short promoter possesses considerably lower activity than the full promoter and gfp - atf6 expressed using the short cmv promoter is localized exclusively to the er and translocates to the nucleus similarly to endogenous atf6. for detection of gfp - atf6, 293 t cells were transfected with pcmvshort - egfp - atf6 (wt), pcmvshort - egfp - atf6 (s1p), and pcmvshort - egfp - atf6 (s2p) plasmids. pcmvshort - egfp - atf6 (s1p) and pcmvshort - egfp - atf6 (s2p) have a mutation that abrogates the cleavage by s1p or s2p, respectively. 24 hours post transfection, cells were treated with 1 g / ml tunicamycin. as shown in figure 4(a), the wild - type gfp - atf6 was translocated to the nucleus via the golgi apparatus. both egfp - atf6 (s1p) and egfp - atf6 (s2p) were localized in 293 t cells similarly to the wild - type gfp - atf6 (figure 4(b) : a c). in contrast to wild - type gfp - atf6 (figure 4(b) : a, d, g), gfp - atf6_(s1p) (figure 4(b) : b, e, h) and egfp - atf6 (s2p) (figure 4(b) : c, f, i) remained associated with the golgi apparatus even 4 hours after tunicamycin treatment. these results demonstrate that cleavage by s1p and s2p is critical for the processing of gfp - atf6 and that only the processed product, gfp - atf6, can enter the nucleus. the advantage of gfp is that its intrinsic fluorescence allows the translocation of atf6 to be continuously followed in single living cells and the whole process recorded over time using, for example, time - lapse photography. er stress has been implicated in human neuronal diseases, such as parkinson 's disease, alzheimer 's disease, as well as other disorders. the exact contributions to and casual effects of er stress in the various disease processes are not known. furthermore, components of er stress signaling are also required during development [40, 41 ]. studies of er stress in vivo will provide information that is important and useful in pathology and developmental biology. the first model, referred to as er stress - activated indicator (erai), was constructed by fusing xbp1 and venus, a variant of the green fluorescent protein (described in section 2.4). this mouse model could serve as a specific and sensitive indicator of er stress in vivo during development and disease, as well as for analysis of drug effects on er function. however, this erai model detects activation of ire1 only and does not reveal any information about atf6 and perk activation. the other limitations of this model include lack of erai expression in some cell types and the inability to detect weak er stress signals. the second model, known as erse - lacz model, was constructed by using a lacz reporter gene driven by 3 kilobases of the rat grp78 promoter. first, the d300lacz mouse contains a 230 bp internal deletion spanning from 300 to 70, which eliminates the known er stress - inducible elements of the grp78 promoter, including both the erse and the camp - response element (cre). second, the d170lacz mouse has a 100 bp internal deletion spanning 170 to 70, which eliminates only the three tandem copies of the erse. the wild - type erse - lacz model recapitulates the endogenous expression profile of grp78 with highest expression in the early embryonic heart which is dependent on the presence of erse in the promoter region of grp78. when using the erse - lacz model, it is recommended to use wild - type grp78 promoter along with erse - deleted grp78 promoter. erse - deleted grp78 promoter serves as an important control for specificity of erse - mediated er stress in vivo. however, this system does not reveal any information about the three different arms of upr. one obvious limitation of the erse - lacz model is possible interference by signals not directly related to er stress since expression of grp78 is regulated by the coordinated function of several other transcription factors that can act outside of erse. therefore, while both erai and erse - lacz mouse models have their unique advantages and pitfalls, they may complement each other to provide novel insights into the complexity of er stress signaling in vivo in multicellular organisms. in addition to maintaining the homeostasis of er function, the er stress response is involved in a number of cellular processes. it has been shown that er stress is induced during the differentiation of b cells into antibody - secreting plasma cells, likely due to the need to increase the secretory capacity of the cells. in addition, er stress activation is associated with several human diseases including alzheimer 's disease, diabetes, and atherosclerosis. the experimental approaches discussed above should prove useful to those researching er stress in vitro and in vivo. further, these experimental strategies may evolve as new methodologies are developed and our understanding of upr improves. nonetheless, it is useful to establish guidelines for acceptable assays that can reliably monitor upr in many experimental systems. | the endoplasmic reticulum (er) is the site of folding of membrane and secreted proteins in the cell. physiological or pathological processes that disturb protein folding in the endoplasmic reticulum cause er stress and activate a set of signaling pathways termed the unfolded protein response (upr). the upr can promote cellular repair and sustained survival by reducing the load of unfolded proteins through upregulation of chaperones and global attenuation of protein synthesis. research into er stress and the upr continues to grow at a rapid rate as many new investigators are entering the field. there are also many researchers not working directly on er stress, but who wish to determine whether this response is activated in the system they are studying : thus, it is important to list a standard set of criteria for monitoring upr in different model systems. here, we discuss approaches that can be used by researchers to plan and interpret experiments aimed at evaluating whether the upr and related processes are activated. we would like to emphasize that no individual assay is guaranteed to be the most appropriate one in every situation and strongly recommend the use of multiple assays to verify upr activation. |
germline mutations in the vhl gene cause the von hippel - lindau disease (vhl ; mim # 193300), a dominantly inherited familial cancer syndrome with retinal and central nervous system hemangioblastomas, renal cell carcinoma, pheochromocytoma, pancreatic endocrine tumors, and endolymphatic sac tumors [14 ]. the vhl mutation pattern includes missense, nonsense, frameshift, and splice site mutations. genotype - phenotype correlation studies showed that the incidence of renal involvement in vhl disease was increased in families with nonsense or frameshift mutations that disrupted the structural integrity of vhl protein, whereas missense mutations associated with a higher risk of pheochromocytoma [57 ]. we hypothesize that the genic localization of vhl variations and nonsense mutations of vhl activating nmd pathway may play an important role in the determination of a specific phenotype. nmd is an evolutionarily conserved mrna surveillance pathway that protects cells from potentially harmful effects of truncated proteins that would otherwise be translated from mrnas bearing ptc. the process serves as a general surveillance mechanism to abolish aberrant transcripts resulting not only from rare mutations but also from mistakes in rna processing, regulating the expression of about 3%10% of the transcriptome in s. cerevisiae, d. melenogaster, and human cells. these natural nmd targets play a role in different biological processes such as transcription, cell proliferation, cell cycle, telomere maintenance, cellular transport and organization, and metabolism. the high evolutionary conserved upf proteins, upf1, upf2, and upf3, constitute the core of nmd machinery [1014 ]. the key molecular component is upf1, an rna helicase that recognizes aberrant translation termination events. although conserved in all eukaryotes that have been analysed so far, nmd employs different molecular mechanisms, depending on the species, to discriminate between natural and premature stop codons and to degrade the targeted mrnas. in mammalian cells, termination codons that lie upstream of an exon - exon boundary the drosophila melanogaster intron - less vhl gene maps at polytene chromosomal position 47e5 - 6 (http://flybase.org/). the human and fly proteins show a high degree of amino acid similarity spread throughout the entire length of vhl with 67% and 76% of similarity in the functional domains of pkcl and elongin c binding domains, respectively. here, by establishing a drosophila nmd mutant, we showed the involvement of nmd mechanism in the modulation of a novel human vhl frameshift mutation and we confirmed this data in the hek 293 human cell line using a molecular strategy based on the minigene constructs. flies were cultured at 25c on standard cornmeal - sucrose - yeast - agar medium containing propionic acid as mold inhibitors. detailed description of mutations and chromosome rearrangements used in the present study could be found at flybase : http://flybase.bio.indiana.edu. total rnas from testes and ovaries of adult flies were isolated using rneasy kit (qiagen) and poly(a) rnas were prepared with oligo(dt)-coupled beads (oligotex, qiagen). rnas were separated in denaturing formaldehyde agarose gel (520 g / lane) and blotted onto positively charged nylon membranes (amersham). upf1 and rp49 p - labeled probes were generated by random priming using standard methods. hybridization was carried out overnight at 65c in hybridization solution (formamide 50%, ssc 5x, denhardt 's 5x, sds 0.5x, edta ph 8.0 10 mm, salmon sperm dna 100 g / ml). autoradiography was carried out for both 16 and 48 hours at 80c using intensifying screens. the adh allele contains a premature stop codon located 258 bp upstream from the boundary between exon 3 and exon 4 while adh is a small deletion that eliminates the 5 splicing signal of intron 2 leading to an in - frame premature stop codon (figure 1(a)). drosophila genomic dna was isolated from adults using genomic dna extraction kit (qiagen). as probe for subsequent screens, a fragment of 700 bp was pcr amplified from genomic dna as template (upf1f and upf1r primers in table 1). the identity of cloned pcr product was confirmed by sequencing. for the isolation of the upf1 cdna full - length hybridization of the hybond - n+ filters (amersham) was carried out at 65c according to the manufacturer 's instructions. the positive upf1 cdna clone was cloned into the pgem - t - easy vector (promega) and verified by dna sequencing. the entire coding sequence of the vhl gene was amplified by pcr with pfu polymerase (promega) using cdna obtained by reverse transcription of total rna extracted from adult flies. the upf1 and vhl mutations were introduced in the cloned cdnas by site - directed mutagenesis with the quickchange ii kit (stratagene) using the following oligonucleotides : upf1fmut and upf1rmut for upf1, vhlf and vhlr for vhl, and vhlf and vhlr for vhl mutations (table 1), respectively. subsequently, mutated upf1 and vhl cdnas were sequenced and inserted into puast vector by site directed cloning. p element transformation was performed by microinjection of puast : upf1 or puast : vhl together with a 2 - 3 transposase containing plasmid into a w drosophila melanogaster strain. the expression of different upstream activating sequences (uass) constructs was tested using a pgal4 line that drives ubiquitous expression. the upf1 dominant negative activity of the transgenic lines selected was tested by crossing virgin females w;2::gal4 with w ; adh / cy ; uas : upf1/tm3 and w ; adh / cy ; uas : upf1/tm3, respectively. the 2::gal4 line drives the transgene expression in the testis. the levels of adh and upf1 mrna from testes of w ; adh/ 2::gal4 ; uas : upf1/+ and w ; adh/2::gal4 ; uas : upf1/+ flies and the levels of vhl from testes of w ; uas : vhl/2::gal4 ; uas : upf1/+ and w ; uas : vhl/2::gal4 ; uas : upf1/+ flies were analysed by qpcr. total rna from testis of 50 adult flies was obtained using rneasy mini kit and reverse transcripted using quantitect reverse transcription kit (qiagen) according to the manufacturer 's instructions. rt - pcr was performed using pvhlf and pvhlr and adh_rt_f and adh_rt_r primers for vhl and adh, respectively (table 1). qpcr was carried out in triplicates using platinum sybr green qpcr supermix - udg (invitrogen) and run on abi 7900ht sequence detection system with defaults parameters. the geometric mean of two reference genes (rp49 and act4a) was used to normalize the relative quantities. the calculations were made using the comparative ct method as reported (user bulletin # 2, applied biosystems). we ligated two pcr fragments from dna of healthy individual carrying wild type vhl alleles. the pcr fragments contained exon 1 and part of its downstream intronic sequence (700 bp) and exon 2 and part of its flanking introns (390 bp at intron 1 and 134 bp at intron 2). the c.163delg mutation was introduced by site - directed mutagenesis using the quickchange ii kit (stratagene) with the generation of a stop codon in exon1 (v66x). the entire coding sequence of the vhl gene was amplified by pcr using as template the cdna obtained by reverse transcription of rna extracted from hek293 cells. hek 293 cells were grown at 37c in dmem supplemented with 10% fetal calf serum and 1% penicillin - streptomycin (invitrogen). they were seeded at 1 10 cells per 100 mm diameter petri dish 24 hours before transfection, performed by fugene hd (roche) with either 1 g of vhl wt or mutant constructs. a gfp plasmid was used as a reference for transfection efficiency in each cell line. the mrna levels of the different constructs were normalized to the mrna level of gfp. then, the ratio between the normalized mrna levels transcribed from the mutant and the wt constructs following chx treatment was calculated and compared with this ratio in untreated cells. to test whether drosophila testis expresses detectable levels of the endogenous upf1, adh, and vhl genes, we performed northern blot and rt - pcr analysis on poly(a) and total rna extract from ovaries and testes of adult flies. as shown in figure 4 these analyses revealed that upf1, adh, and vhl are normally expressed in ovaries and testes of adult flies. the yeast r779c and mammals r844c upf1 mutations convert the conserved arginine to cysteine at residue 799 and 844 respectively, within the rna helicase domain, conferring a dominant - negative effect on yeast and human upf1p activity in nonsense - mediated mrna decay pathway. because of the high identity of drosophila upf1 protein with the human and yeast upf1 protein (67% and 53%, resp.) we introduced the same mutation into the fly upf1 cdna and we tested whether this mutation in vivo exerts a dominant negative effect on the regulation of alcohol dehydrogenase gene, adh, a specific substrate of nmd, by utilizing the heterologous gal4-uas binary expression system. by screening of a drosophila melanogaster adult ovaric cdna library with a upf1 probe we isolated one positive clone that consisted of an upf1 full - length containing an open reading frame of 3530 bp with a 5-untranslated region of 372 bp and a 3-untranslated region of 802 bp, respectively. using directed mutagenesis we generated upf1 cdna that carries the r822c substitution that mimics the yeast r779c and mammals this mutated upf1 cdna was cloned into p element expression vectors under the control of yeast gal4-uas. p element - mediated germ line transformation was used to generate an uas : upf1 transgenic fly line that we called uas : upf1. we observed that the ubiquitous expression of the dominant - negative upf1 protein, driven by actin - gal4 driver line (p{act5c gal4}17bfo1), caused 100% larval lethality (0/1445). consistently, the observed phenotype and the efficacy of uas : upf1 transgene were confirmed by isolation and characterization of a loss - of - function mutation in the drosophila upf1 gene that causes lethality during larval development. to verify whether upf1 is able to modulate nmd pathway, we used qpcr to test its effect on mrna levels of adh and adh, two nonsense mutations of the alcohol dehydrogenase gene (adh) (figure 1(a)), known to be targeted by nmd in s2 cells and in vivo [14, 20 ]. first, we measured the levels of adh mrna in both adh mutant strains and we detected, in agreement with previous data, that they were 25% and 10% lower compared to the wild type strain (data not shown), because of increased turnover of the mutant transcript by the nmd pathway. since the ubiquitous expression of upf1 protein caused larval lethality, we reasoned that the choice of a tissue in which the absence of the nmd pathway is not essential for drosophila viability or development is fundamental to carry out functional analysis on nmd targets. interestingly, we observed that the expression of upf1 protein in drosophila testis, driven by a testis - specific gal4 driver line (2::gal4), had no effect on testis development and/or larval lethality. thus, we retained that the use of 2::gal4 driver line could allow a detailed analysis of adult - onset phenotypes induced by loss of upf1 activity. further, we tested whether the upf1 mutation has a dominant - negative effect on the regulation of adh and adhtranscripts by inducing the expression of uas : upf1 transgene in drososphila testis. w ; adh / cy ; uas : upf1/tm3 and w ; adh / cy ; uas : upf1/tm3 males were crossed to 2::gal4 females and the levels of adh and upf1 mrnas from testes of w ; adh/2::gal4 ; uas : upf1/+ and w ; adh/2::gal4 ; uas : upf1/+ flies were measured by using qpcr. consistently with we observed a 3.8- and 8.8-fold accumulation of adh mrna when compared to the control (figures 1(b) and 1(c)), implying that the expression of upf1 mutation could abolish nmd pathway function. together these results strong point out that upf1line represents a useful system to conduct a functional study to identify possible substrates of nmd pathway in drosophila melanogaster. the uas : upf1line was used to investigate whether vhl alleles carrying ptcs are degraded by nmd pathway. the vhlallele contains the c.172delg frameshift mutation located in the exon 1 of vhl gene. this mutation corresponds to the human c.163delg pathogenic mutation that we recently identified in a sporadic case of human cerebellar hemangioblastomas (muscarella, submitted). the vhl allele contains the c.254delc mutation corresponding to the c.239delg in human vhl gene (figure 2(a)). p element - mediated germ line transformation was used to generate two independent transgenic fly lines carrying vhl mutations, uas : vhl and uas : vhl. to verify whether the two different vhl mutant transcripts were targeted by nmd pathway, w ; uas : vhl / cy ; uas : upf1/tm3 and w ; uas : vhl / cy ; uas : upf1/tm3 males were crossed to w;2::gal4 females. the mrna levels of both wild type and mutated forms of vhl and upf1 from testis of w ; uas : vhl/2::gal4 ; uas : upf1/+ and w ; uas : vhl/2::gal4 ; uas : upf1/+ flies were measured by qpcr. we observed an increased of vhl transcript in uas : vhl/2::gal4 ; uas : upf1/+ transgenic line. conversely, the uas : vhl/2::gal4;uas : upf1/+ flies did not show any difference in vhl expression compared to the upf1 wild type line (figures 2(b) and 2(c)). to investigate the stability of vhl wild type and certain human nonsense transcripts, we measured by qpcr the mrna levels of constructs carrying wild type, c.163delg and c.239delg (figures 3(a) and 3(b)) vhl mutations transfected into hek 293 cells in absence and presence of cycloheximide (chx), a widely used inhibitor of nmd. the analysis showed that the fold increase differs between the two mutants, with a modest increase in the level observed (1.4 0.10) for c.239delg and a higher increase of 2.0 (2.4 0.8) for c.163delg (figures 3(c) and 3(d)). in humans, the role of nmd as a modifier of the phenotypic consequences of ptc is becoming more apparent. there are a consistent number of genetic diseases in which nmd partially mitigates the consequences of mutation owing to phenotypic variability. the vhl is a well - known tumor suppressor gene, involved in cell cycle, regulation of hypoxia inducible genes and proper fibronectin assembly in extracellular matrix. germline mutations of the vhl gene lead to the development of the von hippel - lindau disease, a rare dominantly inherited familial cancer syndrome with a marked phenotypic variability and age - dependent penetrance. the number of mutations in vhl gene is enormous and includes missense, nonsense, frameshift, and splice site mutations. in the past few years many different approaches using several molecular gene parameters have been used to make a possible correlation between vhl gene mutation and tumor phenotype [57, 23 ]. in the present study we generated upf1 mutant fly line, uas : upf1, to investigate whether two nonsense alleles of the vhl gene are nmd targets. in agreement with others we observed that the ubiquitous expression of upf1 protein, induced by a specific actin - gal4 driver line, causes 100% larval lethality. nmd pathway modulates the activity of specific native transcripts, whose misregulation would perturb the development or function of select cells or tissues and leading to lethality. since upf1 gene is broadly expressed and active throughout development, identification of the tissue target of upf1 lethality will be an important first step to select the cellular substrates of nmd gene regulation. since the expression of uas - transgene can be targeted to a specific tissue using the gal4/uas binary expression system, for our experiments we have chosen the 2::gal4 line that drives the transgene expression in a region of testis in which the perturbation of nmd pathway is not essential for drosophila viability and development. the observed abolishing effect of degradation of adh nonsense transcript, an nmd substrate, by upf1 dominant - negative mutant suggested that the uas : upf1 line could be used as genetic system to screen nonsense mutations substrate of nmd pathway. we investigated if the expression of two specific vhl nonsense transcripts, vhl and vhl, is modulated by nmd mechanism. the observed effect of nmd on the degradation of these two vhl nonsense transcripts was different. in particular we showed the involvement of nmd in the degradation of vhl transcript, whereas vhl transgenic line showed no difference in vhl expression compared to the wild type. these results suggest that the nmd of vhl transcript carrying the c.172delg mutation is effective, whereas the c.254delc is not. similar results were observed in hek293 cell line transfected with vhl constructs harboring the corresponding human vhl mutations after chx treatment. indeed while the c.239delg mutation transcript level showed only a marginal increase following the nmd inhibition, a fairly good increase of mrna expression of c.163delg mutant transcript was observed. our data confirm that some frameshift mutations located in the last portion of vhl gene could escape nmd. in fact in both mammalian cells and drosophila the c.239delg and the c.254delc transcripts, respectively, are immune to nmd. not all nonsense codons trigger nmd. in mammalian cells a splicing - dependent signal seems to be involved in ptc definition. remarkably, stop codons located at least 5055 nt upstream of an exon - exon boundary are generally defined as premature, whereas most ptcs downstream of this point do not elicit decay. notably, although the splicing and nmd machineries are conserved in d. melanogaster, the nmd in this organism was shown to occur independently of ejc components and ptc - containing transcripts that derive from intronless genes were found to be nmd - competent [11, 25 ]. recent data demonstrated that the position of nonsense codons relative to the cytoplasmic poly(a)-binding protein 1 (pabpc1) is also a critical determinant for ptc definition both in drosophila and in human. interestingly, if pabpc1 is in close proximity to the ptc, it seems to function as an nmd repressor. the observation that the vhl but not the vhl mrna abundance is subject to nmd regulation might be attributable to the spatial rearrangements of the 3utr that close pabpc1 to the ptc. probably, proximity of the pabpc1 protein to the ptc generated by c.172delg mutation inhibits nmd. another possible explanation for the difference observed between the two mutants should be that whereas the c.163delg mutation is located sufficiently upstream of an exon - exon junction and therefore is able to trigger nmd, the c.239delg mutation is located in the 3-most exon. therefore it is not surprising that this mutation is not able to trigger nmd in mammalian cells. the possibility that vhl truncating mutations may recognised by nmd was recently verified. in that study, inhibition of nmd in two sporadic rcc cell lines (786o and ktcl26) with endogenous frameshift vhl mutations that generated stop codons at residues 104 and 147 amino acidic composition residues, respectively, did not produce major changes in vhl mrna expression (1.6- and 0.4-fold increase following emetine treatment, unpublished observations). the authors concluded that the nmd is not effective on the modulation of vhl because of the small length of vhl gene that consists of only three exons. our experiments confirm the utility of drosophila melanogaster as an easy experimental system for understanding the nmd mechanism with a relevant potential applicability. further molecular investigations on a greater number of drosophila transgenic lines harbouring mutations that result in truncated proteins in different regions of vhl gene or whatever also gene will be need to get more indications on the correlations between mutation position, activation of nmd in drosophila, and specification of a definite phenotype. finally, a larger number of mutations need to be tested to definitely establish whether the nmd is involved in the pathogenesis of von hippel lindau disease. | there are many well - studied examples of human phenotypes resulting from nonsense or frameshift mutations that are modulated by nonsense - mediated mrna decay (nmd), a process that typically degrades transcripts containing premature termination codons (ptcs) in order to prevent translation of unnecessary or aberrant transcripts. different types of germline mutations in the vhl gene cause the von hippel - lindau disease, a dominantly inherited familial cancer syndrome with a marked phenotypic variability and age - dependent penetrance. by generating the drosophila uas : upf1d45b line we showed the possible involvement of nmd mechanism in the modulation of the c.172delg frameshift mutation located in the exon 1 of vhl gene. further, by quantitative real - time pcr (qpcr) we demonstrated that the corresponding c.163delg human mutation is targeted by nmd in human hek 293 cells. the uas : upf1d45b line represents a useful system to identify novel substrates of nmd pathway in drosophila melanogaster. finally, we suggest the possible role of nmd on the regulation of vhl mutations. |
most babies with congenital diaphragmatic hernia (cdh) are now diagnosed on antenatal ultrasound, however, they may present with respiratory distress after birth. we present a rare case of right diaphragmatic hernia with hepatic torsion causing biliary obstruction and obstructive jaundice. to our knowledge, this anomaly has not been reported in the available literature. a 2-month - old baby girl was referred with jaundice, acholic stool, and highly colored urine since birth. she was admitted to another hospital with fever, cough and poor intake and treated as a case of pneumonia, right diaphragmatic hernia, and cholestatic jaundice. the total bilirubin was 12.50 mg / dl, alanine transaminase 244 u / l, aspartate transaminase 500 u / l, alkaline phosphatase 485 u / l, and albumin 3.2 g / dl. x - ray revealed marked elevation of the right dome of the diaphragm with upward migration of the liver. ultrasound, computed tomography abdomen and magnetic resonance (mr) cholangiogram showed cdh with a large segment of the liver herniated into the right chest and severe intra and extrahepatic bile duct dilatation. posterolateral defect, and nearly two - third of the liver was seen in the thoracic cavity. the right lobe of the liver had nearly 180 counter clock rotation causing obstruction to the biliary outflow [figure 1 ]. the right hepatic torsion was corrected, and liver was relocated into the abdomen. after relocation, it was noticed that the hepatobiliary anatomy has been restored [figure 2 ]. an operative cholangiogram showed that there were intra and extrahepatic biliary ducts dilatation with dilated common bile duct (cbd) but free flow of the contrast into the intestine. it was not possible to close the abdominal wall without significant tension, therefore, only skin closure was performed without repair of the abdominal wall muscles. in the postoperative period, the child was kept on assisted ventilation for 2 days, and then gradually weaned off the ventilator. baby was readmitted at the age of 6 months ; repair of ventral hernia was performed and later discharged home in a stable condition. the total bilirubin dropped from 12.50 mg / l into its normal values within 3 months after initial surgery. a repeat ultrasound at 6 months showed normal liver architecture with no evidence of biliary dilatation. right liver lobe having 180 torsion and pale color normal anatomy restored after correction of right hepatic torsion the association of jaundice with cdh is well - established and the common causes are herniation of the hepatobiliary apparatus in the chest, malrotation causing occlusion of cbd, neonatal hepatitis, biliary atresia, and cytomegalovirus infections to mention a few. obstructive jaundice has also been reported in other diaphragmatic defects such as hiatal and morgagni hernias. to our knowledge, chd with liver herniation in the chest and causing hepatic torsion and obstruction to the biliary outflow has not been reported in the available literature. x - ray chest picked up the diaphragmatic hernia. ultrasonography and mr cholangiogram were suggesting dilated hepatobiliary system and dilated cbd with the impression of choledochal cyst. reviewing the mr cholangiogram retrospectively, the gall bladder was seen on the medial side of the herniated right lobe but due to the distorted anatomy, it was not possible to make a diagnosis of hepatic torsion. it was only after exploration and liver reduction in the abdomen that we found there was liver torsion causing biliary obstruction. once the torsion was corrected the operative cholangiogram showed the free passage of contrast in the bowel excluding other possible causes such as choledochal cyst and extrahepatic biliary atresia. another difficulty faced after liver reduction in the abdomen was small abdominal capacity to close the abdomen without tension. with primary closure, there was high - risk of abdominal compartment syndrome, and therefore, it was decided to leave a ventral hernia for later repair. this approach definitely helped the baby, and she recovered soon, and the ventral hernia was repaired easily at the age of 6 months. the presence of liver in the chest can cause biliary obstruction and in worst - case scenario even torsion of liver. leaving a ventral hernia for later repair in large cdh with limited abdominal cavity | right sided congenital diaphragmatic hernia may cause biliary obstruction. we present a 2 months female infant who had respiratory distress and persistent jaundice since birth. investigations suggested direct hyperbilirubinemia, right - sided diaphragmatic hernia with liver herniation in the thorax, and intra- and extrahepatic biliary dilatation. laparotomy showed herniation of liver in the chest with hepatic torsion of about 180 causing obstruction of bile ducts. liver torsion was corrected and liver relocated in the abdomen. an operative cholangiogram confirmed free passage of contrast to the intestine after correction of hepatic torsion. repair of the diaphragmatic hernia was performed. only skin closure was performed leaving a ventral hernia to avoid abdominal compartment syndrome. postoperatively, the baby was kept on ventilator for 2 days and then extubated. she showed rapid recovery and was discharged in a stable condition. the ventral hernia was repaired at the age of 6 months. her total bilirubin levels dropped gradually from 12.50 mg / dl into its normal values within 3 months. |
vitamin d has been shown to play an important role in both the innate and adaptive immune system. in vitro studies have demonstrated vitamin d to correlate with alterations of several cytokines such as il-4, il-5, il-6, il-10, il-13, and interferon [13 ]. hence, as a potent immune modulator, vitamin d was shown to be associated with childhood asthma and allergic diseases [46 ]. in addition to allergic diseases, vitamin d also partakes a potential role in airway inflammation, thus, strongly linked with acute infectious illness such as upper or lower respiratory tract infections, sepsis, and hospitalization [710 ]. given the important immune modulatory role of vitamin d, the link between toll - like receptors- (tlrs-) mediated innate immunity and vitamin d deserves in - depth investigation. studies have shown vitamin d to downregulate tlr expression in order to dampen immune cytokine response in multiple basic science models [1113 ]. in contrast, some reports have shown treatment with vitamin d to result in increased tlr activation. in a cohort study of 225 infants, higher 25(oh)d3 level at 6 months thus, despite a wide variety of studies that acknowledged the immunomodulatory role of vitamin d, the results have been conflicting. furthermore, very few studies address the impact of prenatal vitamin d status on tlr - related innate immune response in neonatal infants. because of the apparent importance of vitamin d in immune development, we aimed to investigate the effect of maternal and/or cord vitamin d level on tlr - triggered cytokine response in neonates at time of birth and disease outcome in early childhood. we focused attention on neonatal innate immunity since early life events appear to have a critical influence on the ultimate pattern of immune maturation. in addition, we sought to investigate whether maternal blood and cord blood vitamin d correspond in their association with tlr - related innate immunity. data for this analysis came from an ongoing prospective birth cohort study called the patch (the prediction of allergy in taiwanese children). the chang gung ethics committee approved the study, and informed consent was obtained from the parents / legal guardians of the neonates. pregnant women undergoing routine prenatal exam were approached randomly by a study nurse and invited to join our research program. all mothers and their offspring were enrolled upon agreement, but those born under the gestational age of 37 weeks, had major congenital anomaly, or were suspicious of congenital infections were subsequently excluded from this analysis. the result from this study a baseline questionnaire survey was conducted at birth to obtain parental information such as demographic characteristics, medical and obstetric history, and smoking exposure history. standardized questionnaires on atopic heredity, environmental factors, infection, and allergic diseases were answered at 2, 4, 6, and 12 months and every year thereafter. infants were defined as ever having lower respiratory tract infection (bronchiolitis, pneumonia, and/or croup) if there was a diagnosis from a health care professional, and the infant either had been hospitalized or received medical treatment. other infections such as infectious enteritis and urinary tract infection were also obtained from medical records with physicians ' diagnosis. by the time of analysis, 321 children included in this study were at least 1 year of age and had adequate follow - up data. briefly, maternal blood was obtained during third gestation and umbilical cord blood collected at the time of delivery. these included synthetic bacterial lipoprotein (pam3csk4) that is recognized by tlr1 - 2 ; a synthetic analog of double stranded rna for tlr3 ; ultrapure lps for tlr4 ; and r848, which is activated via the tlr7/tlr8 signaling pathway. as a positive control, cells were treated with the nf-b activator phytohemagglutinin (murex pharmaceuticals) at 4 g / ml in r10-fbs. to determine tlr responses, 3 10 pbmcs in 100 l r10-fbs were added to each of the media or ligands (in duplicate), containing wells and incubated at 37c for 20 h with 5% co2. the concentrations of the ligands used for this experiment are as follows : 10 g / ml of pam3csk4, 10 g / ml of poly(i : c) directly administered, 20 ng / ml of lps, and 10 g / ml of r848 (invivogen, san diego, ca). tnf-, il-10, and il-6 levels in culture supernatants were determined by enzyme - linked immunosorbent assays according to the manufacturer 's instructions (elisa ; r&d systems, mn). the detection limits were 15.6 pg / ml for tnf-, 3.12 pg / ml for il-6, and 7.8 pg / ml for il-10. serum samples obtained from the pregnant mother and cord blood were stored frozen in aliquotsat 80c until analysis. serum 25(oh)d levels were measured by elecsys vitamin d total assay (roche diagnostics, mannheim, germany). this method is a new automated electrochemiluminescence - based assay that measures both the 25(oh)d2 and 25(oh)d3 as total 25(oh)d level. results from this assay have shown close agreement to other well - established methods such as liquid - chromatography tandem mass spectrometry (lc - ms / ms). spearman 's rank correlation test was performed to analyze the correlation between maternal and cord blood 25(oh)d level. since the concentrations of 25(oh)d and cytokines were not normally distributed, values were logarithmically transformed as continuous variables in the statistical models. regression analysis was used to determine the relation between maternal / cord blood 25(oh)d concentration and tlr - induced cytokine response as continuous variables. association between serum vitamin d level and binary outcomes (bronchiolitis, pneumonia, croup, infectious enteritis, and urinary tract infection) was analyzed by using logistic regression. models were adjusted for gestational age, gender, birth body weight, mode of delivery, maternal allergy, and season of birth. all statistical analysis was carried out using ibm spss statistics version 20 (armonk, ny). the incidence of maternal allergy was 34.8%, compatible with that of the general population. all neonates included in this analysis were above gestational age of 37 weeks with adequate birth body weight. slightly more babies were delivered during the season of spring (28,8%). of the original 372 maternal - neonatal pairs, fifty - one participants either were lost to follow - up, refused to further participate, or had yet to return. by the age of 12 months, the median maternal blood 25(oh)d concentration was 15.18 ng / ml (interquartile range (iq) : 10.8519.10 ng / ml), and the median cord blood 25(oh)d was 14.80 ng / ml (iq : 10.0218.86 ng / ml). of the 372 maternal participants, 280 (75%) had 25(oh)d levels less than 20 ng / ml (considered deficient), and 71 (19%) had levels between 20 and 30 ng / ml (considered insufficient). an even higher percentage of vitamin d deficiency was found in the neonatal cord blood, with 279 (75.8%) having levels less than 20 ng / ml, and 55 (15%) between 20 and 30 ng / ml. there was a high correlation between maternal and cord 25(oh)d levels (r = 0.67, p < 0.001 ; figure 2). because the distribution of most cytokine levels and vitamin d concentrations was highly skewed (data not shown), we used natural log - transformed 25(oh)d and cytokine levels for correlation analysis. the result showed significant inverse correlation between maternal 25(oh)d level and il-10 response to tlr3 and tlr7 - 8 stimulation (p = 0.007 and p = 0.008, resp.) in cord blood mononuclear cells. the result still remained significant after adjusting for potential confounding factors (p = 0.004 for tlr3 and p = 0.006 for tlr7 - 8) (table 2(a)). however, neonatal cord 25(oh)d concentration was not associated with any of the tlr - triggered cytokine productions (table 2(b)). preliminary analysis was also performed on maternal innate immune function ; the result showed no correlation between maternal vitamin d status and cytokine response to tlr ligands in maternal mononuclear cells (supplement 1) (see supplementary material available online at http://dx.doi.org/10.1155/2016/8175898). by the age of one year, 321 infants had their medical records reviewed and completed the questionnaires administered at 6 and 12 months of age. analysis was made to investigate whether maternal or cord blood vitamin d status was associated with lower respiratory tract infection (bronchiolitis, pneumonia, and croup), infectious enteritis, and urinary tract infection at 1 year of age. the results, summarized in table 3, showed no significant association between maternal vitamin d status and the incidence of infection during the first year of life. cord blood vitamin d level was also not correlated with any of the infectious disorders by 12 months of age. the result from our study showed that maternal, but not cord blood vitamin d level, was associated with tlr-3 and tlr7 - 8 triggered il-10 response. to our knowledge, this is the first cohort study to simultaneously assess the effect of both maternal and cord blood vitamin d status on tlr - related immune response and various infectious diseases during infancy. despite extensive investigations on vitamin d, the reasons for various conflicting results might be due to differences in the study designs, age of the study population, definition of clinical outcomes, and also disparities in the assessment of vitamin d concentration (use of maternal blood or cord blood). our result suggested that the latter might be an important issue to consider, because despite a strong correlation between maternal and cord vitamin d level, our study had observed a distinction between maternal and cord vitamin d status in their association with tlr - triggered cytokine response. thus, when addressing the impact of prenatal vitamin d status on various outcomes, it might be important to consider that vitamin d levels in the pregnant mothers and cord blood might not always correspond uniformly. similar observations were noted in few other studies that concurrently assessed maternal and cord vitamin d concentrations. in the study of weisse although both maternal and cord blood vitamin d levels were associated with clinical food allergy, only maternal 25(oh)d3 was associated with an increase in allergen sensitization. another recent publication had demonstrated that although low levels of vitamin d in the cord blood were associated with higher airway resistance in childhood, maternal vitamin d level was not related to the children 's airway resistance. our result had observed a negative correlation between maternal vitamin d concentration and tlr - induced il-10 response. in contrast to our study, vijayendra chary. had observed lower cord blood il-10 level in vitamin d deficient or insufficient subjects. in vitro studies have also shown direct vitamin d supplementation in culture human cells to upregulate il-10 secretion [3, 2124 ]. the difference between our findings and those of published reports might be explained by distinctive study design, as ours assessed cytokine response to tlr ligands under different vitamin d concentrations, and not cytokine response to direct vitamin d stimulation. because direct vitamin d supplementation deemed to increase il-10 production, our result suggested a reduced il-10 response to tlr stimulation with higher vitamin d concentration. similar result was observed in the study of belderbos, in which they found high concentration of 1,25-ohd to suppress il-10 response to lps stimulation in adult pbmc. as a potent anti - inflammatory immune modulator, studies have shown vitamin d to downregulate tlr expression in monocytes resulting in reduced downstream cytokine production [11, 13 ]. thus, we speculated that, with increasing vitamin d level, the ability of tlr to trigger il-10 production is diminished when compared to lower concentration, thus displaying a negative correlation between vitamin d level and cytokine response to tlr stimulation. in addition, studies have demonstrated higher vitamin d levels at birth to be associated with lower number of t regulatory (treg) cells in the cord blood [2, 16 ]. since one potential source of il-10 is treg, it was speculated that higher vitamin d level would be associated with less treg cells to respond to tlr stimulation, thus resulting in lower il-10 response as seen in our study. further research is warranted to investigate the mechanism in which maternal vitamin d status affects neonatal tlr - related il-10 response. evidences have shown low production of il-10 at birth to be strongly associated with susceptibility to acute respiratory tract infections in children aged 5 years. however, in present analyses, albeit an association between maternal vitamin d level and viral tlr - triggered il-10 response, there was no effect on the prevalence of infectious diseases during the first 12 months of life. our observations are at odds with several studies that showed lower vitamin d status to be associated with increased incidence or severity of infection during early childhood. however, most studies that showed protective effect of vitamin d against respiratory diseases were of interventional studies that used supplementary vitamin d and did not measure serum vitamin d level. although the study of belderbos. demonstrated an association between low cord blood vitamin d level and increased respiratory syncytial virus infections in infancy, however, unlike our participants, around 50% of their neonates were vitamin d sufficient [2729 ]. since the majority of our participants were vitamin d deficient, it is possible that higher serum levels might be required to reach optimal protective effect to result in significant clinical differences. nonetheless, in support of our results, several studies also failed to show a difference in serum vitamin d level between children with and without respiratory infections [3032 ]. these inconsistent observations point to the complicated role of vitamin d in the immune modulation and disease process. the null results from our observation suggested that since the immune system is composed of multiple cells and variable pathways, having effect on only certain cytokines, such as il-10, might not have an overall effect on disease outcome. first, the predominantly low serum level of 25(oh)d in this study has limited our ability to determine whether there is an association between higher concentration of vitamin d and infection. it has also limited the applicability of our result in representing the general population, although inadequate vitamin d concentration seems particularly common among pregnant woman [3, 19 ]. in addition, having a majority of population with suboptimal vitamin d level, we were unable to perform analysis with commonly used clinical cut - offs of vitamin d (deficient < 20 ng / ml, insufficient 2029.9 ng / ml, sufficient 30 ng / ml). thus, future studies related to the effect of prenatal vitamin d level on neonatal innate immunity and subsequent health outcomes will need to focus on populations with more vitamin d sufficient pregnant mothers. in addition, because only cultured supernatants were harvested in this study, we did not perform tests on t regulatory cells or maturation of the monocytes. thus, our data could not provide detailed mechanism on how maternal vitamin d level affected neonatal tlr - triggered il-10 response. finally, although present study had observed an association between prenatal vitamin d status and viral tlrs - triggered response (tlr3 and tlr7/8, both of which recognize viral rna), the effect of vitamin d on cpg double stranded dna motif (tlr9) of the viral genome also demands further exploration. however, due to technical issues, analysis was only completed in very few participants. the result showed no correlation between maternal vitamin d status and neonatal tlr9 triggered cytokine response (supplement 2), though such conclusion needed to be interpreted with caution for the null correlation might be due to lack of power owing to small number of test samples. in conclusion, our study had shown that maternal vitamin d level, but not cord vitamin d, was associated with tlr3 and tlr7 - 8 triggered il-10 response. this study emphasized that even though cord vitamin d level was strongly correlated with maternal vitamin d status, the extent of impact on fetal immune cytokine response might be distinctive. although our study did not show maternal vitamin d concentration to have a significant impact on the magnitude or functional capacity of the young infant to defend against infection, we believe our study may contribute to a better understanding of the effect of prenatal vitamin d status on neonatal innate immunity and infectious disease during early life. | reports on the effect of prenatal vitamin d status on fetal immune development and infectious diseases in childhood are limited. the aim of this study was to investigate the role of maternal and cord blood vitamin d level in tlr - related innate immunity and its effect on infectious outcome. maternal and cord blood 25 (oh)d level were examined from 372 maternal - neonatal pairs and their correlation with tlr - triggered tnf-, il-6, and il-10 response at birth was assessed. clinical outcomes related to infection at 12 months of age were also evaluated. the result showed that 75% of the pregnant mothers and 75.8% of the neonates were vitamin deficient. there was a high correlation between maternal and cord 25(oh)d levels (r = 0.67, p < 0.001). maternal vitamin d level was inversely correlated with il-10 response to tlr3 (p = 0.004) and tlr7 - 8 stimulation (p = 0.006). however, none of the tlr - triggered cytokine productions were associated with cord 25(oh)d concentration. there was no relationship between maternal and cord blood vitamin d status with infectious diseases during infancy. in conclusion, our study had shown that maternal vitamin d, but not cord vitamin d level, was associated with viral tlr - triggered il-10 response. |
female genital mutilation or clitoris cutting (fgm) is defined as the partial or total removal of clitoris and labia. well known since antiquity in egypt, this practice is widespread in the world but mainly in africa [17 ]. many factors related to tradition, sexual behavior in the males, and religious beliefs impact on fgm [811 ]. the clinical observation of three cases : first in female newborn twins aged three weeks and second in an 8-year girl led us to carry out a prospective study on fgm in infants and young girls. we studied the prevalence and etiologic factors in the pediatric ward at the general hospital of abobo, a suburb of abidjan. our study also aimed to influence the parents of girls and the traditional circumcisers and practitioners to abandon the practice. not only are there laws prohibiting fgm, but there are later gynecological and obstetrical consequences of fgm. our objectives were (1) to identify fgm in infants and young girls seen in our clinic, (2) to describe the sociocultural context of young girls who had undergone fgm, (3) to assess the mothers ' fgm status and attitudes regarding the practice, (4) and to determine the clinical issues in terms of immediate or later complications. the general hospital of abobo is the premier public health entity that takes care of many patients of abobo and others from periurban areas of abidjan. this includes about 1,500,000 inhabitants or 20% of the population of the city of abidjan. eligible for the survey were infants and young girls seen at the hospital for any reason and whose mothers agreed verbally or by written consent to enter the survey and answer the questionnaire items. from 16 april to 16 december, 2007, during eight months, 409 infants and young girls aged from 1 to 14 years and their mothers entered the prospective study. these examinations were complemented by a questionnaire comprising four groups of items : (1) patient 's identification with age, native region (north, south, east, west, and center of the country), ethnic group, religion, and nationality ; (2) history and circumstances of fgm practice, age at fgm procedure, observance of ritual ceremony or not, the individuals behind the decision of fgm practice, and the motivations ; the circumciser (childbirth attendant or matron), tools used for fgm, and the occurrence of immediate complications such as bleeding, the medicines used to heal the wounds, the rituals observed during the fgm ceremony, time elapsing before full wound healing, and the fgm status of the mothers themselves ; (3) evidence of fgm by a physical general examination including the genitalia and classification of fgm, when present, according to the world health organization 's (who) classification : these are type i : sunna partial or total removal of the clitoris and/or the prepuce or excision, type ii : partial or total removal of the clitoris and the labia minora, with or without excision of the labia majora (clitoredectomy), type iii : narrowing of the vaginal orifice with creation of a covering seal by cutting and apposing the labia minora and/or the labia majora with or without excision of the clitoris (infibulations or pharaonic circumcision), and type iv : all other harmful procedures to the female genitalia for nonmedical purposes piercing, pricking, incising, scraping, and cauterization of the genitalia area (unclassifiable). ethics of our study. the general hospital consultative committee that evaluates the relevance, feasibility, confidentiality of the information obtained, and ethnical aspects of clinical research reviewed our protocol of research and gave its permission. once the mother 's oral or written consent was obtained, the same female physician organized the questionnaire, performed the physical examinations, and filled out the data sheets during both inpatients and outpatients consultations. sixty of 409 infants and young girls (15%) were diagnosed as having undergone fgm. their age distribution at the time of consultation or hospitalization was between 1 and 5 years : 19, (32%) between 5 and 10 years : 29 (48%) and between 10 and 15 years : 12 (20%). the baseline characteristics on epidemiological aspects were the earlier age at fgm practice, 19 infants under one - year old ; women were the individuals behind the decision of fgm practice (96.60%) ; several west african ethnic groups from cote d'ivoire, mali, burkina faso, benin, and niger were implicated ; muslim families 59/60 and the illiterate or low educational level of the parents 81% and 87%, respectively in mothers and fathers were found as major factors. the practitioners were traditional circumcisers ; no nurses, midwives, or physicians were involved. pain, fever, and minimal bleeding were the main symptoms and signs disclosed by the mothers surveyed. there was a potential relative risk of undergoing type ii mutilation for those under five years of age. amongst the mothers, 250 women out of 409 had had fgm (61.1%). among them, 151 had their daughters (60.4%) undergone the procedure. the details of sociocultural characteristics of our samples and the clinical findings of our patients are reported on the tables 1, 2, and 3 and figure 1 shows a fgm type ii in a 1-year - old peulh female. the main associated factors were as follows : women were the decision makers relative to fgm ; in 97% of cases, it was a grandmother, mother, or aunt who initiated the operation. fgm was encountered most often in the communities of three countries with a relative high rate in some ethnic groups as the malinke and senoufo. most families were muslim (98.3%) and most parents were illiterate, 81% and 87% in mothers and fathers, respectively. previous reports on fgm in west african women [1317 ] gave rates varying from 45 to 60% in the general population and 20 up to 87% in northern and western regions of the country. rates were high among the dan, malinke, w, and senoufo ethnic groups. the proportion of young girls has been estimated by oula in his report to be about 500 females. those were 31% for 155 children between 0 and 5 years ; 31.4% for 157 between 12 and 16 years of age ; and 38.6% in 193 women. the religions were distributed in this way : christians : 55.91%, muslims : 43.34%, and animists 0.75%. the decision makers were mainly women : grandmothers (71.6%), mothers (25.0%), and fathers (3.4%). in a survey carried out in 38,816 egyptian young school girls the motivations were religion : 33.4%, cleanliness for girls : 18.9%, cultural and ancient tradition : 17.9%, and chastity 15%. compared to the study of snow. in nigeria, similar characteristics had been found amongst young girls and women between 15 and 49 years victims of fgm and interviewed : age at fgm prior one year 371 (68.3%), between one and ten years 43 (7.9%), and ten to twenty years 88 (16.3%). the religious context in this study was pentecostals : 562 (33.1%), protestants 277 (16.3%), catholics 613 (36.1%), muslim 100 (5.9%), and others 146 (8.6%). on the other hand educational level of the surveyed girls was distributed as follows : primary : 330 (19.3%), secondary : 533 (32.2%), tertiary 767 (44.9%), and none 77 (4.5%) showing the inhomogeneous and spatial distribution of sociocultural factors in the practice of fgm. the commonest basis would be the ancient and tradition beliefs [20, 21 ]. these observations are similar to those in data from burkina faso, mali, guinea, and gambia in west africa. about the clinical findings, fgm types i and ii accounted for 100% of cases whereas in somalia, sudan and egypt, mali, and burkina faso types iii and iv were mentioned up to 89% [2325 ]. the immediate complications, such as pain, fever, and minimal or incidental bleeding as short period of bleeding (if it is severe) could be catastrophic, were probably underestimated. hemorrhages, infections, and death have been reported together with the posttraumatic stress disorders and memory problems [26, 27 ]. what is the future of our patients ? most did not have major long - term complications, after the fear and the psychological trauma of fgm, finding similar to those of althaus. these infants and young girls, once adults, could nonetheless face the late consequences of fgm. painful intercourse, bleeding, dystocia, long labor, and episiotomy needed at the time of labor have been reported by gynecologists and many nongovernmental organizations fighting for the abandonment of fgm [29, 30 ]. although in our study no major psychological troubles were encountered, posttraumatic stress disorders have been reported in patients similar to ours [3135 ]. many african countries and elsewhere in the world have laws prohibiting fgm. nongovernmental organizations (ngos) campaigns against fgm continue to fight for its abandonment [3640 ]. despite these laws and campaigns to eliminate it, fgm continues in urban and rural areas, as our study and other recent reports have shown [41, 42 ]. women, having a past history of fgm, play the key role in the occurrence of fgm in their daughters. only types i and ii mutilations have been met. the combination of law - enforcement together with information and education activities by ngo 's aimed at female populations has curtailed fgm in most countries. continuing efforts are needed to eliminate fgm as a threat to the health and wellbeing of women. | the practice of female genital mutilations continues to be recurrent in african communities despite the campaigns, fights, and laws to ban it. a survey was carried out in infants and young girls at the general hospital of abobo in cote d'ivoire. the purpose of the study was to describe the epidemiological aspects and clinical findings related to fgm in young patients. four hundred nine (409) females aged from 1 to 12 years and their mothers entered the study after their consent. the results were that 60/409 patients (15%) were cut. the majority of the young females came from muslim families (97%) ; the earlier age at fgm procedure in patients is less than 5 years : 87%. amongst 409 mothers, 250 women underwent fgm which had other daughters cut. women were mainly involved in the fgm and their motivations were virginity, chastity, body cleanliness, and fear of clitoris similar to penis. only who types i and ii were met. if there were no incidental events occurred at the time of the procedure, the obstetrical future of these young females would be compromised. with fgm being a harmful practice, health professionals and ngos must unite their efforts in people education to abandon the procedure. |
both morbidity and mortality due to gastric cancer have recently shown a downward trend in most countries worldwide. reduced morbidity has also been observed in poland, though as yet without a significant reduction in mortality rates. according to national cancer registry data, a total of 5103 new cases also, a total of 5674 deaths from this cancer type were reported in the same year. median survival of patients with inoperative or metastatic gastric cancer (imgc) does not exceed 10 months, while the maximum two - year survival rate is 10%. patients in whom surgery is not possible due to advanced cancer stage usually require palliative treatment in the form of chemotherapy. although a dozen or so different chemotherapy regimens are used in patients with inoperable cancer to improve their quality of life, no significant extension of overall survival has been achieved so far. the most commonly used cytostatics are cisplatin (ddp) and 5-fluorouracil (5fu) in various combinations. the article outlines the evolution of systemic treatment of gastric cancer throughout the last several years and discusses results of the most recent studies into the so - called personalization in medicine. even back in the 1990s, there was no consensus about the benefits of systemic treatment in imgc patients. at that time, results of several phase iii trials comparing chemotherapy with best supportive care (bsc) were published. some of the trials were stopped prematurely because early evidence was obtained both in terms of significant extension of progression - free survival (pfs) and overall survival (os) among patients receiving chemotherapy compared to bsc, p < 0.05 [3, 4 ]. furthermore, the quality of life of chemotherapy patients was found to be better than bsc patients. also, more than ten trials were conducted to compare single - drug with multiple - drug chemotherapy regimens. authors of the meta - analysis stress that toxicity was insignificantly higher in patients receiving multiple - drug chemotherapy than single - drug chemotherapy. response rates were higher in the multiple - drug chemotherapy arm, p < 0.00001. also, progression - free survival (p = 0.015) and overall survival (p = 0.00003) times were shown to be significantly longer in patients treated with multiple - drug regimens. imgc patients have also been studied in about a dozen phase iii clinical trials seeking to establish the standard regimen of palliative chemotherapy. the most commonly used drug combinations included 5fu, ddp, methotrexate (mtx), adriamycin (adm), etoposide (vp-16) and mitomycin c. wagner 's metaanalysis investigating two and three - drug regimens demonstrated longer overall survival in patients receiving three - drug combination chemotherapy. drug regimens including anthracyclines were also shown to be superior in terms of efficacy to anthracycline - free regimens. cisplatin - treated patients were found to have a longer survival than patients receiving cisplatin - free chemotherapy [9, 10 ]. the quality of life of patients treated with ddp - containing regimens was better than patients treated without cisplatin. some authors recognize the ecf scheme (epirubicin, ddp, 5fu) as the standard of care for imgc patients. others claim that no three - drug combination chemotherapy extends the overall survival compared to the two - drug regimen ddp plus 5fu. finally, it was observed that three - drug regimens might extend progression - free survival and increase the treatment response rate [8, 12, 13 ]. recent years have seen the publication of results of several phase iii trials investigating new drugs in gastric cancer patients, including fluoropyrimidines, irinotecan, taxanes and oxaliplatin. the real-2 trial demonstrated that ddp substitution with oxaliplatin eliminated the requirement for lengthy hydration and reduced the risk of complications (renal dysfunction, hearing disorders, vomiting). capecitabine administered instead of prolonged continuous infusions with 5fu was found to improve the quality of life of patients without compromising therapeutic efficacy. taxanes added to ddp and 5fu (dcf) regimens increase response rates, and extend progression - free survival and overall survival. due to considerable toxicity (neutropenic fever developing in 30% of patients), patients treated with irinotecan had longer overall survival than patients receiving irinotecan - free chemotherapy. trials comparing the standard regimen (i.e. ddp in combination with 5fu [pf ]) demonstrated an insignificantly lower occurrence rate of lethal complications in patients treated with chemotherapy regimens containing irinotecan [15, 16 ]. today, pf (ddp, 5fu) remains the most commonly used palliative chemotherapy regimen in imgc patients worldwide. response rates do not usually exceed 20 - 30%, while one - year survival rates reach 30%, with a median survival time of approximately 8 months. new molecularly targeted drugs, commonly referred to as targeted therapy, are increasingly used in clinical practice to treat patients with malignancies. for example, trastuzumab has been approved for patients with her2-overexpressing breast cancer, while bevacizumab, cetuximab and panitumumab have been approved for colorectal cancer. the epidermal growth factor receptor (egfr) pathway is a commonly known pathway which plays an important role in oncogenesis. egfr overexpression is often seen in excised specimens of malignant gastrointestinal tumours. in gc patients, her2 overexpression is more common in the intestinal type, tumours located proximally or in the gastroesophageal junction, higher - stage cancer, spreading to the lymph nodes and at the stage of liver metastases ; it is associated with more rapid disease progression and shorter survival [17, 18 ]. results of a phase iii trial on the addition of trastuzumab to pf chemotherapy in her2 overexpressing patients (toga) were presented during the 2009 asco meeting. overall survival was found to be significantly longer among patients in the trastuzumab arm (13.5 vs. 11 months), p = 0.0048. on that basis, trastuzumab was approved for the therapy of patients with metastatic gastric cancer and her2 overexpression. results of the toga trial demonstrating the efficacy of targeted therapy in a selected group of patients created a foundation for further studies into egfr inhibitors in gc therapy. also, by analogy to breast cancer treatment, lapatinib is currently being investigated as second - line therapy in gastric cancer patients who have previously failed trastuzumab treatment. k - ras or b - raf mutations are rarely observed in excised specimens of malignant gastric tumours. the finding forms a basis for attempts to use cetuximab or bevacizumab for gc treatment. for the time being, the only reports of efficacy of antiangiogenic therapy in imgc patients come from non - randomized phase ii trials. in one of them, the response rates were 65%, while progression - free survival was 8.3 months and overall survival was 12.3 months. at the same time, however, bevacizumab was associated with frequent severe complications, mostly thromboembolic incidents and gastrointestinal perforations [20, 21 ]. in another trial, results of the avagast phase iii trial designed to evaluate the efficacy of bevacizumab combined with capecitabine and ddp, compared to chemotherapy alone, are currently being awaited. magic-2, another trial which is now in progress, seeks to evaluate the efficacy of bevacizumab for neoadjuvant treatment. yet another trial, expand, is designed to clarify the role of cetuximab combined with ddp and capecitabine in first - line treatment of imgc patients. also, results are yet to be announced for trials investigating combinations of chemotherapy with other angiogenesis inhibitors (sunitinib, sorafenib, cediranib or axitinib), other egfr inhibitors (panitumumab, matuzumab) and inhibitors of intracellular tyrosine kinase domain (gefitinib, erlotinib, lapatinib, canertinib). researchers expect that new molecules will improve efficacy levels and reduce chemotherapy - induced toxicity in patients suffering from disseminated gastric cancer. however, with the exception of trastuzumab, no targeted drug has as yet been approved for the therapy of gc patients. as is commonly known, gc is disseminated both by blood and lymph circulation, and into the peritoneum. some authors point to an increased risk of digestive obstruction during irinotecan treatment in patients with gc metastasizing to the peritoneum. japanese studies have shown the survival rates of patients with peritoneal metastases treated with irinotecan - containing regimens to be significantly shorter compared to patients treated without irinotecan. on the other hand, the survival rates of patients receiving the same therapy, though with different metastatic sites, were found to be longer [15, 23 ]. s-1 (tegafur, gimeracil, oteracil), which is widely used in asia, is thought to be more toxic in caucasian than asian populations. two trials (flags and s.c.-101) demonstrated longer os survival in patients treated with the s-1 regimen combined with ddp in the chinese and japanese populations compared to the caucasian population, in which the drugs were also found to be more toxic [2325 ]. the majority of other patients experience tumour progression during the course of the disease [24, 26 ]. it is not clear whether second - line systemic treatment, followed by third - line and beyond, has an effect on the survival of gs patients. it seems, however, that gc patients may benefit from this type of management similarly to patients suffering from colorectal cancer. a phase ii trial assessing the efficacy of irinotecan combined with capecitabine in patients who have failed their ddp + 5fu therapy has shown that with reduced drug doses the regimen is safe and produces high response rates. the growing number of new active and easily accessible drugs gives grounds to believe that patients may benefit from further therapy, even though biological differences between gastric and colorectal cancers are indisputable. regardless of the number and quality of available drugs, however, it should be remembered that advanced gastric cancer is associated with extremely poor prognosis. therefore, the overriding goal of therapy should always be to improve the quality of patients life. since new therapies, opening up new treatment possibilities, are becoming more easily accessible, gc patients and their families can hope for more effective and safer treatment. expanding knowledge of gc biology makes it possible to individualize treatment to the patient, not only to cancer type. for example, chemotherapy can be combined with trastuzumab in gc patients with her-2 overexpression. some authors claim that patients with peritoneal metastases should not be treated with irinotecan because of elevated risk of digestive obstruction. in caucasian patients the outcomes of numerous studies into new targeted drugs for gc therapy are currently awaited. patients who are in poor general condition (zubrod score 2) should not be deemed eligible for systemic treatment. patients with a zubrod score < 2, depending on their comorbidities and therapeutic possibilities of the medical centre, can receive systemic or supportive therapy, or be enrolled in clinical trials (nccn v.2010 gastric cancer, 34). | gastric cancer is one of the most frequent neoplasms. although the incidence of gastric cancer worldwide has declined, there is still high mortality. treatment of inoperable disease is under evaluation in clinical trials. in palliative treatment chemotherapy containing cisplatin and 5-fluorouracil is the most widely used.in the past years progress in tumour biology has advanced greatly and has led to development of new molecules aimed at targets important for cancer expansion. there are several randomized trials under targeted therapies for gastric cancer patients. one of them led to approval of trastuzumab.in the current paper the authors illustrate new possibilities in systemic treatment with particular attention to targeted therapy and personalization in medicine. |
a 19-year - old male patient reported with a swelling in the posterior portion of his palate, which was present for the past 3 months. on examination, the swelling was 2 2 cm in dimension, extending anteriorly from the posterior portion of the hard palate, laterally 6 mm away from the left alveolar margin, medially 2 cm from the right alveolar margin, and posteriorly 1 cm anterior to the uvula [figure 1 ]. the swelling was firm in consistency, nontender, and had no fixity to the overlying palatal mucosa or the underlying bone. preoperative intraoral picture of the lesion incisional biopsy was done, and the lesion was diagnosed as pleomorphic adenoma arising from the minor salivary glands in soft palate region after histopathologic examination and clinical correlation findings. reconstruction of the soft palate defect after the tumor excision was done by using bipedicle rotational and advancement of palatal pedicle flaps [figure 2b ], following which prefabricated surgical splint was placed. (a) excised tumor mass (b) intraoperative picture after reconstruction the postoperative recovery was uneventful. the palatal splint was removed after 1 week. on reviewing the patient after 1 month, the reconstructed surgical defect with bipedicled rotation and advancement flaps were healing uneventfully [figure 3 ]. pleomorphic adenoma is a mixed salivary gland tumor originating from the epithelial and mesodermal elements. it consists of acini, cords, and thin strands of epithelial cells suspended in a stroma which often has a myxomatous appearance. however, some cases exhibiting rapid growth have been reported.[24 ] lopez - ce - drun. reported a case of pleomorphic adenoma in the palate of a 16-year - old male patient which was noted only 2 weeks before his presentation. most cases of palatal pleomorphic adenoma cause not only a bulge in the palatal mucosa, but also erosion of the palatal bone as well. in our case report, the patient presented with a painless swelling in the soft palate, which was noted 3 months before his presentation. the noninvasive diagnostic aids for salivary gland tumors include ultrasound, computerized tomography, and magnetic resonance imaging. these are useful methods in determining the size of the lesion as well as verifying any bony involvement.[68 ] overall, the prognosis for pleomorphic adenomas of minor salivary glands is generally considered to be better than that for those arising in the parotid salivary gland. we did wide excision of the tumor with clear margins, followed by reconstruction of the defect created by the surgical excision. the reconstruction technique used was bipedicled palatal rotation and advancement flap, which was used to cover the surgical defect. this technique is versatile for reconstruction of soft palatal defects created by surgical excision of the tumors. hence, we conclude that this particular case report occurring in a young adolescent is rare and the technique used for reconstruction was versatile and at the same time simple to perform. | pleomorphic adenoma generally occurs in the 4thand 5thdecade of life. the adenoma is an uncommon presentation and is exceedingly rare in children and young adolescents. this case report deals with the diagnosis and surgical management of pleomorphic adenoma in the soft palate region in a young adolescent patient. |
gitelman 's syndrome (gs) is a rare autosomal recessive, renal tubular disorder characterized by chronic hypokalemia, hypomagnesemia, metabolic alkalosis, hypocalciuria, modest hyperreninemia, minimal - to - absent volume depletion, and a low normal blood pressure, with a normal glomerular filtration rate. this disorder is linked to the gene encoding the thiazide sensitive na - clco - transporter (ncc) located on chromosome 16q[13 ] (without affecting the furosemide - sensitive carrier). this report presents an affected 52-year - old female, with emphasis on distal nephron functional studies with furosemide and hydrochlorothiazide and reviews gs. the 52-year - old female, a housewife, presented with a history of an unknown insect bite in the medial part of her left thigh, three weeks ago, followed by development of a deep crater like ulcer with gradual development of fever in an unremitting course. after completion of systemic antibiotic therapy and proper surgical debridement of her thigh lesion the patient was seen to be in a haggard condition lying in a listless posture. on detailed questioning she reported bilateral proximal upper and lower limb muscle weakness, which was objectively confirmed. on further probing several such episodes were revealed, which used to precipitate during exertion. throughout her course in the hospital she was normotensive (110/70 mmhg 7/5 mmhg), with a normal renal function (serum urea 13 mg / dl and creatinine 0.72 mg / dl). on evaluating the muscle weakness, persistent hypokalemia was noticed, with a potassium level of 1.31 (0.75) mmol / l. an arterial blood gas showed metabolic alkalosis and a detailed biochemical examination showed hypocalcemia and hypomagnesemia. both her plasma rennin activity and plasma aldosterone level were modestly elevated [table 1 ]. patient 's biochemical profile to evaluate the hypokalemia and metabolic alkalosis, we excluded surreptitious diuretic use, extracellular volume contraction (diarrhea or vomiting) or a post - hypercapnic state. urinary electrolytes were measured, which revealed urine cl above 20 meq / day, which excluded a chloride - responsive cause of metabolic alkalosis, and a urine k above 30 meq / day, which was consistent with a primary tubular disorder. a family history of bartter 's syndrome was absent and a provisional diagnosis of gitelman 's syndrome was made. an ultrasonographic examination of the abdomen did not reveal any evidence of nephrocalcinosis, and an electrocardiogram (ecg) and stress echocardiography were within normal limits. to assess the tubular function, she was interrupted from any pharmacological therapy for 10 days before the studies and allowed an unrestricted diet. after overnight fasting, the patient drank water (20 ml / kg of body weight) over 20 minutes and received intravenous infusion of 0.45% saline at a rate of 40 ml / hour. urine output was measured every 20 minutes followed by additional water intake (urine volume plus 20 ml / 20 minutes).when urine flow reached a maximum level, samples of blood and urine were obtained, to calculate the basal values of the parameters described a little later in the text. for thiazide loading test, 100 mg of hydrochlorothiazide was orally administered to the patients. for the furosemide loading test, 40 mg of furosemide was given intravenously to the patients. in both tests, the clearance data were obtained when the urine flow was maximum. the parameters used were : solute - free water clearance (ch2o) = v (1 uosm / posm), where v = urine flow rate in ml / min, uosm = urinary osmolality, posm = plasma osmolality. chloride clearance (ccl) = v ucl / pcl, where ucl = urinary chloride concentration, pcl = plasma chloride concentration. distal fractional chloride reabsorption (dfcr) = ch2o/ (ch2o + ccl) fractional distal delivery of chloride (fddc) = (ch2o + ccl) / creatinine clearance fractional excretion of a solute [x ] (fex) = 100 (ux / px) (pcr/ ucr), where, pcr = plasma creatinine concentration, ucr = urinary creatinine concentration, x was taken as na (sodium), k (potassium), and cl (chloride). the basal values showed a markedly high value of fek of 31.15% (normal 4 16% with a mean of 8%). furosemide loading resulted in a marked increase in fena, fek, and fecl, with reduced free water clearance and chloride clearance, while thiazide loading did not significantly alter the free water clearance or chloride clearance, but did result in an increased fractional excretion of solutes, but to a lesser extent than that caused by furosemide [table 2 ]. gitelman 's syndrome (gs), also known as a hypocalciuric variant of bartter 's syndrome (bs) or as familial hypokalemia - hypomagnesemia, is an autosomal recessive inherited disorder, first described by gitelman., in 1966. gs is caused by inactivating mutations in the gene for the thiazide sensitive ncc (thiazide - sensitive ncc) of the distal convoluted tubule, called slc12a3. patients with gitelman 's syndrome are usually normotensive, which differentiate them from patients with liddle 's syndrome. hypomagnesemia, although an important feature of the typical gs, may be absent in some patients. patients with gs present in adult life, differentiating it from most forms of bartter 's syndrome. most patients with gs are asymptomatic or complain of mild intermittent cramps or muscle weakness, with a few developing chondrocalcinosis, with increased bone mineral density, choroidal calcification or rarely prolongation qt interval, with development of fatal cardiac arrhythmia. in our patient, the diagnosis of gs was made after the patient was found lying listlessly, and had muscle weakness. as primary hypokalemic periodic paralysis rarely presents after the age of 25 years, a diagnosis of secondary hypokalemic periodic paralysis was entertained. the classical presentation of hypokalemia, hypomagnesemia, hypocalcicuria, a normal blood pressure, modestly raised plasma rennin, and aldosterone activity clinches the diagnosis of gitelman 's syndrome. our patient did not share any of the more sinister complications listed here. in our study, thiazide induced blunted natriuresis and chloruresis as compared to the markedly increased values obtained with furosemide. the ccl and dfcr showed an abrupt change after furosemide administration, while thiazide had little effect on our patient. the most likely explanation for this data is the decreased diuretic effect of thiazide in gs patients, owing to the genetic defect of gs resulting in reduced nacl reabsorption via the thiazide sensitive na / clsymporter of the distal convoluted tubule. the relationship between fddc and dfcr is shown in figure 1, with data borrowed from gill and bartter. our patients basal values were in between the surreptitious vomiting and bartter 's syndrome (bs) groups, but closer to the former. fddc (x axis) versus dfcr (y axis) (sv = surreptious vomiting ; bs = bartter 's syndrome ; bv = basal value ; tlt = thiazide loading test ; flt = furosemide loading test) similar results were also obtained by previous workers. in agreement with the previous studies we believe this differential response owes it origin to the differential placement of receptors for the different diuretics. as furosemide acts in the loop of henle that is anatomically proximal to the distal convoluted tubule (dct), which is the primary site of the receptor defect in gs, administration of furosemide results in increased distal delivery of the chloride, as reflected by the increased fddc. this increased chloride load in dct fails to get reabsorbed, due to the basic pathophysiology of gs, resulting in a marked reduction of dfcr. on the other hand thiazide therefore, use of the furosemide loading test localizes the defect in gs to a distal tubular location and the thiazide loading test nails the location to the thiazide - sensitive ncc. this observation is of immense importance in a resource poor setting like india, where this study was located, and where genetic testing for a disease like gs is practically out of the question for most patients. these two simple and easy to perform bedside tests can easily clinch the diagnosis of gs. differentiation of gs from bs using one or the other tests has been reviewed earlier. we also propose the use of the normogram [figure 1 ], which originally appeared in the classic article by gill and bartter. the placement of basal values close to the surreptious vomiting (sv) group, a marked change effected by the furosemide loading test (flt) group, and the minimal change caused by the thiazide loading test (tlt) group may be used as a simple graphical measure to diagnose gitelman 's syndrome. the only two other case reports from india did not make use of the renal clearance studies used in this article. to the best of our knowledge, this is probably the first reported case of gitelman 's syndrome in india, where these two simple techniques have been used to localize the site of the renal tubular defect and to confirm the diagnosis. | gitelman 's syndrome is a rare autosomal recessive, renal tubular disorder, characterized by chronic hypokalemia, hypomagnesemia, metabolic alkalosis, hypocalciuria, and normal blood pressure. patients usually present at a later age with episodic mild muscle weakness. unexplained hypokalemia arouses suspicion. the diuretic loading test with furosemide and thiazide and the use of bartter 's normogram provides a practical and simple tool in comparison to the complex and costly genetic analysis, to confirm the diagnosis. here we report a case of gitelman 's syndrome to show the utility of these simple techniques to explain the pathophysiology of the disease, as well as to localize the site of the renal tubular defect, to confirm the diagnosis. |
endovascular treatment of intracranial aneurysms by endovascular coiling has become an alternative treatment to surgical clipping, with lower morbidity and mortality rates in selected cases.17) however, the possibility of coil migration and long - term angiographic recurrence pose limitations in the treatment of complex or wide - necked aneurysms.17)23) self - expanding stents allow denser aneurysm packing with increased neck coverage, and may also improve treatment durability through a combination of flow - diversion, parent vessel straightening, and fibroelastic tissue formation along the neck of the aneurysm.14)23) currently, two stents have been approved for stent - assisted coiling in the usa : the enterprise vascular reconstruction device (enterprise ; codman neurovascular / johnson & johnson, raynham, ma, usa) and the neuroform stent (neuroform ; boston scientific / stryker, kalamazoo, mi, usa). the enterprise is a self - expandable nitinol stent with a highly flexible closed - cell design. the stent can be delivered through a standard microcatheter, technically easier than the exchange procedure.20)23) there are many reports of the feasibility and safety of stent - assisted coiling. however, little information is available regarding the follow - up results of the technique. thus, in this study, we report our initial and follow - up clinical experience with enterprise stent placement in 39 consecutive patients with 40 wide - neck intracranial aneurysms. we reviewed the clinical and radiological records in a single - center registry of all patients who were treated with enterprise stent - assisted coil embolization during the 30-month period from june 2009 to december 2011. thirty - nine patients with 40 wide - necked aneurysms were enrolled, including nine men and 30 women with mean age 61.3 years (range 44 - 85 years). thirty patients were asymptomatic, four had cerebrovascular accident sequelae, and five had suffered acute subarachnoid hemorrhage. a " wide - necked " aneurysm was defined as having a neck of > 4 mm diameter or an aspect ratio of > 2.0. twenty - eight aneurysms were located in the anterior and 12 in the posterior circulation (table 1). one aneurysm had reopened after prior coil embolization, while 39 had not been treated. clopidogrel 300 mg per day was given in the morning of the procedure in patients with unruptured aneurysms. because of the risk of rebleeding, no premedication with platelet inhibitors was administered to patients with acutely ruptured aneurysms unless thromboembolic events occurred. heparin was administered for anticoagulation in a bolus infusion of 4000 iu, followed by 1000 iu / h. three neurointerventionalists reviewed the angiographic records. angiographic results were classified as : complete occlusion (no contrast filling the sac), remnant neck (residual filling of the neck), and remnant sac (residual filling of the sac).22) during follow - up, the aneurysm could change from one class to another or remain unchanged. if conventional angiography was not feasible, 3.0-tesla magnetic resonance angiography (mra) was performed. the mean aneurysm neck size was 5.58 mm (range 3 - 15.1 mm). complete occlusion was achieved in 8/40 (20%) of all stent - assisted cases, while a remnant neck was found in 6/40 (15%) and a remnant sac was observed in 26/40 (65%) (table 2). an embolic infarction was seen on diffusion mr imaging (mri) that was performed to investigate transient hemiparesis. after several days ' observation, the patients were discharged without any symptoms. in one patient, in - stent the next day, the thrombus was not visible on angiography and the patient had no symptoms. in another patient (pt. 2 in table 1), acute middle cerebral artery occlusion occurred as a result of in - stent thrombus. prompt chemical thrombolysis was carried out with abciximab (10 mg) and urokinase (100,000 u), achieving recanalization and a thrombolysis in cerebral infarction (tici) score of 2b. however, a multiple embolic infarction in the middle cerebral arterial territory was seen on diffusion mri. consequently, this patient had morbidity 3 on the modified rankin scale (mrs). one thromboembolic event caused procedure - induced morbidity (2.5%). among the 39 patients, 29 had an mrs at discharge of 0, four patients had a score of 1, two patients had a score of 3, three patients had a score of 5 and one patient had a score of 6. table 1 summarizes the major findings and results for each of the 40 aneurysms in 39 patients. angiographic follow - up was available in 18 of the 40 treated aneurysms and ranged from 6 to 23 months (mean 11.3 months). one of three with a remnant neck had progressed to complete occlusion, one remained unchanged and one showed recanalization. three of the 13 aneurysms with a remnant sac had evolved to remnant neck, while ten were completely occluded. thus, in 18 aneurysms treated with enterprise stent - assisted coiling, angiographic follow - up showed 13 complete occlusions (72.2%) and four with a remnant neck (22.2%), while major recanalization to a remnant sac was observed in one aneurysm (5.6%) (table 3). additional coiling was performed without complications in the aneurysm that was recanalized. in the patients with angiographic follow - up, no evidence of stent miration or in - stent thrombosis was observed (fig. 1, 2). as an alternative, mra follow - up was used in five treated aneurysms after 10 to 36 months (median, 12 months). no evidence of recurrence was seen in any of these studies (table 4). the mean aneurysm neck size was 5.58 mm (range 3 - 15.1 mm). complete occlusion was achieved in 8/40 (20%) of all stent - assisted cases, while a remnant neck was found in 6/40 (15%) and a remnant sac was observed in 26/40 (65%) (table 2). an embolic infarction was seen on diffusion mr imaging (mri) that was performed to investigate transient hemiparesis. after several days ' observation, the patients were discharged without any symptoms. in one patient, in - stent the next day, the thrombus was not visible on angiography and the patient had no symptoms. in another patient (pt. 2 in table 1), acute middle cerebral artery occlusion occurred as a result of in - stent thrombus. prompt chemical thrombolysis was carried out with abciximab (10 mg) and urokinase (100,000 u), achieving recanalization and a thrombolysis in cerebral infarction (tici) score of 2b. however, a multiple embolic infarction in the middle cerebral arterial territory was seen on diffusion mri. consequently, this patient had morbidity 3 on the modified rankin scale (mrs). one thromboembolic event caused procedure - induced morbidity (2.5%). among the 39 patients, 29 had an mrs at discharge of 0, four patients had a score of 1, two patients had a score of 3, three patients had a score of 5 and one patient had a score of 6. table 1 summarizes the major findings and results for each of the 40 aneurysms in 39 patients. angiographic follow - up was available in 18 of the 40 treated aneurysms and ranged from 6 to 23 months (mean 11.3 months). one of three with a remnant neck had progressed to complete occlusion, one remained unchanged and one showed recanalization. three of the 13 aneurysms with a remnant sac had evolved to remnant neck, while ten were completely occluded. thus, in 18 aneurysms treated with enterprise stent - assisted coiling, angiographic follow - up showed 13 complete occlusions (72.2%) and four with a remnant neck (22.2%), while major recanalization to a remnant sac was observed in one aneurysm (5.6%) (table 3). additional coiling was performed without complications in the aneurysm that was recanalized. in the patients with angiographic follow - up, no evidence of stent miration or in - stent thrombosis was observed (fig. 1, 2). as an alternative, mra follow - up was used in five treated aneurysms after 10 to 36 months (median, 12 months). no evidence of recurrence was seen in any of these studies (table 4). wide - necked aneurysms are difficult to treat, either surgically or endovascularly, because of their unfavorable geometry, which reduces the possibility of achieving dense packing and elimination of the aneurysm from the circulation. the stent serves as a scaffold in the parent artery to prevent coil migration.17) furthermore, stent placement across the aneurysm neck enables additional obliteration by denser and safer packing of the aneurysm lumen and may improve aneurysm occlusion by redirection of flow.11)12)17) the enterprise stent is the first closed - cell stent designed to treat wide - necked intracranial aneurysms. advantages of the design include the ability of the stent to be partially deployed, recaptured, and redeployed, and it may improve the stability of coils within the aneurysm.12) furthermore, the enterprise stent 's delivery system facilitates its navigation and placement. reported rates for the inability to navigate or deploy the neuroform stent are as high as 19.8%, compared with only 0 - 5% for the enterprise. despite recent improvements in the delivery system, the failure rate of the neuroform has remained high.1)2)6)12)19) however, concerns have been raised in experimental and clinical reports regarding the conformability and apposition of the enterprise stent 's closed - cell design within curved vessels.4)9) furthermore, heller. found that incomplete stent apposition, as assessed by 3-tesla mra, was more common in enterprise (55%) versus neuroform stents (0%).10) for this reason, problems such as stent migration, in - stent restenosis, and periprocedural thromboembolism can occur frequently. for example, kadkhodayan.12) reported that the periprocedural rates of transient ischemic attack and periprocedural stroke were higher for the enterprise (6.1% and 2.6%, respectively) than for the neuroform (1.4% and 0%, respectively). cases of stent migration have been reported.13)15) however, despite the structural weaknesses, numerous other studies reported that periprocedural stroke, in - stent thrombosis, stent migration and clinical outcome did not differ between the enterprise and the neuroform.3)5)7)11)24) with intracranial atherosclerotic disease, thromboembolic events such as periprocedural stroke and in - stent thrombosis occur frequently.18) however, stent - assisted coiling is associated with a low rate of thromboembolic events. exceptionally, in the case of subarachnoid hemorrhage, the risk of hemorrhage or a thromboembolic event is increased.3) chalouhi. analyzed 508 patients with 552 aneurysms who were treated with stent - assisted coiling. the risks for procedural complications were subarachnoid hemorrhage and aneurysm location (carotid terminus, middle cerebral artery). the risks for recanalization were age, retreatment, large size, incomplete occlusion, neuroform stent, and aneurysm location, and for a worse clinical outcome were subarachnoid hemorrhage, age, and procedural complication.3) ease of use may influence periprocedural risk. if a device is difficult to use, the operator may need to make several attempts. as a result, the procedure time will increase and the doctor 's concentration may be affected, raising the risk of complications. thus, ease of use can have a strong effect on the angiographic and clinical outcome. in our study, the immediate angiographic results were disappointing, showing only 20% cases with complete occlusion, 15% with a remnant neck, and 65% with a remnant sac. however, angiographic follow - up showed an improvement, with 72% complete occlusion, 22% remnant neck, and only 6% recanalizations (fig. 1, 2). these results are consistent with the pattern reported in a recent large study,8) and agree with other recent reports that stent - assisted coiling has a favorable long - term outcome.11)12)14)17) however, enterprise can cause thromboembolic complications.12) in the patients who had angiographic follow - up, evidence of stent migration or in - stent thrombosis was not observed. furthermore, in the cases that had only mra follow - up, there was no evidence of recurrence. this study showed that stent - assisted coiling is an effective treatment that stabilizes or improves the long - term anatomical results in most cases. however, there is a possibility of thromboembolic events due to the use of the stent. although this study is limited by its retrospective nature, these results indicate that enterprise stent - assisted coil embolization is an effective technique in the treatment of wide - necked cerebral aneurysms. further studies are needed to evaluate the long - term durability of stent - assisted aneurysm occlusion and the rate of thromboembolic events due to stent use. | objectiveself - expanding stents are increasingly used for the treatment of complex intracranial aneurysms. the purpose of this study was to evaluate the usefulness and safety of a self - expanding nitinol stent (enterprise) in the treatment of wide - necked intracranial aneurysms.methodsthis was a retrospective study of 39 patients with 40 wide - necked intracranial aneurysms who were enrolled in a single - center registry of patients treated with the enterprise between june 2009 and december 2011. thirty patients were asymptomatic, four had cerebrovascular accident sequelae, and five had suffered subarachnoid hemorrhage. one aneurysm had reopened after prior coil embolization, while 39 had not been treated. clinical charts, procedural data, and angiographic results, including both immediate post - procedural angiograms and follow - up imaging, were reviewed.resultsthe mean neck size of the aneurysms was 5.58 mm (range 3 - 15.1 mm). embolization was successful in all patients. there were five procedure - related events. there were no fatalities, but one procedure - related morbidity was noted. the immediate angiographic results included eight complete occlusions (20%), six remnant necks (15%), and 26 remnant sacs (65%). at angiographic follow - up (mean : 11.3 months), out of 18 of the aneurysms treated with stent - assisted coiling, there were 13 (72.2%) complete occlusions, four (22.2%) remnant necks, and one recanalization (5.6%).conclusionstent - assisted coiling using the enterprise is effective for the treatment of wide - necked intracranial aneurysms. further angiographic and clinical follow - up investigation will be needed for evaluation of the long - term outcomes. |
idiopathic choroidal neovascularization (icnv) occurs in patients younger than 50 years without any other predisposition for choroidal neovascularization (cnv). the pathological basis of icnv and age - related macular degeneration (amd) are similar ; both present as choroidal neovascularization in the macular region and cause bleeding, oozing, and fibrous scarring. these pathological changes are closely related to vascular endothelial growth factor (vegf) expression. although icnv may have better prognosis than amd, it occurs mainly in young people, and is therefore more devastating. in recent years, a number of reports have shown that bevacizumab, one of the anti - vegf monoclonal antibodies, achieved good effects in treating icnv [3, 4 ]. in 2012, after ranibizumab was approved for sale in china, we used it to treat icnv. we achieved good effects in some patients, but it had a limited effect in other patients. therefore, we reviewed our icnv patients and allocated them into two groups according to the length of the treatment course, the early group and the mid group, to observe the effects in the different groups and the effect of disease duration on prognosis. from january 2012 to december 2012, 44 patients were diagnosed with icnv in one eye with disease duration of 6 months. among them were 15 men (15 eyes) and 29 women (29 eyes) ; the patients were aged 1849 years with a mean age of 32.57 7.13 years and a mean disease duration of 49.07 17.65 days. all patients underwent a visual examination based on the early treatment diabetic retinopathy study (etdrs) eye chart, indirect ophthalmoscopy, fundus fluorescein angiography (ffa), optical coherence tomography (oct), and other tests depending on the duration of their disease, that is, 15 etdrs letters, and the difference was statistically significant (= 4.130, p = 0.042). iop at baseline was normal in both groups at 13.9 4.1 mmhg in the early group and 15.2 3.9 mmhg in the mid group (p = 0.291). no significant differences were observed from baseline iop values in either group at any time point examined. additionally, there was no difference in iop between the two groups at 1, 3, 6, 9, or 12 months. although there were no significant changes in mean iop from baseline, three eyes had an iop of 21 mmhg (25 mmhg). the average number of injections administered in the mid group was 2.53 1.76 injections. this was significantly higher than the 1.22 1.01 injections administered to the early group (t = 3.090, p = 0.0035). no significant cataract formation was observed, and no serious complications from the injection procedure (e.g., endophthalmitis or retinal detachment) occurred. icnv is not uncommon in chinese patients, and it is one of the causes impairing visual function of young adults. it is conventionally treated mainly with pdt ; however, pdt may cause temporary ischemia, can damage the retinal pigment epithelium (rpe) in the irradiated portion, can increase vegf reactivity, and cause cnv lesions to recur [7, 8 ]. in recent years, ranibizumab became a first - line therapy for amd. because icnv and amd have similar pathologies, ophthalmologists began using ranibizumab to treat icnv after it was approved in china in 2012. while some patients responded well to this drug, others responded poorly, and relapse occurred in some others. we retrospectively evaluated our treated patients after dividing them into early and mid - groups according to disease duration and investigated the necessity and clinical efficacy of early treatment. bcva was significantly improved in both the early and mid - groups. additionally, bcva was statistically different between the two groups at all time points examined. cmt as measured by oct was significantly reduced from baseline values in both groups at all follow - ups. there was a significant difference in cmt between the groups at all time points. at the last follow - up visit (12 months), 19 eyes (79.1%) in the early group and 10 eyes (50.0%) in the mid group had a visual gain of > 15 etdrs letters, and the difference was statistically significant (= 4.130, p = 0.042)., cnv progresses from bleeding and oozing to the gradual processes of scarring and fibrosis ; therefore, early lesions have more reversible components ; thus the treatment effect was superior. the mean number of injections in the early group (1.22 1.01) was significantly lower than that in the mid group (2.53 1.76 injections, p = 0.0035). therefore, it is possible that early injection of ranibizumab may reduce the number of injections required for icnv treatment. fewer injections mean lower costs, and this is particularly beneficial for patients who struggle to pay for the high cost of repeated injections. additionally, average iop was not statistically different between the two groups at any time point examined. the duration of icnv mainly depends on the patients ' attitude, which to some extent is subjective ; however, patients employed in the present study were young adults, with typically good vision who were sensitive to their vision changes. once decreased vision or visual distortion occurred, they could generally notice it in a timely manner. in addition, patients with other diseases causing visual impairment were excluded ; this also helps to improve the accuracy of the estimated disease duration. nevertheless, our study is limited by its small sample size and relatively short follow - up period. this study shows that early treatment of icnv can result in better visual prognosis, more obvious cmt decrease, and fewer numbers of injections over a 1-year follow - up period. further studies with a longer follow - up period and a larger number of patients are warranted to further assess the efficacy and necessity of intravitreal injections of ranibizumab for icnv. | background. to compare visual outcomes and spectral - domain optical coherence tomography results following intravitreal ranibizumab treatment for early and mid - idiopathic choroidal neovascularization (icnv). methods. this retrospective, case - controlled study examined 44 patients with icnv in one eye initially treated with intravitreal ranibizumab (0.5 mg). further intravitreal treatments were administered as necessary. patients were divided into two groups according to disease duration, that is, 3 months or 36 months (early and mid - groups), and the data were compared. results. all patients completed at least 12 months of follow - up. significant differences were observed between the groups in best - corrected visual acuity and in central macular thickness (cmt) reduction at all five follow - up visits. at the last follow - up (12 months), 19 early group eyes (79.1%) and 10 mid group eyes (50.0%) had statistically significant visual gains of > 15 early treatment diabetic retinopathy study (etdrs) letters (2 = 4.130, p = 0.042). the mean number of injections was significantly higher (p = 0.0001) in the mid group (2.53 1.76) than in the early group (1.22 1.01). conclusions. early intravitreal ranibizumab for icnv can result in better visual prognoses, more obvious decreases in cmt, and fewer injections. |
hypertension is a condition associated with high morbidity and mortality.1 it is also a risk factor, albeit, a manageable one, for conditions like stroke, kidney failure, heart failure, and myocardial infarction.2,3 as of 2004, one out of every three individuals in the us was diagnosed with hypertension. this translates to 72 million americans in 2004.4 by 2030, an additional 27 million individuals are expected to be diagnosed with hypertension.5 the comorbidities, high prevalence rates, and the chronic nature of hypertension generate substantial economic burden for both the patient and the us health care system. the total hypertension - related costs are projected to rise from us$93.5 million in 2010 to us$240.1 million in 2030.5 previous research has shown that systematic control of blood pressure can result in considerable cost savings.6,7 additionally, pharmacoeconomic analysis and comparative effectiveness research can help in determining cost - effective treatment choices leading to additional cost savings. the treatment regimen for hypertension is burdensome for the patient in terms of cost and adherence considering the fact that it is a chronic condition that is usually treated with two or more medications.8 research has shown that adherence to a treatment regimen can lead to better clinical outcomes.6,9,10 however, in the general population, adherence to all antihypertensive drug classes has been suboptimal, and the adherence to beta - blockers and diuretics has been the lowest amongst all antihypertensive drug classes.6,9 to increase adherence to the antihypertensive treatment regimen by reducing the pill burden, many medications are currently available in a once - daily dosage form. once - daily medications reduce the pill burden and, as a result, may improve adherence by providing more convenience to the patient.6 as the clinical outcomes for both the preparations are similar because of the identical active ingredient, it would be interesting to find whether the improvement in adherence can offset the additional cost by producing savings in overall health care expenditure. in this study, the authors attempted to answer this question by analyzing the health care expenditures and the drug expenditures of the two products of metoprolol in the treatment of hypertension. metoprolol tartarate (mt), which is taken twice a day, and metoprolol succinate (ms), an extended - release form, taken once a day in the treatment of hypertension. both mt and ms are food and drug administration (fda) approved for the treatment of hypertension and angina pectoris ; however, ms is also fda approved for the reduction of mortality in patients with heart failure (new york heart association class ii or class iii).11 studies have shown similarity in outcomes between the two products in the treatment of hypertension.12,13 however, they are different in terms of their cost. ms has an average wholesale price (awp) of us$52.45/30 pills (30-day supply), and mt has an awp of us$34.09/60 pills (30-day supply).14 moreover, the acquisition price of both mt and ms could be much lower since both of these drugs are available as generic products. the main objective of this study was to compare the impact of the metoprolol products on overall health care expenditure and prescription drug expenditure using population - based data of matched cohorts. the authors examined whether a specific type of metoprolol product was associated with changes in total health care expenditures and prescription drug expenditure. data from the 2008 medical expenditure panel survey (meps) was used to perform a retrospective cross - sectional analysis. meps is a nationally representative database maintained by the agency for healthcare research and quality under the purview of the united states department of health and human services. it is a database of the results of the large - scale surveys of families and/or individuals, health care providers, employers, and payers. the medical conditions file hc-120 and the prescribed medicines file hc-118 were used to identify patients being treated for hypertension (international classification of diseases, ninth revision, clinical modification [icd-9-cm ] codes 401405) using mt or ms. patients using mt or ms were filtered using the medication name : metoprolol, metoprolol tart, and metoprolol succ. the fields that did not have a medication name were then identified using the eleven - digit national drug code (ndc) in an effort to not leave out any of the hypertensive patients on mt or ms. mt and ms are approved for the treatment of hypertension and angina. since this study was limited to the utility of mt and ms in the treatment of hypertension, patients on mt or ms who had a record of angina (identified by icd-9 code 413) in addition to a record of hypertension were excluded from the study. the patient cohorts obtained were then merged with the full - year consolidated data files (hc-121) to get demographic information, as well as the expenditure information of the patients. after the patients meeting all requirements described in the inclusion / exclusion criteria (figure 1) were selected, they were divided into two separate groups depending upon the type of metoprolol product (mt or ms). baseline characteristics were compared between the patient cohorts, and descriptive statistics were calculated. to achieve the balance in baseline characteristics and to account for the selection bias, propensity score matching is a technique that aims at adjusting for selection bias in nonexperimental, nonrandomized, and retrospective observational studies like the present one. propensity score matching allowed mirroring each patient in the ms cohort with a patient with similar predefined characteristics in the mt cohort. the following characteristics were used to match patients in both cohorts : age, sex, race, ethnicity, income, charlson comorbidity index (cci), and insurance type. based on the balancing guidelines,15 the one - to - one caliper matching technique produced the best balance. as a result, patients were matched using the calipers of width equal to 0.2 of the standard deviation of the logit of the propensity score. to analyze the association between type of metoprolol salt and health care expenditure, a multiple regression analysis using a generalized linear model with a log link function and gamma distribution was used, adjusting for age, sex, race, ethnicity, income, cci, and insurance type. total health care expenditure, as defined in meps, was the sum of direct payments for care provided during the year, including out - of - pocket payments and payments by private insurance, medicaid, medicare, and other sources. the total prescription drug expenditure was the sum of all prescription drugs payments irrespective of the source of payment for the drugs. interpretation was carried out by taking the natural exponential [exp(1) ] of the regression coefficient for the expenditure variables. the level of statistical significance was p 0.05, and all statistical computations were done with sas software (v 9.1 ; sas institute inc, cary, nc). after the patients meeting all requirements described in the inclusion / exclusion criteria (figure 1) were selected, they were divided into two separate groups depending upon the type of metoprolol product (mt or ms). baseline characteristics were compared between the patient cohorts, and descriptive statistics were calculated. to achieve the balance in baseline characteristics and to account for the selection bias, propensity score matching was applied. propensity score matching is a technique that aims at adjusting for selection bias in nonexperimental, nonrandomized, and retrospective observational studies like the present one. propensity score matching allowed mirroring each patient in the ms cohort with a patient with similar predefined characteristics in the mt cohort. the following characteristics were used to match patients in both cohorts : age, sex, race, ethnicity, income, charlson comorbidity index (cci), and insurance type. based on the balancing guidelines,15 the one - to - one caliper matching technique produced the best balance. as a result, patients were matched using the calipers of width equal to 0.2 of the standard deviation of the logit of the propensity score. to analyze the association between type of metoprolol salt and health care expenditure, a multiple regression analysis using a generalized linear model with a log link function and gamma distribution was used, adjusting for age, sex, race, ethnicity, income, cci, and insurance type. total health care expenditure, as defined in meps, was the sum of direct payments for care provided during the year, including out - of - pocket payments and payments by private insurance, medicaid, medicare, and other sources. the total prescription drug expenditure was the sum of all prescription drugs payments irrespective of the source of payment for the drugs. interpretation was carried out by taking the natural exponential [exp(1) ] of the regression coefficient for the expenditure variables. the level of statistical significance was p 0.05, and all statistical computations were done with sas software (v 9.1 ; sas institute inc, cary, nc). of the 33,066 unweighted observations, 6658 were identified to use metoprolol. among these users, 798 were found to be diagnosed for hypertension. after excluding patients who are also diagnosed with angina, based on the type of metoprolol they used, 388 patients were found to be using mt and 354 were using ms. after propensity score matching, the two cohorts were further reduced to 291 each to carry out the final analysis. baseline characteristics (listed in table 1) were similar in both the cohorts as a result of the propensity score matching. the average prescription drug expenditure was slightly lower in the mt cohort (us$2675) compared with ms (us$2761) (figure 2). the results of the regression analysis showed that the total health care expenditure was not significantly associated with the type of metoprolol product being utilized (table 2). upon converting the coefficient into its natural exponential form, the total health care expenditures of mt users was found to be 1.01 (p = 0.23) times higher, than the corresponding expenditures of the ms users ; however, the p value indicated that this association is not statistically significant. in case of prescription drug expenditure, ms users were found to be 1.06 or 6% (p = 0.019) times higher, respectively, than the corresponding expenditures of the ms users. among the variables used to adjust for overall health care expenditure employment (p 0.001) status none of the other variables were significantly associated with the overall health expenditure. in case of prescription drug expenditure, however, along with employment status (p 0.001), age categories 4065 (p = 0.0214), and > 65 (p = 0.0113) were also significantly associated. previous research on comparing different formulations of the same drug molecule has been mostly limited on establishing efficacy or effectiveness of products. in the case of metoprolol, existing literature documents clinical outcomes associated with mt and ms,12,13 but no research is available on how these two products compare with each other in terms of total health care costs incurred. the results of the current study show that the overall expenditures of hypertensive patients on twice - daily mt are not significantly different than the overall expenditures of once - daily ms. however, since the cost of a once a daily formulation is almost two times a twice - daily formulation, ms is associated with significantly higher out - of - pocket cost. the similarities in overall health care expenditure indicate that both the products are equally beneficial, and once daily ms may not offer any additional advantage to justify the additional drug cost. adherence is a major issue in the treatment of hypertension, especially if approximately 50% of the hypertensive population discontinues their antihypertensive medication within the first 612 months of initiation of therapy.16 ms being a once - daily formulation has a clear advantage over mt in terms of improving adherence by providing more ease to the patient. previous studies have shown that simplification of dosing regimens using once - daily medications and/or combination medications does help in improving adherence to the regimen.6,1722 most of these studies show that there is no significant reduction in the blood pressure associated with increase in adherence to the treatment regimen with a once - daily regimen when compared with a twice - daily regimen in the treatment of hypertension.1820,22 on the other hand, there are studies that show that once - daily medications not only improve adherence, but also decrease blood pressure, and are cost - effective as well.21,23 as a result, there is lack of established relationship between adherence and lowering of blood pressure.17,24 hence, in this study, the similarity in overall expenditure questions the advantage of ms having a once - daily dosing regimen, as the total health care expenditure is a good predictor of the overall health status of a hypertensive individual. currently, very little is known about the extent of difference in adherence required to produce any noticeable effect in terms of overall health status and health care expenditure. further research is warranted to examine adherence rates in similar cohorts and its impact on overall health status. although both ms and mt have a similar impact on total health care expenditure, one key difference to be noted is, only ms is indicated for the treatment of heart failure by the fda.10 heart failure is shown to be associated with hypertension.25 therefore, in heart failure patients who are hypertensive, ms is an obvious choice given its fda - approved indication for heart failure. moreover, the pharmacokinetic profile of mt is associated with higher utilization of health care services and inferior outcomes when compared with ms in heart failure patients.26 in addition to the inferiority of mt, heart failure is associated with a higher risk of hospitalization, which can lead to increased costs ; prevention of hospitalization with the use of ms can save money in the long run in this patient population.27 mt is available as a discounted generic in many pharmacies. the discounts available on mt have increased access to this medication, even with hypertensive patients who are uninsured.28 this access to medications at a deeply discounted price with the same efficacy will ensure that the hypertensive patients do not go without medications due to lack of insurance. finding affordable treatment options has become a very important need to reduce financial burden on both patients and payers. future research should be carried out to produce more evidence towards economic comparison of different dosage forms of widely prescribed drugs such as metoprolol using diverse patient populations to generate potential cost savings without compromising health outcomes. some clinicians initiate therapy of mt as a once daily dose ; however, with the meps database, it becomes difficult to identify these patients. nonetheless, if the outcomes of this therapeutic regimen are similar to that of mt given twice a day and/or ms given once a day, there could be considerable reduction in the costs associated with the treatment of hypertension using mt. further clinical and pharmacoeconomic research of this therapeutic regimen could present clinicians with other cost savings. given the sample size and the complexity of the characteristics and the disease of hypertension, the socioeconomic characteristics and their association with health care expenditure needs to be carefully interpreted from this study. previous research has shown that females have higher overall expenditures, but males are associated with more spending on drugs, physician service, and hospital service.29,30 although the results of this study do not show such association, it demonstrates that the expenditure to age correlation is supported by existing literature.29,30 in addition, previous studies have shown conflicting results for the association between expenditure and employment status and, hence, the results of our study should be carefully interpreted.29,30 in short, with the limitations of this study, which are listed below, such associations may not be fully confirmed based on a single study. meps, being a self - reported survey, is subject to common limitations such as recall bias and missing information associated with all survey - based retrospective datasets. however, the pharmacy records are verified for accuracy and completeness of the data, which includes the ndc of the drug, the date the prescription is filled and/or refilled, the quantity dispensed, the amount paid by the patient, the amount paid by any third - party payers, and the type of third - party payer during any calendar year. although the results were adjusted for the comorbidity index, availability of clinical measures such as the blood pressure of the patients, side effects of the medications, or discontinuation of the medication would have been helpful to assess the safety and efficacy of the regimen in each of the cohorts. also, with hypertension being a disease, many hypertensive patients will not be diagnosed with hypertension, and there would be an underestimation of the problem of hypertension. in addition, with the icd-9 codes limited to just three digits, we lose the specificity that we could otherwise have with a five - digit icd-9 code. moreover, the management of hypertension is a complex process, considering the comorbidities associated with it. with the meps database, it would be difficult to account for all the dimensions of the pharmacotherapy of hypertension. the use of cci and propensity score matching would help in balancing the comorbidities in each cohort and hence reduce the chance of bias. with the increasing health care costs associated with the treatment of hypertension, it is imperative to analyze the treatment options to avoid unnecessary costs for the health care system. the results of this study contribute towards decision making involved in formulary management and by clinicians treating patients with hypertension. further analysis such as the present one could help to determine cost - saving options across all classes and combination antihypertensive agents that are available in the market. | backgroundmetoprolol, a selective beta-1 blocker, is available in two different salt forms in the market metoprolol succinate (ms) and metoprolol tartarate (mt). both the formulations are food and drug administration approved for the treatment of hypertension. several studies have shown similar efficacies between the two salts ; however, they differ in their pharmacokinetic properties and are therefore priced differently. the primary objective of this study was to compare the overall health care expenditures of hypertensive patients on mt and ms to see if the price difference in the two preparations is offset by savings in overall expenditure.methodstwo cohorts of patients using mt and ms were selected from the 2008 medical expenditure panel survey. propensity score matching technique was used to balance the cohorts on various parameters such as demographic information, insurance status, and comorbidity score. patients using mt were matched to patients using ms on the logit of propensity score using calipers of width equal to 0.2 of the standard deviation of the logit of the propensity score. multiple regression analysis was carried out to examine the association between health expenditure and type of metoprolol salt, adjusting for other covariates.resultsa total of 742 patients were found to use metoprolol (mt-388, ms-354). after propensity score matching, a total of 582 patients were left in the sample for final analysis (291 patients in each cohort). the average annual health care expenditure was slightly higher in the mt cohort ; however, after adjusting for covariates in a multivariate analysis, the difference was found to be statistically insignificant (p = 0.23).conclusionboth the products of metoprolol were found to have similar average annual total health care expenditure ; however, ms once a day has higher out - of - pocket cost. |
local treatment for hepatocellular carcinoma (hcc) has been widely used in clinical practice due to its minimal invasiveness and high rate of cure ; percutaneous options for local treatment include radiofrequency ablation (rfa), ethanol injection, microwave coagulation and laser ablation therapy. among these, percutaneous rfa is more widely applied because it requires fewer treatment sessions and yields a larger coagulation volume (1). some serious rfa complications such as a liver abscess, intraperitoneal hemorrhage, biloma, ground pad burn, diaphragmatic injury, pneumothorax, pleural effusion, bowel perforation, hepatic infarction, renal infraction and tumor seeding have been reported (2). the prevalence of major complications from a large multicenter study was found to be 1.5 - 2.4%, and the mortality rate between 0.09 - 0.11% (2). we present here a rare case of hemorrhagic cardiac tamponade secondary to an anterior cardiac vein (right marginal vein) injury during rfa for treatment of hcc. a 56-year - old malay man with chronic hepatitis b, not on regular follow - up, who first presented to a private medical center with abdominal distension in july 2010, was diagnosed with hepatocellular carcinoma and referred to our institute for further management. at our institute, a dynamic ct scan of the liver revealed five hypervascular lesions at segments iva, vii and viii in the background of cirrhosis. the largest lesion at segment iva, measured 4.3 3.5 cm and associated splenomegaly and esophageal varices but no ascites was observed (fig. local treatment of the multicentric hcc using rfa was planned in agreement with the patient. during the pre - procedural assessment, the patient was incidentally found to have a small ventricular septal defect with left to right shunting. however, the chamber sizes and left ventricular ejection fraction were normal. at the time of treatment, he had child class a compensated liver disease with the following laboratory test results : serum albumin, 32 g / l ; serum bilirubin, 21 mol / l ; alanine aminotransferase (alt), 45 iu / l ; aspartate aminotransferase (ast), 54 iu / l ; platelet count, 61 10/l ; international normalised ratio, 1.2 ; and alpha fetoprotein (afp), 23.8 ng / ml. the procedure was performed under general anesthesia and fluoroscopic ct guidance (somatom definition as, siemens medical solutions, erlangen, germany) using a 10 cm long expandable 15 g starburst xl radiofrequency (rf) needle (rita medical system, mountain view, ca, usa) with an array diameter of 5 cm. the rf current generator used was the 1500x rf generator system (rita medical system, mountain view, ca, usa). the patient 's pulse - oximetry, arterial blood pressure, and cardiac activity were monitored during the entire procedure. under ct the needle tip was placed such that the thines at 2 cm deployment covered the outer margins of the tumour. this lesion was ablated to 5 cm after which the needle was repositioned twice to ablate the medial and lateral margins to provide a 5 mm margin around the tumour. 1e - h) with no evidence of any pericardial fluid. during the attempt to remove the rf needle from segment iva the operator then decided to ablate the lesion in segment vi. during placement of the needle, it was noted that there was an expanding pericardial effusion (fig. approximately 300 ml of blood was aspirated but the patient was persistently hypotensive and an emergency sternostomy was performed. a puncture wound was noted at the anterior cardiac vein (right marginal vein) (fig. in addition, inflammatory changes are also seen in the adjacent diaphragm but no evidence of any ablation change was seen in the pericardium. the anterior cardiac vein (right marginal vein) his condition gradually deteriorated with the development of liver failure, upper gastrointestinal bleeding, pneumonia, and sepsis. percutaneous rfa is commonly used as local treatment for hcc nodules adjacent to the diaphragm. (3) and another one by gao. (4). in our patient, the haemorrhagic cardiac tamponade was secondary to the direct puncture of the rfa needle through the diaphragm and injuring the anterior cardiac vein during an attempt to remove the rfa needle from segment iva of the liver. we had to be aware that the expandable rfa needle was sometimes difficult to remove after repeated ablations. to reduce the rate of complication, three important strategies including prevention, early detection, and proper management were acknowledged (2) ; prevention, was the most important of the three. in this study, four points had to be emphasizedas follows : 1) pre - procedural assessment to identify high risk patients and to optimize them before the procedure, 2) deployment of thermal protection technique for lesions in closed proximity to vulnerable organs 3) use of real - time imaging guidance (e.g., ultrasound or ct fluoroscopy) for placement of the needle prior to ablation and monitoring the position of the deployed thines during ablation as well as during removal of the rfa needle 4) prevention of charring and tissue adhesion of the rfa needle by removal of the rfa needle between treatment cycles to clean the thines and thus reduce the risk of thines getting stuck. pre - procedural assessment is important to identify the high risk group such as patients with coagulopathy and poor hepatic reserve. for patients with coagulopathy, the rfa should be postponed until the coagulation profile is corrected. for patients with a poor hepatic reserve, any potential hepatotoxic drug should be withheld and the general condition of the patient optimized prior to the procedure. many protective techniques have been developed to thermally insulate and protect the organs at risk. they include using fluid, gas, or balloon interpositions between the organs at risk and the ablation zone. chen. (5) reported that injection of a 5% dextrose solution into the peritoneal cavity reduces the risk of thermal injury to the diaphragm or the bowel during rfa. bowel protection with balloon interposition during rfa of hcc was reported by yamakado. (7) also demonstrated that co2 dissection is an effective technique to protect the organs at risk during rfa or cryoablation. all these techniques are increasing the space between the organs at risk and the rfa target area. therefore, besides providing thermal protection, they can also reduce the risk of direct puncture of adjacent organs by the rfa needle during insertion and removal of the needle. real - time imaging such as ultrasound or ct fluoroscopy is useful for monitoring the needle position throughout the rfa. it is also crucial for monitoring the position of the deployed thines during ablation as well as during the removal of the rfa needle. ultrasound is the most affordable real - time imaging, but it has the disadvantage of poor visualization if there is a gaseous structure or bone around the target lesion. ct fluoroscopy overcomes the limitations of ultrasound, but with the disadvantage of radiation. proper use of real - time imaging in monitoring the rfa needle position will prevent injury of adjacent organs due to the malposition of the rfa needle. prevention of charring and tissue adhesion to the rf needle is not only important to ensure an effective ablation of the lesion, but also to avoid injury to the adjacent organs during withdrawal of the rf needle. a multi - pronged rf needle like the rita medical system starburst xl is known to be relatively difficult to remove (8), especially after prolonged or repeated ablation. we believe that the difficulty in retracting the thines was the reason for the cardiac tamponade in the case presented. therefore, it is recommended to frequently remove, clean and redeploy the rf needle to prevent charring and tissue adhesion if a prolonged or repeated ablation of a single lesion is contemplated. although early detection can not reduce the frequency of complications, it can potentially minimize their clinical magnitude. therefore, the operator and medical personnel who are involved in the care of the patient during and after rfa should be knowledgeable on the spectrum of various rfa complications, so that these complications can be detected early. close monitoring of the patient during the procedure will help the operator detect the complications early and stop the ablation to prevent more serious damage. close monitoring of vital signs with a complete blood cell count and measurement of prothrombin time after the procedure is essential for early detection of complications. immediate (within 24 hours) follow - up ct is a reliable modality for detecting any complications after rfa (2). proper management at the appropriate time is obviously an important issue because a complication is not a static condition. thus, the operator should treat patients with complications properly on the basis of the unique clinical characteristics of each complication. in summary, we present a case of haemorrhagic cardiac tamponade, which is a rare complication of percutaneous rfa for hcc. as with this patient, the end result was one of fatality. thus, the operator should exercise all necessary care when embarking on the procedure being fully aware of all the potential complications and taking preventive measures to avoid them. | local treatment for hepatocellular carcinoma (hcc) has been widely used in clinical practice due to its minimal invasiveness and high rate of cure. percutaneous radiofrequency ablation (rfa) is widely used because its treatment effectiveness. however, some serious complications can arise from percutaneous rfa. we present here a rare case of hemorrhagic cardiac tamponade secondary to an anterior cardiac vein (right marginal vein) injury during rfa for treatment of hcc. |
preterm infants are at a high risk of motor deficits in later life, with approximately fourteen percent of very preterm infants developing cerebral palsy (cp), and up to forty percent of very preterm infants demonstrating mild motor deficits. the mechanisms underlying such motor impairments have not yet been fully elucidated, but have been related to a number of factors, including abnormal cerebral development (particularly in sensorimotor regions), conditions such as periventricular leukomalacia, peri - intraventricular hemorrhage, and/or stressors in the neonatal intensive care unit (nicu) environment. new insights into the neural structures and mechanisms, underlying motor function in preterm - born infants, should help in the development of new diagnostic and prognostic tools and provide information on the immediate efficacy of early intervention therapies. the corpus callosum is vital for communicating and integrating motor and somatosensory information between the hemispheres, and for bimanual motor coordination and function. the maturation or structural development of the corpus callosum, that is, the organisation of axon fiber bundles and the degree of axonal myelination and microstructural integrity, can be studied using diffusion tensor imaging (dti), particularly via the measures of fractional anisotropy (fa) and mean diffusivity (md). the interpretation of fa and md values is not entirely clear and largely depends on the underlying fiber architecture, including the degree of myelination, axon size, density, and organization [7, 8 ]. since the corpus callosum is a highly organized myelinated structure, with axons typically running in packed parallel bundles, a high fa value and low md value is suggestive of greater structural maturation. in imaging studies, the infant corpus callosum is often segmented into six anatomical regions from anterior to posterior the genu, rostral body, anterior midbody, posterior midbody, isthmus, and splenium. thompson. found that very preterm infants had significantly reduced corpus callosum cross - sectional area, lower fa and higher md values compared to term infants, thus suggesting that corpus callosum development is altered in preterm - born infants compared to term - born infants. a minority of studies have investigated the implications of this altered development by examining associations between corpus callosum maturation and neurodevelopment [1113 ] investigated the relationship between dti measures of the genu and splenium (the most anterior and posterior subregions of the corpus callosum, resp.) taken at term age with neurological assessments (amiel - tison scale, gross motor function classification system, and bayley scales of infant development) performed at eighteen months in preterm - born children. the maturation of the splenium (as reflected by fa values) was significantly lower in children with abnormal versus normal neurological assessments, indicating that splenium fa near term age could potentially be used to prognosticate subsequent neurodevelopment. 2002 study using dti to examine white matter tracts in children with cerebral palsy as a result of periventricular leukomalacia. the tracts in the splenium, posterior corona radiate, and posterior internal capsule were markedly reduced in size in participants suffering from cerebral palsy compared to controls. hence, it was suggested that interhemispheric tracts to or from the sensory cortex, in addition to motor tracts, may also play a role in motor impairment. a strong positive association between the midsagittal surface area of the corpus callosum on t1-weighted magnetic resonance imaging (mri) scans and concomitant motor function in preterm - born children, studied at school age. furthermore, iai. compared midsagittal corpus callosum t1-weighted mri measures in preterm - born children with spastic diplegia (cp) versus neurologically typical children. in the diplegic children, it was found that the ratios of the thickness of the splenium and of the midbody to the corpus callosum length were significantly reduced, compared to the ratios computed in neurologically typical children. furthermore, the ratio for the splenium was highly correlated with the extent of motor impairment. however, aside from these few studies, potential associations between corpus callosum structure and neuro - motor function in preterm - born neonates have not been reported. outcomes from such investigations may prove clinically meaningful ; for example, they may inform development of early prognostic indicators, interventions, and/or markers to inform instigation of such interventions. hence the primary aim of this study was to investigate and explore potential associations between dti measures of subregions of the corpus callosum and concomitant neurological measures in a small sample of preterm infants. we hypothesized that a positive relationship would exist between corpus callosum maturation and concomitant neurological measures. the participants were preterm infants born at gestational age between 28 and 32 weeks (ga) at the royal brisbane and women 's hospital (rbwh) with no post - natal medical issues or complications. inclusion criteria were : infants that were born at a gestational age between 28 and 32 weeks, with a birth weight and length between the 10th and 90th percentiles for gestational age and who were determined to be medically stable. exclusion criteria were as follows : the presence of abnormalities on brain ultrasound (i.e., intraventricular hemorrhage grades 3 or 4, persistent periventricular flares, or periventricular cysts) and the presence of major genetic disorders or malformations. these criteria were set to ensure that the study participants were at low risk for an adverse outcome and were medically stable. this study was approved by the rbwh human research ethics committee and monash university human research ethics committee. parents who agreed to their infant participation in the study signed a written consent form and were provided with a copy of the study protocol. on reaching term - equivalent age (42 weeks ga), the infants underwent the hammersmith neonatal neurological examination (hne) at the rbwh performed by a single neonatologist. the hne evaluates a number of motor and behavioral functions including posture and tone, tone patterns, reflexes, abnormal signs and orientation, and behavior. when performed at around term age, it provides a summary score for each of these categories and a total hne score (maximum score 32) which is the sum of these categories. as a follow - up analysis, a total motor - specific score (maximum 20) was calculated by summing the scores from the posture and tone, tone patterns, and reflexes categories. associations between the hne and motor - specific scores and dti measures were examined. the infants underwent neuroimaging at approximately term - equivalent age (refer to table 1). the infants were scanned using a 3.0-t siemens tim trio scanner and were placed in an mri - compatible neonatal incubator with a dedicated head coil (lammers medical, luebeck, germany). they were swaddled and placed in a vacuum fixation beanbag designed to keep the infant still and supported in the scanner. diffusion weighted images were acquired along 30 directions at a b - value of 1000 s / mm, along with one minimally diffusion weighted image (b = 0). the image resolution of the scans was 1.75 1.75 mm in - plane, with a slice thickness of 2 mm. other imaging parameters were as follows : tr / te 9300/130 ms, field of view 128 128, 47 slices. the mri parameters for the field map acquired were tr / te1/te2 488/4.9/7.4 ms, matrix size 64 64, field of view 160 160 mm, slice thickness 2.6 mm with 0.65 mm slice gap, 29 slices, and flip angle 60 degrees. preprocessing of the imaging data involved correction for any head movement using rigid - body registration with subsequent adjustment of the b - matrix, skull stripping, as well as susceptibility distortion correction and correction for intensity inhomogeneities. additionally, images were visually examined for artifacts and distortions and infants whose images showed motion artifact on the minimally diffusion - weighted image were excluded from the dti analyses. fractional anisotropy (fa), color fa, and md maps of the brain were calculated for each infant, with fa representing the degree of anisotropic diffusion and md representing the magnitude of diffusion. alignment of images with the midsagittal plane was achieved using rigid - body registration of fa maps with the john hopkins university neonatal fa template. care was taken in the manual delineation of the corpus callosum in order to minimize the number of voxels that were contaminated by partial volume effects. for each infant, based on visual inspection, a corpus callosum region of interest was manually drawn onto the midsagittal slice of the color - fa maps. four sets of masks were drawn for each infant, to ensure reproducibility of the masks. for each infant, the four corpus callosum masks were then segmented into six regions genu, rostral body, anterior midbody, posterior midbody, isthmus, and splenium according to the neonatal segmentation schema provided by thompson. an average was taken of the mean values of the regions from the four masks to provide six corpus callosum fa and md values for each infant. the infants ranged between 41 and 45 weeks ga at the time of dti assessment. as it is known that fa values tend to increase rapidly with increasing ga, the fa values were adjusted for ga. using spss (statistical package for the social sciences, version 14.0 ; ibm spss, chicago, il, usa), the correlations between clinical measures and corpus callosum dti measures were explored using a two - tailed spearman 's rho (see tables 2 and 3 for the fa and md values used in the analysis). correction for multiple comparisons was not performed given the exploratory nature of this study of a small sample as well as the number and nature of the variables analyzed. table 1 provides a summary of the characteristics and assessments for these thirteen infants. due to time constraints furthermore, due to technical issues and motion artifacts, dti data from three infants was excluded from the analyses, leaving eight infants whose data was included in the correlation analyses. using spearman 's rho, associations were explored between the clinical and dti measures (see tables 4 and 5). a highly significant positive correlation was found between the total hne scores and the anterior midbody fa measures (rho = 0.929 ; p = 0.001) and similarly between the motor - specific scores and the anterior midbody fa measures (rho = 0.857 ; p = 0.007). a statistically significant negative correlation was found between the total hne scores and the anterior midbody md measures (rho = 0.714 ; p = 0.047). scatter plots illustrating these correlations are provided in figures 2, 3, and 4. in summary, the total hne scores correlated significantly with both the anterior midbody fa and md measures. in addition a significant positive correlation was found between the motor - specific subscores of the hne assessment and anterior midbody fa measures. overall neurological function, as well as specific motor function measures, correlated significantly with dti measures from the anterior midbody, but not from other regions of the corpus callosum. these findings are consistent with studies investigating corpus callosum topography in primates and humans [26, 27 ]. the results from these studies suggest that, from a neuroanatomical perspective, axons in the midbody interconnect the premotor and primary motor cortical areas. furthermore, the primary and secondary motor cortices and somatosensory regions are located in the precentral and postcentral cortices, which are in a similar spatial region to the corpus callosum midbody. given that these somatosensory and motor regions, as well as the corpus callosum, are topographically organized, it is likely that interhemispheric axons which connect homologous regions of the left and right cortical regions pass through the corpus callosum midbody. in particular, these study findings suggest that such axons connecting (frontal) motor cortical regions likely constitute part of the anterior midbody. both total hne and motor - specific scores correlated with greater maturation of the anterior midbody (i.e., higher fa and lower md values). it has been suggested that fa values in the corpus callosum are primarily a reflection of fiber density and organization, rather than myelination or axon diameter in contrast, md values are believed to be more sensitive to (pre-)myelination, with lower md values indicating advanced callosal myelination and microstructure [30, 31 ]. consequently, a relatively well - organized and (pre-)myelinated corpus callosum (e.g., anterior midbody) may be associated with more efficient transmission of interhemispheric neural signals, which thereby permits more optimal processing and integration of (e.g., motor - related) information between the hemispheres. this study appears to be one of the first studies to describe a strong correlation between the maturation of the anterior midbody and concomitant neurological function in preterm infants. in contrast, a number of studies (as described in section 4) demonstrated associations between splenium maturation and altered neurological function. however, the infant cohorts used in these studies involved infants with demonstrated white - matter injury and periventricular leukomalacia (pvl). a characteristic feature of pvl is thinning or altered maturation of the splenium ; hence, this may explain why a strong association was found between splenium maturation and altered neurological function in these infants. in light of these findings, intervention programs and management strategies directed towards enhancing the development of white matter should be investigated further, as this may aid in enhancing motor function and possibly other neurobehavioral functions for preterm infants. an mri study performed by smith. demonstrated that stresses from the nicu environment correlated with decreased white matter maturation and interhemispheric communication in preterm infants, as assessed by dti and functional mri. this study also reported that infants experiencing greater nicu - induced stress in the immediate postnatal period demonstrated poorer motor function at term - equivalent age. als. performed a randomized control trial investigating the merits of a newborn individualized developmental care and assessment program (nidcap) in order to reduce stressors for preterm infants while in nicu. they found improved white matter development (assessed via dti), brain functional connectivity (as measured by electroencephalography), and neurological function in the nidcap cohort of infants versus controls at term - equivalent age. a similar study performed by mcanulty. demonstrated that nidcap intervention had positive effects on preterm - born children 's neurobehavioral function at least until school age. since the current findings indicate an association between anterior midbody development and neurological function, this may in part explain why interventions such as the nidcap, which are directed towards enhancing white matter development, resulted in improved neuromotor function. the observed relationship between anterior midbody integrity and neurological function, if replicated and extended in larger studies, may inform future development of prognostic tools for neonates. future studies should investigate whether such dti measures may demonstrate value in the prediction of neurodevelopmental, particularly motor outcomes at a later age. conversely, in light of the strong correlation between hne scores and dti measures, it is possible that hne assessment may also prove to be a valuable prognostic marker, with the added advantage of being easy to perform at the bedside. such markers might also ultimately prove informative for future interventional trial programs, for example for selection of inclusion criteria, or predicting or assessing response to a given intervention. there are a number of limitations in the current study, particularly the small sample size and associated low statistical power. in addition, the corpus callosum segmentation method employed was not necessarily optimal as current understanding of corpus callosum anatomical segmentation and tract topography in infants is limited, unlike in adult studies. this would be likely improved by identification of callosal regions defined by dti tractography methods in infants. however a positive association was observed between dti measures of structural maturation of the anterior midbody of the corpus callosum and neurological and motor function, in healthy preterm - born infants assessed at term - equivalent age. future studies of larger samples may extend upon these preliminary findings and possibly investigate the value of corpus callosum dti measures as early prognostic markers for neurodevelopmental and motor outcomes. | background. the etiology of motor impairments in preterm infants is multifactorial and incompletely understood. whether corpus callosum development is related to impaired motor function is unclear. potential associations between motor - related measures and diffusion tensor imaging (dti) of the corpus callosum in preterm infants were explored. methods. eight very preterm infants (gestational age of 2832 weeks) underwent the hammersmith neonatal neurological examination and dti assessments at gestational age of 42 weeks. the total hammersmith score and a motor - specific score (sum of hammersmith motor subcategories) were calculated. six corpus callosum regions of interest were defined on the mid - sagittal dti slice genu, rostral body, anterior midbody, posterior midbody, isthmus, and splenium. the fractional anisotropy (fa) and mean diffusivity (md) of these regions were computed, and correlations between these and hammersmith measures were sought. results. anterior midbody fa measures correlated positively with total hammersmith (rho = 0.929, p = 0.001) and motor - specific scores (rho = 0.857, p = 0.007). total hammersmith scores also negatively correlated with anterior midbody md measures (rho = 0.714, p = 0.047). discussion. these results suggest the integrity of corpus callosum axons, particularly anterior midbody axons, is important in mediating neurological functions. greater callosal maturation was associated with greater motor function. corpus callosum dti may prove to be a valuable screening or prognostic marker. |
the challenge in diagnosis is that there is no single definitive clinical symptoms or signs. initial treatment approach to the patients with suspected acute bacterial meningitis depends on rapid diagnostic evaluation and emergent antimicrobial and adjunctive therapy. once there is a suspicion, lumbar puncture should be performed immediately to determine whether the cerebrospinal fluid (csf) findings are consistent with clinical diagnosis. ankylosing spondylitis is a complex, potentially debilitating disease that is insidious in onset and progressing to radiological sacroiliitis over several years. in advanced stage of disease, the affected tissue is gradually replaced by fibrocartilage and then becomes ossified. in 1940, taylor described a modified para - median lumbosacral approach through the l5-s1 space. the l5-s1 space is least likely to be obliterated by pathological processes such as degeneration and excessive scarring. here lumbar puncture was successfully performed with taylor 's approach after it failed with the conventional approach. a 42-year - old gentleman, weighing around 50 kg, presented with the history of headache, fever (up to 102 f), and altered level of consciousness of 1-day duration. on examination, he was confused and neck stiffness was present. he was febrile and tachycardic. with the suspicion of bacterial meningitis, empiric antibiotic therapy with ceftriaxone 2 recent radiograph of lumbosacral spine revealed bilateral sacroiliitis, calcification of anterior and posterior longitudinal ligaments with syndesmophytes and bamboo spine [figure 1 ]. local examination of lumbar spine revealed loss of lumbar lordosis [figure 2 ]. multiple attempts for lumbar puncture in left lateral position at various levels (l2 - 3 and l3 - 4), with both midline and para - median approach were carried out by experienced anesthesiologists, but it failed. after eight failed attempts, lumbar puncture was successfully performed with the taylor 's approach. after infiltration with local anesthetic agent, 25 gauge quincke spinal needle was inserted at a point 1 cm medial and 1 cm caudal to the lowest prominence of posterior superior iliac spine, located immediately anterior to skin dimple [figure 2 ]. the needle was directed in a cephalo - medial direction towards the l5-s1 space and turbid csf was obtained in first attempt. csf analysis was highly suggestive of bacterial meningitis and the culture report revealed streptococcus pneumoniae. ceftriaxone was administered 2 g 12 hourly for 14 days and dexamethasone was continued 6 hourly for 4 days at the dose of 7.5 mg. x - ray of lumbosacral spine showing bilateral sacroiliitis, calcification of anterior and posterior longitudinal ligaments with syndesmophytes and bamboo spine. needle insertion point and direction is marked by black arrows patient lying in left lateral position showing loss of lumbar lordosis. posterior superior iliac spine is marked by white arrow and the site of skin puncture for lumbar puncture by taylor 's apporach is marked by black arrow. the outcome of the patients is improved by prompt antibiotics treatment. delay in antibiotic therapy the odds for unfavorable outcome may increase by up to 30% per h of treatment delay. after administration of antibiotics, the chance of positive csf culture decreases with time, but is likely to be positive within 4 h. ankylosing spondylitis is a chronic rheumatic disease causing chronic inflammation, bone destruction and aberrant bone repair. in the late stage of disease lumbar puncture is technically challenging in these patients due to reduced articular mobility of spine, obliteration of interspinous spaces, midline ossification of interspinous ligament and difficulty in proper patient positioning. taylor 's approach can provide a reliable alternative to midline approach for lumbar puncture by targeting the l5-s1 interlaminar space, which is the lowest and widest available space, which is least affected by arthritic and degenerative changes. use of ultrasound for lumbar puncture has been shown to reduce the risk of failure as well as the number of needle insertions and redirections. ultrasound guidance has been shown to be useful in obstetric and nonobstetric population with difficult surface anatomic landmarks. however, it is operator dependent and is not routinely available in all places. in our case, lumbar puncture with taylor 's approach can be helpful for obtaining csf sample for diagnostic evaluation in patients with deformity of spine, when conventional technique for lumbar puncture fails. | meningitis and encephalitis are the neurological emergencies. as the clinical findings lack specificity, once suspected, cerebrospinal fluid (csf) analysis should be performed and parenteral antimicrobials should be administered without delay. lumbar puncture can be technically challenging in patients with ankylosing spondylitis due to ossification of ligaments and obliteration of interspinous spaces. here, we present a case of ankylosing spondylitis where attempts for lumbar puncture by conventional approach failed. csf sample was successfully obtained by taylor 's approach. |
atomic force microscopy (afm)-based single - molecule force spectroscopy (smfs) is widely used to mechanically measure the folding and unfolding of proteins. however, the temporal resolution of a standard commercial cantilever is 501000 s, masking rapid transitions and short - lived intermediates. recently, smfs with 0.7-s temporal resolution was achieved using an ultrashort (l = 9 m) cantilever on a custom - built, high - speed afm. by micromachining such cantilevers with a focused ion beam, we optimized them for smfs rather than tapping - mode imaging. to enhance usability and throughput, we detected the modified cantilevers on a commercial afm retrofitted with a detection laser system featuring a 3-m circular spot size. moreover, individual cantilevers were reused over multiple days. the improved capabilities of the modified cantilevers for smfs were showcased by unfolding a polyprotein, a popular biophysical assay. specifically, these cantilevers maintained a 1-s response time while eliminating cantilever ringing (q 0.5). we therefore expect such cantilevers, along with the instrumentational improvements to detect them on a commercial afm, to accelerate high - precision afm - based smfs studies. |
|
we performed a prospective study to determine whether asymptomatic or mild infection attributable to sars - cov was common in hcws in this outbreak at prince of wales hospital. when it had been established that an outbreak was occurring, a sars screening clinic was instituted to care for hospital staff with symptoms suggestive of or suspected to be sars. asymptomatic staff or those without compatible symptoms were also invited to participate in this study. in late march and early april 2003, a blood sample was collected from each hcw who voluntarily participated and who wished to be tested for antibody to sars - cov ; a second blood sample was collected 46 weeks later. most of the second blood samples were collected in early may 2003, approximately 8 weeks from the first peak and 4 weeks from the second peak of admission of hcws with sars (figure). each hcw completed a questionnaire to document known direct contact with sars patients, their body fluids, secretions, or excretions ; places of duty within the hospital ; and symptoms of any illness during the period between first and second blood sample collection. additional information also included the department and the position of hcws, so that the job nature could be delineated. number of patients with severe acute respiratory syndrome (sars) admitted to prince of wales hospital during the first 10 weeks of the sars outbreak. a total of 160 healthcare workers and 171 non - healthcare workers were admitted ; a second peak of admission occurred the 5th week after the outbreak started. immunoglobulin (ig) g antibody to sars - cov was detected by an immunofluorescence assay on the basis of vero cells infected with coronavirus isolated from a patient with sars. we isolated this sars - cov and determined the complete genome sequence (genbank accession no. this immunofluorescence assay had been successfully used for serodiagnosis of sars in patients in our hospital ; titers of > 320 developed in acutely ill sars patients 4 weeks after onset of illness. six hundred and seventy - four hcws completed the questionnaire and had a second serum sample obtained. the mean age of these hcws was 40 years (range 2060), and 75% were female. hcw jobs were categorized into five groups according to those with direct patient care, namely : doctors and nurses, 28% (188) ; healthcare and general service assistants, 15% (104) ; and allied health workers, including physiotherapists, occupational therapists, and x - ray technicians, 6% (43). the remainder of staff, who did not have direct patient care, included the ancillary staff, 35% (235) ; pathology laboratory staff, 14% (95) ; and others, 1% (9 hcws). altogether, 43% of the hcws reported having known direct contact with patients with sars or their body fluids, secretions, or excretions. an additional proportion of hcws might have had contact with patients who subsequently were confirmed to have had sars, unknown to the hcws. a total of 36% of the staff worked in or visited adult medical or pediatric wards with sars patients30% in the accident and emergency unit and 9% in the intensive - care unit all areas at high risk for sars within the hospital during the outbreak. of the 674 hcws, 353 (52%) reported mild, self - limiting illnesses during the period between the times when the first and second blood samples were collected (table). all symptoms reported were mild, self - limiting, and lasted for 1 to 2 days. the current global outbreak of sars is associated with a novel coronavirus, sars - cov, which is phylogenetically distinct from other known members of the virus family (coronaviridae) and genus (coronavirus) (68). the full clinical spectrum of this novel infection in humans has not yet been defined. among the 674 hcws that we examined it is possible that a proportion of our study participants might not have actually been exposed to sars - cov. although these participants were working in our hospital when a large number of patients with sars were staying there, vigilant infection - control measures had been in place since the outbreak was recognized (9). all staff working in high - risk areas were required to wear a mask, gloves, eye goggles, and protective clothing. the results of this study show that our sars clinic successfully identified all staff with sars - cov infections. alternatively, our data suggest that asymptomatic or mild forms of sars - cov are rare at the current point to which the virus has evolved. from the virologic viewpoint, this finding indicates that the novel coronavirus has not yet adapted to transmit among humans through asymptomatically infected hosts. this finding has important public health implications, as the level of immunity towards sars - cov could be very low even in members of communities that had had a large outbreak of sars. if this is the case, a large proportion of the population remains susceptible, and another major outbreak may occur when the virus is introduced by highly infectious sources. | whether severe acute respiratory syndrome associated coronavirus (sars - cov) infection can be asymptomatic is unclear. we examined the seroprevalence of sars - cov among 674 healthcare workers from a hospital in which a sars outbreak had occurred. a total of 353 (52%) experienced mild self - limiting illnesses, and 321 (48%) were asymptomatic throughout the course of these observations. none of these healthcare workers had antibody to sars cov, indicating that subclinical or mild infection attributable to sars cov in adults is rare. |
in this issue of critical care, textoris and colleagues report that high levels of central venous oxygen saturation (scvo2) are associated with mortality in patients with septic shock. scvo2 is easily measured in most icu patients and thus represents a convenient therapeutic marker in the resuscitation of the critically ill patient. low scvo2 is a valid therapeutic target in early septic shock and a diagnostic marker for low cardiac output. scvo2 itself is a surrogate marker of mixed venous oxygen saturation, which in theory reflects the balance between global oxygen delivery and consumption, so that low scvo2 is a marker of inadequate oxygen delivery. so far, the focus has mostly been on low levels of scvo2, but textoris and co - workers have focused on higher levels of scvo2 in septic shock patients. they hypothesise that levels of scvo2 above 80% correlate with increased mortality and that this correlation is likely due to impaired ability to extract oxygen. in a retrospective design, they identified all adult icu patients with septic shock in a 2-year period and registered lowest and highest scvo2 measurements during the first 3 days in the icu. they found that the maximum scvo2 was significantly higher in the patients that died in hospital than in those who survived (85% versus 79%, p = 0.009). the association between maximum scvo2 and mortality persisted in a multivariate analysis adjusting for other variables that differed between the survivors and non - survivors. this is of obvious interest, but the study has several limitations, as the authors point out. the retrospective design carries an inherent risk of selection bias since patients with mild disease or early death might not have had any scvo2 measurements and were then excluded from the study. furthermore, scvo2 might have been measured more frequently in the most severely ill patients, increasing the chance for a high scvo2 measurement, especially as scvo2 varies over time. scvo2 depends on arterial oxygen saturation, cardiac output, oxygen consumption, haemoglobin levels and shunting. the ability of scvo2 to reflect systemic oxygen delivery / consumption is not constant in time as it depends on many conditions, including sedation, ventilator treatment, redistribution of blood as seen in shock and thus shock severity, the position of the catheter tip, which depends on the body position, and so on. textoris and co - workers hypothesise that the high scvo2 in the non - survivor group is likely due to impaired oxygen extraction, but there may be other explanations. it is likely that very aggressive resuscitation with high doses of fluid, vasopressors, inotropes and blood resulting in supranormal oxygen delivery, and thus high scvo2, negatively impacts on survival. alternatively, impaired regulation of the microcirculation might have resulted in shunting and thus high scvo2. the current data can not distinguish between these alternative hypotheses as discussed by the authors. if high scvo2 associates with increased mortality in sepsis, it may have clinical implications. but the hypothesis should be evaluated in a prospective, multicentre study with protocolized scvo2 measurements and detailed registration of potentially confounding factors, including use of fluid, vasopressors, inotropes and blood, to reduce the risk of bias. results from such a study have the potential to influence the design of further clinical trials evaluating scvo2 as a target for shock therapy. | shock therapy aims at increasing central venous oxygen saturation (scvo2), which is a marker of inadequate oxygen delivery. in this issue of critical care, textoris and colleagues challenge this notion by reporting that high levels of scvo2 are associated with mortality in patients with septic shock. this is of obvious interest, but as their retrospective design has inherent limitations, the association should be confirmed in a prospective, multicenter study with protocolized scvo2 measurements and detailed registration of potentially confounding factors. |
william 's syndrome, also known as william's - beuren syndrome or elfin - facies syndrome, was first described in 1961 as an association of supravalvular aortic stenosis and mental retardation in four children with characteristic facies by j.c.p william. beuren. described the syndrome independently and expanded the phenotype to include peripheral pulmonary artery stenosis and dental malformations. the mendelian inheritance in man (mim) number for william 's syndrome is # 194050. cases are thought to result from deletion of genetic material from adjacent genes (contiguous genes) within a specific region of chromosome 7 (7q11.23). medical diagnosis shows a deletion of genetic material including the elastin gene on chromosome # 7. individuals with william 's syndrome need regular monitoring for potential medical problems by a physician familiar with the disorder. a male patient of age 10 years reported to the department of pedodontics and preventive dentistry, with a chief complaint of pain in the lower right back tooth region. medical history revealed that he had been diagnosed of william 's syndrome 6 months after birth. his parents gave a history of swallowing problem and failure to thrive as an infant. general examination revealed abnormal gait, sloping shoulders, relatively short limbs, clubbed finger nails, hallus valgus and soft skin [figure 1,2 ]. classic facial features were broad forehead, spiked hair, broad eyebrows, bitemporal narrowness, periorbital fullness, short palpebral fissures, epicanthal folds, short nose, depressed nasal bridge, long philtrum, broad flattened thick lips, and wide mouth [figure 3 ]. hallus valgus(great toe) craniofacial features intraoral examination revealed class i molar relation bilaterally with anterior open bite and widely spaced dentition. deep proximal caries was seen in a, b, j, k, l and s (universal system). deep caries with pulpal involvement was seen in t. smooth surface caries were seen in the labial aspect of c, m and r. chronic generalized gingivitis was seen because of poor oral hygiene. intraoral findings - teeth in occlusion intraoral findings - maxillary arch intraoral findings - mandibular arch radiographic examination revealed mild taurodontism of both primary and permanent dentition [figure 7 ]. the following tests were carried out to rule out any systemic condition : transdermal skin test for allergy to lignocaine, cardiovascular evaluations for cardiovascular abnormalities and hypertension, eye test for vision and strabismus and blood investigation. although the patient presented with cooperative behavior and was able to follow instructions, he was unable to sit for a longer duration and would become irritable. hence, it was decided to treat the patient in an outpatient surgery setting with a short duration of appointments utilizing behavior management technique oral prophylaxis, pulpectomy in relation to a, b, j, t, pulpotomy in relation to k followed by stainless steel crown and restoration with glass ionomer cement in relation to c, m and, r was carried out. no complications presented during the treatment and the patient returned for follow - up visits after the next 6 months [figures 8,9,10 ]. follow - up photographs- teeth in occlusion follow - up photographs- maxillary arch follow - up photographs - mandibular arch william 's syndrome (idiopathic hypercalcemia supravalvular aortic stenosis syndrome) consists of a constellation of manifestations that overlap with hypercalcemia with or without mental retardation and supravalvular aortic stenosis with or without mental retardation. diagnosis is usually made in mid - childhood when characteristic features, cognitive profiles and cardiac findings become more apparent. one of the first indications that a neonate may have william 's syndrome is prolonged gestation (> 42 weeks), with birth weight and length in the 550 percentile. other manifestations are feeding difficulties, profuse vomiting and failure to thrive. owing to variability in the clinical findings, diagnosis is usually confirmed by chromosomal fluorescent in situ hybridization analysis or polymerase chain reaction. prenatal diagnosis of the deletion of 7q11.23 is available for families at high risk, using chorionic villous sampling or amniocentesis. facial dysmorphology is considered to be a diagnostic feature in patients with william 's syndrome, and is composed of soft tissue and skeletal components. the gene gtf2ird1 part of the tfii-1 transcription family has been implicated in the craniofacial features of william 's syndrome. according to mass and belostoky, four skeletal features contribute to the facial appearance of children with william 's syndrome : a short cranial base, the steep angle of the mandibular plane, an unusual proportion of upper to lower anterior facial height and posterior to anterior facial height, and a deficient chin, although the mandible could not be classified as retrognathic. patients demonstrated a higher than normal prevalence of class ii and class iii occlusions, open and deep bites, and anterior cross - bites. mild micrognathia, osteosclerotic changes in the lamina dura (particularly in the premolar molar region), folding and thickening of the buccal mucous membranes, and prominent accessory labial frenula are observed. hypoplasia of teeth, high prevalence of tooth agenesis, severe dental decay, oligodontia, pulp stones, microdontia, and abnormally small roots, tapered or screwdriver - shaped incisors, bud - shaped maxillary primary second molars, and mandibular permanent molars have been observed. abnormal tooth morphology was noted in 12.5% of the primary dentitions and in 40.7% of the permanent dentitions. malocclusion was noted in 85% of the cases, tongue thrusting in 67.7%, while more than 50% of the patients had excessive interdental spacing.[157 ] the craniofacial findings present in the present case were similar to the features described by moti moskovitz. medical considerations in treating these patients include : (i) cardiovascular and renal defects, which require general anesthetic and dosage of drugs modification. the major cause of morbidity is narrowing of arteries due to stenosis, hypoplasia, or coarctation. renal defects lead to hypercalcemia, impaired renal function, elevated blood urea, and creatine levels. patients require premedication to reduce anxiety and administration of prophylactic antibiotics for subacute bacterial endocarditis. impairment in perceptual motor integration and inability to cooperate, and hyperactivity disorder, which may require treatment consideration under sedation. hyperacusis in 7495% of the patients has been reported, which leads to easy distraction. this requires treating with caution to avoid mishaps due to sudden involuntary patient movement while treating in an outpatient surgery setting. cognitive, motor, and language delay are universal, and mental retardation is ultimately diagnosed. older children demonstrate a relative strength in language and auditory memory, with a significant weakness in visuospatial cognition. behavioral problems may include hypersensitivity to sound, sleep problems, attention - deficit / hyperactivity disorder, and anxiety. younger children suffer from anorexia and vomiting, which requires early dental evaluation and dietary counseling. dental anomalies, caries and malocclusion require nutritional counseling, dental restorative treatments, and orthodontic consultations. but, in children with hypoplasia, additional preventive measures need to be taken to reduce the occurrence of caries. the aapd has set guidelines for special considerations for the child diagnosed with william 's syndrome. establishment of medical and dental home with clear emphasis on continuity of care and the role of the family members as partners in the ongoing management and care of the child is required. william 's syndrome patients require a multi - disciplinary approach, taking into consideration their medical conditions and modifying treatment options to improve the quality of life of these patients. facial dysmorphology is considered to be a diagnostic feature in patients with william 's syndrome, and is composed of soft tissue and skeletal components. the gene gtf2ird1 part of the tfii-1 transcription family has been implicated in the craniofacial features of william 's syndrome. according to mass and belostoky, four skeletal features contribute to the facial appearance of children with william 's syndrome : a short cranial base, the steep angle of the mandibular plane, an unusual proportion of upper to lower anterior facial height and posterior to anterior facial height, and a deficient chin, although the mandible could not be classified as retrognathic. patients demonstrated a higher than normal prevalence of class ii and class iii occlusions, open and deep bites, and anterior cross - bites. mild micrognathia, osteosclerotic changes in the lamina dura (particularly in the premolar molar region), folding and thickening of the buccal mucous membranes, and prominent accessory labial frenula are observed. hypoplasia of teeth, high prevalence of tooth agenesis, severe dental decay, oligodontia, pulp stones, microdontia, and abnormally small roots, tapered or screwdriver - shaped incisors, bud - shaped maxillary primary second molars, and mandibular permanent molars have been observed. abnormal tooth morphology was noted in 12.5% of the primary dentitions and in 40.7% of the permanent dentitions. malocclusion was noted in 85% of the cases, tongue thrusting in 67.7%, while more than 50% of the patients had excessive interdental spacing.[157 ] the craniofacial findings present in the present case were similar to the features described by moti moskovitz. medical considerations in treating these patients include : (i) cardiovascular and renal defects, which require general anesthetic and dosage of drugs modification. the major cause of morbidity is narrowing of arteries due to stenosis, hypoplasia, or coarctation. renal defects lead to hypercalcemia, impaired renal function, elevated blood urea, and creatine levels. patients require premedication to reduce anxiety and administration of prophylactic antibiotics for subacute bacterial endocarditis. (ii) neurological defects mental retardation, impairment in perceptual motor integration and inability to cooperate, and hyperactivity disorder, which may require treatment consideration under sedation. hyperacusis in 7495% of the patients has been reported, which leads to easy distraction. this requires treating with caution to avoid mishaps due to sudden involuntary patient movement while treating in an outpatient surgery setting. cognitive, motor, and language delay are universal, and mental retardation is ultimately diagnosed. older children demonstrate a relative strength in language and auditory memory, with a significant weakness in visuospatial cognition. behavioral problems may include hypersensitivity to sound, sleep problems, attention - deficit / hyperactivity disorder, and anxiety. younger children suffer from anorexia and vomiting, which requires early dental evaluation and dietary counseling. dental anomalies, caries and malocclusion require nutritional counseling, dental restorative treatments, and orthodontic consultations. but, in children with hypoplasia, additional preventive measures need to be taken to reduce the occurrence of caries. the aapd has set guidelines for special considerations for the child diagnosed with william 's syndrome. establishment of medical and dental home with clear emphasis on continuity of care and the role of the family members as partners in the ongoing management and care of the child is required. william 's syndrome patients require a multi - disciplinary approach, taking into consideration their medical conditions and modifying treatment options to improve the quality of life of these patients. with the occurrence of sporadic cases of william 's syndrome, knowledge about their diagnosis, general health, and mode of delivering treatment help the dentists to deliver a more appropriate treatment. | william 's syndrome is a chromosomal disorder characterized by multisystem, congenital and panethnic occurrence, characterized by a number of developmental and physical abnormalities. this case report describes the dental management of a 10-year - old male patient with william 's syndrome who had multiple dental problems such as caries, periodontal disease and malocclusion. |
cells produce cytokines in response to a variety of stresses, including infection, physical trauma, and carcinogen - induced injury. however, failure of the body to resolve an injury can lead to persistent cytokine production and tissue damage. chronic cytokine production with angiogenesis and inflammation during tumor growth is an example of this. cancer cells release various cytokines and growth factors into their surroundings, recruiting and reprogramming other cell types in order to establish a tumor microenvironment [111 ]. tumor derived cytokines, such as fas ligand, vascular endothelial growth factor (vegf), and transforming growth factors and (tgf), may facilitate the suppression of immune response to tumors. the complex interactions between tumor cells and various other cell types, such as endothelial cells, fibroblasts, and leukocytes, involve cascades of cytokines and growth factors that in turn can have local and systemic effects [19 ]. cytokines such as interleukins 4, 6, 8, and 10 (il-4, il-6, il-8, il-10) along with tgf and vegf, may regulate tumor growth, promote angiogenesis, induce (or inhibit) inflammation, or modify the antitumor immune responses [611 ]. some cancer patients exhibit chronic low - grade inflammation that in turn can give rise to fatigue, depression, anorexia, cachexia, pain, and poor prognosis. interleukins 1, 6, 8, 12, and 13 (il-1, il-6, il-8, il-12, il-13), granulocyte macrophage colony - stimulating factor (gm - csf), monocytes chemoattractant proteins (mcp-1), macrophage inflammatory proteins (mip-1,), interferon (ifn-), tumor necrosis factor (tnf-), epidermal growth factor (egf), vegf, and tnf receptor ii have all been reported to be elevated in cancer patient serum relative to that of healthy subjects [111 ]. recent studies suggest that ascorbate (ascorbic acid, vitamin c) therapy may reduce inflammation and angiogenesis in tumors. intravenous ascorbate therapy is of interest as a potential adjuvant therapy, in part because of the potential for ascorbate, at sufficient concentrations, to inhibit cancer cell growth while serving as a biological response modifier. ascorbate, at concentrations attainable via intravenous infusions, has been shown to induce apoptosis in cancer cells, inhibit tubule formation and angiogenesis, stimulate collagen synthesis, and reduce the production of pro - inflammatory cytokines. ascorbate may protect against activation of hif-1, an inflammation promoter that is upregulated in tumors and leads to increased production of the angiogenesis factor vegf. it also may inhibit the activation of nf-b, a transcription factor that leads to an overexpression of inflammatory proteins and cytokines such as il-2il-1 and tnf- [2428 ]. vitamin c may also inhibit inflammation by blocking the inflammatory activity of gm - csf, a cytokine that induces an increase in reactive oxygen species in response to tumor necrosis factor and il-1. the effects of ascorbate on inflammatory cytokines is concentration dependent, in that doses typical of oral supplementation (250 to 3000 mg per day) do not show any effect [3035 ]. hence, any anti - inflammatory effect of vitamin c is likely confined to situations where the antioxidant is administered intravenously. ascorbate may also be important in supporting immune function, in part through its antioxidant protection of immune cells and its effects on phosphatase activity, transcription factors, and gene expression. in vitro ascorbate may increase phagocytic activity and have anti - proliferative activity comparable to that of ifn-. given the role of cytokines in cancer, and the potential ability of ascorbate to modulate cytokine production, we undertook to measure cytokine production in cancer patients before and after treatment with intravenously administered vitamin c. the goal of the study was to demonstrate that ascorbate therapy may alter cytokine expression in cancer patients in a way that is favorable to tumor suppression. the present manuscript describes measurements of over 170 cytokines in twelve patients with a variety of cancers. in a separate sample of 4 patients serum samples from twelve cancer patients and 8 healthy volunteers were obtained for analysis on a voluntary basis with full hipaa compliance. the research was in compliance of the declaration of helsinki and approved by the institutional review board of riordan clinic. most patients were late stage, had metastatic disease, and had previously undergone surgery and/or conventional therapy. cancer patients were treated with intravenous ascorbate infusions at the riordan clinic according to the riordan ivc protocol. the details of this protocol have been described elsewhere and are available for download at the riordan clinic web site : https://riordanclinic.org / research - study / vitamin - c - research - ivc - protocol/. briefly, new cancer patients are given a 15-gram injection for their first dose, followed by a 25-gram injection the next day. dosage is then adjusted by the physician based on the patients tolerance and plasma ascorbate levels attained post infusion. patients in the present study reached 50 grams per infusion by their sixth course of treatment. serum samples for cytokine analysis were taken before the onset of each patient s first ivc treatment and after the patient s sixth ivc treatment. serum concentrations of 174 cytokines were measured using a protein array kit (aah - cyt-2000, raybiotech). the assay was conducted according to the manufacture s provided procedure. in this assay, is added and cytokines are allowed to bind to antibodies, additional antibodies tagged with chemiluminescent markers are added. the antigen - antibody spots on the image were circled by spot denso of fluorchem sp software (alpha innotech). specifically the mean and standard deviation sd were determined for each cytokine, with a 2 sd range being considered normal. z - scores for each cytokine in each cancer patient were computed : furthermore, cytokines were also scored based on their ability to promote (+) or inhibit () angiogenesis or inflammation. an angiogenesis score and an inflammation score were then computed for each sample by taking the sum of the z - scores for angiogenesis (or inflammation) promotors and subtracting out the z - scores of the angiogenesis (or inflammation) inhibitors. the result was then divided by the total number of cytokines included in the sum. further tests were done on 4 of 12 cancer patients for ivc influences as measured by protein array assay. serum concentrations of 58 proteins (a list is provided along with results in table 2) were measured by array, which is a label - based assay (with antibody spotted and analyte labeled) for 58 markers of cytokines and oncoproteins based on the principle of ray biotech protein array kit (# aah - blm-1 - 2) and modified. serum samples from 8 healthy volunteers (3560 years old, 4 males and 4 females) were used to establish normal ranges, and z - scores for each protein in each cancer patient were computed as described above. vitamin c in serum of subjects was measured by high - pressure liquid chromatography (hplc) with electrochemical detection. the data were analyzed by systat software (systat, inc.) and kaleidagraph software. graphs and curve fits were generated by kalaidagraph (synergy software) and tests of significance were carried out using mann - whitney non - parametric test. serum samples from twelve cancer patients and 8 healthy volunteers were obtained for analysis on a voluntary basis with full hipaa compliance. the research was in compliance of the declaration of helsinki and approved by the institutional review board of riordan clinic. most patients were late stage, had metastatic disease, and had previously undergone surgery and/or conventional therapy. cancer patients were treated with intravenous ascorbate infusions at the riordan clinic according to the riordan ivc protocol. the details of this protocol have been described elsewhere and are available for download at the riordan clinic web site : https://riordanclinic.org / research - study / vitamin - c - research - ivc - protocol/. briefly, new cancer patients are given a 15-gram injection for their first dose, followed by a 25-gram injection the next day. dosage is then adjusted by the physician based on the patients tolerance and plasma ascorbate levels attained post infusion. patients in the present study reached 50 grams per infusion by their sixth course of treatment. serum samples for cytokine analysis were taken before the onset of each patient s first ivc treatment and after the patient s sixth ivc treatment. serum concentrations of 174 cytokines were measured using a protein array kit (aah - cyt-2000, raybiotech). the assay was conducted according to the manufacture s provided procedure. in this assay, is added and cytokines are allowed to bind to antibodies, additional antibodies tagged with chemiluminescent markers are added. the antigen - antibody spots on the image were circled by spot denso of fluorchem sp software (alpha innotech). specifically the mean and standard deviation sd were determined for each cytokine, with a 2 sd range being considered normal. z - scores for each cytokine in each cancer patient were computed : furthermore, cytokines were also scored based on their ability to promote (+) or inhibit () angiogenesis or inflammation. an angiogenesis score and an inflammation score were then computed for each sample by taking the sum of the z - scores for angiogenesis (or inflammation) promotors and subtracting out the z - scores of the angiogenesis (or inflammation) inhibitors. the result was then divided by the total number of cytokines included in the sum. further tests were done on 4 of 12 cancer patients for ivc influences as measured by protein array assay. serum concentrations of 58 proteins (a list is provided along with results in table 2) were measured by array, which is a label - based assay (with antibody spotted and analyte labeled) for 58 markers of cytokines and oncoproteins based on the principle of ray biotech protein array kit (# aah - blm-1 - 2) and modified. serum samples from 8 healthy volunteers (3560 years old, 4 males and 4 females) were used to establish normal ranges, and z - scores for each protein in each cancer patient were computed as described above. vitamin c in serum of subjects was measured by high - pressure liquid chromatography (hplc) with electrochemical detection. the data were analyzed by systat software (systat, inc.) and kaleidagraph software. graphs and curve fits were generated by kalaidagraph (synergy software) and tests of significance were carried out using mann - whitney non - parametric test. the serum concentrations of 174 cytokines were determined in each of 12 cancer patients before and after a course of intravenous vitamin c therapy. plasma ascorbate levels, shown in figure 1, ranging from 5 mm to 15 mm, were achieved immediately after infusions, consistent with previous observations with the riordan protocol. total treatment times ranged from less than 1 month to 52 months, with cancers of the breast, prostate, colon, lung, sarcoma, and pancreas all represented. data presented in article were measured at the beginning of patient enrollment during first 2 weeks. the comparison of initial samples (prior to therapy) and final samples (after the last of 6 ivc treatments) showed important changes in cytokine levels. cytokines that moved in the normal range and those that moved outside the normal range are listed in table 3. the values presented in 2 columns for each patient show the cytokines that were out of normal range (nr 2sd) and returned to normal range or were in normal range and decreased or increased to levels lower or higher than nr. the overall effect of treatment was to decrease most cytokine levels ; whether this is due to the ascorbate treatments or simply due to disease progression is not known, since we did not have untreated control subjects in this study, but as the period of treatment was 2 weeks, we suggest that all changes were due to treatment. there are several cytokines for which a variety of patients saw decreases after ivc therapy. these include mitogens (egf, fit-3 ligand, hgf, igf-1, il-21r) and chemo - attractants (ctac, eotaxin, e - selectin, lymphotactin, mip-1, mcp-1, tarc, sdf-1), as well as inflammation and angiogenesis factors (fgf-6, il-1, tgf-1). the cytokines that were increased after treatments were timp (high concentrations are associated with good prognosis in patients with breast cancer), beta - ngf (stimulates chemotactic recruitment of leukocytes), i - tac (potent chemoattractant for il-2 activated t cells), il-1r (antagonistic to il-1, a non - signaling decoy receptor, which functions by capturing il-1 and blocking il-1r1), and il-3 (enhances tumor antigen presentation). several cytokines were decreased : mip-1 (causes local inflammatory response, chemoattractant for t cells and monocytes), il-10 (inhibits antigen - presenting cells, inhibits cytokine production), lymphotactin (enhances t cell recruitment), il-1 (co - stimulates cell activation, inflammation, required for tumor invasion and angiogenesis), bmp (regulates cellular proliferation and apoptosis), and igf (promotes the proliferation of many types of cells). the cytokine profile in these patients was compared to the normal range (determined from 8 healthy volunteers). we calculated for each patient the percentage of cytokines (from all measured cytokines) that were in normal range before and after treatment, percentage of cytokines that returned to normal range and percentage of cytokines that remained higher or lower than normal range. the cytokines that remained in normal range before and after treatment were in a range of 6080%, the improved cytokines ranged from 1% to 9%, with lowest value for the lung cancer patient, and the levels of 79% for patients with prostate, colon, renal, and ovarian cancers. the cytokines that were not changed and were outside the normal levels ranged from 3% to 23%. there is quite a contrast, with 7 patients (all breast cancer patients, sarcoma, lung and colon cancer) having cytokine levels that are predominately below the normal range while 5 others (prostate, ovarian, pancreas, renal and colon cancers) had cytokine levels that were predominantly in the normal range. interestingly, all 4 of the breast cancer patients in our study fell into the first group, showing depressed cytokine levels across the board. only 28 cytokines had average z - scores (mean of twelve patients) above zero, with bmp-4, sdf-1, il-1alpha, mcp-2 and light having the highest average z - scores before treatment. among the cytokines considered relevant to inflammation and angiogenesis, the ones with positive mean (for the twelve cancer patients) z - scores are fgf-4 (0.33), scf (z=0.1), mip-3-alpha (z=0.2), il-9 (z=0.24), bmp-6 (z=0.54), tgf - beta 3 (z=0.78), ck beta (z=1.2), il-1alpha (z=1.8), mif (z=1.04), and mip-1-delta (z=1.1). all of these cytokines, it should be noticed, decreased in concentration over the course of ivc therapy. in an attempt to understand how these changes might affect cancer, we separated the angiogenesis factors and inflammation factors. angiogenesis and inflammation scores for each patient, computed as described above, are shown in table 4. table 5 shows cytokines from those categories that showed the most change over the course of treatment. some, such as dr6, il-1, il1-r1, and il-12, showed considerable variability without consistent trends, while others showed more consistent decreases over time. particularly striking were decreases in the angiogenesis factors endoglin, egf, and fgf-6. inflammation factors (or anti - inflammation factors) that decreased most dramatically were eotaxin, il-4, il-10, lymphotactin, mcp-1, mip-1, tarc, tgf-3, and tgf-1. there does not appear to be any systematic decrease in pro - inflammatory agents versus anti - inflammatory agents. overall, the inflammation and angiogenesis scores decreased, suggesting that over time the cytokine mix for these patients moves toward a less inflammatory and less angiogenic state. the declines in values are more dramatic in subjects who started with positive initial values. the changes in z - scores, angiogenesis scores, and inflammation scores were especially dramatic for the pancreatic cancer patient, a subject who showed cytokine profiles characterized by normal to elevated levels before treatment, and reduced levels after treatment. this patient was interesting in that he did not undergo radiation therapy, chemotherapy, or surgery. prostate patient had proved refractory to standard treatment and was given a prognosis of death within 1 year ; with ivc treatments he survived for 6 years. she was treated for 3 years, at which point scans showed her to be clear of almost all metastases. finally, the breast cancer patient (who had an invasive tumor with a recurrence score of 23) was treated with ivc after mastectomy. she was treated at the riordan clinic for 2.5 years before moving to another location. examining data in tables 3 and 5, we do not see much commonality between these 3 subjects. patients with breast cancer and sarcoma had cytokine levels what were reduced during treatment, with large reductions in angiogenesis and inflammation scores. the patient with prostate cancer, however, showed profiles with reduced cytokine levels and did not show much change in levels during treatment. to gain a different perspective, and perhaps narrow the focus a bit, we tested 4 of the 12 cancer patients for serum levels of 58 protein markers. we chose the patient with sarcoma, who came after radiation and chemotherapy with very poor prognosis ; 2 patients with breast cancer (both after mastectomy, but 1 of them had metastasis and treated by chemotherapy and radiation and another did not have metastasis and chemotherapy) ; and the patient with colon cancer after conventional treatment (surgery and chemotherapy). as indicated, these patients were subject to a series of 6 intravenous vitamin c treatments prior to the final assay. the results for 4 patients of protein profiles and their average z - scores are listed in table 2. before treatment, all measured proteins except cea pan h-8, ca 15 - 3, h - albumin, ca 19 - 9, c - myc and ca242 were in normal range 2sd. the most dramatic and consistent results involved decreases in values of several tumor markers (ca 15 - 3, ca 19 - 9, cea, and ca 242) as well as decreases in the transcription regulator c - myc. the gene responsible for producing this protein is thought to be mutated in cancer cells, leading to increased expression and increased cell proliferation. figure 3 shows a histogram to indicate how dramatically these tumor markers decreased over the course of treatment. for the average z - score of ras protein, we saw a return from an overproduced state (z=1.18) to normal ranges (z=0.08). other encouraging results include statistically significant increases in brca1 and brca2, both dna repair agents key in cell cycle control, and c - jun, an important factor in cell differentiation, proliferation control, and apoptosis. however, mmp-3/10, a matrix metalloproteinase that is critical in maintaining extracellular matrix composition, increased slightly during treatments. in summary, the protein assay test shows several tumor markers being reduced or restored to normal ranges over the course of treatments. we are able to show that average z - scores for several inflammatory and angiogenesis promoting cytokines are positive, indicating that they are higher than averages for healthy controls, and that their levels decreased over the course of treatment. some of these results confirm previous reports, including egf, fgf, mip, mcp, and tnf. others elevated in our study, including il-4, 10, mcsf - r, and leptin, have not been reported previously as being elevated. of the cytokines that are thought to be important in angiogenesis and inflammation, we saw dramatic decreases in egf, fgf, il-4, il-10, lymphotactin, mcp-1, mip, tarc, tgf-, and tgf-. we computed 2 parameters, the angiogenesis score and the inflammation score, to provide an average z - score for cytokines involved in these processes. these scores decreased noticeably during the period of treatments, with changes being more dramatic in the cancer patients, who had elevated levels of inflammatory and angiogenic cytokines prior to treatment. our small sample size did not allow us to demonstrate differences pre - versus post - treatment with 95% confidence, but we did have significance near the =0.10 level in some cases, suggesting that further measurements may be worthwhile. our encouraging finding may be the measurements of 58 proteins and markers in 4 cancer patients. we found that serum concentrations of tumor markers decreased during the time period of ivc treatment. in addition to the marker decreases, we saw reductions in c - myc and ras, 2 proteins implicated in being upregulated in cancer. we also saw increases in some proteins that might be considered beneficial in combating cancer, including c - jun, which plays a role in differentiation and apoptosis, and the dna repair agents brca1 and 2. it should be noted that changes that occurred during the course of therapy (1 or 2 weeks) may be due to the therapy itself ; however, there were no untreated controls for cancer patients in this study. the use of high - dose intravenous vitamin c as a possible therapy for cancer has been revisited recently [4148 ] and several trails of the use of ivc as adjuvant therapy are under way. in our study we analyzed cytokines as the messengers for the regulation of the inflammatory and angiogenic cascades. our data confirm the inhibition and positive regulation of the part of cytokines responsible for angiogenesis and inflammation after 6 ivc treatments. angiogenesis and inflammation share common pathways, and both play key roles in the initiation and progression of cancer. inflammatory cells may facilitate angiogenesis and promote tumor cell growth, invasion, and metastasis. the fda has approved several angiogenesis inhibitors for anticancer therapy. while these drugs seem to have mild adverse effects, recent studies reveal the potential for complications that reflect the importance of angiogenesis in normal body processes. high - dose ascorbic acid therapy may also be a useful strategy for reducing inflammation and angiogenesis. phase i studies show high - dose (10 to 100 grams) intravenous ascorbate therapy shows a good safety profile [45,4953 ] while improving quality of life as measured by cancer patient reported scores in physical, emotional, and cognitive function. patients also show reduced fatigue, nausea / vomiting, pain, and appetite loss after ivc administration. because intravenous ascorbate therapy is of interest as a potential adjuvant therapy, we analyzed the levels of cytokines before and after high - dose ascorbic acid treatment in cancer patients. the ivc injections resulted in increased concentration of ascorbic acid in blood, from 5 mm after first 15 g ivc infusion to 15 mm after last 50 g ivc. given the role of cytokines in cancer, and the potential ability of ascorbate to modulate cytokine production, we measured cytokine production in cancer patients before and after treatment. it should be noted that changes that occurred during the time of therapy (2 weeks) may be considered being due to the therapy itself ; however, there were no untreated controls of cancer patients in this study. we were able to show that average z - scores for several inflammatory and angiogenesis promoting cytokines that were higher than average for healthy controls decreased over the duration of treatment. in addition, serum concentrations of tumor markers decreased during the period of treatment and there were reductions in c - myc and ras proteins thought to be upregulated in cancer. in conclusion, the present study suggests that vitamin c therapy can downregulate angiogenesis and inflammation promoting cytokines in some cancer patients. future studies should focus on a larger sample of cancer patients, and perhaps a greater variety of tumor types. | backgroundcytokines play an important role in tumor angiogenesis and inflammation. there is evidence in the literature that high doses of ascorbate can reduce inflammatory cytokine levels in cancer patients. the objective of this study was to investigate the effect of treatment by intravenous vitamin c (ivc) on cytokines and tumor markers.material/methodswith the availability of protein array kits allowing assessment of many cytokines in a single sample, we measured 174 cytokines and additional 54 proteins and tumor markers in 12 cancer patients before and after a series of ivc treatments.resultspresented results show for our 12 patients the effect of treatment resulted in normalization of many cytokine levels. cytokines that were most consistently elevated prior to treatments included m - csf - r, leptin, egf, fgf-6, tnf-,, tarc, mcp-1,4, mip, il-4, 10, il-4, and tgf-. cytokine levels tended to decrease during the course of treatment. these include mitogens (egf, fit-3 ligand, hgf, igf-1, il-21r) and chemo - attractants (ctac, eotaxin, e - selectin, lymphotactin, mip-1, mcp-1, tarc, sdf-1), as well as inflammation and angiogenesis factors (fgf-6, il-1, tgf-1).conclusionswe are able to show that average z - scores for several inflammatory and angiogenesis promoting cytokines are positive, indicating that they are higher than averages for healthy controls, and that their levels decreased over the course of treatment. in addition, serum concentrations of tumor markers decreased during the time period of ivc treatment and there were reductions in cmyc and ras, 2 proteins implicated in being upregulated in cancer. |
cerebral palsy (cp) refers to permanent, mutable motor development disorders stemming from a primary brain lesion, leading to secondary musculoskeletal alterations, and limitation of activities of daily living1. motor impairment is the main manifestation in children with cp, and it has consequent effects on the biomechanics of the body2. children with cp exhibit impaired muscle coordination, difficulties in organization of sensory information and functional limitations3. postural control is fundamental to efficient, effective functional performance in all activities of daily living4. this complex process depends on the interaction of the visual, vestibular and peripheral systems, commands of the central nervous system and neuromuscular responses5. deficits in postural control due to motor impairment have been identified as one of the main limitations in the development of children with cp6. abnormal movements and posture of children with cp are the consequences of limitations stemming from the disease, which directly affect overall neuromuscular development and the postural control mechanism7. a number of studies in the scientific literature propose combining the pediatric evaluation of disability inventory (pedi) and the gross motor function classification system (gmfcs)2 for the classification of cp with regard to function8. the pedi allows the assessment of skills and functional performance in typical tasks and activities of daily living9, and it is administered in the form of a structured interview with one of the child s caregivers. the first part of the questionnaire evaluates the skills in the child s repertoire grouped into three functional categories : self - care, mobility and social function. in the present study, only the self - care and mobility dimensions were considered to determine the importance of functional balance in the performance of activities of daily living. due to the lack of specific scales, assessment tools for the clinical evaluation of postural control in elderly individuals the berg balance scale was developed for the analysis of balance of elderly individuals12, 13 and was translated into portuguese by miyamoto. this scale has been widely used for the assessment of balance of adult and child populations. however, a pilot study involving children found that the berg balance scale demonstrated contestable reliability in a child population15. thus, changes were made to the 14 items of the scale to adapt it to the pediatric population and a specific scale was developed the pediatric balance scale (pbs). the pbs was developed in the united states and has 14 items that assess daily functional activities of children aged 5 to 15 years with mild to moderate motor impairment. the pbs was used to detect successive changes in the functional balance of six children with cp with mild to moderate impairment in evaluations performed at four - month intervals over a three - year period16. the adaptation of the scale consisted of changes to the order of the application of the tests, the time for maintaining static positions, the instructions and the equipment used. ries.17 published a study in which the pbs was adapted and validated for use with brazilian pediatric populations. the cross - cultural adaptation process involved four translators and 33 healthcare professionals. intra - examiner reliability was demonstrated through the administration of the scale for five volunteers with cp on three different occasions. the pbs has demonstrated reliability for use with brazilian children with a diagnosis of cp classified as levels i and ii on the gmfcs. as the pbs and pedi are important tools for the evaluation of function of children, the primary aim of the present study was to determine whether there was a correlation between functional balance (pbs) and functional performance (pedi) in a sample of children with cp at a physical therapy teaching clinic. the secondary aim was to determine differences in functional balance and functional performance (self - care and mobility dimensions) in children classified as levels i, ii and iii on the gmfcs. the hypothesis to be tested was that different results would be found among children classified on different gmfcs levels. the present study complied with the principles of the declaration of helsinki and the regulating norms and guidelines for research involving human subjects formulated by the brazilian national health council, ministry of health, established in october 1996. the study received approval from the ethics committee of the universidade nove de julho (sao paulo, brazil) under protocol number 409972\2011. all parents / guardians agreed to the participation of the children by signing a statement of informed consent. an observational, cross - sectional study was carried out involving 30 male and female children aged four to 10 years with a diagnosis of spastic cp. the participants were recruited from the physical therapy clinics of nove de julho university in so paulo, brazil. convenience sampling was performed and the initial sample was made up of 53 children with a diagnosis of cp, 30 of whom were selected based on the following eligibility criteria : a diagnosis of spastic cp ; a functional classification of levels i, ii or iii on the gmfcs2 an age between 4 and 12 years ; and agreement from a parent / guardian to the child s participation received through a signed statement of informed consent. the exclusion criteria were a) incompatible degree of comprehension and cooperation for performance of the activities proposed, and b) orthopedic deformities with indication for surgery. the sample was divided into three groups based on the gmfcs : group 1 children classified as level i ; group 2 children classified as level ii ; and group 3 children classified as level iii. the participants were evaluated using the following functional test and scale. pediatric balance scale (pbs) : functional balance was assessed using the pbs, which consists of 14 tasks similar to activities of daily living. the items are scored on a five - point scale (0, 1, 2, 3 or 4), with zero denoting an inability to perform the activity without assistance and four denoting the ability to perform the task with complete independence. the score is based on the time for which a position can be maintained, the distance to which the upper limb is capable of reaching in front of the body, and the time needed to complete the task. the test is performed with the child clothed and making use of his / her habitual brace and/or gait - assistance device4, 13. pediatric evaluation disability inventory : the pedi quantitatively measures functional performance. this questionnaire was administered in interview form to one of the child s caregivers who was knowledgeable about the performance of the child in typical activities and tasks of daily routine. this assesses skills in the child s repertoire grouped into three functional categories : self - care (73 items), mobility (59 items) and social function (65 items). an item is scored 0 (zero) when the child is unable to perform the activity or 1 (one) when the activity is part of the child s repertoire of skills. each participant was evaluated on two non - consecutive days by previously trained physiotherapists blinded to the objectives of the study. anthropometric characteristics (height, body mass and body mass index) were then determined. the order of the administration of the assessment tools was determined randomly by lots. during all evaluations, the children were clothed and made use of their habitual ankle - foot orthoses, walkers or crutches, since the aim of the study was to obtain results similar to normal daily performance. the children could interrupt the evaluation at any time due to fatigue or discomfort. the kolmogorov - smirnov test was used to determine whether the data adhered to the gaussian curve. a normal distribution was demonstrated, the data were expressed as mean and standard deviation. pearson s correlation coefficient (r) was used to determine correlations between the pbs and pedi. one - way anova was used for the comparison of means of the results among the different groups. the data were organized and tabulated using the statistical package for the social sciences (spss v.19.0). group 1 was made up of two children with diparesis and eight with hemiparesis. group 2 was made up of nine children with diparesis and one with hemiparesis. group 3 was entirely made up of ten children with diparesis who used forearm crutches as a gait - assistance device. anthropometric data of the sample (mean sd)group 1 gmfcs igroup 2 gmfcs iigroup 3 gmfcs iiiage (years)8.5 0.78.4 0.77.9 1.4body mass (kg)27.4 2.526.5 2.925.8 3.2height (cm)127.3 5.8124.1 6.9122.4 4.2body mass index (kg / m)16.5 0.617.0 0.315.9 0.9 displays the anthropometric data for the sample. a strong correlation was found between the pbs and both the self - care (r = 0.73 ; p < 0.001) and mobility (r = 0.82 ; p < 0.001) dimensions of the pedi. a strong positive correlation was also found between the self - care and mobility dimensions of the pedi (r = 0.72 ; p < 0.001). in the analysis of the different gmfcs levels, a moderate correlation was found between the pbs and self - care dimension of the pedi (r = 0.51 ; p = 0.12), and a strong correlation was found between the pbs and the mobility dimension of the pedi (r = 0.82 ; p < 0.001) in group 1 (gmfcs level i). moderate correlations were found between the pbs and both the self - care dimension (r = 0.57 ; p = 0.10) and mobility dimension (r = 0.41 ; p = 0.23) of the pedi in group 2 (gmfcs level ii). the pbs was weakly correlated with the self - care dimension (r = 0.11 ; p = 0.77) and moderately correlated with the mobility dimension (r = 0.55 ; p = 0.12) in group 3 (gmfcs level iii). the results of anova (table 2table 2. results (mean and sd) of the functional test and pedi scale in the different groupsgroup 1 (n=10)group 2 (n=10)group 3 (n=10)pbs51.0 (2.7)46.6 (4.7)34.8 (4.9) # pedi- mobility51.1 (3.3)50.6 (3.0)34.5 (6.9) # pedi- self - care62.0 (7.6)63.5 (7.0)41.7 (6.2) # anova i x iii (p<0.05) ; # anova ii x iii (p<0.05)) revealed statistically significant differences in the self - care dimension of the pedi between groups 1 and 3 (p < 0.001) as well as between groups 2 and 3 (p < 0.001), whereas no significant difference was found between groups 1 and 2 (p = 1.0). statistically significant differences were also found in the mobility dimension of the pedi between groups 1 and 3 (p < 0.001) as well as between groups 2 and 3 (p < 0.001), whereas no significant difference was found between groups 1 and 2 (p = 1.0). likewise, statistically significant differences were found in the pbs between groups 1 and 3 (p < 0.001) as well as between groups 2 and 3 (p < 0.001), whereas no significant difference was found between groups 1 and 2 (p = 0.08). anova i x iii (p<0.05) ; # anova ii x iii (p<0.05) falls constitutes one of the most frequent complaints of children with cp who have the ability to walk independently21. the aim of the present study was to analyze correlations between the results of the pediatric balance scale and the functional test, the pediatric evaluation disability inventory (self - care and mobility dimensions), for children classified as levels i to iii on the gmfcs. the current preference in the literature is to classify children with cp based on the gmfcs, which measures functional independence with regard to gross motor skills. a number of studies report that this classification, which takes the child s age into account, maintains a certain stability over the years22, 23. children classified on levels i and ii have a good prognosis regarding gait and do not require gait - assistance devices. auxiliary resources, such as orthoses, conventionally improve the positioning of the ankle. in contrast, walkers and forearm crutches are indicated to compensate for deficient balance and are fundamental for children classified as level iii. the present findings revealed significant differences between the children classified as levels i and ii and those classified as level iii regarding self - care, mobility and the pbs ; there were no significant differences between the children classified as levels i and ii. despite the lack of significant differences between the children classified using the gmfcs as groups 1 and 2, the results of the correlations analyzed were not equal. the only significant correlation for group 1 participants was between the pbs and the mobility dimension of the pedi. a strong correlation was found between functional balance and the mobility dimension of the pedi in group 1 and moderate correlations were found in groups 2 and 3. the mobility dimension of the pedi evaluates performance during locomotion as well as overall mobility, including transfers. the pbs involves items such as changing from a sitting to a standing position, transfers and picking up objects from the floor, which is similar to the assessments performed with the mobility dimension of the pedi. many of the items of these two instruments are similar, and the results demonstrate the clinical status of children with cp regarding muscle tone and impaired postural control, both of which affect functional balance6, 24, 25. with the current interest in the analysis of functional balance, there is a need for detailed evaluations of assessment tools designed for such an analysis. in study carried out by ries.17, the pbs was shown to be a simple, valid, reliable assessment tool for individuals with cp. the administration of the pbs requires a maximum of 15 minutes and uses materials that are easy to obtain (stopwatch, ruler / tape measure, chair, stool, adhesive tape, foot support)., postural control is inversely proportional to the classification level of the gmfcs, as a higher level denotes worse postural control. balance and postural control in the standing position are fundamental components of movement, involving the ability to anticipate and recover from instabilities as well as to take action to avoid instability26. as poor balance hampers the performance of functional activities of daily living5, we expected the pbs would be significantly correlated with all dimensions of evaluation employed in the present study, which did not prove to be true. thus, the pbs can not be considered a predictor of performance of global functions in children with cp, especially children classified as level iii, since a strong correlation was only found for the mobility dimension of the pedi for level i subjects, and only moderate correlations were found for levels ii and iii. regarding the self - care dimension, moderate correlations were found among all levels, which may be explained by the fact that this dimension does not involve a change in position and only evaluates activities performed while sitting (eating, brushing one s teeth, brushing one s hair). the pbs demonstrated a positive correlation with the mobility dimension of the pedi, regardless of the degree of motor impairment (gmfcs level). thus, the results of the scale can help to determine the degree of independence in activities related to functional mobility in children with cp, such as the ability to walk, demonstrating that balance is a prerequisite for independent gait performance. in the present study, no significant differences were found between groups 1 and 2, which is likely due to the similarity in these two functional levels. reliable measures of functional balance for children with cp are important in clinical practice for the determination of the proper therapy protocol and the assessment of the results obtained. based on the present findings, the pbs may be considered a good auxiliary tool for the assessment of functional performance with regard to mobility, but can not be used in an isolated fashion as a predictor of performance of other functions. thus, a complete analysis is necessary for the functional classification of children with cp. the study population was composed of a convenience sample (children with cp registered at the physical therapy clinics of the universidade nove de julho, brazil) and therefore no sample size calculation was performed. future studies with a larger number of participants should stratify the sample based on functional level (gmfcs levels i / ii and level iii). | [purpose ] to investigate the correlation of functional balance with the functional performance of children with cerebral palsy. [subjects and methods ] this was a cross - sectional study of children with cerebral palsy with mild to moderate impairment. the children were divided into 3 groups based on motor impairment. the evaluation consisted of the administration of the pediatric balance scale (pbs) and the pediatric evaluation disability inventory. correlations between the instruments were determined by calculating pearson s correlation coefficients. [results ] in group 1, a strong positive correlation was found between the pbs and the mobility dimension of the pediatric evaluation disability inventory (r=0.82), and a moderate correlation was found between the pbs and self - care dimension of the pediatric evaluation disability inventory (r=0.51). in group 2, moderate correlations were found between the pbs and both the self - care dimension (r=0.57) and mobility dimension (r=0.41) of the pediatric evaluation disability inventory. in group 3, the pbs was weakly correlated with the self - care dimension (r=0.11) and moderately correlated with the mobility dimension (r=0.55). [conclusion ] the pbs proved to be a good auxiliary tool for the evaluation of functional performance with regard to mobility, but can not be considered a predictor of function in children with cerebral palsy. |
for in vitro end joining and lyase reactions recombinant purified ku, xrcc4-ligaseiv, xlf / cernunnos, and/or dna - pkcs purified from hela cells were incubated with radiolabeled substrates before analysis by electrophoresis. for cellular nhej assays a dermal fibroblast line from a mouse deficient in ku70 and p5313 was engineered by retroviral transduction to express wild type mouse ku70, ku70 3a, or an empty vector control. nhej substrates were introduced into these cells by electroporation, harvested, and sample recovery and nhej efficiency assessed by qpcr. nhej accuracy was further assessed by digestion of amplified junctions with a restriction enzyme diagnostic for predicted products. | mammalian cells require nonhomologous end joining (nhej) for efficient repair of chromosomal dna double - strand breaks1. a key feature of biological sources of strand breaks is associated nucleotide damage, including base loss (abasic or ap sites)2. at single strand breaks, 5 ' terminal abasic sites are excised by pol 's 5'drp lyase activity3,4,5,6 : we show here in vitro and in cells that accurate and efficient repair by nhej of double - strand breaks with such damage similarly requires 5'drp / ap lyase activity (figure 1a). classically defined nhej is moreover uniquely effective at coupling this end - cleaning step to joining in cells, helping distinguish this pathway from otherwise robust alternate nhej pathways. surprisingly, the nhej factor ku can be identified as an effective 5'drp / ap lyase. similar to other lyases7, ku nicks dna 3 ' of an abasic site by a mechanism involving a schiff base covalent intermediate with the abasic site. we demonstrate using cell extracts that ku is essential for efficient removal of ap sites near double - strand breaks and, consistent with this result, joining of such breaks is specifically reduced in cells complemented with a lyase - attenuated ku mutant. ku had previously been presumed only to recognize ends and recruit other factors that processed ends ; our data supports an unexpected direct role for ku in end processing steps as well. |
refractive surgery in high myopia with thinner corneas and borderline topography is a challenging decision, with the most feared complication being regression and postoperative ectasia [14 ]. collagen cross - linking (cxl) has been proven to be an effective modality to strengthen and stabilize the cornea in keratoconus and ectasia after corneal refractive surgery [511 ]. another novel application of cxl is the combination of this technique with photo ablative procedures such as lasik and prk [12, 13 ], which has improved safety and better outcomes in subjects that were not suitable for corneal refractive correction due to their corneas being borderline. one such technique is lasik xtra which has been suggested as a safe and effective procedure for prophylaxis against postoperative ectasia in susceptible patients. relex smile is a flapless, all femtosecond laser technique which involves creation of a refractive lenticule with femtosecond laser and its removal from a small incision. this procedure has significant advantages over lasik as there are no flap related complications, faster visual recovery, better long - term biomechanical stability, less postoperative dry eye, and fewer induction of aberrations. relex smile, when combined with collagen cross - linking intraoperatively, may further prevent the risk of future ectasia in susceptible individuals. hence, this study was undertaken to observe the safety and visual outcomes following this procedure. the efficacy of the procedure in stabilizing the corneal biomechanics has not been studied. however the study was approved by institutional ethics committee and adhered to the tenets of declaration of helsinki. the nature of the procedure was explained and informed consent was obtained from all the patients participating in the study. inclusion criteria were decided considering the assumed risk factors for ectasia based on published literature reports [15, 16 ]. according to the randleman scoring for ectasia risk, eyes were classified into low (score 0.05). there was significant improvement in logmar bcva at 1 month (p 0.05). the cdva was stable over time, with no eye losing visual acuity more than 1 line. at last visit, 19 eyes (47.5%) had no change in cdva, 14 eyes (35%) gained 1 line, and 7 eyes (17.5%) gained 2 lines (figure 1). two eyes lost 1 line at one month follow - up, which improved to 20/20 visual acuity at 3 months. at 12 months, 38 eyes (95%) were 20/20 or better, while all (100%) eyes were 20/25 or better (figure 1). the overall mean efficacy index (postoperative udva / preoperative cdva) and mean safety index (postoperative cdva / preoperative cdva) at the last follow - up visit were 1.03 and 1.29, respectively. figure 2 shows the improvement and stability of mean spherical equivalent (se) over time. the mean se decreased from 5.02 2.06 d preoperative to 0.30 0.22 d at 1 month, 0.24 0.18 d at 6 months, and 0.24 0.18 d at 1 year postoperatively. high levels of predictability were achieved after surgery as 21 eyes (52.5%) were within 0.25 d and 37 (92.5%) eyes were within 0.5 d of the attempted correction at the 1-month visit. this improvement was maintained and remained stable over the subsequent postoperative follow - up. at 12 months, 26 eyes (65%) were within 0.25 d and 39 eyes (97.5%) were within 0.5 d of the target refraction. undercorrection (se 0.75 d or more) was detected in 2 eyes (5%) at 3 months, while all eyes were within 0.75 d at 12 months (figure 3). table 3 depicts pre- and postoperative comparisons of keratometry and pachymetry over the complete follow - up period. the mean k readings from day one postoperative baseline to all postoperative time points were not statistically significant (p > 0.05). figure 4 shows serial anterior keratometry and difference maps of an eye treated with smile xtra showing stability of keratometry over time. as - oct was done for all eyes postoperatively. the demarcation line was well defined at 1 month in 22 eyes (55%), 28 eyes (70%) at 3 months, 25 eyes (62.5%) at 6 months, and 12 eyes (30%) at 12 months (figure 5). in 4 eyes (10%) the average depth of stromal demarcation line was found to be 229.5 19.1 m at 3 months and 225.7 18.4 m at 6 months, after which the clarity decreased and was not appreciable in most of the eyes. table 4 shows ecd, hoa, and schirmer 1 scores preoperatively and 12 months after smile xtra. the mean endothelial cell density at last follow - up did not show a significant change from preoperative values (p = 0.22). hoa increased from 0.172 0.08 m to 0.21 0.08 m at 3 months and was 0.189 0.03 m at the last follow - up, although the increase in hoa was statistically not significant at the last follow - up (p = 0.06). there was no significant difference in the schirmer 1 scores pre- and postoperatively (p > 0.05). although there was a drop in the contrast for all spatial frequencies, it remained in the normal acceptable range and showed a trend towards recovery in all subjects at the end of the mean follow - up. photorefractive keratectomy (prk) and laser in situ keratomileusis (lasik) have been recognized as weakening the corneal structural integrity by 14% to 33% and may increase the risk of ectasia [1820 ]. to address this issue, adjuvant methods using collagen cross - linking at the time of laser refractive surgery have been suggested. for prophylactic purposes virtually any corneal excimer laser patient can be treated with cross - linking, although certain susceptible patients may benefit more. the combination of both prk and lasik with accelerated cross - linking has come into practice indicating favourable outcomes [12, 13, 21 ], thus broadening the inclusion criteria for potential patients who were initially ineligible for excimer laser correction. continuing with the series, we went one step ahead with a new procedure smile xtra, which involves simultaneous high fluence cross - linking of cornea following relex smile for myopia, in individuals who may be at risk of future corneal ectasia. the concept is similar to the study by kanellopoulos who did cxl in a femtosecond laser created corneal pocket in early keratoconus, suggesting a safe and effective alternative to conventional collagen cross - linking with advantages of no deepithelisation, faster healing, and reduced chances of infections and better patient comfort. a recent study, combined accelerated cross linking with relex smile in early keratoconus eyes, and one year follow - up suggested this a promising modality in arresting ectasia. while previous studies highlighted cross - linking in corneal pocket to be a novel and epithelial sparing technique for achieving desired results on corneal stability in early keratoconus, our study focused on otherwise normal eyes, which could be at future risk of developing ectasia after relex smile. although the efficacy of the classical dresden protocol as well as accelerated cross - linking is established in long - term follow - up studies in keratoconus [7, 9, 10, 24 ], the prophylactic dose required in nonkeratoconus individuals who may be at risk of ectasia is not yet established. review of the literature reveals that there is no standard protocol addressing such patients at risk, and different authors have suggested different regimens. when combined with lasik, researchers have used high fluence of 30 mw / cm for variable durations, delivering energy ranging from 1.8 to 5.4 j / cm, and found all regimens to be safe and effective [13, 21, 25 ]. thus, there is wide variation and the minimum amount of energy to make the cornea sufficiently stiff to prevent ectasia in individuals at risk is still not known. in our protocol, using the avedro kxl device, we took advantage of the highest fluence at 45 mw / cm and accelerated cross - linking for 75 seconds, thus delivering a surface dose of 3.4 j / cm at the corneal plane. since the cross - linking is facilitated through the cap, with the epithelium being intact, we proposed that the high fluence of 45 mw / cm would allow sufficient radiation to reach the stroma for effective cross - linking, since the epithelium itself may absorb substantial amount of uv - a radiation. with a prophylactic procedure, we aimed at achieving an optimal energy, which is neither too high as is used for progressive keratoconus (> 5.4 j / cm) nor too low to be effective. we exploited the highest fluence of the system and found our regimen to be safe as it did not result in punctate keratitis, epithelial defects, deep lamellar keratitis, or endothelial toxicity. we used vibex xtra (0.25% in saline) which is recommended for intrastromal application as it rapidly achieves high concentrations in the stroma. since it is devoid of dextran, the diffusion into deeper layers is achieved as early as 60 seconds after application. this helps in selective placement of riboflavin in the stroma so that it absorbs and activates uva light and achieves cross - linking without posing a threat to the underlying vital structures due to any stray radiation. the stromal demarcation line was seen at a mean depth of 229.5 19.1 m at 3 months which is significantly higher compared to the conventional cross - linkage in which it is typically seen at 300 m as early as two weeks., who have recently shown that stromal demarcation line after accelerated cross - linkage was significantly higher than conventional cross - linking. in our series, the mean depth of demarcation line was seen at even higher levels than that observed by kymionis. the possible explanation could be due to differences in the total duration of exposure and amount of energy delivered which was lower (3.4 j / cm) in our study as compared to theirs (5.4 j / cm) because we did not intend to give the full therapeutic dose as is recommended for progressive keratoconus. in smile xtra, the dye gets rapidly diffused in both the overlying cap and the underlying stroma, theoretically resulting in effective cross - linking of both, whereas when combined with lasik, the dye is administered only to the residual stromal bed and any contact with flap is avoided due to risk of postoperative microcicatricial changes leading to flap - interface disparity, flap wrinkling, irregular cross - linking, and difficulty in lifting the flap for retreatments. due to this, cross - linking of the flap may not be very effective and may not offer security against flap dislocations in future. smile is a flapless and a more tissue saving procedure as it takes similar or less tissue per diopter (~13 versus ~17 for lasik) and the cap thickness contributes to the residual bed thickness thus allowing higher corrections to be safely achieved. hence, it may not be unreasonable to say that even patients, ineligible for lasik xtra, may safely qualify to undergo corneal refractive correction with smile xtra without increasing the risk of corneal destabilization. due to this advantage, corrections using this technique may be safely attempted in early keratoconus with judicious patient selection. we observed the refractive and topographic stability of the procedure to be excellent and well maintained at one year. however, corneal thickness in this series showed a statistically significant decrease from 1 month to 3 months postoperatively. the possible causes to this result could be a small sample size and compaction of stroma as a result of simultaneous accelerated cross linking, which appear to stabilize by 6 months after surgery. none of the treated eyes had regression or evidence of postoperative ectasia clinically or topographically. dry eye and the drop in contrast sensitivity was minimal, with near recovery of both transient problems by six months. initial results suggest that it is safe to combine relex smile with accelerated cross - linking for future applications to prevent ectasia in susceptible individuals. it also establishes the safety of our regime of using 45 mw / cm uv irradiance and we believe there is no previous literature supporting this. it has been shown that the biomechanics with smile are better than lasik and the incidence of ectasia after smile may even be rare ; however, we do not recommend this procedure for all patients undergoing smile routinely. eyes with moderate to high risk (randleman score > 3) with or without additional risk factors may be offered this combined treatment. patients at risk should be identified and offered kxl as an adjunct to ensure long - term stability of results after smile. one limitation of our study was that due to the lack of equipment we could not study the changes in biomechanics and effect of the very high fluence cross - linking upon keratocyte activity with confocal microscopy. also the superiority of this method compared to smile alone should be investigated through a comparative study. since the technique aims at future prophylaxis, longer follow - ups of these patients with studies on corneal biomechanics and the effects on corneal stabilization are required to establish the stability and efficacy of the procedure in preventing ectasia as compared to conventional lasik xtra. | purpose. to study the safety and clinical outcomes of relex smile with accelerated cross - linking in individuals with thinner corneas, borderline topography, and higher refractive errors. methods. eligible patients first underwent smile procedure for correction of myopic refractive error. following the removal of lenticule, 0.25% riboflavin in saline was injected into the interface and allowed to diffuse for 60 seconds. finally, eye was exposed to uv - a radiation of 45 mw / cm2 for 75 seconds through the cap. total energy delivered was 3.4 j / cm2. results. 40 eyes of 20 patients with mean age of 26.75 5.99 years were treated. mean follow - up was 12 months 28.12 days. mean spherical equivalent (se) was 5.02 2.06 d preoperatively and 0.24 0.18 d postoperatively. the mean central corneal thickness (cct) and keratometry changed from 501 25.90 m to 415 42.26 m and 45.40 1.40 d to 41.2 2.75 d, respectively. mean uncorrected visual acuity (ucva) was 20/25 or better in all eyes. no eyes lost lines of corrected distant visual acuity (cdva). there were no complications like haze, keratitis, ectasia, or regression. conclusion. based on the initial clinical outcome it appears that smile xtra may be a safe and feasible modality to prevent corneal ectasia in susceptible individuals. |
pylori) is the most common bacterial infection, affecting almost half of the world s population. it is a known cause for peptic ulcer disease, as well as gastric adenocarcinoma, and lymphoma. although numerous studies have been performed to determine the ideal regimen for eradicating the bacteria, results vary among different geographic regions and sometimes they had been disappointing. the reasons for failure to treatment are numerous, but the most important factors include primary resistance to antibiotics and differences in bacterial strains. clarithromycin is an antibiotic that has been successfully used as an alternative to metronidazole in standard triple therapy for h. pylori eradication. but massive use of the drug has led to decrease in the eradication rates, sometimes even to lower than 70%. on the other hand furazolidone has also been used as an alternative to clarithromycin or metronidazole in h. pylori eradication regimens. 14-day furazolidone - containing quadruple regimens have shown promising eradication rates, but short - course, low dose therapies have always been attractive. therefore, we designed a study to compare the efficacy of two 10-day triple regimens containing moderate and highdose furazolidone for h. pylori eradication. two hundred and ten patients with endoscopically confirmed peptic ulcer disease and positive h. pylori infection, documented by antral biopsy and rapid urease test, entered the study. upper endoscopy and biopsy sampling were performed using fujinon eg-250wr5 videogastroscope(fuji photo optical ltd, japan). the exclusion criteria were : age less than 18 years, significant underlying disease including liver, cardiac, pulmonary, and renal diseases, neoplasia, coagulopathy, history of gastric surgery, pregnancy, breast - feeding, glucose-6-phosphate dehydrogenase deficiency, and history of allergic reactions to any of the medications used in this protocol. demographic information, smoking habits, history of previous upper gastrointestinal bleeding (gib), and some endoscopic findings including ulcer type, ulcer diameter, and number of ulcers were recorded in questionnaires. the patients were randomly assigned to one of these 2 groups using a computer generated randomization system : 105 patients received omeprazole 20 mg, amoxicillin 1000 mg, and furazolidone 200mg(oaf-400), all twice a day for ten days. and the remaining 105 patients received omeprazole 20 mg twice a day, amoxicillin 1000 mg twice a day and furazolidone 200 mg three times a day for ten days(oaf-600). the patients were provided by written instructions and written informed consents were obtained from all of them. they were also informed about avoiding some special foods due to mono - amine oxidase inhibition by furazolidone. the patients were asked to record the side effects of the medications on a daily basis and were also advised to call the doctor in case of severe side effects. after the treatment course, they were visited and were asked about their compliance to treatment and side effects of therapy. the severity of side effects were classified as : no side effect, mild (not interfering with daily activities), moderate (partially interfering with daily activities), and severe (abandoning daily activities). the compliance to treatment was considered to be excellent if the patient had used more than 80% of the medications, moderate if the patient used 60 - 80% of the medications, and poor in case of taking less than 60% of the prescribed drugs. eight weeks after the treatment course, h. pylori eradication was assessed by c-urea breath test (ubt) (heliprobe breath card and analyser, kibion ab, uppsala, sweden). according to the results of previous studies performed on furazolidone - containing regimens, we assumed to have about 8% difference between the two regimens in their ability to eradicate h. pylori. we included 105 patients in each group. to calculate the intention to treat eradication rates, everyone who entered the study was considered and to calculate per - protocol eradication rates, only those who completed the entire protocol with more than 80% compliance to treatment were considered in the analysis. data were analyzed using spss software for windows (version 17) and chi - square and t tests were used as appropriated. according to the results of previous studies performed on furazolidone - containing regimens, we assumed to have about 8% difference between the two regimens in their ability to eradicate h. pylori. we included 105 patients in each group. to calculate the intention to treat eradication rates, everyone who entered the study was considered and to calculate per - protocol eradication rates, only those who completed the entire protocol with more than 80% compliance to treatment were considered in the analysis. data were analyzed using spss software for windows (version 17) and chi - square and t tests were used as appropriated. demographic and baseline characteristics of the patients were not statistically different between the two groups (table 1). four patients did not perform ubt (two patients in each group). also, four patients in oaf-400 and three patients in oaf-600 groups discontinued treatment due to adverse effects of therapy. oaf : omeprazole, amoxicillin, furazolidone compliance to treatment was excellent in 95.2% of the patients in oaf-400 and 90.5% in oaf-600 groups. one of the patients in oaf-400 and seven patients in oaf-600 groups had used 60 - 80% of the prescribed drugs. furthermore, four and three patients had used less than 60% of the medications in the two groups, respectively. but totally, these rates were not significantly different between the two groups (p= 0.9). according to intention to treat (itt) analysis, eradication rates were 76.19% (80/105) (95% ci=68 - 84.2) in oaf-400group and 80.95% (85/105) (95% ci=73.4 - 88.4) in oaf-600group (p=0.38). per - protocol (pp) eradication rates were 81.63% (80/98) (95% ci=74 - 89.2) and89.47% (85/95) (95% ci=83.3 - 95.5), respectively (p= 0.11, figure 1). method of follow up & treatment efficacy it should be noted that three of the patients who had used 60 - 80% of medications (2 in oaf-400 and 1 in oaf-600) had negative ubt results, but they were not included in pp analysis. also one of the patients who had used less than 60% of medications in oaf-600 group had negative ubt result. severe side effects occurred in 9 (8.6%) of the patients in oaf-400 and 6 (5.7%) in oaf-600 groups, but the rates were not significantly different between the two groups (p=0.1). however, the total side effects (including mild, moderate, and severe side effects) were significantly more prevalent in the oaf-600 group (p=0.001). the most common side effects were nausea, malaise, and dizziness, being significantly more common in oaf-600 group (table 2). h. pylori eradication rates have been mostly lower in developing countries compared with the developed ones. it seems that high resistance to antibiotics, especially to metronidazole (40 - 70%) has played the most important role for the difference. therefore, metronidazole - containing regimens are not usually recommended for the developing countries. clarithromycin is an antibiotic that is widely used as an alternative to metronidazole in h. pylori eradication regimens. but common use of the drug has led to decrease in eradication rates, even to unacceptable level in some studies. de boer and colleagues have reported the evolution of clarithromycin resistance from 1% to 13% in the previous years. furthermore, graham and co - workers believe that resistance to clarithromycin is the most important factor in the current failure rates. on the other hand, furazolidone has also been used as an alternative toclarithromycin or metronidazole in h. pylori eradication regimens. furazolidone does not have cross - resistance with metronidazole and therefore, is recommended to be used in areas with high metronidazole resistance. the drug is readily available with low costs. the first studies evaluating the effects of furazolidone - containing regimens were reported in the early 1990 s. in iran the first reports were in 2000 and the resistance rate to furazolidone has increased during the previous 10 years, but the change in resistance rate was not significant (from 0% in 2003 to 4.5% in 2010). in iran, 14-day furazolidone - containing quadruple regimens have shown promising eradication rates. however, the side effects of the drug have limited its use. the most common adverse effects include sudden hypotension, fever, headache, abdominal pain, and skin rash. although these reactions lead to cessation of therapy by some patients, they mostly occur in the second week of treatment. therefore, some researchers modified their treatment strategies, administering furazolidone just during the first or the second week of treatment or using short term protocols. in 2011, fakheri and colleagues evaluated two modified quadruple therapies : the first group received omeprazole, amoxicillin, and metronidazole for 2 weeks and the second group received omeprazole, amoxicillin, and bismuth for 2 weeks. adverse effects of treatment were significantly lower in the second group (12.8% vs. 2.5%). fakheri and colleagues also performed another study in which low - dose furazolidone (100 mg twice a day) was administered in triple and quadruple regimens. but per - protocol eradication rates were not acceptable (54% and 72%, respectively). consequently, two other bismuth - based quadruple therapies were conducted in 10- and 14-day regimens in which metronidazole was administered over the first half of therapy and was then replaced by furazolidone over the second half. khatibian and colleagues performed a study comparing 14-day omeprazole - amoxicillin - bismuth - furazolidone with a 14-day quadruple regimen in which metronidazole was given during the first week and then was replaced by furazolidone during the second week. per - protocol eradication rates were 95.2% and 95.3%, respectively. in another study, ghadir and colleagues compared the efficacy of omeprazole - amoxicillin - furazolidone triple therapy with omeprazole - amoxicillin - bismuth - furazolidone quadruple therapy. pp eradication rates were 61.1% vs. 85.3%, respectively (p 90% pp eradication rate. in the present study, we evaluated the effects of moderate- and high - dose furazolidone - containing regimens on h. pylori eradication. our first hypothesis was to assess whether moderate - dose furazolidone - containing treatment could be as effective as the high - dose regimen. the itt eradication rates were 76.19% vs. 80.95% and pp eradication rates were 81.36% vs. 89.47%, respectively. however, if we consider h. pylori infection as an infectious disease, the ideal regimen is the one that can eradicate h. pylori infection in more than 95% of cases. graham classified the efficacy of treatment according to per protocol success as a : excellent (> 95% eradication rate), b : good (90 - 95%), c : fair (85 - 89%), d : poor (81 - 84%) and f : unacceptable (80%). accordingly, although the regimen containing high - dose furazolidone could achieve higher eradication rate, it is classified in group c, and therefore, can not be recommended as a suitable first - line option. the only previous study evaluating the effects of high - dose furazolidone (600mg / day) was performed by frota and colleagues. according to their study, a triple regimen containing omeprazole, tetracycline, and but the duration of treatment was 14 days that was longer than our protocol. another important issue in introducing an ideal option for h. pylori eradication is the occurrence of side effects. but in our study, although the oaf-600 group had near - optimal eradication rate, it had more than 5% adverse effects. previous studies have shown that most side effects of furazolidone - containing regimens occur in the second week of treatment. our second hypothesis was that moderate - dose regimen would lead to higher compliance to treatment than the high - dose therapy. as it was assumed, the number of patients who had less than 80% compliance to treatment was higher in oaf-600 than the oaf-400 group (8 patients vs. 5 patients), but the difference was not statistically significant. finally, it should be mentioned that the main limitation of our study was the unavailability of h. pylori culture. however the latest study in the same geographic region has reported 73.4% resistance to metronidazole, 30% to clarithromycin, 6.8% to amoxicillin, and 9% to tetracycline. in conclusion, none of our triple furazolidone - based regimens (moderate- and high - dose) could achieve the standard eradication rate, and therefore, can not be considered as a suitable option for first - line treatment. due to the ineffectiveness of furazolidone - containing triple regimens, we recommend that in future studies, the efficacy of furazolidone in quadruple regimens be investigated. | background furazolidone has been used as an alternative for clarithromycin or metronidazole in helicobacterpylori (h.pylori) eradication regimens. in iran, 14-day furazolidone - containing quadruple regimens have shown promising eradication rates, but short - course, low dose therapies are always attractive. therefore, we designed a study to compare the efficacy of two 10-day triple regimens containing moderate and high dose furazolidone for h.pylori eradication. methods two hundred and ten patients with peptic ulcer disease who were nave to h.pylori treatment were included. they were randomized into 2 groups : 105 patients received omeprazole 20 mg, amoxicillin 1000 mg, and furazolidone 200mg(oaf-400), all twice a day for ten days.and the remaining 105 patients received omeprazole 20 mg twice a day, amoxicillin 1000 mg twice a day and furazolidone 200 mg three times a day for ten days(oaf-600). urease breath test was performed 8 weeks after the treatment to confirm h. pylori eradication. results the intention - to - treat eradication rate was 76.19% in group oaf-400 and 80.95% in group oaf-600 (pp=0.38). per protocol eradication rates were 81.63% and 89.47%, respectively (p= 0.11).severe adverse effects were reported by 8.6% of the patients in group oaf-400 and 5.7% of the patient in group oaf-600 (p=0.1). however, the total side effects (including mild, moderate, and severe ones) were significantly more prevalent in the oaf-600 group (p=0.001). conclusion none of our triple furazolidone - based regimens (moderate- and high - dose) could achieve the standard eradication rate, and therefore, can not be considered as a suitable option for first - line treatment. |
neoadjuvant chemotherapy (nac) is the standard of care in patients with locally advanced breast cancer (labc), as it improves local control and survival [2, 3 ]. the reported clinical response rate to nac varied between 30% and 90% and the 5-year overall survival (oas) was reported to range between 40% and 60%. as the clinical and pathological responses of breast cancer to nac are short - term markers for a long outcome, it is important to identify biological factors that may predict response to nac and subsequent disease - free survival (dfs) and oas [5, 6 ]. it is well established that the expression of the estrogen receptor (er) and progesterone receptor (pr) determines the responsiveness of tumors to hormonal interventions. nevertheless the absence or presence of these hormonal receptors does not predict response to chemotherapy. however, breast cancer patients with tumors that are er positive and/or pr positive have lower risks of mortality after their diagnosis compared to women with er- and/or pr - negative disease [8, 9 ]. one of the most important markers being studied is her2/neu protooncogene, which has been localized to long arm of chromosome and encodes a transmembrane tyrosine kinase growth factor receptor. the protein product of her-2/neu is overexpressed in 25%30% of breast cancers and is associated with a poor prognosis. the tumor suppressor gene, p53, is located on short arm of chromosome 17. mutations in the tumor suppressor gene p53 are present in 18%25% of primary breast carcinomas. preclinical data have shown that cells with mutated p53 might be resistant to radiation or chemotherapeutics. the aim of this study is to evaluate the potential value of biological markers (her2/neu, p53, and hormonal receptor status) for the prediction of disease outcome and response to therapy in patients with locally advanced breast cancer, after neoadjuvant chemotherapy. this prospective phase ii study was conducted at south egypt cancer institute, assiut university, egypt, and sohag cancer centre, sohag university, egypt, during the period from march 2006 to september 2011. informed consent was obtained for all patients, and the protocol was approved by institutional review board at our center. this study included ninety - five female patients with biopsy proven locally advanced, nonmetastatic breast cancer (stage iib (limited to t3n0) and stage iiia disease), eastern cooperative oncology group performance score of 0 to 1, and left ventricular ejection fraction (lvef) of 60%. each patient was subjected to clinical examination, laboratory investigations, and breast sonomammography to exclude multiple scattered microcalcifications. true - cut needle biopsy was taken for histopathological diagnosis and assessment of biological factors. radiological studies were done, such as chest x - ray and abdominopelvic ultrasonography to exclude patients with visceral metastasis and bone scan to exclude patients with bone metastasis. each patient was given 3 cycles of taxenes based combination chemotherapy with 3 weeks interval, paclitaxel 135 mg / m, adriamycin 50 mg / m and cyclophosphamide 500 mg / m. three weeks after the third cycle, each patient was evaluated by clinical examination and breast sonomammography to assess the response to neoadjuvant chemotherapy. primary end points were evaluation of the value of biological markers for the prediction of response to therapy and survival. secondary end points were determination of the association of her-2/neu overexpression in relation to p53 inactivation, hormonal receptor status, and conventional prognostic factors. after true - cut needle biopsy, the tissue samples were pulverized while frozen in a chilled mortar and homogenized for 2 minutes in ted buffer in melting ice using a teflon homogenizer. the supernatants were recentrifuged at 3000 xg for another 15 minutes and finally stored at 70c in 200 mi aliquots till assay. tissue levels of her2/neu were determined by elisa, using the human neu oncoprotein elisa kit supplied by oncogene science inc., oia-04, uniondale, new york, usa. for tissue homogenates, 100 l of tissue homogenate was extracted with 20 l of antigen extraction agent supplied with the kit. then, 100 l of diluted sample was used for the determination of her2/neu. tissue levels of p53 were also determined by elisa technique, using kits supplied by diaclone research, france, catalogue number 043. a monoclonal antibody specific for p53 had been coated onto the wells of the microtiter strips provided. during the first incubation after washing, a biotinylated monoclonal antibody specific for p53 was incubated. then the streptavidin - peroxidase enzyme was added. after incubation and washing to remove all unbound enzymes, a substrate solution which acts on the bound enzyme was added to induce a colored reaction product. the intensity of this colored product is directly proportional to the concentration of p53 present in the samples. protein concentration in the tissue homogenates was determined by the method of lowry. as modified by miller the receptor status had been determined using a commercial enzyme immunoassay according to the instructions of the manufacturer (abbott laboratories, chicago, il, usa). a result exceeding 15 fmol / mg was considered positive for the presence of the particular receptor. after neoadjuvant chemotherapy, patients with tumors 5 cm) (86 patients, (90.5%), 19 patients of them had no palpable ipsilateral axillary nodes (n0), 55 patients had mobile ipsilateral axillary nodes (n1 disease), and only 21 patients had fixed nodes (n2 disease)). was found in 20 (21.1%) patients, and p53 inactivation in 29 (31.5%) patients (table 1). out of the 95 patients, 68 patients (71.6%) showed partial response and underwent cbs with negative margins and the remaining 27 patients underwent mrm. the association of clinical response and the findings of hormonal receptor, her-2, and p53 protein were evaluated. the hormonal receptors were positive in 77.6% of patients with or and in 78.9% of nr patients (p = 1 ; fisher 's exact test). there were no her-2 and p53, protein expression significant differences before chemotherapy between the or and nr groups (p = 0.345 and p = 0.096, resp., fisher exact test) (table 2). in terms of relapse following conservative surgery with negative margins (68 patients), 12 cases had a disease relapse (17.6), 4 of them had isolated local recurrence and were salvaged by mastectomy. following mrm (27 patients), there were 7 disease relapses 3 of them were isolated relapse and were surgically resected (table 3). the 5-year disease - free and overall survival rates were calculated for patients according to hmr status, her2/neu expression, and p53 staining (figures 1, 2, 3, 4, 5, and 6). the dfs rates at 5 years were 82.3% and 26.5% for breast cancer patients with positive and negative hormonal receptors, respectively (p 5 cm) in our study (86 out of 95 patients ; 90.5%) than that in the reported study (18 out of 50 patients ; 36%). in the current study, inactive p53 and her2/neu coexpressing tumors represented 9.5% (9 out of 95 patients) and were more often negative for hormonal receptors. this is comparable with the rate of breast cancer with coexpression reported in previous studies which ranged between 3% and 19.5% of total breast cancers examined [10, 45 ] and has been reported to be prognostically unfavorable. in conclusion we have found that the studied biological factors were not able to predict tumor response to neoadjuvant chemotherapy. however, her2/neu overexpression was associated with poor disease - free and overall survival rates, which may be explained on the ground that it was significantly associated with negative hormonal receptors and high tumor grade. | introduction. biological markers as her2/neu, p53, and hormonal receptors (hmrs) may be reliable parameters for prognostic assessment of patients of locally advanced breast cancer (labc). this work aims at assessing the potential value of these biological markers for the prediction of disease outcome after neoadjuvant taxane - based chemotherapy and its implication on the surgical role. patients and methods. from march 2006 to september 2011, 95 patients with labc were treated by neoadjuvant taxane - based chemotherapy given at intervals of 3 weeks. expression of her2/neu and p53 was examined in the initial tissue biopsy by using elisa technique. status of hmrs was determined using a commercial enzyme immunoassay. three weeks after the third cycle, patients underwent surgical resection followed by 3 more cycles of taxane - based chemotherapy and radiotherapy as an adjuvant therapy. relations of her2/neu overexpression to p53, hmrs, and conventional prognostic factors were analyzed. results. median followup was 61 months. the 5-year dfs and oas rates were significantly higher in patients with positive hmrs than in those with negative hmrs, patients with her2 than those with her2 + breast cancer, and patients with intact p53 breast cancer than those with inactive p53. her-2 overexpression was statistically significant associated with loss of hmr positive immunostaining (p < 0.0001), grade iii breast cancer (p < 0.0001), advanced nodal status (p = 0.0039), and younger (< 50 years) age (p = 0.0108). conclusion. her2/neu overexpression was associated with poor dfs and oas rates, as it was significantly associated with negative hmr and high grade. |
splenic artery aneurysm is the third most common location of intraabdominal aneurysms following the abdominal aorta and iliac arteries. a 35-year - old woman presented with three episodes of passage of black tarry stools. there was no history suggestive of any systemic infections, trauma, family history of aneurysm, and connective tissue disorders. the patient had an anxious look, pallor, pulse rate of 120/min. and b.p of 90/70 mm hg. an emergency upper gastrointestinal endoscopy was done which revealed grade ii - iii oesophageal varices for which sclerotherapy was done. doppler study was suggestive of extrahepatic portal vein obstruction (ehpvo) with splenic artery aneurysm and multiple perisplenic, gastric, and perioesophageal collaterals and documenting portal cavernoma with hepatofugal flow (figure 1). on digital subtraction angiography a selective angiogram confirmed a huge saccular aneurysm arising from splenic artery. on laparotomy a normal appearing liver, no ascites, and a 8 10 centimeters aneurysm arising from splenic artery, involving middle and distal two - thirds of an artery and an enlarged spleen were observed (figure 2). splenic aneurysm biopsy revealed true aneurysm, splenic biopsy showed congestion with small areas of infarction, and liver biopsy was normal. this patient had an uneventful postoperative period and was discharged on the 10th postoperative day. splenic artery aneurysms larger than 3 centimeters are rare, but giant aneurysms measuring 10 cm or more have been reported. splenic artery aneurysm has a female predominance, can be diagnosed at any age, but is more commonly seen in the fifth and sixth decades with a mean age of presentation of 52 years. these are generally located in the middle and distal segment of the artery and are mostly of saccular form. specific causes of splenic artery aneurysms remain unknown, although suspected etiological factors are thought to be atherosclerosis, focal arterial inflammation, pancreatitis, hypersplenism, portal hypertension, trauma, and hormonal and hemodynamic changes due to pregnancy, liver transplant, and splenomegaly. these aneurysms can be asymptomatic and in up to 20% may present with epigastric or left upper quadrant abdominal pain. occasionally, the aneurysm can erode into an adjacent viscus or into the pancreatic duct and presents as gastrointestinal hemorrhage. contrast - enhanced ct scans and ct angiogram are important in the evaluation of this condition. doppler ultrasound represents a fast and noninvasive strategy and is considered modality very reliable in diagnosis and has great potential as follow - up tools. once the diagnosis has been confirmed, a therapeutic strategy needs to be determined. treatment is recommended for all patients with symptomatic aneurysms, those with aneurysm larger than 2 centimeters in a diameter, growing aneurysms, and for all pregnant women and women of childbearing age who may subsequently become pregnant. the choice is governed by the condition of the patient, the exact morphology of the aneurysm, and the availability of the endovascular procedure facility. open surgery is reserved mostly for the treatment of complications or if the endovascular procedures fail or are lack of availability of endovascular procedures or allergic to contrast medium. surgical procedure for splenic artery aneurysm may involve splenic artery ligation, aneurysmectomy, or splenectomy is the option. if the aneurysm is located in the distal third of the artery and the aneurysm has to be resected, the patient may ultimately require a splenectomy. if the aneurysm is located in the proximal third of the artery, splenic conservation should be attempted. | splenic artery aneurysm is the third most common location of intra - abdominal aneurysms. giant splenic artery aneurysm is rarely seen and is at a high risk of rupture. location and size of the splenic artery aneurysm determine the likelihood of rupture. a case of giant splenic artery aneurysm in a 35-year - old woman is reported. she presented with upper gastrointestinal bleeding. she had splenomegaly and extrahepatic hepatic portal hypertension. angiography confirmed a giant splenic artery aneurysm measuring 8 10 centimeters, located in middle and distal two - thirds of the splenic artery. surgical treatment in the form of in toto excision of aneurysm with splenectomy and devascularization was performed. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.